Mol Biol Rep DOI 10.1007/s11033-009-9632-1

Porcine CSRP3: polymorphism and association analyses with meat quality traits and comparative analyses with CSRP1 and CSRP2

Xuewen Xu Æ Haifang Qiu Æ Zhi-Qiang Du Æ Bin Fan Æ Max F. Rothschild Æ Fan Yuan Æ Bang Liu

Received: 15 February 2009 / Accepted: 10 July 2009 Ó Springer Science+Business Media B.V. 2009

Abstract CRP3 is the muscle-specific form of the cys- Keywords CSRP3 RH mapping Expression patterns teine and glycine-rich family and plays an impor- Meat quality Association analysis Pigs tant role in myofiber differentiation. Here we isolated and characterized its coding CSRP3 from porcine muscle. Phylogenic analyses demonstrated that CSRP3 diverged Introduction first and is distinguished from two other members, CSRP1 and CSRP2. CSRP3 mRNA was up-regulated during the The cysteine and glycine-rich (CRPs) are evolu- development of porcine embryonic , indi- tionarily conserved proteins that have been implicated in cating its potential importance in muscle growth. Genetic the regulation of muscle development [1, 2]. The CRP variant analyses detected multiple variations in an family currently has three vertebrate members, CRP1, approximately 400 bp region covering 4 and its CRP2, and CRP3 (also named the muscle LIM protein, downstream intron, and two haplotypes were identified by MLP), which share common that consists sequencing. One of synonymous substitutions C1924T was of two tandemly arrayed LIM domains [1, 2]. The CSRP1 used for linkage and association analyses. It was revealed gene, coding for CRP1, was first isolated in a human term that the substitution of C1924T had significant associations placental cDNA library by hybridization with a human with firmness (P \ 0.01), Lab Loin pH, Off Flavor Score prolactin cDNA probe [3]. Subsequent studies revealed that and Water Holding Capacity (P \ 0.05), and a suggestive CSRP1 predominantly is expressed in vascular and visceral effect (P \ 0.1) on Flavor Score and Average Glycolytic smooth-muscle cells (SMCs, and it was demonstrated to be Potential in a Berkshire 9 Yorkshire F2 population. The an early marker for SMC differentiation [1, 4]. Two association analyses results agreed with the gene’s locali- interacting proteins, and a-, had been identi- zation to a QTL region for meat quality traits on porcine fied for CRP1, revealing an important role of CRP1 in 2p14-17 demonstrated by both linkage map- cytoarchitectural organization [5, 6]. The CSRP2 gene ping and RH mapping. These results provide fundamental encoding CRP2 was originally identified by a subtractive evidence for CSRP3 as a functional candidate gene hybridization screen for that differentially expressed affecting pig meat quality. in myc-transformed cells. It has been shown that the CSRP2 mRNA was dramatically reduced in oncogenically or chemically induced transformed cells, indicating its regu- latory role in and differentiation [7]. Further & X. Xu H. Qiu F. Yuan B. Liu ( ) studies revealed that CSRP2 is expressed extensively but Key Laboratory of Agricultural Genetics, Breeding and Reproduction of Ministry of Education, Huazhong preferentially in aortic smooth muscle cells [8] and hepatic Agricultural University, 430070 Wuhan, China stellate cells [9]. Thus, both CSRP1 and CSRP2 play a role e-mail: [email protected] in smooth muscle cells. Unlike the nearly ubiquitous expression pattern of Z.-Q. Du B. Fan M. F. Rothschild Department of Animal Science, Center for Integrated Animal CSRP1 and CSRP2, the third member CSRP3 (coding for Genomics, Iowa State University, Ames, IA 50011, USA CRP3) is expressed only in striated muscle and its 123 Mol Biol Rep expression coincides with myogenic differentiation [10]. CA, USA) following the manufacturer’s instructions. The CRP3 is localized in both the nucleus and the , crude total RNA was then treated with RNase-free DNase I The nuclear CRP3 serves as a cofactor for the myogenic (Promega, Madison, WI, USA) for 30 min at 37°C, fol- basic helix-loop-helix (bHLH) proteins (MyoD, MRF4, lowed by two-steps extraction with mixture of acid phenol and ), by promoting their interaction with the ‘‘E- and chloroform (acid phenol:chloroform 5:1, pH 4.5) and Box’’ elements in the regulatory region of most muscle- chloroform in succession to remove genomic DNA. Two specific genes [11]. The cytoplasmic CRP3 plays as a micrograms of purified total RNA from each specimen , interacts and co-localizes with alpha- were used for reverse transcription reaction by M-MLV actinin [12], beta- [11] and (T-cap) Reverse Transcriptase (Promega, Madison, WI, USA). overlying the Z- and M-lines of myofibrils [13]. Therefore, CRP3 exhibits both regulatory and structural properties in cDNA cloning and sequence analysis . Moreover, the role of CRP3 in myogenesis is emphasized by the finding that CSRP3-deficient mice dis- Porcine ESTs were retrieved and compared to find the con- played characteristic symptoms of dilated sensus sequences, which were then used to design primers for (DCM) and [14]. Although the phenotypic the amplification of CSRP3. Bi-directional RACE (Rapid alterations in skeletal muscle are not as dramatic as in Amplification of cDNA Ends) assays were conducted using , skeletal muscle fiber defects, such as the SMARTTMRACE cDNA Amplification Kit (Takara, swollen fibers, shorter and resting length, and Dalian, China). Meanwhile, the complete coding sequences skeletal muscle atrophy, have already been identified in of porcine CSRP1 and CSRP2, two other members of the CSRP3-deficient mice [15], suggesting an important role of CSRP gene family, were cloned according to the non-ref- CSRP3 in the maintenance of normal muscle structure and erence mRNA sequence (ACCESSION: AK234534.1 and function, including myofiber size and sarcomere length. AY610113.1 for CSRP1 and CSRP2, respectively) and val- Muscle fiber characteristics, including composition, size idated by sequencing. The primer sequences, localization, and total fiber number, are critical for meat quality, and in annealing temperatures, and product sizes are listed in pigs it has been suggested that the slow fibers contribute to Table 1. both juiciness and tenderness [16]. CSRP3 was constitu- The ORFs and corresponding sequences were tively expressed in rat slow muscle and lowly expressed in predicted with the DNAstar software package (Madison, fast muscle [17]. It was up-regulated in fast muscle during WI, USA). An alignment file (msf) for porcine CRPs was the transition toward slow muscle induced by enhanced generated with the T-Coffee program (www.ebi.ac.uk/ contractile activity [17, 18]. Thus, CSRP3 was probably t-coffee/) and used for secondary structure prediction by involved in the regulation of myofiber distribution, and the Jpred3 (http://www.compbio.dundee.ac.uk/*www-jpred/). investigation of the porcine CSRP3 gene will probably The functional domains of the deduced proteins were ana- provide some evidence as to whether it influences meat lyzed with the SMART program (http://smart.embl- quality. In the present study, we characterized the porcine heidelberg.de/). The alignment and functional prediction CSRP3 gene, discovered and analyzed its genetic variants, results were then enhanced with Jalview software [21]. A examined its association with meat quality traits, and per- phylogenetic tree was constructed using the neighbor- formed comparative analysis with CSRP1 and CSRP2 as joining method with MEGA 3.1 software employing most well. available cysteine and glycine-rich proteins [22].

