Phycoiogicai Research 1999; 47: 109-114
Molecular phylogeny of Laminariales (Phaeophyceae) inferred from small subunit ribosomal DNA sequences
Sung Min Boo,^* Wook Jae Lee,' Hwan Su Yoon,' Atsushi Kato^ and Hiroshi Kawai^ 'Department of Biology, Chungnam National University, Daejon 305-764, Korea, ^Division of Biological Sciences, Graduate School of Science, Hokkaido University, Sapporo 060-0810, Japan and ^Kobe University, Research Oenter for Inland Seas, Rokkodai, Kobe 657-8501, Japan,
morphic, diplohaplontic life cycle, with an alternation SUMMARY between highly differentiated diploid sporophytes and microscopic haploid gametophytes (van den Hoek In order to elucidate the molecular phylogeny of the ef al. 1995), The Laminariales currently has six fami- order Laminariales, complete small subunit (SSU) rDNA lies: Pseudochordaceae, Chordaceae, Phyllariaceae, sequences were determined for 11 species, including Alariaceae, Laminariaceae and Lessoniaceae and two representatives from all the families of the order: members of uncertain familial assignment, Halosiphon Pseudochorda gracilis Kawai et Nabata and P. nagaii tomentosum and Akkesiphycus iubricus (Setchell and (Tokida) Inagaki of the Pseudochordaceae, Chorda fiium Gardner 1925; Tilden 1935; Kawai and Kurogi 1985; (L,) Stackhouse of the Chordaceae, Alaria fistulosa Kawai 1986; Henry and South 1987; Peters 1998), Postels et Ruprecht, Ecklonia cava Kjellman and Even though the SSU rDNA sequence data support a Egregia menziesii (Turner) Areschoug of the Alariaceae, phylogenetic position close to the Sporochnales and Des- Agarum clathratum f, yakishiriense, I, Yamada, Kjeli- marestiales (Tan and Druehl 1996), there are few mole- manieila crassifolia Miyabe and Laminaria japonica cular phylogenetic studies on circumscription of the Areschoug of the Laminariaceae and Lessonia Laminariales and the interfamilial relationships of all the nigrescens Bory and Postelsia palmaeformis Ruprecht families within the Laminariales, of the Lessoniaceae, The published data of Halosiphon Members of the Pseudochordaceae and Chordaceae, tomentosus (Lyngbye) Jaasund and Saccorhiza poly- Halosiphon tomentosum and Akkesiphycus iubricus are schides (Lightfoot) Batters were included for tree con- generally regarded as 'primitive'. They share some plesio- struction. Our SSU rDNA sequences show that the morphic features: (i) diffuse meristematic activity on Pseudochordaceae and Chordaceae are clearly sepa- thalli of annual sporophytes, except for Chorda filum rated from the strongly monophyletic group consisting and Pseudochorda gracilis (Kogame and Kawai 1996); of the Alariaceae, Laminariaceae and Lessoniaceae, The (ii) presence of stigmata in zoospores; and (iii) monoe- sequence data also show that the Pseudochordaceae is cious, or dioecious but sexually monomorphic gameto- monophyletic and is distant from H. tomentosus and phytes; except for C, filum and Pseudochorda gracilis S, polyschides. Considering our molecular data and the (Kawai and Kurogi 1985; Kawai and Nabata 1990), reported morphology, life history and sex pheromones of The Chordaceae, represented only by C. filum, is char- the family, it appears likely that the Pseudochordaceae acterized by an intercalary meristem and the nature of might have branched off first from the laminarialean the sexual pheromones and gametophytes (Maier 1995; lineage that leads, through the Chordaceae, to the Kogame and Kawai 1996), Chorda tomentosa Lyngbye advanced Laminariales (i,e, the Alariaceae, Laminari- was reinstated as the monospecific genus Halosiphon aceae and Lessoniaceae), The limited resolution that Jaasund by Peters (1998) on the basis of ribosomal results from the close similarities among the SSU rDNA DNA sequences. The Phyllariaceae also exhibit some of sequences gives a need for more informative molecular the primitive features of the Pseudochordaceae and markers in order to resolve the circumscription and phy- Chordaceae (Henry 1987a,b; Kogame and Kawai 1996), logeny of the Laminariales, but they have foliose sporophytes and conducting ele- ments called solenocysts and allelocysts (Sauvageau Key words: Laminariales, molecular phylogeny, Phaeo- 1918), phyceae, Pseudochordaceae, small subunit rDNA,
