Contribution of Cabpm4, a BTB Domain–Containing Gene, to the Response of Pepper to Phytophthora Capsici Infection and Abiotic Stresses

agronomy

Article Contribution of CaBPM4, a BTB Domain–Containing Gene, to the Response of Pepper to Phytophthora capsici Infection and Abiotic Stresses

Yu-Mei He 1, Ke-Ke Liu 1,2, Huai-Xia Zhang 1, Guo-Xin Cheng 1, Muhammad Ali 1 , Saeed Ul Haq 1, Ai-Min Wei 3 and Zhen-Hui Gong 1,*

1 College of Horticulture, Northwest A&F University, Yangling 712100, China 2 College of Horticulture, Henan Agricultural University, Zhengzhou 450002, China 3 Tianjin Vegetable Research Center, Tianjin 300192, China * Correspondence: [email protected]; Tel.: +86-029-8708-2102

Received: 24 June 2019; Accepted: 27 July 2019; Published: 30 July 2019

Abstract: The Broad-complex Tramtrack and Bric-a-brac (BTB) domain participates in plant responses to biotic and abiotic stresses, however its role is unknown in pepper plants. CaBPM4 has meprin and TRAF homology (MATH) and BTB domains at its N- and C-termini, respectively, and it contains a 1589-bp full-length cDNA that encodes a protein containing 403 amino acids. In this study, the pepper gene CaBPM4 (Capsicum annuum BTB-POZ and MATH domain protein) was cloned, and its role in responses to Phytophthora capsici, cold, drought, and salt stress were characterized. The results of quantitative RT-PCR revealed that CaBPM4 was down-regulated under P. capsici infection, salicylic acid, H2O2, and abscisic acid treatments, while abiotic stresses, including salt, cold, and drought, enhanced its transcript level. Furthermore, CaBPM4 silencing signiﬁcantly impaired resistance to P. capsici, apparently by altering the transcript level of defense-related genes CaPR1, CaDEF1, and CaSAR82 and reducing root activity. However, CaBPM4-silenced plants exhibited remarkably increased peroxidase activity and decreased malondialdehyde concentrations, indicating that CaBPM4 may enhance resistance to salt and drought stress. Further study should focus on the mechanism by which CaBPM4 regulates the defense response to P. capsici infection and abiotic stresses.

Keywords: pepper; BTB protein; Phytophthora capsici; abiotic stress; virus-induced gene silencing

1. Introduction Plants typically encounter several biotic and abiotic stresses, including cold [1], salinity [2], drought [3], and pathogens [4]. Various environmental stresses induce physiological problems in plants and lead to various types of damages. To defend against stress-induced injuries, plants have evolved many defense mechanisms, including transcriptional regulation [5]. Defense mechanisms can positively or negatively regulate reactive oxygen species (ROS) produced by environmental stresses to achieve long-term physiological adaption to adverse environmental conditions [6]. The eﬀect of transcription factors (TFs) on gene expression plays an essential role in various cellular processes that include signaling transduction and cellular stress responses [7]. The numerous transcription factors (TFs) that regulate gene expression by binding to target gene promoters provide mechanisms of well developmental and physiological control that can be shaped by natural selection, thereby enabling adaptive responses to environmental stress [8]. For example, CaWRKY40 plays an essential role in regulating the response of pepper plants to Ralstonia solanacearum infection, and CaWRKYd also regulates hypersensitive and defense responses to pathogen infection [9,10]. MYB [11] and bZIP [12,13] also play vital roles in protecting plants from environmental stresses.

Agronomy 2019, 9, 417; doi:10.3390/agronomy9080417 www.mdpi.com/journal/agronomy Agronomy 2019, 9, 417 2 of 16

Broad-complex Tramtrack and Bric-a-brac (BTB) domain, also known as POX virus and Zinc finger (POZ) domain, is evolutionarily conserved and reported to be involved in transcriptional regulation [14,15] and targeting proteins for degradation [16]. BTB domain was first discovered in Drosophila [15], and since then, its vital roles in hormone-induced signaling transduction and plant responses to biotic and abiotic stresses have been revealed [17,18]. For example, in soybean, GmBTB expression was induced strongly by Phytophthora sojae infection [19]. The potato (Solanum tuberosum) BTB-containing protein NRL1 can interact with the positive immunity regulator NbSWAP70 in Nicotiana benthamiana and also suppress plant immunity against Phytophthora infestans infections [20]. Expression of Arabidopsis NPR1 in wheat, transgenic tobacco, rice, and tomato enhanced plant resistance to pathogen attacks [21–24]. Furthermore, the BTB-containing protein ARIA also affected the abscisic acid (ABA)-mediated signaling pathway through interactions with a transcription factor ABF2 [25]. The BTB domain-containing protein gene family of tomato was also well-known to be related closely to abiotic stresses [26]. Many BTB/POZ proteins contain a secondary protein domain, such as a meprin and TRAF (tumor necrosis factor receptor associated factor) homology (MATH) domain, a tumor necrosis factor receptor-associated element [27]. A previous study suggested that MATH domain-containing proteins positively regulate defense responses to abiotic stresses in Arabidopsis and rice [28]. Different functional roles have been identified for BTB proteins, including transcription repression, cytoskeleton regulation, and protein degradation, in which the amino-terminal MATH domain is responsible for substrate specificity [21]. In the model plant Arabidopsis, six genes (AtBPM1–AtBPM6) encoding BTB-MATH proteins were characterized [29], and these BPMs can interact with the homeodomain-leucine zipper transcription factors ATHB6 to regulate phytohormone ABA responses and responses to abiotic stresses [17]. Morimoto et al. (2017) [30] revealed that BPM proteins modulate plant thermotolerance by negatively regulating the degradation of DREB2A. BPM also can participate in other biological processes of plant through interacting with ERFs and MYBs [31,32]. Furthermore, 33 BTB-MATH proteins have been identified in maize and one member ZmMAB1 was studied playing key roles during meiosis II and the first mitotic division [33,34]. Overexpression of a wheat BTB-MATH gene TaMAB2 on Arabidopsis plants showed an effect on the plant’s growth and development [35]. Thus, BPMs play different roles during the plant growth and development processes. Pepper (Capsicum annuum L.) is an economically important vegetable crop worldwide. However, environmental stresses are significant constraint in pepper production, which can remarkably affect pepper growth and development. Here, we have isolated and characterized the gene CaBPM4, which belongs to the BPM subfamily, and further analyzed its contribution to abiotic or biotic stress response in pepper plant using qRT-PCR and virus-induced gene silencing (VIGS). The study provides insights into the mechanisms by which CaBPM4 regulates pepper development under environmental stress and provides a foundation for future selective breeding efforts.

2. Materials and Methods

2.1. Plant Materials and Growth Conditions Pepper (Capsicum annuum L.) plant cultivar ‘A3’ which is susceptible to HX-9 and resistant to PC strain of P. capsici were provided from the Capsicum Research Group, College of Horticulture, Northwest A&F University, China. Seeds were soaked in warm water (55 ◦C) for 20 min and dipped in the normal temperature water for 4–6 h. Seedlings were grown under the conditions described by Wang et al. (2013) [36].

2.2. Pathogen Preparation and Inoculation Procedures The avirulent PC strain (incompatible with the ‘A3’ pepper cultivar) and the virulent HX-9 strain (compatible with ‘A3’) of Phytophthora capsici were used in this experiment. A P. capsici zoospore suspension was prepared according to the protocol used by Wang et al. (2013) [36] and Ali et al. Agronomy 2019, 9, 417 3 of 16

(2019) [37]. The virulent HX-9 and avirulent PC strains of P. capsici were grown on potato dextrose agar (PDA) medium for seven days in the darkness at 28 ◦C. Cut-up portions of the media were placed into sterile distilled water under ﬂuorescent light for four days. Zoospore release was induced by chilling cultures to 4 ◦C for 1 h and then incubation at room temperature for 1 h. The zoospore concentration was counted using a hemocytometer, and the concentration was adjusted to 1 104 × zoospores per millimeter. Experimentation with P. capsici infection was conducted as follows: The drench-method was used to inoculate the zoospores into the pepper seedlings at the six true-leaf stage, and distilled water was used as a control. Leaf and root samples were collected at 0, 4, 12, 24, and 48 h after inoculation. For virus-induced gene silencing (VIGS) of CaBPM4 in pepper plants, leaves and roots from control plants (TRV2:00) and silenced pepper plants (TRV2:CaBPM4) were collected after infection with P. capsici.

2.3. Stress Treatments Pepper plants at six true-leaf stage were used for abiotic stresses and signaling molecule treatments. In case of abiotic stress, cold, drought, and salt stress were applied according to the protocol used by He et al., 2018 [38]. Control plants were treated with sterile water. Leaves from treated plants were collected at 0, 4, 8, 12, and 24 h after treatment. For each plant signaling molecule treatment, each signaling molecule (namely 5 mM salicylic acid (SA), 50 µM methyl jasmonate (MeJA), 10 mM H2O2, 100 µM abscisic acid (ABA), and 10 mM ethephon (ETH)) was supplemented with 0.5% Tween-20 and sprayed onto pepper seedlings (SA, MeJA, ABA was ﬁrst solubilized in 0.1% v pure alcohol, respectively, and then sterile water was used to adjust the solution to working concentration, while ETH and H2O2 was solubilized with sterile water). Control plants (for SA, MeJA, ABA treatment) were sprayed with sterile water with a mixture of 0.5% Tween-20 and 0.1% alcohol. And plants sprayed with sterile water with a mixture of 0.5% Tween-20 were also treated as a control (for H2O2 and ETH treatment). Leaves from treated plants were collected at 0, 4, 8, 12, 24, and 48 h after treatment. All collected samples were instantly frozen in liquid nitrogen and stored at 80 C. All treatments were − ◦ performed and analyzed in triplicate across separate experiments.

