Bound Transcriptional Activators Transcriptional Oter-Bound Ser Award Seraward 1,2,3* 1,2,3* on Atvtr

Page 1of23 between this versionandtheVersionrecord. Pleasecitethis articleasdoi:10.1002/pro.2951. through thecopyediting, typesetting, paginationandproofreadingprocess, whichmayleadtodifferences This istheauthormanuscript acceptedforpublicationandhasundergone full peerreviewbuthasnotbeen 1. Life Sciences Institute, University of Michigan, Institute,University of Life Sciences 1. AmandaDugan prom of targets cellular directthe capturing TRIC: BriefCommunication Kai Thomas Emil 2015 of the winner the is AnnaMapp author: *Corresponding Michigan, of University Department of Chemistry, 3. ofMichi University Biology, Chemical in Program 2. Accepted Article 1,2 , Rachel Pricer Rachel , [email protected] [email protected] This article isprotected by copyright. All rights reserved. 1,2 , Micah Katz, and Anna MappK. Katz, Micah ,

Protein Science Ann Arbor, Michigan, United States States United Arbor, Ann Michigan, Ann Arbor, Michigan, United States States United Arbor, Ann Michigan, gan, Ann Arbor, Michigan, United States States United Arbor, gan,Ann Michigan, oter-bound transcriptional activators transcriptional oter-bound ser Award serAward 1,2,3* 1,2,3* on atvtr. e eosrt ta ti tne r tandem this that demonstrate We activators. bound transcription factor TBP at the GAL1 promoter in li in GAL1 promoter the at TBP factor transcription interaction the capture to able is approach (TRIC) inves to (Bpa) pbenzoylLphenylalanine acid amino sitespecifi the with together ChIP of crosslinking that strategy this of expansion an describe we Here hs cmlxs ht ev a te ciao binding activator the as serve that complexes these b promoter, the to activators by recruited are that ( immunoprecipitation chromatin and colocalization complexes required for gene expression to occur. H occur. to expression gene for required complexes a dynamic the coordinate activators Transcriptional Abstract Toward this goal, goal, this Toward activator PPIs that underpin this process has been been has process this underpin that PPIs activator transcr the of components individual and activators proteinp of formation the through occurs this that wit promoters individual at machine transcriptional directi in essential are activators Transcriptional promot GAL1 at thefactor TBP transcription general tran the of interactions protein direct the capture p-benzoyl-L-phenylal chro and acid, with amino photocrosslinking incorporated capture chemical covalent crosslinking amino acids has emerged as animportan as emerged has acids amino crosslinking Accepted Article n vivo in This article isprotected by copyright. All rights reserved. oaet hmcl atr wt gntcly incorpo genetically with capture chemical covalent John Wiley& Sons Protein Science ut distinguishing the individual subunits within within subunits individual the distinguishing ut rotein interactions (PPIs) between DNAbound DNAbound between (PPIs) interactions rotein technically challenging. technically c, irreversible crosslinking of the nonnatural nonnatural the of crosslinking irreversible c, hin the genome. Though it is well understood well is it Though genome. the hin ve yeast.ve iptional machinery, resolving the network of of network the resolving machinery, iptional polymerase RNA the of assembly the ng of the viral activator VP16 and the general general the and VP16 activator viral the of ChIP) studies have identified the complexes complexes the identified have studies ChIP) utilizes the rapid, reversible formaldehyde formaldehyde reversible rapid, the utilizes t tool in the identification of PPIs in cells. in of PPIs identification the in tool t partner(s) partner(s) iae h drc, n io Ps f DNA of PPIs vivo in direct, the tigate matin immunoprecipitation (ChIP) to (ChIP) immunoprecipitation matin eversible and irreversible crosslinking crosslinking irreversible and eversible citoa atvtr P6 ih the with VP16 activator scriptional ere we combine the power of power the combine we ere er in live yeast. yeast. live erin ssembly of multi-protein coactivator coactivator multi-protein of ssembly anine (Bpa), a genetically genetically a (Bpa), anine n vivo in a nt en possible. been not has 1 For example, example, For ae photo rated in vivoin in vivo in 25

Page 2of23 Page 3of23 position. Furthermore, work from our group has demo has group our from work Furthermore, position. promoter contexts such as GAL1. A significant body significant A GAL1. as such contexts promoter this, our previous work showed a robust and repeata and robust a showed work previous our this, maintainin in involved be to shown been has residue in which the activator is not directly involved in directlyin not involved activator is the which in wi interactions via mediated is GAL1 to recruitment ntae ee xrsin a vr sgiiaty fro significantly vary can expression gene initiate multiprotei of the compositions and Theidentities motif. activation VP16 extended the of half terminal amino descri previously As identities. their determine to bind captured covalently The incorporation. of site partner protein any with bond covalent irreversible system. usi VP16 of (TAD) domain activation transcriptional Bpa acid amino unnatural photolabile the approach, directl VP16 if determine to used first was capture re TBP of mechanisms two the between distinguish To neato bten P6 n TBP. and VP16 between interaction mechanism by which TBP arrives at promoters is stil is promoters at arrives TBP which by mechanism VP activator transcriptional canonical the by (TBP) th example, an As defined. poorly remain PPIs these individual the determining for appropriate methods 2 We chose to incorporate Bpa at position 444 in the in 444 position at Bpa incorporate to chose We 18,19 Accepted Bpa light, UV with yeast live of irradiation Upon Article This article isprotected by copyright. All rights reserved. 1013 John Wiley& Sons Protein Science However, TBP recruitment. TBP bed, we used a chimeric activator in which the the which in activator chimeric a used we bed, n complexes that assemble at genes in order to to order genesin at assemble that complexes n ing partners can then be isolated and analyzed analyzed and isolated be then can partners ing pooe t promoter. to promoter m s that are in direct contact with VP16 at the the at VP16 with contact direct in are that s ble multiprotein crosslinking profile at this this at profile crosslinking multiprotein ble domain is fused to the LexA DNA binding binding DNA LexA the to fused is domain g activator interactions and, consistent with consistent and, interactions activator g contacts made by activators at a promoter, promoter, a at activators by made contacts th the SAGA complex, supporting a model model a supporting complex, SAGA the th l contested, even in the case of wellstudied wellstudied of case the in even contested, l 16 has been studied extensively, yet the the yet extensively, studied been has 16 nstrated that incorporation at this site does site this at incorporation that nstrated y contacts TBP in living yeast. In this this In yeast. living in TBP contacts y of of n vivo in ng an engineered nonsense suppression suppression nonsense engineered an ng e recruitment of TATAbinding protein protein TATAbinding of recruitment e is genetically incorporated into the the into incorporated genetically is in vitro in rimn, n io oaet chemical covalent vivo in cruitment, VP16N (413456) subdomain, as this as subdomain, (413456) VP16N ChIP studies suggest that TBP TBP that suggest studies ChIP 1417 data exists to support a direct direct a support to exists data s ciae ad om an forms and activated is