INTRODUCTION *To whom correspondence shouid be addressed. Email:
The Alariaceae, Laminariaceae and Lessoniaceae lowed by 28 cycles of denaturation at 95°C for 1 min, are regarded as advanced families in the Laminariaies annealing at 45°C for 0.5 min, extension at 72°C for compared with the previously discussed primitive fam- 2 min and final extension at 72°C for 10 min. The reac- ilies. These three families share many common fea- tion mixtures of Nakayama et al. (1996) were used. A tures: absence of a stigma in zoospores; dioecious and negative control without a target DNA template was sexually dimorphic gametophytes; lamoxirene as the included in,each set of reactions. The amplified DNA sexual pheromone; presence of an intercalary meristem; was purified using a GeneClean II kit (Bio 101, La conducting systems in the sporophytes; and unicellular Jolla, CA, USA). paraphyses. However, published morphological (Setchell For C. fiium and two Pseudochorda species, the SSU and Gardner 1925) and molecular data (Druehl 1989; rDNA was amplified as two fragments using the primers Druehl and Saunders 1992) are contradictory in regard LD 1 -I- LDC and LDD H- LDF (Saunders and Druehl to the interfamilial relationships as well as the taxo- 1992). The amplification profile was an initial denatu- nomic positions of the individual taxa. ration at 94°C for 3 min, annealing at 55°C for 1 min In the present study, we aimed to elucidate the famil- and extension at 72°C for 3 min, followed by 25 cycles ial phylogeny of the Laminariaies using SSU rDNA of denaturation at 94°C for 0.75 min, annealing at sequence data. Together with published data of Sac- 55°C for 1 min, extension at 72°C for 3 min and final corhiza polyschides 0^ the Phyllariaceae and Halosiphon extension at 72°C for 10 min. Reaction mixtures des- tomentosus (Tan and Druehl 1996), we studied two cribed by Kawai et al. (1995) were used. Poiymerase Pseudochorda species of the Pseudochordaceae, Chorda chain reaction products were purified by gel filtration fiium of the Chordaceae, three species each of the using Sephacryl S-200 HR resin (Amersham Life Alariaceae and Laminariaceae and two species of the Science, Cleveland, OH, USA). Lessoniaceae to include all the families, although Akke- The sequence of each SSU rDNA was analyzed using siphycus could not be included. According to Saunders the BigDye™ Terminator Cycle Sequencing Kit [Applied and Druehl (1992), the SSU rDNA sequences are so Biosystems (ABI), Perkin-Elmer Cetus, Norwaik, CT, conserved that it is rather difficult to resolve the phylo- USA] following the manufacturer's recommendations. genetic relationships among members of the advanced Reactions were electrophoresed and the sequence data Laminariaies, but the same gene system, nevertheless, were collected with the ABI Model PRISM™ 377 DNA provides adequate sequence divergence to distinguish Sequencer (Applied Biosystems, Foster City, CA, USA). S. poiyschides of the Phyllariaceae and H. tomentosus Both strands of SSU rDNA were completely sequenced, from the advanced Laminariaies (Tan and Druehl 1996). using the PCR and nested primers of Nakayama ef