Testican 2 Abrogates Inhibition of Membrane-Type Matrix Metalloproteinases by Other Testican Family Proteins1

[CANCER RESEARCH 63, 3364–3369, June 15, 2003] Testican 2 Abrogates Inhibition of Membrane-type Matrix Metalloproteinases by Other Testican Family Proteins1

Mitsutoshi Nakada,2 Hisashi Miyamori,2 Junkoh Yamashita, and Hiroshi Sato3 Department of Molecular Virology and Oncology [M. N., H. M., H. S.], Center for the Development of Molecular Target Drugs, Cancer Research Institute [H. S.], Department of Neurosurgery, Division of Neuroscience, Graduate School of Medical Science [M. N., J. Y.], Kanazawa University, Ishikawa 920-0934, Japan

ABSTRACT activation of pro-MMP-2 is a common functional role proposed for all of the MT-MMPs (4–8), expression of MT1-MMP most closely Testican family proteins are putative extracellular heparan/chondroitin correlates with invasive phenotype of human tumors (9–13). sulfate proteoglycans of unknown function. We identified recently N-Tes, Testican was first defined as an unnamed chondroitin/heparan which is a product of testican 3 splicing variant gene, as an inhibitor of membrane-type matrix metalloproteinases (MT-MMPs). The inhibitory sulfate proteoglycan in seminal plasma (14). Corresponding cDNAs function is common among testican family members except for testican 2, were isolated from human testis libraries, and the deduced protein was which was shown to uniquely abolish inhibition of MT1-MMP- or MT3- named testican (15). To date 3 members of the testican family were MMP-mediated pro-MMP-2 activation by other testican family members. identified by cDNA cloning, with deduced amino acid homologies of Testican 2 inactivates N-Tes by binding to the COOH-terminal extracel- 42%, 51%, and 44% for testican 1/testican 2, testican 1/testican 3, and lular calcium-binding domain of N-Tes through its NH2-terminal unique testican 2/testican 3, respectively (15–17). Testican 1 and testican 2 domain as demonstrated by coimmunoprecipitation analysis, and, thus, are extracellular proteoglycans highly expressed in brain, and it was testican 2 was unable to inactivate a N-Tes deletion mutant lacking the expected that testicans might contribute to the proteoglycan-rich ECM ⌬ extracellular calcium-binding domain (N-Tes- 122). Migration of U251 of the brain and associate with neurogenesis (17–19). However, the cells on collagen, which was dependent on MT1-MMP activity under biological function of testicans has not been extensively explored. We serum-free condition, was inhibited by N-Tes or N-Tes-⌬122 deposited on collagen. Testican 2 was not incorporated into collagen by itself, and was identified recently a splicing variant of the testican 3 gene by the deposited only in the presence of N-Tes, suggesting that testican 2 binds to expression cloning method, the product of which inhibits pro-MMP-2 N-Tes deposited on collagen. Binding of testican 2 to N-Tes deposited on processing mediated by MT-MMPs (20). Furthermore, we revealed collagen allowed migration of cells expressing MT1-MMP. Unlike wild- that all members of testican except testican 2 interfered with pro- type N-Tes, N-Tes-⌬122 did not bind to testican 2, and, thus, expression of MMP-2 activation mediated by MT1-MMP or MT3-MMP (20). This testican 2 did not recover cell migration blocked by N-Tes-⌬122. In situ suggests that testicans may regulate ECM degradation by interacting hybridization showed that neurons are a major source of all of the testican with MT-MMPs. However, its biological role in controlling ECM family members in the normal brain. The quantitative reverse transcrip- turnover has not been explored thus far. In addition, the expression tion-PCR analysis demonstrated that all of the testican family members level and tissue localization of testican mRNA in tumor tissues have are expressed prominently in normal brain, and their expression levels not been studied. decrease as tumor grade increases. The expression level of testican 2 was the highest among testican family members regardless of histological In this study, we examined the interaction between testican 2 and grade of astrocytic tumors. These results suggest that abundant distribu- other testican family proteins, and demonstrated that testican 2 abol- tion of testican 2 may contribute to glioma invasion by inactivating other ishes inactivation of MT-MMPs by other testican family, and permits testican family members including N-Tes, which all inhibit MT-MMPs. migration of glioma cells expressing MT1-MMP in the presence of We propose that N-Tes-⌬122, which is resistant to testican 2, may have other testican family proteins. Furthermore, we showed that testican 2 therapeutic potential as a barrier against glioma invasion. was expressed more highly than other testican family members both in normal and malignant astrocytic tissues. These results suggest that in contrast to other testican family members, only testican 2 contributes INTRODUCTION to malignant behavior of astrocytic tumors. MMPs4 are a family of Zn2ϩ-dependent enzymes that are essential for ECM turnover in normal and pathological conditions (1–3). To MATERIALS AND METHODS date, 21 mammalian MMPs have been identified by cDNA cloning, and they can be subgrouped into 15 soluble-type and 6 MT-MMPs. Reagents. DMEM was from Nissui Pharmaceutical Co., Ltd. (Tokyo, MMPs are overexpressed in various human malignancies (2, 3). The Japan). Primers were synthesized by Genset (Kyoto, Japan). Anti-FLAG M2 first MT-MMP (MT1-MMP) was identified as an activator of pro- and anti-HA antibodies were purchased from Sigma and Santa Cruz Biotech MMP-2, which functions on the cell surface (4). Although the proteolytic (Santa Cruz, CA), respectively. Cell Culture. Human embryonic kidney 293T cells, and U251, U87, U373, and T98G glioma cells were obtained from Health Science Resources Bank Received 9/5/02; accepted 4/15/03. The costs of publication of this article were defrayed in part by the payment of page (Osaka, Japan) and cultured in DMEM supplemented with 10% fetal bovine charges. This article must therefore be hereby marked advertisement in accordance with serum. 18 U.S.C. Section 1734 solely to indicate this fact. Expression Plasmids. Expression plasmids for MT1-MMP, MT3-MMP, 1 Supported by grants-in-aid for young scientists (B-14770707 to M. N.) and for MMP-2, and TIMP-2 were as described previously (4, 21). Expression plas- scientific research (B2-13470290 to J. Y., and B2-14370053 and 11240203 to H. S., respectively) from the Ministry of Education, Science and Culture of Japan, and a grant mids for testican 1, testican 2, testican 3, N-Tes, and N-Tes/testican-2 chimeric from the Hokkoku Foundation for Cancer Research (to M. N.). proteins tagged with FLAG or HA epitope at the COOH terminus were 2 These authors have equally contributed to this work. constructed as described previously (20, 22). Expression plasmids for N-Tes- 3 To whom requests for reprints should be addressed, at Department of Molecular ⌬122, testican 2-⌬-133, and testican 2-⌬-89 tagged with FLAG or HA epitope Virology and Oncology, Cancer Research Institute, Kanazawa University, 13-1 Takara- machi, Kanazawa, Ishikawa 920-0934, Japan. Phone: 81-76-265-2750; Fax: 81-76-234- were constructed by inserting cDNA fragment into respective plasmids. N-Tes- 4504; E-mail: [email protected]. ⌬122 cDNA fragment was PCR-amplified with pEAK8 5Ј primer and N-Tes 4 The abbreviations used are: MMP, matrix metalloproteinase; ECM, extracellular reverse primer TCTAGATCCTGCTTCTTTCATCCTG that starts at nucleotide matrix; TIMP, tissue inhibitor of metalloproteinase; MT, membrane type; HA, influenza 2ϩ 473 (GenBank accession no. AB054866) with an extra Xba I site (italicized). virus hemagglutinin; EC, extracellular C -binding; RT-PCR, reverse transcription-PCR; ⌬ ⌬ GAPDH, glyceraldehydes-3-phosphate dehydrogenase; ISH, in situ hybridization; The cDNA fragments encoding testican 2- -133 and testican 2- -89 were N-, NH2-. amplified with testican 2 forward primer GAATTCCAGACCACGAT- 3364

