Damasceno Nataliadebrito M.Pdf

UNIVERSIDADE ESTADUAL DE CAMPINAS

INSTITUTO DE BIOLOGIA

NATÁLIA DE BRITO DAMASCENO

MAPEAMENTO DA COLONIZAÇÃO DE PLANTAS DE SOJA E MILHO POR UMA COMUNIDADE MICROBIANA SINTÉTICA ORIUNDA DO MICROBIOMA DA CANA- DE-AÇÚCAR

MAPPING THE COLONIZATION OF A SYNTHETIC MICROBIAL COMMUNITY INOCULUM FROM SUGARCANE MICROBIOME IN SOYBEAN AND MAIZE PLANTS

CAMPINAS

2018 NATÁLIA DE BRITO DAMASCENO

MAPEAMENTO DA COLONIZAÇÃO DE PLANTAS DE SOJA E MILHO POR UMA COMUNIDADE MICROBIANA SINTÉTICA ORIUNDA DO MICROBIOMA DA CANA- DE-AÇÚCAR

MAPPING THE COLONIZATION OF A SYNTHETIC MICROBIAL COMMUNITY INOCULUM FROM SUGARCANE MICROBIOME IN SOYBEAN AND MAIZE PLANTS

Dissertação apresentada ao Instituto de Biologia da Universidade Estadual de Campinas como parte dos requisitos exigidos para a obtenção do título de Mestra em Genética e Biologia Molecular na área de Genética Animal e Evolução.

Dissertation presented to the Institute of Biology of the University of Campinas in partial fulfillment of the requirements for the degree of Master in Genetics and Molecular Biology, in the area of Animal Genetics and Evolution.

ESTE ARQUIVO DIGITAL CORRESPONDE À VERSÃO FINAL DA DISSERTAÇÃO DEFENDIDA PELA ALUNA NATÁLIA DE BRITO DAMASCENO, E ORIENTADA PELO PROF. DR. PAULO ARRUDA.

Orientador: PAULO ARRUDA

CAMPINAS

2018 Agência (s) de fomento e nº (s) de processo (s): FAPESP, 2016/23425-5; CAPES

Ficha catalográfica Universidade Estadual de Campinas Biblioteca do Instituto de Biologia Mara Janaina de Oliveira - CRB 8/6972

Damasceno, Natália de Brito, 1990- D18m DamMapeamento da colonização de plantas de soja e milho por uma comunidade microbiana sintética oriunda do microbioma da cana-de-açúcar / Natália de Brito Damasceno. – Campinas, SP: [s.n.], 2018.

DamOrientador: Paulo Arruda. DamCoorientador: Rafael Soares Correa de Souza. DamDissertação (mestrado) – Universidade Estadual de Campinas, Instituto de Biologia.

Dam1. Microbiota. 2. Comunidades microbianas. I. Arruda, Paulo, 1952-. II. de Souza, Rafael Soares Correa, 1988-. III. Universidade Estadual de Campinas. Instituto de Biologia. IV. Título.

Informações para Biblioteca Digital

Título em outro idioma: Mapping the colonization of a synthetic microbial community inoculum from sugarcane microbiome in soybean and maize plants Palavras-chave em inglês: Microbiota Microbial communities Área de concentração: Genética Animal e Evolução Titulação: Mestra em Genética e Biologia Molecular Banca examinadora: Paulo Arruda [Orientador] Juliana Velasco de Castro Oliveira Fernando Dini Andreote Lara Durães Sette Sara Adrián Lopez de Andrade Data de defesa: 13-09-2018 Programa de Pós-Graduação: Genética e Biologia Molecular

Campinas, 13 de setembro de 2018

COMISSÃO EXAMINADORA

Prof. Dr. Paulo Arruda

Profa. Dra. Juliana Velasco de Castro Oliveira

Prof. Dr. Fernando Dini Andreote

Os membros da Comissão Examinadora acima assinaram a Ata de Defesa, que se encontra no processo de vida acadêmica do aluno.

AGRADECIMENTOS

À Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP - Processo nº 2016/23425-5), ao Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) e à Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) pelo apoio financeiro e institucional.

RESUMO

Este projeto de mestrado foi desenvolvido no âmbito do projeto “The Sugarcane Microbiome (Saccharome): A Key Element in Sustainability of an Energy Crop”, que resultou no mapeamento detalhado da diversidade e abundância relativa de comunidades microbianas presentes na cana-de-açúcar ao longo de seu desenvolvimento. Em um segundo momento, foi construída e anotada uma coleção de microrganismos representativa do microbioma core da cana. A identificação das bactérias da coleção permitiu seu cruzamento com as informações geradas pelo mapeamento do microbioma da cana em termos de diversidade e abundância, possibilitando a elaboração de um inóculo sintético composto por 17 isolados que representam os grupos bacterianos mais abundantes na cana. Resultados preliminares em milho mostraram que o inóculo sintético é capaz de estimular o crescimento das plantas. Através do sequenciamento do gene do rRNA 16S, foi possível mapear o perfil de colonização dessas bactérias nos compartimentos endofítico e exofítico de amostras de raiz, caule e folhas de plantas de milho inoculadas com a comunidade sintética. Dentre as 27 bactérias presentes no inóculo, 10 colonizaram os tecidos da planta com alta eficiência, alterando a microbiota natural do milho e tornando-se predominantes principalmente na raiz e no caule. Neste trabalho, avaliamos o impacto da mesma comunidade sintética, validada em milho, em soja a fim de verificar a trans especificidade do inóculo sintético em uma planta filogeneticamente distante da cana e do milho. Devido a comunidade sintética ser composta por isolados microbianos que podem conter mais que um microrganismo armazenado junto, nós buscamos desvendar os grupos de bactérias em soja e de fungos em soja e milho que potencialmente estão envolvidos na colonização eficiente das plantas. Os resultados de inoculação em soja mostraram que o mesmo inóculo sintético utilizado em milho é capaz de estimular o crescimento de plantas de soja. As plantas de soja inoculadas com a comunidade sintética apresentaram um aumento significativo da biomassa e da área da raiz e foliar de até 1,6 vezes quando comparadas às plantas não inoculadas. Através do sequenciamento do gene do rRNA 16S foram acessados os grupos de bactérias pertencentes ao inóculo sintético nos órgãos de raiz, caule e folha de plantas inoculadas e não inoculadas. Membros do inóculo sintético não foram capazes de colonizar os tecidos da soja de maneira eficiente, contudo, promoveram alterações na microbiota natural dessas plantas. As famílias Comamonadaceae, Caulobacteraceae, Rhizobiaceae, Sphingobacteriaceae, Burkholderiaceae e Xanthomonadaceae representam os grupos mais abundantes identificados em plantas de soja inoculadas e não inoculadas. Esses resultados sugerem que a comunidade sintética, isolada da cana-de-açúcar, apresenta uma plasticidade em colonizar e promover o crescimento de plantas filogeneticamente muito distantes, como essas culturas representantes das mono e dicotiledôneas. Ainda não sabemos quais mecanismos podem estar diretamente relacionados a esses efeitos, mas acreditamos que essas funções podem ter sido selecionadas durante a co-evolução da interação microbiota/planta e estarem relacionadas à maior disponibilidade de nutrientes, naturalmente produzidos pelas plantas, através de genes que foram selecionados/enriquecidos nessas bactérias específicas.

ABSTRACT

This master's project was developed under the project "The Sugarcane Microbiome (Saccharome): A Key Element in Sustainability of an Energy Crop”, which resulted in a detailed description of the diversity and relative abundance of microbial communities found in association with sugarcane along plant development. At a second moment, we constructed and annotated a collection of microorganisms representative of sugarcane core microbiome. The identification of bacterial groups present in the collection allowed cross-referencing this information with data from sugarcane microbiome description concerning abundance and diversity. As a result, it was possible to elaborate a synthetic community composed of 17 isolates, which represents the most abundant bacterial groups found in sugarcane. Preliminary results in maize showed that the synthetic inoculum efficiently promotes plant growth. By sequencing rRNA 16S gene, it was possible to map the colonization pattern of these bacterial groups in endophytic and exophytic compartments of root, stem and leaves of inoculated maize plants. Among 27 bacteria present in the inoculum, 10 groups were highly efficient in colonizing plant tissues, resulting in alterations in the natural maize microbiota composition and becoming predominant mainly in the root and stem. In this work, we evaluated the impact of the same synthetic community, previously validated in maize, in soybean plants in order to verify the trans specificity of the synthetic inoculum in a plant species phylogenetically distant from sugarcane and maize. As the synthetic community is composed of microbial isolates that possibly contains more than one microorganism stored together, we seek to uncover bacterial groups in association with soybean and fungal groups in association with both models that are potentially involved in colonizing plant tissues. Soybean inoculated plants showed a significant increase in their biomass and roots and leaf areas of up to 1.6 fold when compared to uninoculated plants. By sequencing rRNA 16S gene, we accessed bacterial groups from the synthetic inoculum in the roots, stem and leaves of inoculated and uninoculated soybean plants. Members of the synthetic community did not colonize plant tissues very efficiently, however, the presence of the inoculum promoted alterations in the natural microbiota found in association with this plant. Comamonadaceae, Caulobacteraceae, Rhizobiaceae, Sphingobacteriaceae, Burkholderiaceae and Xanthomonadaceae families are the most representative groups identified in association with inoculated and uninoculated soybean plants. Together, these results suggest that the synthetic community, initially isolated from sugarcane, has a plasticity in colonizing plant tissues and promote plant growth of phylogenetically distant plant species like maize and soybean, two representatives of mono and dicotyledonous. The mechanisms directly involved in these effects are still unknown, but we believe that these functions can have been select during the co-evolution of microbiota/plant interactions and can be relate to the higher availability of nutrients naturally produced by plants, by genes that were selected/enriched in these specific bacteria.

LISTA DE FIGURAS

Figura 1 – Plataforma de inoculação em milho ...... 28

Figura 2 – Esquema representativo do pipeline de inoculação estabelecido para avaliação do efeito da comunidade sintética em plantas de milho e soja ...... 30

Figura 3 – Plataforma de inoculação em soja ...... 31

Figura 4 – Medições da altura da parte aérea e comprimento da raiz para fenotipagem de plantas de milho e soja ...... 32

Figura 5 – Amostragem representativa das comunidades microbianas dos tecidos de raiz, caule e folha de plantas de soja ...... 34

Figura 6 – Uma comunidade microbiana sintética oriunda do microbioma da cana-de-açúcar induz o crescimento de plantas de soja em diferentes condições nutricionais ...... 43

Figura 9 – Heatmap da abundância relativa das OTUs identificas nos órgãos de plantas de soja inoculadas e não inoculadas com a comunidade sintética mantidas com solução nutritiva MS 1X ...... 58

LISTA DE TABELAS

Tabela 1 – Classificação taxonômica das OTUs originadas da coleção de microrganismos representantes dos grupos mais abundantes do microbioma core da cana de açúcar que compõe a comunidade microbiana sintética ...... 26

Tabela 2 – Sequências adaptadoras e primers 16S e ITS completos utilizados para amplificação das regiões V4, do gene 16S, e ITS2, do gene ITS, na etapa de PCR1 de preparação das bibliotecas de sequenciamento ...... 36

Tabela 3 – Sequências adaptadoras, primers e barcodes originais do kit Illumina Index Kit utilizados na etapa de PCR2 de preparação das bibliotecas de sequenciamento...... 37

Tabela 4 – Número de reads paired-end bruto, unmerged, de baixa qualidade, cloroplastos, mitocôndrias e primers não reconhecidos (Primers) por amostra para o conjunto de dados de 16S de soja ...... 47

Tabela 5 – Classificação taxonômica e valores de confiança das OTUs pertencentes a comunidade sintética. As OTUs foram identificadas através do algoritmo SINTAX no software USEARCH utilizando o banco de dados SILVA. Conf., confiança ...... 49

Tabela 6 – Classificação taxonômica e abundância relativa média de 20 famílias encontradas nos órgãos de raiz, caule e folha de plantas inoculadas e não inoculadas com a comunidade sintética mantidas em condição MS 1X ...... 51

Tabela 7 – Classificação taxonômica e abundância relativa média de 20 famílias encontradas nos órgãos de raiz, caule e folha de plantas inoculadas e não inoculadas com a comunidade sintética mantidas em condição MS 1/2X ...... 53

Tabela 8 – Classificação taxonômica e abundância relativa média de 20 famílias encontradas nos órgãos de raiz, caule e folha de plantas inoculadas e não inoculadas com a comunidade sintética mantidas em condição MS 1/4X ...... 55

Tabela 9 - Número de reads paired-end bruto, unmerged, de baixa qualidade e primers não reconhecidos (Primers) por amostra para o conjunto de dados de ITS de soja ...... 59

Tabela 10 - Número de reads paired-end bruto, unmerged, de baixa qualidade e primers não reconhecidos (Primers) por amostra para o conjunto de dados de ITS de milho ...... 60

SUMÁRIO

Agradecimentos ...... 5 Resumo ...... 6 Abstract ...... 8 Lista de Figuras ...... 10 Lista de Tabelas ...... 11 1. Introdução ...... 14 1.1 Microrganismos associados às plantas desempenham funções benéficas para o crescimento vegetal ...... 14 1.2 O microbioma da cana de açúcar ...... 17 1.3 Construção de uma coleção de microrganismos ...... 19 1.4 Efeito de bioinoculantes em culturas de importância econômica ...... 20 2. Objetivos ...... 24 3. Materiais e métodos ...... 25

3.1 Inóculo sintético ...... 25

3.2 Inoculação em milho ...... 27

3.3 Inoculação em soja ...... 28

3.4 Coleta e fenotipagem de plantas de milho e soja ...... 31

3.5 Fenotipagem de soja por análise de imagem ...... 32

3.6 Mapeamento da colonização em plantas de milho e soja ...... 33

3.7 Bibliotecas de sequenciamento ...... 34

3.7.1 Extração e quantificação de DNA ...... 34

3.7.2 Primers ...... 34

3.7.3 Etapas de PCR e purificação das bibliotecas de sequenciamento ...... 39

3.7.4 Quantificação das bibliotecas e pool de sequenciamento ...... 39

3.8 Bioinformática ...... 40

3.8.1 Processamento dos reads ...... 40

3.8.2 Clusterização em OTUs ...... 40

3.8.3 Classificação taxonômica das OTUs ...... 41 3.8.4 Construção da Tabela de OTUs e cálculo da abundância relativa dos grupos microbianos ...... 41

4. Resultados ...... 42

4.1 Efeito da comunidade microbiana sintética no crescimento de plantas de soja ...... 42

4.2 Padrão de colonização da comunidade microbiana sintética ...... 45

5. Discussão ...... 62

5.1 A comunidade microbiana sintética induz uma melhora no crescimento de plantas de milho e soja ...... 62

5.2 O padrão de colonização da comunidade sintética ocorre de maneira distinta em plantas de milho e soja ...... 64

6. Conclusões ...... 67 7. Referências ...... 68 8. Apêndices ...... 75 9. Anexos ...... 98 9.1 Publicação ...... 98 9.2 Declaração de bioética e biossegurança ...... 116 9.3 Declaração referente a direitos autorais ...... 117

1. INTRODUÇÃO

1.1 Microrganismos associados às plantas desempenham funções benéficas para o crescimento vegetal

As plantas hospedam uma enorme diversidade de microrganismos, que compõe a sua microbiota (Lindow et al., 2003; Delmotte et al., 2009; Bulgarelli et al., 2012; Knief et al., 2012; Lundberg et al., 2012). A maior parte desses microrganismos não causam danos ao hospedeiro, possivelmente devido ao estabelecimento de relações simbióticas benéficas que vão desde o comensalismo até o mutualismo (Bulgarelli et al., 2013). Através dessas interações, a microbiota é capaz de desempenhar funções essenciais para o desenvolvimento vegetal de forma direta ou indireta. Consequentemente, as plantas hospedeiras dispõe de vantagens como o acesso facilitado a nutrientes presentes no solo (Bais et al., 2006), proteção contra fito patógenos (Innerebner et al., 2011), produção de fitormônios (Glick et al., 1995), resistência ao calor (Castiglioni et al., 2008) e a salinidade (Zhang et al., 2007), entre outras. Em contrapartida, as plantas mantem sua microbiota disponibilizando uma variedade de compostos fotossintéticos na rizosfera (Dakora e Phillips, 2002) como fontes de energia ricas em carbono e nitrogênio, estabelecendo um nicho favorável e equilibrado para o estabelecimento de uma relação mutualmente benéfica (Bais et al., 2006). Esse processo é descrito como rizo-deposição, e acredita-se que seja um dos principais mecanismos envolvidos na aquisição e manutenção da microbiota associada à planta (Jones et al., 2009), pois os microrganismos utilizam-se dos compostos de origem vegetal para se desenvolver e desempenhar funções benéficas para o seu hospedeiro.

A microbiota associa-se intimamente as plantas tanto na região endofítica (interna) como exofítica (externa) dos órgãos. Além disso, as bactérias normalmente presentes no solo são capazes de se multiplicar e colonizar a região endofítica da raiz e modular o crescimento e desenvolvimento das plantas (Hardoim et al., 2008), resultando em impactos positivos na produtividade de culturas comerciais (Mei e Flinn, 2010) ou em casos de fitorremediação (Weyens et al., 2009). Acredita-se que as funções associadas a microbiota das plantas possam ampliar a capacidade das plantas em se adaptar a diferentes ambientes (Bulgarelli et al., 2013).

Tradicionalmente, estudos envolvendo microrganismos associados as plantas utilizam metodologias da microbiologia clássica baseadas no isolamento e cultivo de culturas puras em meios seletivos. No entanto, essa forma de isolar microrganismos pode privilegiar a amostragem de alguns grupos específicos de bactérias e fungos em detrimento de outros ou de funções microbianas intrínsecas a esses grupos (Bhattacharjee et al., 2008). A rápida evolução

das tecnologias de sequenciamento de DNA e de ferramentas de bioinformática permitiu gerar uma enorme quantidade de dados descrevendo comunidades microbianas complexas associadas a um número crescente de espécies vegetais sem a necessidade de isolamento dos microrganismos. Essas tecnologias, denominadas independentes de cultivo, permitiram pela primeira vez mapear a estrutura de comunidades microbianas de forma direta através do sequenciamento de amostras de DNA preparadas do ambiente ou de tecidos, utilizando marcadores moleculares ou metagenomas (Amann et al., 1995; Bulgarelli et al., 2012). Através do sequenciamento do gene ribossomal 16S, por exemplo, foram identificadas as comunidades bacterianas da raiz de Arabidopsis thaliana crescidas em solos naturais em condições controladas (Lundberg et al., 2012). Em trigo, Bulgarelli e colaboradores (2015) combinaram dados do perfil do gene do rRNA 16S e de análises de metagenoma para investigar a diversidade estrutural e funcional da microbiota associada a variedades selvagens e domesticadas. Outras espécies de plantas, incluindo o arroz (Knief et al., 2012), Populus (Gottel et al., 2011), entre outras (Whipps et al., 2008; Bulgarelli et al., 2015), tiveram suas microbiotas descritas através dos métodos independentes de cultivo. Esses estudos recentes têm revelado uma grande diversidade de comunidades de microrganismos em associação com os órgãos vegetais muito mais complexas do que se conhecia até então e que ainda não haviam sido exploradas com relação ao seu papel biológico na associação planta/microrganismo (Compant et al., 2010; Lundberg et al., 2012; Rinke et al., 2013; Lebeis et al., 2015). Esses avanços tiveram um impacto positivo no desenvolvimento de tecnologias no âmbito do estudo da interação microrganismos/planta e trouxeram uma nova visão sobre microbiomas e seu potencial para a agricultura e indústria de biotecnologia em geral (Compant et al., 2010; Berg et al., 2013; Coleman-Derr et al., 2014).