69 Due to a lack of of lack a to Due presence of a covalently bound VP16TBP species. I species. VP16TBP bound covalently a of presence idn a ti site. this at binding biochemical data, our results indicate that this si this that indicate results our data, biochemical SDSPAGE and the resulting Western blot was probed probed was blot Western resulting the and SDSPAGE protein bound noncovalently any away washing After immuno lysates the and lysed then were Yeast VP16. covale and Bpa activate to light UV with irradiated oan L3P n F4P ta aoihs ciiy a activity specific [Fig. is interaction this indicatingthat abolishes that F442P) and (L439P domain a of introduction reports, previous with Consistent indicates data This 2(A)]. [Fig. TBP and construct additi the to corresponds that kDa 60 approximately not impair activator function. activator impair not of different promoterlocalized and nonDNA bound V bound nonDNA and promoterlocalized different of cros the words, other In context. one any on report VP between interaction direct a demonstrating While in dynamic exchange with other transcriptional prot transcriptional other with exchange dynamic in residues that suggest data Biochemical out. carried covalent interaction, this substantiate further To vivo. B rsle i a rslnig BP6 dut [Fig adduct TBPVP16 crosslinking a in resulted TBP th found We experiments. capture chemical covalent was 114 position at leucine the which in construct 24 Accepted Article 2224 e hrfr cxrse Lx+P6 T lnsd a alongside WT LexA+VP16 coexpressed therefore We This article isprotected by copyright. All rights reserved. 2 LexA+VP16 L444Bpa was expressed in yeast and the c the and yeast in expressed was L444Bpa LexA+VP16 John Wiley& Sons Protein Science 2(A)]. chemical capture in which TBP is the captor was was captor the TBPis which in capture chemical te on TBP is indeed a contact point for VP16 in in VP16 for point contact a indeed is TBP on te double point mutation in the VP16 activation activation VP16 the in mutation point double that VP16 directly contacts TBP in live yeast. live in TBP contacts directly VP16 that slinked species likely originate from a variety variety a from originate likely species slinked along the concave face of TBP are involved involved are TBP of face concave the along eins, including activators, which compete for compete which activators, including eins, ntly capture any proteins directly contacting contacting directly proteins any capture ntly 20,21 mutated to Bpa (L114Bpa) and carried out out carried and (L114Bpa) Bpa to mutated 16 and TBP, the above experiments do not not do experiments above the TBP, and 16 precipitated with an antibody against TBP. TBP. against antibody an with precipitated s, the immunoprecipitated TBP was run on on run TBPwas immunoprecipitated the s, at incorporation of Bpa at this position in position this at Bpa of incorporation at ve molecular weight of the LexA+VP16 LexA+VP16 the of weight molecular ve ndeed, a crosslinked band is observed at observed is band crosslinked a ndeed, P16 species. We next chose to design a a design to chose next We species. P16

with a FlagHRP antibody to detect the the detect to antibody FlagHRP a with . 2(B)]. Thus, in support of previous previous of support in Thus, 2(B)]. . lso abrogates crosslinking to TBP, TBP, to crosslinking abrogates lso mycTBP mycTBP ells were were ells Page 4of23 Page 5of23 buffer, whereas the Bpa crosslinks are irreversible are crosslinks Bpa the whereas buffer, immunoprecipitati chromatin classic from principles t h GL pooe peet n h yat tan T strain. yeast the in present promoter GAL1 the at dir the for allow would that method straightforward specifically, the formaldehyde crosslinks can be re be can crosslinks formaldehyde the specifically, are that bonds covalent the of nature the in rooted advantage The complexes. o transcription immobilized of targets direct the crosslink sitespecifically c chemical covalent our to subjected then are cells stabilize rapidly to cells to administered first is formaldehyde stabilization of promoterbound protei promoterbound of stabilization formaldehyde which in under conditions visualized only could be immunoprecipitation during copurified that DNA the 2(C) [Fig. lysate yeast in interaction this capture fra DNA the in crosslink VP16TBP a observe to able formald both where conditions under only that found irrevers and reversible tandem our executed we When visu be and able to intact coactivatorinteractions only leaving reversed, then are complexes isolated thi in interest, of protein the against out carried solubilized be then could DNA the ChIP, to Similar extensively pellet the wash ye and pellet, containing the lyse could we treatment, crosslinking tandem Accepted Article This article isprotected by copyright. All rights reserved. John Wiley& Sons Protein Science s case TBP. The formaldehyde crosslinks on the the on crosslinks formaldehyde The TBP. case s alized via Western blotting (Fig. 1). 1). blotting(Fig. Western via alized ]. When this protocol was repeated to examine examine to repeated was protocol this When ]. dynamic proteinDNA interactions. The fixed fixed The interactions. proteinDNA dynamic adily reversed in an appropriately nucleophilic nucleophilic appropriately an in reversed adily under such treatment conditions. Thus, after Thus, conditions. treatment such under apture workflow in order to activate Bpa and Bpa activate to order in workflow apture formaldehyde was present. This indicates that that indicates This was present. formaldehyde ect examination of the VP16TBP interaction interaction VP16TBP the of examination ect to remove any nonDNA bound complexes. complexes. bound nonDNA any remove to omd y ah rslnig oey more moiety; crosslinking each by formed the irreversible photocrosslinked activator photocrosslinked irreversible the on (ChIP) protocols in which formaldehyde formaldehyde which in protocols (ChIP) on ehyde and UV treatment were used were we we were used were treatment UV and ehyde ns is required to observe the interactions of of interactions the observe to required is ns ur Bpacontaining activators within the the within activators Bpacontaining ur ction, whereas UV alone was sufficient to to sufficient was alone UV whereas ction, , we observed that the GAL1LacZ gene gene GAL1LacZ the that observed we , of this tandem crosslinking approach is is approach crosslinking tandem this of via sonication and immunoprecipitation immunoprecipitation and sonication via ible crosslinking (TRIC) approach, we we approach, (TRIC) crosslinking ible he first step of this strategy borrows borrows strategy this of step first he s, slt te noul chromatin insoluble the isolate ast, rti bss n re t ahee ufcet crossl sufficient achieve to order in basis protein interaction using previously reported oneminute ra oneminute reported previously using interaction We crosslinking. formaldehyde of duration the was ap this for order in required were areas several in t of hybrid a is protocol the although that note We [Fig.2(E)]. interacti proteinprotein direct a observing indeed our to colocalize TBP and LexA+VP16 both that show exec we Finally, 2(D)]. [Fig. activators DNAbound cell lysis and yielded maximal protein release protein t in yieldedmaximal