Materials and methods Tissue distribution and temporal expression profile analysis Tissue sampling, RNA isolation and cDNA preparation The mRNA expression of porcine CSRP1, CSRP2 and Nine different tissues, including heart, skeletal muscle, CSRP3 in different tissues/organs was detected by RT-PCR liver, spleen, lung, kidney, adipose, testicle and bladder, with the housekeeping gene GAPDH as an internal control were collected from an adult Chinese indigenous Tongch- [23], which consistently was expressed among different eng pig for the tissue expression analyses [19, 20]. The tissue samples in this experiment. Primers (Table 1) for longissimus dorsi muscles were harvested for the temporal these three genes were designed in separate to dis- expression analyses from the embryos collected from tinguish the cDNA products from the genomic DNA, if pregnant Tongcheng and Landrace females at three stages, contaminated. The RT-PCR products for the spatial dis- 33, 65 and 90 days post coitus (dpc) [20]. Total RNA was tribution were separated by electrophoresis on 2.0% aga- extracted using TRIzolÒReagent (Invitrogen, Carlsbad, rose gels and visualized by ethidium bromide staining. The 123 Mol Biol Rep

Table 1 Primers used in the present study

0 0 Gene name Primer name Primer sequences (5 –3 ) Application Localization Tm (°C) Size (bp)