Nas últimas décadas, bactérias promotoras do crescimento vegetal foram extensivamente estudadas para se entender a biologia da interação com as plantas, entretanto, ainda pouco se sabe sobre os reais mecanismos envolvidos nas associações microbiota/hospedeiro (Berendsen et al., 2012; Bulgarelli et al., 2013). Desta forma, se faz necessário o estabelecimento de sistemas simples que permitam avaliar os processos relacionados à dinâmica dessas interações em diferentes modelos. Neste contexto, o uso de comunidades microbianas em ensaios de inoculação em sistemas bem definidos tem surgido como uma importante estratégia (Niu et al., 2017).

Diversos estudos sobre a dinâmica do estabelecimento de microbiomas foram desenvolvidos utilizando-se principalmente a planta modelo Arabidopsis thaliana e suas

comunidades microbianas associadas. Em geral, essas comunidades são muito diversas, dificultando, em princípio, identificar grupos específicos que apresentem efeitos benéficos para o desenvolvimento vegetal. As chamadas comunidades sintéticas, compostas de bactérias selecionadas de microbiomas, passaram a ser estudadas em diferentes contextos, o que permitiu a identificação de grupos de bactérias para compor inóculos sintéticos e estudar seus efeitos no crescimento vegetal. Através do uso de uma comunidade microbiana simplificada, foi possível caracterizar a influência de genes da planta que poderiam estar envolvidos na estrutura da microbiota da filosfera de A. thaliana (Bodenhausen et al., 2014). Outro trabalho utilizando plantas de A. thaliana mutantes para o sistema imune, inoculadas com uma comunidade sintética composta por 38 bactérias, mostrou que genes da planta ligados ao sistema imune modulam a colonização da rizosfera por diferentes grupos bacterianos (Lebeis et al., 2015). Contudo, apesar de estudos utilizando plantas modelo revelarem aspectos importantes acerca dos mecanismos envolvidos na associação microbiota/planta, ainda existem diversos fatores desconhecidos modulando essas interações. Desvendar os fatores envolvidos nessas associações, assim como associar a genética das plantas e dos microrganismos envolvidos no processo de colonização em culturas de importância econômica, é um passo crucial para a aplicação da tecnologia baseada em microbiomas de plantas na agricultura (Peiffer et al., 2013).

O milho é uma das culturas economicamente mais importantes no mundo, apresentando uma grande diversidade genética e fenotípica que, para o desenvolvimento de híbridos comerciais, precisam ser selecionadas nas mais variadas regiões de cultivo (Gore et al., 2009). O milho pode ser muito influenciado por alterações ambientais (Buckler et al., 2009) ou mesmo microclimas, e por seu amplo cultivo como monocultura, acredita-se ser um importante fator responsável por moldar ambientes agrícolas coabitados por diferentes espécies (Peiffer et al., 2013). Alguns trabalhos têm mostrado que a composição da microbiota associada à rizosfera do milho é altamente influenciada pelo genótipo das plantas (Bouffaud et al., 2012) e comunidades de bactérias encontradas na rizosfera foram consideravelmente diferentes de outras regiões do solo em termos de riqueza, diversidade e abundância relativa dos diferentes grupos (Gomes et al., 2001; Haichar et al., 2008; Peiffer et al., 2013).

No âmbito dos recentes esforços para o desenvolvimento de uma agricultura mais sustentável, o estudo do microbioma das plantas pode permitir o acesso a ferramentas importantes originadas de recursos biológicos, como a aplicação de inóculos microbianos para o biocontrole de pragas e estresses e como potenciais agentes promotores do crescimento vegetal.

1.2 O microbioma da cana de açúcar

Apesar da cana-de-açúcar ter sido ampla e tradicionalmente cultivada principalmente para a produção de açúcar, essa cultura tem se destacado nas últimas décadas como uma das culturas mais relevantes na área da biotecnologia para produção de bioetanol (Arruda, P., 2012). Devido à grande importância e potencial econômico associados à essa cultura, desvendar os fatores envolvidos na aquisição de nutrientes nessas plantas é um passo importante para melhorar a produtividade desse cultivar. Neste contexto, a cana tem sido objeto de estudo quanto à sua associação com microrganismos benéficos para o desenvolvimento vegetal por um longo período. Um fato importante sobre o cultivo dessas plantas é que, aparentemente, a cana não necessita de extensiva adubação nitrogenada como outras culturas (Urquiaga et al., 1992; Boddey et al., 1995). Essa observação direcionou os estudos em cana à procura por grupos de bactérias fixadoras de nitrogênio como potenciais contribuidoras para disponibilidade deste elemento através da fixação biológica de nitrogênio.

Microrganismos associados à cana-de-açúcar vem sendo investigados há décadas em relação a seus efeitos benéficos na aquisição de nutrientes, no crescimento vegetal e, principalmente, na fixação biológica de nitrogênio (Döbereiner, 1961; Cavalcante e Döbereiner, 1988; Olivares et al., 1996; Baldani et al., 1997). Em geral, esses estudos utilizaram q dos de grupos de bactérias em meios de cultura seletivos (Döbereiner, 1961; Baldani et al., 1997). Essa estratégia possibilitou o acesso a bactérias fixadoras de nitrogênio que, além dessa característica, podem apresentar outras funções que de alguma forma beneficiam o crescimento das plantas. A contribuição de microrganismos fixadores de nitrogênio em cana foi amplamente estudada em alguns grupos de bactérias, incluindo Azospirillum, Herbaspirillum, Burkholderia, Azotobacter, Bacillus, Enterobacter e Gluconacetobacter (Döbereiner, 1961; Cavalcante e Döbereiner, 1988; Olivares et al., 1996; Baldani et al., 2002). Entretanto, apesar de existirem evidências da contribuição dessas bactérias para o crescimento da cana (Döbereiner et al., 1972; Urquiaga et al., 1992), nenhum estudo foi capaz de mensurar a real contribuição desses microrganismos ao longo do desenvolvimento vegetal. Devido maior a atenção da comunidade científica da área ter sido voltada à fixação biológica de nitrogênio, esses trabalhos limitaram os estudos e o acesso a outros grupos bacterianos componentes do microbioma da cana. Com isso, até recentemente, aspectos fundamentais da associação entre a cana-de-açúcar e microrganismos, tais como a real diversidade das comunidades microbianas associadas a diferentes órgãos, a origem e fatores que influenciam no estabelecimento e distribuição dessas

comunidades e a abundância relativa dos grupos microbianos nos tecidos da planta ainda eram amplamente desconhecidos.

Neste contexto, nosso grupo de pesquisa desenvolveu o projeto Saccharome, cujo objetivo foi investigar em detalhe as comunidades de bactérias e fungos associadas aos diferentes órgãos da cana-de-açúcar. Para isso, foi investigada a comunidade microbiana nos órgãos de brotos jovens, raiz, colmo e folha de indivíduos em diferentes estágios de desenvolvimento de uma variedade comercial de cana mantida em casa de vegetação. Foram acessados tanto os microrganismos oriundos do compartimento interno (endofíticos) quanto externo (exofítico) à planta através do sequenciamento dos genes do RNA ribossomal 16S, para bactérias, e a região ITS2 (Internal Transcribed Spacer), para fungos, de DNA microbiano isolado diretamente dos tecidos vegetais, da rizosfera e do solo. Ao todo, foram identificadas 23,811 “Operational Taxonomic Units” (OTUs) representativas de bactérias e 11,727 OTUs representativas de fungos que constituem, no seu conjunto, o microbioma da cana (de Souza et al., 2016). Uma OTU representa um conjunto de sequências que apresentam determinada similaridade entre si, caracterizando um grupo operacional representativo de um microrganismo. Como esperado, mais de ~90% dos grupos bacterianos e ~70% dos grupos de fungos que habitam os diferentes órgãos da planta tem sua origem do solo (de Souza et al., 2016), que parece atuar como a principal fonte de diversidade microbiana para a planta (Gans et al., 2005; Tringe et al., 2005). Esses resultados mostraram que os grupos de microrganismos presentes no solo colonizam os tecidos da planta e aumentam sua abundância relativa de acordo com o tecido ou compartimento que se encontram, apresentando padrões de distribuição distintos entre os grupos e principalmente entre bactérias e fungos. Enquanto o compartimento (endofítico ou exofítico) é o principal determinante para o estabelecimento das comunidades bacterianas, o tecido vegetal parece ter maior influência para colonização por fungos (de Souza et al., 2016). Esse fenômeno pode estar ocorrendo muito provavelmente devido a funções que beneficiam mutuamente a planta e os microrganismos e a mecanismos de comunicação específicos que direcionem o estabelecimento dessas comunidades.

A despeito da enorme diversidade de bactérias e fungos encontrados colonizando os diferentes órgãos da cana, há uma fração de microrganismos extremamente abundante cuja composição não se altera significativamente ao longo do desenvolvimento da planta (de Souza et al., 2016). Esse grupo foi denominado “microbioma core” e, apesar de compreender menos de ~20% do total da riqueza microbiana encontrada na cana, soma por mais de ~90% da abundância relativa total de microrganismos identificados nessas plantas. Acreditamos que a

predominância e prevalência do microbioma core pode estar intimamente relacionado com os benefícios desses grupos em promover o crescimento vegetal. Entretanto, devido à maioria dos estudos relacionados à associação de microrganismos com a cana terem mantido seus esforços em alguns poucos grupos de bactérias, dentre os 170 gêneros identificados pertencentes ao microbioma core da cana, apenas 41 gêneros de bactérias apresentam algum representante já descrito como um Microrganismo Promotor do Crescimento Vegetal (PGPM – Plant Growth Promoting Microorganisms). Dentre estes, apenas 23 possuem pelo menos um representante já isolado de cana-de-açúcar (de Souza et al., 2016). Nesse sentido, muitos grupos de microrganismos, alguns extremamente abundantes e enriquecidos na cana, foram pouco estudados em associação com plantas. Desta forma, os resultados obtidos a partir da descrição do microbioma da cana-de-açúcar indicam que podem existir diversos processos biológicos novos e complexos envolvidos na interação planta/comunidades microbianas que ainda não foram explorados.

Tradicionalmente, microrganismos são selecionados e utilizados em ensaios baseados, principalmente, na sua identificação taxonômica e na seleção em busca por funções relacionadas a sua capacidade em promover o crescimento vegetal. Entretanto, não existem evidências de que a presença de uma função promotora do crescimento vegetal em determinado grupo esteja diretamente relacionada com a sua representatividade ou função em um órgão vegetal. Para estudarmos o papel funcional da interação desses microrganismos com a planta, bem como os mecanismos moleculares envolvidos nessa associação, é necessário estabelecer uma coleção de microrganismos que seja representativa de uma espécie vegetal e eficaz para armazenagem e identificação dos isolados de forma confiável e simples. Existe, ainda, uma grande lacuna nesse aspecto e se faz necessário o desenvolvimento de novas ferramentas, amplas e acessíveis, para isolar, identificar e explorar o potencial das comunidades microbianas associadas às plantas (Bulgarelli et al., 2013).

1.3 Construção de uma coleção de microrganismos

O estudo do microbioma associado à cana-de-açúcar revelou a existência de uma grande diversidade de grupos de bactérias e fungos ainda muito pouco explorados de acordo com a literatura (de Souza et al., 2016). Para o estudo da interação funcional desses microrganismos com a planta, é necessário estabelecer um método de cultivo eficaz para obtenção e manipulação desses grupos. Nesse sentido, em trabalhos anteriores realizados pelo nosso grupo de pesquisa, foi desenvolvida uma nova metodologia para construção de coleções

de microrganismos baseada na obtenção de comunidades microbianas oriundas de colônias representadas por um único ou diversos microrganismos e uma metodologia baseada no uso de sequenciamento genético para identificação dos microrganismos armazenados (Armanhi et al., 2016). Esse conceito, denominado de Community-based Culture Collection (CBC), se baseia em permitir a existência de comunidades microbianas naturais a serem armazenadas e preservadas em termos de relações e funções intraespecíficas (Armanhi et al., 2016).

Utilizando essa abordagem, nosso grupo de pesquisa construiu uma coleção de microrganismos representativa do microbioma da cana-de-açúcar contendo cerca de 5.000 comunidades armazenadas (Armanhi et al., 2018). A identificação dos isolados da CBC permitiu o cruzamento de dados de uma coleção de microrganismos com dados de metagenomas do microbioma de uma mesma planta. O cruzamento de dados da anotação da coleção o microbioma da cana permitiu a seleção de grupos de microrganismos de interesse baseados na abundância relativa desses isolados nos diferentes órgãos vegetais, independente da classificação taxonômica desses grupos. Esta abordagem foi desenvolvida e utilizada no desenho de uma comunidade sintética, composta pelos grupos mais abundantes do microbioma core da cana-de-açúcar, para estudos sobre seus efeitos em associação com plantas (Armanhi et al., 2018). Juntos, os isolados pertencentes à comunidade sintética representam respectivamente, 4,9% e 6,8% da abundância relativa total de microrganismos pertencentes ao microbioma core dos compartimentos endofítico e exofítico da raiz e 17,5-20% do compartimento endofítico de colmo (Armanhi et al., 2018) sendo que, em sua maioria, esses grupos nunca foram descritos ou estudados anteriormente em associação com culturas de importância econômica.

1.4 Efeito de bioinoculantes em culturas de importância econômica

Estudos recentes têm utilizado o conceito de comunidade microbiana sintética e sua aplicação como inoculantes para avaliar os efeitos benéficos promovidos no crescimento vegetal e o potencial de colonização das plantas por diferentes grupos de microrganismos (Bhattacharjee et al., 2008; Lebeis et al., 2015; Niu et al., 2017). O uso de comunidades microbianas, e não microrganismos isolados, tem a vantagem de carregar nessas associações múltiplas funções individuais, redundantes ou não, que podem ser determinantes para a interação com as plantas. Neste contexto, alguns estudos têm mostrado as contribuições benéficas de comunidades microbianas através de ensaios de inoculação em condições estéreis (Bai et al., 2015; Timm et al., 2016; Castrillo et al., 2017; Armanhi et al., 2018). Por exemplo,

Govindarajan e colaboradores (2008) observaram que a inoculação conjunta de H. seropedicae, A. lipoferum, G. diazotrophicus e B. Vietnamiensis induziu um aumento de 14,4% na produtividade de arroz, em contraste ao aumento médio de 6,2% promovido pela inoculação individual desses grupos. Com isso, inúmeros grupos de bactérias fixadoras de nitrogênio têm sido isolados, caracterizados e utilizados como inoculantes de diversas culturas de leguminosas e não-leguminosas. Entretanto, o uso de inóculos compostos por diferentes grupos microbianos ainda apresenta limitações quanto ao seu efeito benéfico e sua compatibilidade com diferentes espécies vegetais. A escolha e composição dessas comunidades parecem ser um fator importante no desempenho do inoculante em promover o crescimento vegetal (Bhattacharjee et al., 2008). A busca por inoculantes com amplo espectro de atuação pode impactar positivamente o desenvolvimento da agricultura, além de desvendar informações biológicas extremamente relevantes para a compreensão dos processos moleculares envolvidos na biologia da comunicação planta/microrganismo.

A existência de um microbioma core na cana-de-açúcar representado por comunidades com abundância relativa constante e elevada, padrões evidentes de especificidade tecidual e com prevalência ao longo do desenvolvimento da planta nos leva a hipotetizar, parcimoniosamente, que essas comunidades devem contribuir com funções altamente benéficas para o desenvolvimento vegetal. A fim de desvendar o potencial desses grupos em associar-se e promover o crescimento vegetal, foi estabelecida uma comunidade microbiana sintética representativa dos microrganismos mais abundantes da cana para ser testada em ensaios de inoculação. Para avaliar o efeito dessa comunidade em associação com plantas, nosso grupo de pesquisa utilizou plantas milho como modelo, uma monocotiledônea filogeneticamente próxima à cana e de grande importância econômica, para o estabelecimento uma plataforma experimental para ensaios de inoculação em plantas (Armanhi et al., 2018). Os resultados de inoculação em milho mostraram que o inóculo sintético promoveu um efeito impactante no crescimento de plantas inoculadas com a comunidade sintética, que tiveram seus pesos fresco e seco aumentados em até 3,4 vezes em relação as plantas não inoculadas (Armanhi et al., 2018). Além disso, as plantas inoculadas eram visualmente mais vistosas e robustas, apresentando folhas mais verdes e um sistema radicular mais bem desenvolvido, com um aumento no número de raízes laterais (Armanhi et al., 2018). Através do sequenciamento do gene ribossomal rRNA 16S, foram acessadas as comunidades bacterianas nos compartimentos endofítico e exofítico dos tecidos de raiz, caule e folha de plantas de milho inoculadas e não inoculadas. Esses dados mostraram que alguns dos membros pertencentes à comunidade sintética colonizaram

eficientemente alguns órgãos da planta, chamados colonizadores robustos, (Armanhi et al., 2018) com um padrão similar ao que foi observado em cana (de Souza et al., 2016). Apesar de algumas sequências do gene 16S de bactérias pertencentes a microbiota natural de plantas não inoculadas serem classificadas em um mesmo grupo de membros componentes da comunidade sintética, essas bactérias não foram tão eficientes em colonizar os tecidos da planta. Este resultado pode estar relacionado ao fato de membros da comunidade sintética apresentarem funções altamente benéficas para o crescimento de plantas que estão ausentes na microbiota natural do milho (Armanhi et al., 2018). Essas funções podem estar ligadas a alterações a nível genômico ou proteico e terem sido selecionadas durante a co-evolução microbiota/planta, permitindo que esses grupos se tornem predominantes ao longo do desenvolvimento vegetal. De uma maneira geral, o efeito da colonização de plantas de milho por uma comunidade microbiana sintética promoveu uma alteração significante na composição, distribuição e abundância relativa de grupos de bactérias naturalmente associados a essas plantas (Armanhi et al., 2018). Curiosamente, este efeito pôde ser observado mesmo em órgãos que não apresentaram colonizadores robustos, como as folhas e o compartimento endofítico do caule, sugerindo que membros do inóculo sintético podem influenciar no estabelecimento de comunidades microbianas não apenas pela competição local, mas também por fatores regulados pela expressão diferencial de genes específicos induzidos durante o processo de colonização da planta (Armanhi et al., 2018).