celllysisand with disruption mechanical extended only that found lysi of extent the assessing visually by as well as c total the measuring by condition each under lysis complete most the with us provide would that method and reagents lysis chemical available commercially the of lanes treated UV the in bands cellular contaminating their release would fraction insoluble the incomplete of conditions under that found We open. c tough a have Yeast fraction. chromatincontaining of extent the involved study this for optimization lehr, omleye rslnig piiain w optimization crosslinking formaldehyde elsewhere, ach to used be could that interval shortest the was that found and times treatment formaldehyde several Accepted Article This article isprotected by copyright. All rights reserved. John Wiley& Sons Protein Science he cell lysate. hecelllysate. s by monitoring cells under a microscope. We We microscope. a under cells monitoring by s on at this specific location in the yeast genome genome yeast the in location specific this at on proach to work. The first point of optimization optimization of point first The work. to proach yeast lysis prior to sonication of the insoluble the of sonication to prior lysis yeast wo powerful approaches, optimization efforts optimization approaches, powerful wo oncentration of protein released in the lysate lysate the in released protein of oncentration pid mixing protocols. mixing pid ell wall that is notoriously difficult to break break to difficult notoriously is that wall ell lysis, any remaining cells that pelleted with pelleted that cells remaining any lysis, nig results. inking ieve consistent results. As has been noted noted been has As results. consistent ieve mechanical lysis conditions to determine a determine to conditions lysis mechanical five minute treatment with formaldehyde formaldehyde with treatment minute five Western. We thus screened a number of of number a screened thus We Western. contents upon sonication, resulting in in resulting sonication, upon contents yeast lysis. We evaluated the efficacy of of efficacy the evaluated We lysis. yeast ill have to be examined on an individual individual an on examined be to have ill glass beads consistently achieved >95% >95% achieved consistently beads glass uted a straightforward ChIP protocol to to protocol ChIP straightforward a uted reporter gene and confirm that we are are we that confirm and gene reporter were unable to observe a VP16TBP VP16TBP a observe to unable were 26,27 nte ky on of point key Another 25 We therefore tested tested therefore We Page 6of23 Page 7of23 promoters has remained elusive, even in the most we most the in even elusive, remained has promoters pr individual at activator of a single interactions to technologies microarray DNA with TRIC combining as interactions activator of picture complete more pro single a at activators of map PPI the resolving promoter. this at residency TBP stabilizing in SAGA TBP for required is SAGA that observations earlier di a suggest thus results our While promoter. GAL1 yeastt in TBP contacts directly VP16 that suggests Bpacontaining the with contact direct in were that factorDNA transcription stabilize to able were we the complexes, transcriptional requisite other with f required factor transcription essential an is TBP has of knowledge, our best the to that, resolution multi DNAbound a within protein given a of targets amino photocrosslinking sitespecific a of use the and formaldehyde using those as (such applications o strategy this of advantage The promoter. GAL1 the as demo activators, bound DNA of PPIs the capturing tand vivo in new a described have we conclusion, In Accepted Article This article isprotected by copyright. All rights reserved. John Wiley& Sons Protein Science omoters across the genome. genome. across the omoters not been achieved prior to this work. this to prior beenachieved not or gene expression in yeast, yet, as is the case the is as yet, yeast, in expression gene or o recruit the general transcription factor to the the to factor transcription general the recruit o moter, work that will be useful in building a building in useful be will that work moter, contacts and then covalently capture proteins proteins capture covalently then and contacts disuccinimidyl suberate, for example) is that is example) for suberate, disuccinimidyl localization to GAL1 likely point a role for for role a point likely GAL1 to localization This work is an important first step toward toward step first important an is work This cd los n t dsigih h direct the distinguish to one allows acid a whole. Future work will be focused on on focused be will work Future whole. a ciao V1 i lv yat Ti work This yeast. live in VP16 activator nstrated by the capture of VP16 and TBP at andTBP of VP16 capture the by nstrated mechanism by which it is recruited to to recruited is it which by mechanism llstudied promoter contexts. Using TRIC, Using contexts. promoter llstudied in useful is that approach crosslinking em ver previously described dual crosslinking crosslinking dual described previously ver rect mechanism of recruitment to GAL1, GAL1, to recruitment of mechanism rect protein complex. This allows a level of of level a allows This complex. protein facilitate the identification of the direct the of identification the facilitate plasmid sequences was performed by the University o University the by performed sequences was plasmid pLexAVP16N 444TAG 444TAG pLexAVP16N backbone containing BamHI and SalI sites. Primers Primers sites. SalI and BamHI containing backbone pLexA+VP16N WT WT pLexA+VP16N plasmids of Construction t biology molecular standard using constructed were D (Wood International ChemImpex from purchased was [JPY9::pZZ41, [JPY9::pZZ41, experiments TRIC and capture chemical covalent All and Materials Methods eind o ae 1 bss f oooy n ihr sid either on homology of bases ~15 have to designed TAD. VP16N or VP16C the within codon TAG with codon w mutagenesis sitedirected plasmid, each create To ligati via created was promoter ADH1 the of control (4 LexA(1202)+VP16N expressing plasmid copy high A and BamHI and treated with calf intestinal phosphat calf intestinal with and treated andBamHI in and BamHI and SalI with digested was product PCR agatAGCCCCACAGC3 ad 5’ and pCLexAV a from (413456) VP16 amplify to used were catGTCGACTTACTTGTCATCGTCGTCCTTGTAGTCTCCCGGCCCCGGGGA catgaattcATGGCCCCCCCGACCGATGTC3’ Accepted Article Mat

his3 This article isprotected by copyright. All rights reserved. 200 leu2 200 John Wiley& Sons 1 trp1 1 Protein Science 63 ura3-52 lys2 ura3-52 63 e to create pLexA+VP16N WT5X Flag. Flag. WT5X create e pLexA+VP16N to on of the fusion gene into a pCLexA5xflag pCLexA5xflag a into gene fusion the of on f Michigan Core Facility (Ann Arbor, MI). MI). (AnnArbor, Facility Core fMichigan as used to replace an existing amino acid acid amino existing an replace to used as echniques. Sanger sequencing verifying verifying sequencing Sanger echniques. were carried out in yeast strain LS41 LS41 strain yeast in out carried were serted into pCLexA digested with SalI SalI with digested pCLexA into serted ale, IL). All plasmids used in this study study this in used plasmids All IL). ale, e of the TAG mutation. QuikChange QuikChange mutation. TAG the of e 1xlg template. P161xflag 13456)+5x FLAG tag under the the under tag FLAG 13456)+5x In general, PCR primers were were primers PCR general, In 385 gal4 gal4 385 URA::pZZ41]. Bpa URA::pZZ41].