CSRP1 C1-F1 caccaccgccgccagaatg cDNA cloning Exon1 62 651 C1-R1 gggcgggggatggtgatgaga Exon6 C1-F2 gacaaggatggcgagatttact DNA cloning Exon5 58 116 C1-R2a gcaggtagggctcactcaga Expression analysis Exon6 C1-F3 ttgacgcttctcttgggaca Gene mapping Intron5 58 281 CSRP2 C2-F1 gtcctgcttccgatcgagat cDNA cloning Exon1 60 68 C2-R1 ctcacagtggtttcgtgttagatg Exon6 C2-F2 tgtgctaagtgtggcaagagtc DNA cloning Exon5 60 1,000 C2-R2 atctgtgcgggattgtgtag Expression analysis Exon6 56 204 C2-F3 ggagagatgcttccagatgaca Gene mapping Intron5 60 271 C2-R3 tgccctgcggtcactatctt Intron5 CSRP3 C3-GSP5O ccttcaggcaggattactcagcta 50RACE Exon6 65 Uncertain C3-GSP5I ctcccatcaccttctcagcagcata Exon4 C3-GSP3O cggtagcagctcacgagtcaga 30RACE Exon3 65 Uncertain C3-GSP3I gcaacccttccaagttcact Exon4 C3-I3F1 gcagctcacgagtcagagatcta DNA cloning and SNP scanning Exon3 60 1,951 C3-I3R1 gcagcatagactgactttccacat Exon4 C3-I4F1 cagcaacccttccaagttcact DNA cloning and SNP scanning Exon4 60 2,760 C3-I4R1 gttctccgtctttgtcagtg Exon5 C3-I5F1 cctgttttcgctgtgccatct DNA cloning and SNP scanning Exon5 62 1,902 C3-I5R1 ctcccagcccaggtatcatca Exon6 C3-MF cttaggagccacccatcttca Gene mapping Intron4 60 155 C3-MR gggagcctgtgtacctttgtatc Intron4 C3-QF cactgacaaagacggagaact Expression analysis Exon5 56 174 C3-QR ccttcaggcaggattactcag Exon6 C3-SNPF ggtactgttcgccaaggaga Genotyping Intron3 60 344 C3-SNPR tccaggaaagtgggtgaaga Intron4 GAPDH GAPDH-F tctgccatctctactaccctaagg Internal control for RT-PCR 60 233 GAPDH-R ctaagaagtgctccctgagcag 18S 18S-F tttcgctctggtccgtcttg Internal control for real-time qRT-PCR 58 101 18S-R ttcggaactgaggccatgat a The primer C1-R2 is also paired with C1-F3 for the gene mapping of CSRP1

PCR fragments were purified and directly sequenced to relative to the level of 18S rRNA using an optimized confirm the correct amplification of the three genes. comparative Ct (DDCt) value method [24]. The F-test was The expression levels of porcine CSRP3 mRNA at the used to evaluate the significant differences at three devel- three developmental stages were detected by real-time opmental stages, and multiple-comparisons were further quantitative RT-PCR assay using the SYBR Green Master conducted to determine differential expression between Mix Kit (Toyobo, Fukui, Japan). The reaction was per- stages, with P \ 0.05 considered as significant. formed in a 20 ll mixture containing 10 ll real-time PCR SYBR Green master mix, 0.3 lM for each primer Radiation hybrid mapping (Table 1) and 1 ll normalized cDNA. PCR amplifications were completed on a ABI Prism 7500 Sequence Detector Primers (Table 1) located in two tandem exons were used System (Applied Biosystems, Foster City, CA, USA) with to amplify the genomic DNA fragment, which was the 9600 emulation mode under the following conditions: sequenced commercially to get the sequence of the internal 50°C for 2 min; 95°C for 4 min; followed by 40 cycles of intron. Then, porcine-specific primers (Table 1) were 94°C for 30 s, 56°C for 40 s and 72°C for 30 s; then 15°C. designed accordingly and used for gene mapping via the For each sample, the PCR was performed in triplicate, and radiation hybrid panel (IMpRH), consisting of 118 ham- the CSRP3 mRNA expression levels were quantified ster-porcine hybrid cell lines [25]. The PCR amplification 123 Mol Biol Rep was carried on IMpRH panel DNA, with porcine genomic Table 2 Allele frequencies of the CSRP3 SNP (C1924T) in different DNA used as a positive control and hamster genomic DNA pig breeds and sterile water as negative controls. The positive typing Breeds No. of Genotype Allele frequency results were recorded and submitted to the IMpRH website CC CT TT C T (http://www.toulouse.inra.fr/lgc/pig/RH/IMpRH.htm)to get the mapping information [26], and a LOD threshold of Yushanhei 27 2 11 14 0.29 0.71 5.0 was considered to be reliable. Qingping 22 2 10 10 0.32 0.68 Erhualian 25 3 10 12 0.32 0.68 Genomic variants detection and polymorphism analyses Tongcheng 33 5 12 16 0.33 0.67 Duroc 19 10 9 0 0.76 0.24 To obtain the DNA sequence and its variant information of Yorkshire 22 19 3 0 0.93 0.07 porcine CSRP3, forward and reverse primers (Table 1) Landrace 12 11 1 0 0.96 0.04 located in two tandem exons were combined to amplify the DNA from Swedish Landrace and Tongcheng pigs. PCR products from different DNA templates were purified and 8.54. The 103 bp 50-UTR, together with the 251 bp 30-UTR sequenced directly to identify the genomic variants, and containing a consensus polyadenylation signal (AATAAA), PCR–RFLP analyses were used for SNP genotyping and were also identified. validation. The allelic frequency distribution was examined The deduced amino acid sequence of porcine CSRP3 in 160 unrelated animals from seven pig breeds, including showed 64.8 and 65.8% sequence similarity with those of four Chinese indigenous breeds (Yushan Black, Qingping, porcine CSRP1 and CSRP2, respectively, whereas the Erhualian and Tongcheng pigs) and three commercial amino acid sequence similarity of porcine CSRP1 and breeds (Large White, Landrace and Duroc) (Table 2). CSRP2 reached 79.3%. Analyses of the amino acid Linkage mapping was conducted using the F2 animals sequences of the three porcine cysteine and glycine-rich of the ISU Berkshire 9 Yorkshire (B 9 Y) resource fam- proteins detected two highly conserved LIM domains, ily [27, 28] employing two-point analyses of CRIMAP followed by the conserved glycine-rich regions (Fig. 1). A version 2.4 [29] with the ‘‘ALL’’ option to get the best Proline residue was found to be inserted in the interval order of the markers and the ‘‘FIXED’’ option to obtain the region between the two LIM domains in CRP3, causing the map. A total of 28 meat quality traits were measured in the length difference of one amino acid compared with that of BY resource family, and traits presented in this article CRP1 and CRP2. A phylogenic tree of the cysteine and included Firmness, Lab (48 h) Loin pH, Off Flavor Score, glycine-rich proteins was generated with input from the Water Holding Capacity, Hormel (24 h) Loin Minolta, entire hitherto characterized vertebrate CRPs and two Flavor score, Average Glycolytic Potential and Average members, MLP84B and MLP60A, illustrated Lactate. Details about the BY resource family and traits in Fig. 2. It showed that the two Drosophila CRP family measurement have been described by Malek et al. [27]. A members formed an independent branch, and that all ver- total of 515 B 9 Y F2 animals were genotyped for the tebrate CRPs can be grouped into another distinct branch, association analyses in the present study using a mixed where CRP3 first diverged into its own cluster, and then model procedure (SAS 9.0; SAS Institute, Cary, NC, USA), CRP1 and CRP2 clustered into two other groups and were which included sex, slaughter date and marker genotypes separated clearly from each other. as fixed effects, dam (litter) as random effect and body weight as covariate. Temporal and spatial expression patterns