Table 1 Nucleotide sequence of primers and probesa Product size Target Sequence 5Ј-3Ј (bp) Testican 1 Forward primer ACACTAGCATCCTGCCCATCT (1147–1167) 86 Reverse primer AGGGTCAAGCAGGAGGTCATAG (1232–1211) Probe CTCCCTGGGCTGGATGTTCAACAA (1175–1198) Testican 2 Forward primer GCAATTTCATGGAGGACGAGC (393–413) 77 Reverse primer GAAGCGGTTCCAGTGCTTGAT (469–449) Probe ATGGCTGTCGTCCATCTCGCAGTACA (415–440) Testican 3 Forward primer GATAAGCCCACCAGTACAAGCA (683–704) 80 Reverse primer CGCAATCTGTTTGCCACTTC (762–743) Probe TAAGAGAGCATGCAGTGACCTGGAGTTCAG (712–741) N-Tes Forward primer CTAATAATGAGTGGTGCTACTGCTT (13–37) 82 Reverse primer ATGCAGGTCAACTATTTGCATC (94–73) Probe CAGAGACAGCAAGGTAAAAGATGAGACCC (39–67) a All of the TaqMan probes carried a 5Ј FAM (6-carboxy-fluorescein) reporter dye and a 3Ј TAMRA (6-carboxy-tetramethyl-rhodamine) quencher dye and contained a 3Ј phosphate group (p) to prevent extension during PCR. Nucleotide numbers for each primers are presented in parenthesis (GeneBank accession nos. CAA51999, CAA04774, NM_016950, and AB056866 for testican 1, testican 2, testican 3, and N-Tes, respectively).

Table 2 Nucleotide sequences of oligo probes used for in situ hybridizationa RESULTS Probe Sequence 5Ј-3Ј Testican 2 Abolishes Inactivation of MT-MMPs by Other Tes- Testican 1 GGGGCCCGCGCCTCCGGCGAGCGCGTCCAG (504–533) Testican 2 GTGCGCGTGCCAGTCAGCTCCAGGCCCAGC (1366–1395) ticans. Testican family members, except for testican 2, inhibit pro- Testican 3 AATGTATACATCATGGTCATCACCACCATC (1400–1429) MMP-2 processing mediated by MT1-MMP or MT3-MMP by bind- N-Tes GACATGCAGGTCAACTATTTGCATCTGTAA (1055–1084) ing to them (20). The effect of testican 2 expression on the inhibition a Nucleotide numbers for each primers are presented in parenthesis (GeneBank acces- of MT-MMPs by other testican family proteins was studied. Pro- sion nos. CAA51999, CAA04774, NM_016950, and AB056866 for testican 1, testican 2, testican 3, and N-Tes, respectively). MMP-2 was processed to an active form (Mr 62,000) through an intermediate form (Mr 64,000) by MT1-MMP, and mainly to an intermediate form by MT3-MMP (Fig. 1A). Pro-MMP-2 processing

GGGCGC starting at nucleotide 278 (GenBank accession no. CAA04774) with an extra EcoRI site (italicized) and reverse primer TCTAGAGTCTTTGTTTC- CATGGAG for testican 2- ⌬-133 or TCTAGAGGGGTCCTTGGTGGTATC for testican 2- ⌬-89 starting at nucleotide 684 or 553, respectively with an extra Xba I site (italicized). Gelatin Zymography, Western Blotting, and Immunoprecipitation. Gelatin zymography, Western blotting, and immunoprecipitation were performed as described previously (22, 23). Concentrations of N-Tes-FLAG and testican-2-FLAG in culture supernatants were estimated by Western blotting using partially purified proteins as standards. Wound-induced Migration Assays. 293T cells transfected with expression plasmid for N-Tes-FLAG, N-Tes-⌬122-FLAG, and/or testican 2-HA were cultured on 12-well plates coated with collagen for 24 h. After removing cells by washing with 0.025% EDTA, U251 cells stably expressing MT1-MMP (2 ϫ 105 cells/well) in DMEM containing 10% fetal bovine serum were plated. At 24 h after plating, subconfluent monolayers of the cells were scraped with a plastic tip and cultured additionally in serum-free DMEM. Migrating cells were photographed at 24 h after scraping. Clinical Samples and Histology. The classification of human brain tumors used in this study is based on the revised WHO criteria for tumors of the central nervous system (24). Fifty-one astrocytic tumors consisted of 9 low- grade astrocytomas, 8 anaplastic astrocytomas, and 34 glioblastomas. All of the tumor tissues were obtained at primary resection, and none of the patients had been subjected to chemotherapy or radiation therapy before resection. Real-Time Quantitative RT-PCR. Real-time quantitative RT-PCR was performed as described previously with primers listed in Table 1. The mRNA level of each testican gene was expressed as a molar ratio to GAPDH mRNA level. ISH. Specific antisense oligonucleotide DNA probes for ISH were de- signed complementary to the mRNA transcripts (Table 2). The specificity of Fig. 1. Interaction between testican 2 and other testican family proteins. A, expression each probe was confirmed as described previously (25). All of the DNA probes plasmids for MMP-2 (50 ng) and either MT1-MMP or MT3-MMP (100 ng) were cotrans- were synthesized with six biotin molecules (hyper biotinylated) at the 3Ј end fected with plasmids for testican tagged with FLAG epitope or TIMP-2 (450 ng) as indicated. via direct coupling using standard phosphoramidite chemistry (Research Ge- The culture supernatants were subjected to gelatin zymography (top panel). Cell lysates were netics, Huntsville, AL). analyzed by Western blotting with anti-FLAG antibody (bottom panel). B, expression plasmids for MMP-2 (50 ng), MT3-MMP (100 ng), and N-Tes-FLAG (450 ng) were cotransfected ␹2 Statistics. Statistical analyses were performed using the test and the with testican 2-FLAG plasmid (450, 400, 350, 300, 250, 200, 150, 100, 50, or 0 ng, two-tailed Mann-Whitney U test. Ps Ͻ 0.05 were considered significant. respectively), and the culture supernatants and cell lysates were analyzed as above. 3365

Downloaded from cancerres.aacrjournals.org on September 29, 2021. © 2003 American Association for Cancer Research. INTERACTION AMONG TESTICAN FAMILY PROTEINS by both MT1-MMP and MT3-MMP were inhibited by testican 1, 3, and N-Tes as was observed with TIMP-2. Coexpression of testican 2 abolished the inhibition by testican 1, 3, and N-Tes, whereas inhibition by TIMP-2 was not affected. Pro-MMP-2 activation mediated by MT3-MMP was inhibited by N-Tes, which was abrogated by the expression of testican 2 dependent on the dose of testican 2 plasmid (Fig. 1B). The concentrations of N-Tes in culture supernatants ranged from 840 to 950 ng/ml, and the highest testican 2 concentration in the supernatants was ϳ920 ng/ml. Mapping of Domains for the Interaction between Testican 2 and N-Tes. To identify the domain of N-Tes responsible for the interaction with testican 2, expression plasmids for N-Tes deletion mutants were constructed (Fig. 2, A and B). Testican 2-⌬89 and testican 2-⌬133 were both detected as two bands, one of which may represent monomer and the other dimmer form for each protein as estimated from molecular size. Expression of a deletion mutant of

N-Tes, which consists of NH2-terminal 122-amino acid residues (N- Tes-⌬122), inhibited pro-MMP-2 processing mediated by MT1-MMP or MT3-MMP as was observed with N-Tes (Fig. 2C, top panel). Expression of testican 2 abolished inhibition by N-Tes; however, inhibition by N-Tes-⌬122 was not affected by testican 2. A chimeric

Fig. 3. Coprecipitation of testican 2 with N-Tes. A, expression plasmids for N-Tes-HA and testican 2-FLAG were transfected either alone or simultaneously. Immunoprecipita- tion was performed with anti-FLAG antibody (left), and the precipitates were analyzed by Western blotting with anti-HA antibody (␣-HA). The blot was reprobed with anti-FLAG antibody (␣-FLAG). Whole cell lysates were also immunoblotted with anti-HA antibody to confirm an equal expression of N-Tes-HA (WCL). Immunoprecipitates prepared as above using anti-HA antibody (right) were also analyzed by anti-FLAG (␣-FLAG)or anti-HA antibody (␣-HA). Whole cell lysates were immunoblotted to confirm an equal expression of testican 2-FLAG with anti-FLAG antibody (WCL). B, cells were transfected with expression plasmids for N-Tes-HA, testican 2-FLAG, and its deletion mutants (⌬89-FLAG and ⌬133-FLAG) and analyzed as above. C, cells were transfected with expression plasmids for N-Tes-HA, N-Tes-⌬122-HA (⌬122-HA), and testican-2-FLAG, and analyzed as above.

protein between N-Tes and testican 2, which consists of a signal peptide and the unique domain of N-Tes and other domains of testican 2 (N-Tes/Tes-2) inhibits MT-MMP-mediated pro-MMP-2 activation as shown with wild-type N-Tes. However, unlike wild-type N-Tes, inhibition by N-Tes/testican 2 chimera was not restored by testican 2 (Fig. 2C, top panel). Deletion of COOH-terminal EC domain from N-Tes was enough to abrogate the susceptibility to testican 2 (data not shown), suggesting that testican 2 interacts with the COOH-terminal EC domain of N-Tes. Next, to identify the domain of testican 2 responsible for the inactivation of N-Tes, testican 2 deletion mutants were constructed,

which comprised the NH2-terminal 89- and 133-amino acid residues (testican 2-⌬89 and testican 2-⌬133), respectively (Fig. 2A). These deletion mutants still abrogated inhibition of MT-MMPs by N-Tes as wild-type testican 2 did (Fig. 2C, bottom panel). These results suggest that the NH -terminal unique domain of testican 2 interacts with the Fig. 2. Direct interaction between testican 2 and N-Tes. A, schematic representation of 2 N-Tes, testican 2, and their mutants. S (signal sequence), U (unique domain), FS (fol- EC domain of N-Tes. listatin-like domain), EC (extracellular calcium-binding domain), TY (thyroglobulin-like Testican 2 Forms a Complex with N-Tes. To examine the inter- domain), and two putative glycosaminoglycan attachment sites are indicated. aa, amino action between N-Tes and testican 2, coimmunoprecipitation of these acids. B, expression of N-Tes or N-Tes-⌬122 tagged with HA epitope, and testican 2 or its mutant protein tagged with FLAG epitope was confirmed by Western blotting with proteins was tested (Fig. 3). N-Tes-HA was detected in the precipi- anti-HA or anti-FLAG antibody. C, expression plasmids for N-Tes, testican 2, or their tates from cells cotransfected with both N-Tes-HA and testican mutant proteins were cotransfected with MMP-2 plasmid and either MT1-MMP or MT3-MMP plasmid as described in legend for Fig. 1. Culture supernatants were analyzed 2-FLAG plasmids, but not from cells transfected with either plasmid by gelatin zymography. alone (Fig. 3A, left panel). In the reciprocal experiment, testican 2 was 3366

that testican 2 binds to the COOH-terminal EC domain of N-Tes

through its NH2-terminal unique domain. Testican 2 Abrogates Reduction of MT1-MMP-mediated Cell Migration by N-Tes. Stable transfection of MT1-MMP in U251 cells

was confirmed by gelatin zymography, in which Mr 64,000 and 62,000 gelatinolytic bands, representing the intermediate and active form of MMP-2, respectively, were observed (Fig. 4A). Migration of parental U251 cells on collagen-coated dish in serum-free medium was minimal (Fig. 4B). Expression of MT1-MMP in U251 cells induced migration on collagen, and this was completely blocked by the addition of MMP inhibitor BB-94 to the culture medium. These results indicate that migration of U251 cells on collagen under serum- free condition is dependent on MT1-MMP activity. In the presence of 10% serum in the culture medium, U251 cells migrated actively on the collagen-coated dish regardless of MT1-MMP activity (data not shown). To examine the effect of N-Tes, N-Tes-⌬122, and/or testican 2 on MT1-MMP-dependent cell migration, they were deposited on collagen by culturing 293T cells transfected with each gene on dishes coated with collagen. The amount of each protein deposited on collagen was analyzed by Western blotting (Fig. 4C). Both N-Tes and N-Tes-⌬122 were deposited effectively on collagen-coated on dishes. Testican 2 was deposited only at a trace level but at a moderate level when coexpressed with N-Tes. However, deposition of testican 2 was not stimulated by coexpression with N-Tes-⌬122. The migration of U251 cells expressing MT1-MMP on N-Tes- coated collagen was quite low compared with migration on mock- Fig. 4. Effects of testican on cell migration. A, the culture medium from U251 cells coated collagen, and codeposition of testican 2 recovered the cell mock-transfected (Mock) or transfected with MT1-MMP expression plasmid (MT1-MMP) were subjected to gelatin zymography. B, migration assay with mock-transfected (Mock) migration blocked by N-Tes. The migration of U251 cells expressing or MT1-MMP-transfected U251 cells (MT1-MMP) was performed in the presence MT1-MMP was also inhibited by deposition of N-Tes-⌬122 on col- (ϩBB94) or absence of 1 ␮M BB-94. Migrating cells were photographed under phase lagen. As described above, culturing of cells expressing both N-Tes- ϫ microscopy 24 h after scraping ( 150). C, N-Tes-FLAG, testican 2-FLAG, or N-Tes- ⌬ ⌬ ⌬122-HA deposited on collagen-coated plates and in cell lysates was analyzed by Western 122 and testican 2 deposited only N-Tes- 122 but not testican 2 on blotting with anti-FLAG or anti-HA antibody. D, migration assay with U251 glioma cells collagen, and thus migration of cells expressing MT1-MMP remained mock-transfected or stably transfected with the MT1-MMP cDNA was performed on collagen-coated plates pretreated as above. restricted. The mRNA Expression Levels of Testican Family Genes. To evaluate the expression levels of each testican family gene, quantita- coimmunoprecipitated with N-Tes (Fig. 3A, right panel). N-Tes-HA tive RT-PCR for each testican mRNA was performed using GAPDH was also coprecipitated with testican 2-FLAG deletion mutants (tes- mRNA as an internal standard (Fig. 5). The mRNA levels of all of the tican 2-⌬89-FLAG, testican 2-⌬133-FLAG; Fig. 3B); however, N- testican family genes (testican mRNA:GAPDH mRNA molar ratios) Tes-HA deletion mutant lacking EC domain (⌬122-HA) failed to be were significantly lower in glioblastoma tissues (testican 1, 2, 3, and coprecipitated with testican-2-FLAG (Fig. 3C). These results indicate N-Tes, 0.093 Ϯ 0.081, 0.107 Ϯ 0.111, 0.007 Ϯ 0.02, and

Fig. 5. The mRNA expression levels of testican family genes. The relative mRNA expression levels of testican family genes (testican mRNA:GAPDH mRNA molar ratios) in the normal brain (NB), low grade astrocytoma (LGA), anaplastic astrocytoma (AA), glioblastoma (GB), metastatic brain tumor (Meta), and glioma cell lines (GCL) were analyzed by the quantitative RT-PCR method. Each mRNA level was expressed as a proportion of the highest mRNA level of testican 2, which was given a value ,ءء ;P Ͻ 0.05 ,ء .of 1. Bars indicate mean value P Ͻ 0.01.

3367

Fig. 6. ISH for testican family mRNA. ISH was performed as described in “Materials and Meth- ods.” Note that strong signals for the mRNA of all testican family genes were detected in the neurons of normal brain, as indicated by arrows (A), and weak signals for testican 1 and testican 2 mRNAs but not for testican 3 and N-Tes in the neoplastic astrocytes as indicated by arrows (B). The poly(dT)20 probe gave a strong signal in all cells, and poly(dA)20 probe gave only a background signal in all tissue samples. Eosin counterstain. Tes-1, testican 1; Tes-2, testican 2; Tes-3, testican 3. Bar, 50 ␮m.

0.029 Ϯ 0.041, respectively; n ϭ 34) than those in normal brain of N-Tes/testican 3. Thus, N-Tes-⌬122 lacking the EC domain did not tissues (0.251 Ϯ 0.053, P Ͻ 0.01; 0.592 Ϯ 0.224, P Ͻ 0.01; interact with testican 2, but it did inhibit MT-MMPs. It was rather 0.182 Ϯ 0.062, P Ͻ 0.01; and 0.359 Ϯ 0.108, P Ͻ 0.01, respectively; surprising to find that testican 2 abrogates inhibition of MT-MMP- n ϭ 10), and their expression levels decrease significantly as tumor mediated pro-MMP-2 activation by N-Tes by binding to its EC grade increases. The mean expression level of testican 2 was the domain, because this is not involved in the inhibition of MT-MMPs. highest among testican family regardless of histological grade of The precise mechanism of interaction between testican 2 and other astrocytic tumors. testican family proteins is not clear thus far, but binding of testican 2 ISH. Cells expressing mRNA for testican family members in the to the EC domain of N-Tes/testican 3 may cause conformational normal brain and glioblastomas were identified by ISH (Fig. 6). The change, which may hamper access to MT-MMPs or may sterically polyT probe gave a strong signal in all of the cells, but polyadenylic hinder access to MT-MMPs. acid probe gave only a background signal in the normal brain and Migration of U251 cells on dishes coated with collagen under glioblastoma tissues. The signals for each testican mRNA were de- serum-free condition was greatly enhanced by MT1-MMP activity. tected with antisense RNA probes mainly in the neurons, but also in MT1-MMP-dependent cell migration on collagen was observed only some endothelial cells in normal brain (Fig. 6A). Only testican 1 and under serum-free condition, and the cells migrated more aggressively testican 2 mRNA was just detected in astrocytic tumor tissues, but in the presence of serum independent of MT1-MMP activity. Detach- testican 3 and N-Tes mRNA was at negligible level (Fig. 6B). These ment of U251 cells from collagen would be the rate-limiting step results are consistent with that of RT-PCR analysis. under serum-free condition, and degradation of collagen by MT1- MMP may accelerate the migration. This would be supported by the DISCUSSION fact that MT3-MMP, which does not degrade type I collagen, did not stimulate migration of U251 cells on collagen.5 Binding of testican 2 We identified previously N-Tes as an inhibitor of MT-MMPs, to N-Tes abrogated inhibition of MT1-MMP-dependent cell migration which is encoded by a spliced variant of testican 3 gene, and showed by N-Tes, as testican 2 abolished inhibition of MT1-MMP-mediated that testican 1 and testican 3 but not testican 2 also have an inhibitory MMP-2 activation by N-Tes. N-Tes-⌬122, which is unable to form a function (20). Testican 2 was identified through the screening of a human cDNA library using an expressed sequence tag related to complex with testican 2, does not induce deposition of testican 2 on BM-40/osteonectin/SPARC, and was shown to be expressed mainly in collagen. Thus, testican 2 did not affect suppression of MT1-MMP- ⌬ brain (17). Our ISH study indicated that testican 2 was localized mediated MMP-2 activation or cell migration by N-Tes- 122. mainly to neurons and some endothelial cells in normal brain as The mRNA levels of all of the testican family members are lower reported previously (17, 19). Other testican family genes, including in glioblastoma samples than those in normal brain tissues, and testican 3 and N-Tes, were also coexpressed predominantly in neu- decrease significantly as tumor grade increases. The mRNA level of rons. Because BM-40 is an ECM molecule well known as a modulator testican 2 is the highest among testican family members in normal and of cell adhesion and proliferation (17, 26–29), testican 2 is also astrocytic tumor tissues. Furthermore, mRNAs of all of the testican thought to function in tissue remodeling. Hartmann and Maurer (30) family members are coexpressed mainly in neurons. Although the showed in vitro that testican 2 inhibits neurite outgrowth, suggesting association of testican 2 with other ECM molecules remains to be that testican-2 may be involved in axonal pathfinding during the examined, these results suggest that testican 2 could be deposited in development of the nervous system. However, the precise function of ECM of brain in a complex form with other testican family proteins. testican 2 as a component of ECM still remained to be explored. In conclusion, testican 2 may contribute to ECM remodeling by The present study demonstrated that testican 2 interacts with other regulating function(s) of other testican family members, which pos- testican family proteins and abolishes their inactivation of MT-MMPs. sess MT-MMP inhibitory function. N-Tes-⌬122, which is incorpo- Testican 2 was shown to form a complex with N-Tes/testican 3 5 through the NH2-terminal unique domain of testican 2 and EC domain Unpublished observations. 3368

Downloaded from cancerres.aacrjournals.org on September 29, 2021. © 2003 American Association for Cancer Research. INTERACTION AMONG TESTICAN FAMILY PROTEINS rated into ECM and refractory to inactivation by testican 2, may have 15. Alliel, P. M., Perin, J. P., Jolles, P., and Bonnet, F. J. Testican, a multidomain potential novel function as a barrier of glioma invasion. testicular proteoglycan resembling modulators of cell social behaviour. Eur. J. Bio- chem., 214: 347–350, 1993. 16. Charbonnier, F., Perin, J. P., Roussel, G., Nussbaum, J. L., and Alliel, P. M. Cloning ACKNOWLEDGMENTS of testican/SPOCK in man and mouse. Neuromuscular expression perspectives in pathology. C. R. Seances Soc. Biol. Fil., 191: 127–133, 1997. We thank Erik Thompson for critical reading of the manuscript. 17. Vannahme, C., Schubel, S., Herud, M., Gosling, S., Hulsmann, H., Paulsson, M., Hartmann, U., and Maurer, P. Molecular cloning of testican 2: defining a novel REFERENCES calcium-binding proteoglycan family expressed in brain. J. Neurochem., 73: 12–20, 1999. 1. Woessner, J. F. J. Matrix metalloproteinases and their inhibitors in connective tissue 18. Bonnet, F., Perin, J. P., Charbonnier, F., Camuzat, A., Roussel, G., Nussbaum, J. L., remodeling. FASEB J., 5: 2145–2154, 1991. and Alliel, P. M. Structure and cellular distribution of mouse brain testican. Associ- 2. Birkedal, H. H., Moore, W. G., Bodden, M. K., Windsor, L. J., Birkedal, H. B., ation with the postsynaptic area of hippocampus pyramidal cells. J. Biol. Chem., 271: DeCarlo, A., and Engler, J. A. Matrix metalloproteinases: a review. Crit. Rev. Oral 4373–4380, 1996. Biol. Med., 4: 197–250, 1993. 19. Marr, H. S., Basalamah, M. A., Bouldin, T. W., Duncan, A. W., and Edgell, C. J. 3. Stetler-Stevenson, W. G., Aznavoorian, S., and Liotta, L. A. Tumor cell interactions Distribution of testican expression in human brain. Cell Tissue Res., 302: 139–144, with the extracellular matrix during invasion and metastasis. Annu. Rev. Cell Biol., 2000. 9: 541–573, 1993. 20. Nakada, M., Yamada, A., Takino, T., Miyamori, H., Takahashi, T., Yamashita, J., and 4. Sato, H., Takino, T., Okada, Y., Cao, J., Shinagawa, A., Yamamoto, E., and Seiki, M. Sato, H. Suppression of membrane-type 1 matrix metalloproteinase (MMP)-mediated A matrix metalloproteinase expressed on the surface of invasive tumour cells. Nature MMP-2 activation and tumor invasion by testican 3 and its splicing variant gene (Lond.), 370: 61–65, 1994. product. N-Tes. Cancer Res., 61: 8896–8902, 2001. 5. Will, H., Atkinson, S. J., Butler, G. S., Smith, B., and Murphy, G. The soluble 21. Takino, T., Sato, H., Shinagawa, A., and Seiki, M. Identification of the second catalytic domain of membrane type 1 matrix metalloproteinase cleaves the propeptide membrane-type matrix metalloproteinase (MT-MMP-2) gene from a human placenta of progelatinase A and initiates autoproteolytic activation. Regulation by TIMP-2 and cDNA library. MT-MMPs form a unique membrane-type subclass in the MMP TIMP-3. J. Biol. Chem., 271: 17119–17123, 1996. family. J. Biol. Chem., 270: 23013–23020, 1995. 6. Wang, Y., Johnson, A. R., Ye, Q. Z., and Dyer, R. D. Catalytic activities and substrate 22. Miyamori, H., Takino, T., Kobayashi, Y., Tokai, H., Itoh, Y., Seiki, M., and Sato, H. specificity of the human membrane type 4 matrix metalloproteinase catalytic domain. J. Biol. Chem., 274: 33043–33049, 1999. Claudin promotes activation of pro-matrix metalloproteinase-2 mediated by mem- 7. Lehti, K., Valtanen, H., Wickstrom, S., Lohi, J., and Keski-Oja, J. Regulation of brane-type matrix metalloproteinases. J. Biol. Chem., 276: 28204–28211, 2001. membrane-type-1 matrix metalloproteinase activity by its cytoplasmic domain. 23. Nakada, M., Yamashita, J., Okada, Y., and Sato, H. Ets-1 positively regulates J. Biol. Chem., 275: 15006–15013, 2000. expression of urokinase-type plasminogen activator (uPA) and invasiveness of astro- 8. Velasco, G., Cal, S., Merlos-Suarez, A., Ferrando, A. A., Alvarez, S., Nakano, A., cytic tumors. J. Neuropathol. Exp. Neurol., 58: 329–334, 1999. Arribas, J., and Lopez-Otin, C. Human MT6-matrix metalloproteinase: identification, 24. Kleihues, P., Burger, P. C., Scheithauer, B. W. Histological Typing of Tumours of the progelatinase A activation, and expression in brain tumors. Cancer Res., 60: 877– Central Nervous System, pp. 11–20. Berlin: Springer-Verlag, 1993. 882, 2000. 25. Greene, G. F., Kitadai, Y., Pettaway, C. A., von Eschenbach, A. C., Bucana, C. D., 9. Nomura, H., Sato, H., Seiki, M., Mai, M., and Okada, Y. Expression of membrane- and Fidler, I. J. Correlation of metastasis-related gene expression with metastatic type matrix metalloproteinase in human gastric carcinomas. Cancer Res., 55: 3263– potential in human prostate carcinoma cells implanted in nude mice using an in situ 3266, 1995. messenger RNA hybridization technique. Am. J. Pathol., 150: 1571–1582, 1997. 10. Ueno, H., Nakamura, H., Inoue, M., Imai, K., Noguchi, M., Sato, H., Seiki, M., and 26. Bolander, M. E., Young, M. F., Fisher, L. W., Yamada, Y., and Termine, J. D. Okada, Y. Expression and tissue localization of membrane-type 1, 2, and 3 matrix Osteonectin cDNA sequence reveals potential binding regions for calcium and hy- metalloproteinases in human invasive breast carcinoma. Cancer Res., 57: 2055–2060, droxyapatite and shows homologies with both a basement membrane protein 1997. (SPARC) and a serine proteinase inhibitor (ovomucoid). Proc. Natl. Acad. Sci. USA, 11. Nakamura, H., Ueno, H., Yamashita, K., Shimada, T., Yamamoto, E., Noguchi, M., 85: 2919–2923, 1988. Fujimoto, N., Sato, H., Seiki, M., and Okada, Y. Enhanced production and activation 27. Mason, I. J., Taylor, A., Williams, J. G., Sage, H., and Hogan, B. L. Evidence from of progelatinase A mediated by membrane-type 1 matrix metalloproteinase in human molecular cloning that SPARC, a major product of mouse embryo parietal endoderm, papillary thyroid carcinomas. Cancer Res., 59: 467–473, 1999. is related to an endothelial cell ‘culture shock’ glycoprotein of Mr 43,000. EMBO J., 12. Nakada, M., Nakamura, H., Ikeda, E., Fujimoto, N., Yamashita, J., Sato, H., Seiki, 5: 1465–1472, 1986. M., and Okada, Y. Expression and tissue localization of membrane-type 1, 2, and 3 matrix metalloproteinases in human astrocytic tumors. Am. J. Pathol., 154: 417–428, 28. Lane, T. F., and Sage, E. H. Functional mapping of SPARC: peptides from two ϩ ϩ 1999. distinct Ca ( )-binding sites modulate cell shape. J. Cell Biol., 111: 3065–3076, 13. Nakada, M., Kita, D., Futami, K., Yamashita, J., Fujimoto, N., Sato, H., and Okada, 1990. Y. Roles of membrane type 1 matrix metalloproteinase and tissue inhibitor of 29. Tremble, P. M., Lane, T. F., Sage, E. H., and Werb, Z. SPARC, a secreted protein metalloproteinases 2 in invasion and dissemination of human malignant glioma. associated with morphogenesis and tissue remodeling, induces expression of metal- J. Neurosurg., 94: 464–473, 2001. loproteinases in fibroblasts through a novel extracellular matrix-dependent pathway. 14. Bonnet, F., Perin, J. P., Maillet, P., Jolles, P., and Alliel, P. M. Characterization of a J. Cell Biol., 121: 1433–1444, 1993. human seminal plasma glycosaminoglycan-bearing polypeptide. Biochem. J., 288: 30. Hartmann, U., and Maurer, P. Proteoglycans in the nervous system–the quest for 565–569, 1992. functional roles in vivo. Matrix Biol., 20: 23–35, 2001.

3369

Downloaded from cancerres.aacrjournals.org on September 29, 2021. © 2003 American Association for Cancer Research. Testican 2 Abrogates Inhibition of Membrane-type Matrix Metalloproteinases by Other Testican Family Proteins

Mitsutoshi Nakada, Hisashi Miyamori, Junkoh Yamashita, et al.

Cancer Res 2003;63:3364-3369.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/63/12/3364

Cited articles This article cites 29 articles, 14 of which you can access for free at: http://cancerres.aacrjournals.org/content/63/12/3364.full#ref-list-1

Citing articles This article has been cited by 14 HighWire-hosted articles. Access the articles at: http://cancerres.aacrjournals.org/content/63/12/3364.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/63/12/3364. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.