The amplified amplified The ATCCC3’ ATCCC3’ 5’ 5’ Page 8of23 Page 9of23 conditions. recommended incorporate to used was CA) Jolla, La (Stratagene, Accepted Article This article isprotected by copyright. All rights reserved. John Wiley& Sons Protein Science the TAG mutants using manufacturer manufacturer using mutants TAG the rvosy described. previously biology techniques. The mycpGADT7 cloning vector w vector cloning mycpGADT7 The techniques. biology pGADT7 mycTBP mycTBP pGADT7 NaCl, 1 mM EDTA, 1% Triton X100, 0.1% NaDeoxychol 0.1% X100, Triton 1% EDTA, mM 1 NaCl, 3’) 3’) AGCTATGGAACAAAAGTTGATTTCTGAAGAAGATTTGGGATCCAATGCATA mutage sitedirected using (Clontech) pGADT7 in tag In vivo covalent chemical capture experiments for p for experiments capture chemical covalent vivo In capture chemical Invivo covalent Protocol). (QiagenQuikchange sto amber an to mutagenized was TBP in Leu114 3’). AGCTTGATCATATGCATTGGATCCCAAATCTTCTTCAGAAATCAACTTTTG catCATATGATGGCCGATGAGGAACGTTTAAAGG3’) and (5’ (5’ NdeI with and digested vector mycpGADT7 a into ligated purifi The 3’). atgCTCGAGTCACATTTTTCTAAATTCACTTAGC catCATATGATGGCCGATGAGGAACGTTTAAAGG3’) yeast from TBP encoding sequence DNA the amplifying Nterminal an expressing pGADT7 plasmid copy high A For lysis, cells were resuspended in 600 L Lysis b Lysis L 600 in resuspended were cells lysis, For media SC in grown were cells that except identical h lst ws eltd n te uentn incubat supernatant the and pelleted was lysate the gla using lysed and (Roche) Inhibitor Protease Free Accepted Article 2 For crosslinking studies with mycTBP L114Bpa, the the L114Bpa, mycTBP with studies crosslinking For This article isprotected by copyright. All rights reserved. John Wiley& Sons Protein Science and uffer (50 mM HEPESKOH pH 7.5, 140 mM mM 140 7.5, pH HEPESKOH mM (50 uffer ss beads by vortexing at 4°C. Subsequently, Subsequently, 4°C. at vortexing by beads ss LexA+VP16N L444Bpa was carried out as as out carried was L444Bpa LexA+VP16N ed with 2 g of LexA antibody (sc1725, (sc1725, antibody LexA of g 2 with ed lacking histidine, leucine, and tryptophan. tryptophan. and leucine, histidine, lacking p codon using sitedirected mutagenesis mutagenesis sitedirected using codon p ei wt te olwn pies (5’ primers: following the with nesis as created by inserting a cmyc epitope epitope cmyc a inserting by created as ly myctagged TBP was constructed by by constructed was TBP myctagged ly and XhoI using standard molecular molecular standard using XhoI and genomic DNA using primers (5’ (5’ primers using DNA genomic ate and 2X Complete Mini, EDTA Mini, Complete 2X and ate d C pout was product PCR ed procedure was was procedure TTCCAT TGATCT (5’ Page 10of23 Page 11of23 h bas y etn a 95 at heating by beads the ee nuae oengt t 0C ih gtto and agitation with 30°C at overnight incubated were N 1M in dissolved pBpa mM 100 of mL 1 Galactose, 2% grow were yeast of cultures mL 100 TRIC, perform To crosslinking irreversible reversibleand Tandem Louis,MO). (Sigma, St. antibody FLAG(M2) usin probed and DTT mM 250 containing CA) Carlsbad, Cultures receiving UV treatment only were spun down spun were only treatment UV receiving Cultures nedd o diinly eev U cosikn we crosslinking UV receive additionally to intended lacking media SC mL 50 with washed and mL centrifuged 15 with quenched then were Cultures incubation. incubat formaldehyde minute 5 a with procedure this remain to allowed and culture the to directly added treatment, formaldehyde only receiving cultures For (Euroso light nm 365 at UV irradiation to subjected transfe and Galactose 2% Raffinose, 2% + tryptophan in resuspended were pellets cell These w tryptophan. washed were pellets cell the which following min. and 1 mM EDTA) and stored dry at 80 at dry stored and EDTA) mM 1 and LiCl, mM 250 8.0, pH TrisHCl mM (10 Buffer Wash mL CA Carlsbad, Invitrogen, Corporation, (Dynal slurry 50 with h 1 for incubation by isolated was antibody immu for 4°C at h 2 for Biotechnologies) Cruz Santa Accepted Article This article isprotected by copyright. All rights reserved. o fr 0 i i NPG 4 LS ape ufr (Invitr buffer Sample LDS 4x NuPAGE in min 10 for C John Wiley& Sons o Protein Science C until elution. The crosslinked sample was eluted eluted was sample crosslinked The elution. until C lar 15 W UV lamp) with cooling for 0.5 h. h. 0.5 cooling for with UV lamp) W lar 15 L of prewashed protein G magnetic beads beads magnetic G protein prewashed of L in the incubator for 20 minutes. Repeat of of Repeat minutes. 20 for incubator the in ) and the beads were washed 6 times with 1 with times 6 washed were beads the and ) ion yielded the same results as a 20 minute minute 20 a as results same the yielded ion 3 mL of 37% formaldehyde solution was was solution formaldehyde 37% of mL 3 re resuspended in 2 mL SC media (His, (His, media SC mL 2 in resuspended re noprecipitation. The protein bound to the to bound protein The noprecipitation. rw t mdlg hs (OD phase midlog to grown 2mL SC media lacking histidine and and histidine lacking media SC 2mL by centrifuging at 3901 rcf at 4at rcf 3901 at centrifuging by n in SC media containing 2% Raffinose, Raffinose, 2% containing media SC in n aOH, and 1 mL 1M HCl. The cultures cultures The HCl. 1M mL 1 and aOH, rd o ml cl clue ihs and dishes culture cell small to rred t S mda akn hsiie and histidine lacking media SC ith 0.5% NP40, 0.1% NaDeoxycholate NaDeoxycholate 0.1% NP40, 0.5% Wsen lt nlss sn anti using analysis Blot Western g of 2M Glycine. Cells were then then were Cells Glycine. 