RT-PCR showed that the mRNA of both porcine CSRP1 Results and CSRP2 were expressed in all nine tissues, whereas CSRP3 was specifically expressed in porcine heart and Molecular cloning and sequence analyses skeletal muscle (Fig. 3). Therefore, we further quantita- of porcine CSRP3 tively analyzed the porcine CSRP3 mRNA level in embryonic skeletal muscle of three different developmental The 931 bp full-length porcine CSRP3 cDNA (ACCES- stages in both Tongcheng and Landrace pigs. The real-time SION: FJ494917) was successfully obtained by bi-direc- RT-PCR assay indicated that CSRP3 showed a generally tional RACE assays. Sequence analyses revealed that the up-regulated trend in pig fetal muscle of both breeds, porcine CSRP3 mRNA contains an ORF of 585 bp, reached a highly significance level in Landrace (P \ 0.01) encoding a protein of 194 residues with a calculated and was suggestively significant (P \ 0.06) in Tongcheng molecular mass of 20.9 kDa and an isoelectric point (pI)of pigs (Fig. 4). Comparing the two breeds, the porcine 123 Mol Biol Rep

Fig. 1 Multiple sequence alignment and prediction of functional different background respectively. As for the secondary structure, properties of porcine CRPs. The LIM domain is indicated with box, round bars indicate alpha-helix region, arrow bars represent beta- Glycine residues (G) and Cysteine residues (C) are highlighted with strand, and black lines indicate random coils

Fig. 3 Tissue distribution of porcine CSRP gene family members

CSRP1 was deduced to be SSC10p11-p12. Porcine CSRP2 Fig. 2 Cladogram of CSRP members from eight different species. was mapped to SSC5q25 according to its linked marker The amino acid sequences were derived from GenBank. The bootstrap confidence values shown at the nodes of the tree were SW967 (75cR; LOD score equals 5.08) that was previously based on 10,000 bootstrap replicates assigned to the region [31]. Porcine CSRP3 was assigned to SSC2p14-17, closely linked to markers SW2167 (12cR; CSRP3 mRNA level was similar in the 33 and 90 dpc, and LOD score equals 20.74), S0170 (29cR; LOD score equals displayed a difference at 65 dpc, but was not statistically 13.41) and SW1026 (32cR; LOD score equals 12.8). significant (P \ 0.11). Genomic sequence and variations analyses Chromosomal localization of porcine CSRP1, of porcine CSRP3 CSRP2 and CSRP3 Alignment of the obtained cDNA with the human DNA RH mapping determined that porcine CSRP1 was closely sequence (ACCESSION: NC_000011) revealed that the linked to the microsatellite marker SWC19 (59cR; LOD porcine CSRP3 gene consisted of six exons and five score equals 6.3), which was assigned to SSC10p11-p12 introns. The amplification using three pairs of primers [30]. Thus, the most likely chromosomal location for (Table 1) successfully yielded three PCR products, which 123 Mol Biol Rep

markedly different groups of allele frequency. Chinese pig breeds had higher frequencies for the allele T, whereas the western breeds appeared to have lower frequencies (Table 2). For each homozygote of the C1924T substitution, pooled PCR products from ten individuals of different pig breeds were sequenced, respectively, to analyze potential haplotypes. Two main haplotypes containing these muta- tions were therefore identified (Fig. 5).