2.4. RNA Extraction and Quantitative Real-Time PCR Analysis To evaluate the tissue-specific expression of CaBPM4, samples from roots, stems, leaves, flowers, green fruits, and red fruits were collected from ‘A3’ cultivar pepper plants. RNA was extracted from pepper samples at different time points using Trizol reagent (Invitrogen, Carlsbad, CA, USA). Then, 0.5 µg of total RNA was used for first-strand cDNA synthesis using a PrimeScript™ Kit (TaKaRa Bio Inc., Dalian, China). Real-time quantitative PCR (qRT-PCR) was conducted using SYBR® Premix Ex Taq™ II (TaKaRa) as described by Guo et al. (2016) [39]. Actin (GenBank ID, AY572427.1) was used as an internal control (i.e., reference gene) [40]. The primer sequences are shown in Table1. Relative ∆∆CT CaBPM4 expression levels were determined using the comparative 2− method [41].

2.5. Cloning and Sequence Analysis of CaBPM4 The rapid ampliﬁcation of cDNA ends (RACE) technique was used to obtain the full-length cDNA designated CaBPM4. According to the partial cDNA fragment of the reported sequence (accession number, CK901556.1), a set of gene-speciﬁc primers (CaBPM4F and CaBPM4R) for 50 and 30 RACE was designed. Contig Express software and BLAST were used to assemble the full-length cDNA sequences. The full-length cDNA sequence was obtained from the leaves of the pepper cultivar ‘A3’ using the primer pair CaBPM4QF and CaBPM4QR. The full-length protein sequences of CaBPM4 and homologs in other plant species were used for multiple sequence alignments with DNAMAN software. MEGA 6.0 was used to construct a phylogenetic tree with the neighbor-joining method. Agronomy 2019, 9, 417 4 of 16

Table 1. Primer sequences used in the experiment.

Code Sequence (5’–3’) CaBPM4F TAAACAGGATGGCAATGAGCAGGAA CaBPM4R TTCCTGCTCATTGCCATCCTGTT CaBPM4QF TGCCCCAAAAAAGAAAACCCTA CaBPM4QR CAGGTTACACCACACGAGAC CaPDSVF(Virus-Induced Gene Silencing (VIGS)) GGGGAATTCTGTTGTCAAAACTCCAAGGTCTGTA CaPDSVR GGGGGATCCTTTCTCCCACTTGGTTCACTCTTGT CaBPM4VF GGGGAATTCTGGGCACAGCTTTCAGACG CaBPM4VR GGGGGATCCCAGGTTACACCACACGAGACG Caactin1F TGTTATGGTAGGGATGGGTC Caactin1R TTCTCTCTATTTGCCTTGGG CaBPM4DF(qRT-PCR) CACCAACGGAAGGAGAGTCA CaBPM4DR CTTTCAGGTTACACCACACGAG CaPR1F(qRT-PCR) GCCGTGAAGATGTGGGTCAATGA CaPR1R TGAGTTACGCCAGACTACCTGAGTA CaDEF1F GTGAGGAAGAAGTTTGAAAGAAAGTAC CaDEF1R TGCACAGCACTATCATTGCATACAATTC CaSAR82F GTTGTGACTATTGTTGTGCCTA CaSAR82R TAATCATAAACAAATCAATCTAAATC CaPO1F GGCGCCAGGATTGCTGACAA CaPO1R GTGGACATAATCCTCGAAGC

The isoelectric point (pI) and molecular weight (MW) of CaBPM4 were analyzed using the online tool (https://www.expasy.org/), and conserved domains were identiﬁed using an NCBI tool (available online: http://www.ncbi.nlm.nih.gov/cdd/) according to the method described by He et al. [38].

2.6. Virus-Induced Gene Silencing Analysis of CaBPM4 in Pepper Plants The tobacco rattle virus (TRV)-based VIGS system was used for gene silencing in pepper plants as described by Choi et al. [42]. A 256-bp fragment harboring a conserved and a non-conserved region of CaBPM4 with primers CaBPM4VF and CaBPM4VR containing restriction sites for EcoRI and BamHI enzymes was cloned into the TRV2 vector. The VIGS in the pepper plants were applied according to the protocol used by Wang et al. (2013) [36]. Five weeks after infiltration, leaves and roots from control plants (TRV2:00) and silenced pepper plants (TRV2:CaBPM4) were collected after infection with P. capsici. Additionally, control (TRV2:00) and silenced (TRV2: CaBPM4) plants were subjected to 0.4 M sodium chloride (NaCl) and mannitol for salt and drought stress treatments, respectively. Leaf samples were collected for the measurement of peroxidase (POD) activity and Malondialdehyde (MDA) concentration. Peroxidase enzyme activity was quantified using the technique described by Beffa et al. [43]. MDA concentration was measured as described by Buege [44]. Triphenyltetrazolium chloride (TTC) was used to estimate root activity according to the methods described by Jin et al. [45]. Root samples collected from TRV2:00 and CaBPM4-silenced plants were incubated with 10 mL 1:1 (v/v) mixture of 1% TTC solution and 0.l M phosphate buffer (pH 7.0) for 1 h in the dark at 37 ◦C, followed by adding 2 mL of 1 M sulphuric acid to inhibit the reaction. Then rinsed root samples with distilled water and dry with absorbent papers, ground in mortar with 3 mL ethyl acetate and transferred to a 10 mL volumetric flask. The residues were rinsed with ethyl acetate and mixed with the earlier extracts and the final volume was adjusted to 10 mL. Measured the absorption of the extraction with a spectrophotometer at 485 nm. The reduced TTC amount was obtained from the standard curve and its 1 1 intensity in the roots was calculated TTC reduction intensity (mg g− h− ) = reduced TTC amount/FW h (FW-fresh root mass; h-the incubation time).

2.7. Statistical Analysis Data were evaluated by an analysis of variance (ANOVA) using SPSS (version 16.0, SPSS Inc., Chicago, IL, USA). Data are expressed as the means standard deviation (SD) of three replicates for all ± Agronomy 2019, 9, x FOR PEER REVIEW 5 of 16

Agronomy 2019, 9, 417 5 of 16 all parameters. A least significant difference (p ≤ 0.05) test was used to identify significant differences among the treatments. parameters. A least significant difference (p 0.05) test was used to identify significant differences ≤ among3. Results the treatments.

3.3.1. Results Cloning and Sequence Analysis of Pepper CaBPM4

3.1. CloningThe full-length and Sequence 1589-bp Analysis cDNA of Pepper of CaBPM4 CaBPM4 (Gene Bank accession number FJ617520) was obtained using RACE. The cDNA included a 41-bp 5′-untranslated region (UTR), a 1212-bp open readingThe frame full-length (ORF), 1589-bp and a 336-bp cDNA of3′-UTRCaBPM4 with(Gene an 18-bp Bank poly accession (A+) tail. number The ORF FJ617520) encoded was a obtaineddeduced usingprotein RACE. consisting The cDNAof 403 amino included acids a 41-bpwith a 5theoretical0-untranslated MW of region 44.574 (UTR), kDa and a 1212-bp pI of 5.680. open Motif reading scan frameindicated (ORF), that and the a protein 336-bp contained 30-UTR with a MATH an 18-bp doma polyin (A (32–144)+) tail. Theat its ORF N-terminus encoded and a deduced a BTB domain protein consisting(197–308) ofat 403its aminoC-terminus acids with(Figure a theoretical 1). Additionally, MW of 44.574 high kDa amino and pacidI of 5.680.sequence Motif homology scan indicated was thatobserved the protein between contained CaBPM4 a MATH (ACM67640.1) domain (32–144)and othe atr itsBPM N-terminus proteins andbased a BTB on multiple domain (197–308) alignments at itsobtained C-terminus using (Figure ClustalW.1). Additionally, The inferred high phylogenetic amino acid sequencetree revealed homology the amino was observed acid sequence between of CaBPM4CaBPM4 (ACM67640.1)was closely related and other to BPM proteinsfrom potato based (Solanum on multiple tuberosum alignments) (Figure obtained 2), indicating using ClustalW. high Theconservation inferred phylogeneticof the BPM sequence tree revealed and structure the amino throughout acid sequence evolution. of CaBPM4 was closely related to BPM from potato (Solanum tuberosum) (Figure2), indicating high conservation of the BPM sequence and structure throughout evolution.