2M of histidine and tryptophan. Samples Samples tryptophan. and histidine 660 o C for 5 5 for C ~1.0). ~1.0). ogen, ogen, from beads were washed 6 times with 1 mL Wash Buffer (10 Buffer Wash mL 1 with times 6 washed were beads bound to the antibody was isolated by incubation fo incubation by isolated was antibody the to bound NaDeoxychol 0.1% X100, Triton 1% EDTA, mM 1 NaCl, pH 7.5, 1M NaCl, 1 mM EDTA, 1% Triton X100, 1% Na 1% X100, Triton 1% EDTA, mM 1 NaCl, 1M 7.5, pH 0.5% NP40, 0.1% NaDeoxycholate and 1 mM EDTA) and EDTA) mM 1 and NaDeoxycholate 0.1% NP40, 0.5% magnetic beads (Dynal Corporation, Invitrogen, Carl Invitrogen, Corporation, (Dynal beads magnetic h cosikd ape a eue fo te ed an beads the from eluted was sample crosslinked The For lysis, cells were resuspended in 600 L Lysis b Lysis L 600 in resuspended were cells lysis, For 0.5h. (Eur light UV nm 365 at irradiation UV to subjected and Galactose 2% and Raffinose 2% containing Trp) iue a 1,0 rm Epnof 47) Slbe c Soluble s 5417C). cruz, (santa antibody TBP (Eppendorf with immunoprecipitated rpm 14,000 at minutes Samples 500). Model Dismembrator Scientific Fisher wit minutes 2 for 10% of setting a at sonicated and standa µL 600 in resuspended were Pellets (Roche)). Complete 2X and NaDeoxycholate 0.1% X100, Triton 7.5, pH HEPESKOH mM (50 buffer ChIP standard with with 4x washed then was pellet remaining The 4°C. cr (santa antibody TBP uL 8 with immunoprecipitated du lysis cell by caused signal background eliminate studies these in found We observed. was lysis >95% gla using lysed and (Roche) Inhibitor Protease Free Accepted Article This article isprotected by copyright. All rights reserved. John Wiley& Sons Protein Science uffer (50 mM HEPESKOH pH 7.5, 140 mM mM 140 7.5, pH HEPESKOH mM (50 uffer h 30 sec pulse on/off (doublestep microtip, microtip, (doublestep on/off pulse sec 30 h ss beads mechanical disruption at 4°C until 4°C at disruption mechanical beads ss rd ChIP buffer containing protease inhibitor inhibitor protease containing buffer ChIP rd “Harsh” ChIP buffer (50 mM HEPESKOH HEPESKOH mM (50 buffer ChIP “Harsh” sbad, CA). After immunoprecipitation, the the immunoprecipitation, After CA). sbad, that complete cellular lysis is necessary to to necessary is lysis cellular complete that r 1 h with 50 L of prewashed protein G G protein prewashed of L 50 with h 1 r uz, sc33736) and incubated for 2 hours at at hours 2 for incubated and sc33736) uz, ring sonication. Subsequent lysates were were lysates Subsequent sonication. ring transferred to a small cell culture dish and dish culture cell small a to transferred slr 5 U lm) ih oln for cooling with lamp) UV W 15 osolar c33736) for 2 hours, 4°C. The protein protein The 4°C. hours, 2 for c33736) d formaldehyde crosslinks reversed by by reversed crosslinks formaldehyde d were then centrifuged at 4°C for 20 20 for 4°C at centrifuged then were mM TrisHCl pH 8.0, 250 mM LiCl, LiCl, mM 250 8.0, pH TrisHCl mM Mini, EDTA Free Protease Inhibitor Inhibitor Protease Free EDTA Mini, Deoxycholate) followed by 2 washes washes 2 by followed Deoxycholate) 4 m NC, m ET, 1% EDTA, mM 1 NaCl, mM 140 ate and 2X Complete Mini, EDTA Mini, Complete 2X and ate stored dry at 80 at dry stored hromatin (supernatant) was was (supernatant) hromatin o C until elution. until C Page 12of23 Page 13of23 heating at 95at heating LacZ specific primers (5’ CCTTCTCTTTGGAACTTTCAGTAAT (5’ primers specific LacZ quantified was DNA buffer. EB µL 58 in eluted and p were Samples 65°C. at overnight incubated samples new a to transferred eluent the and rpm 3000 at sec resuspen to minutes 5 every vortexing with minutes, br vortexed and beads the to added then was SDS) 1% b elution µL 50 ex). mL 500 in g (5 SDS 0.01% EDTA, time two E and buffer, wash with time µL 1 buffer, lysis 58 in elution and wi 2x washed were beads samples, immunoprecipitated Cleanup PCR by followed 65°C to added was TE/SDS µL 90 samples, TRIC on PCR For bps. 300900 Ethi with stained gel agarose 1% on visualized were i then and added was stock) mg/mL (1 A RNAse µL 0.5 to hours 3 for 50°C at incubated and added then was crosslin reverse to 65°C at overnight incubated and µL 50 chromatin, sheared the of size the examine To experiments. thesediscarded in immunopr to prior saved being chromatin solubilized followe was protocol TRIC the TRIC, during IP’d DNA (Sigma, antibody (M2) antiFLAG using analysis Blot o Accepted Article DTT mM 250 containing buffer SUTEB in min 20 for C This article isprotected by copyright. All rights reserved. John Wiley& Sons Protein Science digest proteins, followed by a PCR cleanup. cleanup. PCR a by followed proteins, digest d the beads. Beads were centrifuged for 30 30 for centrifuged were Beads beads. the d s with TE buffer (10 mM TrisHCl, 1 mM 1 TrisHCl, mM (10 buffer TE with s ks. 2.5 µL proteinase K (20 mg/mL stock) stock) mg/mL (20 K proteinase µL 2.5 ks. and PCR reactions were set up with GAL1 with up set were reactions PCR and tube. 120 µL TE/SDS was added and the the and added was TE/SDS µL 120 tube. St. Louis, MO). For studies