Linkage and association analyses of porcine CSRP3

Genotyping results revealed that most individuals were Fig. 4 Temporal expression pattern of porcine CSRP3 at three ‘‘CC’’ or ‘‘CT’’ genotypes, and only a few ‘‘TT’’ homo- different developmental stages of skeletal muscle. The relative expression levels of porcine CSRP3 mRNA were normalized to zygous individuals had been detected. The C1924T sub- endogenous 18S rRNA expression. Error bars indicate the SD stitution segregated in the B 9 Y resource family and was (n = 3) of relative mRNA expression values. P values represent the used for linkage analyses. Two-point linkage analysis total expression difference of CSRP3 mRNA in skeletal muscle at assigned the CSRP3 gene to the SSC2 linkage map, and a three developmental stages of a specific pig breed, calculated respectively by ANOVA best sex-averaged map: MyoD1-6.0-CSRP3-3.1-TEF1-12- SW766 (log10_likelihood equals -1,902.898, with genetic were sequenced and assembled into a 6,229-bp genomic distances between loci in Kosambi centiMorgans) was DNA fragment (ACCESSION: FJ494918) spanning from further established after multipoint analysis. exon 3 to 6. Using information from the porcine HTGS We further investigated the effect of the C1924T poly- database and exon 1 and 2, we identified two homologous morphism on meat quality traits in the B 9 Y F2 popula- genomic DNA sequences (ACCESSION: CU929490.3 and tion. Considering the limited number of the ‘‘TT’’ CU929970.1), which supplied information for the introns. homozygotes, we only compared the observed difference The exon/intron junctions’ analysis revealed that each of between the ‘‘CT’’ heterozygotes and the ‘‘CC’’ homozy- the 50-donor and 30-acceptor splice sites confirmed the gotes. The association analyses indicated that animals of consensus sequences for eukaryotic splice junctions. the CC genotype had much more desirable meat quality Four synonymous , A1855G, A1858C, (Table 3). A1912G and C1924T, were identified in exon 4 of porcine CSRP3 by comparative sequencing. Furthermore, a ‘‘GGG’’ deletion (2,065–2,067) and another five single nucleotide Discussion polymorphisms, G2071A, G2075A, T2135C, A2204T and G2213C were found in the intron 4. All of these nine SNPs The cysteine and glycine-rich proteins are evolutionally and the deletion were located in a 400 bp region conserved proteins that mediate protein–protein interac- covering exon 4 and its downstream intron (Fig. 5). There- tions and have been demonstrated to be implicated in the after, the C1924T substitution recognized by TaqI was fur- process of proliferation and differentiation [1]. ther used for PCR–RFLP genotyping, which revealed two In particular, CRP3 is expressed specifically in striated

Fig. 5 Haplotype analysis of sequenced genomic regions 123 Mol Biol Rep

Table 3 Association analysis results of CSRP3 in the BY population Traits Genotypic least squares means (SE) CC (296)a CT (194) P-value