Figure 1. Multiple sequence alignment of the ZmBPM4/mab17 (Zea mays, ACG37150.1), AtBPM4 Figure 1. Multiple sequence alignment of the ZmBPM4/mab17 (Zea mays, ACG37150.1), AtBPM4 (Arabidopsis thaliana, NP_566212.2), NaBPM4 (Nicotiana attenuate, XP_019251977.1), CsBPM4 (Arabidopsis thaliana, NP_566212.2), NaBPM4 (Nicotiana attenuate, XP_019251977.1), CsBPM4 (Cucumis (Cucumis sativus, XP_011653454.1), GmBPM4 (Glycine max, XP_006604260.1), OsBPM4 (Oryza sativus, XP_011653454.1), GmBPM4 (Glycine max, XP_006604260.1), OsBPM4 (Oryza sativa, sativa, XP_015646533.1), BnBPM4 (Brassica napus, XP_013729393.1), SpBPM4 (Solanum pennellii, XP_015646533.1), BnBPM4 (Brassica napus, XP_013729393.1), SpBPM4 (Solanum pennellii, XP_015056619.1), NtBPM4 (Nicotiana tabacum, XP_016504598.1), VvBPM4 (Vitis vinifera, XP_002277148.1), XP_015056619.1), NtBPM4 (Nicotiana tabacum, XP_016504598.1), VvBPM4 (Vitis vinifera, SlBPM4 (Solanum lycopersicum, XP_004251235.1), StBPM4 (Solanum tuberosum, XP_006340346.1) and XP_002277148.1), SlBPM4 (Solanum lycopersicum, XP_004251235.1), StBPM4 (Solanum tuberosum, CaBPM4 (ACM67640.1) proteins. Dark-blue and gray-pink shading reﬂects 100% and 75% percent XP_006340346.1) and CaBPM4 (ACM67640.1) proteins. Dark-blue and gray-pink shading reflects amino acid residues conservation, respectively. Gaps (-) were introduced to maximize alignment. A 100% and 75% percent amino acid residues conservation, respectively. Gaps (-) were introduced to red solid line shows the Broad-complex Tramtrack and Bric-a-brac (BTB) domain, and a dark solid line shows the meprin and TRAF homology (MATH) domain.

Agronomy 2019, 9, x FOR PEER REVIEW 6 of 16 Agronomy 2019, 9, x FOR PEER REVIEW 6 of 16

maximize alignment. A red solid line shows the Broad-complex Tramtrack and Bric-a-brac (BTB) maximize alignment. A red solid line shows the Broad-complex Tramtrack and Bric-a-brac (BTB) Agronomydomain,2019, 9and, 417 a dark solid line shows the meprin and TRAF homology (MATH) domain. 6 of 16 domain, and a dark solid line shows the meprin and TRAF homology (MATH) domain.

Figure 2. Phylogenetic tree of CaBPM4 proteins and their homologues in other species. The rooted FigureFigure 2.2. PhylogeneticPhylogenetic treetree ofof CaBPM4CaBPM4 proteinsproteins andand theirtheir homologueshomologues inin otherother species.species. TheThe rootedrooted gene tree (majority-rule consensus from 1,000 bootstrap replicates) resulted from was obtained by a genegene treetree (majority-rule(majority-rule consensusconsensus from 10001,000 bootstrapbootstrap replicates)replicates) resultedresulted fromfrom waswas obtainedobtained byby aa heuristic searching in using MEGA6.0. Bootstrap values are indicated at each branch node. GenBank heuristicheuristic searchingsearching inin usingusing MEGA6.0.MEGA6.0. BootstrapBootstrap valuesvalues areare indicatedindicated atat eacheach branchbranch node.node. GenBankGenBank accession numbers are in parentheses after each species and gene name. The red point represents accessionaccession numbersnumbers areare inin parenthesesparentheses afterafter eacheach speciesspecies andand genegene name.name. TheThe redred pointpoint representsrepresents CaBPM4 (ACM67640.1). Scale bar indicates the similarity coefficient. CaBPM4CaBPM4 (ACM67640.1).(ACM67640.1). ScaleScale barbar indicatesindicates thethe similaritysimilarity coecoefficient.fficient. 3.2. Tissue-Specific Tissue-Specific ExpressionExpression of CaBPM4 in Pepper 3.2. Tissue-Specific Expression of CaBPM4 in Pepper Real-time quantitative PCR was conducted to determine the expression of CaBPM4 in different different Real-time quantitative PCR was conducted to determine the expression of CaBPM4 in different tissues. CaBPM4CaBPM4transcripts transcripts were were detectable detectable in all in tissues, all tissu withes, leaf with tissue leaf having tissue the having highest the expression highest tissues. CaBPM4 transcripts were detectable in all tissues, with leaf tissue having the highest level,expression which level, was which about was 10-fold about higher 10-fold than higher that ofthan root that tissue, of root followed tissue, byfollowed flower by tissue, flower with tissue, the expression level, which was about 10-fold higher than that of root tissue, followed by flower tissue, secondwith the highest second level. highest Among level. other Among tissues, other the expressiontissues, the levels expression were highest levels in were roots highest followed in by roots red with the second highest level. Among other tissues, the expression levels were highest in roots fruit,followed stem, by and red green fruit, fruit stem, tissues, and respectively,green fruit buttissues, there respectively, was no significant but there difference was betweenno significant these followed by red fruit, stem, and green fruit tissues, respectively, but there was no significant tissuesdifference (Figure between3). these tissues (Figure 3). difference between these tissues (Figure 3).

Figure 3. Tissue-specificTissue-specific expression of CaBPM4 in different different organs of pepper plants. The samples of Figure 3. Tissue-specific expression of CaBPM4 in different organs of pepper plants. The samples of root, stemstem andand leafleaf areare collected collected from from A3 A3 pepper pepper plants plants at at the the six six true-leaf true-leaf stage, stage, while while the the samples samples of root, stem and leaf are collected from A3 pepper plants at the six true-leaf stage, while the samples flower,of flower, Gfruit Gfruit (green (green fruit) fruit) and Rfruit and (redRfruit fruit) (red are fruit) collected are collected from mature from plants. mature Relative plants. expression Relative of flower, Gfruit (green fruit) and Rfruit (red fruit) are collected from mature plants. Relative levelsexpression of the levelsCaBPM4 of thein di CaBPM4fferent tissues in different were determined tissues were in comparisondetermined with in comparison that in roots. with Results that arein expression levels of the CaBPM4 in different tissues were determined in comparison with that in presentedroots. Results as the are means presentedSD ofas threethe means independent ± SD of biological three independent replicates. Smallbiological letters replicates. (a–c) represent Small roots. Results are presented± as the means ± SD of three independent biological replicates. Small significantletters (a–c) di representfferences significant (p < 0.05). differences (p < 0.05). letters (a–c) represent significant differences (p < 0.05). 3.3. Expression of CaBPM4in Pepper Under P. capsici Infection 3.3. Expression of CaBPM4in Pepper Under P. capsici Infection 3.3. ExpressionTo investigate of CaBPM4in the role of PepperCaBPM4 Underin pepperP. capsici responses Infection to biotic stress, we analyzed the temporal To investigate the role of CaBPM4 in pepper responses to biotic stress, we analyzed the expressionTo investigate of CaBPM4 themRNA role of in leavesCaBPM4 and in roots pepper after responses inoculation to with biotic the stress, avirulent weP. analyzed capsici strain the temporal expression of CaBPM4 mRNA in leaves and roots after inoculation with the avirulent P. PCtemporal (which expression is incompatible of CaBPM4 with ‘A3’ mRNA pepper in plants)leaves andand theroots virulent after inoculationP. capsici strain with HX-9 the (compatibleavirulent P. with ‘A3’) using qRT-PCR. Transcript levels of CaBPM4 in leaf tissue samples were significantly Agronomy 2019, 9, x FOR PEER REVIEW 7 of 16

capsici strain PC (which is incompatible with ‘A3’ pepper plants) and the virulent P. capsici strain HX-9 (compatible with ‘A3’) using qRT-PCR. Transcript levels of CaBPM4 in leaf tissue samples were significantly downregulated at 4 h and reached their lowest level, 16-fold lower compared with Agronomythe control,2019, 9, 417at 48; however, in the incompatible interaction, CaBPM4 transcript levels7 ofwere 16 downregulated significantly at 12 h and reached the lowest level of 16-fold less at 48 h (Figure 4A). While in the root tissue, the expression level of CaBPM4 exhibited a trend similar to that in downregulated at 4 h and reached their lowest level, 16-fold lower compared with the control, at 48; leaves during interactions (Figure 4B). CaBPM4 was downregulated after inoculation with P. capsici. however, in the incompatible interaction, CaBPM4 transcript levels were downregulated signiﬁcantly At 4, 12, and 24 h the compatible virulent HX-9 and incompatible avirulent PC stain had significantly at 12 h and reached the lowest level of 16-fold less at 48 h (Figure4A). different effects on CaBPM4 expression.