examining the the examining studies For Louis,MO). St. TE/SDS was added to the Input samples samples Input the to added was TE/SDS dium bromide. Smears showed between between showed Smears bromide. dium urified using a PCR cleanup kit (Qiagen) (Qiagen) kit cleanup PCR a using urified th lysis buffer, 1 time with 500 mM NaCl NaCl mM 500 with time 1 lysis buffer, th ecipitation. Additionally, lysates were were lysates Additionally, ecipitation. uffer(50 mM TrisHCl, 10 mM EDTA, EDTA, mM 10 TrisHCl, mM uffer(50 iefly before incubating at 65°C for 30 30 for 65°C at incubating before iefly ncubated at 37°C for 30 min. Samples min. 30 for 37°C at ncubated 50 uL input and incubated overnight at overnight incubated and input uL 50 d with the exception of 50 uL of of uL 50 of exception the with d ACGCTTAACTGC 3’ and 5’ 5’ and 3’ ACGCTTAACTGC B buffer (Qiagen). For For (Qiagen). buffer B and probed using Western Western using probed and bromide. ethidium with stained visua were Products ). 3’ GGGCGATCGGTGCGGGCCTCTTCGC Accepted Article This article isprotected by copyright. All rights reserved. John Wiley& Sons Protein Science lized on a 1% agarose gel gel agarose 1% a on lized Page 14of23 Page 15of23 bath. Samples were purified using Qiagen PCR Clean PCR using wereQiagen Samples purified bath. 90 L TESDS was added. Formaldehyde crosslinks wer crosslinks Formaldehyde added. was L 90 TESDS buf SDS) 0.1% EDTA, mM 1 TrisHCl, mM (10 ofTESDS GAL1LacZ gene, as expected. gene,as expected. GAL1LacZ for sequen and submitted gelwas band purified This designed the amplification with PCR quantitation. each with b condition, each forrun replicates were instrument StepOnePlus Biosystems an Applied on out (sequ GAL1LacZ specificfor primers using Promega) was usingrun P and inputs samples all on EB.qPCR EDTA, 1% SDS) at 65at SDS) 1%EDTA, Le were 50 in eluted complexes Immunoprecipitated t in washed were Beads (LifeslurryTechnologies). at 4at Immunoprecipita Biotechnologies). Cruz Santa 2027, Cru Santa antibody(sc1725, LexA Biotechnologies), eitherg 2 Snf1 with wereimmunoprecipitated then e was split chromatin soluble The remaining sample. the from was separated chromatin earlier.Soluble were Samples pipetting. gentle by resuspended were b glass After mechanical experiments. fordone TRIC gr were cultures immunoprecipitation, Forchromatin GAL1-LacZ at Immunoprecipitation Chromatin o Accepted of prew L ~40 forwith h 1 incubation by followed C Article o C for 30 minutes. The eluate was transferred to a to was transferred The eluate for minutes. 30 C This article isprotected by copyright. All rights reserved. John Wiley& Sons Protein Science iological replicate run in triplicate for qPCR for qPCR triplicate in run iologicalreplicate pellet and 10 L was saved as an input as an input wassaved L and 10 pellet primers yielded a single band around 450 bps. bps. 450 yieldedaround band a single primers he same manner as TRIC DNA samples. DNA samples. as TRIC hesamemanner cing. Results returned a sequence for the fora sequence the returned Results cing. qually between three 1.75 mL which 1.75 tubes three qually between sonicated and centrifuged as described asdescribed andcentrifuged sonicated own and formaldehyde crosslinked as was as was crosslinked and formaldehyde own romega GoTaq qPCR master mix (A6001, (A6001, mix master GoTaq qPCR romega antibody (sc15621, Santa Cruz Cruz Santa (sc15621, antibody pellet and insoluble lysate eadshearing,the z Biotechnologies), or control IgG (sc control or Biotechnologies), z tions were allowed to proceed for 2 hours forhours proceed2 were to allowed tions Up protocol and eluted in 58 L BufferL 58 in eluted and protocol Up . At least three independent biological biological three least At independent . ences above). All qPCR runs were runs carried qPCR All above). ences lution buffer (50 mM TrisHCl, 10 mM mM 10 TrisHCl, mM (50 buffer lution e reversed overnight in a 65°C water a 65°C in overnight reversed e ashed protein G magnetic Dynabeads Dynabeads magnetic G ashed protein fer was added. To the saved inputs, saved the inputs, To added. fer was new tube and 120 L L and 120 tube new 1 Mapp AK, Ansari AZ (2007) A TAD further: Exogenou further: TAD A (2007) AZ Ansari AK, Mapp 1 References 2 Krishnamurthy M, Dugan A, Nwokoye A, Fung YH, La YH, Fung A, Nwokoye A, Dugan M, Krishnamurthy 2 4 Berg M, Michalowski A, Palzer S, Rupp S, Sohn K ( K Sohn S, Rupp S, Palzer A, Michalowski M, Berg 4 SecYSecA of modes Different (2006) K Ito H, Mori 3 5 Ting SY, Schilke BA, Hayashi M, Craig EA (2014) (2014) EA Craig M, Hayashi BA, Schilke SY, Ting 5 Ra J, enc S Mguo T 21) Genomewide (2015) T Magnuson S, Resnick JR, Raab 6 Wa G, an W Aohi E Blof P Pzr M Pizer JP, Balhoff E, Abouheif MW, Hahn GA, Wray 7 8 Cheng JX, Floer M, Ononaji P, Bryant GO, Ptashne Ptashne GO, Bryant P, Ononaji M, Floer JX, Cheng 8 Chem Biol 2:6275. 2:6275. Biol Chem K 21) agt n h at cvln crosslinking 6:13211326. Biol Chem ACS vivo. in interactions covalent act: the in Caught (2011) AK 9:e89436. 9:e89436. Aha1 of domain homodimerization a reveals approach Acad Natl Proc photocrosslinking. vivo directedin 289:2868928696. 289:2868928696. the with interactions and translocon mitochondrial mediated by biochemically distinct SWI/SNF complexe SWI/SNF distinct biochemically by mediated 1419. 1419. regulation transcriptional of evolution The (2003) genes to changes in the transcriptional machinery a machinery transcriptional the in changes genesto Biol 12:18282832. 12:18282832. Biol