Firmness 3.48 (0.04) 3.29 (0.05) 0.002 Lab loin pH 5.84 (0.01) 5.80 (0.02) 0.028 Off flavor score 1.34 (0.15) 1.71 (0.16) 0.047 Water holding capacity 0.19 (0.01) 0.21 (0.01) 0.048 Hormel loin minolta 20.86 (0.39) 21.62 (0.43) 0.086 Flavor score 2.92 (0.12) 2.65 (0.13) 0.082 Average glycolytic potential 103.75 (1.32) 106.55 (1.48) 0.090 Average lactate 86.36 (1.04) 88.56 (1.16) 0.087 a In bracket, number of animals for different genotypes muscle and exhibits dual subcellular localization in the regulatory role in muscle development [10]. At 65 dpc, we nucleus and cytoplasm [10]. Given its important regulatory observed that the expression of CSRP3 in Tongcheng pig and structural functions in myogenesis and its synergetic was slightly higher than that in Landrace. It was generally expression changes during myofiber type transformation agreed that 65 dpc is approximately the turning point in [17, 18], we cloned and characterized the porcine CSRP3 porcine prenatal skeletal muscle development, at which the gene as a potential functional candidate gene affecting pig pattern showed the greatest difference meat quality. between the Tongcheng pig and Landrace pig [20]. The We characterized the amino acid sequences of porcine introduced pig breeds such as Landrace and Large White cysteine and glycine-rich proteins. Like the orthologous have a high growth rate and much more fast fibers but often genes in the human and the mouse, porcine CRPs display have inferior meat quality, whereas Chinese indigenous considerable sequence conservation in two LIM domains pigs such as Erhualian and Tongcheng pigs have lower and the glycine-rich regions, suggesting conservation of growth rate but have more slow fibers and more desirable functional properties. Although the sequence similarities meat quality [20, 33]. Therefore, given the synergetic between two CRPs exceeded 64%, CRP3 showed much changes demonstrated by rat CSRP3 during the fiber tran- more distinct sequence similarity and length in comparison sition from fast to slow [17, 18], the CSRP3 gene probably to CRP1 and CRP2. The relative dissimilarity of CRP3 in contributed to myofiber generation and transition, and sequence is further demonstrated by phylogenic analysis. therefore affected meat quality. According to a predicted phylogenic tree (Fig. 2), we By comparative sequencing of porcine CSRP3,we proposed that two rounds of gene duplication could have identified nine SNPs and one deletion mutation in a 400 bp occurred during the formation of the CSRP gene family in region covering exon 4 and its adjacent intron, which vertebrates. The CSRP3 gene first diverged from the formed two haplotypes. Therefore, we only choose one of common ancestor gene during the first duplication, and the substitution, C1924T, for further analyses. Linkage analy- other two members diverged in the secondary duplication, sis using the substitution of C1924T assigned porcine which was in agreement with the hypothesis that two CSRP3 to SSC2, closely linked with TEF1 that had been rounds of whole genome duplication (WGD) occurred assigned to the same region previously [23]. This result during early vertebrate evolution [32]. The structural and was further reinforced by RH mapping, which assigned evolutionary differences were suggested by their functional CSRP3 to SSC 2p14-17, closely linked with SW2167, divergence, which was partially reflected also by their S0170 and SW1026. Surrounding this region, a search in tissue distribution (Fig. 3). The CSRP1 and CSRP2 genes the Pig QTL database (http://www.animalgenome.org/QTL were expressed widely and both were involved in the db/pig.html) revealed multiple QTLs for meat quality regulation of SMCs development [4, 8], whereas CSRP3 traits, including drip loss [27], pH for Longissmus Dorsi had restricted expression in striated muscle and contributed [34], subjective juiciness score [35], subjective off-flavor to its development [10]. score [35], shear force [30] and subjective chew score [30]. The porcine CSRP3 mRNA showed a generally up- The localization data were in accordance with the associ- regulated trend in embryonic skeletal muscle of three dif- ation analyses results, which revealed that the individuals ferent developmental stages in both Tongcheng and of CC genotype showed much more desirable meat quality, Landrace pigs, which was in accordance with its positive with higher firmness and Lab (48 h) Loin pH, and lower