Figure 4. Expression profiles of CaBPM4 in response to P. capsici infection and abiotic stresses. (A) The avirulentFigure PC4. Expression strain (incompatible profiles of with CaBPM4 the ‘A3’ in pepper response cultivar) to P. andcapsici the infection virulent HX-9and abiotic strain (compatible stresses. (A) withThe ‘A3’) avirulent of P. capsici PC straininfection (incompatible in roots; (B with) the avirulentthe ‘A3’ pepper PC strain cultivar) (incompatible and the with virulent the ‘A3’ HX-9 pepper strain cultivar)(compatible and thewith virulent ‘A3’) of HX-9 P. capsici strain infection (compatible in roots; with ( ‘A3’)B) the of avirulentP. capsici PCinfection strain in(incompatible leaves; (C) salt with stress;the ‘A3’ (D) pepper drought cultivar) stress;( andE) cold the stress.virulent Relative HX-9 strain expression (compatible levels with of the ‘A3’)CaBPM4 of P. atcapsici different infection time in pointleaves; were (C determined) salt stress; in(D comparison) drought stress; with ( thatE) cold in thestress. control Relative plants expression at the corresponding levels of the same CaBPM4 time at point.different Results time are point presented were as determined mean means in comparSD of threeison independentwith that in biological the control replicates. plants Smallat the ± letterscorresponding (a–d) represent same significant time point. di ffResultserences are (p < pres0.05).ented as mean means ± SD of three independent biological replicates. Small letters (a–d) represent significant differences (p < 0.05). While in the root tissue, the expression level of CaBPM4 exhibited a trend similar to that in leaves during3.4. CaBPM4 interactions Expression (Figure in4 B).ResponseCaBPM4 to Abioticwas downregulated Stresses and Signaling after inoculation Molecule Treatments with P. capsici in Pepper. At 4, 12, and 24CaBPM4 h the compatible gene expression virulent after HX-9 abiotic and incompatible stresses (i.e., avirulent cold, drought, PC stain and had salt) significantly was also diobserved.fferent effTheects expression on CaBPM4 levelexpression. of CaBPM4 was increased up to three-fold at 8 h post-treatment with salt stress 3.4.(Figure CaBPM4 4C), Expression while exposure in Response to drought to Abiotic stress Stresses sign andificantly Signaling increased Molecule the Treatments expression in level Pepper by up to 23-fold (23.71 ± 5.32) or more at 8 h (Figure 4D). CaBPM4 also responded to cold stress (4 °C), and its expressionCaBPM4 increasedgene expression at 12 h post-treatment after abiotic stresses (Figure (i.e., 4E). cold, drought, and salt) was also observed. The expression level of CaBPM4 was increased up to three-fold at 8 h post-treatment with salt stress (Figure4C), while exposure to drought stress significantly increased the expression level by up to 23-fold (23.71 5.32) or more at 8 h (Figure4D). CaBPM4 also responded to cold stress (4 C), and its ± ◦ expression increased at 12 h post-treatment (Figure4E). Agronomy 2019, 9, x FOR PEER REVIEW 8 of 16 Agronomy 2019, 9, 417 8 of 16

We also studied the effects of SA, MeJA, ETH, ABA, and H2O2 on CaBPM4 expression in pepper plants. Plants treated with H2O2 showed a decrease in CaBPM4 transcript level, reaching a minimum We also studied the effects of SA, MeJA, ETH, ABA, and H2O2 on CaBPM4 expression in pepper at 48 h post-treatment, which is almost a 10-fold decrease in expression compared to control plants plants. Plants treated with H2O2 showed a decrease in CaBPM4 transcript level, reaching a minimum (Figure 5A). A similar trend in CaBPM4 expression under ABA treatment was detected as well, while at 48 h post-treatment, which is almost a 10-fold decrease in expression compared to control plants transcript expression was decreased from 2 h post-treatment to 48 h post-treatment for ABA and (Figure5A). A similar trend in CaBPM4 expression under ABA treatment was detected as well, while H2O2 stress, reaching minimal expression compared with the control (Figure 5B). Likewise, plants transcript expression was decreased from 2 h post-treatment to 48 h post-treatment for ABA and H2O2 treated with SA showed dramatically down-regulated CaBPM4 expression, and the differences in stress, reaching minimal expression compared with the control (Figure5B). Likewise, plants treated the transcript of CaBPM4 at post-treatment time points were significant compared with the control with SA showed dramatically down-regulated CaBPM4 expression, and the differences in the transcript (Figure 5C). In response to the ETH treatment, the expression CaBPM4 increased at 4 and 8 h of CaBPM4 at post-treatment time points were significant compared with the control (Figure5C). In post-treatment compared to the control, continuing until 48 h (Figure 5D). Plants treated with MeJA response to the ETH treatment, the expression CaBPM4 increased at 4 and 8 h post-treatment compared showed initially upregulated expression, reaching the highest level at 8 h post-treatment, followed to the control, continuing until 48 h (Figure5D). Plants treated with MeJA showed initially upregulated by downregulation, reaching a minimum at 12 h post-treatment, and the differences in CaBPM4 expression, reaching the highest level at 8 h post-treatment, followed by downregulation, reaching a expression were significant (Figure 5E). minimum at 12 h post-treatment, and the differences in CaBPM4 expression were significant (Figure5E).

Figure 5. Quantitative real-time PCR analysis of CaBPM4 gene after signaling molecule treatments in Figure 5. Quantitative real-time PCR analysis of CaBPM4 gene after signaling molecule treatments in the leaves of pepper plant. (A) Hydrogen peroxide (H2O2) treatment; (B) abscisic acid (ABA) treatment; the leaves of pepper plant. (A) Hydrogen peroxide (H2O2) treatment; (B) abscisic acid (ABA) (C) salicylic acid (SA) treatment; (D) ethephon (ETH) treatment; (E) methyl jasmonate (MeJA) treatment. treatment; (C) salicylic acid (SA) treatment; (D) ethephon (ETH) treatment; (E) methyl jasmonate Relative expression levels of the CaBPM4 at different time point were determined in comparison with that(MeJA) in the treatment. control plants Relative at the expression corresponding levels sameof the time CaBPM4 point. at Results different are time presented point were as mean determined means inSD comparison of three independent with that biologicalin the control replicates. plants Smallat the letters corresponding (a–d) represent same significanttime point. di Resultsfferences are ± (ppresented< 0.05). as mean means ± SD of three independent biological replicates. Small letters (a–d) represent significant differences (p < 0.05). 3.5. CaBPM4 Silencing Decreased the Defense Response of Pepper Against P. capsici 3.5.The CaBPM4 expression Silencing of CaBPM4 Decreasedwas the upregulated Defense Response under of abiotic Pepper stresses Against andP. capsici. MeJA and ETH treatments, whileThe ABA, expression SA and H 2ofO 2CaBPM4treatments was as upregulated well as infection under with abiotic the virulentstresses (HX-9)and MeJA and avirulentand ETH (PC)treatments, strains ofwhileP. capsici ABA,downregulated SA and H2O2 treatments its expression. as well To as confirm infection this with finding, the virulent a silencing (HX-9) vector and

Agronomy 2019, 9, x FOR PEER REVIEW 9 of 16

Agronomyavirulent2019 ,(PC)9, 417 strains of P. capsici downregulated its expression. To confirm this finding, a silencing9 of 16 vector was constructed and transformed into the Agrobacterium strain GV3101. Visible photobleaching symptoms were observed in the leaves of CaPDS-silenced pepper seedlings 35 days was constructed and transformed into the Agrobacterium strain GV3101. Visible photobleaching after injection (Figure 6A). The CaBPM4 expression was analyzed by qRT-PCR and significant symptoms were observed in the leaves of CaPDS-silenced pepper seedlings 35 days after injection decrease was found in silenced lines (Figure 6B), confirming the reliability of VIGS in silencing the (Figure6A). The CaBPM4 expression was analyzed by qRT-PCR and significant decrease was found in target gene in pepper. The CaBPM4-silenced seedlings with silencing efficiency over 50% were used silenced lines (Figure6B), confirming the reliability of VIGS in silencing the target gene in pepper. The for the subsequent experiment. CaBPM4-silenced seedlings with silencing efficiency over 50% were used for the subsequent experiment.