al. (1996) and newly designed primers of forward dir- ection (S34, 5' CAAGTCTGGCAATTGGAATGAGA 3'; MATERIALS AND METHODS S56, 5' AGCATGGAATAATGAGATAGG G 3'; S78, 5' A list of species investigated in this study, their taxo- ACCAGGAGTGGAGCCTGCGGCTT 3'; Sll, CGAG- nomic positions and collection sites are provided in GAATTCCTAGTAAACG 3'). However, SSU rDNA from Table 1. Thalii dried in air were used for DNA extrac- C. fiium and the two Pseudochorda species were se- tion, except for Pseudochorda graciiis, where fresh quenced using the primers of Saunders and Druehl sporophytes were used. Genomic DNA was extracted (1992) and newly designed primers of forward direction using a modification of a hexadecyl trimethylammo- (KAl, 5' TAGCATGGAATAATGAGATAG 3') and of reverse nium bromide (CTAB) method (Doyle and Doyle 1987). direction (KA2, 5' CCGCACGCGCGCTACACTGATG 3'). Approximately 0.02 g algal tissue powder was incu- There were no differences between the Laminaria japon- bated in 500 pL 2% CTAB buffer (with the addition of ica sequences obtained with primers of Nakayama ef al. 2% p-mercaptoethanol) at 60°C for 45 min. Extractions (1996) and those of Kawai etal. (1995). with chloroform-isoamyl alcohol (CIA, 24:1 v/v) were The SSU rDNA sequences were aligned using performed repeatedly until complete removal of the SeqPup, a multisequence editing program (Gilbert Interphase was achieved. DNA was precipitated with 1995). Final alignment was done manually. Two- 1000 |JL of 100% cold ethanol for 30 min at -70°C, parameter distances (Kimura 1980) between taxa pelleted by centrifugation (10 min, 10 000 g, 4°C), were estimated and phylogenies were inferred with the washed with 70% ethanol twice, air dried and dissolved neighbor-joining method using the NEIGHBOR program in 150|jLTris-EDTA. of PHYLIP (Felsenstein 1995). The maximum-likelihood The SSU rDNA gene was amplified as two frag- (ML) tree was constructed using the DNAML program of ments using the primers SRI + SR7 and SR4 -i- SR12 PHYLIP in which the global rearrangement option was (Nakayama et al. 1996) in an automated thermocycler given. Maximum parsimony (MP) analysis was carried (MJ Research, Watertown, MA, USA). The profile of out using the PAUP program (version 3.1.1, Swofford the poiymerase chain reaction (PCR) conditions was 1993). To provide rough estimates of support for topo- an initial denaturation at 95°C for 2 min annealing at logical elements in all analyses, bootstrapping (Felsen- 45°C for 0.5 min and extension at 72°C for 2 min, fol- stein 1985) was done with 1000 resamplings in both SSU rDNA phylogeny of Laminariales 111
Table 1. List of species investigated in this study, including their taxonomic position, collection site and GenBank accession number
Order/family/species Collection site Reference and GenBank accession no. Laminariales Family uncertain Haiosiphon tomentosus (Lyngbye) Jaasund Tan and Druehl 1996, L43056 Chordaceae Chorda tilum (L.) Stackhouse Oshoro, Japan New sequence, AF123585 Phyllariaceae Saccorhiza polyschides (Lightfoot) Batters Tan and Druehl 1996, L43059 Pseudochordaceae Pseudochorda graciiis Kawai et Nabata Isoya, Japan New sequence, AF123583 P. naga/V (Tokida) Inagaki Hanasaki, Japan New sequence, AF123584 Alariaceae Aiaria tistuiosa Postels et Ruprecht Kamchatka, Russia New sequence, AF123578 Eckionia cava Kjellman Cheju, Korea New sequence, AF123579 Egregia menziesii (Turner) Areschoug Oregon, USA New sequence, AF123580 Laminariaceae Agarum dathratum f. yakishiriense I. Yamada Kangreung, Korea New sequence, AF123576 Kjeilmanieiia crassifoiia Miyabe Kangreung, Korea New sequence, AF123577 Laminaria japonica Areschoug Sinnam, Korea New sequence, AF123575 Lessoniaceae Lessonia nigrescens Bory llo, Peru New sequence, AF123581 Posteisia paimaeformis Ruprecht Oregon, USA New sequence, AF123582 Desmarestiales Desmarestiaceae Desmarestia iiguiata (Lightfoot) Lamouroux Tan and Druehl 1996, L43060 Scytosiphonales Scytosiphonaceae Scytosiphon iomentaria (Lyngbye) Link Kawai etai. 1995, D16558 Sporochnales Sporochnaceae Sporochnus comosus C. Agardh Tan and Druehl 1996, L43016