O fato de uma comunidade microbiana isolada originalmente de cana-de-açúcar quando inoculada em plantas de milho ter um impacto altamente benéfico no crescimento dessas plantas e promover um deslocamento da sua microbiota natural, levou-nos a questionar acerca da ubiquidade de microbiomas em associar-se com diferentes espécies vegetais. Além disso, dentre os 20 grupos pertencentes ao inóculo sintético, apenas 10 se destacaram como colonizadores eficientes em milho (Armanhi et al., 2018). Curiosamente, os outros 10 grupos, apesar de muito abundantes nos tecidos da cana, não colonizam as plantas de milho com tanto vigor. Essas diferenças podem estar ligadas a características únicas apresentadas por essas bactérias específicas que resultam na seleção diferencial entre as espécies vegetais, mostrando que ocorre uma dinâmica de enriquecimento de microrganismos no milho de uma maneira tecido-preferencial diferente da observada em cana. Até recentemente, não existiam trabalhos mostrando a dinâmica de associação e os efeitos no crescimento vegetal de uma comunidade microbiana, construída baseada na abundância de grupos de bactérias na planta independente da sua classificação taxonômica ou presença de funções PGP, com diferentes modelos vegetais.

Entender questões como se o padrão de colonização e a abundância de grupos microbianos foram tecido- ou espécie-específicas e se existem mecanismos conservados envolvidos na associação microbiota/planta podem ser a chave para a compreensão dos fatores envolvidos na real contribuição funcional de microbiomas para a biologia das plantas. Neste contexto, nós buscamos avaliar qual é o efeito dessa comunidade e desvendar o perfil de colonização dos grupos microbianos pertencentes ao inóculo sintético em uma cultura representante das dicotiledôneas. Para isso, foi escolhida a soja para ensaios de inoculação por ser filogeneticamente mais distante e apresentar características metabólicas contrastantes tanto à cana quanto ao milho, além de ser uma cultura de grande importância econômica.

Foi observado, em milho, uma dinâmica de enriquecimento de grupos de bactérias pertencentes ao inóculo sintético até então desconhecida e uma alteração impactante da microbiota natural dessas plantas, possivelmente devido aos efeitos da presença dos membros da comunidade sintética se estenderem para órgãos que não foram diretamente inoculados (Armanhi et al., 2018). Todos esses resultados foram observados acerca das comunidades de bactérias presentes no milho e originadas da CBC. Entretanto, a descrição do microbioma da cana-de-açúcar revelou uma grande diversidade de grupos tanto de bactérias como de fungos que ainda não foram explorados em associação com plantas, resultando no conhecimento restrito sobre os potenciais benefícios promovidos por esses microrganismos para o desenvolvimento vegetal (de Souza et al., 2016). Estudos sobre interações ecológicas entre fungo e hospedeiro compreendem apenas uma pequena porção (<<5%) dentre toda a diversidade de espécies fúngicas possivelmente existentes (Hawksworth DL, 1991), sendo que a maioria desses trabalhos focaram apenas em associações entre plantas e fungos patogênicos e micorrizas (Douds e Millner, 1999; Carlsson-Graener e Thrall, 2002). Associações simbióticas positivas entre fungos e plantas foram amplamente descritas ao longo dos anos (Berbee ML, 2001), sendo conhecido que alguns grupos de fungos endofiticos, como os ascomicetos, habitam os tecidos vegetais sem causar danos ou doenças ao hospedeiro (Petrini O, 1991). De uma maneira geral, a associação com fungos endofíticos pode reduzir a herbivoria, melhorar o crescimento vegetal e a resistência de plantas a metais pesados, a seca e patógenos (Clay K, 1988; Saikkonen et al., 1998; Malinowski e Beleskey, 1999; Clay e Schardl, 2002).

A construção de uma coleção de microrganismos representativa da cana-de-açúcar baseada no isolamento de comunidades microbianas (CBC) permitiu a obtenção de grupos de bactérias e fungos armazenados juntos (Armanhi et al., 2016) e que até então não foram desvendados. Desta forma, a comunidade sintética estabelecida para os ensaios de inoculação

em milho construída a partir de isolados obtidos da CBC certamente compreende grupos de fungos na sua composição. Neste contexto, nesse trabalho nós buscamos desvendar o perfil de colonização de grupos de bactérias e fungos em plantas de soja e de fungos em milho, ambas inoculadas com uma comunidade microbiana sintética oriunda do microbioma da cana-de- açúcar, com o objetivo de desvendar os efeitos desses grupos na estrutura da microbiota natural associada a essas culturas e compreender a dinâmica de estabelecimento de bactérias e fungos da comunidade sintética nos diferentes tecidos vegetais dos modelos estudados. Compreender os efeitos e desvendar os mecanismos envolvidos na colonização e dinâmica de estabelecimento de comunidades microbianas com diferentes modelos de plantas podem guiar estudos importantes direcionados para culturas de interesse econômico em busca de bioinoculantes com ampla capacidade de interagir beneficamente com diferentes espécies vegetais.

2. OBJETIVOS

Os objetivos deste trabalho foram:

1 – Avaliar o efeito de uma comunidade microbiana sintética oriunda do microbioma da cana-de-açúcar, capaz de promover o crescimento vegetal em plantas de milhos, em plantas de soja.

2 – Investigar o potencial da comunidade sintética em colonizar e se estabelecer nos órgãos vegetais da soja.

3 – Comparar o padrão de colonização de bactérias e fungos pertencentes à comunidade sintética em plantas de milho e soja.

3.1 – Investigar a abundância relativa dos grupos microbianos ao longo dos órgãos vegetais.

3.2 – Investigar se existe uma preferência espécie- e/ou órgão-específica.

4 – Investigar o efeito da presença dos microrganismos da comunidade sintética na estrutura da microbiota natural de plantas de milho e soja.

3. MATERIAIS E MÉTODOS

3.1 Inóculo sintético

Neste trabalho, nós nos baseamos no conceito de abundância de grupos microbianos originalmente na planta para construção de uma comunidade microbiana sintética para ser testada em ensaios de inoculação. A partir da descrição do microbioma da cana-de-açúcar (Souza et al., 2016) e da construção e anotação da coleção de microrganismos baseada no isolamento de comunidades (Armanhi et al., 2016), foram selecionadas as 10 OTUs mais abundantes nos tecidos da raiz e as 10 OTUs mais abundantes nos tecidos do colmo da cana para compor uma comunidade sintética. Como um mesmo grupo microbiano pode ser representado por diferentes OTUs, no fim, a comunidade sintética é composta por isolados distribuídos em 17 poços da coleção (Tabela 1). Devido à coleção de microrganismos ser baseada no isolamento de comunidades, alguns dos poços das placas de 96 wells contendo as OTUs selecionadas possuem mais que um microrganismo armazenado junto, de forma que, ao todo, a comunidade sintética é composta por mais de 17 microrganismos diferentes. Os 17 isolados que compõe a comunidade sintética foram crescidos individualmente em meio de cultura líquido LB ½ (Luria Bertani; 5 g triptona, 5 g NaCl e 2,5 g extrato de levedura) enriquecido com xarope de cana contendo 8 g l-1 de açúcares totais (©Amyris; 83,78 g glicose, 72,76 g frutose e 545,94 g sucrose) por 3 dias, sob agitação constante de 215 rpm e temperatura de 30°C. Para obtenção da solução inoculante final, a quantidade de cada isolado foi padronizado pela sua OD620 (Optical Density) de forma a se obter quantidades equivalentes de cada cultura. A composição final da comunidade sintética foi padronizada para

OD620 final = 0.6. Uma alíquota de cada crescido individual e da solução inoculante final foram armazenadas para o sequenciamento dos genes 16S e ITS.

Tabela 1 - Classificação taxonômica das OTUs originadas da coleção de microrganismos representantes dos grupos mais abundantes do microbioma core da cana de açúcar que compõe a comunidade microbiana sintética. As OTUs da CBC foram classificadas utilizando o algoritmo SINTAX e o bando de dados RDP. ID, identificação. Conf, confiança.

ID Reino Conf. Filo Conf. Classe Conf. Ordem Conf. Família Conf. Gênero Conf.

Bacteria 100.0 Bacteroidetes 100.0 Flavobacteria 97.9 Flavobacteriales 97.9 Flavobacteriaceae 97.9 Flavobacterium 95.4 A01 Bacteria 100.0 Bacteroidetes 100.0 Sphingobacteria 100.0 Sphingobacteriales 100.0 Chitinophagaceae 100.0 Chitinophaga 99.5 Bacteria 100.0 Bacteroidetes 100.0 Sphingobacteria 98.3 Sphingobacteriales 98.3 Sphingobacteriaceae 98.3 Pedobacter 97.5 Bacteria 100.0 Bacteroidetes 100.0 Flavobacteria 97.9 Flavobacteriales 97.9 Flavobacteriaceae 97.9 Flavobacterium 95.4 A02 Bacteria 100.0 Proteobacteria 100.0 Gammaproteobacteria 100.0 Xanthomonadales 99.2 Xanthomonadaceae 99.0 Lysobacter 99.0 Bacteria 100.0 Proteobacteria 100.0 Alphaproteobacteria 98.9 Rhizobiales 98.9 Rhizobiaceae 98.9 Rhizobium 98.9 Bacteria 100.0 Firmicutes 100.0 Bacilli 99.8 Bacillales 99.6 Bacillaceae_1 99.6 Bacillus 99.6 A10 Bacteria 100.0 Proteobacteria 100.0 Betaproteobacteria 99.4 Burkholderiales 99.4 Burkholderiaceae 99.4 Burkholderia 99.3 Bacteria 100.0 Proteobacteria 100.0 Alphaproteobacteria 98.7 Rhizobiales 98.7 Bradyrhizobiaceae 98.3 Bosea 98.3 C05 Bacteria 100.0 Actinobacteria 100.0 Actinobacteria 100.0 Actinomycetales 99.6 Microbacteriaceae 99.4 Microbacterium 98.9 F04 Bacteria 100.0 Proteobacteria 100.0 Betaproteobacteria 99.2 Burkholderiales 99.2 Comamonadaceae 98.3 Variovorax 98.3 Bacteria 100.0 Bacteroidetes 100.0 Flavobacteria 97.9 Flavobacteriales 97.9 Flavobacteriaceae 97.9 Flavobacterium 95.4 G01 Bacteria 100.0 Proteobacteria 100.0 Betaproteobacteria 99.4 Burkholderiales 99.4 Burkholderiaceae 99.4 Burkholderia 99.3 H03 Bacteria 100.0 Proteobacteria 100.0 Gammaproteobacteria 100.0 Enterobacteriales 99.2 Enterobacteriaceae 98.9 Enterobacter 95.0 Bacteria 100.0 Proteobacteria 100.0 Gammaproteobacteria 96.4 Pseudomonadales 96.4 Pseudomonadaceae 95.9 Rhizobacter 90.8 Bacteria 100.0 Proteobacteria 100.0 Alphaproteobacteria 98.5 Rhizobiales 98.5 Rhizobiaceae 98.5 Ensifer 96.3 F06 Bacteria 100.0 Bacteroidetes 100.0 Sphingobacteria 99.1 Sphingobacteriales 99.1 Sphingobacteriaceae 99.1 Mucilaginibacter 99.1 Bacteria 100.0 Proteobacteria 100.0 Betaproteobacteria 98.9 Burkholderiales 98.9 Comamonadaceae 97.2 Variovorax 94.5 G08 Bacteria 100.0 Proteobacteria 100.0 Gammaproteobacteria 99.7 Xanthomonadales 99.5 Xanthomonadaceae 99.5 Dyella 98.3 Bacteria 100.0 Proteobacteria 100.0 Alphaproteobacteria 99.8 Caulobacterales 99.6 Caulobacteraceae 99.6 Asticcacaulis 99.6 F02 Bacteria 100.0 Proteobacteria 100.0 Alphaproteobacteria 98.9 Caulobacterales 98.9 Caulobacteraceae 98.9 Asticcacaulis 96.3 Bacteria 100.0 Proteobacteria 100.0 Alphaproteobacteria 99.7 Sphingomonadales 99.0 Sphingomonadaceae 98.5 Sphingomonas 98.5 D05 Bacteria 100.0 Proteobacteria 100.0 Alphaproteobacteria 97.8 Rhizobiales 97.8 Rhizobiaceae 97.8 Rhizobium 97.1 F08 Bacteria 100.0 Proteobacteria 100.0 Gammaproteobacteria 100.0 Enterobacteriales 99.2 Enterobacteriaceae 98.9 Enterobacter 95.0 G12 Bacteria 100.0 Proteobacteria 100.0 Gammaproteobacteria 99.5 Xanthomonadales 99.3 Xanthomonadaceae 99.3 Dyella 93.2 C12 Bacteria 100.0 Bacteroidetes 100.0 Sphingobacteria 98.0 Sphingobacteriales 98.0 Sphingobacteriaceae 98.0 Mucilaginibacter 93.8 Bacteria 100.0 Proteobacteria 100.0 Alphaproteobacteria 98.6 Rhizobiales 98.6 Beijerinckiaceae 97.8 Beijerinckia 96.6 E09 Bacteria 100.0 Proteobacteria 100.0 Gammaproteobacteria 100.0 Enterobacteriales 99.2 Enterobacteriaceae 98.9 Enterobacter 95.0 Bacteria 100.0 Proteobacteria 100.0 Gammaproteobacteria 99.5 Enterobacteriales 98.4 Enterobacteriaceae 97.4 Pantoea 89.1 B02 Bacteria 100.0 Actinobacteria 100.0 Actinobacteria 100.0 Actinomycetales 99.8 Micrococcaceae 99.4 Arthrobacter 99.2

B08 Bacteria 100.0 Bacteroidetes 100.0 Sphingobacteria 98.6 Sphingobacteriales 98.6 Sphingobacteriaceae 98.6 Pedobacter 95.0

3.2 Inoculação em milho Para o estabelecimento da plataforma de inoculação em milho, foram utilizadas sementes do híbrido comercial simples DKB 177 (DEKALB-MONSANTO). Para remover os microrganismos naturalmente presentes nas sementes e minimizar suas influências no crescimento das plantas, antes de serem colocadas em contato com a comunidade sintética, as sementes de milho foram esterilizadas superficialmente lavando-se por 3 vezes consecutivas em solução 0,5% tween 20 (Sigma®, St Louis, USA). Em seguida, foram feitas lavagens com água milliQ estéril para remoção do detergente. Após, as sementes foram imersas em solução de hipoclorito de sódio comercial 15% por 15 min e, por fim, foram lavadas com água milliQ estéril até total remoção do hipoclorito e colocadas para secar em ambiente estéril. As sementes previamente esterilizadas foram germinadas em rolos de papel filtro estéril, embebidos em água estéril, por 3 dias a 28°C no escuro. Após esse período, para eliminar o efeito das reservas nutricionais desde o início do desenvolvimento ou mesmo de microrganismos naturalmente presentes na região interna das sementes, é feita a excisão do endosperma dos embriões pré germinados. Por fim, os embriões pré germinados e excisados foram mantidos imersos na solução inoculante final durante 30 minutos. Para a condição controle, os embriões foram mantidos imersos em solução nutritiva estéril diluída 1/10 x pelo mesmo período. Em seguida, os embriões foram plantados em vasos de 10 x 25 cm D x A contendo vermiculita como substrato (Figura 1). Para avaliar o efeito dessa comunidade sintética em associação com uma espécie vegetal, foram estabelecidos três momentos distintos de inoculação das plantas: no dia do plantio (dia 0), dois (dia 2) e sete dias após o plantio (dia 7) (Figura 2). Em cada etapa de inoculação, é aplicado 1 mL do inóculo final por indivíduo no vaso diretamente no substrato, próximo ao local de inserção da planta. Após 7 dias do plantio, foi realizado o desbaste das plantas de acordo com o estágio de desenvolvimento de cada vaso. Ao todo, foram preparados 10 vasos para cada condição. Essas plantas foram mantidas em casa de vegetação no Centro de Biologia Molecular e Engenharia Genética (CBMEG) da Unicamp (22° 49' 8.50'' S 47° 3' 32.48'' W) por 4 semanas recebendo solução estéril de Hoagland modificada (Hoagland DR, 1950) (15 ml nitrato de potássio 1M, 15 mL nitrato de cálcio 1M, 6 mL sulfato de magnésio 1 M, 12 mL nitrato de amonia 0.25M, 6 mL fosfato de potássio monobásico 0.5M, 3 mL solução de micronutrientes e 6 mL Fe-EDTA 1g/L, completando o volume final para 1 L com água) como única fonte nutricional. Após 4 semanas, as plantas foram coletadas e utilizadas para fenotipagem (medições e registro fotográfico) e armazenadas a -80°C para extração de DNA.

Figura 1 - Plataforma de inoculação em milho. Para avaliar o efeito da comunidade sintética em plantas de milho, as sementes são previamente esterilizadas e germinadas em condições estéreis. Os embriões são então excisados de seu endosperma e imersos na solução inoculante para posterior plantio. As plantas Inoculadas recebem o inóculo sintético por mais 3 vezes.