Accepted Article This article isprotected by copyright. All rights reserved. John Wiley& Sons Protein Science in eukaryotes. Mol Biol Evol 20:1377 Evol Biol Mol eukaryotes. in re determined by their promoters. Curr Curr promoters. their by redetermined Sci USA 103:1615916164. 103:1615916164. USA Sci matrix import motor. J Biol Chem Chem Biol J motor. import matrix 2014) An in vivo photocrosslinking photocrosslinking vivo in An 2014) M (2002) Responses of four yeast four of Responses (2002) M s. PLoS Genet 11:e1005748. PLoS 11:e1005748. s. Genet Architecture of the TIM23 inner inner TIM23 the of Architecture s control of gene activation. ACS activation. gene of control s captures activatorcoactivator activatorcoactivator captures neatos eeld y site by revealed interactions ncia JK, Majmudar CY, Mapp Mapp CY, Majmudar JK, ncia Rcmn V Rmn LA Romano MV, Rockman , n . eeiie Po One PLoS cerevisiae. S. in transcriptional regulation regulation transcriptional Page 16of23 Page 17of23 Ps Z, bee C, ate D (03 Te mediat The (2013) DJ Taatjes CC, Ebmeier ZC, Poss 0 Klein J, Nolden M, Sanders SL, Kirchner J, Weil Weil J, Kirchner SL, Sanders M, Nolden J, Klein 0 2 Nedialkov YA, Triezenberg SJ (2004) Quantitative (2004) SJ Triezenberg YA, Nedialkov 2 1 tigr F Ige C, rebat (90 Dire (1990) J Greenblatt CJ, Ingles KF, Stringer 1 3 hn , reebr S, ese P Pre D Knu D, Porter P, Hensley SJ, Triezenberg F, Shen 3 4 oiulh , an (08 Stpcfc cross Sitespecific (2008) S Hahn N, Mohibullah 4 5 uly M Ruele , iso F 19) h Spt The (1999) F Winston C, Rougeulle AM, Dudley 5 6 Larschan E, Winston F (2001) The S. cerevisiae S cerevisiae S. The (2001) F Winston E, Larschan 6 7 Bhaumik SR, Green MR (2001) SAGA is an essential an is SAGA (2001) MR Green SR, Bhaumik 7 regulation. Crit Rev Biochem Mol Biol 48:575608. 48:575608. Biol Mol Biochem Rev Crit regulation. native transcription factor IID and SAGA. J Biol Ch Biol IIDJ andSAGA. factor transcription native genetically introduced crosslinker to identify int identify to crosslinker introduced genetically region. Arch Biochem Biophys 425:7786. 425:7786. Biophys Biochem Arch region. the of target a as protein TATAbinding implicates transcriptional activation domain to the TATAbox f TATAbox the to domain activation transcriptional upon interaction with basal transcription factors. factors. transcription basal with interaction upon b VP16 herpesvirus protein the of domain activation 3006. 3006. SA the with interaction functional direct a reveals 2945. 2945. postactivatorbindi a at promoter a to binding TBP coactivator for transcriptional activation by Gal4. by activation fortranscriptional coactivator activator Gal4p. Genes Dev 15:19351945. 15:19351945. Dev Genes activatorGal4p. Accepted Article This article isprotected by copyright. All rights reserved. John Wiley& Sons Protein Science J Biol Chem 271:48274837. 271:48274837. Chem Biol J Genes Dev 15:19461956. 15:19461956. GenesDev eraction sites of acidic activators within within activators acidic of sites eraction GA subunit Spt3. Genes Dev 22:2994 Dev Genes Spt3. subunit GA ct and selective binding of an acidic acidic an of binding selective and ct AGA complex functions in vivo as a a as vivo in functions complex AGA ikn o TP n io n i vitro in and vivo in TBP of linking em 278:67796786. 278:67796786. em ng step in vivo. Genes Dev 13:2940 Dev Genes vivo. in step ng ecomes conformationally constrained constrained conformationally ecomes actor TFIID. Nature 345:783786. 345:783786. actor Nature TFIID. assessement of in vitro interactions interactions vitro in of assessement PA, Melcher K (2002) Use of a a of Use (2002) K Melcher PA, in vivo target of the yeast acidic acidic yeast the of target vivo in VP16C transcriptional activation activation transcriptional VP16C components of SAGA facilitate facilitate SAGA of components tson JR (1996) Transcriptional Transcriptional (1996) JR tson or complex and transcriptional transcriptional and complex or 9 Majmudar CY, Lee LW, Lancia JK, Nwokoye A, Wang A, Nwokoye JK, Lancia LW, Lee CY, Majmudar 9 Zhan M, Mukherji JC, Anderson TA, Cropp JW, Chin 8 1 eir L Se F Tizneg J 19) Pattern (1993) SJ Triezenberg F, Shen JL, Regier 1 0 Ingles CJ, Shales M, Cress DW, Triezenberg SJ, G SJ, Triezenberg DW, Cress M, Shales CJ, Ingles 0 2 ihkw J Kkb T Hrksi , odr G N RG, Roeder M, Horikoshi T, Kokubo J, Nishikawa 2 3 Mal TK, Takahata S, Ki S, Zheng L, Kokubo T, Iku T, Kokubo L, Zheng S, Ki S, Takahata TK, Mal 3 4 i T, ahmt S Klee R II Faaa P Flanagan III, RJ Kelleher S, Hashimoto TK, Kim 4 5 Bryant GO, Ptashne M (2003) Independentrecruitm (2003) M Ptashne BryantGO, 5 6 Das PM, Ramachandran K, vanWert J, Singal R (200 R Singal J, vanWert K, Ramachandran PM, Das 6 binding modes of a transcriptional activator. J Am Am activator.J of a transcriptional modes binding binding domain of the TATA boxbinding protein. Pro protein. boxbinding TATA of the domain binding expanded eukaryotic genetic code. Science 301:9649 code. Science genetic eukaryotic expanded K 20) mat f ontrl mn ai mutagenes acid amino nonnatural of Impact (2009) AK Acad Sci USA 90:883887. 