the MP and NJ analyses but 100 resamplings in the the branches collapsed in the 50% majority-rule con- ML analysis. As the Desmarestiales and Sporochnales sensus tree (tree not shown). have been shown to be relatives of the Laminariales As is seen in both the ML and NJ trees (Figs 1,2), by morphology and SSU rDNA sequences (van den Saccoriiiza poiysciiides was basal to the clade com- Hoek et ai. 1995), published sequences of Desmares- prising all the taxa treated here, in which i-iaiosiption tia iiguiata and Sporoctinus comosus were included for tomentosus branched off and then Sporochnus data analyses. In all cases, Scytosipiion iomentaria oi comosus and Desmarestia iiguiata followed. However, the Scytosiphonales was used as an outgroup. most of these branches were weakly supported by low bootstrap values. RESULTS The ML and NJ trees showed that members of the Chordaceae, Pseudochordaceae, Alariaceae, Laminari- Complete SSU rDNA sequences were determined for 11 aceae and Lessoniaceae form a single monophyletic representatives of the Laminariales (Table 1). The total clade, even though the clade was supported by 58% length of the SSU rDNA sequences of the species (ML tree) and 48% (NJ tree) bootstrap values. The two treated here ranged from 1715 to 1722 b.p., which members of the Pseudochordaceae formed a single were aligned with a total of 1726 positions (alignment clade with 85% (ML tree) and 97% (NJ tree) bootstrap available on request). Although most of the positions values, and were shown to be sisters of the Chordaceae. were the same among the sequences, there were 101 The Pseudochordaceae is also distant from Haiosipiion variable positions between 613 and 619, 666 and 670 tomentosus and Saccoriiiza tomentosus. The members and 1657 and 1685. of the Alariaceae, Laminariaceae and Lessoniaceae pro- Phylogenetic trees constructed from the MP, ML and duced a strong clade with 94% (ML tree) and 97% (NJ NJ analyses showed a similar topology. There were 34 tree) bootstrap values. The members of the three fami- parsimony-informative nucleotide positions in our align- lies formed branches that overlapped with each other ment. The MP analysis retained 48 trees, but most of and the bootstrap supports were also weak. 112 S, M, Boo etal.
36 r Bcklonia cava Le8sonia nigrescenB Agarum clatbratum Postelsia pahnaeformis KJeUmaniella ciassilolia
Egregia menziesii Laminariales Laminaria Japonica Alaria Bstulosa
Pseudochorda gracilis Chorda Slum Desmarestia ligulata Desmarestiales 8porochnus comosus Sporochnales —Halosiphon tomentosus Laminariaies • Saccorhiza poiyschides Fig. 1, Phylogenetic tree using maxi- Scytosiphon Iomentaria \ Scytosipiionaies mum-likelihood analysis. Numbers above branches are bootstrap values 0,005 (100 resamplings). 48 r Ecklonia cava
45 LessonisL nigrescens • Agarum clathratum 24 27 146 — Postelsia pahnaeformis . KJeUmaniella crassifoUa 55 • Bgregia menziesii 99 Laminaria japonica 48 '- Alaria Bstulosa 97 Pseudocborda nagaii 48 Pseudocborda gracilis 34 30 • Cborda Blum —— Desmarestia ligulata 51 ' Sporocbnus comosus ' Halosipbon tomentosus
^——•—^ Saccorbiza polyscbides Fig, 2, Phylogenetic tree using Scytosipbon Iomentaria neighbor-joining analysis. Numbers above the branches are bootstrap 0,005 values (1000 resamplings).