3.3 Inoculação em soja Para o estabelecimento da plataforma de inoculação em soja foram utilizadas sementes da variedade convencional de soja comercial BRS 232 (EMBRAPA). Para remover os microrganismos naturalmente presentes nas sementes e minimizar sua influência no crescimento das plantas, as sementes foram esterilizadas superficialmente pela ação de gás clorídrico utilizando um protocolo adaptado de Kereszt et al., 2007, no qual o tempo de esterilização das sementes foi padronizado para 16h. As sementes foram mantidas em ambiente fechado durante este período em contato apenas com o gás liberado da reação de hipoclorito de sódio comercial com ácido clorídrico 32%. Em seguida, as sementes foram deixadas ao ar em

ambiente estéril para evaporação de resíduos do gás. Após esse processo, as sementes foram embebidas em água estéril na proporção 2:1 m/v semente/água e mantidas por 16h no escuro, a 28°C, para induzir a germinação (pre sowing) (Dierking e Bilyeu, 2009). Posteriormente, as sementes foram divididas em duas condições: Inoculado e Não Inoculado (controle). Para compor o grupo Inoculados, as sementes esterilizadas e intumescidas foram mantidas imersas na solução inoculante final durante 30 minutos. Para a condição controle, as sementes foram mantidas imersas em solução nutritiva estéril diluída 1/10 x pelo mesmo período. Em seguida, as sementes foram plantadas em vasos de 10 x 25 cm D x A contendo vermiculita como substrato. Para as sementes inoculadas, segue-se o mesmo protocolo mencionado no tópico 3.2 (Figura 2). A fim de avaliar o efeito da comunidade sintética no crescimento das plantas e minimizar o efeito das reservas nutricionais ou mesmo de microrganismos naturalmente presentes nas sementes que não foram removidos pela esterilização superficial, é feita a retirada dos cotilédones das plantas 7 dias após o seu plantio (Figura 3). Neste mesmo momento, é feito o desbaste das plantas de acordo com o estágio de desenvolvimento de cada vaso. Para manutenção das plantas, foram estabelecidas 3 diferentes concentrações de solução nutritiva MS (Murashige e Skoog, 1962; Sigma, M5524): 1X, 1/2X e 1/4X. Foram preparados 5 vasos para cada condição. As plantas foram mantidas em casa de vegetação no Centro de Biologia Molecular e Engenharia Genética (CBMEG) da Unicamp (22° 49' 8.50'' S 47° 3' 32.48'' W) por 4 semanas recebendo solução MS estéril como única fonte nutricional. Após 4 semanas, essas plantas foram coletadas e utilizadas para fenotipagem (medições e registro fotográfico) e armazenadas a -80°C para extração de DNA.

Figura 2 - Esquema representativo do pipeline de inoculação estabelecido para avaliação do efeito da comunidade sintética em plantas de milho e soja. (A) e (D) primeira etapa de inoculação, no dia do plantio (Dia 0). Cada embrião (milho) ou semente (soja) plantados recebe, individualmente, 1 mL do inóculo sintético. (B) e (E) segunda etapa de inoculação, dois dias após o plantio (Dia 2). Cada plântula recebe, individualmente, 1 mL do inóculo sintético próximo a base do caule. (C) e (F) terceira etapa de inoculação, sete dias após o plantio (Dia 7). As plantas individuais recebem 1 mL do inóculo sintético próximo a base do caule.

Figura 3- Plataforma de inoculação em soja. Para avaliar o efeito da comunidade sintética em plantas de soja, as sementes são previamente esterilizadas e induzidas a germinar. As sementes intumescidas são imersas na solução inoculante e para posterior plantio. As plantas Inoculadas recebem o inóculo sintético por mais 3 vezes. Uma semana após o plantio, é feita a remoção dos cotilédones das plantas Inoculadas e Não Inoculadas.

3.4 Coleta e fenotipagem de plantas de milho e soja Após o período de crescimento por 4 semanas em casa de vegetação, as plantas foram coletadas separadamente em ambiente controlado para evitar contaminação cruzada do material. As plantas foram retiradas dos vasos e foi feita uma lavagem da raiz em água corrente para retirar o substrato aderido a esse órgão, mantendo suas estruturas intactas. Em seguida, essas plantas foram fotografadas mantendo-se as mesmas condições de exposição para cada indivíduo. A fim de compreender e quantificar os efeitos no crescimento vegetal potencialmente promovidos pela presença do inóculo sintético nos dois modelos estudados, foram estabelecidos 4 parâmetros de medição para fenotipagem desse material: 1) altura da

parte aérea, 2) comprimento da raiz e 3) peso fresco total, obtidos a partir do material recém coletado; e 4) peso seco total, obtido de plantas mantidas em estufa a 65°C, por 7 dias, para secagem e posterior pesagem. Para as análises de fenotipagem foram utilizados 5 indivíduos inoculados e 5 não inoculados, para cada condição estabelecida, representativos das plantas de milho e de soja. A altura da parte aérea foi estabelecida a partir da interface caule/raiz até o ápice da maior folha, para milho (Figura 4), e até a origem da gema apical mais recente, para soja (Figura 4). O comprimento da raiz foi estabelecido a partir da interface caule/raiz até o ápice da raiz para ambas espécies (Figura 4). Para calcular a significância entre plantas inoculadas e não inoculadas dos parâmetros estabelecidos para fenotipagem foi utilizado o Teste t de Student com valor de significância (p-valor) < 0,05.

Figura 4 – Medições da altura da parte aérea e comprimento da raiz para fenotipagem de plantas de milho e soja. (A) Altura da parte aérea do milho, estabelecida a partir da interface caule/raiz até o ápice da maior folha. (B) Altura da parte aérea da soja, estabelecida a partir da interface caule/raiz até o ápice da gema apical mais nova. (C) Comprimento da raiz de plantas de milho e soja, estabelecida a partir da interface caule/raiz até o ápice da ramificação mais longa.

3.5 Fenotipagem de soja por análise de imagem

A fim de quantificar os efeitos da comunidade sintética no crescimento vegetal em plantas de soja, foi utilizado um método de medição por análise de imagem para avaliação da área da raiz, caule e folha dessas plantas. As imagens geradas na coleta foram padronizadas utilizando-se o programa Adobe Photoshop CC 2015 e submetidas a um pipeline automatizado

no software ImageJ 1.52e (Fiji) capaz de analisar a área de cada órgão separadamente. Os dados crus originados pelo software foram gerados em pixels e exportados para um arquivo Excel. Para conversão dos valores de área de pixels para inch, foi aplicado o fator de multiplicação 0,000108508 e, para conversão dos valores de inch para centímetros, foi aplicado o fator de multiplicação 2,54. Para calcular a significância da área de plantas inoculadas e não inoculadas foi utilizado o Teste t de Student com valor de significância < 0,05.

3.6 Mapeamento da colonização em plantas de milho e soja

Para o mapeamento da colonização da comunidade sintética nos órgãos vegetais de milho, foram utilizados 5 indivíduos representativos dessa cultura. Imediatamente após serem retiradas do vaso, foi feita a separação entre os órgãos de raiz, caule e folha dessas plantas. Em seguida, esses tecidos foram lavados superficialmente em tampão PBS-tween 20 (7 mM Na2HPO4, 3 mM NaH2PO4, pH 7.0 e 0.05% tween20) gelado e a solução de lavagem resultante foi filtrada em gaze para amostragem das comunidades presentes no compartimento exofítico da planta. Posteriormente, esses tecidos foram lavados em água MilliQ estéril, triturados em tampão PBS (7 mM Na2HPO4, 3 mM NaH2PO4, pH 7.0) gelado e filtrados em gaze para amostragem das comunidades microbianas presentes no compartimento endofítico da planta. Os pellets resultantes enriquecidos de microrganismos foram congelados em nitrogênio líquido e armazenados a -80°C para extração de DNA. Para o mapeamento das comunidades microbianas presentes em plantas de soja foram obtidas amostras representativas dos tecidos de raiz, caule e folha, originadas das mesmas regiões entre os indivíduos (Figura 5), de plantas inoculadas e não inoculadas recém coletadas. Esses tecidos foram imediatamente congelados em nitrogênio líquido e armazenadas a -80°C para extração de DNA.

Figura 5 – Amostragem representativa das comunidades microbianas dos tecidos de raiz, caule e folha de plantas de soja. Para acessar os grupos de bactérias de fungos presentes nos tecidos da soja, foram coletadas amostras representativas de cada órgão. Para amostragem da raiz, foi retirada uma amostra de 5 cm da região central, próxima ao brotamento, incluindo a raiz principal. Para o caule, foi retirada uma amostra de 2,5 cm obtida a partir da cicatriz dos cotilédones. Para as folhas, foram coletadas as folhas centrais do terceiro ramo. Todas as amostras foram padronizadas entre os indivíduos.

3.7 Bibliotecas de sequenciamento

3.7.1 Extração e quantificação de DNA

Para acessarmos os microrganismos presentes nas plantas de milho e soja foi feita extração de DNA total das amostras previamente coletadas e armazenadas utilizando o kit DNeasy PowerSoil Kit (Qiagen, 12888). Os pellets enriquecidos de microrganismos resultantes das amostras de milho foram diretamente utilizados para o processo de extração. Os tecidos de soja armazenados foram previamente macerados em nitrogênio líquido e mantidos a -80°C. Foi utilizado de 0,5 a 1 mg de cada material macerado para o processo de extração, executado de acordo com o protocolo do fabricante acrescido de um passo a 65°C durante 10 min após a adição da solução C1, conforme estabelecido por Souza et al., 2016. As amostras de DNA resultantes foram quantificadas por fluorometria utilizando o kit Qubit® dsDNA BR Assay Kits (Invitrogen, Q32853) no equipamento Qubit® 2.0 e armazenadas a -80°C.

3.7.2 Primers Para acessar os grupos de bactérias e fungos presentes nas plantas de milho e soja foram selecionadas, respectivamente, as regiões V4 do gene ribossomal 16S e a região ITS2

como alvos para montagem das bibliotecas de sequenciamento. Para isso, em uma primeira etapa de PCR (PCR1), foram utilizados os primers 515f e 806r (Tabela 2), para amplificação do gene 16S, e ITS9 e ITS4 (Tabela 2), para amplificação da região ITS2. Para cada região selecionada, foram desenhados 3 primers forward contendo diferentes nucleotídeos aleatórios extras (FS, Frame shift) na região 5’ para aumentar a diversidade das sequências alvo (Souza et al., 2016). Volumes equimolares dos 3 primers forward foram utilizados para compor um único pool de primers que foi utilizado nas reações de PCR1. Os primers reverse (Tabela 2) foram desenhados contendo 6 nucleotídeos aleatórios (Souza et al., 2016). Por fim, os primers foram modificados pela adição de uma sequência adaptadora Illumina Nextera transposase (Tabela 3) que será adicionada ao amplicon nesta etapa de PCR. Em uma segunda etapa (PCR2) foram utilizados os primers originais do kit Illumina Index Kit – PCR Primers (Tabela 3; Illumina Adapter Sequences) para adição de um sistema duplo de adaptador e barcode no amplicon que permite a identificação exata do poço de origem da amostra quando sequenciada em pool.

Adaptadores Oligo Orientação Sequência completa (5’ -> 3’) Adaptador 5’ (Sequência Nextera transposase) Frame shift Sequência primer

515f_FS1 Forward TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG NNNNNN GTGCCAGCMGCCGCGGTAA TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNGTGCCAGCMGCCGCGGTAA

515f_FS2 Forward TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG NNNNN GTGCCAGCMGCCGCGGTAA TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNGTGCCAGCMGCCGCGGTAA

515f_FS3 Forward TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG NNNN GTGCCAGCMGCCGCGGTAA TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNGTGCCAGCMGCCGCGGTAA

806r Reverse GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG NNNNNN GGACTACHVGGGTWTCTAAT GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGNNNNNNGGACTACHVGGGTWTCTAAT

ITS9f_FS1 Forward TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG NNNNNN GAACGCAGCRAAIIGYGA TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNGAACGCAGCRAAIIGYGA

ITS9f_FS2 Forward TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG NNNNN GAACGCAGCRAAIIGYGA TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNGAACGCAGCRAAIIGYGA

ITS9f_FS3 Forward TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG NNNN GAACGCAGCRAAIIGYGA TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNGAACGCAGCRAAIIGYGA

ITS4r Reverse GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG NNNNNN TCCTCCGCTTATTGATATGC GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGNNNNNNTCCTCCGCTTATTGATATGC

Tabela 3 - Sequências adaptadoras, primers e barcodes originais do kit Illumina Index Kit utilizados na etapa de PCR2 de preparação das bibliotecas de sequenciamento.

Adaptadores Oligo Orientação Sequência completa (5’ -> 3’) Adaptador 5’ para Adaptador Illumina Barcode primer forward

Primers i5 S501 Forward AATGATACGGCGACCACCGAGATCTACAC TAGATCGC TCGTCGGCAGCGTC AATGATACGGCGACCACCGAGATCTACACTAGATCGCTCGTCGGCAGCGTC S502 Forward AATGATACGGCGACCACCGAGATCTACAC CTCTCTAT TCGTCGGCAGCGTC AATGATACGGCGACCACCGAGATCTACACCTCTCTATTCGTCGGCAGCGTC S503 Forward AATGATACGGCGACCACCGAGATCTACAC TATCCTCT TCGTCGGCAGCGTC AATGATACGGCGACCACCGAGATCTACACTATCCTCTTCGTCGGCAGCGTC S504 Forward AATGATACGGCGACCACCGAGATCTACAC AGAGTAGA TCGTCGGCAGCGTC AATGATACGGCGACCACCGAGATCTACACAGAGTAGATCGTCGGCAGCGTC S505 Forward AATGATACGGCGACCACCGAGATCTACAC GTAAGGAG TCGTCGGCAGCGTC AATGATACGGCGACCACCGAGATCTACACGTAAGGAGTCGTCGGCAGCGTC S506 Forward AATGATACGGCGACCACCGAGATCTACAC ACTGCATA TCGTCGGCAGCGTC AATGATACGGCGACCACCGAGATCTACACACTGCATATCGTCGGCAGCGTC S507 Forward AATGATACGGCGACCACCGAGATCTACAC AAGGAGTA TCGTCGGCAGCGTC AATGATACGGCGACCACCGAGATCTACACAAGGAGTATCGTCGGCAGCGTC S508 Forward AATGATACGGCGACCACCGAGATCTACAC CTAAGCCT TCGTCGGCAGCGTC AATGATACGGCGACCACCGAGATCTACACCTAAGCCTTCGTCGGCAGCGTC S510 Forward AATGATACGGCGACCACCGAGATCTACAC CGTCTAAT TCGTCGGCAGCGTC AATGATACGGCGACCACCGAGATCTACACCGTCTAATTCGTCGGCAGCGTC S511 Forward AATGATACGGCGACCACCGAGATCTACAC TCTCTCCG TCGTCGGCAGCGTC AATGATACGGCGACCACCGAGATCTACACTCTCTCCGTCGTCGGCAGCGTC S513 Forward AATGATACGGCGACCACCGAGATCTACAC TCGACTAG TCGTCGGCAGCGTC AATGATACGGCGACCACCGAGATCTACACTCGACTAGTCGTCGGCAGCGTC S515 Forward AATGATACGGCGACCACCGAGATCTACAC TTCTAGCT TCGTCGGCAGCGTC AATGATACGGCGACCACCGAGATCTACACTTCTAGCTTCGTCGGCAGCGTC S516 Forward AATGATACGGCGACCACCGAGATCTACAC CCTAGAGT TCGTCGGCAGCGTC AATGATACGGCGACCACCGAGATCTACACCCTAGAGTTCGTCGGCAGCGTC S517 Forward AATGATACGGCGACCACCGAGATCTACAC GCGTAAGA TCGTCGGCAGCGTC AATGATACGGCGACCACCGAGATCTACACGCGTAAGATCGTCGGCAGCGTC

Primers i7 N701 Reverse CAAGCAGAAGACGGCATACGAGAT TCGCCTTA GTCTCGTGGGCTCGG CAAGCAGAAGACGGCATACGAGATTCGCCTTAGTCTCGTGGGCTCGG N702 Reverse CAAGCAGAAGACGGCATACGAGAT CTAGTACG GTCTCGTGGGCTCGG CAAGCAGAAGACGGCATACGAGATCTAGTACGGTCTCGTGGGCTCGG N703 Reverse CAAGCAGAAGACGGCATACGAGAT TTCTGCCT GTCTCGTGGGCTCGG CAAGCAGAAGACGGCATACGAGATTTCTGCCTGTCTCGTGGGCTCGG N704 Reverse CAAGCAGAAGACGGCATACGAGAT GCTCAGGA GTCTCGTGGGCTCGG CAAGCAGAAGACGGCATACGAGATGCTCAGGAGTCTCGTGGGCTCGG N705 Reverse CAAGCAGAAGACGGCATACGAGAT AGGAGTCC GTCTCGTGGGCTCGG CAAGCAGAAGACGGCATACGAGATAGGAGTCCGTCTCGTGGGCTCGG N706 Reverse CAAGCAGAAGACGGCATACGAGAT CATGCCTA GTCTCGTGGGCTCGG CAAGCAGAAGACGGCATACGAGATCATGCCTAGTCTCGTGGGCTCGG N707 Reverse CAAGCAGAAGACGGCATACGAGAT GTAGAGAG GTCTCGTGGGCTCGG CAAGCAGAAGACGGCATACGAGATGTAGAGAGGTCTCGTGGGCTCGG N708 Reverse CAAGCAGAAGACGGCATACGAGAT CCTCTCTG GTCTCGTGGGCTCGG CAAGCAGAAGACGGCATACGAGATCCTCTCTGGTCTCGTGGGCTCGG

N709 Reverse CAAGCAGAAGACGGCATACGAGAT AGCGTAGC GTCTCGTGGGCTCGG CAAGCAGAAGACGGCATACGAGATAGCGTAGCGTCTCGTGGGCTCGG N710 Reverse CAAGCAGAAGACGGCATACGAGAT CAGCCTCG GTCTCGTGGGCTCGG CAAGCAGAAGACGGCATACGAGATCAGCCTCGGTCTCGTGGGCTCGG N711 Reverse CAAGCAGAAGACGGCATACGAGAT TGCCTCTT GTCTCGTGGGCTCGG CAAGCAGAAGACGGCATACGAGATTGCCTCTTGTCTCGTGGGCTCGG N712 Reverse CAAGCAGAAGACGGCATACGAGAT TCCTCTAC GTCTCGTGGGCTCGG CAAGCAGAAGACGGCATACGAGATTCCTCTACGTCTCGTGGGCTCGG N714 Reverse CAAGCAGAAGACGGCATACGAGAT TCATGAGC GTCTCGTGGGCTCGG CAAGCAGAAGACGGCATACGAGATTCATGAGCGTCTCGTGGGCTCGG N715 Reverse CAAGCAGAAGACGGCATACGAGAT CCTGAGAT GTCTCGTGGGCTCGG CAAGCAGAAGACGGCATACGAGATCCTGAGATGTCTCGTGGGCTCGG N716 Reverse CAAGCAGAAGACGGCATACGAGAT TAGCGAGT GTCTCGTGGGCTCGG CAAGCAGAAGACGGCATACGAGATTAGCGAGTGTCTCGTGGGCTCGG N718 Reverse CAAGCAGAAGACGGCATACGAGAT GTAGCTCC GTCTCGTGGGCTCGG CAAGCAGAAGACGGCATACGAGATGTAGCTCCGTCTCGTGGGCTCGG N719 Reverse CAAGCAGAAGACGGCATACGAGAT TACTACGC GTCTCGTGGGCTCGG CAAGCAGAAGACGGCATACGAGATTACTACGCGTCTCGTGGGCTCGG N720 Reverse CAAGCAGAAGACGGCATACGAGAT AGGCTCCG GTCTCGTGGGCTCGG CAAGCAGAAGACGGCATACGAGATAGGCTCCGGTCTCGTGGGCTCGG N721 Reverse CAAGCAGAAGACGGCATACGAGAT GCAGCGTA GTCTCGTGGGCTCGG CAAGCAGAAGACGGCATACGAGATGCAGCGTAGTCTCGTGGGCTCGG N722 Reverse CAAGCAGAAGACGGCATACGAGAT CTGCGCAT GTCTCGTGGGCTCGG CAAGCAGAAGACGGCATACGAGATCTGCGCATGTCTCGTGGGCTCGG N723 Reverse CAAGCAGAAGACGGCATACGAGAT GAGCGCTA GTCTCGTGGGCTCGG CAAGCAGAAGACGGCATACGAGATGAGCGCTAGTCTCGTGGGCTCGG N724 Reverse CAAGCAGAAGACGGCATACGAGAT CGCTCAGT GTCTCGTGGGCTCGG CAAGCAGAAGACGGCATACGAGATCGCTCAGTGTCTCGTGGGCTCGG N726 Reverse CAAGCAGAAGACGGCATACGAGAT GTCTTAGG GTCTCGTGGGCTCGG CAAGCAGAAGACGGCATACGAGATGTCTTAGGGTCTCGTGGGCTCGG N727 Reverse CAAGCAGAAGACGGCATACGAGAT ACTGATCG GTCTCGTGGGCTCGG CAAGCAGAAGACGGCATACGAGATACTGATCGGTCTCGTGGGCTCGG