Figure 6. Effect of CaBPM4-silencing in pepper plant. (A) Phenotypes of CaBPM4-silenced, TRV2:00 Figure 6. Effect of CaBPM4-silencing in pepper plant. (A) Phenotypes of CaBPM4-silenced, TRV2:00 (negative control) and TRV2:CaPDS (positive control, in which the endogenous phytoene desaturase (negative control) and TRV2:CaPDS (positive control, in which the endogenous phytoene desaturase (PDS) gene was silenced to cause photobleaching), and images were obtained after 35-days inoculation. (PDS) gene was silenced to cause photobleaching), and images were obtained after 35-days (B) Real-Time RT-PCR analysis of CaBPM4 expression levels in TRV2:00 and CaBPM4-silenced line inoculation. (B) Real-Time RT-PCR analysis of CaBPM4 expression levels in TRV2:00 and (#1, #2, and #3 indicate three biological levels of efficiency of CaBPM4 gene silencing) 35 days after CaBPM4-silenced line (#1, #2, and #3 indicate three biological levels of efficiency of CaBPM4 gene inoculation. Relative expression levels of the CaBPM4 were determined in comparison with that in silencing) 35 days after inoculation. Relative expression levels of the CaBPM4 were determined in TRV2:00. Small letters (a, b) represent significant differences (p < 0.05). comparison with that in TRV2:00. Small letters (a, b) represent significant differences (p < 0.05). After inoculation with the PC strain of P. capsici, the expression levels of CaPR1, CaDEF1, CaPO1,After and CaSAR82inoculationwere with elevated. the PC Atstrain 0 h, of the P. expression capsici, the of expression the pathogen-related levels of CaPR1 genes, CaPR1CaDEF1, , CaDEF1CaPO1, ,CaPO1 and CaSAR82, and CaSAR82 were elevated.exhibited At no 0 significanth, the expression difference of betweenthe pathogen-related non-silenced genes plants CaPR1 and , CaBPM4CaDEF1-silenced, CaPO1 plants., and CaSAR82 Significant exhibited increases no insignificant the transcript difference abundances between of non-silencedCaPR1, CaDEF1 plants, and and CaSAR82CaBPM4were-silenced detected plants. at 24Significant h in the non-silencedincreases in the plants, transcript while abundances the increase of in CaPR1 the expression, CaDEF1, ofand defense-relatedCaSAR82 were genes detected was lower at 24 in h the in CaBPM4the non-silenced-silenced plantsplants, compared while the with increase control in plantsthe expression (Figure7). of However,defense-relatedCaPO1 expression genes was was lower downregulated in the CaBPM4 during-silencedP. capsici plantsinfection compared of both withCaBPM4 control-silenced plants and(Figure control 7). plants. However, At 2 CaPO1 day post-PC expression inoculation, was downregulatedCaDEF1 and CaSAR82 during P.showed capsicidownregulation infection of both comparedCaBPM4 with-silenced that at and 1 day, control and significant plants. At di ff2 erenced post-PC were detectedinoculation, in the CaDEF1 expression and level CaSAR82 of CaSAR82 showed betweendownregulation the control compared plants and CaBPM4with that-silenced at 1 d, plants. and Thesignificant expression difference of CaPO1 wereincreased detected at 2in day, the withexpression a significant level high of level CaSAR82 in the CaBPM4between-silenced the control plants. plants Similarly, and after CaBPM4 inoculation-silenced with plants. the HX-9 The strain,expression the expression of CaPO1 levels increased of the at defense-related 2 d, with a significant genes CaPR1 high ,levelCaDEF1 in the, and CaBPM4CaSAR82-silencedwere plants. also upregulatedSimilarly, after 1 day inoculation post-inoculation. with the The HX-9 up-regulation strain, the expression of CaDEF1 levelsand CaSAR82 of the defense-relatedwas significantly genes higherCaPR1 in, non-silencedCaDEF1, and plants CaSAR82 than were in CaBPM4 also upregulated-silenced plants, 1 d whilepost-inoculation.CaPO1 was downregulatedThe up-regulation at 1 of day,CaDEF1 followed and by CaSAR82 an increase was at 2significantly day post-HX-9 higher inoculation. in non-silenced Furthermore, plants after thanP. capsiciin CaBPM4inoculation,-silenced weplants, measured while root CaPO1 activity was in the downregulated silenced and control at 1 plantsd, followed using the by TTC an method. increase Root at activity2 d post-HX-9 in the silencedinoculation. plants Furthermore, was lower than after that P. in capsici control inoculation, plants, and we in measured the case of root the HX-9activity strain, in the a significantsilenced and diffcontrolerence plants was observed using the at 7TTC day method. post-inoculation Root activity between in silencedthe silenced and plants control was plants lower (Figure than8). that in control plants, and in the case of the HX-9 strain, a significant difference was observed at 7 d post-inoculation between silenced and control plants (Figure 8).

Agronomy 2019, 9, x FOR PEER REVIEW 10 of 16 Agronomy 2019, 9, 417 10 of 16 Agronomy 2019, 9, x FOR PEER REVIEW 10 of 16

Figure 7. Silencing of CaBPM4 reduced the expression of defense defense-related genes in pepper at Figure1 d post-inoculation 7. Silencing of CaBPM4 with PCreduced and HX-9 the strains expression of P. capsici of defense. Relative defense-related expression geneslevels inof pepperthe defense at Figure 7. Silencing of CaBPM4 reduced the expression of defense defense-related genes in pepper at 1 daydefense-related post-inoculation genes with at PC different and HX-9 time strains point of P. under capsici .P. Relative capsici expression infection levelswere ofdetermined the defense in 1 d post-inoculation with PC and HX-9 strains of P. capsici. Relative expression levels of the defense defense-relatedcomparison with genes that at diinff erentTRV2:00. time Values point under are thP.e means capsici infection± SD from were three determined independent in comparison experiments. defense-related genes at different time point under P. capsici infection were determined in withSmall that letters in TRV2:00. (a–c) represent Values are significant the means differencesSD from (p three< 0.05). independent experiments. Small letters comparison with that in TRV2:00. Values± are the means ± SD from three independent experiments. (a–c) represent significant differences (p < 0.05). Small letters (a–c) represent significant differences (p < 0.05).

Figure 8. Silencing of CaBPM4 reduced the root activity of pepper post P. capsici inoculation. The root activityFigure parameter 8. Silencing showed of CaBPM4 that the reduced activeness the and root function activity of of roots. pepper (A) post Root P. activity capsici in inoculation.CaBPM4-silenced The root activity parameter showed that the activeness and function of roots. (A) Root activity in andFigure control 8. Silencing plants after of inoculationCaBPM4 reduced with the the PC root strain; activity (B) rootof pepper activity post in CaBPM4 P. capsici-silenced inoculation. and controlThe root CaBPM4-silenced and control plants after inoculation with the PC strain; (B) root activity in plantsactivity after parameter inoculation showed with the that HX-9 the strain. activeness Values and are thefunction means of SDroots. from (A three) Root independent activity in CaBPM4-silenced and control plants after inoculation with the HX-9± strain. Values are the means ± experiments.CaBPM4-silenced Small lettersand control (a–c) represent plants after significant inoculation differences with ( pthe< 0.05). PC strain; (B) root activity in SD from three independent experiments. Small letters (a–c) represent significant differences (p < CaBPM4-silenced and control plants after inoculation with the HX-9 strain. Values are the means ± 3.6. CaBPM40.05). Silencing Enhanced the Defense Response of Pepper against Abiotic Stresses SD from three independent experiments. Small letters (a–c) represent significant differences (p < The above results suggested that the CaBPM4-silenced pepper plants showed reduced tolerance 3.6. CaBPM40.05). Silencing Enhanced the Defense Response of Pepper against Abiotic Stresses. to biotic stress, while the effect of osmotic stress on CaBPM4 silenced pepper plants was unknown. Accordingly,3.6. CaBPM4The above we Silencing studied results Enhanced the suggested effect the of that salt Defense andthe CaBPM4 droughtResponse-silenced on of CaBPM4Pepper pepper against-silenced plantsAbiotic pepper sh Stresses.owed plants reduced and explored tolerance theto possible biotic stress, physiological while the mechanismeffect of osmotic by which stressCaBPM4 on CaBPM4contributes silenced topepper osmotic plants stress was responses unknown. The above results suggested that the CaBPM4-silenced pepper plants showed reduced tolerance inAccordingly, pepper. At 24we h studied post-treatment the effect with of 0.4salt M and NaCl drought (salt treatment), on CaBPM4 the-silenced control (TRV2:00)pepper plants plants and to biotic stress, while the effect of osmotic stress on CaBPM4 silenced pepper plants was unknown. exhibitedexplored more the severepossible wilting physiological compared mechanism with the CaBPM4by which-silenced CaBPM4 plants contributes (Figure 9toA). osmotic Under saltstress Accordingly, we studied the effect of salt and drought on CaBPM4-silenced pepper plants and stress,responsesCaBPM4 in -silencedpepper. At plants 24 h showedpost-treatment a higher with increase 0.4 M in NaCl POD (salt activity treatment), at 6 and 24the h control post-treatment (TRV2:00) explored the possible physiological mechanism by which CaBPM4 contributes to osmotic stress comparedplants exhibited to the control more plantssevere (Figure wilting9C). compared Likewise, with MDA the levels CaBPM4 were-silenced also measured, plants with(Figure MDA 9A). responses in pepper. At 24 h post-treatment with 0.4 M NaCl (salt treatment), the control (TRV2:00) concentrationsUnder salt stress, increasing CaBPM4 in both-silencedCaBPM4 plants-silenced showed plants a higher as well increase as control in POD plants activity increased at 6 and under 24 h plants exhibited more severe wilting compared with the CaBPM4-silenced plants (Figure 9A). saltpost-treatment stress, reaching compared a maximum to atthe 24 control h post-treatment. plants (Figure A lower 9C). increase Likewise, was detectedMDA levels in the silencedwere also Under salt stress, CaBPM4-silenced plants showed a higher increase in POD activity at 6 and 24 h plants,measured, with levels with significantlyMDA concentrations differing increasing from the control in both plants CaBPM4 (Figure-silenced9E). plants as well as control post-treatment compared to the control plants (Figure 9C). Likewise, MDA levels were also plants increased under salt stress, reaching a maximum at 24 h post-treatment. A lower increase was measured, with MDA concentrations increasing in both CaBPM4-silenced plants as well as control detected in the silenced plants, with levels significantly differing from the control plants (Figure 9E). plants increased under salt stress, reaching a maximum at 24 h post-treatment. A lower increase was detected in the silenced plants, with levels significantly differing from the control plants (Figure 9E).

Agronomy 2019, 9, x FOR PEER REVIEW 11 of 16

Similarity, at 6 h post-treatment with 0.4 M mannitol (i.e., drought treatment), the control plants (TRV2:00) also exhibited more serious wilting compared the CaBPM4-silenced plants (Figure 9B). Exposure of the TRV2:00 and TRV2:CaBPM4 lines to drought stress resulted in increased POD activity at 6 and 24 h post-treatment compared with that at 0 h (Figure 9D), and the increases were more substantial for TRV2:CaBPM4 plants than TRV2:00 plants. The opposite trend was observed Agronomyfor MDA2019 , concentration,9, 417 and MDA levels were higher in TRV2:00 plants. Afterwards, 11a ofslight 16 decrease was detected at 48 h post-treatment in both lines (Figure 9F).