123 Mol Biol Rep

Off-flavor Score and Water Holding Capacity (a lower 2. Harper BD, Beckerle MC, Pomies P (2000) Fine mapping of the value indicating that less moisture was lost from the loin alpha-actinin binding site within cysteine-rich protein. Biochem J 350(Pt 1):269–274. doi:10.1042/0264-6021:3500269 shortly after cutting, therefore is desirable) [27]. Since the 3. Liebhaber SA, Emery JG, Urbanek M, Wang XK, Cooke NE meat quality traits may be affected by muscle fiber type, (1990) Characterization of a human cdna encoding a widely the association analyses results were therefore in agree- expressed and highly conserved cysteine-rich protein with an ment with the regulatory functions of CSRP3 for muscle unusual -finger motif. Nucleic Acids Res 18:3871–3879. doi: 10.1093/nar/18.13.3871 fiber characteristics [15]. 4. Henderson JR, Macalma T, Brown D, Richardson JA, Olson EN, In Chinese indigenous pig breeds, allele T seems to be Beckerle MC (1999) The lim protein, crp1, is a smooth muscle of high frequency. However, association analysis demon- marker. Dev Dyn 214:229–238. doi:10.1002/(SICI)1097-0177 strated that the CC genotype showed much more desirable (199903)214:3\229::AID-AJA6[3.0.CO;2-S 5. Sadler I, Crawford AW, Michelsen JW, Beckerle MC (1992) meat quality in a B 9 Y F2 population, which has very low Zyxin and ccrp: two interactive proteins associated frequency of allele T. This suggests that further investi- with the . J Cell Biol 119:1573–1587. doi:10.1083/ gation still needs to be done to explore the genetic mode of jcb.119.6.1573 CSRP3 effects on complex meat quality traits. Further- 6. Pomies P, Louis HA, Beckerle MC (1997) Crp1, a lim domain protein implicated in muscle differentiation, interacts with alpha- more, the difference of the allelic frequency distribution of actinin. J Cell Biol 139:157–168. doi:10.1083/jcb.139.1.157 the C1924T substitution suggests an evolutionary diver- 7. Weiskirchen R, Pino JD, Macalma T, Bister K, Beckerle MC gence and might reflect a history of artificial selection in (1995) The cysteine-rich protein family of highly related lim commercial pig breeds. domain proteins. J Biol Chem 270:28946–28954. doi:10.1074/ jbc.270.48.28946 According to porcine codon usage analysis (http:// 8. Jain MK, Fujita KP, Hsieh CM, Endege WO, Sibinga NE, Yet www.kazusa.or.jp/codon/), both the A1855G and C1924T SF, Kashiki S, Lee WS, Perrella MA, Haber E, Lee ME (1996) caused Proline residue codon changes with the same Molecular cloning and characterization of smlim, a develop- direction. Proline residue confers unique structural con- mentally regulated lim protein preferentially expressed in aortic smooth muscle cells. J Biol Chem 271:10194–10199. doi:10.1074/ straints on peptide chains [36] and influences markedly the jbc.271.7.3667 protein folding speed [37]. These synonymous mutations 9. Weiskirchen R, Moser M, Weiskirchen S, Erdel M, Dahmen S, could not change amino acids but caused the codon alter- Buettner R, Gressner AM (2001) Lim-domain protein cysteine- and ations, which probably affect translation efficiency and the glycine-rich protein 2 (crp2) is a novel marker of hepatic stellate cells and binding partner of the protein inhibitor of activated stat1. efficiency of cotranslational protein folding [38]. There- Biochem J 359:485–496. doi:10.1042/0264-6021:3590485 fore, it probably gives some clues for the interpretation of 10. Arber S, Halder G, Caroni P (1994) Muscle lim protein, a novel functional divergence of the two haplotypes. However, essential regulator of myogenesis, promotes myogenic differen- further study is needed to evaluate the functional difference tiation. Cell 79:221–231. doi:10.1016/0092-8674(94)90192-9 11. Kong Y, Flick MJ, Kudla AJ, Konieczny SF (1997) Muscle lim of the two haplotypes and additional aspects of the associ- protein promotes myogenesis by enhancing the activity of . ations. Mol Cell Biol 17:4750–4760 In summary, we have isolated and characterized the 12. Arber S, Caroni P (1996) Specificity of single lim motifs in tar- porcine CSRP3 gene. Data presented here provide bio- geting and lim/lim interactions in situ. Genes Dev 10:289–300. doi:10.1101/gad.10.3.289 chemical and structural bases for further investigation on 13. Knoll R, Hoshijima M, Hoffman HM, Person V, Lorenzen- its function and will potentially lead to a better under- Schmidt I, Bang ML, Hayashi T, Shiga N, Yasukawa H, Schaper standing of the mechanism of myofiber determination and W, McKenna W, Yokoyama M, Schork NJ, Omens JH, McCul- transformation. This in turn could help provide molecular loch AD, Kimura A, Gregorio CC, Poller W, Schaper J, Schul- theiss HP, Chien KR (2002) The cardiac mechanical stretch mechanisms for meat quality study in pigs. sensor machinery involves a z disc complex that is defective in a subset of human . Cell 111:943–955. doi: Acknowledgments We are grateful to Dr Martine Yerle for pro- 10.1016/S0092-8674(02)01226-6 viding the RH panel. This research was supported by National Natural 14. Arber S, Hunter JJ, Ross J Jr, Hongo M, Sansig G, Borg J, Science Foundation of China (30771536), National High Science and Perriard JC, Chien KR, Caroni P (1997) Mlp-deficient mice Technology Foundation of China (2007AA10Z168) and The College exhibit a disruption of cardiac cytoarchitectural organization, of Agriculture and Life Sciences, Iowa State University and State of dilated cardiomyopathy, and heart failure. Cell 88:393–403. doi: Iowa and Hatch Funding. 10.1016/S0092-8674(00)81878-4 15. Barash IA, Mathew L, Lahey M, Greaser ML, Lieber RL (2005) Muscle lim protein plays both structural and functional roles in skeletal muscle. Am J Physiol Cell Physiol 289:C1312–C1320. References doi:10.1152/ajpcell.00117.2005 16. Fonseca S, Wilsons IJ, Horgan GW, Maltin CA (2003) Slow fiber 1. Louis HA, Pino JD, Schmeichel KL, Pomies P, Beckerle MC cluster pattern in pig longissimus thoracis muscle: Implications (1997) Comparison of three members of the cysteine-rich protein for myogenesis. J Anim Sci 81:973–983 family reveals functional conservation and divergent patterns of 17. Schneider AG, Sultan KR, Pette D (1999) Muscle lim protein: gene expression. J Biol Chem 272:27484–27491. doi:10.1074/ expressed in slow muscle and induced in fast muscle by enhanced jbc.272.43.27484 contractile activity. Am J Physiol 276:C900–C906