DISCUSSION inariaceae and Lessoniaceae, The Pseudochordaceae and Chordaceae show a sister relationship in the trees In the molecular analyses based on complete SSU constructed in this study, so either family might have rDNA gene sequences, both the Pseudochordaceae and branched off first within the laminarialean lineage. Chordaceae are clearly separated from the strongly As mentioned previously, the Chordaceae (Kogame monophyletic group consisting of the Alariaceae, Lam- and Kawai 1996) and Pseudochordaceae (Kawai and SSU rDNA phylogeny of Laminariaies 113
Kurogi 1985) Kawai and Nabata share some basic mor- tures in the Laminariaies. Our current molecular data phological features (e.g. terete sporophyte organization and the above-discussed data support the view that and early developmental processes of sporophytes). The the Alariaceae, Laminariaceae and Lessoniaceae are Chordaceae also shares closest morphological similarity the most recently evolved (advanced) groups in the with the Alariaceae, Laminariaceae and Lessoniaceae Laminariaies. in that it has: (i) unicellular paraphyses; (ii) trumpet- The present SSU rDNA sequences do not show clear shaped hyphae; (iii) a well developed intercalary meri- separation among the advanced families of the Laminar- stem; and (iv) sexually dimorphic gametophytes. iaies because of the very similar sequences and a small Therefore, the close phylogenetic relationship of the number of the informative sites. The close relationship Pseudochordaceae, Chordaceae, Alariaceae, Laminari- among the advanced families is also represented in the aceae and Lessoniaceae based on the SSU rDNA mole- data of internal transcribed spacer (ITS) sequences cular data agree with the morphological features. (Saunders and Druehl 1993a; Druehl etal. 1997), which The Pseudochordaceae, including only Pseudo- are generally known to be much more variable than those chorda graciiis and P. nagaii, shows a strong mono- of the 18S region in the same ribosomal gene and to be phyly. Although P. nagaii, which has dioecious but fast-evolving in the Laminariaies (Saunders and Druehl sexually monomorphic gametophytes, is different from 1992, 1993b) as well as in other algae (Olsen 1990). P. graciiis, which has dioecious and dimorphic gameto- For example, Saunders and Druehl (1993a) concluded phytes, the close similarity of the SSU rDNA supports that both the Alariaceae and Lessoniaceae are poly- the identity of the Pseudochordaceae proposed by phyletic and Druehl etal. (1997) further established that Kawai and Kurogi (1985). Kawai and Kurogi (1985) the Laminariaceae is not a natural group. suggested that the Pseudochordaceae should be Our current sequence data support a view that the regarded as the most primitive Laminariaies based on Laminariaies may not be monophyletic if Saccorhiza morphology and life history. However, it appears likely polyschides of the Phyllariaceae and Halosiphon that the Pseudochordaceae might have branched off tomentosus are included in the order, consistent with first from the laminarialean lineage that leads, through the reports of both Tan and Druehl (1996), based on the Chordaceae, to the advanced Laminariaies. SSU rDNA data, and Rousseau etal. (1997), based on The current SSU rDNA sequences also show that large subunit rDNA sequences. However, because of the Saccorhiza polyschides of the Phyllariaceae and limited resolution from the small number of informative Halosiphon tomentosus are quite distantly related to sites and low bootstrap values, circumscription of the the other families of the Laminariaies. These results are order Laminariaies needs further study. As is mentioned in accordance with those of Peters (1998) who showed by Peters (1998), even though the sequences of addi- that H. tomentosus is separated from the Chordaceae tional members may be analyzed, both the informative and Tan and Druehl (1996) who showed that S. poly- and variable sites may not significantly increase. This schides of the Phyllariaceae is related to both H. rather confuses phylogenetic relationships, especially tomentosus and Sporochnus comosus. As described among the advanced families. Therefore, more infor- earlier, the Phyllariaceae have also been regarded as mative markers should be analyzed in order to improve primitive on the basis of morphology, life history and the molecular taxonomy and phylogeny of the Laminar- sex pheromones. Given the present molecular data iaies. Both the ITS regions in nuclear ribosomal genes together with other published data, S. polyschides (Druehl et al. 1997; Peters 1998) and the plastid- appears quite different from the Laminariaies, even encoded RuBisCo large subunit and spacer region, though the Phyllariaceae show some similarities to the which are more informative within the Ectocarpales Laminariaies (e.g. Flores-Moya and Henry 1998). sensu lato (Siemer ef al. 1998) and in the family The members of the Alariaceae, Laminariaceae and Alariaceae (Yoon and Boo, in press), may prove to be Lessoniaceae are the most strongly grouped in the trees recommendable markers for an improved molecular constructed in the present study. This result suggests phylogeny of the Laminariaies. that these families might have evolved closely to each other, but separately from the other families of the Laminariaies. This relationship is shown in the pub- ACKNOWLEDGEMENTS lished SSU rDNA (Saunders and Druehl 1992; Tan and Thanks are due to Professor Cesar A. Cordova and Tania Druehl 1996) and ITS data (Saunders and Druehl Peria for a sample from Chile and Gayle Hansen and 1993a,b; Druehl et al. 1997). These three families Tae Oh Cho for samples from Oregon. Eric Henry share many features, such as: (i) differentiation improved the earlier drafts of the manuscript and between blade and stipe; (ii) presence of mucilaginous Akira Peters and an anonymous reviewer improved the structures; (iii) lack of a stigma in zoospores; (iv) the final revision. This work was supported by the 1997 usually perennial nature of the sporophytes; and (v) joint program between KOSEF and JSPS among S.M.B., lamoxirene as the common sexual pheromone. These H.K. and In Kyu Lee, and KOSEF 96-04-01-03 to characteristics are generally regarded as advanced fea- S.M.B. 114 S. M. Boo et al.