3.7.3 Etapas de PCR e purificação das bibliotecas de sequenciamento

As bibliotecas de sequenciamento de amplicons 16S e ITS foram feitas de acordo com o protocolo estabelecido em nosso laboratório (Souza et al., 2016) e consiste em duas etapas de PCR. A primeira etapa (PCR1) foi desenhada para amplificar as regiões de interesse 16S e ITS2 e adicionar um adaptador Illumina Nextera no amplicon. Para as reações de PCR1 do gene 16S, foram adicionadas sequências de PNA clamp (PNA Bio) em concentração final de 0,75 µM cada para minimizar a amplificação de regiões 16S de mitocôndrias e cloroplastos. Nesta etapa foi utilizada a enzima KAPA HiFi HotStart (Kapa Biosystems, KK2602) e as reações foram padronizadas contendo 10 ng de DNA e primers em concentração final de 0,75 µM cada, de acordo com o protocolo do fabricante. Em seguida, as amostras foram purificadas pelo sistema de beads Agencourt AMPure XP (Beckman Coulter, A63881) na proporção 1:1 / beads:DNA e ressuspendidas em água milliQ. A segunda etapa (PCR2) foi desenhada para adição de um sistema duplo de identificação das amostras em placa de 96 wells através da combinação única de barcodes de linha e coluna. Nesta etapa foi utilizada a enzima Platinum® Taq DNA Polymerase High Fidelity. As reações foram feitas de acordo com o protocolo do fabricante, contendo 5 µL do produto de PCR1 purificado e oligos da Illumina S5xx e N7xx em concentração final de 0,75 µM cada. Os produtos de PCR2 foram purificados pelo sistema de beads Agencourt AMPure XP na proporção 1:1 / beads:DNA, ressuspendidos em água milliQ e armazenados a -20°C.

3.7.4 Quantificação das bibliotecas e pool de sequenciamento

Para controle de qualidade das bibliotecas e montagem do pool de sequenciamento, os produtos finais de PCR2 foram quantificados por fluorometria através do kit Qubit® dsDNA BR Assay e por qPCR utilizando o kit KAPA Library Quantification Kit (Kapa Biosystems, KK4824). Em seguida foi feito um único pool de bibliotecas, com concentração final de 4 pM, contendo quantidades equimolares de cada amostra. Utilizamos uma comunidade microbiana mock (BEI Resources, HM-783D) como controle durante a preparação das bibliotecas e para o sequenciamento. O sequenciamento foi feito utilizando a plataforma Illumina HiSeq 2500, no modo rápido, programado para gerar reads pair-end de 250 pb (pares de base). O controle de qualidade, montagem do pool de bibliotecas e sequenciamento foram realizados pela equipe do Laboratório de Genômica do LaCTAD (Laboratório Central de Tecnologias de Alto Desempenho em Ciências da Vida), UNICAMP.

3.8 Bioinformática

3.8.1 Processamento dos reads

Os dados brutos gerados pelo sequenciamento dos genes 16S e ITS foram processados de acordo com o pipeline estabelecido em nosso laboratório (de Souza et al., 2016). O demultiplexing dos reads foi feito utilizando-se o software CASAVA v1.8.2 (Consensus Assessment of Sequence and Variation; Illumina, San Diego, CA, USA), permitindo apenas 1 mismatch para identificação dos barcodes. As etapas do pipeline de bioinformática, incluindo a junção de sequências paired-end, filtragem por qualidade, remoção de sequências de primers e correspondentes à planta foram feitas através de comandos baseados no software USEARCH (Edgar RC, 2013) v9.2. Inicialmente, os reads pair-end demultiplexados foram utilizados para montagem de reads maiores através do comando “fastq_mergepairs” seguindo o parâmetro “- fastq_maxdiffs 10 –fastq_maxdiffpct 10”. Em seguida, foi feita a remoção das sequências frame-shift através de um script em Perl que utiliza o comando “search_oligodb”, do USEARCH v8.1, para identificar as regiões nos primers que apresentem mismatches não aceitos pelo pipeline. As sequências de primers foram removidas através do comando “fastx_truncate” seguida do seu número de nucleotídeos como parâmetro de truncagem. Para filtragem dos reads por qualidade foi utilizado o comando “fastq_filter” seguindo o parâmetro “-fastq_maxee 0.25”. Por fim, os reads foram filtrados por tamanho de 230 a 270 nucleotídeos para biblioteca 16S. Para remoção de sequências 16S correspondentes a mitocôndrias e cloroplastos, obtidas do NCBI (National Center for Biotechnology Information), respectivamente, através dos números de acesso DQ490951.2 e KF241981.1, foi utilizada a ferramenta DUK seguindo os parâmetros “-k 20 –c 2”. O conjunto de reads gerados após o pipeline de processamento foi chamado de reads “filtrados” e utilizados nas etapas seguintes de análise.

3.8.2 Clusterização em OTUs

Os reads filtrados foram utilizados para obtenção de sequências únicas por meio do pipeline UPARSE (Edgar RC, 2013), aplicando-se o comando “fastx_uniques” seguido do comando “cluster_otus” e parâmetros “-minsize 2 -otu_radius_pct 3” para clusterização das sequências em OTUs. Em seguida, para o mapeamento dos reads, foi utilizado o comando “usearch_global” e parâmetros “-strand plus –id 0.97” para estabelecer uma identidade mínima de 97% entre as sequências de uma mesma OTU.

3.8.3 Classificação taxonômica das OTUs

Para identificação taxonômica dos grupos de bactérias correspondentes às OTUs encontradas nas amostras de soja e milho foi utilizado o algoritmo do software SINTAX (Edgar RC, 2016) no USEARCH v9.2 e o banco de dados de genes SILVA 16S rRNA modificado (www.drive5.com/sintax/silva_16s_v123.fa.gz), compatível ao SINTAX. Para identificação taxonômica dos grupos de fungos identificados nas plantas, foi utilizado o bando de dados RDP Warcup training set v2 (Cole et al., 2005). O nível de classificação taxonômica (Reino, Filo, Classe, etc) mais profundo considerado para cada OTU foi definido baseado no valor de confiança da classificação. Portanto, para cada nível de classificação taxonômica, foi aplicado um filtro buscando apenas as OTUs com valores de confiança > 0,8 para serem utilizadas em análises posteriores. Esses parâmetros foram utilizados para obtenção da soma da abundância relativa por órgão das OTUs pertencentes a um determinado grupo taxonômico para cada condição nutricional avaliada.

3.8.4 Construção da Tabela de OTUs e cálculo da abundância relativa dos grupos microbianos

Para construção da Tabela de OTUs, os dados originais foram filtrados para remoção de OTUs com abundância relativa < 0,3% por amostra. Esse valor foi determinado baseado na análise dos dados gerados para comunidade mock e réplicas das amostras. Para o agrupamento das OTUs presentes nos órgãos de raiz, caule e folha em uma determinada condição nutricional, foram consideradas apenas as OTUs que apresentaram abundância relativa em amostras de planta > 0. A abundância relativa de uma OTU por amostra foi calculada com base na sua quantidade normalizada de reads gerados na amostra pelo número total de reads. Para calcular a significância da abundância relativa das OTUs pertencentes ao inóculo sintético nas plantas inoculadas em relação as plantas não inoculadas foi utilizado o Teste t de Student com valor de significância (p-valor) < 0,05. Apenas as OTUs que apresentaram um aumento significativo na sua abundância relativa em plantas inoculadas foram consideradas como grupos colonizadores robustos.

4. RESULTADOS

4.1 Efeito da comunidade microbiana sintética no crescimento de plantas de soja

Em trabalhos anteriores do nosso grupo de pesquisa, foi visto, em milho, que a presença da comunidade sintética representativa do microbioma core da cana-de-açúcar promove uma melhora no desenvolvimento de plantas inoculadas, que apresentaram um aumento significativo de até 3,4 vezes dos seus pesos fresco e seco quando comparadas às plantas não inoculadas (Anexo 9.1). Para avaliar o efeito dessa mesma comunidade em uma cultura de importância econômica e filogeneticamente distante tanto da cana quanto do milho, foi estabelecida uma plataforma de ensaios de inoculação em soja. A avaliação do crescimento das plantas de soja foi feita através de medições de parâmetros biológicos de fenotipagem e das áreas da raiz, caule e folha utilizando análise de imagem de plantas mantidas em diferentes condições nutricionais. Os resultados de fenotipagem mostraram que o inóculo sintético é capaz de melhorar o crescimento de plantas de soja inoculadas de uma maneira geral nas três condições nutricionais avaliadas quando comparadas às plantas não inoculadas (Figura 6).

Figura 6 – Uma comunidade microbiana sintética oriunda do microbioma da cana-de-açúcar induz o crescimento de plantas de soja em diferentes condições nutricionais. Crescimento vegetal, robustez da parte aérea e do sistema radicular e área dos órgãos de plantas de soja não inoculadas (esquerda) e inoculadas (direita) com a comunidade sintética mantidas em diferentes concentrações de solução nutritiva MS. (A) Plantas de soja crescidas com solução MS em concentração 1X. (B) Plantas de soja crescidas com solução MS em concentração 1/2X. (C) Plantas de soja crescidas com solução MS em concentração 1/4X. Escala: 4 cm.

Plantas inoculadas mantidas com solução nutritiva MS 1X apresentaram um aumento na altura da parte aérea e no comprimento da raiz (Figura 7A), contudo, apresentaram um aumento significativo de 1,21 vezes em ambos pesos fresco e seco (Figura 7B). Através da análise da área dos órgãos do mesmo material, nós observamos um aumento na área da raiz de plantas inoculadas, em relação as plantas não inoculadas, de 1,12 vezes (Figura 7C), enquanto a área do caule dessas plantas parece não diferir na presença do inóculo sintético (Figura 7C). Entretanto, observamos um aumento significativo na área foliar de plantas inoculadas, nesta condição, de 1,26 vezes (Figura 7C). Apesar de não ter sido observada uma diferença significativa no comprimento da raiz e altura dessas plantas, o aumento na área dos órgãos de raiz e folha corroboram os dados obtidos de aumento do peso total de plantas inoculadas mantidas em condição nutricional MS 1X.

Plantas de soja inoculadas mantidas em condição nutricional MS 1/2X não apresentaram diferença na altura da parte aérea quando comparadas às plantas não inoculadas (Figura 7A). Já o comprimento da raiz de plantas não inoculadas, nesta condição, apresentou um aumento de 1,19 vezes em relação às plantas inoculadas (Figura 7A). Este resultado pode estar relacionado ao fato de as plantas não inoculadas, afora não compreenderem um sistema radicular visualmente melhor desenvolvido, apresentarem o eixo da raiz principal mais alongado (Figura 6B). Apesar de os parâmetros de comprimento da raiz e altura da parte aérea não apresentarem um aumento em plantas inoculadas com a comunidade sintética na condição MS 1/2X, essas plantas tiveram um aumento significativo nos seus pesos fresco e seco de 1,21 vezes cada quando comparadas às plantas não inoculadas (Figura 7B). Não foi observada diferença entre a área das folhas de plantas inoculadas e não inoculadas na condição MS 1/2X (Figura 7C). Porém, assim como observado na condição anterior, os dados de aumento dos pesos fresco e seco dessas plantas condizem com um aumento importante observado nas áreas da raiz e do caule de ~1,2 vezes cada órgão (Figura 7C), indicando um aumento no acúmulo de biomassa total de plantas inoculadas nesta condição.

Os resultados de fenotipagem de plantas de soja mantidas em condição nutricional MS 1/4X apresentaram um padrão semelhante ao observado na condição MS 1X. Plantas inoculadas com a comunidade sintética apresentaram um aumento significativo da altura da parte aérea de 1,21 vezes em relação às plantas não inoculadas (Figura 7A). Não foi observado um aumento no comprimento da raiz dessas plantas (Figura 7A), entretanto, observamos um aumento significativo nas medições dos pesos fresco e seco de plantas inoculadas de 1,6 vezes cada (Figura 7B). Nós observamos que o aumento dos pesos fresco e seco de plantas mantidas em condição nutricional MS 1/4X ocorre de maneira mais acentuada, apresentando um aumento desses parâmetros 1,3 vezes maior quando comparado ao aumento observado nas condições MS 1X e 1/2X. Não observamos diferença entre as áreas do caule de plantas inoculadas e não inoculadas nesta condição (Figura 7C), entretanto, corroborando os resultados acerca do peso total de plantas inoculadas, nós observamos um aumento significativo nas áreas da raiz e da folha dessas plantas de 1,5 e 1,26 vezes, respectivamente, quando comparadas às plantas não inoculadas (Figura 7C).

Figura 7 – A presença de uma comunidade microbiana sintética induz uma melhora no desenvolvimento e aumento da biomassa total de plantas de soja mantidas em diferentes condições nutricionais. Efeito da inoculação na (A) altura da parte área e comprimento da raiz, (B) pesos fresco e seco e (C) área dos tecidos de raiz, caule folha em plantas de soja inoculadas e não inoculadas crescidas por 4 semanas. As plantas inoculadas apresentaram um aumento na biomassa total de até 1,6x em relação as plantas não inoculadas. *p-value < 0,05, **p-value < 0,01.

Os resultados de fenotipagem de plantas de soja inoculadas e não inoculadas com a comunidade sintética mantidas em três condições nutricionais distintas sugerem que os membros do inóculo sintético são capazes de interagir de forma benéfica com essas plantas e promover o crescimento vegetal independente da disponibilidade de nutrientes no meio, resultando no aumento do acúmulo de biomassa total de plantas inoculadas quando comparadas com plantas não inoculadas.

4.2 Padrão de colonização da comunidade microbiana sintética Através de ensaios de inoculação em plantas de soja e milho em condições nutricionais controladas utilizando uma comunidade microbiana sintética derivada do microbioma core da cana-de-açúcar, foi demonstrado que a presença do inóculo sintético é capaz de promover uma melhora significante no crescimento de ambas culturas estudadas. A

fim de compreender os fatores envolvidos no potencial da comunidade sintética em se estabelecer nos órgãos vegetais e promover o crescimento das plantas, nós buscamos desvendar o padrão de colonização e a abundância relativa dos grupos microbianos pertencentes ao inóculo sintético em plantas de soja e milho inoculadas e não inoculadas. Para isso, foi feito o sequenciamento do gene do rRNA 16S para identificação dos grupos de bactérias e do gene ITS2 para identificação dos grupos de fungos presentes em amostras de raiz, caule e folha dessas plantas. Os resultados de colonização em milho utilizando o gene do rRNA 16S mostraram que dentre os 20 grupos bacterianos pertencentes à comunidade sintética, 10 se destacaram como colonizadores robustos nos compartimentos exofítico de raiz e caule e endofítico de raiz de plantas inoculadas, apresentando um aumento significativo da sua abundância relativa nesses órgãos em relação às plantas não inoculadas (Anexo 9.1). De uma maneira geral, a microbiota natural encontrada em associação com o milho sofreu alterações na sua composição e distribuição em todos os órgãos avaliados, ocorrendo uma diminuição na abundância de alguns grupos em função de um aumento dos grupos pertencentes ao inóculo sintético (Anexo 9.1). O sequenciamento das bibliotecas 16S de amostras enriquecidas de microrganismos originadas dos órgãos de raiz, caule e folha de soja utilizando a plataforma Illumina HiSeq 2500 gerou um número total de reads de 109.570.631 (Tabela 4). Os relatórios de qualidade do sequenciamento foram gerados no formato FastQC e utilizados para checagem individual de cada amostra (dados não mostrados). As amostras de raiz, caule e folha geraram em média, respectivamente, 28.783.037, 38.702.253 e 42.085.341 de reads brutos. Após utilizar o pipeline automatizado para o processamento dos reads, foi obtido um total de 22.037.415 de reads filtrados (Tabela 4) que foram utilizados para etapa de clusterização em OTUs. Em média, foram obtidos 15.187.645 de reads filtrados para as amostras de raiz e 5.081.496 e 1.768.274 para amostras de caule e folha, respectivamente. Ao fim do processo de clusterização em OTUs, foram obtidas, inicialmente, 3046 OTUs distintas distribuídas entre todas as amostras. As OTUs foram filtradas e apenas aquelas que apresentaram abundância relativa > 0,3% por amostra foram consideradas para análise de colonização. Após o agrupamento de OTUs por condição nutricional, foram obtidas 191 OTUs distintas distribuídas ao longo dos órgãos vegetais de plantas inoculadas e não inoculadas mantidas na condição nutricional MS 1X (Tabela A1 – material apêndice). Para condição MS 1/2X, obteve-se um total de 199 OTUs (Tabela A2 – material apêndice) e para condição MS 1/4X foram obtidas 264 OTUs (Tabela A3 – material apêndice) distribuídas entre os órgãos vegetais.

Tabela 4 – Número de reads paired-end bruto e unmerged e número de sequências com primers não reconhecidos (Primers), de baixa qualidade, cloroplastos e mitocôndrias por amostra para o conjunto de dados de 16S de soja. Os reads demultiplexados foram introduzidos no pipeline automatizado de processamento de reads estabelecido por de Souza et al (2016). Reads unmerged e sequências de primers, de baixa qualidade e correspondentes a cloroplastos e mitocôndrias foram descartadas. Apenas os reads resultantes (Filtrados) foram utilizados para o processo de clusterização em OTUs.

