OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC304445
KDELR3 (NM_016657) Human Untagged Clone Product data:
Product Type: Expression Plasmids Product Name: KDELR3 (NM_016657) Human Untagged Clone Tag: Tag Free Symbol: KDELR3 Synonyms: ERD2L3 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >NCBI ORF sequence for NM_016657, the custom clone sequence may differ by one or more nucleotides
ATGAACGTGTTCCGAATCCTCGGCGACCTGAGCCACCTCCTGGCCATGATCTTGCTGCTGGGGAAGATCT GGAGGTCCAAGTGCTGCAAGGGCATCTCTGGGAAGAGCCAGATCCTGTTTGCTCTCGTCTTCACCACCAG GTACCTGGACCTGTTCACCAACTTCATCTCCATCTACAACACAGTAATGAAGGTGGTTTTTCTCCTCTGT GCCTATGTTACAGTGTACATGATATATGGGAAATTCCGTAAAACTTTTGACAGTGAGAATGACACATTCC GCCTGGAGTTTCTTCTGGTCCCAGTCATTGGCCTTTCCTTCCTTGAAAACTACAGTTTCACTCTGCTGGA GATCCTCTGGACTTTCTCTATCTATCTGGAATCAGTGGCTATCCTGCCCCAGCTCTTCATGATCAGCAAG ACTGGAGAGGCTGAGACCATAACTACTCACTACCTGTTCTTTCTGGGTCTGTACCGGGCACTCTACCTGG CTAACTGGATCAGGCGGTACCAGACTGAGAATTTCTATGACCAAATTGCAGTCGTGTCTGGAGTAGTACA AACCATCTTCTACTGTGACTTCTTCTACTTGTATGTGACCAAAGGTAGGTCCTGGGATGACAGCAATGCT GACACTGGCCTAAGGAGTTACTCATCCATTTAA
Restriction Sites: SgfI-MluI ACCN: NM_016657
This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 KDELR3 (NM_016657) Human Untagged Clone – SC304445
OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at [email protected] or by calling 301.340.3188 option 3 for pricing and delivery.
The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. RefSeq: NM_016657.2, NP_057839.1 RefSeq Size: 960 bp RefSeq ORF: 663 bp Locus ID: 11015 UniProt ID: O43731 Protein Families: Druggable Genome, Transmembrane Protein Pathways: Vibrio cholerae infection Gene Summary: This gene encodes a member of the KDEL endoplasmic reticulum protein retention receptor family. Retention of resident soluble proteins in the lumen of the endoplasmic reticulum (ER) is achieved in both yeast and animal cells by their continual retrieval from the cis-Golgi, or a pre-Golgi compartment. Sorting of these proteins is dependent on a C-terminal tetrapeptide signal, usually lys-asp-glu-leu (KDEL) in animal cells, and his-asp-glu-leu (HDEL) in S. cerevisiae. This process is mediated by a receptor that recognizes, and binds the tetrapeptide- containing protein, and returns it to the ER. In yeast, the sorting receptor encoded by a single gene, ERD2, is a seven-transmembrane protein. Unlike yeast, several human homologs of the ERD2 gene, constituting the KDEL receptor gene family, have been described. KDELR3 was the third member of the family to be identified. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013] Transcript Variant: This variant (2) uses an alternate 3' terminal exon, compared to variant 1. It encodes isoform b which is shorter and has a distinct C-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
This product is to be used for laboratory only. Not for diagnostic or therapeutic use. ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 2 / 2