REFERENCES Maier, I. 1995. Brown algal pheromones. In Round, F. E. and Chapman, D. J. (Eds). Progress in Phycoiogicai Research, Doyle, J. J. and Doyle, J. L. 1987. A rapid DNA isolation pro- Vol. 11. Biopress Ltd, Bristol, pp. 51-102. cedure for small quantities of fresh leaf tissue. Phytochem. Nakayama, T., Watanabe, S., Mitsui, K., Uchida, H. and Bull. 19: 11-15. Inouye, I. 1996. The phylogenetic relationship between Druehl, L. D. 1989. Molecular evolution in the Laminariales: the Chlamydomonadales and Chlorococcales inferred A review, in Garbary, D.J. and South, G.R. (Eds). Evoiu- from 18S rDNA sequence data. Phycoi. Res. 44: 47-55. tionary Biogeography ot the Marine Aigae ot the North Olsen, J. L. 1990. Nucleic acids in algal systematics. J. Phycoi. Atlantic. NATO ASI series Vol. G22. Springer-Verlag, 26: 209-14. Berlin, pp. 205-17. Peters, A. F. 1998. Ribosomal DNA sequences support taxo- Druehl, L. D., Mayes, C, Tan, I. H. and Saunders, G. W. nomic separation of the two species of Chorda; reinstate- 1997. Molecular and morphological phylogenies of kelp ment of Haiosiphon tomentosus (Lyngbye) Jaasund and associated brown algae. In Bhattacharya, D. (Ed.). (Phaeophyceae, Laminariales). Eur. J. Phycoi. 33: 65-71. Origins ot Aigae and Their Piastids. Springer-Verlag, Rousseau, R, Leclerc, M-C. and de Reviers, B. 1997. Mol- Vienna, pp. 221-35. ecular phylogeny of European Fucales (Phaeophyceae) Druehl, L. D. and Saunders, G. W. 1992. Molecular explo- based on partial large-subunit rDNA sequence compar- rations in kelp evolution. Prog. Phycoi. Res. 8: 47-83. isons. Phycoiogia 36: 438-46. Felsenstein, J. 1985. Confidence limits on phylogenies: An Saunders, G. W. and Druehl, L. D. 1992. Nucleotide approach using the bootstrap. Evolution 39: 783-91. sequences of the small-subunit ribosomal RNA genes from Felsenstein, J. 1995. PHYLIP: Phyiogenetic interence Package, selected Laminariales (Phaeophyta): Implications for kelp version 3.5.7.2. Department of Genetics, University of evolution. J. Phycoi. 28: 544-9. Washington, Seattle. Saunders, G. W. and Druehl, L. D. 1993a. Nucleotide Flores-Moya, A. and Henry, E. 1998. Gametophyte and first sequences of the internal transcribed spacers and 5.8S stages of the sporophyte of Phyllariopsis purpurascens rRNA genes from Aiaria marginata and Posteisia paimae- (Laminariales, Phaeophyta). Phycoiogia 37: 398-401. tormis (Phaeophyta: Laminariales). Mar Bioi. 115: Gilbert, D. G. 1995. SeqPup, a biological sequence, editor 347-52. and analysis program for Macintosh computers. Available Saunders, G. W. and Druehl, L. D. 1993b. Revision of the kelp via anonymous ftp: