CHARACTERIZATION OF AN EHRLICHIA MURIS-LIKE ORGANISM

ISOLATED FROM A TICK IN MINNESOTA

A DISSERTATION SUBMITTED TO THE FACULTY OF THE

GRADUATE SCHOOL OF MINNESOTA

BY

Geoffrey Everett Lynn

IN PARTIAL FULFILLMENT OF THE REQUIREMENTS

FOR THE DEGREE OF DOCTOR OF PHILOSOPHY

Dr. Ulrike G. Munderloh

September 2016

UNIVERSITY OF MINNESOTA

© Geoffrey Everett Lynn 2016

i

Acknowledgements

I am very grateful to my advisor, Dr. Uli Munderloh for giving me the opportunity to study and apply research methods in such an excellent learning environment. Despite my lack of prior laboratory experience, she took a chance on me, allowing me to pursue my own interests, and with patience when I failed.

I also thank Dr. Tim Kurtti for generously allowing me the use of his and Uli’s facilities and equipment, and taking the time to show me the techniques, including the one that resulted in the culture isolation of EmCRT. I would also like to acknowledge the contributions of my other committee members, Dr. Ann Fallon and Dr. Jeff Bender for their contributions to my academic progress.

I am grateful to Dr. Jon Oliver for helping me with many experiments and providing advice on being a graduate student and a scientist, and the rest of the lab scientists – Rod, Nicole, and Curt - for patiently showing me many a technique, and reviewing my work whenever asked. I also want to thank Adela, Chan and Lisa for their contributions to my work, and Sarah, Kendra, Bryten, Ellie, and Kenwyn for their work in the lab. I could not have asked for a better lab group.

Finally, I would like to thank my friends and family for their support throughout this lengthy process.

This research was funded under grant number R01AI042792 provided by the

National Institutes of Health (USA) and awarded to Dr. Munderloh. ii

Dissertation Abstract

The Ehrlichia muris-like agent (EMLA) is a newly recognized zoonotic disease agent occurring in the Upper Midwestern United States.

In the fall of 2011, two years after the organism was isolated from a human patient, a second isolate was cultured from an engorged tick. The following thesis is a description of the steps taken to identify this tick- derived organism as a second EMLA isolate. The tick-derived isolate

(EmCRT) was characterized with a variety of techniques, including cell culture, genetic sequencing, tick-host transmission models, rodent histopathology, and transmission electron microscopy. Prior to this work, infection in ticks had not been well-described for most members of the

Anaplasmataceae family, including Ehrlichia spp. The EmCRT isolate was transformed with a Himar1 transposon to produce mutant organisms that are visible under live microscopy in both cell culture and live tick tissues. In situ hybridization and transmission electron microscopy of whole-sectioned infected ticks enabled additional localization and description of tick tissues harboring EMLA. White-footed mice, as both a common host for immature ticks in the Upper Midwest, and the only non- human vertebrate species with evidence of EMLA infection, are a iii presumed reservoir host for this pathogen. To evaluate this, a tick-host transmission study was conducted, and we present evidence that white- footed mice are, indeed, competent reservoirs of EMLA. Co-feeding transmission between ticks was also demonstrated. Tick-transmitted EMLA was highly pathogenic for non-inbred rodents, emphasizing the importance of tick phenology and co-feeding transmission in the natural maintenance of EMLA. iv

Table of Contents

Page

Acknowledgements……………………………………….……….…...…..i

Dissertation Abstract………………………………...……...……..….……ii

Table of Contents………………………..………………….……….…….iv

List of Figures……………………………………………….….…...……..v

List of Tables……………………………………………….….…….…...xii

Supplemental Resources……………………………………….…..…….xiii

Chapter 1. Background on Ehrlichia spp., including history, biology, ecology, and epidemiology…………………………………………..…….1

Chapter 2. Characterization and genetic transformation of an Ehrlichia isolated from a Minnesota tick………………………...…………...……..13

Chapter 3. Tissue distribution of the Ehrlichia muris-like agent in a tick vector………………………………………………………………...……46

Chapter 4. Experimental evaluation of Peromyscus leucopus as a reservoir host of the Ehrlichia muris-like agent………………………..…………...68

Summary…………………………………………………...……………..87

References………………………………………………………...………89

v

List of Figures

Chapter 2. Characterization and genetic transformation of an

Ehrlichia isolated from a Minnesota tick

Figure 1. Giemsa-stained cells showing EmCRT morulae in a variety of cultured cell lines.……………………………………………………..….36

Figure 2. Phylogenetic tree showing the relationship between EmCRT and closely related Ehrlichia……………………………………….……….....37

Figure 3. H&E stained lung sections displaying pathology in C57BL/6 mice with acute EmCRT infection…………………………………….….38

Figure 4. Lung tissue from acutely infected C57BL/6 mice containing morulae that are stained or labeled using ISH…………………….…..…..39

Figure 5. Live confocal images of tick tissue infected with mCherry

EmCRT…………………………………………………………………....40

Figure 6. Live confocal images of mCherry EmCRT in cell culture.….…41

Figure 7. Electron micrographs of EmCRT morulae……………………..42

vi

Chapter 3. Tissue distribution of the Ehrlichia muris-like agent in a tick

Figure 1. Whole tick sections subjected to ISH assay. Includes the basis capitulum region and synganglion………………………………………..63

Figure 2. Whole tick sections subjected to ISH. Includes acini and male reproductive organs…………………………………………………….....64

Figure 3. Whole tick sections subjected ISH. Includes acini and salivary ducts……………………………………………………………………....65

Figure 4. Whole tick sections subjected to ISH. Includes tracheae, appendages, and side-by-side bright field/fluorescent microscopy…..…..66

Figure 5. Transmission electron micrographs of EmCRT morulae in tick tissues…………………………………………………………………..…67

Chapter 4. Experimental evaluation of Peromyscus leucopus as a

reservoir host of the Ehrlichia muris-like agent

Figure 1. Timeline showing the course of EmCRT infection in WFM, including transmissibility for ticks……………………………….....…….82 vii

Figure 2. Lung tissue from WFM infected with EmCRT, with pathological lesions and morulae as shown by H&E staining and ISH………………...83

Figure 3. Liver tissue from WFM infected with EmCRT, with pathological lesions and morulae as shown by H&E staining and ISH……..…..…..….84

Figure 4. Brain tissue from WFM infected with EmCRT, as shown by sections treated with H&E staining and ISH…………………….………..85

Figure 5. EMLA-infected vasculature within the leptomeninges, demonstrated using ISH. ………………………………………..…..…...86

List of Tables

Chapter 2. Characterization and genetic transformation of an

Ehrlichia isolated from a Minnesota tick

Table 1. DNA oligonucleotides used in the study for PCR and probing...43

Table 2. Genomic insertion sites and proposed gene interruptions for mCherry and mKate mutants generated with Himar1 transposases……...43

viii

Supplementary Resources

Chapter 2. Characterization and genetic transformation of an

Ehrlichia isolated from a Minnesota tick

S1. Maps of the Himar1 transposon and transposase plasmids used to create mutant EmCRT………………………………………………….…44

S2. Dissemination of EmCRT to mouse tissues, as diagnosed using PCR and gel electrophoresis……………….………………………….………..44

S3. Relative ehrlichial load of wild-type versus mutant EmCRT in mouse lung tissue as determined by qPCR………………………….……………45 1

Chapter 1

Background on Ehrlichia spp., including history, biology, ecology, and epidemiology

2

History and Classification

Ehrlichia is a genus of rickettsial bacteria classified within the Anaplasmataceae family, which currently includes Ehrlichia chaffeensis, Ehrlichia canis, Ehrlichia

(Cowdria) ruminantium, Ehrlichia ewingii, Ehrlichia mineirensis and Ehrlichia muris.

Ehrlichiae are gram-negative alpha proteobacteria with relatively small genomes

(~1200-1400 kilobase pairs) that form intracellular inclusions called “morulae” consisting of groups of bacteria contained within host cell membranes. Although highly pleomorphic, in cell culture ehrlichiae typically appear in either dense core or reticulate forms (1), which divide by binary fission. All are zoonotic disease agents and are transmitted by hard-bodied (Ixodid) ticks.

Ehrlichiosis was first described in the 1800’s as a livestock disease called heartwater, later determined to be caused by E. ruminantium. The genus was eventually named after the German bacteriologist Paul Ehrlich (2). Heartwater, also known as cowdriosis after Edmund Cowdry, a Canadian rickettsiologist who first described the condition in South African cattle (3), was the most prominent disease caused by members of the currently-recognized genus until human cases of ehrlichiosis caused by

E. chaffeensis were described in the United States in 1986 (4, 5).

In 2011, Pritt et al. reported detection of an ehrlichial organism in patient samples that had not previously been recognized in North America (6). Atypical melting points (outside of the predetermined range for targets) associated with a diagnostic real-time polymerase chain reaction (PCR) assay detected a bacterial species distinct from other Anaplasmataceae of medical relevance. An isolate was then 3 cultured from blood obtained from a human patient using rhesus and tick cells, and genetic sequencing allowed for comparison with other Ehrlichia spp. Sequences for the

16S rRNA and GroEL heat-shock protein genes indicated that the new organism was most closely related to Ehrlichia muris isolates originating in Asia, and the organism was provisionally named “E. muris-like agent”, or EMLA. At approximately the same time frame, DNA of an organism with similar gene sequence was extracted from ticks collected in Wisconsin during the mid-1990’s, and amplified using primers targeting the

16S rDNA, groEL, and citrate synthase genes (7). Though EMLA sequences have been detected in multiple patients, the only isolates in existence are the one obtained from human blood, and a second isolate from an engorged tick that will be further described in this thesis.

Human epidemiology

At present, human monocytic ehrlichiosis (HME) caused by E. chaffeensis is the most commonly reported ehrlichiosis, with a peak of 961 cases reported in the United

States in 2008 (8). Clinical outcomes of infection range from asymptomatic to severe illness, including various combinations of fever, headache, chills, malaise, myalgia, nausea, confusion, conjunctival injection, arthralgia, and rash (9). The distribution of

HME corresponds with the range of the lone star tick (Amblyomma americanum), with cases reported from the eastern seaboard to the southeastern and southcentral U.S. (9).

Though diagnostic serologic tests occasionally indicated that patients in Minnesota had been exposed to E. chaffeensis, available surveillance records for local animal hosts and 4 ticks did not support the presence of this organism in Minnesota and Wisconsin, where lone star ticks have yet to establish endemic populations. Serological cross reactivity with an undetermined related pathogen and/or travel-related exposure were considered plausible explanations.

In 2009, ehrlichial infections were identified in four symptomatic patients from either Minnesota or Wisconsin. Sequencing of bacterial DNA indicated that the groEL and 16S rDNA genes matched the genetic sequence of E. muris, an Old World

Ehrlichia occurring in Eastern Europe to Japan that is not widely recognized as a human pathogen (10, 11).

As of 2013, 69 cases of human ehrlichiosis confirmed as EMLA infection have been reported, all of which were likely to have been exposed in either Minnesota or

Wisconsin. This number probably under-represents actual disease incidence given that availability of diagnostic testing for this organism is very limited. For reported cases, onset of illness peaked during June and July when human exposure to questing blacklegged ticks (Ixodes scapularis) is highest in the Upper Midwest (12, 13).

Clinical presentation of ehrlichiosis caused by EMLA is non-specific and similar to that of HME and human anaplasmosis (HA), which makes it difficult to diagnose.

Symptoms most commonly reported include fever, headache and fatigue, but also nausea, myalgia, vomiting, and rash. Laboratory findings include lymphopenia, thrombocytopenia, anemia, elevated hepatic aminotransferases, and mildly elevated alkaline phosphatase levels (6, 12). As with other species belonging to

Anaplasmataceae, doxcycline is the preferred antibiotic treatment for EMLA. 5

Cell tropism for EMLA has yet to be definitively identified, though the organism has been cultured in multiple cell lines, including those derived from embryonic ticks (ISE6) and rhesus monkey choroid retina (RF/6A). In contrast to E. chaffeensis and Anaplasma phagocytophilum, two other causes of acute febrile illness which may be diagnosed through visual identification of morulae in monocytes and neutrophils, respectively, of peripheral blood smears, EMLA infections in humans have not been identified though this method, even in patients with positive serological and

PCR results. At this time, the route for EMLA dispersion throughout the mammalian circulatory system is unknown. However, E. chaffeensis has been shown to be capable of replication outside of host cells while retaining infectivity and pathogenicity in mice

(14). Another study found that E. muris preferentially replicates within bone marrow- derived macrophages in mice (15). We found that endothelial cells appear to be the most widely infected cell types in mice infected with EMLA (16, 17).

Vector

Initial surveillance work in or near areas of where patient exposures are thought to have occurred has focused on the two primary tick species known to attack humans in these areas: the blacklegged tick, and the American dog tick (Dermacentor variabilis). DNA sequence matching EMLA was amplified from I. scapularis in three separate instances: first as part of a retrospective analysis of blacklegged ticks collected near Spooner, WI in the 1990’s (7), and second from I. scapularis collected in

Minnesota and Wisconsin in 2009 (6). Prevalence of EMLA was very low (16/534, 3% 6 and 7/760, 1%) in these samples. A more recent publication tested I. scapularis collected between 2007 and 2012 at military reserves in Minnesota and Wisconsin, and likewise, reported low prevalence (0-7.5%). In this same study, I. scapularis collected at a similar installation in Pennsylvania all tested negative (18). Presently, EMLA has not been found outside these two midwestern states, despite the existence of well- established populations of I. scapularis in the New England, Mid-Atlantic and

Southeastern regions. The American dog tick is sympatric in most regions where blacklegged ticks are found and frequently bites humans. However, of 88 D. variabilis collected at EMLA-endemic areas, none were positive by PCR (6). The lone star tick

(Amblyomma americanum), which is the primary vector for E. chaffeensis, is unlikely to play a significant role in natural maintenance of EMLA given that its range does not extend into Minnesota and Wisconsin (19). On a global scale, E. muris is carried by the taiga tick, I. persulcatus in Eastern Russian and Siberia (20, 21) while in Japan, E. muris is thought to be transmitted by Haemaphysalis flava (22), a metastriate tick species not present in the United States. The rabbit tick, Haemaphysalis leporispalustris is found in the Americas (23), however it has not been associated with any Ehrlichia sp., is not a competent vector for A. phagocytophilum, and rarely bites humans (24).

Ixodid ticks including I. scapularis undergo four distinct life stages: egg, larva, nymph, and adult. Blacklegged ticks are categorized as a three host ticks, where a first blood meal allows the six-legged larvae to transform into eight-legged nymphs.

Following a second blood meal, engorged nymphs molt into adults. Mating occurs 7 either off host or on the third host, typically white-tailed deer (Odocoileus virginianus), where females take a final blood meal that will be used to produce an egg mass.

Molting of immature stages and egg deposition occurs in the leaf litter and humus, after engorged ticks have dropped off their host. Larvae emerge from the eggs the following summer (25, 26). This life cycle typically spans a period of two to three years, depending on local environmental conditions (27, 28). Blacklegged ticks are arguably the most medically important vector ticks in North America, as they are responsible for the greatest number of cases of tickborne illness and transmit the largest variety of pathogens, including the agents for Lyme disease, human anaplasmosis, babesiosis, and

Powassan encephalitis. With the exception of Powassan virus (29), none of these pathogens are transmitted vertically from female tick to offspring (transovarial transmission), effectively excluding larvae from pathogen transmission. Though adult

I. scapularis are most likely to carry pathogens as a result of having fed on multiple hosts, this life stage is also the most conspicuous to potential human hosts.

Accordingly, onset of diseases transmitted by I. scapularis typically peak in mid- summer, when the combination of questing nymphs and heavy outdoor activity coincide closely.

Reservoir species

Like other Anaplasmataceae, Ehrlichia spp. are not known to be transmitted transovarially, necessitating a reservoir host to act as a bridge between vectors to perpetuate the enzootic cycle. Just as the vectors of various Ehrlichia spp. are often 8 associated with a specific range of animals, the bacteria are mostly commonly exposed to, and potentially better adapted to exist within certain host species. For E. canis, this includes domestic and wild canids (30), while the primary reservoirs for E. chaffeensis in North America are white-tailed deer, with various medium-sized mammals including canids potentially playing a lesser role (19, 31). Surveys where E. chaffeensis is present in ticks indicate that rodents are not typically exposed, likely indicative of feeding habits of its vector species (32). In contrast, small mammals and rodents are reportedly the primary reservoirs of E. muris in Asia (10, 11, 20–22). Similarly, Borrelia burgdorferi, A. phagocytophilum, and Babesia microti, the three most common tickborne human pathogens vectored North America by I. scapularis are maintained in small mammal populations (33). Consequently, it is presumed that small mammals facilitate I. scapularis infection with EMLA. Castillo et al. reported finding EMLA

DNA in 2/146 small mammals tested, with both positive samples coming from white- footed mice (Peromyscus leucopus) (34). The same study reported that all of 181 white tailed deer were negative for EMLA. Although blacklegged ticks are highly generalistic in their host preferences, P. leucopus and O. virginianus tend to be the most common and most utilized hosts in Midwestern and Northeastern areas reporting high incidence of disease (35–38, 26).

Infection and pathogenicity in rodents

In addition to humans, EMLA is known to infect inbred laboratory mice and hamsters and can be highly pathogenic for these animals (16, 34, 39–41). By contrast, 9 immunocompetent rodents infected with E. chaffeensis and A. phagocytophilum do not typically exhibit disease (42–45). This is an important consideration, considering that

E. chaffeensis infection of immunocompetent mice is subclinical, and does not allow for an optimal model of HME (46, 42). Pathogenicity and capacity for lethal outcome in lab mice also distinguishes EMLA from the E. muris type strain derived from a

Japanese rodent, which typically results in mild or asymptomatic infections that may be chronic, with minimal fatality (10, 47). The Ixodes ovatus Ehrlichia, a closely related organism also currently known as IOE or Candidatus Ehrlichia ovata that was isolated from Ixodes ovatus ticks in Japan, like EMLA, causes an acute and frequently lethal infection in mice, but unlike EMLA, is not known to cause human illness (48–50).

C57BL/6 mice exposed to EMLA show onset of illness between 9-13 days post inoculation (d.p.i.) (16, 17). Clinical signs include hunched posture, lethargy, labored breathing, ruffled fur, anorexia and dehydration, which were typically observed less than 24 hours before death. Necropsies of mice showed systemic distribution of

EMLA, yielding bacteria in a variety of organs including lungs, spleen, liver, lymph nodes, kidney, brain, bone marrow and heart (16, 17). Pathologic lesions were identified in multiple tissues in individuals exposed to a lethal dose via intraperitoneal and intravenous inoculation, while sub-lethal doses did not cause observable disease. In mice with severe acute (lethal dose) infections, the liver was the organ with the most obvious morphological changes, including hepatocellular mitoses, and apoptosis.

Histopathological analysis also showed apoptosis in lymphoid tissues, and lungs displayed cellular infiltrations that mirrored disease in the lethal IOE model. However, 10 pulmonary changes were not well-defined for mice infected with EMLA as for IOE (16,

49). Along with the infectious dose, route of transmission also appears to impact the length, severity, and type of disease. A comparison of multiple dosage quantities revealed that neither low dose or high dose via intradermal infection resulted in fatality or pathologic signs, but high dosages did result in a prolonged infection (16). Tick-to- host transmission also resulted in systemic infection and lethal outcome (27-80%) for inbred lab mice (40, 41) with a higher antibody response relative to needle inoculation

(40).

Himar1 mutagenesis

The mutant EMLA isolates described in this document were created using a

Himar (hyperactive mariner) transposition system. Mariners are diverse group of transposable elements (transposons) found in a wide variety of life forms. The version we used to transform EMLA is Himar1, a cut-and-paste transposase obtained from the horn fly, Haematobia irritans (51, 52). The term “insertion cassette” describes the genetic information to be inserted into the genome of wild-type EMLA, transforming it into a mutant capable of expressing fluorescent protein that is visible under ultraviolet light. The cassette also includes the Escherichia coli aadA gene, which confers resistance to spectinomycin and streptomycin, allowing mutants to be selected from wildtype EMLA, which is susceptible to those antibiotics. A promoter derived from

Anaplasma marginale (Am tr promoter) which drives expression of these proteins is 11 also included upstream of the selection and resistance marker genes. The insertion cassette is contained within a plasmid vector that additionally encodes the Himar1 transposase outside the TA inverted repeats flanking the transposon that are recognized by the transposase. Following electroporation of the vector into EMLA bacteria purified from host cells, the Himar1 transposase, also driven the by the Am tr promoter is expressed, and excises the insertion cassette and inserts it into the target genome. The site of insertion is random, though interruption or interference with genes critical to survival likely limits the spectrum of mutants to certain non-essential locations.