Figure 9. Physiological attributes of CaBPM4-silenced and control pepper plants under salt and drought Figure 9. Physiological attributes of CaBPM4-silenced and control pepper plants under salt and stress. (A) Phenotypes of the gene-silenced plants in response to salt stress; (B) phenotypes of the drought stress. (A) Phenotypes of the gene-silenced plants in response to salt stress; (B) phenotypes gene-silenced plants in response to drought stress; (C) the activity of POD after salt stress; (D) the of the gene-silenced plants in response to drought stress; (C) the activity of POD after salt stress; (D) activity of POD after drought stress; (E) MDA concentration after salt stress; (F) MDA concentration the activity of POD after drought stress; (E) MDA concentration after salt stress; (F) MDA after drought stress. Values are the means SD from three independent experiments. Small letters concentration after drought stress. Values± are the means ± SD from three independent experiments. (a–e) represent signiﬁcant diﬀerences (p < 0.05). Small letters (a-e) represent significant differences (p < 0.05). Similarity, at 6 h post-treatment with 0.4 M mannitol (i.e., drought treatment), the control plants (TRV2:00)4. Discussion also exhibited more serious wilting compared the CaBPM4-silenced plants (Figure9B). ExposurePlants of the have TRV2:00 evolved and intricate TRV2:CaBPM4 regulatorylines toand drought defense stress systems resulted that in resist increased biotic POD and activity abiotic atstresses 6 and 24 [46], h post-treatment and the BTB domain compared has withbeen that implic at 0ated h (Figure in plant9D), defense and the and increases environmental were more stress substantialresponses. for Many TRV2: BTB-containingCaBPM4 plants proteins than TRV2:00 participate plants. in The biological opposite regulatory trend was networks, observed for including MDA concentration,transcriptional and regulation, MDA levels protein were degradation, higher in TRV2:00 chromatin plants. remodeling, Afterwards, and acytoskeletal slight decrease regulation was detected at 48 h post-treatment in both lines (Figure9F).

4. Discussion Plants have evolved intricate regulatory and defense systems that resist biotic and abiotic stresses [46], and the BTB domain has been implicated in plant defense and environmental stress responses. Many BTB-containing proteins participate in biological regulatory networks, including Agronomy 2019, 9, 417 12 of 16 transcriptional regulation, protein degradation, chromatin remodeling, and cytoskeletal regulation networks, under adverse environmental conditions [15,47]. Utilizing available whole genome sequences, 80 and 149 members of the BTB gene superfamily have been identified in Arabidopsis thaliana and rice, respectively [44,45]. Moreover, 38 BTB members were found in the tomato plant [26]. Furthermore, six BPMs (BTB-MATH) in Arabidopsis have been observed to assemble with cullins to form complexes [29]. ZmMAB1, a BPM protein in maize can interact with Cullin 3 proteins [33]. Furthermore, wheat BPM protein TaMAB2 functions as part of a CUL3 based ligase complex and involved in CUL3-based degradation [35]. However, very little is known about the effect of genes with BTB domains on the development of pepper. The current study described the characteristic of the newly discovered gene CaBPM4 from the BPM family in the pepper plant. CaBPM4 was inferred to encode a protein containing an N-terminal MATH domain and a C-terminal BTB domain. This novel pepper gene may play an important role in revealing the BPM signaling transduction mechanisms in pepper. The tissue-specific expression patterns of BPM genes have been reported in various species, such as Arabidopsis [48], tomato [26], and rice [49]. However, there is no uniform pattern of gene expression for these BPM genes [17,31]. The qRT-PCR result from the present study showed that CaBPM4 has a high level of expression in leaf and flower tissues. In Arabidopsis, AtBPMs were expressed at a significantly higher level in floral buds and open flowers, and BPM-silenced plants exhibited altered flower development [17]. In tomato, SlBOPs (Solanum lycopersicum BLADE-ON-PETIOLE), which are BTB transcriptional regulators, can interact with the transcription factor TERMINATING FLOWER (TMF) to control inflorescence architecture [50]. This suggests that BTB-containing proteins may participate in flower development processes. P. capsici was also revealed to downregulate CaBPM4 expression, which was contrary to the results of previous research that found rice genes including OsMB9, OsMB10, and OsMB11 show upregulated expression under infection [28]. Few plant species, including Arabidopsis, have shown trends similar to our result. Therefore, the underlying mechanisms of BPM proteins remain elusive and require further investigation. Under abiotic stress, CaBPM4 expression was strongly induced, which is mostly consistent with previous research. In Arabidopsis, BPM1, BPM4, and BPM5 are reported to be upregulated under salt and drought stresses [31]. Kushwaha et al. (2016) [28] also noted that OsMB10 and OsMB11, which encode BPM proteins in rice, showed apparent increases in expression level under salinity and drought stress. Inhibitory effects of exogenous substances, especially ABA, on CaBPM4 expression were observed in the current study, which is unsurprising. In the tomato plant, SlBTB12 was inhibited by ABA across all time points [26]. GMPOZ, a nuclear factor found in soybean, also functions as a repressor of ABA-regulated genes [51]. Treatment with ABA lowered AtBT2 mRNA levels, while MeJA induced AtBT2 expression [18], indicating that BPM proteins can mediate the ABA pathway. AtBPM proteins were also linked to ethylene response. Specifically, AtBPMs can interact with members of the ethylene response factor/Apetala2 (ERF/AP2) transcription factor family [31]. Additionally, the BTB domain is associated with ethylene biosynthesis [52] and the salicylic acid signaling pathway [22,53]. To understand the role of CaBPM4 in the response of pepper plants to stress conditions, VIGS was conducted to silence CaBPM4 expression. In the current study, photobleaching symptoms were observed in the leaves of CaPDS-silenced plants, indicating the reliability of the VIGS assay. After inoculation with P. capsici, the transcript levels of defense-related genes in CaBPM4-silenced pepper plants were lower than those of control plants, and root activity in the silenced plants was also lower than that of control plants. This indicated that CaBPM4 silencing aggravated P. capsici infection in pepper by diminishing the defense system of pepper plants. A similar result was also observed in CabZIP63-silenced plants, where the transcript levels of the defense-related genes CaPR1 and CaDEF1 were significantly lower than those in the control pepper plants under R. solanacearum infection [54]. Similarly, CaPTI1 and CanTF silencing also altered the expression levels of CaPR1 [55], CaDEF1 [56], and CaSAR82 [57] as well as the root activity of silenced plants relative to those in control plants [38,45]. Agronomy 2019, 9, 417 13 of 16

Zhang reported that overexpression of the gene GmBTB increased the transcript levels of GmNPR1 in GmBTB/POZ-OE plants [19]. Another study supporting our results showed that CaPAL1 silencing suppresses CaPR1 expression compared to control plants during Xcv infection [58]. Under infection with Xcv (especially with a virulent strain), CaPO2-silenced plants exhibited signiﬁcantly lower induction of CaDEF1 and CaSAR82 [42]. In contrast, the CaBPM4-silenced plants exposed to drought and salt stress showed enhanced tolerance compared with control plants. Less wilting, higher POD activity, and lower MDA concentration in CaBPM4-silenced plants suggested that CaBPM4 silencing can improve plant tolerance to abiotic stress. In Arabidopsis, BPM-silenced plants showed an improved thermotolerance under high humidity, as shown by a higher survival rate and lower ion leakage after heat shock. AtBPMs can interact with DREB2A, a key transcription factor in both drought and heat stress tolerance [59], and are responsible for DREB2A degradation, thus aﬀecting plant responses to abiotic stress [30]. BPM proteins can also interact with ATHB6, a negative regulator of ABA responses [60], resulting in modulations of ABA signaling and plant responses to cold and salt stresses [17]. BPM proteins can also interact with some other factors that respond to abiotic stress [61]. Collectively, these data suggest a putative BPM function of CaBPM4 in pepper responses to stresses.

5. Conclusions In brief, CaBPM4 encodes a protein containing an N-terminal MATH domain and a C-terminal BTB domain and the amino acid sequence of CaBPM4 was closely related to BPM from potato (Solanum tuberosum). CaBPM4 gene has a higher expression in leaf and flower tissue other than in root, stem, fruit tissue and it was induced by both biotic and abiotic stresses. P. capsici infection resulted in the downregulation of CaBPM4 expression, while salt and drought stress enhanced CaBPM4 expression. CaBPM4 silencing in pepper significantly weakened the defense response by downregulating the expression of defense-related genes and inhibiting root activity under P. capsici infection, while enhancing tolerance to salt and drought stress in CaBPM4-silenced plants. These results suggest that CaBPM4 can respond to different stresses by regulating plant defense systems. Additional research is needed to characterize the detailed mechanism by which CaBPM4 regulates the defense response to biotic and abiotic stress in pepper plants.

Author Contributions: Conceptualization, Y.-M.H. and Z.-H.G.; methodology, Y.-M.H., K.-K.L. and Z.-H.G.; software, Y.-M.H. and G.-X.C.; investigation, Y.-M.H., K.-K.L. and H.-X.Z.; resources, A.-M.W. and Z.-H.G.; data curation, Y.-M.H., M.A.; writing—original draft preparation, Y.-M.H.; writing—review and editing, Y.-M.H. M.A., S.U.H. and Z.-H.G.; funding acquisition, A.-M.W. and Z.-H.G. All authors read and approved the final manuscript. Acknowledgments: This work was supported through funding from the National Key R&D Program of China (No. 2016YFD0101900), the National Natural Science Foundation of China (No. U1603102). Conflicts of Interest: The authors declare no conflict of interest.