123 Mol Biol Rep

18. Willmann R, Kusch J, Sultan KR, Schneider AG, Pette D (2001) pigIi. Meat and muscle composition. Mamm Genome 12:637– Muscle lim protein is upregulated in fast skeletal muscle during 645. doi:10.1007/s003350020019 transition toward slower phenotypes. Am J Physiol Cell Physiol 28. Xu XL, Xu XW, Pan PW, Li K, Jiang ZH, Yu M, Rothschild MF, 280:C273–C279 Liu B (2009) Porcine skeletal muscle differentially expressed 19. Nabel EG, Yang ZY, Plautz G, Forough R, Zhan X, Haudenschild gene cmya1: Isolation, characterization, mapping, expression and CC, Maciag T, Nabel GJ (1993) Recombinant fibroblast growth association analysis with carcass traits. Anim Genet 40:255–261 factor-1 promotes intimal hyperplasia and angiogenesis in arteries 29. Green P, Falls K, Crooks S (1990) Documentation for crimap, in vivo. Nature 362:844–846. doi:10.1038/362844a0 version 2.4. Washington University School of Medicine, St Louis 20. Tang Z, Li Y, Wan P, Li X, Zhao S, Liu B, Fan B, Zhu M, Yu M, 30. Alexander LJ, Rohrer GA, Beattie CW (1996) Cloning and Li K (2007) Longsage analysis of skeletal muscle at three pre- characterization of 414 polymorphic porcine microsatellites. natal stages in tongcheng and landrace pigs. Genome Biol Anim Genet 27:137–148 8:R115. doi:10.1186/gb-2007-8-6-r115 31. Robic A, Riquet J, Yerle M, Milan D, Lahbib-Mansais Y, Dubut- 21. Clamp M, Cuff J, Searle SM, Barton GJ (2004) The jalview java Fontana C, Gellin J (1996) Porcine linkage and cytogenetic maps alignment editor. Bioinformatics 20:426–427. doi:10.1093/bio integrated by regional mapping of 100 microsatellites on somatic informatics/btg430 cell hybrid panel. Mamm Genome 7:438–445. doi:10.1007/s0033 22. O’Donnell JK, Martin MJ, Logan JS, Kumar R (1993) Production 59900129 of human hemoglobin in transgenic swine: an approach to a blood 32. Dehal P, Boore JL (2005) Two rounds of whole genome dupli- substitute. Cancer Detect Prev 17:307–312 cation in the ancestral vertebrate. PLoS Biol 3:e314. doi: 23. Xu X, Xing S, Du ZQ, Rothschild MF, Yerle M, Liu B (2008) 10.1371/journal.pbio.0030314 Porcine tef1 and rtef1: Molecular characterization and association 33. Yang X, Zhao R, Chen J, Xu Q, Wei X (2005) The develop- analyses with growth traits. Comp Biochem Physiol B Biochem mental changes of myofibre types in ld muscle of erhualian and Mol Biol 150:447–453. doi:10.1016/j.cbpb.2008.05.003 large white pigs. Chin J Vet Sci 25:89–94 24. Livak KJ, Schmittgen TD (2001) Analysis of relative gene 34. Su YH, Xiong YZ, Jiang SW, Zhang Q, Lei MG, Zheng R, CY D expression data using real-time quantitative pcr and the 2(-delta (2004) Mapping quantitative trait loci for meat quality trait in a delta c(t)) method. Methods 25:402–408. doi:10.1006/meth.2001. large white 9 meishan cross. Yi Chuan Xue Bao 31:132–136 1262 35. Edwards DB, Ernst CW, Raney NE, Doumit ME, Hoge MD, 25. Yerle M, Pinton P, Robic A, Alfonso A, Palvadeau Y, Delcros C, Bates RO (2008) Quantitative trait mapping in an f2 Hawken R, Alexander L, Beattie C, Schook L, Milan D, Gellin J duroc 9 pietrain resource population: iiCarcass and meat quality (1998) Construction of a whole-genome radiation hybrid panel traits. J Anim Sci 86:254–266. doi:10.2527/jas.2006-626 for high-resolution gene mapping in pigs. Cytogenet Cell Genet 36. Yaron A, Naider F (1993) Proline-dependent structural and bio- 82:182–188. doi:10.1159/000015095 logical properties of peptides and proteins. Crit Rev Biochem 26. Milan D, Hawken R, Cabau C, Leroux S, Genet C, Lahbib Y, Mol Biol 28:31–81. doi:10.3109/10409239309082572 Tosser G, Robic A, Hatey F, Alexander L, Beattie C, Schook L, 37. Wedemeyer WJ, Welker E, Scheraga HA (2002) Proline cis-trans Yerle M, Gellin J (2000) Imprh server: an rh mapping server isomerization and protein folding. Biochemistry 41:14637– available on the web. Bioinformatics 16:558–559. doi:10.1093/ 14644. doi:10.1021/bi020574b bioinformatics/16.6.558 38. Kimchi-Sarfaty C, Oh JM, Kim IW, Sauna ZE, Calcagno AM, 27. Malek M, Dekkers JC, Lee HK, Baas TJ, Prusa K, Huff-Lonergan Ambudkar SV, Gottesman MM (2007) A ‘‘Silent’’ polymorphism E, Rothschild MF (2001) A molecular genome scan analysis to in the mdr1 gene changes substrate specificity. Science 315:525– identify chromosomal regions influencing economic traits in the 528. doi:10.1126/science.1135308

123