90:883887. AcadUSA Sci VP1 the of subdomains two of one for critical acids ofV mutants compromised transcriptionally to TFIID TAFII230 and the transcriptional activator VP16 bin VP16 activator transcriptional the and TAFII230 associated factor 1. J Biol Chem 282:2222822238. 282:2222822238. Chem Biol J 1. associatedfactor of linkage covalent a by (TBP) protein TATAbinding initiation in yeast. in 369:252255. Nature initiation TB activationdefective of Effects (1994) RG Roeder required for transcription. Mol Cell 11:13011309. 11:13011309. Cell Mol transcription. requiredfor assay. Biotechniques 37:961969. 37:961969. assay.Biotechniques Accepted Article This article isprotected by copyright. All rights reserved. John Wiley& Sons Protein Science Chem Soc 131:1424014242. 131:1424014242. Soc Chem reenblatt J (1991) Reduced binding of of binding Reduced (1991) J reenblatt of aromatic and hydrophobic amino amino hydrophobic and aromatic of ent in vivo by Gal4 of two complexes complexes two byvivo ofGal4 in ent 6 transcriptional activator. Proc Natl Natl Proc activator. transcriptional 6 ra M (2007) Functional silencing of of silencing Functional (2007) M ra 67. 67. P16. Nature 351:588590. Nature351:588590. P16. d competitively to the TATA box TATA the to competitively d 3) Chromatin immunoprecipitation immunoprecipitation Chromatin 3) c Natl Acad Sci USA 94:8590. 94:8590. USA Sci cAcad Natl the Nterminal domain of TBP of domain Nterminal the M, Kornbeg RD, Horikoshi M, M, Horikoshi RD, Kornbeg M, Q, Wands AM, Wang L, Mapp Mapp L, Wang AM, Wands Q, is on the in vivo function and and function vivo in the on is P mutations on transcription transcription on mutations P akatani Y (1997) Drosophila Drosophila (1997) Y akatani g Z, Schultz PG (2003) An An (2003) PG Schultz Z, g Page 18of23 Page 19of23 blotting. blotting. transcriptional the in acid amino photocrosslinking FIGURELEGENDS in proteins chromosomal Mapping (2000) V Orlando 27 expressing LexA+VP16N L444Bpa were either crosslink either were L444Bpa LexA+VP16N expressing transcript bound DNA of targets direct the captures Tand (c,d) antibody. HRP Flag a with blot Western covale The antibody. TBP a with immunoprecipitated irra were Yeast L114Bpa. mycTBP and WT LexA+VP16N expressing yeast in capture chemical covalent using The yeast. in TBP contacts directly VP16 2. Figure covale irreversibly the and reversed are crosslinks i the of immunoprecipitation Following sonication. lysed are cells The assembly. complex coordinating li UV with irradiated gently then are cells Treated prot and proteinDNA stabilize to formaldehyde with ac transcriptional of targets direct the of capture Crossl Irreversible and Reversible Tandem 1. Figure Accepted Article 2 Sci Trends Biochem immunoprecipitation. chromatin

This article isprotected by copyright. All rights reserved. John Wiley& Sons Protein Science tivators at a promoter. Yeast cells are treated treated are cells Yeast promoter. a at tivators ntly linked PPIs are identified by Western Western by identified are PPIs linked ntly VP16TBP interaction was captured in vivo in captured was interaction VP16TBP ional activators. Identical cultures of yeast of cultures Identical activators. ional activation domain (TAD) of the activator activator the of (TAD) domain activation and the chromatin isolated and sheared via via sheared and isolated chromatin the and mmobilized complexes, the formaldehyde formaldehyde the complexes, mmobilized em reversible and irreversible crosslinking crosslinking irreversible and reversible em nt VP16TBP products were visualized on visualized were products VP16TBP nt irti itrcin a te promoter. the at interactions einprotein inking (TRIC) allows for the covalent covalent the for allows (TRIC) inking ght to activate a genetically encoded encoded genetically a activate to ght (a) LexA+VP16N L444Bpa and (b) (b) and L444Bpa LexA+VP16N (a) ed with UV, formaldehyde, or treated treated or formaldehyde, UV, with ed diated with UV light and the lysates lysates the and light UV with diated vivo by formaldehydecrosslinked by vivo 5:99104. 5:99104. mean. mean. replicate biological three least at of mean the are immunoprecipita Chromatin (e) (d). bromide ethidium visua and primers specific GAL1LacZ with amplified antibo Flag an with probed were (c) blots Western f the and antibody TBP an with immunoprecipitated usin solubilized and sheared was chromatin the then t washed were cultures these of fractions chromatin (formaldehyde procedures both of combination a with

Accepted Article This article isprotected by copyright. All rights reserved. John Wiley& Sons Protein Science s. Error bars indicate the standard error of the the of error standard the indicate bars Error s. o remove noncovalently bound protein and and protein bound noncovalently remove o g sonication. Soluble chromatin was then then was chromatin Soluble sonication. g tion at the GAL1 promoter in yeast. Bars Bars yeast. in promoter GAL1 the at tion y n imnpeiiae DA was DNA immunoprecipitated and dy ormaldehyde crosslinks were reversed. reversed. were crosslinks ormaldehyde followed by UV crosslinking). The The crosslinking). UV by followed lized on an agarose gel stained with with stained gel agarose an on lized Page 20of23 Page 21of23

Page 22of23 Page 23of