References

1. Nguyen, H.T.; Leipner, J.; Stamp, P.; Guerra-Peraza, O. Low temperature stress in maize (Zea mays L.) induces genes involved in photosynthesis and signal transduction as studied by suppression subtractive hybridization. Plant Physiol. Biochem. 2009, 47, 116–122. [CrossRef] 2. Chaves, M.M.; Flexas, J.; Pinheiro, C. Photosynthesis under drought and salt stress: Regulation mechanisms from whole plant to cell. Ann. Bot. 2009, 103, 551–560. [CrossRef] 3. Barber, V.A.; Juday, G.P.; Finney, B.P. Reduced growth of Alaskan white spruce in the twentieth century from temperature-induced drought stress. Nature 2000, 405, 668–673. [CrossRef] 4. Lamour, K.H.; Stam, R.; Jupe, J.; Huitema, E. The oomycete broad-host-range pathogen Phytophthora capsici. Mol. Plant Pathol. 2012, 13, 329–337. [CrossRef] 5. Kim, T.H.; Ok, S.H.; Kim, D.; Suh, S.C.; Ok Byun, M.; Shin, J.S. Molecular characterization of a biotic and abiotic stress resistance-related gene RelA/SpoT homologue (PepRSH) from pepper. Plant Sci. 2009, 176, 635–642. [CrossRef] Agronomy 2019, 9, 417 14 of 16

6. Petrov, V.; Hille, J.; Mueller-Roeber, B.; Gechev, T.S. ROS-mediated abiotic stress-induced programmed cell death in plants. Front. Plant Sci. 2015, 6, 69. [CrossRef] 7. Ambawat, S.; Sharma, P.; Yadav, N.R.; Yadav, R.C. MYB transcription factor genes as regulators for plant responses: An overview. Physiol. Mol. Biol. Plants 2013, 19, 307–321. [CrossRef] 8. Ülker, B.; Somssich, I.E. WRKY transcription factors: From DNA binding towards biological function. Curr. Opin. Plant Biol. 2004, 7, 491–498. [CrossRef] 9. Dang, F.; Wang, Y.; Yu, L.U.; Eulgem, T.; Lai, Y.A.N.; Liu, Z.; Wang, X.U.; Qiu, A.; Zhang, T.; Lin, J.; et al. CaWRKY40, a WRKY protein of pepper, plays an important role in the regulation of tolerance to heat stress and resistance to Ralstonia solanacearum infection ABSTRACT. Plant. Cell Environ. 2013, 36, 757–774. [CrossRef] 10. Huh, S.U.; Choi, L.M.; Lee, G.; Kim, Y.J.; Paek, K. Plant Science Capsicum annuum WRKY transcription factor d (CaWRKYd) regulates hypersensitive response and defense response upon Tobacco mosaic virus infection. Plant Sci. 2012, 197, 50–58. [CrossRef] 11. Abe, H. Role of Arabidopsis MYC and MYB Homologs in Drought-and Abscisic Acid-Regulated Gene Expression. Plant Cell Online 1997, 9, 1859–1868. 12. Sun, X.; Li, Y.; Cai, H.; Bai, X.; Ji, W.; Ding, X.; Zhu, Y. The Arabidopsis AtbZIP1 transcription factor is a positive regulator of plant tolerance to salt, osmotic and drought stresses. J. Plant Res. 2012, 125, 429–438. [CrossRef] 13. Zhou, X.T.; Jia, L.J.; Wang, H.Y.; Zhao, P.; Wang, W.Y.; Liu, N.; Song, S.W.; Wu, Y.; Su, L.; Zhang, J.; et al. The potato transcription factor StbZIP61 regulates dynamic biosynthesis of salicylic acid in defense against Phytophthora infestans infection. Plant J. 2018, 95, 1055–1068. [CrossRef] 14. Fedele, M.; Benvenuto, G.; Pero, R.; Majello, B.; Battista, S.; Lembo, F.; Vollono, E.; Day, P.M.; Santoro, M.; Lania, L.; et al. A novel member of the BTB/POZ family, PATZ, associates with the RNF4 RING finger protein and acts as a transcriptional repressor. J. Biol. Chem. 2000, 275, 7894–7901. [CrossRef] 15. Melnick, A.; Ahmad, K.F.; Arai, S.; Polinger, A.; Ball, H.; Borden, K.L.; Carlile, G.W.; Prive, G.G.; Licht, J.D. In-depth mutational analysis of the promyelocytic leukemia zinc finger BTB/POZ domain reveals motifs and residues required for biological and transcriptional functions. Mol. Cell. Biol. 2000, 20, 6550–6567. [CrossRef] 16. Furukawa, M.; Xiong, Y. BTB Protein Keap1 Targets Antioxidant Transcription Factor Nrf2 for Ubiquitination by the Cullin 3-Roc1 Ligase. Mol. Cell. Biol. 2005, 25, 162–171. [CrossRef] 17. Lechner, E.; Leonhardt, N.; Eisler, H.; Parmentier, Y.; Alioua, M.; Jacquet, H.; Leung, J.; Genschik, P. MATH/BTB CRL3 receptors target the homeodomain-leucine zipper ATHB6 to modulate abscisic acid signaling. Dev. Cell 2011, 21, 1116–1128. [CrossRef] 18. Mandadi, K.K.; Misra, A.; Ren, S.; McKnight, T.D. BT2, a BTB Protein, Mediates Multiple Responses to Nutrients, Stresses, and Hormones in Arabidopsis. Plant Physiol. 2009, 150, 1930–1939. [CrossRef] 19. Zhang, C.; Gao, H.; Li, R.; Han, D.; Wang, L.; Wu, J.; Xu, P.; Zhang, S. GmBTB/POZ, a novel BTB/POZ domain-containing nuclear protein, positively regulates the response of soybean to Phytophthora sojae infection. Mol. Plant Pathol. 2019, 20, 78–91. [CrossRef] 20. He, Q.; Naqvi, S.; McLellan, H.; Boevink, P.C.; Champouret, N.; Hein, I.; Birch, P.R.J. Plant pathogen effector utilizes host susceptibility factor NRL1 to degrade the immune regulator SWAP70. Proc. Natl. Acad. Sci. USA 2018, 115, 201808585. [CrossRef] 21. Boyle, P.; Le Su, E.; Rochon, A.; Shearer, H.L.; Murmu, J.; Chu, J.Y.; Fobert, P.R.; Despres, C. The BTB/POZ Domain of the Arabidopsis Disease Resistance Protein NPR1 Interacts with the Repression Domain of TGA2 to Negate Its Function. Plant Cell 2009, 21, 3700–3713. [CrossRef] 22. Chern, M.S.; Fitzgerald, H.A.; Yadav, R.C.; Canias, P.E.; Aarts, M.G.; Dong, X.; Ronald, P.C. Evidence for a resistance signalling pathway in rice similar to the NPR1-mediated, SA-dependent pathway in Arabidopsis. Plant J. 2001, 27, 101–113. [CrossRef] 23. Makandar, R.; Essig, J.S.; Schapaugh, M.A.; Trick, H.N.; Shah, J. Genetically Engineered Resistance to Fusarium Head Blight in Wheat by Expression of Arabidopsis NPR1. Mol. Plant Microbe Interact. 2006, 19, 123–129. [CrossRef] 24. Lin, W.; Lu, C.; Wu, J.; Cheng, M.; Lin, Y.; Black, L.; Green, S.K.; Wang, J.; Cheng, C. Transgenic tomato plants expressing the Arabidopsis NPR1 gene display enhanced resistance to a spectrum of fungal and bacterial diseases. Transgenic Res. 2004, 13, 567–581. [CrossRef] Agronomy 2019, 9, 417 15 of 16