Número de reads Amostra Paired-end Baixa Unmerged Primers Cloroplastos Mitocôndrias Filtrados bruto qualidade Raiz 4.800.501 481.315 1.058.706 765.981 17.538 8.166 2.468.795 - Caule 6.857.188 2.268.946 2.547.530 465.266 207.407 205.312 1.162.727

Não

inoculado Folha 6.420.866 1.692.075 3.203.399 356.296 686.722 153.799 328.575 Raiz 4.915.824 362.082 1.200.283 767.603 16.158 7.147 2.562.551 MS 1X Caule 6.852.792 2.150.902 2.785.695 458.324 236.811 254.951 966.109

Inoculado Folha 7.718.412 2.155.988 4.106.366 344.631 742.715 161.308 207.404 Raiz 4.971.872 380.980 1.112.107 761.420 46.691 6.966 2.663.708 -

Caule 6.774.427 2.564.574 2.792.726 319.803 206.262 156.658 734.404 Não

inoculado Folha 7.085.631 2.522.287 3.332.262 306.901 556.834 146.555 220.792 Raiz 4.300.626 317.969 961.354 699.953 21.738 5.476 2.294.136 MS 1/2X Caule 6.128.084 2.139.958 2.493.356 330.279 181.641 167.111 815.739

Inoculado Folha 7.676.921 2.769.740 3.809.609 256.615 611.574 101.485 127.898 Raiz 4.617.843 413.849 944.608 761.146 9.330 7.591 2.481.319 - Caule 6.341.088 2.375.228 2.735.689 275.809 187.032 160.029 607.301

Não

inoculado Folha 6.414.403 1.988.830 3.059.434 307.301 429.717 127.480 501.641 Raiz 5.176.371 451.978 1.105.735 890.973 5.685 4.864 2.717.136 MS 1/4X Caule 5.748.674 1.662.602 2.510.508 373.789 208.168 198.391 795.216

Inoculado Folha 6.769.108 1.932.421 3.616.719 279.606 462.935 95.463 381.964 Total 109.570.631 28.631.724 43.376.086 8.721.696 4.834.958 1.968.752 22.037.415

A partir do sequenciamento das amostras da solução inoculante utilizada nos ensaios de inoculação em soja, foi possível acessar as OTUs pertencentes à comunidade sintética e que foram inoculadas nas plantas. Ao fim do processo de filtragem das OTUs, foram identificadas 19 OTUs distintas pertencentes à comunidade sintética (Tabela 5). Dentre as 19 OTUs componentes do inóculo, uma OTU não apresentou classificação taxonômica confiável (valor de confiança > 0,8) a partir de filo, sendo referenciada apenas como OTU_2 e classificada como pertencente ao reino Bacteria (Tabela 5) para as discussões neste trabalho. Uma segunda OTU (OTU_1294) foi classificada com confiança apenas a nível de ordem, representando um

membro do grupo Bacillales (Tabela 5). Com isso, as OTUs 2 e 1294 não foram agrupadas para descrição e soma dos valores de abundância das famílias e gêneros encontrados ao longo dos órgãos vegetais nas três condições nutricionais avaliadas. Dentre as 17 OTUs restantes, 3 foram classificadas a nível de família, representando 2 membros do grupo Bacillaceae e um membro da família Caulobacteraceae (Tabela 5). 12 OTUs foram identificadas pertencentes aos diferentes gêneros Delftia, Ochrobactrum, Achromobacter, Brevundimonas, Rhizobium, Pseudomonas, Sphingomonas, Bradyrhizobium, Acinetobacter, Herbaspirillum, Methylobacterium e Burkholderia (Tabela 5). Por fim, duas OTUs foram descritas como representantes das espécies Stenotrophomomas e Xanthomonas (Tabela 5). A identificação taxonômica dessas OTUs permitiu a comparação com dados de anotação da CBC (Tabela 1) para validação dos grupos microbianos cultivados no preparo do inóculo. Apesar da classificação taxonômica de alguns grupos do inóculo apresentarem diferenças aos dados de anotação da coleção, dentre as 19 OTUs identificadas pertencentes ao inóculo sintético, a nível de família, apenas os grupos Brucellaceae, Alcaligenaceae, Moraxellaceae, Oxalobacteraceae e Methylobacteriaceae não foram encontrados anotados na CBC. Contudo, as respectivas ordens desses grupos estão presentes em pelo menos 1 poço utilizado para composição do inóculo sintético. A classificação de OTUs por pipelines automatizados de certa forma pode ser influenciada pelas ferramentas de bioinformática e os bancos de dados utilizados, principalmente acerca da atualização das informações depositadas nesses bancos, resultando em divergências entre classificações. Entretanto, parâmetros de qualidade do sequenciamento e filtros durante o processamento dos reads e montagem da Tabela de OTUs garantem a autenticidade dos dados gerados.

Tabela 5 - Classificação taxonômica e valores de confiança das OTUs pertencentes a comunidade sintética. As OTUs foram identificadas através do algoritmo SINTAX no software USEARCH utilizando o banco de dados SILVA. Conf., confiança.

OTU_ID Reino Conf. Filo Conf. Classe Conf. Ordem Conf. Família Conf. Gênero Conf. Espécie Conf.

OTU_35 Bacteria 1.0000 Firmicutes 1.0000 Bacilli 1.0000 Bacillales 0.9500 Bacillaceae 0.9300 Anaerobacillus 0.5700 Bacillus_gibsonii 0.0600 OTU_29 Bacteria 1.0000 Proteobacteria 1.0000 Betaproteobacteria 1.0000 Burkholderiales 1.0000 Comamonadaceae 1.0000 Delftia 0.8100 beta_proteobacterium_KNU3 0.0500 OTU_45 Bacteria 1.0000 Proteobacteria 0.9200 Alphaproteobacteria 0.9200 Rhizobiales 0.9200 Brucellaceae 0.8800 Ochrobactrum 0.8700 Ochrobactrum_sp._SCTS14 0.5900 OTU_1294 Bacteria 1.0000 Firmicutes 1.0000 Bacilli 1.0000 Bacillales 0.8000 Bacillaceae 0.7500 Bacillus 0.6500 Bacillus_thuringiensis_serovar_finitimus 0.1200 OTU_42 Bacteria 1.0000 Proteobacteria 1.0000 Betaproteobacteria 1.0000 Burkholderiales 1.0000 Alcaligenaceae 1.0000 Achromobacter 0.9400 Achromobacter_xylosoxidans 0.3300 OTU_23 Bacteria 1.0000 Firmicutes 1.0000 Bacilli 1.0000 Bacillales 0.9900 Bacillaceae 0.8500 Bacillus 0.7600 Bacillus_cohnii 0.3000 OTU_34 Bacteria 1.0000 Proteobacteria 1.0000 Alphaproteobacteria 1.0000 Caulobacterales 1.0000 Caulobacteraceae 1.0000 Brevundimonas 0.9800 Brevundimonas_sp._SMXB12 0.2100 OTU_12 Bacteria 1.0000 Proteobacteria 1.0000 Alphaproteobacteria 1.0000 Rhizobiales 1.0000 Rhizobiaceae 0.9900 Rhizobium 0.9900 Agrobacterium_tumefaciens 0.5100 OTU_36 Bacteria 1.0000 Proteobacteria 1.0000 Gammaproteobacteria 1.0000 Pseudomonadales 1.0000 Pseudomonadaceae 1.0000 Pseudomonas 1.0000 Pseudomonas_sp._FSB 0.2600 OTU_2 Bacteria 1.0000 Proteobacteria 0.7500 Gammaproteobacteria 0.7500 Enterobacteriales 0.7500 Enterobacteriaceae 0.7500 Escherichia-Shigella 0.6900 unidentified 0.2500 OTU_923 Bacteria 1.0000 Proteobacteria 1.0000 Gammaproteobacteria 1.0000 Xanthomonadales 1.0000 Xanthomonadaceae 1.0000 Stenotrophomonas 1.0000 Stenotrophomonas_sp._AHL_1 0.8800 OTU_16 Bacteria 1.0000 Proteobacteria 1.0000 Alphaproteobacteria 1.0000 Sphingomonadales 1.0000 Sphingomonadaceae 0.9900 Sphingomonas 0.9900 Sphingomonas_sp._AHM7 0.2300 OTU_117 Bacteria 1.0000 Proteobacteria 1.0000 Alphaproteobacteria 1.0000 Caulobacterales 1.0000 Caulobacteraceae 1.0000 Phenylobacterium 0.0300 Phenylobacterium_sp._P-28 0.0200 OTU_20 Bacteria 1.0000 Proteobacteria 1.0000 Alphaproteobacteria 1.0000 Rhizobiales 1.0000 Bradyrhizobiaceae 1.0000 Bradyrhizobium 1.0000 Bradyrhizobium_sp._[ex_Lupinus] 0.6100 OTU_647 Bacteria 1.0000 Proteobacteria 1.0000 Gammaproteobacteria 1.0000 Xanthomonadales 1.0000 Xanthomonadaceae 1.0000 Xanthomonas 1.0000 Xanthomonas_gardneri 1.0000 OTU_93 Bacteria 1.0000 Proteobacteria 1.0000 Gammaproteobacteria 1.0000 Pseudomonadales 1.0000 Moraxellaceae 1.0000 Acinetobacter 1.0000 Acinetobacter_junii 0.4300 OTU_133 Bacteria 1.0000 Proteobacteria 1.0000 Betaproteobacteria 1.0000 Burkholderiales 1.0000 Oxalobacteraceae 0.9700 Herbaspirillum 0.9400 Sclerotinia_homoeocarpa 0.3600 OTU_10 Bacteria 1.0000 Proteobacteria 1.0000 Alphaproteobacteria 1.0000 Rhizobiales 1.0000 Methylobacteriaceae 1.0000 Methylobacterium 1.0000 Methylobacterium_radiotolerans 0.5800 OTU_11 Bacteria 1.0000 Proteobacteria 1.0000 Betaproteobacteria 1.0000 Burkholderiales 1.0000 Burkholderiaceae 1.0000 Burkholderia 1.0000 Burkholderia_sp._UYPR1.3 0.3900

A fim de desvendar os fatores biológicos envolvidos no processo de colonização de comunidades microbianas encontradas em associação com plantas e as contribuições desses microrganismos para o crescimento vegetal, nós buscamos identificar quais grupos de bactérias são mais abundantes e representativos nos órgãos de raiz, caule e folha de plantas de soja. Dentre as 191 OTUs identificadas em plantas de soja inoculadas e não inoculadas com a comunidade sintética, mantidas com solução nutritiva MS 1X, 180 apresentaram classificação taxonômica confiável a nível de família, representando 65 famílias distintas distribuídas entre os órgãos vegetais nesta condição. De acordo com os dados encontrados na Tabela 6, membros das famílias Rhizobiaceae, Burkholderiaceae e Oxalobacteraceae representam, nesta ordem, os grupos mais abundantes encontrados na raiz e no caule de plantas não inoculadas, somando, juntos, por 53% da abundância relativa total de microrganismos identificados na raiz e 42,8% no caule. Nas folhas de plantas não inoculadas, as famílias Xanthomonadaceae, Rhizobiaceae e Burkholderiacae representam, nesta ordem, os grupos mais abundantes nessa condição. Juntos, eles somam por 46% da abundância relativa total de microrganismos identificados neste órgão, no qual a família Xanthomonadaceae representa, sozinha, 27,3% da abundância relativa total. Em contrapartida, em plantas inoculadas, os grupos Rhizobiaceae, Xanthomonadaceae e Burkholderiaceae representam, nesta ordem, as famílias mais abundantes encontradas na raiz, somando ~45% da abundância relativa total de microrganismos encontrados neste órgão. Quando comparada às plantas não inoculadas, a abundância relativa total de membros representantes de Xanthomonadaceae apresentou um aumento de 1,4 vezes neste órgão, enquanto Burkholderiaceae e Oxalobacteraceae tiveram uma diminuição da sua abundância relativa de 30% e ~50%, respectivamente. Nos órgãos de caule e folha de plantas inoculadas, a família Xanthomonadaceae foi o grupo mais abundante. Entretanto, não foi observada uma predominância desse grupo em relação à outras famílias, ocorrendo uma distribuição semelhante de membros pertencentes a família Xanthomonadaceae, Bacillaceae e Rhizobiaceae no caule e Xanthomonadaceae, Rickettsiaceae e Rhizobiaceae na folha.

Tabela 6 – Classificação taxonômica, abundância relativa média por órgão e proporção da abundância relativa média em plantas inoculadas com a comunidade sintética sobre não inoculadas de 20 famílias encontradas em plantas de soja mantidas em condição MS 1X.

Não inoculado Inoculado Proporção inoc. / não inoc. Família Raiz Caule Folha Raiz Caule Folha Raiz Caule Folha Rhizobiaceae 0,1886 0,2020 0,1043 0,1828 0,1162 0,0939 0,9693 0,5755 0,9003 Burkholderiaceae 0,1869 0,1137 0,0830 0,1325 0,0497 0,0616 0,7090 0,4368 0,7423 Oxalobacteraceae 0,1548 0,1128 0,0388 0,0751 0,0152 0,0306 0,4855 0,1347 0,7869 Xanthomonadaceae 0,0948 0,0544 0,2735 0,1331 0,1382 0,1494 1,4035 2,5397 0,5464 Micrococcaceae 0,0770 0,0387 0,0249 0,0432 0,0089 0,0165 0,5602 0,2298 0,6630 Sphingomonadaceae 0,0561 0,0468 0,0181 0,0403 0,0517 0,0192 0,7180 1,1051 1,0617 Methylobacteriaceae 0,0388 0,0664 0,0161 0,0455 0,0155 0,0187 1,1745 0,2332 1,1592 Microbacteriaceae 0,0298 0,0120 0,0083 0,0291 0,0060 0,0039 0,9750 0,5013 0,4633 Caulobacteraceae 0,0192 0,0264 0,0140 0,0000 0,0311 0,0264 0,0000 1,1772 1,8860 Comamonadaceae 0,0179 0,0778 0,0775 0,0398 0,0407 0,0894 2,2242 0,5230 1,1534 Enterobacteriaceae 0,0165 0,0294 0,0354 0,0643 0,0169 0,0163 3,9094 0,5770 0,4608 Bradyrhizobiaceae 0,0154 0,0132 0,0104 0,0136 0,0069 0,0109 0,8788 0,5237 1,0459 Paenibacillaceae 0,0149 0,0030 0,0049 0,0038 0,0663 0,0016 0,2522 22,4562 0,3325 Sphingobacteriaceae 0,0147 0,0327 0,0535 0,0192 0,0226 0,0339 1,3068 0,6918 0,6336 Cytophagaceae 0,0045 0,0044 0,0008 0,0079 0,0030 0,0008 1,7572 0,6813 1,0602 Phyllobacteriaceae 0,0040 0,0000 0,0000 0,0020 0,0008 0,0018 0,5111 0,0008 0,0018 Streptomycetaceae 0,0026 0,0000 0,0095 0,0536 0,0008 0,0088 20,3677 0,0008 0,9262 Pseudomonadaceae 0,0026 0,0644 0,0258 0,0046 0,0127 0,0282 1,7382 0,1979 1,0922 Bacillaceae 0,0000 0,0139 0,0643 0,0007 0,1220 0,0801 0,0007 8,7726 1,2459 Rickettsiaceae 0,0000 0,0000 0,0018 0,0000 0,0000 0,1055 0,0000 0,0000 59,2708

Dentre as 199 OTUs identificadas em plantas de soja inoculadas e não inoculadas com a comunidade sintética mantidas com solução nutritiva MS 1/2X, 181 apresentaram classificação taxonômica confiável a nível de família, representando 62 famílias distintas distribuídas entre os órgãos vegetais nesta condição. De acordo com os dados encontrados na Tabela 7, semelhante ao que foi encontrado na condição anterior, os grupos mais abundantes na raiz de plantas não inoculadas mantidas em condição nutricional MS 1/2X foram Oxalobacteraceae, Burkholderiaceae e Rhizobiaceae e representam, juntos, 54,7% da abundância relativa total de microrganismos identificados neste órgão. Não observamos no caule dessas plantas a predominância de alguma família específica, no qual membros dos grupos Rhizobiaceae, Xanthomonadaceae e Burkholderiaceae representam os grupos mais abundantes neste órgão, com representatividade semelhantes, e somam por 38% da abundância

relativa total de microrganismos. Nas folhas de plantas não inoculadas, a família Rickettsiaceae representa, sozinha, 18,4% da abundância relativa total de microrganismos. Somada a membros das famílias Comamonadaceae e Bacillaceae, elas representam os grupos mais abundantes neste órgão. Em plantas inoculadas com a comunidade sintética, nós observamos uma predominância da família Oxalobacteraceae na raiz, que apresenta abundância relativa total neste órgão de 26%. Oxalobacteraceae, Xanthomonadaceae e Burkholderiaceae, nesta ordem, são os grupos mais abundantes neste órgão e somam por 51,6% da abundância relativa total de microrganismos encontrados nesta condição. Nos órgãos de caule e folha dessas plantas, não observamos a predominância de um grupo específico. Contudo, membros da família Xanthomonadaceae, Rhizobiaceae e Burkholderiaceae representam os grupos mais abundantes no caule, e as famílias Comamonadaceae, Bacillaceae e Burkholderiaceae nas folhas. Em ambos os órgãos, esses três grupos mais representativos somam por 32,5% da abundância relativa total de microrganismos identificados nesta condição.

Tabela 7 – Classificação taxonômica, abundância relativa média por órgão e proporção da abundância relativa média em plantas inoculadas com a comunidade sintética sobre não inoculadas de 20 famílias encontradas em plantas de soja mantidas em condição MS 1/2X.

Não inoculado Inoculado Proporção inoc. / não inoc Família Raiz Caule Folha Raiz Caule Folha Raiz Caule Folha Rhizobiaceae 0,1548 0,1502 0,0629 0,1093 0,1162 0,0797 0,7064 0,7738 1,2657 Burkholderiaceae 0,1808 0,1112 0,0442 0,1169 0,0738 0,0806 0,6465 0,6635 1,8228 Oxalobacteraceae 0,2119 0,0905 0,0431 0,2595 0,0612 0,0592 1,2245 0,6758 1,3741 Xanthomonadaceae 0,0946 0,1198 0,0740 0,1406 0,1353 0,0775 1,4861 1,1290 1,0469 Micrococcaceae 0,0408 0,0408 0,0106 0,0031 0,0078 0,0110 0,0760 0,1912 1,0332 Sphingomonadaceae 0,0501 0,0339 0,0234 0,0187 0,0497 0,0226 0,3733 1,4670 0,9667 Methylobacteriaceae 0,0480 0,0284 0,0146 0,0313 0,0166 0,0279 0,6509 0,5820 1,9188 Microbacteriaceae 0,0173 0,0018 0,0000 0,0033 0,0047 0,0019 0,1924 2,5921 0,0019 Caulobacteraceae 0,0049 0,0173 0,0265 0,0089 0,0291 0,0287 1,8218 1,6826 1,0832 Comamonadaceae 0,0142 0,0640 0,0946 0,0903 0,0595 0,1293 6,3659 0,9302 1,3666 Enterobacteriaceae 0,0254 0,0167 0,0759 0,0259 0,0155 0,0178 1,0212 0,9269 0,2351 Bradyrhizobiaceae 0,0271 0,0118 0,0058 0,0159 0,0116 0,0125 0,5865 0,9792 2,1806 Paenibacillaceae 0,0085 0,0350 0,0068 0,0000 0,0275 0,0033 0,0000 0,7861 0,4881 Sphingobacteriaceae 0,0474 0,0497 0,0282 0,0381 0,0538 0,0323 0,8043 1,0829 1,1430 Cytophagaceae 0,0117 0,0050 0,0000 0,0053 0,0028 0,0025 0,4507 0,5731 0,0025 Phyllobacteriaceae 0,0042 0,0021 0,0009 0,0007 0,0018 0,0000 0,1694 0,0018 0,0000 Streptomycetaceae 0,0000 0,0026 0,0049 0,0900 0,0017 0,0066 0,0900 0,0017 1,3558 Pseudomonadaceae 0,0029 0,0241 0,0771 0,0000 0,0228 0,0465 0,0000 0,9463 0,6030 Bacillaceae 0,0000 0,0437 0,0778 0,0000 0,0733 0,1148 0,0000 1,6773 1,4756 Rickettsiaceae 0,0000 0,0000 0,1840 0,0000 0,0000 0,0239 0,0000 0,0000 0,1299

Dentre as 264 OTUs identificadas em plantas de soja inoculadas e não inoculadas com a comunidade sintética mantidas com solução nutritiva MS 1/4X, 248 apresentaram classificação taxonômica confiável a nível de família, representando 75 famílias distintas distribuídas entre os órgãos vegetais nesta condição. De acordo com os dados encontrados na Tabela 8, seguindo o mesmo padrão observado nas condições anteriores, Rhizobiaceae, Oxalobacteraceae e Burkholderiaceae representam, nesta ordem, os grupos mais abundantes identificados na raiz de plantas não inoculadas e somam por 50,7% da abundância relativa total de microrganismos neste órgão. Já nas raízes de plantas inoculadas com a comunidade sintética, os grupos Xanthomonadaceae, Oxalobacteraceae e Comamonadaceae são os grupos mais abundantes e somam por 51,4% da abundância relativa total de microrganismos identificados neste órgão, nesta condição. No caule de plantas não inoculadas, conforme observado na

condição MS 1/2X, os grupos Rhizobiaceae, Xanthomonadaceae e Burkholderiaceae representam as famílias mais abundantes e abundâncias relativas no órgão semelhantes. Juntos, somam por 33,8% da abundância relativa total de microrganismos encontrados no caule. Em folhas de plantas não inoculadas mantidas em condição nutricional MS 1/4X observamos um padrão distinto de grupos de famílias ao que foi observado nas condições MS 1X e 1/2X. Membros das famílias Caulobacteraceae, Sphingobacteraceae e Methylobacteraceae representam os grupos mais abundantes nesta condição com uma prevalência da família Caulobacteraceae, que soma por ~3 vezes mais em relação às outras famílias. No caule de plantas inoculadas, Rhizobiaceae, Comamonadaceae e Xanthomonadaceae representam os grupos mais abundantes e valores de abundância semelhantes. Juntos, representam 34,3% da abundância relativa de microrganismos identificados neste órgão. Nas folhas de plantas inoculadas, nesta condição, nós encontramos uma predominância da família Staphylococcaceae que representa, sozinha, 28% da abundância relativa total de microrganismos. Em sequência, Comamonadaceae, conforme observado nas outras condições, e Xanthomonadaceae foram os grupos mais representativos na folha, representando, juntos, 15% da abundância relativa total de microrganismos nas folhas de plantas inoculadas.

Tabela 8 – Classificação taxonômica, abundância relativa média por órgão e proporção da abundância relativa média em plantas inoculadas com a comunidade sintética sobre não inoculadas de 20 famílias encontradas em plantas de soja mantidas em condição MS 1/4X.

Não inoculado Inoculado Proporção inoc. / não inoc Família Raiz Caule Folha Raiz Caule Folha Raiz Caule Folha Rhizobiaceae 0,1808 0,1308 0,0550 0,1244 0,1264 0,0358 0,6882 0,9668 0,6511 Burkholderiaceae 0,1486 0,0994 0,0222 0,0802 0,0808 0,0348 0,5397 0,8128 1,5685 Oxalobacteraceae 0,1783 0,0640 0,0272 0,1860 0,0601 0,0269 1,0431 0,9399 0,9876 Xanthomonadaceae 0,0327 0,1086 0,0201 0,1936 0,1009 0,0681 5,9276 0,9283 3,3808 Micrococcaceae 0,0168 0,0667 0,0167 0,0000 0,0208 0,0059 0,0000 0,3113 0,3522 Sphingomonadaceae 0,0662 0,0362 0,0555 0,0156 0,0668 0,0208 0,2354 1,8467 0,3756 Methylobacteriaceae 0,0865 0,0377 0,0592 0,0453 0,0310 0,0109 0,5237 0,8224 0,1833 Microbacteriaceae 0,0000 0,0029 0,0038 0,0000 0,0000 0,0046 0,0000 0,0000 1,2163 Caulobacteraceae 0,0107 0,0129 0,1567 0,0064 0,0138 0,0388 0,5941 1,0700 0,2474 Comamonadaceae 0,0580 0,0897 0,0582 0,1345 0,1160 0,0815 2,3179 1,2931 1,4011 Enterobacteriaceae 0,0038 0,0207 0,0171 0,0054 0,0249 0,0206 1,4161 1,2016 1,2045 Bradyrhizobiaceae 0,0212 0,0129 0,0351 0,0140 0,0113 0,0063 0,6575 0,8806 0,1786 Paenibacillaceae 0,0124 0,0130 0,0000 0,0017 0,0039 0,0008 0,1347 0,3032 0,0008 Sphingobacteriaceae 0,0372 0,0359 0,0594 0,0698 0,0537 0,0141 1,8785 1,4959 0,2374 Cytophagaceae 0,0090 0,0020 0,0009 0,0054 0,0031 0,0000 0,5969 1,5805 0,0000 Phyllobacteriaceae 0,0041 0,0000 0,0039 0,0012 0,0009 0,0000 0,2879 0,0009 0,0000 Streptomycetaceae 0,0000 0,0034 0,0000 0,0824 0,0079 0,0050 0,0824 0,0079 0,0050 Pseudomonadaceae 0,0022 0,0405 0,0253 0,0000 0,0561 0,0257 0,0000 1,3854 1,0160 Bacillaceae 0,0000 0,0242 0,0561 0,0000 0,0264 0,0633 0,0000 1,0909 1,1283 Staphylococcaceae 0,0000 0,0153 0,0025 0,0000 0,0042 0,2796 0,0000 0,2745 111,8400

De uma maneira geral, para as três condições nutricionais avaliadas, as famílias Rhizobiaceae, Burkholderiaceae, Oxalobacteraceae e Xanthomonadaceae foram os grupos mais abundantes identificados nas raízes e caules tanto de plantas inoculadas como não inoculadas. Nas raízes, juntos, esses grupos representam em média, nas três condições, mais que 50% da abundância relativa total de microrganismos encontrados neste órgão. Já no caule podemos notar que, apesar de ainda serem os grupos mais abundantes, os valores de abundância são melhores distribuídos entre as famílias, sendo que a representatividade desses quatro grupos juntos corresponde a 33-42% da abundância relativa total de microrganismos neste órgão. Esses resultados sugerem que ocorra um favorecimento no estabelecimento de membros pertencentes especificamente a essas famílias nos órgãos da raiz e caule de plantas de soja. Entretanto, em relação aos grupos mais abundantes identificados nas folhas da soja, notamos que ocorre uma

maior diversidade de famílias nas três condições nutricionais avaliadas. Não foi observado um padrão de distribuição entre os tratamentos, conforme encontrado nas condições MS 1X e 1/2X, ou grupos predominantes tanto nas plantas inoculadas como não inoculadas. Com o objetivo de investigar se os microrganismos pertencentes à comunidade sintética são capazes de colonizar os tecidos da soja com alta eficiência, nós comparamos a significância da variação da abundância relativa das OTUs pertencentes ao inóculo em plantas inoculadas em relação às plantas não inoculadas. Esses resultados mostraram que, nas três condições nutricionais avaliadas, nenhuma OTU identificada como pertencente ao inóculo sintético foi capaz de colonizar um órgão vegetal com robustez, efeito contrário ao que obtivemos em estudos com milho. Contudo, na condição nutricional MS 1/2X, dois membros pertencentes ao inóculo representantes da família Bacillaceae e dois representantes dos gêneros Delftia e Ochrobactrum apresentaram um aumento considerável da sua abundância relativa na folha das plantas inoculadas quando comparadas as plantas não inoculadas (Figura 8). De uma maneira geral, apesar de não observamos um aumento significativo na abundância relativa dos membros pertencentes ao inóculo sintético nas plantas inoculadas, nas três condições nutricionais avaliadas, ocorre uma alteração na distribuição, composição e abundância de grupos microbianos naturalmente encontrados nos diferentes órgãos da soja. Nós observamos que algumas OTUs pertencentes à microbiota natural da soja que possuem uma baixa abundância em plantas não inoculadas, apresentam um aumento na sua abundância em plantas inoculadas. Este efeito pode ser observado no principalmente no caule de plantas mantidas em condição nutricional MS 1X (Figura 9) e 1/2X (Figura 8) que, na presença do inóculo sintético, parecem favorecer o estabelecimento de alguns membros que são pouco abundantes nas plantas não inoculadas (Figura 9). Na condição MS 1X, este efeito não é diretamente proporcional a alterações na abundância de membros da comunidade sintética (Figura 9). Curiosamente, em condições nutricionais restritas MS 1/4X, ao contrário do que foi observado para as outras condições, membros da microbiota natural da soja encontrados nas folhas de plantas não inoculadas parecem ser mais negativamente afetados pela presença do inóculo sintético, apresentando uma grande diminuição nas suas abundâncias em plantas inoculadas (Figura 10). Simultaneamente, nesta mesma condição, algumas OTUs pertencentes ao inóculo sintético parecem colonizar as folhas das plantas inoculadas com maior eficácia (Figura 10).

Figura 8 – Heatmap da abundância relativa das OTUs identificas nos órgãos de plantas de soja inoculadas e não inoculadas com a comunidade sintética mantidas com solução nutritiva MS 1/2X. (A) Escala de cores estabelecida por colunas. (B) Escala de cores estabelecida por linhas. As OTUs pertencentes a comunidade sintética e sua classificação taxonômica a nível de gênero estão destacadas a direita. Abd.: abundância; rel.: relativa.

Figura 9 - Heatmap da abundância relativa das OTUs identificas nos órgãos de plantas de soja inoculadas e não inoculadas com a comunidade sintética mantidas com solução nutritiva MS 1X. (A) Escala de cores estabelecida por colunas. (B) Escala de cores estabelecida por linhas. As OTUs pertencentes a comunidade sintética e sua classificação taxonômica a nível de gênero estão destacadas a direita. Abd.: abundância; rel.: relativa.

Figura 10 – Heatmap da abundância relativa das OTUs identificadas nos órgãos de plantas de soja inoculadas e não inoculadas com a comunidade sintética mantidas com solução nutritiva MS 1/4X. (A) Escala de cores estabelecida por colunas. (B) Escala de cores estabelecida por linhas. As OTUs pertencentes a comunidade sintética e sua classificação taxonômica a nível de gênero estão destacadas a direita. Abd.: abundância; rel.: relativa.

O sequenciamento das bibliotecas ITS de amostras enriquecidas de microrganismos originados de raiz, caule e folha de plantas de soja utilizando a plataforma Illumina HiSeq 2500 gerou um número total de reads de 161.392.182 (Tabela 9). Os relatórios de qualidade do sequenciamento foram gerados no formato FastQC e utilizados para checagem individual de cada amostra (dados não mostrados). Após utilizar o pipeline automatizado para o processamento dos reads, foi obtido um total de 66.344.799 de reads filtrados (Tabela 9) que foram utilizados para etapa de clusterização em OTUs.

Tabela 9 – Número de reads paired-end bruto, unmerged, de baixa qualidade e com primers não reconhecidos por amostra para o conjunto de dados de ITS de soja. Os reads demultiplexados foram introduzidos no pipeline automatizado de processamento de reads estabelecido por Souza et al (2016). Paired-end bruto indica a soma de reads R1 e R2. Reads unmerged e sequências de baixa qualidade e com primers não reconhecidos foram descartadas. Os reads resultantes (Filtrados) foram utilizados para clusterização em OTUs.

Número de reads

Amostra Paired-end Baixa Unmerged Primers Filtrados bruto qualidade

Raiz 13480450 7270711 344384 413273 5452082 - Caule 6580390 3434126 175895 190806 2779563

Não

inoculado Folha 6640632 3445508 183486 214095 2797543

Raiz 8610172 4516057 246124 469163 3378828 MS 1X Caule 6224538 3260163 162071 145208 2657096

Inoculado Folha 8118694 4188744 248143 406472 3275335

Raiz 17487650 9130806 491355 853434 7012055 -

Caule 11125402 5752236 328276 241171 4803719 Não

inoculado Folha 8237932 4396631 178077 129061 3534163

Raiz 6563626 3444733 178536 305976 2634381 MS 1/2X Caule 8744238 4510032 259800 237220 3737186

Inoculado Folha 10792384 5591394 312616 600227 4288147 Raiz 12869272 6734851 334965 637149 5162307 - Caule 7830628 4031167 237441 287525 3274495

Não

inoculado Folha 7281626 3747701 219088 215049 3099788

Raiz 7581444 3973451 190411 237424 3180158 MS 1/4X Caule 6747450 3536745 176533 271478 2762694

Inoculado Folha 6475654 3344268 186911 429216 2515259 161392182 84309324 4454112 6283947 66344799 Total

O sequenciamento das bibliotecas ITS de amostras de milho enriquecidas de microrganismos originadas dos compartimentos endofítico e exofítico dos órgãos de raiz, caule e folha de soja utilizando a plataforma Illumina HiSeq 2500 gerou um número total de reads de 120.553.298 (Tabela 10). Os relatórios de qualidade do sequenciamento foram gerados no formato FastQC e utilizados para checagem individual de cada amostra (dados não mostrados). Após utilizar o pipeline automatizado para o processamento dos reads, foi obtido um total de 51.820.779 de reads filtrados (Tabela 10) que foram utilizados para etapa de clusterização em OTUs.

Tabela 10 – Número de reads paired-end bruto, unmerged, de baixa qualidade e com primers não reconhecidos por amostra para o conjunto de dados de ITS de soja. Os reads demultiplexados foram introduzidos no pipeline automatizado de processamento de reads estabelecido por Souza et al (2016). Paired-end bruto indica a soma de reads R1 e R2. Reads unmerged e sequências de baixa qualidade e com primers não reconhecidos foram descartadas. Os reads resultantes (Filtrados) foram utilizados para clusterização em OTUs.

Número de reads Amostra Paired-end Baixa Unmerged Primers Filtrados bruto qualidade

Raiz 45763146 22984655 1604134 377354 20797003 -

Caule 4761694 3414769 96900 31849 1218176 Não

inoculado Folha 2219736 770501 104168 54493 1290574 Raiz 2485354 2482034 182 292 2846 Endofítico Caule 6991680 4721059 142848 325650 1802123

Inoculado Folha 5326116 2915125 154381 210612 2045998 Raiz 12937072 5978326 424305 697403 5837038 - Caule 7091476 3770243 234726 10501 3076006

Não

inoculado Folha 9905940 4667857 412595 534376 4291112

Raiz 18982 5726 873 462 11921 Exofítico Caule 8120688 3256607 328242 180483 4355356

Inoculado Folha 14931414 6782950 588651 467187 7092626 Total 120553298 61749852 4092005 2890662 51820779

Ao fim do processo de clusterização em OTUs foram obtidas, inicialmente, sem passar pelos passos de filtragem por abundância por amostra, 2067 OTUs distintas distribuídas entre os órgãos das amostras de soja e 2291 OTUs em milho. Os parâmetros de análise para o conjunto de dados gerados para as bibliotecas ITS de soja e milho estão sendo estabelecidos e padronizados para futuro processamento.

5. Discussão

5.1 A comunidade microbiana sintética induz uma melhora no crescimento de plantas de milho e soja

Há muitas décadas, microrganismos associados as plantas vem sendo estudados acerca das suas contribuições para o desenvolvimento vegetal. Tradicionalmente, esses trabalhos utilizam metodologias de isolamento de culturas microbianas para obtenção de microrganismos baseados na seleção de grupos que sabidamente desempenham funções relacionadas ao crescimento das plantas, como a fixação biológica de nitrogênio e produção de fitormônios. Entretanto, há poucas evidências que mostram que a presença de uma função promotora do crescimento vegetal esteja diretamente relacionada à representatividade de um microrganismo no órgão da planta. Ainda, o uso dessas metodologias limita os estudos em microbioma a uma pequena diversidade de grupos. Neste contexto, nos últimos anos, diversos trabalhos têm descrito a microbiota de diversas espécies de plantas através de metodologias de sequenciamento de amostras de DNA obtidas diretamente dos tecidos vegetais e do solo. O uso dessas metodologias tem revelado uma enorme diversidade e complexidade de associações de grupos de microrganismos aos órgãos das plantas desconhecidas até então. Contudo, ainda se faz necessário o desenvolvimento de métodos simples que permitam o acesso e manipulação de grupos específicos, independente da sua classificação taxonômica ou presença de uma função promotora do crescimento vegetal, a fim de desvendar seu papel biológico quando em associação com a planta. No âmbito do desenvolvimento de uma agricultura mais sustentável, estudos em microbioma tem se revelado como uma importante ferramenta para o desenvolvimento de tecnologias aplicadas na agricultura capazes de melhorar a produtividade de importantes cultivares. Com isso, trabalhos recentes têm utilizado comunidades microbianas sintéticas em ensaios de inoculação em condições controladas para avaliar os efeitos benéficos e a colonização de microrganismos em plantas de diferentes espécies. O uso de comunidades sintéticas tem a vantagem de agrupar funções desenvolvidas por diferentes grupos de microrganismos, redundantes ou não, que podem, juntas, impactar positivamente no desenvolvimento vegetal.