The advantages of using the Himar1 transposon are that insertions are stable, and because it requires no host-specific transposon factors, it can be used to transform a diverse array of organisms. The mCherry and mKate proteins were used because they are relatively stable under live imaging conditions and allow the user to avoid much of the autofluorescence that is visible in tick tissues when GFP is used.

Research Goals

This doctoral thesis research addresses three topics of interest. The first is to thoroughly describe the new Ehrlichia isolate EmCRT, including the process by which it was culture isolated, its morphology, its genomic relationship within Ehrlichia, and how biological transmission occurs. Prior to the research described in the following chapters, the majority of accounts of in vivo localization of Ehrlichia as well as most

Anaplasmataceae had been obtained from mammalian hosts. With assistance from 12 colleagues, my goal was to visually describe infection in vivo during the in-vector stage of EMLA lifecycle. This was the impetus for genetic transformation of EmCRT, which produced mutants that are observable under live microscopy. The second goal was to improve upon the live imaging results, using both molecular probing and transmission electron microscopy to describe distribution of ehrlichiae in fixed, sectioned ticks.

Finally, reservoir competence was assessed for the presumed natural reservoir host, P. leucopus, including a simultaneous evaluation of the potential impact of co-feeding I. scapularis lifestages on enzootic transmission.

13

Chapter 2

Characterization and genetic transformation of an Ehrlichia isolated from a Minnesota tick.

Geoffrey E. Lynn1, Nicole Y. Burkhardt1, Roderick F. Felsheim1, Curtis M. Nelson1, Jonathan D. Oliver1, Timothy J. Kurtti1, Ingrid Cornax2, M. Gerard O’Sullivan2, and Ulrike G. Munderloh1

1Department of Entomology, University of Minnesota – Twin Cities, 2Comparative Pathology Shared Resource, University of Minnesota – Twin Cities

Accepted for publication by Applied Environmental Microbiology (pending revisions May 2016)

14

Abstract. Ehrlichioses are zoonotic diseases caused by intracellular bacteria that are transmitted by ixodid ticks. The Ehrlichia muris-like agent is a newly recognized cause of human ehrlichiosis in Minnesota and Wisconsin. We describe the culture isolation of an ehrlichial organism from a field-collected tick and detail the relationship of this isolate to other species of Ehrlichia. The isolate was successfully transmitted between ticks and rodents, with PCR and microscopy demonstrating a broad pattern of dissemination in arthropod and mammalian tissues. Histologic sections further revealed that the wild-type isolate is highly virulent for mice and hamsters, causing severe systemic disease that is frequently lethal. This included multiple pathologic features indicating that murine infection with this isolate is applicable as a surrogate model for acute human monocytic ehrlichiosis. A Himar1 transposase system was also used to create mCherry and mKate-expressing mutants of this organism, which despite showing reduced virulence in rodents, were retained transstadially and successfully transmitted between ticks and their hosts.

Importance

This research describes the isolation of bacteria from a tick, which are closely related to, or the same as the Ehrlichia muris-like agent (EMLA), a newly recognized human pathogen. The tick-derived isolate, EmCRT is only the second known isolate of EMLA and first from a non-human source, further supporting the hypothesis that blacklegged ticks harbor this disease agent and are likely the primary biological vector for human 15 infections. EmCRT and the genetic mutants created from this isolate are further characterized in this study.

Introduction

In recent decades, parts of the North Central US have been identified as focal areas of emerging tick-borne diseases, with cases of Lyme disease, human anaplasmosis

(HA), babesiosis, Rocky Mountain spotted fever, and Powassan virus illness reported

(1–3). Of these, Lyme disease and HA occur frequently in Minnesota and Wisconsin.

Human anaplasmosis was initially diagnosed in patients from Minnesota and western

Wisconsin in 1993 (4, 5) and with annual reported cases for these states steadily increasing to a combined 1,088 (45.5% of the national total) as of 2012, the region accounts for a substantial proportion of nationally reported cases of HA (6). As diagnostic testing for tick-borne pathogens increased in this region, patients presenting with suspected tick-borne illness occasionally tested seropositive for Ehrlichia chaffeensis, the etiologic agent of human monocytic ehrlichiosis (HME) that is transmitted by the lone star tick, Amblyomma americanum (7). However, this tick species has yet to become established in either Minnesota or Wisconsin, and it is unlikely that E. chaffeensis is transmitted by ticks in this region. In cases where potential tick exposure in E. chaffeensis-endemic areas could not be established for patients, serological cross-reactivity with Anaplasma phagocytophilum, the causative agent of HA, was considered a possible explanation (Friedlander, H., et al. 2012 16 presented at the 22nd International Conference on Emerging Infectious Diseases,

Atlanta, GA, March 11-14, 2012) (8).

However, in 2009, an Ehrlichia species previously unrecognized as a human pathogen in North America was identified in several Minnesota and Wisconsin patients

(9). As of 2013, 69 human cases of illness due to what is currently referred to as the

Ehrlichia muris-like agent (EMLA) have been reported by MN and WI, though this figure likely under-represents true incidence given that specific diagnostic testing for

EMLA is currently limited to only a few facilities (10).

Presently, the natural ecology of this organism has not been fully described.

Blacklegged ticks (Ixodes scapularis) collected in Minnesota and Wisconsin have tested positive by PCR for EMLA DNA, with American dog tick (Dermacentor variabilis) specimens from the same locations testing negative (9, 11, 12). Experimental demonstration of highly efficient transmission and acquisition of EMLA by I. scapularis to and from mice suggests that this tick species is an efficient vector of

EMLA (13–15) in nature, while D. variabilis do not appear to be vector competent (15).

Ehrlichia spp. are not known to be vertically transmitted and a definitive reservoir host for EMLA has yet to be identified.

Here we report the culture isolation of an Ehrlichia muris-like organism from an

I. scapularis tick, with genotypic and histologic characterization indicating that it is closely related to or the same as the EMLA (Ehrlichia sp, Wisconsin) isolated from a human patient. Also described is the genetic transformation of this organism using a

Himar1 transposition system, which resulted in mutants that expressed fluorescent 17 protein markers in vitro and in vivo, allowing visual identification of infection in live tick tissues using confocal microscopy.

Methods

Cultivation of Ehrlichia from infected tick organs

In October 2011, engorged ticks were collected from hunter-killed white‐tailed deer (Odocoileus virginianus) at Camp Ripley, MN (46.094514° N, 94.3482° W) and an Ehrlichia sp. was isolated from one of the female I. scapularis. The tick was surface- sterilized by 5 min sequential rinses in 0.1 % sodium hypochlorite, 0.5 % benzalkonium chloride, and 70% ethanol, followed by three rinses in purified water (EMD Millipore,

Billerica, MA, USA)(16). Fifty µL of Tween 80 was added to 10 ml each of the bleach and benzalkonium choride to enhance wetting of tick surfaces. Ticks were submerged in ~50 µL of L15C300 tick cell culture medium, (supplemented as described below), whereupon internal organs were extracted and introduced into wells of a 96-well plate seeded three days prior with the ISE6 cell line (ATCC CRL - 11974, Manassas, VA,

USA) derived from I. scapularis embryonic cells (17, 18). Cultures were incubated at

32 °C in a humidified candle jar and grown in L15C300 medium supplemented with

10% fetal bovine serum (heat-inactivated; Gemini Bio-products, Sacramento, CA,

USA), 5% tryptose phosphate broth, (Difco, Detroit, MI, USA), 0.1 % lipoprotein concentrate (MP Biomedical, Irvine, CA, USA), and buffered with 25 mM HEPES (2-

[4-(2-hydroxyethyl)piperazin-1-yl]ethanesulfonic acid) and 0.25% NaHCO3, pH 7.6

(17, 18). Medium was replaced with fresh medium three times per week. Contents of wells that remained uncontaminated for 10-14 days were gently pipetted out of wells, 18 and transferred to larger wells (24-well plates seeded with ISE6 cells) where they were pooled with like tissues from the same source tick. Once morulae (intracellular bacteria-containing vacuoles characteristic of Anaplasmataceae) were apparent, well contents were transferred by pipet into sealed 12.5 cm2 flasks containing ISE6 cells and cultured at 34 °C. Cultures were inspected for infection with intracellular bacteria by light microscopic examination of cell samples that had been centrifuged onto microscope slides, fixed in methanol and stained in Giemsa’s solution. Microscopic identification was performed on a Nikon Eclipse 400 (Nikon, Melville, N.Y). The resulting isolate is referred to here as Ehrlichia muris-like Camp Ripley tick (EmCRT).

Propagation of the Ehrlichia Isolate in Cell Culture

The EmCRT isolate was tested for its ability to infect five mammalian cell lines: the human promyelocytic leukemia cell line HL-60 (ATCC CRL-1780), the human monocytic leukemia cell line THP-1 (ATCC TIB-202), the human dermal microvascular endothelial cell line HMEC-1 (ATCC CRL-3243), the dog macrophage- like cell line DH82 (ATCC CRL 10389), and the rhesus (Macaca mulatta) endothelial cell line RF/6A (ATCC CRL-1780), either wild-type or transformed with GFP-LifeAct to label the actin cytoskeleton for enhanced live microscopy detection (19). To obtain cell-free bacteria, ehrlichiae were first extracted from ISE6 cell suspension by vortexing at top speed with ~300 µL of 60/90 sterile rock tumbler grit (Lortone, Mukilteo, WA,

USA). Grit was allowed to settle for 30 sec, and the supernatant was passed through a 2

µm Whatman PVDF filter (GE Healthcare, Buckinghamshire, UK) onto a fresh cell 19 layer or suspension of cells. Uninfected HMEC-1 and RF/6A cells, as well as infected and uninfected HL-60 and THP-1 cells were cultured in RPMI 1640 medium with 25 mM HEPES buffer (Gibco, Carlsbad, CA, USA), 2 mM L-glutamine (Gibco), and 10%

FBS. DH82 cultures were grown using DMEM medium (Gibco) also with 2 mM L- glutamine and 10% FBS added. Infected HMEC-1, DH82, and RF/6A cells were cultured in supplemented L15C300 medium modified as described above, and incubated at 37 °C in a humidified atmosphere of 5% CO2 in ambient air.

Giemsa-stained cell cultures were prepared and examined as above. DNA was extracted with a Puregene Blood Core Kit B (Qiagen Sciences, Gaithersburg, MD,

USA) and PCR performed using GoTaq DNA polymerase (Promega, Madison, WI,

USA) with Anaplasmataceae-specific Per1 and Per2 primers under cycling conditions as described (20) (Table 1). HS1 and HS6 primers were also used to amplify groESL sequence, using previously described cycling conditions (21). Amplicons (451 and

1411 bp products) were visualized on a 1% agarose gel, and sequencing performed at the University of Minnesota Genomics Center (UMNGC).

Phylogenetic analysis

Ehrlichia groESL operon sequences were obtained from Genbank to create an unrooted phylogenetic tree. The sequences used include (with accession number):

Ehrlichia ewingii (AF195273.1), Ehrlichia muris AS145 (CP006917.1), Ehrlichia muris Nov Ip205 (GU358686.1), EmCRT (LANU01000002.1), Ehrlichia sp. Wisconsin

(KU214846), Ehrlichia sp. HF (CP007474.1), Candidatus Ehrlichia ovata (IOE) 20

(DQ672553.1), Ehrlichia chaffeensis str. Arkansas (CP000236.1), Ehrlichia canis str.

Jake (CP000107.1), Ehrlichia mineirensis (CDGH01000062.1), Candidatus Ehrlichia khabarensis (KR063139.1), and Ehrlichia ruminantium (U13638.1).

ClustalX 2.012 (22, 23) was used for sequence alignment, and maximum likelihood trees were generated using Mr. Bayes v.3.2.5 (24) with 1000 bootstrap replicates, and Phylogenerator (25). Each program was used under default parameters, and produced trees that agreed with each other. FigTree v1.4.2 (26) and Adobe

Photoshop were used for additional modification of the final tree included here.

Rodent infection and histology

All animals in this study were maintained and used under protocol approved by the University of Minnesota Institutional Animal Care and Use Committee (# 1307-

30753A) in accordance with recommendations listed in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health (27). Female C57BL/6 mice ranging from 4-12 weeks old and outbred Syrian hamsters (Mesocricetus auratus) of either sex ranging from 4-8 weeks old were infected intraperitoneally (ip) by injection of 300-500 µL of Ehrlichia-infected cell suspension, estimated by Giemsa stain and hemocytometer to contain 3x105 infected cells. Animals were euthanized 8 to 12 days post-inoculation (dpi) and blood was drawn post mortem via cardiac puncture for DNA extraction using the Puregene Blood Core Kit B. Bacterial DNA was then amplified by

PCR targeting 16S rDNA and groESL regions (see below, and Table 1), and sequenced at the University of Minnesota Genomics Center. 21

In addition to PCR, blood (100 – 500 µL) from infected animals was also inoculated onto ISE6 cells to re-isolate the pathogen and confirm current infection.

Sterile 15% ethylenediaminetetraacetic acid solution (EDTA, Kendall/Covidien,

Mansfield, MA, USA) was used to prevent hamster blood from clotting. Cells were cultured and assessed for infection via PCR and Giemsa staining as described above.

Rodents were dissected immediately following euthanasia, and organs fixed in a

10% buffered formalin solution for 24-48 hours at 4 °C, followed by storage in 70% ethanol. Fixed tissues were paraffin-embedded, sectioned at 4 µm onto slides (Fisher

Scientific, Hampton, NH, USA), and a subset stained with hematoxylin and eosin

(H&E) at the Masonic Cancer Center Comparative Pathology Laboratory at the

University of Minnesota. Unstained paraffin-embedded lung sections were processed using in situ hybridization (ISH), as previously described (13). Unfixed samples of the organs for PCR analysis were also collected and frozen at -70°C prior to extraction of

DNA using the DNeasy Blood & Tissue Kit (Qiagen). PCR assays used 100 ng of template DNA extracted from 10-20 mg pieces of tissue.

Tick infection

Gravid specific pathogen-free I. scapularis and lone star ticks (Amblyomma americanum) were obtained from a colony maintained at Oklahoma State University

(Stillwater, OK, USA) and stored at room temperature under 97% humidity and a 16:8 hr light-dark cycle, where they proceeded to oviposit. Larvae were fed to repletion on mice or hamsters, and then washed in 0.1% bleach solution, rinsed with Milli-Q filtered 22 water and housed in vented 5 mL polystyrene tubes (BD Biosciences, Canaan, CT,

USA) stored in a desiccator over a saturated solution of K2SO4. When needle inoculation was used to infect hosts, approximately 50 larvae were placed on each animal 8-10 dpi and only ticks that engorged were collected. For hosts infected via tick, naïve larvae were placed 10 or 11 days following initiation of nymphal feeding. After molting, a subset of ticks were washed in 0.1 % bleach, rinsed twice in Milli-Q filtered water and bisected with a sterile needle in a 1.5 ml microcentrifuge tube. Tissue was denatured for at least 24 hrs in cell lysis buffer prior to DNA extraction using the

Puregene kit. A pooled sample consisted of five nymphs processed simultaneously.

Adult I. scapularis were obtained by feeding nymphs on either hamsters or mice at densities of 10-20 ticks per animal. Additional engorged female ticks collected from

Camp Ripley deer in 2011 and 2012 were cleaned, cultured and evaluated for ehrlichial infection in the same manner as described above.

Mutagenesis/Detection/Location

EmCRT was transformed using the Himar1 transposase system as described in

Felsheim et al. (28). Two plasmid constructs (pCis mCherry-SS Himar A7, and pCis mKate-SS Himar A7) each encoding both the transposase and the transposon, were used for transformation, with either mCherry or mKate as the fluorescent marker (Fig.

S1.) (29). Modification of the above protocol included use of sterile Lortone grit to lyse infected cells, and centrifugation of bacteria with ISE6 cells at 5,000g for 5 min following electroporation. Bacteria/cell pellets were allowed to sit at room temperature 23 for 30 min prior to being resuspended and added to ISE6 cell cultures in 25 cm2 flasks.

Starting 2-3 days after electroporation, transformants were selected using 0.25 mg each of spectinomycin (5 µL of 50 mg/mL solution) and streptomycin (25 µL of 10 mg/mL solution) per 5 mL medium(28, 30).

To confirm the insertion of the expression cassettes into the EmCRT genome,

PCR was performed on DNA extracted from the mutant EmCRT-infected cultures using the Puregene Blood Core Kit A with GoTaq DNA polymerase and one of two primer sets: CherryF and SpecR targeting transposon gene sequences in mCherry-expressing mutants, or FR1 and SpecR targeting those expressing mKate (Table 1). Cycling conditions were as follows: 95°C for 2 min for one cycle; 95°C for 30 sec, 55°C for 30 sec, and 72°C for 1 min. for 35 cycles, followed by a final extension at 72°C for 5 min.

Amplicons were electrophoresed on a 1% agarose gel and stained with GelGreen

(Biotium, Inc., Hayward, CA, USA) for visualization.

Southern analysis was performed as previously described by Baldridge et al.

(31) using 500 ng BglII-digested DNA per mutant EmCRT isolate and hybridizing with the digoxigenin-labeled Spec probe at 65 °C. Integration sites were then identified by plasmid rescue cloning. Briefly, EcoRI or HindIII-cut genomic EmCRT DNA was ligated to pGEM (Promega, Madison, WI) overnight at 14 °C , electroporated into

DH5α-E Competent Cells (Invitrogen) and plated onto YT agar plates containing 50

µg/mL each of streptomycin and spectinomycin, and 75 µg/mL ampicillin. Bacteria from individual colonies were grown in tubes containing terrific broth (TB) and plasmid

DNA was extracted using the High Pure Plasmid Isolation Kit (Roche) as per the 24 manufacturer’s protocol. Sequencing was performed at the University of Minnesota

Genomics Center using primers Cherry up and out and Spec down and out (table 1).

Quantitative PCR (qPCR) was used to determine quantities of wild type and transformed EmCRT in mouse lung tissue. Quantitative PCR was performed as previously described (32) with an Mx3005 qPCR cycler (Stratagene), Brilliant II SYBR green qPCR master mix (Stratagene), 240nM concentration of each primer, 100 ng of mouse lung tissue DNA and serial dilutions of plasmid DNA adjusted to 10 ng DNA per sample with salmon sperm DNA (Promega). Primers that target the single copy 16S rRNA gene in EmCRT (PER5 (20) and PER6-EmCRT [5’-

CCTTCATGTCAAAAAGTGGTAAGG-3’] were used and a standard curve was generated using a plasmid created by PCR amplification of EmCRT with 16S rRNA primers PER4 (20)/PER6-EmCRT. Cycling parameters were 1 cycle at 95oC for 10 min, 40 cycles at 95oC for 30 s, 59oC for 1 min and 72oC for 30 s with a dissociation curve cycle of 95oC for 1 min, 58oC for 30s and 95oC for 30s to confirm product specificity. MxPro version4 software was used to acquire the data and to reference genomic sample values to the standard curve. Values were expressed as an average of amplification from samples run in triplicate on one plate.

Transmission Electron Microscopy

Cultures of Ehrlichia-infected ISE6 cells were gently washed off the culture flask using a stream of medium, pelleted at 300x g centrifugation for 5 minutes, and rinsed twice with PBS. Pellets were then fixed overnight at 4 °C using a modified Ito’s 25 fixative (33, 34). Hamster lung tissue was collected 9 dpi and immediately fixed overnight at 4 °C, also using Ito’s fixative. The dehydration, staining, and embedding procedures for the cells and tissue were performed as described by Lynn et al.(13).

Imaging

Confocal images were taken using a Quantem:512SC electron multiplying charge-coupled-device camera (Photometrics, Tucson, AZ) interfaced with a BX61

DSU spinning disk confocal microscope (Olympus America, Center Valley, PA) equipped with an X-cite Exacte fluorescent light source (Lumen Dynamics,

Mississauga, Ontario, Canada). An Olympus Q-Fire digital camera was used to image slides stained with Giemsa or processed using ISH. MetaMorph Premier (Molecular

Devices, Sunnyvale, CA, USA) imaging software in conjunction with ImageJ (U.S.

NIH, Bethesda, MD, USA) software was used to acquire and process images.

Additionally, some Giemsa stained cell-samples were viewed and imaged using a Nikon

Eclipse 400 (Nikon, Melville, N.Y) microscope equipped with a Nikon DXM 1200 digital camera controlled by ACT-1 imaging software (Nikon). Adjustments to improve color balance and sharpness were made with Adobe Photoshop. Histological images were taken with SPOT Insight 4.0 Megapixel color mosaic camera using Spot version

5.2 imaging software. Contrast, brightness, and sharpness were adjusted linearly across the whole image in Adobe Photoshop.

26

Results

Propagation of the Ehrlichia isolate in cell culture and genotyping

Following isolation of EmCRT in ISE6 cells (Fig. 1A), ehrlichiae were extracted from host cells and successfully grown in the following cell lines selected for their ability to support various Ehrlichia spp. (9, 20, 35–38): RF/6A (Fig. 1B), HL-60, (Fig.

1C), THP-1 (Fig. 1D), DH82, and HMEC-1. In ISE6 cultures, ehrlichial inclusions frequently expanded to encompass a large part of the cytoplasm, developing into morulae that can contain dozens or hundreds of bacteria. Similar to the Ehrlichia muris type species isolate (E. muris AS145), one or two large morulae per ISE6 cell were typically observed for EmCRT infection, in contrast to the Ixodes ovatus Ehrlichia

(IOE) isolate, which forms multiple smaller morulae in this cell line (39).

In early stage infection (~12-24 hours) of HL-60 and TPH-1 cells, individual cells contained one or two small morulae, while cells later stages of infection (24-48 hours) harbored many equally small morulae. RF/6A and DH82 cells also maintained small morulae, which increased in quantity until the entire cell was packed with numerous small to mid-sized morulae. In several instances, a morula was observed within a tick cell nucleus by either Giemsa stain or live confocal microscopy, an observation that has also been reported for E. chaffeensis (40). Yet another distinctive characteristic of this isolate was that in adherent mammalian cell cultures, advanced ehrlichial infection resulted in cell rounding and detachment from the flask. This was attributed to degeneration of the actin cytoskeleton, and was readily observed in infected GFP-LifeAct-expressing RF/6A cells. 27

A phylogenetic tree (Fig. 2) showing the genetic relationship of selected

Ehrlichia spp. closely related to EmCRT was constructed with groESL sequences.

Probability values for each of the nodes were 96% or greater, with the exception of the

E. ruminantium-E. ewingii node (52%). Our isolate matched the human-derived EMLA isolate (Ehrlichia sp. Wisconsin), and was closely related to two identical E. muris isolates from Asia (Ehrlichia muris AS145 & Ehrlichia muris isolate Nov Ip205). The

Candidatus Ehrlichia ovata and Ehrlichia sp. HF sequences were also identical.

Rodent infection and histology

Infection of mice and hamsters with EmCRT produced severe and often fatal systemic disease, with disease outcome influenced by route of inoculation, quantity and in vitro passage number of inoculum, and host animal attributes, such as age and species. Use of larger inoculum, low passage number of EmCRT culture, and younger animals were each more likely to result in lethal infections, as was the use of hamsters as opposed to C57BL/6 mice. Signs of illness included hunched posture, huddling, dyspnea, tachypnea, inactivity, ruffled fur, and ataxia, with rapid onset less than 24 hours prior to fatal outcome. In fatal cases, animals typically expired between 9-13 dpi and necropsies of moribund animals revealed moderate splenomegaly and pleural effusions consisting of cloudy pale yellow serous fluid. In contrast to healthy lung tissues, which typically float for several hours in buffered formalin solution, lung tissues from animals in late stages of disease sank immediately into the fixative, indicating pulmonary edema. Examination of histological sections of lung tissue 28 revealed diffuse moderate to severe interstitial pneumonia (pneumonitis) with marked pulmonary edema consistent with diffuse alveolar damage (Fig. 3). The alveolar walls were diffusely thickened by increased numbers of predominantly mononuclear inflammatory cells and had multiple small foci of necrosis. There was also mild hemorrhage and increased numbers of alveolar macrophages. The spleen had disruption and focal necrosis of the white pulp which was infiltrated by plasma cells and other large lymphoid cells; similar cellular infiltrates were present throughout the red pulp.

The liver had increased numbers of mononuclear cells within sinusoids and moderate

Kupffer cell hyperplasia. In the heart of one infected mouse, the atrioventricular valves were mildly infiltrated by mononuclear inflammatory cells and edema (nonsuppurative valvular endocarditis).

EmCRT infection of mice and hamsters was confirmed post mortem through in vitro culture of the organism from cardiac blood and lung fluids as well as by PCR of these fluids. Nearly all rodents tested during the acute phase of infection (9-14 dpi) displayed systemic dissemination of ehrlichiae to various organs (as evidenced by

PCR/ISH), including lungs, heart, liver, brain, kidney, and spleen (Figs. 4B, S2) (13).

Morulae were typically seen within two weeks in cultures inoculated with infected rodent blood, using either Giemsa stain and/or live fluorescent microscopy.

Tick infection

Naïve I. scapularis larvae and nymphs that fed upon either infected hamsters or

C57BL/6 mice successfully acquired EmCRT, and following molt, infected nymphs 29 transmitted the bacteria to naïve animals. Acquisition of ehrlichiae by ticks and successful transmission to rodents was demonstrated for both wild-type and transformed

EmCRT. Transstadial retention of the bacteria was demonstrated by PCR in adults infected as either nymphs or larvae. These results were corroborated by confocal live microscopy, which identified fluorescent ehrlichiae in the synganglion, male accessory glands, salivary glands (Fig. 5A), and along tracheae (Fig. 5B). Host-to-tick transmission success was very high (greater than 90%) in all cases when ticks were fed on infected rodents with PCR-confirmed bacteremia. In contrast, 0 of the 9 nymphs from a group of approximately 100 lone star tick larvae that were allowed to feed on an

EmCRT-infected hamster at 9 dpi acquired EmCRT. This included 4 individual nymphs and one pool of 5 nymphs, each of which tested negative by PCR for EmCRT after molting, despite a positive PCR result from the hamster blood collected immediately following tick feeding.

Of the field-collected I. scapularis we assessed from Camp Ripley, one of 26

(3.9%) female ticks collected in 2011, and 1 of 13 (7.7%) from 2012 tested positive by

PCR, with groESL sequence matching EMLA and EmCRT.

Mutagenesis/Detection/Location

Five mCherry and three mKate-expressing isolates were produced. Each of these mutants demonstrated the ability to grow in the ISE6 and RF/6A cell lines (Fig.

6). Expression of the mCherry and mKate proteins visible through live microscopy appeared to be stable for each isolate through 30 passages without antibiotic selection 30 pressure. Transposon insertion sites were mapped for each mutant, revealing that 2 of 8 isolates were comprised of a mixed population (Table 1). Isolates D-69, 6/16, C5III,

L27, and BUR contained intragenic insertion sites, while the B-65, 327, C5III and EL isolates contained intergenic insertions. No obvious defective phenotype was observed for any isolate in either ISE6 cells or RF/6A cells (Fig. 6).

Each mutant was inoculated into rodents via ip injection, and subsequently, through infected nymphs. Similar to wild-type EmCRT infection, bacteremia was detectable for mutants between 8-14 dpi and recoverable in cell culture. Mutants were were also infectious for ticks, but in contrast to wild-type EmCRT, no morbidity was observed, and only a single fatality was observed in a collective 25 hamsters and mice infected by either tick feeding or ip inoculation. PCR was used to evaluate systemic infection with mutants, and mCherry sequence was successfully amplified from all five tissues assessed (heart, lung, liver, spleen, and kidney) in at least one animal when two groups of three mice were infected with either the D-69 or B-65 mutants. This included positive lung samples from all 6 individuals assessed. A quantitative comparison of lung tissue between mice infected with either wild-type EmCRT, or mCherry mutants indicated that the mean ehrlichial load in 10 ng of DNA from mouse lung tissue infected with wild-type EmCRT (49766) was not significantly different from the corresponding mean (16410) for lung tissue infected with mCherry mutant isolates (2x

P-value < 0.299. Fig. S3). Larval I. scapularis were allowed to feed on rodents infected with one of the 8 mutant isolates and assessed by PCR as nymphs for acquisition of 31 mutant EmCRT. All 8 mutants were successfully acquired by larvae and maintained through the adult stage.

Transmission Electron Microscopy

TEM images of EmCRT infected tick cells showed highly pleomorphic bacteria with a smooth inner and a corrugated outer membrane commonly seen in

Anaplasmataceae (Fig. 7). The number of bacteria per cell and per morula was variable and they ranged in size from 0.25 µm to 1.5 µm. Cultured cells were fixed at an advanced stage of infection (>48 hours post-inoculum), where dense core and reticulate bodies could be seen within the same cell, and in some cases, within the same inclusion.

Morulae containing mostly reticulate bodies tended to have fewer bacteria that were more tightly packed together, whereas dense core bodies were more widely spaced within morulae that contained a greater number of ehrlichiae. Cultured tick cells typically contained multiple morulae per cell at various stages of development, compared to hamster tissue cells that harbored single morulae containing a synchronous population of ehrlichiae. These observations were consistent with previously reported differences between ehrlichiae grown in tick cell culture and mammalian cell culture

(39, 40). Morulae observed in tissue in this study had a similar general appearance to those in cell culture, but were smaller and contained fewer bacteria than morulae in

ISE6 cells. A fibrillar matrix as reported for both RF/6A cells and mouse tissue infected with IOE (39, 41) was not observed in morulae in either our in vitro or in vivo samples. 32

Discussion

The EmCRT isolate as characterized here appears to be genotypically and phenotypically indistinguishable from the human-derived EMLA isolate, Ehrlichia sp.

Wisconsin. Analysis of sequences from the groESL heat shock operon indicated that the isolates were identical, though a more extensive comparison using multi-gene analysis should be undertaken to confirm these results. This new isolate, obtained from a field-collected tick and maintained in vitro in a tick-rodent cycle, reinforces previous research indicating that blacklegged ticks are highly competent vectors and potentially the primary arthropod species involved in EMLA transmission cycles (14). Also of epidemiologic importance, it appears that lone star ticks, a species established in states bordering Minnesota and Wisconsin and currently expanding its range, are not competent vectors of EmCRT.

The demonstrated capacity of the EmCRT isolate to infect multiple types of cultured cell lines, as well as a wide range of tissues in live mammals and ticks (13) suggests a broad cellular tropism. Similar to the human-derived EMLA isolate

(Ehrlichia sp. Wisconsin) and the Ixodes ovatus Ehrlichia, EmCRT infection was highly pathogenic for rodents, with systemic distribution of bacteria and disease often resulting in fatal acute respiratory distress syndrome. And consistent with previously reported fatal murine ehrlichiosis, histopathologic features of EmCRT infection were apparent in mouse livers and spleens and especially pronounced in the lungs (15, 41–

44). 33

Apart from having considerable implications for tick-host transmission dynamics in nature, the pathologic features of EmCRT demonstrated in rodents are of added value as a animal model for human disease, producing outcomes similar to those described for HME, particularly acute respiratory distress syndrome, with findings in our study consistent with diffuse alveolar damage that included interstitial pneumonitis, pulmonary edema, and pulmonary hemorrhage. (45–49). Also consistent with HME and other pathogenic ehrlichioses, composite results of histology, ISH, and electron microscopy analysis of live mammalian rodent tissue performed in this study indicate that EmCRT infects a relatively small proportion of cells, suggesting that pathogenesis is primarily a result of host immune response rather than extensive bacteria-induced cellular injury (43, 50, 51). These acute, severe disease outcomes contrast with the mild or asymptomatic, non-fatal infections observed in laboratory mice infected with the type species isolate (E. muris AS145) obtained from a wild

Japanese mouse, which may result in prolonged infections (52, 53).

In our attempts to identify infected tissues in ticks, mutants were generated for the purpose of imaging EmCRT in live tissue, with some success. We discovered that autofluorescent features of tick anatomy reduced the ability to discern the mutants’ marker protein in certain tissues, requiring careful dissection and use of samples of an appropriate thickness. The images acquired using these mutants provided a foundation for further attempts at in vivo localization using molecular probes and electron microscopy (13). It is noteworthy, if not surprising that none of our mutants showed a conspicuous phenotype in culture. This is likely because insertion events which disrupt 34 critically important genes may result in nonviable, unrecoverable mutants, while those with intragenic insertions that are successfully recovered are likely those with redundant genes and/or alternate metabolic pathways. The observed reduction of virulence in rodent hosts however, may have important immunological implications given that previous work using GFP and mCherry-expressing mutant Anaplasma marginale has also shown reduced virulence as compared to the wild-type in cattle, despite also being phenotypically indistinguishable from wild-type in cell culture (54, 55). For the two isolates that represented a mixture of several mutants, we did not determine which individual mutants survived passage through the animals. While reduced virulence in mammalian hosts has previously been described for E. chaffeensis mutants where critical genes were disrupted (29, 56), our quantitative analysis did not show a statistically significant difference in ehrlichial load in mouse lung tissue infected with wild-type EmCRT compared with mutant-infected tissue. The reduced virulence phenotype could be caused a number of possibilities, including costs of over-expression of mCherry and Spec from the transposon, or the manipulation of the cultures associated with the transposon mutagenesis produced selective pressure giving rise to spontaneous virulence attenuation mutants that are unrelated to the transposon insertion sites.

These findings raise further questions as to the limited presence of EMLA in nature recognized at this time. The high efficiency of transmission between I. scapularis and laboratory rodents observed in experiments seems at odds with the low figures for EMLA prevalence reported in previous surveys in Minnesota and Wisconsin 35

(9, 11, 12, 57), as well as the low rate of Ehrlichia infection in adult ticks we collected from Camp Ripley deer in successive years. One possible explanation is that EMLA may be in the early stages of emergence or reemergence in North America and as yet, poorly adapted to local vectors and/or host animals. Presently there are few published reports of vertebrates infected with EMLA, however deer do not appear to carry the organism and initial reports have found low prevalence in wild rodents at sites with infected ticks (58), (B. Ayres and W.L. Nicholson, personal communication and presented at the 22nd meeting of the American Society for Rickettsiology, Olympic

Valley, CA, June 20-23, 2015). Given the observed virulence of EMLA in lab rodents, it is likely that in nature, morbidity or mortality among infected vertebrate hosts might limit the number of opportunities for vector ticks to acquire ehrlichiae. An alternate explanation is that EMLA is limited by a shared ecological niche with A. phagocytophilum, a sympatric species also transmitted by I. scapularis. Antagonistic interaction between tick-borne pathogens has been described previously for A. phagocytophilum and other Rickettsiaceae (59, 60), and it is possible that inhibition or an alternate form of competition between Anaplasmataceae could occur within I. scapularis and/or their mammalian hosts.

In summary, our tick-derived isolate appears to match the EMLA isolate acquired from a human patient. As a well-documented human pathogen with a high degree of pathogenicity for rodents, EMLA is an ideal model organism for the study of acute HME. The availability of fluorescent protein-expressing EmCRT mutants described will enhance further study of this organism, aiding our ability to work with 36 live intercellular organisms with additional potential for immunological applications.

Additional research is needed to determine the natural reservoirs of EMLA and to discern its ecological relationship with coincident tick-borne pathogens, including A. phagocytophilum.

Figures

Figure 1. Cultured cells infected with EmCRT, fixed and stained with Giemsa’s solution. Arrows indicate ehrlichial morulae, which stain a darker shade of purple than host cells. (A) ISE6, (B) RF/6A, (C) HL-60 (D) THP1. Scale bar = 10 µm.

" # $ %

37

Figure 2. Phylogenetic tree showing the relationship between EmCRT and closely related Ehrlichia as compared by groESL sequence. EmCRT is identical to the human

EMLA isolate (Ehrlichia sp. Wisconsin), as are each of two additional pairs of isolates

(Ehrlichia muris AS145 & Ehrlichia muris isolate Nov Ip205, and Candidatus Ehrlichia ovata & Ehrlichia sp. HF). Node values indicating the probability that branches are correctly arranged were calculated and were all 96% or greater, with the exception of the E. ruminantium-E. ewingii node, which was 52%. Scale bar denotes expected site changes per distance.

T LBOTB BUB US
"S
PW TJT

T IJB òFFO SMJD B
DIB
&I SMJDIJ UVT &I JEB OE ' $B JB
TQ
) ISMJDI  & /PW
*Q &ISMJDIJB
FXJOHJJ B
NVSJT
&ISMJDIJ &ISMJDIJB
NVSJT
"4

& &N I $3 S 5 MJ DI JB TJT
T
LIBCBSFO Q &ISMJDIJB 
8 JT DP O T JO &ISMJDIJB
NJOFJSFOTJT &ISMJDIJB
DBOJT
TUS
+BLF
& . -"

38

Figure 3. H&E stained lung sections from C57BL/6 mice at 9 dpi. (A) Uninfected control displaying clear alveolar space (asterisk) and bronchioles. (B) Infected mouse.

Lung has diffuse interstitial pneumonia and pulmonary edema (asterisk denotes alveolus filled with edema). (C) Higher magnification of lungs in uninfected mouse. Note thin alveolar walls (arrows) and clear alveolar space (asterisk). (D) Higher magnification of lungs in infected mouse. The alveolar septa (arrows) are diffusely thickened and hypercellular. The alveoli are edematous (asterisk) and contain increased numbers of alveolar macrophages. Scale bar: A & B = 200 µm, C & D = 50 µm.



39

Figure 4. Lung tissue from C57BL/6 mouse at 9 dpi. (A) H&E stain. Arrow indicates a morula near alveolar space. (B) ISH assay performed on infected lung tissue. Red label indicates probe hybridization to ehrlichiae. Cell nuclei are stained light purple. Scale bar

= 20 µm.

'JH

-VOH
UJTTVF
GSPN
$#-
NPVTF
BU

EQJ
"
)&
TUBJO
"SSPX
JOEJDBUFT
B
NPSVMB
OFBS
BMWFP MBS
TQBDF
#
*4)
BTTBZ
QFSGPSNFE
PO
JOGFDUFE
MVOH
UJTTVF
3FE
MBCFM
JOEJDBUFT
QSPCF
IZCSJEJ[BUJPO
UP
FISMJDIJBF
$FMM
OVDMFJ
BSF
TUBJOFE
MJHIU
QVSQMF
4DBMF
CBS


ɅN 40

Figure 5. Live confocal images of tick tissue infected with mCherry EmCRT. (A)

Salivary glands: salivary ducts and acini displayed. Red indicates EmCRT and green/yellow is autofluorescence. (B) Trachea: mCherry EmCRT shown in red, superimposed over brightfield image. Scale bar = 20 µm.

41

Figure 6. Live confocal images of mCherry EmCRT in culture. (A) EmCRT infecting

ISE6 cells. Ehrlichiae are shown in red and nuclei are stained blue with DAPI. Scale bar = 20 µm (B) EmCRT infecting Lifeact RF/6A cells. Ehrlichiae are red and host cell actin is green. Scale bar = 10 µm.

42

Figure 7. Electron micrographs of EmCRT morulae. (A) In ISE6 culture. (B) In hamster lung tissue. Scale bar = 1 µm.

43

Table 1. DNA oligonucleotides used for PCR and probing, including target genes.

Table 2. Genomic insertion sites and proposed gene interruptions for the three mCherry and five mKate mutants generated using Himar1 transposases. Isolates C5III and EL each contained two identifiable insertion sites. Accession numbers are listed for

GenBank sequences containing each insertion site.

44

S1. Maps of the Himar1 transposon and transposase plasmids used to create mCherry and mKate-expressing mutants. (A) pCis cherry-SS A7 Himar. (B) pCis Far Red-SS A7

Himar #29.

S2. Mouse tissue diagnosis by PCR. PER1 and PER2 primers were used to amplify

EMLA. Lane 1: EmCRT/ISE6 culture, L2:dd H2O. L3: uninfected mouse lung. L4-

L8: infected tissue. L4: lung, L5: liver, L6: kidney, L7: spleen, L8: heart.


,C
QMVT MBEEFS        

      



4

.PVTF
UJTTVF
EJBHOPTJT
CZ
1$3

1&3
BOE
1&3
QSJNFST
XFSF
VTFE
UP
BNQMJGZ
&.-"

-BOF

&N$35*4&
DVMUVSF
-EE
)0
-
VOJOGFDUFE
NPVTF
MVOH

--
JOGFDUFE
UJTTVF
-
MVOH
-
MJWFS
-
LJEOFZ
-
TQMFFO
-
IFBSU 45

S3. Relative ehrlichial load in mice tissues (quantitative PCR). Mice infected with wild-type (wt) EMLA had a higher mean copy number per 10ng DNA extracted from lung tissue than mice infected with mCherry transformants. However, this difference was not statistically significant (2x P-value > 0.299).

46

Chapter 3

Tissue distribution of the Ehrlichia muris-like agent in a tick vector

Geoffrey E. Lynn, Jonathan D. Oliver, Curtis M. Nelson, Roderick F. Felsheim, Timothy J. Kurtti, and Ulrike G. Munderloh

Department of Entomology, University of Minnesota, 219 Hodson Hall, 1980 Folwell Ave., St. Paul, MN 55108, USA

As published in PLOS ONE, March 2015

47

Abstract

Human pathogens transmitted by ticks undergo complex life cycles alternating between the arthropod vector and a mammalian host. While the latter has been investigated to a greater extent, examination of the biological interactions between microbes and the ticks that carry them presents an equally important opportunity for disruption of the disease cycle. In this study, we used in situ hybridization to demonstrate infection by the Ehrlichia muris-like organism, a newly recognized human pathogen, of Ixodes scapularis ticks, a primary vector for several important human disease agents. This allowed us to assess whole sectioned ticks for the patterns of tissue invasion, and demonstrate generalized dissemination of ehrlichiae in a variety of cell types and organs within ticks infected naturally via blood feeding. Electron microscopy was used to confirm these results. Here we describe a strong ehrlichial affinity for epithelial cells, neuronal cells of the synganglion, salivary glands, and male accessory glands.

48

Introduction

The incidence of tick-borne zoonoses has been increasing worldwide, primarily in moderate climate zones, which is attributable in part to the expanded geographical distribution and abundance of vector ticks. Ongoing changes in climate and habitat, as well as human land usage frequently alter the composition of local flora and fauna in favor of ticks and their hosts [1–10]. While some of the causative agents have been known for decades, others have only recently been identified as human pathogens. One such organism, a species closely related to Ehrlichia muris, was cultured from a human patient diagnosed with ehrlichiosis acquired in Wisconsin in 2009 [11]. Previously undescribed in that area, as of 2013, 67 cases of illness caused by the E. muris-like agent (EML) have been documented with probable exposure in Minnesota and

Wisconsin (2009 -2013)[12]. Clinical presentation is similar to human anaplasmosis and human monocytic ehrlichiosis, with symptoms including fever, headache, myalgia, malaise, and nausea [11,12]. EML organisms have been identified via polymerase chain reaction (PCR) in blacklegged ticks (Ixodes scapularis) [11,13] and isolated from an engorged adult I. scapularis [14], suggesting this species as the probable primary vector to humans.

In order to identify possible points of intervention related to prevention and treatment of parasitic diseases, it is invaluable to understand the development and biological requirements of the etiologic agent and how it interacts with each of its hosts

[15]. Several medically important species within the family Anaplasmataceae, to which 49

EML belongs, have been well-studied in vertebrate hosts, including the zoonotic pathogen Anaplasma phagocytophilum, and the veterinary pathogen Anaplasma marginale, which causes bovine anaplasmosis. Within the genus Ehrlichia, the species most frequently responsible for human illness, Ehrlichia chaffeensis, has been studied extensively in vitro and in human tissues [16–18], and EML infection in mice has been evaluated as a potential model of human ehrlichiosis [19]. Comparatively, understanding of the biological interaction between Anaplasmataceae and their tick vectors lags behind that of mammalian hosts, especially those with medical significance. In particular, description of specific sites of infection within ticks has relied largely upon detection of pathogen DNA in tick tissues using the polymerase chain reaction (PCR). A number of factors contribute to the difficulty of visually identifying these bacteria in ticks, including their intracellular niche, small size, polymorphic shape, low pathogen load of some species, as well as the autofluorescence of digestive byproducts and certain anatomical features of ticks. It is important to surmount these obstacles in order to improve our understanding of individual pathogens, their unique characteristics such as cell/tissue tropisms and processes of acquisition and transmission, and to evaluate the contrasts between their dual life histories in mammalian hosts and tick vectors.

Among the Anaplasmataceae, only the life cycle of A. marginale has been described extensively in vivo in ticks. Using light and electron microscopy, morphologic features unique to in vivo infection have been imaged, and various 50 bacterial life stages identified in a wide range of tissues in Dermacentor andersoni, with the salivary glands and gut muscle cells shown to be important sites for replication and transmission, respectively [15,20–23]. In contrast, among Anaplasmataceae commonly infecting humans, published literature on tissue localization is limited to A. phagocytophilum. This includes identification in salivary glands, gut, and hemolymph using PCR, staining, and light microscopy [24–26] as well as a single electron microscopy study showing morulae (membrane bound bacterial inclusions within the cytoplasm of host cells) in tick gut muscle cells, salivary glands, and ganglia [27].

Ehrlichia chaffeensis has yet to be imaged in ticks, while the ultrastructural features of

E. canis and E. ruminantium have been shown in several organs of experimentally infected ticks [28,29]. In addition, there is a single publication containing micrographs of ehrlichial organisms in the salivary glands of wild caught ticks [30].

To address this deficit in knowledge and determine potential targets for disrupting pathogen acquisition and transmission, we undertook an in-depth visual investigation of EML infection in nymphal, male, and female I. scapularis using in situ hybridization (ISH) and electron microscopy.

Materials and Methods

Tick infection

Larval I. scapularis were hatched from gravid females obtained from Oklahoma

State University and allowed to feed to repletion on 10-week old outbred Syrian hamsters (Mesocricetus auratus) inoculated intraperitoneally with ISE6 cell culture 51

[31,32] infected with the EmCRT (Ehrlichia muris-like agent Camp Ripley Tick) isolate. Larvae were assumed pathogen free given that colony-reared adults are fed on pathogen-free animal hosts and ehrlichiae have not been shown to be transovarially transmitted. The EmCRT isolate was cultured from an engorged female I. scapularis collected at Camp Ripley, Minnesota in the fall of 2011. Following euthanasia, PCR was performed on blood drawn from a single hamster via cardiac puncture eight days post inoculation (d.p.i.) to confirm EML infection. The remaining hamsters were then infested with larvae the following day (9 d.p.i.). Blood was collected as described previously from hamsters for PCR once most larvae had fed to repletion (15 d.p.i.) to confirm tick exposure to EML.

Animal research was carried out in accordance with the recommendations in the

Guide for the Care and Use of Laboratory Animals of the National Institutes of Health

[33]. Sodium pentobarbital was used to sedate rodents for tick application, and carbon dioxide overexposure was used for euthanization of hamsters, following a protocol approved by The Institutional Animal Care and Use Committee (IACUC) of the

University of Minnesota (# 1307-30753A). Fully-engorged larvae were surface cleaned with sodium hypochlorite diluted to 0.01% in water and rinsed with Milli-Q (Millipore

Corporation, Billerica, MA, USA) filtered water. Cleaned ticks were housed in 5 mL vented polystyrene tubes (BD Biosciences, Canaan, CT, USA) and stored in a glass desiccator over a saturated solution of K2SO4 (~97% humidity) at room temperature

(20-22 degrees Celcius) under a 16 hour light, 8 hour dark photoperiod [34]).

Following molting, five nymphs were assessed for infection using PCR, and the 52 remainder were fed on naïve hamsters 8-12 weeks later and allowed to molt into adults.

Adults were then tested for ehrlichial infection by PCR.

Determination of tick infection by PCR

Ticks used for PCR were washed as described above, placed individually in sterile 1.5 ml micro-centrifuge tubes and sliced into 2-3 pieces using sterile 25G x 5/8 inch needles (BD, Franklin, NJ, USA) and fine forceps. To avoid carry-over of DNA, fresh needles and forceps were used for individual ticks. Pieces were then submerged in 300 µl Cell Lysis Solution (Puregene Core Kit A; Qiagen Sciences, Valencia, CA,

USA), vortexed, heated to 75 °C for 5 min and allowed to further dissolve overnight at room temperature. DNA was extracted from ticks using the Puregene Core Kit A per manufacturer’s instructions (Qiagen) and PCR was performed using PER 1

(5'TTTATCGCTATTAGATGAGCCTATG3') and PER 2

(5'CTCTACACTAGGAATTCCGCTAT3') primers [35] with GoTaq DNA polymerase

(Promega, Madison, WI, USA) to amplify ehrlichial DNA. These primers target the

16S rDNA and produce a 451 bp product that was visualized after agarose gel electrophoresis and GelGreen staining (Biotium, Hayward, CA, USA) to verify successful PCR-amplification. The primer set can be used to identify members of the genera Anaplasma and Ehrlichia (including EML), but not does not amplify sequence of the I. scapularis symbiont, Rickettsia buchneri [36].

53

In Situ Hybridization (ISH)

Sections of the dorsal carapace were removed from surface-sterilized male, female, and nymphal I. scapularis, and ticks were fixed overnight in a 10% buffered formalin solution (Fisher Scientific, Hampton, NH, USA ) at 4 °C. Fixed specimens were washed in 70% ethanol and positioned in groups of four in 1.2% agarose gel to retain planar position. Blocks of gel were then submitted to the Masonic Cancer Center

Comparative Pathology Laboratory at the University of Minnesota where they were paraffin embedded, sectioned at 4 µm thickness, and placed onto Superfrost Plus microscope slides (Fisher Scientific, Minneapolis, MN, USA).

Slides were baked at 60 °C for 60 min prior to paraffin removal with xylenes (Fisher

Scientific). Next, ISH was performed using the QuantiGene ViewRNA ISH Tissue 1-

Plex Assay for RNA (Affymetrix, Santa Clara, CA, USA) with Gill’s hematoxylin and

DAPI (4',6-diamidino-2-phenylindole) used as described in the manufacturer’s protocol to provide tissue- and cellular context. An EmCRT-specific DNA probe from

Affymetrix containing a set of 20 oligonucleotide pairs targeting the EmCRT 23S rRNA

(GenBank accession ID# BankIt1793496 E_muris_ KP702294) was hybridized to the bacterial RNA. The sequence selected to construct the probe was obtained using the

EmCRT Illumina sequencing trace file downloaded from NCBI (SRR1029852.sra) and assembled with SPAdes [37]. The annotation was completed using Prokka [38].

Selection of Ehrlichia sequence used in the probe was carefully chosen to avoid hybridization with the I. scapularis endosymbiont genome (accession #

JFKF01000080; locus tag REISMN_04040). Amplifying branched DNA was 54 hybridized to the probe to increase signal strength, followed by hybridization with a label probe that utilized Fast Red as substrate (2-amino-5-chlorotoluenehydrochloride tablets dissolved in napthol) to provide both red chromogenic and red fluorescent labelling.

Imaging

Sections affixed to slides were viewed on an Olympus DSU (disc scanning unit) confocal microscope equipped with a Q-Fire digital camera, as well as DAPI and mCherry filters and a Photometrix QuantEm 512 SC camera for fluorescent microscopy image capture. MetaMorph Premier (Molecular Devices, Sunnyvale, CA, USA) imaging software in conjunction with ImageJ (U.S. NIH, Bethesda, MD, USA) and

Adobe Photoshop software were used to acquire and process images. The Smart

Sharpen filter and Brighten/Contrast tools in Photoshop CS4 were used to enhance contrast in TEM images and to correct brightness levels in brightfield images.

Transmission Electron Microscopy

Freshly molted adults infected with EmCRT as larvae were bisected anterior to posterior using a sterile # 15 surgical blade (Southmedic, Barrie, ON, Canada). These specimens were immediately fixed using a modified version of Ito’s fixative [39,40], first under vacuum for 10 min, then submerged at 4°C overnight. Following three 5 55 min rinses with 0.1 M sodium cacodylate buffer, 1% osmium tetroxide was used for secondary fixation (3.5 h at room temperature) prior to a second wash in 0.1 M sodium cacodylate buffer. Rinsed fixed specimens were stained with 0.5% uranyl acetate overnight at 4°C, and dehydrated in an ascending series of ethanol (20% for 10 min,

40% for 10 min, 60% for 10min, 80% for 10min, 95% and 100% for 10 min x 3), followed by an acetone to resin transition where >99% acetone was used for a total of two 10 min washes. Samples were then immersed in resin diluted 1:1 by volume with acetone for 30 min using a rotator and subsequently removed from the mixture and infiltrated with undiluted Spurr Low Viscosity Resin (Sigma-Aldrich, St. Louis, MO,

USA) for 24 h. Resin containing ticks was poured into blocks and polymerized at 70 °C for 24 hours. Ultrathin sections were cut using a diamond knife on an Leica Ultracut

LCT ultramicrotome (Leica Microsystems), collected on formvar/carbon- coated copper grids, and stained at room temperature for 20 min in 3% aqueous uranyl acetate followed by 3 min in Sato's lead stain. Sections were visualized and imaged with a Philips CM12 model transmission electron microscope (FEI, Hillsboro, OR,

USA) operating at 60 kV at the University of Minnesota Imaging Centers-St. Paul.

Anatomical structures were identified with the aid of several literature sources [41–43].

Results

In situ hybridization (ISH)

Microscopic examination of sectioned I. scapularis that had undergone ISH demonstrated great variability in bacterial load between individual ticks. While many 56 ticks showed broadly disseminated infections that were easily visible by bright field microscopy facilitated by the chromogenic label, in others, infection load was light enough to require the use of fluorescent microscopy to detect probe signal (Fig. 1A, bright-field). Light infection loads were those in which few small morulae were scattered throughout tissues or restricted to one or two organs, and no obvious pathogenic changes were observed. Heavy infection loads (Fig. 1B) were defined as those that affected the entire tick, including leg muscle, synganglion, salivary glands and male accessory glands, and induced significant and wide-spread tissue damage.

Because of the predilection of E. muris for the male accessory glands, males were always considered heavily infected. Females and nymphs observed in this study displayed similar infection patterns, with several individuals of each group showing widespread infection throughout their anatomy. While ehrlichiae were found in tissues throughout the tick, they appeared to preferentially invade epithelial cells. Salivary glands (Fig. 2A & Fig. 3), outer cortex regions of the synganglion (central nervous system) (Fig. 1C) and epithelial cells surrounding the tracheal complex (Figs. 4A & 4B) were the most frequent sites of infection among the ticks sampled. Interestingly, some salivary gland acini harbored large numbers of ehrlichiae, while neighboring clusters were lightly or uninfected, suggesting a possible tropism for specific types of acini that was further supported by TEM findings in this study [15,43]. Similarly, we consistently observed ehrlichiae in cells forming the peripheral cortical region of the synganglion while the internal neuropile was largely free of morulae or contained a few scattered groups of bacteria (Fig. 1C). Ovarian tissues showed no evidence of active infection, an 57 unsurprising observation given that transovarial transmission has not been observed within the genus Ehrlichia [44].

Conversely, male reproductive tissues showed varying susceptibilities, as the accessory glands of several individuals contained numerous EML bacteria. Ehrlichiae were especially apparent in the secretory cells of the latero-dorsal lobes (Fig. 2C), while adjacent lobes of the accessory gland and seminal vesicle appeared to be much less susceptible (Fig. 2D). Spermatids and spermatocysts did not show evidence of intracellular bacteria, and testes appeared relatively free of EML, with probe hybridizing only to cells forming the capsule (Fig. 2B). Similar to females and nymphs, salivary glands, synganglion, and epithelial cells in males were heavily infected.

In heavily infected individuals, EML invaded the connective tissue and muscle throughout the legs, appearing to spread along the epithelial cells lining tracheoles extending throughout the body (Fig. 4). While we did observe EML RNA within hemocytes, no morulae were evident (Fig. 4C), leaving it unclear whether the cells played a role in dispersion of EML, as reported for A. phagocytophilum [26], or whether we simply detected an immune response and bacterial phagocytosis. Many of the infected tissues were adjacent to interstitial compartments, which suggested possible cell-free dispersion of EML. Of additional interest, we noted a visually significant load of bacteria in the basis capitulum and mouthparts of several individuals. This could possibly reflect route of initial bacterial exposure during acquisition feeding as well as 58 potentially represent a factor in tick to host transmission (Figs. 1B & 1D). In contrast to previous publications localizing Anaplasma spp., infection of gut tissues was infrequent and light.

I n several individuals, tissues containing large numbers of ehrlichiae showed signs of pathogenic changes, particularly within the appendages where muscle tissues appeared to be deteriorating or detached from connective tissues and the chitinous exoskeleton. Additional areas of apparent tissue damage included frayed lining of the synganglion, and lesions within synganglial tissue and the lumen of male accessory glands (Figs. 2C).

TEM

Transmission electron microscopy was used to confirm results of the ISH assay.

Ehrlichial bodies displaying an outer cell wall membrane and an inner cytoplasmic membrane were identified within morulae in both male and female I. scapularis (Fig. 5

A & B insets). While variable with respect to cell type, infected tick cells typically exhibited 1-3 morulae per cell, with 10 to 20 bacteria per section, in contrast to light microscopic observations of EML-infected tick cell cultures where cells may contain as many as six morulae that may harbor dozens of bacteria [11]. Morulae in most tissues, with the exception of the male accessory glands were smaller and contained fewer bacteria than described for A. marginale and E. muris [21,30]. EML bacteria were observed in multiple organs and tissues including salivary gland (type II and type II 59 acini) (Fig. 5A), synganglion (Fig. 5B), the tracheal complex (Fig. 5C), male accessory gland and connective tissues (Fig. 5D). Ehrlichiae were not observed in type I (non granulated) acini. Both reticulate and dense core organisms were present.

Discussion

An organism’s capacity to utilize the contrasting environments offered by arthropod and mammalian host cells depends upon a diverse set of physiologic abilities.

Differences in transcription, antigenicity, developmental rate and appearance have been observed between Anaplasmataceae cultured in tick and mammalian cell lines as well as in vivo infection of different hosts and tissues, reflecting a potentially unique set of interactions between the bacteria and a particular environment [15,21,24,45–52]. These comparisons are vital for understanding the functions of the genes that allow intracellular pathogens to navigate highly disparate host systems and cell types using a limited genome. Accordingly, results of this study address a key deficit in existing knowledge of the arthropod phase of the life cycle of ehrlichiae and provide a basis to compare and contrast with the mammalian stage of infection. In addition to improving our understanding of a potentially important model organism for human ehrlichiosis

[19], our findings may contribute toward the study of other human pathogens vectored by I. scapularis, including A. phagocytophilum.

60

The application of ISH to whole sectioned ticks enabled a sensitive and specific means to screen entire ticks for EML infection rather than limiting our search to specific tissues. EML were identified in tissues beyond the expected targets, i.e., midgut and salivary glands, and the assay allowed us to pinpoint the location of bacteria to a specific region of an organ while retaining exact anatomical context. Electron micrographs supplemented the ISH images, displaying EML tropism for neural cells in the outer cortex region of the synganglion, particularly along the border of the neuropile. Salivary gland images facilitated the identification of specific acinus types and confirmed the heavy and regionally specific foci of infection in the male accessory gland, another secretory organ. Broad areas of general probe hybridization (pink regions in Fig. 2D) in these structures suggest that ehrlichial RNA is present within the secretory fluids, possibly as a result of degraded bacteria released from heavily infected lysing cells. At present, published work on the anatomy and function of this organ is limited, especially for Ixodes spp. Further study in this area could provide a clearer picture of why certain lobes are associated with heavy infection while proximal regions of the gland are uninfected, and if there is an effect on male reproductive fitness.

Cytopathic effects were also apparent in muscle and connective tissues within appendages such as the legs and palps, and throughout the basis capitulum. Although these regions are proximal to the alimentary canal, it is not known whether bacteria residing there can access salivary ducts or esophagus during transmission feeding, unless severe damage from heavy infections would sufficiently compromise tissue 61 integrity to allow leakage into the food canal. In contrast to previous reports for E. muris infection of Ixodes persulcatus [30], salivary gland cells appeared largely intact.

Somewhat unexpectedly, we found that ehrlichiae were highly disseminated throughout various tick tissues, with a strong affinity for epithelial cells. The contrast observed between several heavily infected nymphs and several lightly infected females suggested that the degree of infection (EML load) was not necessarily dependent on developmental stage, and may be a result of individual tick susceptibility or bacterial dosage related to feeding position on the host. Irrespectively, males consistently displayed heavy infections. Salivary glands were heavily colonized in all life stages where infection was chromogenically visible while the gametes of both sexes were free of bacterial colonies, indicating enzootic horizontal transmission as the probable route of pathogen maintenance in nature.

Visual recognition of salivary glands, synganglia, skeletal muscle, and epithelial tissues as sites harboring EML bacteria coincides with prior reports localizing

Anaplasma and Ehrlichia spp.[15,20–23,26,27,30]. However, the ehrlichial load in some ticks in our study was more extensive than what was previously assumed for

Anaplasmataceae other than A. marginale. Because we infected ticks as larvae, it is possible that the extended period of infection or the additional physiological tissue reorganization during a second molt (nymph to adult) could have led to more disseminated ehrlichial colonization of adult ticks than in adults infected as nymphs. 62

Yet we also observed several nymphs with heavy bacterial burdens, suggesting other factors such as host bacteremia level at the time of feeding, position of tick during feeding, or reduced tick immune responses to EML as possible explanations. Despite heavy colonization of essential tissues such as synganglia, which frequently appeared to show pathologic changes, we did not note any adverse reactions to EML in ticks such as difficulty feeding or reduced survival under laboratory conditions. Yet it is possible that under more stressful conditions in the wild, EML may have a discernable negative impact on vectors and possibly account for the low prevalence of these infections in wild-caught ticks [11,13]. A broad distribution throughout the vector has previously been considered to be indicative of a pathogenic species rather than a symbiont in other

Rickettsiales [53–55] typically found at low frequencies in wild tick populations.

Determining the potential impacts of advanced EML infection on the fitness of ticks, including their ability to access hosts and overwinter survival might contribute toward a clearer picture of the epidemiology of this organism.

Future research efforts should describe the pathogen-vector relationship sequentially through the processes of acquisition, internal development, dissemination, and transmission to host. Doing so may uncover key points for disruption of the transmission process through vaccines or therapeutic approaches.

63

Figures

Figure 1. Whole tick sections subjected to ISH assay. (A) Nymph with non- apparent EML infection. (B) Female basis capitulum showing heavy infection of epithelial tissues. (C) Male synganglion showing heavy infection of outer cortex.

(D) Transversal section through male basis capitulum with cheliceral sheathes shown at left. Red indicates bacterial probe hybridization, blue indicates nuclear staining. Scale bars (SB) A, B, C =100 µm, D = 50 µm.

" #

$ % 64

Figure 2. Whole tick sections subjected to ISH assay. (A) Acini and salivary ducts of infected adult female SB = 10 µm. (B) Spermatozoa of adult male with infected lining sheath. SB = 10µm. (C) Infected adult male accessory gland (single lobe). SB

= 20 µm. (D) Infected adult male accessory gland (multiple lobes). SB = 100 µm.

65

Figure 3. Whole tick sections subjected to ISH assay. Salivary gland of adult male showing multiple infected acini and salivary ducts. SB = 20 µm.

66

Figure 4. Whole tick sections subjected to ISH assay.

(A) Infected epithelial cells lining a trachea in adult male (bright field microscopy).

(B) Same specimen as (A) imaged using fluorescent red filter. (C) Appendage of infected adult male. Arrows indicate hemocytes. SB = 20 µm.

67

Figure 5. TEM of whole tick sections.

(A) Male salivary gland showing Type I and Type II acini. Arrows indicate EMLA morulae. Inset shows morula at higher magnification. (B) Synganglion of infected adult male tick. Np = neuropile, nsg = neurosecretory granules. Inset shows morulae at higher magnification. (C) Infected epithelial sheath surrounding a tracheole. (D) Adult male accessory gland with heavy infection of lobe on the right.

SB A,B,D = 5µm, C = 1µm.

68

Chapter 4

Experimental evaluation of Peromyscus leucopus as a reservoir host of the Ehrlichia muris-like agent

Geoffrey E. Lynn1, Jonathan D. Oliver1, Ingrid Cornax2, M. Gerard O’Sullivan2, and Ulrike G. Munderloh1

1 Entomology Dept., University of Minnesota – Twin Cities 2 Comparative Pathology and Shared Resources, University of Minnesota – Twin Cities

For submission to Parasites and Vectors

69

Abstract

Background: The Ehrlichia muris-like agent is a newly recognized human pathogen in the North Central United States. Though blacklegged ticks have been identified as capable vectors, wild reservoirs have not yet been established for EMLA. As key hosts for blacklegged ticks, white-footed mice are important reservoirs for various tickborne pathogens, and potentially, for EMLA. The objective of this study was to evaluate reservoir competence in white-footed mice using a natural vector.

Results: White-footed mice acquired EMLA infection from feeding ticks and were able to transmit infection to naïve ticks. Co-feeding transmission between tick life stages was also demonstrated. Infections in mice were acute and severe, with systemic dissemination. Limited host survival and clearance of infection among survivors resulted in a narrow period of host infectiousness for ticks.

Conclusions: White-footed mice are competent reservoirs of EMLA and likely to play a role in its enzootic transmission cycle. The length and severity of EMLA infection in these hosts suggests that tick phenology is a critical factor determining the geographic distribution of EMLA in North America.

70

Background

Ehrlichia is a genus of gram-negative intracellular bacteria transmitted by hard- bodied ticks. Several species are important medical and veterinary pathogens, including the Ehrlichia muris-like agent (EMLA), which has recently been recognized as a cause of human ehrlichiosis in Minnesota and Wisconsin (1, 2). Surveillance and experimental studies indicate that the blacklegged tick (Ixodes scapularis) is the primary vector for EMLA (1, 3–8).

In contrast to the research associating I. scapularis with transmission of EMLA, the enzootic reservoirs of this pathogen are not yet well defined. Borrelia burgdorferi and Anaplasma phagocytophilum, the respective agents of Lyme disease and human anaplasmosis, the two most common tick-borne pathogens in the upper Midwest, are pathogens that also circulate in an enzootic transmission cycle between vertebrate hosts and blacklegged ticks. Though these ticks are generalists that feed on a variety of hosts including mammals, birds, and reptiles (9, 10), the white-footed mouse (Peromyscus leucopus) is commonly recognized as a primary host, and a reservoir for pathogens transmitted by I. scapularis.

White-footed mice (WFM) are among the most ubiquitous, and frequently, the most numerous small mammals represented in surveys of northern deciduous forests

(11–16). As key hosts of immature I. scapularis, WFM permit heavy infestation and support a high level of molting success (17, 18). These attributes and the demonstrated 71 high reservoir competence of WFM for both B. burgdorferi (11, 19) and A. phagocytophilum strains responsible for human disease (13, 15, 20–22) frequently result in efficient production of infected nymphs, or high “realized reservoir competence” (23,

24). It is therefore possible that these mice could also be important reservoirs for

EMLA. However, a survey of small mammals at two locations where EMLA is present in ticks found only 2/139 P. leucopus with DNA evidence of infection (3). White-tailed deer (Odocoileus virginianus), the primary reservoir for Ehrlichia chaffeensis, another human pathogen closely related to EMLA, have not been found to carry EMLA in these same locations (3), even though deer are an important host for I. scapularis.

The primary goals of this work were to assess competence of WFM as reservoirs of EMLA including evaluation of both host-pathogen interaction and vector-host transmission, and to determine whether transmission between cofeeding tick lifestages may have an impact on natural EMLA transmission.

Materials and Methods

Ten female P. leucopus were sourced from the Peromyscus Genetic Stock

Center at the University of South Carolina, (Columbia, SC, USA). Mice were approximately 16 weeks old at the time of study initiation. All research involving animals was performed in accordance with the recommendations in the Guide for the

Care and Use of Laboratory Animals of the National Institutes of Health (25)and a 72 protocol approved by The Institutional Animal Care and Use Committee (IACUC) of the University of Minnesota (# 1307–30753A).

Larval ticks used in the experiments hatched from eggs laid by gravid female I. scapularis that were obtained from Oklahoma State University. EMLA-infected nymphs were produced via larval feeding on hamsters inoculated with the EmCRT isolate cultured in ISE6 cells (7, 26, 27). Successful hamster infection with EMLA was confirmed by testing blood using PCR with PER1 and PER2 primers complimentary to

EMLA 16S rDNA under conditions described previously (7, 28). Engorged ticks were washed and housed in 5-mL vented polystyrene tubes as described (7, 27). At approximately 12 weeks following nymphal molt, each mouse was infested with 10-12 nymphs from a cohort of which 70% (n=10) had tested PCR-positive for EMLA using the same primers as for testing blood. About 150-200 larvae were then placed on individual P. leucopus at varying time points between 24 hours and 34 days following nymphal infestation.

Mice were screened for bacteremia as early as 24 hours after nymph infestation.

Blood for PCR was collected from the facial vein (live subjects), or by cardiac puncture following euthanasia. The Puregene Core Kit A (Qiagen Sciences, Valencia, CA, USA) was used to extract DNA from blood.

Following euthanasia, mouse tissues were removed aseptically and small sections were frozen at -70 °C, with the remainder fixed in 10% buffered formalin 73 solution at 4 °C for 24-48 hours, followed by storage in 70% ethanol. DNA was extracted from 10-20 mg of frozen tissue using the DNeasy Blood & Tissue Kit

(Qiagen). Ticks tested by PCR were surface sterilized with sodium hypochlorite, rinsed in purified water (7), and placed in sterile microfuge tubes where they were perforated with sterile needles prior to DNA extraction using the DNeasy Blood & Tissue Kit.

PCR was performed using PER1 and PER2 primers with ~100 ng of template DNA.

Fixed tissues were paraffin-embedded, sectioned at 4 µm onto slides (Fisher

Scientific, Hampton, NH, USA), and a subset stained with hematoxylin and eosin

(H&E) at the Masonic Cancer Center Comparative Pathology Laboratory at the

University of Minnesota. Unstained paraffin-embedded tissue sections were processed using in situ hybridization (ISH), as previously described (7, 29).

Histological images were acquired using a SPOT Insight 4.0 Megapixel color mosaic camera using Spot version 5.2. Images showing ISH were obtained using the

SPOT equipment/software as well as a Nikon Color DS-Fi2 CCD camera and NIS

Elements imaging software. Contrast, brightness, and sharpness were adjusted linearly across the whole images in Adobe Photoshop.

Results

At least 9 of the 10 mice acquired EMLA infection from feeding ticks, as evidenced by positive PCR results for blood (Fig1). Eight mice developed fatal disease, 74 with onset for the majority (5/8) occurring 10 to 12 days after nymph feeding was initiated. Onset of illness was sudden, and ataxia and tremors were the first signs, while dyspnea was not observed. Of the two surviving mice, infection was confirmed in one by PCR on day 10, while the second was negative at that time. It is possible that this second individual developed bacteremia after blood was collected (day 10). This scenario occurred for individual #7, which tested negative on day 10, but was subsequently positive when it developed severe illness on day 15.

Blood from all three mice infested with larvae 24 h after infected nymphs were introduced tested PCR-negative for ehrlichiae at that time (Fig. 1). From those infestations, one mouse produced infected nymphs (4/10), while nymphs from the other two mice tested negative. PCR results subsequently showed that all three mice had detectable EMLA bacteremia on day 10. Nine of 10 nymphs molting from larvae placed on mouse #5 seven days after infestation with infected nymphs tested positive. Though blood samples collected for mouse #4 on day 10 were inadequate for PCR, xenodiagnosis was utilized. Engorged larvae that had dropped off mouse #4 from days

9-12 tested negative (0/10), and additionally, nymphs (0/10) resulting from this feeding tested negative as well. EMLA infection was subsequently confirmed by PCR at the onset of illness, 23 days following infestation. Engorged nymphs were recovered from mouse #4 over the same time period as the ticks feeding on mouse #5, indicating that no delay of initiation of feeding by larval ticks had occurred, and that a prolonged incubation period resulted in the delayed onset of illness for this mouse. All ticks fed 75 on the two surviving mice 21 and 34 days following nymphal infestation tested negative.

All tissues for the eight individuals with lethal infections (mice #1-7, & #10) tested positive for ehrlichiae by PCR. These results were later confirmed for a combination of tissue sections from mouse #1 and mouse #2 using ISH (Figs. 2-4). The two surviving mice (#8 & #9) were euthanized on day 41, when cardiac blood and all tissues including bone marrow tested negative by PCR.

Three of the mice that succumbed to acute disease were examined by histology.

The most significant lesion observed in all three mice was moderate interstitial pneumonia (pneumonitis) (Fig. 2A) characterized by multifocal thickening of the alveolar walls by increased numbers of mononuclear inflammatory cells (Fig. 2B &

2C). In addition, there was marked diffuse intralobular perivascular edema (Fig. 2A), and moderate to marked peripheral alveolar edema with increased numbers of alveolar macrophages and occasional multinucleate cells (Fig 2C). Pulmonary blood vessels were often surrounded by prominent lymphohistiocytic perivascular cuffs and contained large numbers of marginated intraluminal monocytes. Scattered endothelial cells were markedly expanded by vacuoles filled with a myriad of punctate organisms (Fig. 2D).

The livers exhibited diffuse mild microvesicular hepatocellular vacuolation, moderate

Kupffer cell hyperplasia, and increased numbers of periportal and sinusoidal mononuclear inflammatory cells (Fig. 3A). Examination of the spleens revealed 76 moderate to marked expansion and disruption of the white pulp, frequent single cell lymphoid necrosis, increased numbers of tingible body macrophages, and infiltrates of large lymphoid cells and plasma cells extending into the red pulp. Similar disruption of lymphoid follicular architecture was noted in the mesenteric lymph nodes. Though brain tissues of acutely ill mice were extensively infected (Figs. 4&5), there were no obvious lesions present. A fourth mouse that tested positive by PCR but never showed overt signs of disease (#8) was also examined histologically, and no significant lesions were observed.

Discussion

As both important hosts for immature blacklegged ticks and amplifying reservoirs of disease agents, WFM are likely to be involved in the natural enzootic cycle of EMLA. Here we show that WFM are susceptible to EMLA infection by feeding ticks and that co-feeding transmission of bacteria to naïve ticks may occur shortly after a host is exposed to EMLA. While previous research using inbred laboratory mice demonstrated that bacteremia was absent or very low during the first week following intraperitoneal (i.p.) infection, peaking at about two weeks (8), we observed successful acquisition by larvae feeding within a period of 24h to 5 days after infestation with infected nymphs. Co-feeding transmission of EMLA by I. scapularis feeding on

C57BL/6 mice (Mus musculus) has been reported (8) and is also likely to occur with the 77 related A. phagocytophilum, where tick-to-mouse transmission can occur within 24h and ticks may acquire the pathogen even when host bacteremia is too low to detect by

PCR (22, 30). The high rate of acquisition (90%) of EMLA by ticks fed on an acutely ill individual with detectable bacteremia (#5) we observed was comparable to that reported for larvae fed on needle-infected C57BL/6 mice (90-100%) at peak bacteremia

(5, 29). Ticks feeding during the same time period on a second mouse (#4) that succumbed much later did not acquire EMLA. While PCR was not performed for this individual at the time of infestation, onset of illness was much later (23 days) than the other mice, which may be attributable to genetic variability in these outbred mice.

Though the quantity of infected nymphs used to infest mice was consistent, it is also possible that differences in bacterial inoculum due to host grooming or tick bacterial load could account for this outlier.

Similar to inbred laboratory mice, tick transmission of EMLA resulted in systemic dissemination of ehrlichiae to various organs of WFM (5, 8, 29). The frequency of lethal outcomes we observed (80%) falls within the range of those previously reported for C57BL/6 mice following tick transmission (27% and 80%)(5,

8). Neither xenodiagnosis nor PCR of bone marrow demonstrated chronic EMLA infection in our WFM infected by ticks, in contrast to previous reports using different experimental conditions to infect inbred laboratory mice (31).

78

Histological analysis indicated that the high mortality of WFM was a result of severe, acute infection that caused multifactorial disease. Pathologic signs were observed in multiple organs, most prominently in the lungs, liver, and lymph nodes. As reported for the IOE mouse model of ehrlichiosis, the rapid course of disease in WFM precluded the formation of liver granulomas in WFM (32). Pulmonary edema though present, was limited compared with our previous observations in i.p. inoculated

C57BL/6 mice (29). Varied presence of EMLA in all tissues assayed was demonstrated by ISH and confirmed PCR results. EMLA has previously been cultured in human and monkey endothelial cells and as well as in an I. scapularis cell line of unknown tissue identity (29). Anaplasma phagocytophilum, and E. chaffeensis reside in leukocytes, which allows for their dispersal to various organs, and it is possible that endothelial cells of the vasculature and lymphatic systems facilitate systemic dissemination of

EMLA. Of particular interest was the extensive infection of vascular endothelial cells throughout the brain, though despite the clinical signs suggesting possible neurological disease, pathological lesions were not obvious. There was, however, some evidence of mild cerebral edema, which should be further investigated.

Our results establish WFM as competent reservoirs of EMLA, although the realized reservoir competence of this species appears to be limited by a short duration of infection in the hosts, reducing potential acquisition opportunities for larvae. This is in contrast to the primary pathogens of medical importance transmitted by I. scapularis,

Borrelia spp. and A. phagocytophilum, which do not typically induce clinical disease or 79 affect the survival of WFM and other wild rodent hosts (33–41). Rather, they cause extended infections that can persist for months to years (13, 19, 36, 38, 40–50), allowing much greater opportunity for transmission to naïve vectors. Acute, lethal

EMLA infections in WFM, a host that typically accounts for a large proportion of larval bloodmeals in the Midwestern and Northeastern U.S. are likely to limit presence of the pathogen in nature, which corresponds with available surveillance data. Nonetheless, it cannot be ruled out that EMLA infections may be less severe and longer lasting in other potential reservoir species that might consequently play a greater role in its natural maintenance.

In addition, factors including highly efficient acquisition by larvae, and tick phenology in areas of EMLA endemicity may counteract the limitations of a brief period of host infectiousness. Most bacterial pathogens transmitted by Ixodes ticks are transtadially retained, but not passed vertically from females to offspring (transovarial transmission). Consequently, the seasonal activity of tick life stages relative to each other may have considerable impact on transmission of certain pathogens that do not persist in hosts for long periods. Successful maintenance of these pathogens in nature may require that larval feeding occurs in close enough temporal proximity to infected nymphs (or potentially adults) for hosts to be infectious.

Previous studies have demonstrated that vector phenology influences distribution patterns of tickborne encephalitis virus (TBEv), B. burgdorferi, and A. 80 phagocytophilum (51, 52). TBEv infections are brief and non-systemic in rodent hosts, requiring simultaneous feeding of infected nymphal and larval Ixodes ricinus ticks for transmission to naïve ticks to occur, and as a result, geographic distribution of the virus is limited to areas with a high degree of seasonal synchrony of immature stages of the vector (53). In contrast, A. phagocytophilum, which may often infects hosts for weeks or months, is present in the US both in areas where immature I. scapularis activity is synchronized, and those where activity is asynchronous. Furthermore, local genotypic composition of B. burgdorferi populations has been shown to be influenced by phenology, where strains that infect hosts for longer periods are dominant in areas where feeding of larvae and nymphs is asynchronous (54).

Likewise, phenology of tick life stages would appear to impact distribution of

EMLA. In the Northeastern US, feeding patterns of immature stages of I. scapularis are typically more asynchronous than in the upper Midwest, with nymphal peaks in late spring followed by larval peaks toward the latter part of summer (55). The large, prolific late summer peak of larval feeding typically observed at Northeastern sites does not coincide with peak nymph emergence in these areas (54, 56–58). In contrast, peak feeding periods of immature I. scapularis life stages in the Upper Midwest are much more closely synchronized, with extensive overlap in some locations (15, 16, 54) that is more conducive for inter-stage transmission of pathogens that cause short-duration infections in hosts. The current geographical distribution of EMLA is likely a consequence of these disparate phenological patterns (16, 54). However, the broad 81 spatial and temporal continuum of phenology occurring in I. scapularis populations between the Northeastern and North Central U.S. would suggest that additional factors contribute to the relatively limited geographical presence of EMLA.

Our findings suggest that the ecological niche occupied by EMLA appears to lie somewhere between that of TBEv and B. burgdorferi, where tick acquisition of ehrlichiae occurs both during a short period of bacteremia as well as during co-feeding transmission from infected nymphs to larvae. The latter extends the period during which ticks could become infected by several days prior to onset of bacteremia. It is also possible that co-feeding transmission enables species that otherwise might not be considered important reservoirs, based on failure to develop systemic infection, to contribute to enzootic maintenance of EMLA (53). Further studies should investigate the possibility that wild canids, insectivores, and other vertebrates, in addition to rodents, play a role in the enzootic cycle, with sampling efforts conducted at or shortly after the expected peak nymphal feeding period.

82

Figures

Figure 1. Timeline showing mouse survival and infectiousness for ticks in white- footed mice infected with EMLA via tick transmission. Infected nymphs were introduced on Day 0 followed by uninfected larvae at various time points. Tick and mouse infection status was determined by PCR.



 UFSNJOBM

 TVSWJWPS

 F

T  V P N

 

 

1$3
TUBUVT
PG
NPVTF
CMPPE &.-"
JOGFDUFE
OZNQIT
QMBDFE

1$3
TUBUVT
PG
NPVTF
CPOF
NBSSPX -BSWBF
QMBDFE
9
JOEJDBUFT

NPMUFE
OZNQIT
QPTJUJWF
GPS
&.-"
JOGFDUJPO

83

Figure 2. Lung tissue from white-footed mice acutely infected with EMLA. Images

A-D show H&E stained sections revealing various pathological signs including (A) marked perivascular edema (asterisk); (B) mononuclear perivascular infiltration in lung tissue (asterisk) and peripheral alveolar edema; (C) alveolar edema

(asterisk), alveolar macrophages (arrowheads) and multinucleate macrophage

(arrow); (D) enlarged vascular endothelial cells containing morulae (arrows). ISH was performed on section (E) to identify morulae within endothelial cells of pulmonary vasculature. EMLA is labeled red, cell nuclei are stained blue. Scale bar:

A & B = 200 μm, C = 100 μm, D = 50 μm, E= 100 μm.

% &

84

Figure 3. White-footed mouse liver tissue infected with EMLA. (A) H&E staining reveals lesions and other signs characteristic of inflammation, including a hepatic portal triad that is mildly infiltrated with mononuclear inflammatory cells. Kupffer cells in hepatic sinusoids are indicated by white arrows, and dividing Kupffer cells are designated by black arrows. The arrowheads point to small clear cytoplasmic vacuoles. (B) ISH labeling of morulae within hepatic or endothelial cells (arrows).

EMLA is labeled red, cell nuclei are stained blue. Scale bar = 100 μm.

"

# 85

Figure 4. Brain tissue infected with EMLA. Images (A) & (B) display sectioned brain stem, while (C) & (D) show part of the cerebellum. Brain tissues lack overt signs of pathology as indicated by H&E staining (A) & (C), despite the presence of

EMLA in these same tissues as demonstrated by ISH where EMLA is labeled red, cell nuclei are stained blue (B) & (D). Arrows point to morulae in (D). Scale bar =

100 μm.

" $

# %

86

Figure 5. EMLA-infected vasculature within the leptomeninges, demonstrated using ISH. EMLA is labeled red, cell nuclei are stained blue. Yellow discs are erythrocytes. Scale bar = 100 μm.

87

Summary

The EmCRT isolate is genotypically and phenotypically similar to the human

EMLA isolate. EmCRT is also pathogenic for inbred laboratory mice and WFM, disseminating to various organs, with lung and liver tissues exhibiting the most overt lesions. Thus, it may be useful as a suitable model for HME. Ehrlichiae were also commonly identified in endothelial cells of the vasculature of infected rodents.

Ixodes scapularis ticks are likely to be the primary vectors transmitting EMLA, and though transmission from infected rodents to I. scapularis is highly efficient, its transmission is also limited by the short duration of infection in vertebrate hosts. The mCherry and mKate mutants generated in this study retained the ability to grow in tick and mammalian cells, enabling the use of live microscopy for in vitro and in vivo imaging. Live microscopy using the mutants, and in situ hybridization each revealed that EMLA infection was well-dispersed throughout ticks, with a particular affinity for epithelial cells, neuronal cells of the synganglion, salivary glands, and male accessory glands.

White-footed mice, which are common and frequent hosts for I. scapularis in settings where EMLA is present, are competent reservoirs for the pathogen. The short window that a host is infective for feeding ticks is likely to limit the prevalence among ticks other hosts in nature. Co-feeding transmission of EMLA by feeding ticks was also demonstrated and is likely to be important in natural enzootic cycle. The brief period of host infectiousness for ticks coupled with the capacity for co-feeding transmission of 88

EMLA are indicative that the phenology of I. scapularis is a critical factor in whether the pathogen occurs in a specific area, and likely explains the current geographical distribution of EMLA.

89

References

Chapter 1

1. Popov VL, Han VC, Chen SM, Dumler JS, Feng HM, Andreadis TG, Tesh RB, Walker DH. 1998. Ultrastructural differentiation of the genogroups in the genus Ehrlichia. J Med Microbiol 47:235–51.

2. Silverstein AM. 1998. On the naming of rickettsiae after Paul Ehrlich. Bull Hist Med 72:731–3.

3. Allsopp BA. 2009. Trends in the control of heartwater. Onderstepoort J Vet Res 76:81–8.

4. Dawson JE, Anderson BE, Fishbein DB, Sanchez JL, Goldsmith CS, Wilson KH, Duntley CW. 1991. Isolation and characterization of an Ehrlichia sp. from a patient diagnosed with human ehrlichiosis. J Clin Microbiol 29:2741– 5.

5. Anderson BE, Dawson JE, Jones DC, Wilson KH. 1991. Ehrlichia chaffeensis, a new species associated with human ehrlichiosis. J Clin Microbiol 29:2838– 42.

6. Pritt BS, Sloan LM, Johnson DKH, Munderloh UG, Paskewitz SM, McElroy KM, McFadden JD, Binnicker MJ, Neitzel DF, Liu G, Nicholson WL, Nelson CM, Franson JJ, Martin SA, Cunningham SA, Steward CR, Bogumill K, Bjorgaard ME, Davis JP, McQuiston JH, Warshauer DM, Wilhelm MP, Patel R, Trivedi VA, Eremeeva ME. 2011. Emergence of a new pathogenic Ehrlichia species, Wisconsin and Minnesota, 2009. N Engl J Med 365:422–9.

7. Telford III SR, Goethert HK, Cunningham JA. 2011. Prevalence of Ehrlichia muris in Wisconsin Deer Ticks Collected During the Mid 1990s. Open Microbiol J 5:18–20.

8. CDC. 2014. Ehrlichiosis and Anaplasmosis 2012. MMWR.

9. Ismail N, Bloch KC, McBride JW. 2010. Human ehrlichiosis and anaplasmosis. Clin Lab Med 30:261–92.

10. Kawahara M, Suto C, Rikihisa Y, Yamamoto S, Tsuboi Y. 1993. Characterization of ehrlichial organisms isolated from a wild mouse. J Clin Microbiol 31:89–96. 90

11. Tabara K, Arai S, Kawabuchi T, Itagaki A, Ishihara C, Satoh H, Okabe N, Tsuji M. 2007. Molecular survey of Babesia microti, Ehrlichia species and Candidatus neoehrlichia mikurensis in wild rodents from Shimane Prefecture, Japan. Microbiol Immunol 51:359–67.

12. Johnson DKH, Schiffman EK, Davis JP, Neitzel DF, Sloan LM, Nicholson WL, Fritsche TR, Steward CR, Ray JA, Miller TK, Feist MA, Uphoff TS, Franson JJ, Livermore AL, Deedon AK, Theel ES, Pritt BS. 2015. Human Infection with Ehrlichia muris-like Pathogen, United States, 2007-2013(1). Emerg Infect Dis 21:1794–9.

13. Neitzel DF. 2014. Lyme Disease Statistics.

14. Li JS-Y, Winslow GM. 2003. Survival, replication, and antibody susceptibility of Ehrlichia chaffeensis outside of host cells. Infect Immun 71:4229–37.

15. Mathema VB, Manzoor Z, Koo J-E, Koh Y-S. 2013. Inhibition of cell death of bone marrow-derived macrophages infected with Ehrlichia muris. Ticks Tick Borne Dis 4:185–90.

16. Saito TB, Thirumalapura NR, Shelite TR, Rockx-Brouwer D, Popov VL, Walker DH. 2014. An Animal Model of a Newly Emerging Human Ehrlichiosis. J Infect Dis.

17. Lynn, Geoffrey E., Burkhardt, Nicole Y., Felsheim, Roderick F. , Nelson, Curtis M. , Oliver, Jonathan D., Kurtti, Timothy J., Cornax, O’Sullivan, M. Gerard and UGM. Characterization and genetic transformation of an Ehrlichia isolated from a Minnesota tick. Appl Environ Microbiol.

18. Stromdahl E, Hamer S, Jenkins S, Sloan L, Williamson P, Foster E, Nadolny R, Elkins C, Vince M, Pritt B. 2014. Comparison of phenology and pathogen prevalence, including infection with the Ehrlichia muris-like (EML) agent, of Ixodes scapularis removed from soldiers in the midwestern and the northeastern United States over a 15 year period (1997-2012). Parasit Vectors 7:553.

19. Paddock CD, Childs JE. 2003. Ehrlichia chaffeensis: a prototypical emerging pathogen. Clin Microbiol Rev 16:37–64.

20. Popov VL, Korenberg EI, Nefedova V V, Han VC, Wen JW, Kovalevskii Y V, Gorelova NB, Walker DH. 2007. Ultrastructural evidence of the ehrlichial developmental cycle in naturally infected Ixodes persulcatus ticks in the course of coinfection with Rickettsia, Borrelia, and a flavivirus. Vector Borne Zoonotic Dis 7:699–716. 91

21. Rar VA, Pukhovskaya NM, Ryabchikova EI, Vysochina NP, Bakhmetyeva S V, Zdanovskaia NI, Ivanov LI, Tikunova N V. 2015. Molecular-genetic and ultrastructural characteristics of “Candidatus Ehrlichia khabarensis”, a new member of the Ehrlichia genus. Ticks Tick Borne Dis 6:658–67.

22. Kawahara M, Ito T, Suto C, Shibata S, Rikihisa Y, Hata K, Hirai K. 1999. Comparison of Ehrlichia muris strains isolated from wild mice and ticks and serologic survey of humans and animals with E. muris as antigen. J Clin Microbiol 37:1123–9.

23. Anderson JF, Magnarelli LA. Avian and mammalian hosts for spirochete- infected ticks and insects in a Lyme disease focus in Connecticut. Yale J Biol Med 57:627–41.

24. Goethert HK, Telford SR. 2003. Enzootic transmission of the agent of human granulocytic ehrlichiosis among cottontail rabbits. Am J Trop Med Hyg 68:633–7.

25. Sonenshine DE. 1992. Biology of Ticks Volume 1. Oxford Univ Press.

26. Anderson JF, Johnson RC, Magnarelli LA, Hyde FW. 1985. Identification of endemic foci of Lyme disease: isolation of Borrelia burgdorferi from feral rodents and ticks (Dermacentor variabilis). J Clin Microbiol 22:36–8.

27. Arsnoe IM, Hickling GJ, Ginsberg HS, McElreath R, Tsao JI. 2015. Different populations of blacklegged tick nymphs exhibit differences in questing behavior that have implications for human Lyme disease risk. PLoS One 10:e0127450.

28. Gray JS, Kahl O, Lane RS, Levin ML, Tsao JI. 2016. Diapause in ticks of the medically important Ixodes ricinus species complex. Ticks Tick Borne Dis 7:992–1003.

29. Costero A, Grayson MA. 1996. Experimental transmission of Powassan virus (Flaviviridae) by Ixodes scapularis ticks (Acari:Ixodidae). Am J Trop Med Hyg 55:536–46.

30. McQuiston JH, McCall CL, Nicholson WL. 2003. Ehrlichiosis and related infections. J Am Vet Med Assoc 223:1750–6.

31. Nair ADS, Cheng C, Jaworski DC, Willard LH, Sanderson MW, Ganta RR. 2014. Ehrlichia chaffeensis infection in the reservoir host (white-tailed deer) and in an incidental host (dog) is impacted by its prior growth in macrophage and tick cell environments. PLoS One 9:e109056. 92

32. Kollars TM. 1993. Ticks (Acari: Ixodidae) infesting medium-sized wild mammals in southwestern Tennessee. J Med Entomol 30:896–900.

33. Nelder MP, Russell CB, Sheehan NJ, Sander B, Moore S, Li Y, Johnson S, Patel SN, Sider D. 2016. Human pathogens associated with the blacklegged tick Ixodes scapularis: a systematic review. Parasit Vectors 9:265.

34. Castillo CG, Eremeeva ME, Paskewitz SM, Sloan LM, Lee X, Irwin WE, Tonsberg S, Pritt BS. 2015. Detection of human pathogenic Ehrlichia muris- like agent in Peromyscus leucopus. Ticks Tick Borne Dis 6:155–7.

35. Schmidt KA, Ostfeld RS, Schauber EM. 1999. Infestation of Peromyscus leucopus and Tamias striatus by Ixodes scapularis (Acari: Ixodidae) in relation to the abundance of hosts and parasites. J Med Entomol 36:749–57.

36. LoGiudice K, Ostfeld RS, Schmidt KA, Keesing F. 2003. The ecology of infectious disease: effects of host diversity and community composition on Lyme disease risk. Proc Natl Acad Sci U S A 100:567–71.

37. Johnson RC, Kodner C, Jarnefeld J, Eck DK, Xu Y. 2011. Agents of human anaplasmosis and Lyme disease at Camp Ripley, Minnesota. Vector Borne Zoonotic Dis 11:1529–34.

38. Walls JJ, Greig B, Neitzel DF, Dumler JS. 1997. Natural infection of small mammal species in Minnesota with the agent of human granulocytic ehrlichiosis. J Clin Microbiol 35:853–5.

39. Lynn, Geoffrey E., Burkhardt, Nicole Y., Felsheim, Roderick F. , Nelson, Curtis M. , Oliver, Jonathan D., Kurtti, Timothy J., Cornax, O’Sullivan, M. Gerard and UGM. Characterization and genetic transformation of an Ehrlichia isolated from a Minnesota tick. Appl Environ Microbiol.

40. Saito TB, Walker DH. 2015. A Tick Vector Transmission Model of Monocytotropic Ehrlichiosis. J Infect Dis.

41. Karpathy SE, Allerdice MEJ, Sheth M, Dasch GA, Levin ML. 2016. Co- Feeding Transmission of the Ehrlichia muris-Like Agent to Mice (Mus musculus). Vector Borne Zoonotic Dis 16:145–50.

42. Winslow GM, Yager E, Shilo K, Collins DN, Chu FK. 1998. Infection of the laboratory mouse with the intracellular pathogen Ehrlichia chaffeensis. Infect Immun 66:3892–9.

43. Winslow GM, Yager E, Shilo K, Volk E, Reilly A, Chu FK. 2000. Antibody- 93

mediated elimination of the obligate intracellular bacterial pathogen Ehrlichia chaffeensis during active infection. Infect Immun 68:2187–95.

44. Massung RF, Priestley RA, Levin ML. 2004. Transmission route efficacy and kinetics of Anaplasma phagocytophilum infection in white-footed mouse, Peromyscus leucopus. Vector Borne Zoonotic Dis 4:310–8.

45. Blas-Machado U, de la Fuente J, Blouin EF, Almazán C, Kocan KM, Mysore J V. 2007. Experimental infection of C3H/HeJ mice with the NY18 isolate of Anaplasma phagocytophilum. Vet Pathol 44:64–73.

46. Telford SR, Dawson JE. 1996. Persistent infection of C3H/HeJ mice by Ehrlichia chaffeensis. Vet Microbiol 52:103–12.

47. Olano JP, Wen G, Feng H-M, McBride JW, Walker DH. 2004. Histologic, serologic, and molecular analysis of persistent ehrlichiosis in a murine model. Am J Pathol 165:997–1006.

48. Shibata S, Kawahara M, Rikihisa Y, Fujita H, Watanabe Y, Suto C, Ito T. 2000. New Ehrlichia species closely related to Ehrlichia chaffeensis isolated from Ixodes ovatus ticks in Japan. J Clin Microbiol 38:1331–8.

49. Sotomayor EA, Popov VL, Feng HM, Walker DH, Olano JP. 2001. Animal model of fatal human monocytotropic ehrlichiosis. Am J Pathol 158:757–69.

50. Munderloh UG, Silverman DJ, MacNamara KC, Ahlstrand GG, Chatterjee M, Winslow GM. 2009. Ixodes ovatus Ehrlichia exhibits unique ultrastructural characteristics in mammalian endothelial and tick-derived cells. Ann N Y Acad Sci 1166:112–9.

51. Lampe DJ, Churchill ME, Robertson HM. 1996. A purified mariner transposase is sufficient to mediate transposition in vitro. EMBO J 15:5470– 9. 52. Lampe DJ, Akerley BJ, Rubin EJ, Mekalanos JJ, Robertson HM. 1999. Hyperactive transposase mutants of the Himar1 mariner transposon. Proc Natl Acad Sci U S A 96:11428–33.

Chapter 2

1. Dumler JS, Bakken JS. 1996. Human granulocytic ehrlichiosis in Wisconsin and Minnesota: a frequent infection with the potential for persistence. J Infect Dis 173:1027–30. 94

2. Belongia EA, Reed KD, Mitchell PD, Mueller-Rizner N, Vandermause M, Finkel MF, Kazmierczak JJ. 2001. Tickborne infections as a cause of nonspecific febrile illness in Wisconsin. Clin Infect Dis 32:1434–9.

3. Neitzel DF, Kemperman MM. 2012. Tick-borne diseases in Minnesota: an update. Minn Med 95:41–4.

4. Chen SM, Dumler JS, Bakken JS, Walker DH. 1994. Identification of a granulocytotropic Ehrlichia species as the etiologic agent of human disease. J Clin Microbiol 32:589–95.

5. Bakken JS, Dumler JS, Chen SM, Eckman MR, Van Etta LL, Walker DH. 1994. Human granulocytic ehrlichiosis in the upper Midwest United States. A new species emerging? JAMA 272:212–8.

6. CDC. 2014. Ehrlichiosis and Anaplasmosis 2012. MMWR. Available online (http://www.cdc.gov/mmwr/preview/mmwrhtml/mm6153a1.htm. ) Accessed 20 September 2015.

7. Paddock CD, Childs JE. 2003. Ehrlichia chaffeensis: a prototypical emerging pathogen. Clin Microbiol Rev 16:37–64.

8. Comer JA, Nicholson WL, Olson JG, Childs JE. 1999. Serologic testing for human granulocytic ehrlichiosis at a national referral center. J Clin Microbiol 37:558–64.

9. Pritt BS, Sloan LM, Johnson DKH, Munderloh UG, Paskewitz SM, McElroy KM, McFadden JD, Binnicker MJ, Neitzel DF, Liu G, Nicholson WL, Nelson CM, Franson JJ, Martin SA, Cunningham SA, Steward CR, Bogumill K, Bjorgaard ME, Davis JP, McQuiston JH, Warshauer DM, Wilhelm MP, Patel R, Trivedi VA, Eremeeva ME. 2011. Emergence of a new pathogenic Ehrlichia species, Wisconsin and Minnesota, 2009. N Engl J Med 365:422–9.

10. Johnson DKH, Schiffman EK, Davis JP, Neitzel DF, Sloan LM, Nicholson WL, Fritsche TR, Steward CR, Ray JA, Miller TK, Feist MA, Uphoff TS, Franson JJ, Livermore AL, Deedon AK, Theel ES, Pritt BS. 2015. Human Infection with Ehrlichia muris-like Pathogen, United States, 2007-2013(1). Emerg Infect Dis 21:1794–9.

11. Telford III SR, Goethert HK, Cunningham JA. 2011. Prevalence of Ehrlichia muris in Wisconsin Deer Ticks Collected During the Mid 1990s. Open Microbiol J 5:18–20. 95

12. Stromdahl E, Hamer S, Jenkins S, Sloan L, Williamson P, Foster E, Nadolny R, Elkins C, Vince M, Pritt B. 2014. Comparison of phenology and pathogen prevalence, including infection with the Ehrlichia muris-like (EML) agent, of Ixodes scapularis removed from soldiers in the midwestern and the northeastern United States over a 15 year period (1997-2012). Parasit Vectors 7:553.

13. Lynn GE, Oliver JD, Nelson CM, Felsheim RF, Kurtti TJ, Munderloh UG. 2015. Tissue Distribution of the Ehrlichia muris-Like Agent in a Tick Vector. PLoS One 10:e0122007.

14. Saito TB, Walker DH. 2015. A Tick Vector Transmission Model of Monocytotropic Ehrlichiosis. J Infect Dis.

15. Karpathy SE, Allerdice MEJ, Sheth M, Dasch GA, Levin ML. 2016. Co- Feeding Transmission of the Ehrlichia muris-Like Agent to Mice (Mus musculus). Vector Borne Zoonotic Dis 16:145–50.

16. Kurtti TJ, Munderloh UG, Hughes CA, Engstrom SM, Johnson RC. 1996. Resistance to tick-borne spirochete challenge induced by Borrelia burgdorferi strains that differ in expression of outer surface proteins. Infect Immun 64:4148–53.

17. Munderloh UG, Jauron SD, Fingerle V, Leitritz L, Hayes SF, Hautman JM, Nelson CM, Huberty BW, Kurtti TJ, Ahlstrand GG, Greig B, Mellencamp MA, Goodman JL. 1999. Invasion and intracellular development of the human granulocytic ehrlichiosis agent in tick cell culture. J Clin Microbiol 37:2518–24.

18. Oliver JD, Burkhardt NY, Felsheim RF, Kurtti TJ, Munderloh UG. 2014. Motility characteristics are altered for Rickettsia bellii transformed to overexpress a heterologous rickA gene. Appl Environ Microbiol 80:1170–6.

19. Riedl J, Crevenna AH, Kessenbrock K, Yu JH, Neukirchen D, Bista M, Bradke F, Jenne D, Holak TA, Werb Z, Sixt M, Wedlich-Soldner R. 2008. Lifeact: a versatile marker to visualize F-actin. Nat Methods 5:605–7.

20. Goodman JL, Nelson C, Vitale B, Madigan JE, Dumler JS, Kurtti TJ, Munderloh UG. 1996. Direct cultivation of the causative agent of human granulocytic ehrlichiosis. N Engl J Med 334:209–15.

21. Sumner JW, Nicholson WL, Massung RF. 1997. PCR amplification and comparison of nucleotide sequences from the groESL heat shock operon of Ehrlichia species. J Clin Microbiol 35:2087–92. 96

22. Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgins DG. 2007. Clustal W and Clustal X version 2.0. Bioinformatics 23:2947–8.

23. Goujon M, McWilliam H, Li W, Valentin F, Squizzato S, Paern J, Lopez R. 2010. A new bioinformatics analysis tools framework at EMBL-EBI. Nucleic Acids Res 38:W695–W699.

24. Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Höhna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP. 2012. MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. Syst Biol 61:539–42.

25. Pearse WD, Purvis A. 2013. phyloGenerator: an automated phylogeny generation tool for ecologists. Methods Ecol Evol 4:692–698.

26. Rambaut A. 2015. FigTree v1.4.2.

27. Guide for the Care and Use of Laboratory Animals 8th Edition. 2011. Available online: http://www.ncbi.nlm.nih.gov/books/NBK54050/. Accessed 21 January 2016.

28. Felsheim RF, Herron MJ, Nelson CM, Burkhardt NY, Barbet AF, Kurtti TJ, Munderloh UG. 2006. Transformation of Anaplasma phagocytophilum. BMC Biotechnol 6:42.

29. Cheng C, Nair ADS, Indukuri V V, Gong S, Felsheim RF, Jaworski D, Munderloh UG, Ganta RR. 2013. Targeted and random mutagenesis of Ehrlichia chaffeensis for the identification of genes required for in vivo infection. PLoS Pathog 9:e1003171.

30. Shaner NC, Campbell RE, Steinbach PA, Giepmans BNG, Palmer AE, Tsien RY. 2004. Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein. Nat Biotechnol 22:1567–72.

31. Baldridge GD, Burkhardt N, Herron MJ, Kurtti TJ, Munderloh UG. 2005. Analysis of fluorescent protein expression in transformants of Rickettsia monacensis, an obligate intracellular tick symbiont. Appl Environ Microbiol 71:2095–105.

32. Baldridge GD, Burkhardt NY, Labruna MB, Pacheco RC, Paddock CD, Williamson PC, Billingsley PM, Felsheim RF, Kurtti TJ, Munderloh UG. 97

2010. Wide dispersal and possible multiple origins of low-copy-number plasmids in rickettsia species associated with blood-feeding arthropods. Appl Environ Microbiol 76:1718–31.

33. Ito S, Vinson JW, McGuire TJ. 1975. Murine typhus Rickettsiae in the Oriental rat flea. Ann N Y Acad Sci 266:35–60.

34. Kurtti TJ, Munderloh UG, Hayes SF, Krueger DE, Ahlstrand GG. 1994. Ultrastructural analysis of the invasion of tick cells by Lyme disease spirochetes (Borrelia burgdorferi) in vitro. Can J Zool 72:977–994.

35. Heimer R, Tisdale D, Dawson J. 1998. A single tissue culture system for the propagation of the agents of the human ehrlichioses. Am J Trop Med Hyg 58:812–815.

36. Barnewall RE, Rikihisa Y, Lee EH. 1997. Ehrlichia chaffeensis inclusions are early endosomes which selectively accumulate transferrin receptor. Infect Immun 65:1455–61.

37. Dawson JE, Anderson BE, Fishbein DB, Sanchez JL, Goldsmith CS, Wilson KH, Duntley CW. 1991. Isolation and characterization of an Ehrlichia sp. from a patient diagnosed with human ehrlichiosis. J Clin Microbiol 29:2741– 5.

38. Dawson JE, Candal FJ, George VG, Ades EW. 1993. Human endothelial cells as an alternative to DH82 cells for isolation of Ehrlichia chaffeensis, E. canis, and Rickettsia rickettsii. Pathobiology 61:293–6.

39. Munderloh UG, Silverman DJ, MacNamara KC, Ahlstrand GG, Chatterjee M, Winslow GM. 2009. Ixodes ovatus Ehrlichia exhibits unique ultrastructural characteristics in mammalian endothelial and tick-derived cells. Ann N Y Acad Sci 1166:112–9.

40. Dedonder SE, Cheng C, Willard LH, Boyle DL, Ganta RR. 2012. Transmission electron microscopy reveals distinct macrophage- and tick cell-specific morphological stages of Ehrlichia chaffeensis. PLoS One 7:e36749.

41. Sotomayor EA, Popov VL, Feng HM, Walker DH, Olano JP. 2001. Animal model of fatal human monocytotropic ehrlichiosis. Am J Pathol 158:757–69.

42. Shibata S, Kawahara M, Rikihisa Y, Fujita H, Watanabe Y, Suto C, Ito T. 2000. New Ehrlichia species closely related to Ehrlichia chaffeensis isolated from Ixodes ovatus ticks in Japan. J Clin Microbiol 38:1331–8. 98

43. Ismail N, Soong L, McBride JW, Valbuena G, Olano JP, Feng H-M, Walker DH. 2004. Overproduction of TNF-alpha by CD8+ type 1 cells and down- regulation of IFN-gamma production by CD4+ Th1 cells contribute to toxic shock-like syndrome in an animal model of fatal monocytotropic ehrlichiosis. J Immunol 172:1786–800.

44. Saito TB, Thirumalapura NR, Shelite TR, Rockx-Brouwer D, Popov VL, Walker DH. 2014. An Animal Model of a Newly Emerging Human Ehrlichiosis. J Infect Dis.

45. Wong S, Grady LJ. 1996. Ehrlichia infection as a cause of severe respiratory distress. N Engl J Med 334:273.

46. Fichtenbaum CJ, Peterson LR, Weil GJ. 1993. Ehrlichiosis presenting as a life-threatening illness with features of the toxic shock syndrome. Am J Med 95:351–7.

47. Marty AM, Dumler JS, Imes G, Brusman HP, Smrkovski LL, Frisman DM. 1995. Ehrlichiosis mimicking thrombotic thrombocytopenic purpura. Case report and pathological correlation. Hum Pathol 26:920–5.

48. Sehdev AE, Dumler JS. 2003. Hepatic pathology in human monocytic ehrlichiosis. Ehrlichia chaffeensis infection. Am J Clin Pathol 119:859–65.

49. Dawson JE, Paddock CD, Warner CK, Greer PW, Bartlett JH, Ewing SA, Munderloh UG, Zaki SR. 2001. Tissue diagnosis of Ehrlichia chaffeensis in patients with fatal ehrlichiosis by use of immunohistochemistry, in situ hybridization, and polymerase chain reaction. Am J Trop Med Hyg 65:603–9.

50. Dumler JS, Dawson JE, Walker DH. 1993. Human ehrlichiosis: hematopathology and immunohistologic detection of Ehrlichia chaffeensis. Hum Pathol 24:391–6.

51. Walker DH, Dumler JS. 1997. Human monocytic and granulocytic ehrlichioses. Discovery and diagnosis of emerging tick-borne infections and the critical role of the pathologist. Arch Pathol Lab Med 121:785–91.

52. Kawahara M, Suto C, Rikihisa Y, Yamamoto S, Tsuboi Y. 1993. Characterization of ehrlichial organisms isolated from a wild mouse. J Clin Microbiol 31:89–96.

53. Olano JP, Wen G, Feng H-M, McBride JW, Walker DH. 2004. Histologic, serologic, and molecular analysis of persistent ehrlichiosis in a murine model. Am J Pathol 165:997–1006. 99

54. Hammac GK, Ku P-S, Galletti MF, Noh SM, Scoles GA, Palmer GH, Brayton KA. 2013. Protective immunity induced by immunization with a live, cultured Anaplasma marginale strain. Vaccine 31:3617–22.

55. Crosby FL, Brayton KA, Magunda F, Munderloh UG, Kelley KL, Barbet AF. 2015. Reduced Infectivity in cattle for an outer membrane protein mutant of Anaplasma marginale. Appl Environ Microbiol 81:2206–14.

56. Cheng C, Nair ADS, Jaworski DC, Ganta RR. 2015. Mutations in Ehrlichia chaffeensis Causing Polar Effects in Gene Expression and Differential Host Specificities. PLoS One 10:e0132657.

57. Paskewitz SM. 2015. Ehrlichia sp. Wisconsin (EML). Wisconsin Ticks Tick- borne Dis. Available online (http://labs.russell.wisc.edu/wisconsin- ticks/ehrlichia-muris-like/ ). Accessed 28 September 2015.

58. Castillo CG, Eremeeva ME, Paskewitz SM, Sloan LM, Lee X, Irwin WE, Tonsberg S, Pritt BS. 2015. Detection of human pathogenic Ehrlichia muris- like agent in Peromyscus leucopus. Ticks Tick Borne Dis 6:155–7.

59. Levin ML, Fish D. 2001. Interference between the agents of Lyme disease and human granulocytic ehrlichiosis in a natural reservoir host. Vector Borne Zoonotic Dis 1:139–48.

60. Macaluso KR, Sonenshine DE, Ceraul SM, Azad AF. 2002. Rickettsial infection in Dermacentor variabilis (Acari: Ixodidae) inhibits transovarial transmission of a second Rickettsia. J Med Entomol 39:809–13.

Chapter 3

1. Barbour AG, Fish D. 1993. The biological and social phenomenon of Lyme disease. Science 260:1610–6.

2. Harrus S, Baneth G. 2005. Drivers for the emergence and re-emergence of vector-borne protozoal and bacterial diseases. Int J Parasitol 35:1309–18.

3. Ogden NH, Maarouf A, Barker IK, Bigras-Poulin M, Lindsay LR, Morshed MG, O’callaghan CJ, Ramay F, Waltner-Toews D, Charron DF. 2006. Climate change and the potential for range expansion of the Lyme disease vector Ixodes scapularis in Canada. Int J Parasitol 36:63–70. 100

4. Ogden NH, Radojevic M, Wu X, Duvvuri VR, Leighton PA, Wu J. 2014. Estimated effects of projected climate change on the basic reproductive number of the Lyme disease vector Ixodes scapularis. Environ Health Perspect 122:631–8.

5. Cortinas MR, Kitron U. 2006. County-level surveillance of white-tailed deer infestation by Ixodes scapularis and Dermacentor albipictus (Acari: Ixodidae) along the Illinois River. J Med Entomol 43:810–9.

6. Jones KE, Patel NG, Levy MA, Storeygard A, Balk D, Gittleman JL, Daszak P. 2008. Global trends in emerging infectious diseases. Nature 451:990–3.

7. LoGiudice K, Duerr STK, Newhouse MJ, Schmidt KA, Killilea ME, Ostfeld RS. 2008. Impact of host community composition on Lyme disease risk. Ecology 89:2841–9.

8. Levi T, Kilpatrick AM, Mangel M, Wilmers CC. 2012. Deer, predators, and the emergence of Lyme disease. Proc Natl Acad Sci U S A 109:10942–7.

9. Kilpatrick AM, Randolph SE. 2012. Drivers, dynamics, and control of emerging vector-borne zoonotic diseases. Lancet 380:1946–55.

10. Stone BL, Russart NM, Gaultney RA, Floden AM, Vaughan JA, Brissette CA. 2014. The Western Progression of Lyme Disease: Infectious and Non- clonal Borrelia burgdorferi sensu lato Populations in Grand Forks County, North Dakota. Appl Environ Microbiol.

11. Pritt BS, Sloan LM, Johnson DKH, Munderloh UG, Paskewitz SM, McElroy KM, McFadden JD, Binnicker MJ, Neitzel DF, Liu G, Nicholson WL, Nelson CM, Franson JJ, Martin SA, Cunningham SA, Steward CR, Bogumill K, Bjorgaard ME, Davis JP, McQuiston JH, Warshauer DM, Wilhelm MP, Patel R, Trivedi VA, Eremeeva ME. 2011. Emergence of a new pathogenic Ehrlichia species, Wisconsin and Minnesota, 2009. N Engl J Med 365:422–9.

12. Johnson DKH, Neitzel DF, Miller TK, Feist MA, Sloan LM, Eremeeva ME, Fritsche TR, Uphoff TS, Ray J, Schiffman E, Murph D, Davis JP, Pritt BS. 2013. Five Years’ Experience with the Novel Human Ehrlichia sp. in the Upper Midwestern United States: 2009 - 2013. In: American Society of Tropical Medicine and Hygiene 62nd annual meeting. 19 Downloaded from http://jid.oxfordjournals.org/ at University of Minnesota on July 18, 2014 Accepted Manuscript (Washington, D.C.). American Society of Tropical Medicine and Hygi.

13. Telford III SR, Goethert HK, Cunningham JA. 2011. Prevalence of Ehrlichia 101

muris in Wisconsin Deer Ticks Collected During the Mid 1990s. Open Microbiol J 5:18–20.

14. Lynn GE, Kurtti TJ, Nelson CM, Munderloh UG. 2012. Characterization of an Ehrlichia spp. isolated from a Minnesota tick. Presented at the annual meeting of the American Society for Rickettsiology, Park City, UT. July 2012., Park City, Utah, USA.

15. Kocan KM. 1986. Development of Anaplasma marginale Theiler in ixodid ticks: Coordinated development of a rickettsial organism and its tick host. , p. 472–505. In Sauer, JR, Hair, JA (eds.), Morphology, physiology, and behavioral biology of ticks, 1st ed. Ellis Horwood Limited, New York.

16. Dawson JE, Paddock CD, Warner CK, Greer PW, Bartlett JH, Ewing SA, Munderloh UG, Zaki SR. 2001. Tissue diagnosis of Ehrlichia chaffeensis in patients with fatal ehrlichiosis by use of immunohistochemistry, in situ hybridization, and polymerase chain reaction. Am J Trop Med Hyg 65:603–9.

17. Dumler JS, Chen SM, Asanovich K, Trigiani E, Popov VL, Walker DH. 1995. Isolation and characterization of a new strain of Ehrlichia chaffeensis from a patient with nearly fatal monocytic ehrlichiosis. J Clin Microbiol 33:1704–11.

18. Walker DH, Ismail N, Olano JP, McBride JW, Yu X-J, Feng H-M. 2004. Ehrlichia chaffeensis: a prevalent, life-threatening, emerging pathogen. Trans Am Clin Climatol Assoc 115:375–82; discussion 382–4.

19. Saito TB, Thirumalapura NR, Shelite TR, Rockx-Brouwer D, Popov VL, Walker DH. 2014. An Animal Model of a Newly Emerging Human Ehrlichiosis. J Infect Dis.

20. Ge NL, Kocan KM, Blouin EF, Murphy GL. 1996. Developmental studies of Anaplasma marginale (Rickettsiales:Anaplasmataceae) in male Dermacentor andersoni (Acari:Ixodidae) infected as adults by using nonradioactive in situ hybridization and microscopy. J Med Entomol 33:911–20.

21. Kocan KM, Stiller D, Goff WL, Claypool PL, Edwards W, Ewing SA, McGuire TC, Hair JA, Barron SJ. 1992. Development of Anaplasma marginale in male Dermacentor andersoni transferred from parasitemic to susceptible cattle. Am J Vet Res 53:499–507.

22. Kocan KM, Oberst RD, Ewing SA, Hair JA, Barron SJ. 1983. Demonstration of Anaplasma marginale in hemolymph of Dermacentor andersoni by animal inoculation and by fluorescent-antibody technique. Am J Vet Res 44:798– 102

801.

23. Goff W, Barbet A, Stiller D, Palmer G, Knowles D, Kocan K, Gorham J, McGuire T. 1988. Detection of Anaplasma marginale-infected tick vectors by using a cloned DNA probe. Proc Natl Acad Sci U S A 85:919–23.

24. Felek S, Telford S, Falco RC, Rikihisa Y. 2004. Sequence analysis of p44 homologs expressed by Anaplasma phagocytophilum in infected ticks feeding on naive hosts and in mice infected by tick attachment. Infect Immun 72:659–66.

25. Telford SR, Dawson JE, Katavolos P, Warner CK, Kolbert CP, Persing DH. 1996. Perpetuation of the agent of human granulocytic ehrlichiosis in a deer tick-rodent cycle. Proc Natl Acad Sci U S A 93:6209–14.

26. Liu L, Narasimhan S, Dai J, Zhang L, Cheng G, Fikrig E. 2011. Ixodes scapularis salivary gland protein P11 facilitates migration of Anaplasma phagocytophilum from the tick gut to salivary glands. EMBO Rep 12:1196– 203.

27. Reichard M V, Roman RM, Kocan KM, Blouin EF, de la Fuente J, Snider TA, Heinz RE, West MD, Little SE, Massung RF. 2009. Inoculation of white- tailed deer (Odocoileus virginianus) with Ap-V1 Or NY-18 strains of Anaplasma phagocytophilum and microscopic demonstration of Ap-V1 In Ixodes scapularis adults that acquired infection from deer as nymphs. Vector Borne Zoonotic Dis 9:565–8.

28. Smith RD, Sells DM, Stephenson EH, Ristic MR, Huxsoll DL. 1976. Development of Ehrlichia canis, causative agent of canine ehrlichiosis, in the tick Rhipicephalus sanguineus and its differentiation from a symbiotic Rickettsia. Am J Vet Res 37:119–26.

29. Kocan KM, Bezuidenhout JD, Hart A. 1987. Ultrastructural features of Cowdria ruminantium in midgut epithelial cells and salivary glands of nymphal Amblyomma hebraeum. Onderstepoort J Vet Res 54:87–92.

30. Popov VL, Korenberg EI, Nefedova V V, Han VC, Wen JW, Kovalevskii Y V, Gorelova NB, Walker DH. 2007. Ultrastructural evidence of the ehrlichial developmental cycle in naturally infected Ixodes persulcatus ticks in the course of coinfection with Rickettsia, Borrelia, and a flavivirus. Vector Borne Zoonotic Dis 7:699–716.

31. Oliver JD, Burkhardt NY, Felsheim RF, Kurtti TJ, Munderloh UG. 2014. Motility characteristics are altered for Rickettsia bellii transformed to 103

overexpress a heterologous rickA gene. Appl Environ Microbiol 80:1170–6.

32. Massung RF, Levin ML, Munderloh UG, Silverman DJ, Lynch MJ, Gaywee JK, Kurtti TJ. 2007. Isolation and propagation of the Ap-Variant 1 strain of Anaplasma phagocytophilum in a tick cell line. J Clin Microbiol 45:2138–43.

33. Animals NRC (US) C for the U of the G for the C and U of L. 2011. Guide for the Care and Use of Laboratory Animals. National Academies Press (US).

34. Kurtti TJ, Munderloh UG, Hughes CA, Engstrom SM, Johnson RC. 1996. Resistance to tick-borne spirochete challenge induced by Borrelia burgdorferi strains that differ in expression of outer surface proteins. Infect Immun 64:4148–53.

35. Goodman JL, Nelson C, Vitale B, Madigan JE, Dumler JS, Kurtti TJ, Munderloh UG. 1996. Direct cultivation of the causative agent of human granulocytic ehrlichiosis. N Engl J Med 334:209–15.

36. Kurtti TJ, Felsheim RF, Burkhardt NY, Oliver JD, Heu CC, Munderloh UG. 2015. Rickettsia buchneri sp. nov.: A rickettsial endosymbiont of the blacklegged tick Ixodes scapularis. Int J Syst Evol Microbiol.

37. Bankevich A, Nurk S, Antipov D, Gurevich AA, Dvorkin M, Kulikov AS, Lesin VM, Nikolenko SI, Pham S, Prjibelski AD, Pyshkin A V, Sirotkin A V, Vyahhi N, Tesler G, Alekseyev MA, Pevzner PA. 2012. SPAdes: a new genome assembly algorithm and its applications to single-cell sequencing. J Comput Biol 19:455–77.

38. Seemann T. 2014. Prokka: rapid prokaryotic genome annotation. Bioinformatics 30:2068–9.

39. Ito S, Vinson JW, McGuire TJ. 1975. Murine typhus Rickettsiae in the Oriental rat flea. Ann N Y Acad Sci 266:35–60.

40. Kurtti TJ, Munderloh UG, Hayes SF, Krueger DE, Ahlstrand GG. 1994. Ultrastructural analysis of the invasion of tick cells by Lyme disease spirochetes (Borrelia burgdorferi ) in vitro. Can J Zool 72:977–994.

41. Balashov YS, Raikhel AS, Hoogstraal H. 1983. An atlas of ixodid tick ultrastructure.Nauka Publ. Entomological Society of America, Leningrad, USSR.

42. Sauer JR, Hair JA. 1986. Morphology, physiology and behavioral biology of ticks. 104

43. Sonenshine DE. 1992. Biology of Ticks Volume 1. Oxford Univ Press.

44. Long SW, Zhang X, Zhang J, Ruble RP, Teel P, Yu X-J. 2003. Evaluation of transovarial transmission and transmissibility of Ehrlichia chaffeensis (Rickettsiales: Anaplasmataceae) in Amblyomma americanum (Acari: Ixodidae). J Med Entomol 40:1000–4.

45. Nelson CM, Herron MJ, Felsheim RF, Schloeder BR, Grindle SM, Chavez AO, Kurtti TJ, Munderloh UG. 2008. Whole genome transcription profiling of Anaplasma phagocytophilum in human and tick host cells by tiling array analysis. BMC Genomics 9:364.

46. Kuriakose JA, Miyashiro S, Luo T, Zhu B, McBride JW. 2011. Ehrlichia chaffeensis transcriptome in mammalian and arthropod hosts reveals differential gene expression and post transcriptional regulation. PLoS One 6:e24136.

47. Munderloh UG, Silverman DJ, MacNamara KC, Ahlstrand GG, Chatterjee M, Winslow GM. 2009. Ixodes ovatus Ehrlichia exhibits unique ultrastructural characteristics in mammalian endothelial and tick-derived cells. Ann N Y Acad Sci 1166:112–9.

48. Noh SM, Brayton KA, Knowles DP, Agnes JT, Dark MJ, Brown WC, Baszler T V, Palmer GH. 2006. Differential expression and sequence conservation of the Anaplasma marginale msp2 gene superfamily outer membrane proteins. Infect Immun 74:3471–9.

49. Agnes JT, Herndon D, Ueti MW, Ramabu SS, Evans M, Brayton KA, Palmer GH. 2010. Association of pathogen strain-specific gene transcription and transmission efficiency phenotype of Anaplasma marginale. Infect Immun 78:2446–53.

50. Ramabu SS, Ueti MW, Brayton KA, Baszler T V, Palmer GH. 2010. Identification of Anaplasma marginale proteins specifically upregulated during colonization of the tick vector. Infect Immun 78:3047–52.

51. Chávez ASO, Felsheim RF, Kurtti TJ, Ku P-S, Brayton KA, Munderloh UG. 2012. Expression patterns of Anaplasma marginale Msp2 variants change in response to growth in cattle, and tick cells versus mammalian cells. PLoS One 7:e36012.

52. Hammac GK, Pierlé SA, Cheng X, Scoles GA, Brayton KA. 2014. Global transcriptional analysis reveals surface remodeling of Anaplasma marginale in the tick vector. Parasit Vectors 7:193. 105

53. Burgdorfer W, Hayes SF, Mavros AJ. 1981. Nonpathogenic rickettsiae in Dermacentor andersoni a limiting factor for the distribution of Rickettsia rickettsii., p. 585–594. In W. Burgdorfer, W, Anacker, RL (eds.), Rickettsiae and rickettsial diseases. Academic Press Inc., New York.

54. Niebylski ML, Schrumpf ME, Burgdorfer W, Fischer ER, Gage KL, Schwan TG. 1997. Rickettsia peacockii sp. nov., a new species infecting wood ticks, Dermacentor andersoni, in western Montana. Int J Syst Bacteriol 47:446–52.

55. Thepparit C, Hirunkanokpun S, Popov VL, Foil LD, Macaluso KR. 2013. Dissemination of bloodmeal acquired Rickettsia felis in cat fleas, Ctenocephalides felis. Parasit Vectors 6:149.

Chapter 4

1. Pritt BS, Sloan LM, Johnson DKH, Munderloh UG, Paskewitz SM, McElroy KM, McFadden JD, Binnicker MJ, Neitzel DF, Liu G, Nicholson WL, Nelson CM, Franson JJ, Martin SA, Cunningham SA, Steward CR, Bogumill K, Bjorgaard ME, Davis JP, McQuiston JH, Warshauer DM, Wilhelm MP, Patel R, Trivedi VA, Eremeeva ME. 2011. Emergence of a new pathogenic Ehrlichia species, Wisconsin and Minnesota, 2009. N Engl J Med 365:422–9. 2. Johnson DKH, Schiffman EK, Davis JP, Neitzel DF, Sloan LM, Nicholson WL, Fritsche TR, Steward CR, Ray JA, Miller TK, Feist MA, Uphoff TS, Franson JJ, Livermore AL, Deedon AK, Theel ES, Pritt BS. 2015. Human Infection with Ehrlichia muris-like Pathogen, United States, 2007-2013(1). Emerg Infect Dis 21:1794–9.

3. Castillo CG, Eremeeva ME, Paskewitz SM, Sloan LM, Lee X, Irwin WE, Tonsberg S, Pritt BS. 2015. Detection of human pathogenic Ehrlichia muris- like agent in Peromyscus leucopus. Ticks Tick Borne Dis 6:155–7.

4. Paskewitz SM. 2015. Ehrlichia sp. Wisconsin (EML). Wisconsin Ticks Tick- borne Dis.

5. Saito TB, Walker DH. 2015. A Tick Vector Transmission Model of Monocytotropic Ehrlichiosis. J Infect Dis.

6. Lynn, Geoffrey E., Burkhardt, Nicole Y., Felsheim, Roderick F. , Nelson, Curtis M. , Oliver, Jonathan D., Kurtti, Timothy J., Cornax, O’Sullivan, M. Gerard and UGM. Characterization and genetic transformation of an 106

Ehrlichia isolated from a Minnesota tick. Appl Environ Microbiol.

7. Lynn GE, Oliver JD, Nelson CM, Felsheim RF, Kurtti TJ, Munderloh UG. 2015. Tissue Distribution of the Ehrlichia muris-Like Agent in a Tick Vector. PLoS One 10:e0122007.

8. Karpathy SE, Allerdice MEJ, Sheth M, Dasch GA, Levin ML. 2016. Co- Feeding Transmission of the Ehrlichia muris-Like Agent to Mice (Mus musculus). Vector Borne Zoonotic Dis 16:145–50.

9. Fish D, Dowler RC. 1989. Host associations of ticks (Acari: Ixodidae) parasitizing medium-sized mammals in a Lyme disease endemic area of southern New York. J Med Entomol 26:200–9.

10. Keirans JE, Hutcheson HJ, Durden LA, Klompen JS. 1996. Ixodes (Ixodes) scapularis (Acari:Ixodidae): redescription of all active stages, distribution, hosts, geographical variation, and medical and veterinary importance. J Med Entomol 33:297–318.

11. Levine JF, Wilson ML, Spielman A. 1985. Mice as reservoirs of the Lyme disease spirochete. Am J Trop Med Hyg 34:355–60.

12. Schmidt KA, Ostfeld RS, Schauber EM. 1999. Infestation of Peromyscus leucopus and Tamias striatus by Ixodes scapularis (Acari: Ixodidae) in relation to the abundance of hosts and parasites. J Med Entomol 36:749–57.

13. Walls JJ, Greig B, Neitzel DF, Dumler JS. 1997. Natural infection of small mammal species in Minnesota with the agent of human granulocytic ehrlichiosis. J Clin Microbiol 35:853–5.

14. LoGiudice K, Duerr STK, Newhouse MJ, Schmidt KA, Killilea ME, Ostfeld RS. 2008. Impact of host community composition on Lyme disease risk. Ecology 89:2841–9.

15. Johnson RC, Kodner C, Jarnefeld J, Eck DK, Xu Y. 2011. Agents of human anaplasmosis and Lyme disease at Camp Ripley, Minnesota. Vector Borne Zoonotic Dis 11:1529–34.

16. Hamer SA, Hickling GJ, Sidge JL, Walker ED, Tsao JI. 2012. Synchronous phenology of juvenile Ixodes scapularis, vertebrate host relationships, and associated patterns of Borrelia burgdorferi ribotypes in the midwestern United States. Ticks Tick Borne Dis 3:65–74.

17. Brunner JL, Cheney L, Keesing F, Killilea M, Logiudice K, Previtali A, 107

Ostfeld RS. 2011. Molting success of Ixodes scapularis varies among individual blood meal hosts and species. J Med Entomol 48:860–6.

18. Keesing F, Brunner J, Duerr S, Killilea M, Logiudice K, Schmidt K, Vuong H, Ostfeld RS. 2009. Hosts as ecological traps for the vector of Lyme disease. Proc Biol Sci 276:3911–9.

19. Donahue JG, Piesman J, Spielman A. 1987. Reservoir competence of white- footed mice for Lyme disease spirochetes. Am J Trop Med Hyg 36:92–6.

20. Magnarelli LA, Anderson JF, Stafford KC, Dumler JS. 1997. Antibodies to multiple tick-borne pathogens of babesiosis, ehrlichiosis, and Lyme borreliosis in white-footed mice. J Wildl Dis 33:466–73.

21. Telford SR, Dawson JE, Katavolos P, Warner CK, Kolbert CP, Persing DH. 1996. Perpetuation of the agent of human granulocytic ehrlichiosis in a deer tick-rodent cycle. Proc Natl Acad Sci U S A 93:6209–14.

22. Levin ML, Nicholson WL, Massung RF, Sumner JW, Fish D. 2002. Comparison of the reservoir competence of medium-sized mammals and Peromyscus leucopus for Anaplasma phagocytophilum in Connecticut. Vector Borne Zoonotic Dis 2:125–36.

23. LoGiudice K, Ostfeld RS, Schmidt KA, Keesing F. 2003. The ecology of infectious disease: effects of host diversity and community composition on Lyme disease risk. Proc Natl Acad Sci U S A 100:567–71.

24. Keesing F, McHenry DJ, Hersh M, Tibbetts M, Brunner JL, Killilea M, LoGiudice K, Schmidt KA, Ostfeld RS. 2014. Prevalence of human-active and variant 1 strains of the tick-borne pathogen Anaplasma phagocytophilum in hosts and forests of eastern North America. Am J Trop Med Hyg 91:302–9.

25. Guide for the Care and Use of Laboratory Animals 8th Edition. 2011. Available online: http://www.ncbi.nlm.nih.gov/books/NBK54050/. Accessed 21 January 2016.

26. Oliver JD, Chávez ASO, Felsheim RF, Kurtti TJ, Munderloh UG. 2015. An Ixodes scapularis cell line with a predominantly neuron-like phenotype. Exp Appl Acarol 66:427–42.

27. Oliver JD, Lynn GE, Burkhardt NY, Price LD, Nelson CM, Kurtti TJ, Munderloh UG. 2016. Infection of Immature Ixodes scapularis (Acari: Ixodidae) by Membrane Feeding. J Med Entomol 53:409–15. 108

28. Goodman JL, Nelson C, Vitale B, Madigan JE, Dumler JS, Kurtti TJ, Munderloh UG. 1996. Direct cultivation of the causative agent of human granulocytic ehrlichiosis. N Engl J Med 334:209–15.

29. Lynn, Geoffrey E., Burkhardt, Nicole Y., Felsheim, Roderick F. , Nelson, Curtis M. , Oliver, Jonathan D., Kurtti, Timothy J., Cornax, O’Sullivan, M. Gerard and UGM. Characterization and genetic transformation of an Ehrlichia isolated from a Minnesota tick. Appl Environ Microbiol.

30. des Vignes F, Piesman J, Heffernan R, Schulze TL, Stafford KC, Fish D. 2001. Effect of tick removal on transmission of Borrelia burgdorferi and Ehrlichia phagocytophila by Ixodes scapularis nymphs. J Infect Dis 183:773– 8.

31. Saito TB, Thirumalapura NR, Shelite TR, Rockx-Brouwer D, Popov VL, Walker DH. 2014. An Animal Model of a Newly Emerging Human Ehrlichiosis. J Infect Dis.

32. Sotomayor EA, Popov VL, Feng HM, Walker DH, Olano JP. 2001. Animal model of fatal human monocytotropic ehrlichiosis. Am J Pathol 158:757–69.

33. Wright SD, Nielsen SW. 1990. Experimental infection of the white-footed mouse with Borrelia burgdorferi. Am J Vet Res 51:1980–7.

34. Moody KD, Terwilliger GA, Hansen GM, Barthold SW. 1994. Experimental Borrelia burgdorferi infection in Peromyscus leucopus. J Wildl Dis 30:155–61.

35. Brown RN, Lane RS. 1994. Natural and experimental Borrelia burgdorferi infections in woodrats and deer mice from California. J Wildl Dis 30:389–98.

36. Hofmeister EK, Ellis BA, Glass GE, Childs JE. 1999. Longitudinal study of infection with Borrelia burgdorferi in a population of Peromyscus leucopus at a Lyme disease-enzootic site in Maryland. Am J Trop Med Hyg 60:598–609.

37. Salkeld DJ, Leonhard S, Girard YA, Hahn N, Mun J, Padgett KA, Lane RS. 2008. Identifying the reservoir hosts of the Lyme disease spirochete Borrelia burgdorferi in California: the role of the western gray squirrel (Sciurus griseus). Am J Trop Med Hyg 79:535–40.

38. Hanincová K, Ogden NH, Diuk-Wasser M, Pappas CJ, Iyer R, Fish D, Schwartz I, Kurtenbach K. 2008. Fitness variation of Borrelia burgdorferi sensu stricto strains in mice. Appl Environ Microbiol 74:153–7.

39. Schwanz LE, Voordouw MJ, Brisson D, Ostfeld RS. 2011. Borrelia 109

burgdorferi has minimal impact on the Lyme disease reservoir host Peromyscus leucopus. Vector Borne Zoonotic Dis 11:117–24.

40. Stafford KC, Massung RF, Magnarelli LA, Ijdo JW, Anderson JF. 1999. Infection with agents of human granulocytic ehrlichiosis, lyme disease, and babesiosis in wild white-footed mice (Peromyscus leucopus) in Connecticut. J Clin Microbiol 37:2887–92.

41. Massung RF, Priestley RA, Levin ML. 2004. Transmission route efficacy and kinetics of Anaplasma phagocytophilum infection in white-footed mouse, Peromyscus leucopus. Vector Borne Zoonotic Dis 4:310–8.

42. Anderson JF, Johnson RC, Magnarelli LA, Hyde FW. 1985. Identification of endemic foci of Lyme disease: isolation of Borrelia burgdorferi from feral rodents and ticks (Dermacentor variabilis). J Clin Microbiol 22:36–8.

43. Schwan TG, Kime KK, Schrumpf ME, Coe JE, Simpson WJ. 1989. Antibody response in white-footed mice (Peromyscus leucopus) experimentally infected with the Lyme disease spirochete (Borrelia burgdorferi). Infect Immun 57:3445–51.

44. Brown RN, Lane RS. 1992. Lyme disease in California: a novel enzootic transmission cycle of Borrelia burgdorferi. Science 256:1439–42.

45. Lane RS, Peavey CA, Padgett KA, Hendson M. 1999. Life history of Ixodes (Ixodes) jellisoni (Acari: Ixodidae) and its vector competence for Borrelia burgdorferi sensu lato. J Med Entomol 36:329–40.

46. Barbour AG, Bunikis J, Travinsky B, Hoen AG, Diuk-Wasser MA, Fish D, Tsao JI. 2009. Niche partitioning of Borrelia burgdorferi and Borrelia miyamotoi in the same tick vector and mammalian reservoir species. Am J Trop Med Hyg 81:1120–31.

47. Leonhard S, Jensen K, Salkeld DJ, Lane RS. 2010. Distribution of the Lyme disease spirochete Borrelia burgdorferi in naturally and experimentally infected western gray squirrels (Sciurus griseus). Vector Borne Zoonotic Dis 10:441–6.

48. Dolan MC, Hojgaard A, Hoxmeier JC, Replogle AJ, Respicio-Kingry LB, Sexton C, Williams MA, Pritt BS, Schriefer ME, Eisen L. 2016. Vector competence of the blacklegged tick, Ixodes scapularis, for the recently recognized Lyme borreliosis spirochete Candidatus Borrelia mayonii. Ticks Tick Borne Dis. 110

49. Levin ML, Fish D. 2001. Interference between the agents of Lyme disease and human granulocytic ehrlichiosis in a natural reservoir host. Vector Borne Zoonotic Dis 1:139–48.

50. Levin ML, Ross DE. 2004. Acquisition of different isolates of Anaplasma phagocytophilum by Ixodes scapularis from a model animal. Vector Borne Zoonotic Dis 4:53–9.

51. Randolph SE, Green RM, Peacey MF, Rogers DJ. 2000. Seasonal synchrony: the key to tick-borne encephalitis foci identified by satellite data. Parasitology 121 ( Pt 1:15–23.

52. Ogden NH, Bigras-Poulin M, O’callaghan CJ, Barker IK, Kurtenbach K, Lindsay LR, Charron DF. 2007. Vector seasonality, host infection dynamics and fitness of pathogens transmitted by the tick Ixodes scapularis. Parasitology 134:209–27.

53. Randolph SE, Gern L, Nuttall PA. 1996. Co-feeding ticks: Epidemiological significance for tick-borne pathogen transmission. Parasitol Today 12:472– 9.

54. Gatewood AG, Liebman KA, Vourc’h G, Bunikis J, Hamer SA, Cortinas R, Melton F, Cislo P, Kitron U, Tsao J, Barbour AG, Fish D, Diuk-Wasser MA. 2009. Climate and tick seasonality are predictors of Borrelia burgdorferi genotype distribution. Appl Environ Microbiol 75:2476–83.

55. Wilson ML, Spielman A. 1985. Seasonal activity of immature Ixodes dammini (Acari: Ixodidae). J Med Entomol 22:408–14.

56. Fish D. 1993. Population ecology of Ixodes dammini. In: Ginsberg, H.S. (Ed.), Ecology and Environmental Management of Lyme Disease. Rutgers University Press, New Brunswick, NJ.

57. Daniels TJ, Falco RC, Curran KL, Fish D. 1996. Timing of Ixodes scapularis (Acari: Ixodidae) Oviposition and arval Activity in Southern New York. J Med Entomol 33:140–147.

58. Ostfeld RS, Miller MC, Hazler KR. 1996. Causes and Consequences of Tick (Ixodes scapularis) Burdens on White-Footed Mice (Peromyscus leucopus). J Mammal 77:266–273.