25. Škrbić,B.; Godula, M.; Durišić-Mladenović,N.; Živanˇcev, J. ARIA, an Arabidopsis Arm Repeat Protein Interacting with a Transcriptional Regulator of Abscisic Acid-Responsive Gene Expression, is a Novel Abscisic Acid Signaling Component. Agron. Res. 2011, 9, 461–468. 26. Li, J.; Su, X.; Wang, Y.; Yang, W.; Pan, Y.; Su, C.; Zhang, X. Genome-wide identification and expression analysis of the BTB domain-containing protein gene family in tomato. Genes Genom. 2018, 40, 1–15. [CrossRef] 27. Kuo, S.P.; Bradley, L.A.; Trussell, L.O. NIH Public Access. Hear. Res. 2010, 29, 9625–9634. 28. Kushwaha, H.R.; Joshi, R.; Pareek, A.; Singla-pareek, S.L. MATH-Domain Family Shows Response toward Abiotic Stress in Arabidopsis and Rice. Front. Plant Sci. 2016, 7, 1–19. [CrossRef] 29. Weber, H. Arabidopsis AtCUL3a and AtCUL3b Form Complexes with Members of the BTB/POZ-MATH Protein Family. Plant Physiol. 2005, 137, 83–93. [CrossRef] 30. Morimoto, K.; Ohama, N.; Kidokoro, S.; Mizoi, J.; Takahashi, F.; Todaka, D.; Mogami, J.; Sato, H.; Qin, F.; Kim, J.S.; et al. BPM-CUL3 E3 ligase modulates thermotolerance by facilitating negative regulatory domain-mediated degradation of DREB2A in Arabidopsis. Proc. Natl. Acad. Sci. USA 2017, 114, E8528–E8536. [CrossRef] 31. Weber, H.; Hellmann, H. Arabidopsis thaliana BTB/POZ-MATH proteins interact with members of the ERF/AP2 transcription factor family. FEBS J. 2009, 276, 6624–6635. [CrossRef] 32. Chen, L.; Bernhardt, A.; Lee, J.; Hellmann, H. Identification of Arabidopsis MYB56 as a novel substrate for CRL3BPM E3 ligases. Mol. Plant 2015, 8, 242–250. [CrossRef] 33. Juranic, M.; Srilunchang, K.O.; Krohn, N.G.; Leljak-Levanic, D.; Sprunck, S.; Dresselhaus, T. Germline-Specific MATH-BTB Substrate Adaptor MAB1 Regulates Spindle Length and Nuclei Identity in Maize. Plant Cell 2012, 24, 4974–4991. [CrossRef] 34. Škiljaica, A. Wheat MATH-BTB Proteins and Their Role in Early Embryogenesis (Proteini MATH-BTB u Pšenice i Njihova Uloga u Ranoj EmbriogeneziI); University of Zagreb: Zagreb, Croatia, 2016. 35. Juranic, M.; Sprunck, S.; Math-btb, T.P.D.Á. De novo zygotic transcription in wheat (Triticum aestivum L.) includes genes encoding small putative secreted peptides and a protein involved in proteasomal degradation. Plant Reprod. 2013, 26, 267–285. 36. Wang, J.E.; Liu, K.K.; Li, D.W.; Zhang, Y.L.; Zhao, Q.; He, Y.M.; Gong, Z.H. A novel peroxidase CanPOD gene of pepper is involved in defense responses to Phytophtora capsici infection as well as abiotic stress tolerance. Int. J. Mol. Sci. 2013, 14, 3158–3177. [CrossRef] 37. Ali, M.; Gai, W.X.; Khattak, A.M.; Khan, A.; Haq, S.U.; Ma, X.; Wei, A.M.; Muhammad, I.; Jan, I.; Gong, Z.H. Knockdown of the chitin-binding protein family gene CaChiIV1 increased sensitivity to Phytophthora capsici and drought stress in pepper plants. Mol. Genet. Genom. 2019, 1–16. [CrossRef] 38. He, Y.; Luo, D.; Khan, A.; Liu, K.; Arisha, M.H.; Zhang, H. CanTF, a Novel Transcription Factor in Pepper, Is Involved in Resistance to Phytophthora capsici as well as Abiotic Stresses CanTF, a Novel Transcription Factor in Pepper, Is Involved in Resistance to Phytophthora capsici as well as Abiotic Stresses. Plant Mol. Biol. Rep. 2018, 36, 776–789. [CrossRef] 39. Guo, M.; Liu, J.; Ma, X.; Zhai, Y.; Gong, Z.; Lu, M. Plant Science Genome-wide analysis of the Hsp70 family genes in pepper (Capsicum annuum L.) and functional identification of CaHsp70-2 involvement in heat stress. Plant Sci. 2016, 252, 246–256. [CrossRef] 40. Palma, M.; Corpas, F.J.; Mateos, R.M.; Bonilla-valverde, D.; Rı, L.A. Physiologia Plantarum NADP-dehydrogenases from pepper fruits: Effect of maturation. Physiol. Plant. 2009, 135, 130–139. 41. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2 ∆∆CT method. Methods 2001, 25, 402–408. [CrossRef] − 42. Choi, H.W.; Kim, Y.J.; Lee, S.C.; Hong, J.K.; Hwang, B.K. Hydrogen peroxide generation by the pepper extracellular peroxidase CaPO2 activates local and systemic cell death and defense response to bacterial pathogens. Plant Physiol. 2007, 145, 890–904. [CrossRef] 43. Beffa, R.; Martin, H.V.; Pilet, P. Oxidases and Peroxidases from Maize Roots. Plant Physiol. 1990, 94, 485–491. [CrossRef] 44. Buege, J.A.; Aust, S.D. Microsomal lipid peroxidation. J. Phys. Conf. Ser. 1978, 52, 302–310. 45. Jin, J.H.; Zhang, H.X.; Tan, J.Y.; Yan, M.J.; Li, D.W.; Khan, A.; Gong, Z.H. A New Ethylene-Responsive Factor CaPTI1 Gene of Pepper (Capsicum annuum L.) Involved in the Regulation of Defense Response to Phytophthora capsici. Front. Plant Sci. 2016, 6, 1–12. [CrossRef] Agronomy 2019, 9, 417 16 of 16

46. Choi, H.W.; Hwang, B.K. The pepper extracellular peroxidase CaPO2 is required for salt, drought and oxidative stress tolerance as well as resistance to fungal pathogens. Planta 2012, 235, 1369–1382. [CrossRef] 47. Lee, D.K.; Shic Kim, Y.; Kim, J.K. Determination of the optimal condition for ethylmethane sulfonate-mediated mutagenesis in a Korean commercial rice, Japonica cv. Dongjin. Appl. Biol. Chem. 2017, 60, 241–247. [CrossRef] 48. Gingerich, D.J.; Gagne, J.M.; Salter, D.W.; Hellmann, H.; Estelle, M.; Ma, L.; Vierstra, R.D. Cullins 3a and 3b Assemble with Members of the Broad Complex/Tramtrack/Bric-a-Brac (BTB) Protein Family to Form Essential. J. Biol. Chem. 2005, 280, 18810–18821. [CrossRef] 49. Gingerich, D.J.; Hanada, K.; Shiu, S.H.; Vierstra, R.D. Large-Scale, Lineage-Specific Expansion of a Bric-a-Brac/Tramtrack/Broad Complex Ubiquitin-Ligase Gene Family in Rice. Plant Cell Online 2007, 19, 2329–2348. [CrossRef] 50. Xu, C.; Park, S.J.; Van Eck, J.; Lippman, Z.B. Control of inflorescence architecture in tomato by BTB/POZ transcriptional regulators. Genes Dev. 2016, 30, 2048–2061. [CrossRef] 51. Woodger, F.J.; Jacobsen, J.V.; Gubler, F. GMPOZ, a BTB/POZ domain nuclear protein, is a regulator of hormone responsive gene expression in barley aleurone. Plant Cell Physiol. 2004, 45, 945–950. [CrossRef] 52. Levin, S.; Hartl, D.; Clark, A.; Petrov, D.; Bustamante, C.; Garwin, L.; Friedman, N. Regulation of ethylene gas biosynthesis by the Arabidopsis ETO1 protein. Nature 2004, 428, 945–950. 53. Wu, Q.; Wang, X.Z.; Tang, Y.Y.; Yu, H.T.; Ding, Y.F.; De Yang, C.; Cui, F.G.; Zhang, J.C.; Wang, C.T. Molecular cloning and characterization of NPR1 gene from Arachis hypogaea. Mol. Biol. Rep. 2014, 41, 5247–5256. [CrossRef] 54. Shen, L.; Liu, Z.; Yang, S.; Yang, T.; Liang, J.; Wen, J.; Liu, Y.; Li, J.; Shi, L.; Tang, Q.; et al. Pepper CabZIP63 acts as a positive regulator during Ralstonia solanacearum or high temperature-high humidity challenge in a positive feedback loop with CaWRKY40. J. Exp. Bot. 2016, 67, 2439–2451. [CrossRef] 55. Kim, Y.J.; Hwang, B.K. Pepper gene encoding a basic pathogenesis-related 1 protein is pathogen and ethylene inducible. Physiol. Plant. 2000, 108, 51–60. 56. Do, H.M.; Lee, S.C.; Jung, H.W.; Sohn, K.H.; Hwang, B.K. Differential expression and in situ localization of a pepper defensin (CADEF1) gene in response to pathogen infection, abiotic elicitors and environmental stresses in Capsicum annuum. Plant Sci. 2004, 166, 1297–1305. 57. Lee, S.C.; Hwang, B.K. Identification of the pepper SAR8. 2 gene as a molecular marker for pathogen infection, abiotic elicitors and environmental stresses in Capsicum annuum. Planta 2003, 216, 387–396. 58. Kim, D.S.; Hwang, B.K. An important role of the pepper phenylalanine ammonia-lyase gene (PAL1) in salicylic acid-dependent signalling of the defence response to microbial pathogens. J. Exp. Bot. 2014, 65, 2295–2306. [CrossRef] 59. Nakashima, K.; Ito, Y.; Yamaguchi-shinozaki, K. Transcriptional Regulatory Networks in Response to Abiotic Stresses in Transcriptional Regulatory Networks in Response to Abiotic Stresses in Arabidopsis and Grasses 1. Plant Physiol. 2009, 149, 88–95. [CrossRef] 60. Himmelbach, A.; Hoffmann, T.; Leube, M.; Höhener, B.; Grill, E. Homeodomain protein ATHB6 is a target of the protein phosphatase ABI1 and regulates hormone responses in Arabidopsis. EMBO J. 2002, 21, 3029–3038. [CrossRef] 61. Lin, R.; Park, H.; Wang, H. Role of Arabidopsis RAP2. 4 in Regulating Light- and Ethylene-Mediated Developmental Processes and Drought Stress Tolerance. Mol. Plant 2008, 1, 42–57. [CrossRef]

© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).