Neste trabalho, nós nos baseamos no conceito de abundância de grupos de microrganismos na planta para construção de uma comunidade microbiana sintética (Anexo 9.1), representativa dos grupos mais abundantes identificados na microbiota da cana-de-açúcar (de Souza et al., 2016), para ser testada em ensaios de inoculação. Para avaliar os efeitos da comunidade sintética no crescimento vegetal, nosso grupo de pesquisa utilizou milho como

modelo representante das monocotiledôneas devido a sua grande importância comercial e por ser filogeneticamente próximo a cana-de-açúcar. A presença do inóculo sintético resultou em uma melhora significativa no crescimento das plantas inoculadas em relação as não inoculadas, que tiveram um aumento de mais de 3 vezes nos seus pesos fresco e seco (Anexo 9.1). Ainda, as folhas das plantas inoculadas são visualmente mais verdes e vistosas e há um aumento do sistema radicular como um todo (Anexo 9.1).

A fim de avaliar o potencial da comunidade sintética em associar-se e promover o crescimento vegetal em diferentes culturas de importância econômica, nós escolhemos a soja como modelo representante das dicotiledôneas por apresentar características fisiológicas contrastantes tanto à cana quanto ao milho. Para avaliar o efeito da comunidade sintética em relação a capacidade das plantas em absorver nutrientes do meio, plantas de soja foram crescidas em três condições distintas de solução nutritiva, denominadas MS 1X, MS 1/2X e MS 1/4X. Os resultados de inoculação em plantas de soja mostraram que, nas três condições avaliadas, a comunidade sintética foi capaz de promover o crescimento de plantas inoculadas quando comparadas às plantas não inoculadas. As plantas inoculadas tiveram um aumento nos seus pesos fresco e seco e na área da raiz e da folha de até 1,6 vezes quando comparadas as plantas não inoculadas. Curiosamente, os efeitos no crescimento das plantas mantidas em condição nutricional mais restrita (MS 1/4X) parecem ser mais intensos em relação às outras condições. Esses resultados sugerem que a comunidade sintética seja capaz de interagir com as culturas de milho e soja estabelecendo relações benéficas e desempenhando funções intimamente relacionadas com a melhora na incorporação de nutrientes disponíveis no meio. Contudo, os resultados obtidos entre as diferentes concentrações de solução nutritiva indicam que o efeito positivo no crescimento da soja pode estar ocorrendo através de formas indiretas da presença do inóculo, como mecanismos ou fatores independentes da disponibilidade de nutrientes no meio. Ainda, esse efeito pode estar relacionado a alterações fisiológicas nessas plantas devido a exposição a uma condição estressante, como a restrição nutricional, podendo ativar vias e respostas contrastantes ao padrão encontrado em uma planta em homeostase. Essas alterações podem interferir diretamente na produção de moléculas envolvidas na manutenção do desenvolvimento vegetal e da microbiota associada, como por exemplo, os exsudados liberados na região da rizosfera, que são em parte responsáveis por modificações na estrutura microbiana deste órgão (Zak et al, 1994; Yang e Crowley, 2000). Nestas condições, as bactérias presentes no inóculo podem interagir com a planta ou responder a essas alterações de maneira

distinta em relação à dinâmica que ocorre em condições normais, induzindo respostas e mecanismos eficazes para melhorar o crescimento vegetal.

Ao comparar o efeito do inóculo sintético no crescimento dos modelos estudados, nós observamos que as plantas de milho apresentaram uma resposta mais robusta em relação ao crescimento observado na soja. A diferença na intensidade das respostas entre as espécies, quando inoculadas com uma mesma comunidade sintética, pode estar relacionada à presença de funções específicas desenvolvidas pelos membros dessa comunidade que foram selecionadas durante a co-evolução da microbiota/planta que, através de mecanismos ainda desconhecidos, favorecem o desempenho de plantas de milho quando em associação com esses grupos específicos. A eficiência dessas funções também pode estar relacionada a capacidade desses microrganismos em se adaptar e se estabelecer em diferentes nichos de acordo com a sua origem, pois essas bactérias foram naturalmente encontradas em associação com plantas de cana-de-açúcar, uma cultura filogeneticamente mais próxima ao milho do que da soja.

5.2 O padrão de colonização da comunidade sintética ocorre de maneira distinta em plantas de milho e soja

Comunidades microbianas sintéticas têm sido utilizadas no âmbito de estudos em microbioma para avaliar o potencial de microrganismos em associar-se com diferentes plantas e desempenhar funções benéficas para o crescimento e desenvolvimento vegetal. Através do sequenciamento de amostras de DNA total de plantas, é possível acessar os grupos de microrganismos, assim como a sua abundância, encontrados habitando os diferentes órgãos vegetais. Apesar de diversos estudos recentes estarem sendo desenvolvidos nesta área, ainda pouco se sabe sobre os reais mecanismos biológicos diretamente envolvidos na interação microbiota/planta e as funções moleculares desenvolvidas pelos microrganismos que beneficiem o crescimento de diferentes espécies vegetais. Neste contexto, o uso de bioinoculantes tem surgido como uma importante ferramenta biotecnológica aplicada à agricultura para compreender relações microrganismo/planta. O desenvolvimento de inoculantes com amplo espectro de ação pode impactar positivamente para o desenvolvimento de tecnologias originadas de microbiomas, além de permitir o acesso a informações biológicas relevantes para a melhor compreensão dos processos moleculares envolvidos na biologia da comunicação planta/microbiota.

A fim de desvendar o padrão de colonização e a abundância dos grupos microbianos pertencentes a comunidade sintética oriunda do microbioma core da cana-de-açúcar, foram acessados os grupos de bactérias presentes na raiz, caule e folha de plantas de milho e soja inoculadas com essa comunidade através do sequenciamento do gene do rRNA 16S. A análise do padrão de colonização de plantas de soja inoculadas e não inoculadas mostraram que os membros pertencentes ao inóculo sintético, apesar de apresentaram um aumento na sua representatividade em algumas condições, em geral não foram capazes de colonizar os órgãos da soja de maneira significativa e robusta conforme observado para alguns grupos em milho (Anexo 9.1). Apesar destes resultados se originarem de experimentos independentes, foi observado que em plantas de milho, dentre os 20 grupos identificados como pertencentes ao inóculo sintético utilizado em milho, 10 foram classificados como colonizadores robustos habitando os órgãos da raiz e caule (Anexo 9.1), pois apresentaram um aumento significativo da sua abundância em plantas inoculadas quando comparada com as plantas não inoculadas. Esses grupos foram identificados como pertencentes às famílias Chitinophagaceae, Comamonadaceae, Caulobacteraceae, Rhizobiaceae, Sphingobacteriaceae, Burkholderiaceae, Xanthomonadaceae e Streptomycetaceae e representam as famílias mais abundantes nas plantas de milho inoculadas (Anexo 9.1). Apesar de algumas sequências de genes 16S de grupos pertencentes a microbiota natural do milho e ao inóculo sintético terem sido agrupadas em uma mesma OTU, as bactérias naturalmente encontradas nessas plantas não foram eficientes em colonizar os tecidos e promover o crescimento vegetal (Anexo 9.1). Ainda que não observarmos diferenças significativas na composição das principais famílias pertencentes a microbiota de plantas de soja inoculadas e não inoculadas, dentre todas as famílias identificadas ao longo dos órgãos dessas plantas, membros dos grupos Comamonadaceae, Caulobacteraceae, Rhizobiaceae, Sphingobacteriaceae, Burkholderiaceae e Xanthomonadaceae representam as famílias mais abundantes encontradas nessa espécie, de forma semelhante ao que foi encontrado em milho. Embora os membros do inóculo sintético utilizado em soja não sejam colonizadores eficientes nessa espécie vegetal, ocorreu um aumento significativo na biomassa total dessas plantas, sugerindo que a presença da comunidade sintética e possivelmente funções relacionadas aos grupos mais abundantes encontrados nessas plantas possam estar atuando de maneira indireta para a melhora desenvolvimento vegetal neste modelo. Os resultados de colonização da comunidade sintética em milho e soja sugerem que funções potencialmente desempenhadas por grupos específicos de microrganismos pertencentes ao inóculo possam estar diretamente relacionadas a melhora no crescimento dessas plantas e estão ausentes nos grupos das microbiotas naturais dessas plantas.

Além da identificação dos colonizadores robustos na raiz e caule do milho, que induziram alterações no perfil da microbiota desses órgãos, foi observada uma grande alteração na microbiota natural do milho até mesmo em órgãos que não foram diretamente inoculados e não apresentaram colonizadores robustos (Anexo 9.1). No compartimento endofítico do caule e nas folhas de milho, membros naturalmente encontrados em associação com a planta tiveram uma diminuição significativa de sua abundância em favorecimento de OTUs pertencentes ao inóculo sintético (Anexo 9.1). O efeito sobre a composição e abundância de grupos naturalmente encontrados em associação com as plantas também foi observado na soja, contudo, alterações na microbiota natural dessa espécie não ocorreram de forma a privilegiar o aumento das OTUs pertencentes ao inóculo. Contrariamente, nós observamos que algumas OTUs com baixa abundância em plantas não inoculadas e que não pertencem ao inóculo sintético apresentaram um aumento relevante nas plantas inoculadas. Essas alterações se destacaram principalmente nos órgãos do caule e da folha da soja, e não na raiz como observado no milho.

A dinâmica da estrutura da microbiota e do estabelecimento de diferentes grupos de microrganismos pode estar influenciando indiretamente o aumento da biomassa da soja através de fatores ainda não conhecidos. Quando inoculados nas plantas, membros do inóculo sintético podem interagir com os grupos naturalmente presentes na soja e interferir nas relações intraespecíficas naturalmente estabelecidas, alterando a composição e capacidade de grupos específicos em se estabelecer e se multiplicar nos órgãos vegetais. Além disso, algumas características fisiológicas adversas entre os modelos, como o metabolismo fotossintético C4 da soja, podem influenciar diretamente na seleção, adaptação e desenvolvimento de grupos de microrganismos de forma diferente nessas plantas. Neste contexto, microrganismos potencialmente relevantes para melhorar o crescimento e desenvolvimento da soja conseguem, na presença do inóculo sintético, desempenhar suas funções com maior eficácia. Além disso, funções como a produção de fitormônios, pequenos peptídeos, moléculas envolvidas na manutenção da saúde dessas plantas, entre outras ainda desconhecidas, podem estar presentes nos membros da comunidade sintética e, quando presentes no meio, induzem uma melhora no crescimento vegetal. Curiosamente, as principais alterações na composição da microbiota da soja parecem estar relacionadas à disponibilidade de nutrientes no substrato. Em plantas de soja mantidas em condição nutricional rica MS 1X, a microbiota natural do caule parece ser mais influenciada, enquanto na condição MS 1/2X observamos maiores alterações nos perfis microbianos tanto do caule quanto da folha. Já em condições nutricionais mais restritas, parece

ocorrer uma maior supressão dos grupos naturais identificados nas folhas de plantas não inoculadas quando comparadas às inoculadas. Essa dinâmica pode estar sendo afetada por alterações moleculares que são diferencialmente reguladas quando em situação de estresse. Ainda não sabemos quais mecanismos podem estar envolvidos na dinâmica dessas interações, porém, tais resultados são de grande interesse para o nosso grupo de pesquisa. Acreditamos, parcimoniosamente, que desvendar o padrão de colonização de comunidades microbianas em associação com diferentes culturas de importância econômica podem revelar dados importantes acerca da biologia envolvida na interação microbiota/planta além de colaborar para o desenvolvimento de tecnologias baseadas em microbiomas para aplicação na agricultura.

6. Conclusões

O aumento da produtividade de culturas como a cana-de-açúcar, soja, o milho, entre muitas outras, se faz cada vez mais necessário para atender o consumo mundial. Estudos recentes têm aplicado seus esforços em busca de estratégias menos agressivas em relação ao demasiado uso de fertilizantes e agrotóxicos na agricultura. Neste contexto, o uso de comunidades microbianas no âmbito de investigar os mecanismos envolvidos na interação microbiota/planta e sua aplicação guiada para a promoção do crescimento e desenvolvimento vegetal têm se destacado nos últimos anos como uma alternativa importante para a agricultura sustentável. O uso de uma comunidade microbiana sintética composta pelos microrganismos mais abundantes nos órgãos da cana, baseados na hipótese de que a alta abundância e prevalência de grupos microbianos ao longo do desenvolvimento da planta possam estar intimamente relacionadas a funções bastante relevantes para o crescimento vegetal, resultou no impacto positivo no crescimento vegetal de duas culturas de grande importância econômica, o milho e a soja. Além do efeito benéfico no crescimento vegetal, a presença dessa comunidade induziu alterações relevantes na microbiota naturalmente associada aos órgãos dos modelos estudados, apresentando um padrão de alterações distinto entre as espécies e possivelmente influenciado pela disponibilidade de nutrientes no meio. O nicho contrastante estabelecido pelo milho e pela soja, assim como o padrão de exsudados dessas diferentes culturas, podem estar influenciando na seleção e estabelecimento de grupos microbianos específicos. Compreender os mecanismos moleculares envolvidos na dinâmica de distribuição e estabelecimento de microrganismos entre diferentes espécies vegetais é um passo importante para o desenvolvimento da agricultura e o uso de tecnologias baseadas na microbiota natural das plantas.

7. Referências

Amann RI, Ludwig W, Schleifer KH. Phylogenetic identification and in situ Detection of individual microbial cells without cultivation. Microbiol Ver, 15 (1): 143–169, 1995.

Armanhi JSL, de Souza RSC, Damasceno NB, de Araújo LM, Imperial J and Arruda P. A community-based culture collection for targeting novel plant growth-promoting bacteria from the sugarcane microbiome. Front Plant Sci, 8: 2191, 2018.

Armanhi JSL, Souza RSC, de Araújo LM, Okura VK, Mieczkowski P, Imperial R, Arruda P. Multiplex amplicon sequencing for microbe identification in community-based culture collections. Sci Rep, 6, 2016.

Arruda P. Genetically modified sugarcane for bioenergy generation. Cur Opin in Biotech, 23: 315–322, 2012.

Bai Y, Müller DB, Srinivas G, Garrido-Oter R, Potthoff E, Rott M, Dombrowski N, Münch PC, Spaepen S, Remus M, et al. Functional overlap of the Arabidopsis leaf and root microbiota. Nature, 528: 364-369, 2015.

Bais HP, Weir Tl, Perry LG, Gilroy S, Vivanco JM. The role of root exudates in rhizosphere interactions with plants and other organisms. Annu Rev Plant Biol, 57: 233–266, 2006.

Baldani JI, Reis VM, Baldani VLD, Döbereiner J. A brief story of nitrogen fixation in sugarcane – reason for success in Brazil. Funct Plant BiolI, 29: 417-423, 2002.

Baldani JI, Caruso L, Baldani, VLD, Goi SR, Döbereiner J. Recent advances in BNF with non-legume plants. Soil Bio and Biochem, 29: 911-922, 1997.

Berbee, ML. The phylogeny of plant and animal pathogens in the Ascomycota. Physiol Mol Plant Pathol, 59: 165-187, 2001.

Berendsen RL, Pieterse CMJ, Bakker PAHM. The rhizosphere microbiome and plant health. Trends Plant Sci, 17 (8): 478-486, 2012.

Berg G, Zachow C, Müller H, Philipps J, Tilcher R. Next-Generation bio-products sowing the seeds of success for sustainable sgriculture. Agronomy 3: 648-656, 2013.

Bhattacharjee RB, Singh A, Mukhopadhyay SN. Use of nitrogen-fixing bacteria as biofertilizer for non-legumes: prospects and challenges. Appl Microbiol Biotechnol, 80: 199- 209, 2008.

Boddey RM, Oliveira OC, Urquiaga S, Reis VM, Olivares FL, Baldani, VLD, Döbereiner J. Biological nitrogen fixation associated with sugar cane and rice: contributions and prospects for improvement. Plant and Soil 174: 195–209, 1995.

Bodenhausen N, Bortfeld-Miller M, Ackermann M, Vorholt JA. A synthetic community approach reveals plant genotypes affecting the phyllosphere microbiota. PLOS Genetics 10 (4): 1-12, 2014.

Bouffaud ML, Kyselkova M, Gouesnard B, Grundmann G, Muller D, Nne-Loccoz YM. Is diversification history of maize influencing selection of soil bacteria by roots? Molec Eco, 21: 195–206, 2012.

Buckler ES, Holland JB, Bradbury PJ, Acharya, CB, Brown PJ, Browne C, Ersoz E, Flint-Garcia1 S, Garcia A, Glaubitz JC, et al. The genetic architecture of maize flowering time. Science, 325: 714–718, 2009.

Bulgarelli D, Garrido-Oter R, Munch PC, Weiman A, Droge J, Pan Y, McHardy AC, Schulze-Lefert P. Structure and function of the bacterial root microbiota in wild and domesticated barley. Cell Host & Microbe 17: 392–403, 2015.

Bulgarelli D, Schlaeppi K, Spaepen S, van Themaat EVL, Schulze-Lefert P. Structure and functions of the bacterial microbiota of plants. Annu Rev Plant Biol, 64: 807-838, 2013.

Bulgarelli D, Rott M, Schlaeppi K, Themaat EVL, Ahmadinejad N, Assenza F, Rauf P, Huettel B, Reinhardt R, Schmelzer E, Peplies J, et al. Revealing structure and assembly cues for Arabidopsis root-inhabiting bacterial microbiota. Nature, 488: 91-95, 2012.

Carlsson‐Graener U, Thrall PH. The spatial distribution of plant populations, disease dynamics and evolution of resistance. OIKOS 97: 97–110, 2002.

Castiglioni P, Warner D, Bensen RJ, Anstrom DC, Harrison J, Stoecker M, Abad M, Kumar G, Salvador S, D'Ordine R, Navarro S, et al. Bacterial RNA chaperones confer abiotic stress tolerance in plants and improved grain yield in maize under water-limited conditions. Plant Physiol, 147 (2): 446–455, 2008.

Castrillo G, Teixeira PJPL, Paredes SH, Law TF, Lorenzo L, Feltcher ME, Finkel OM, Breakfield NW, Mieczkowski P, Jones CD, et al. Root microbiota drive direct integration of phosphate stress and immunity. Nature, 10, 2017.

Cavalcante VA, Döbereiner J. A new acid-tolerant nitrogen-fixing bacterium associated with sugarcane. Plant and Soil, 108: 23-31, 1988.

Clay K. Fungal endophytes of grasses: a defensive mutualism between plants and fungi. Ecology, 69: 10-16, 1988.

Clay K, Schardl C. Evolutionary origins and ecological consequences of endophyte symbiosis with grasses. Am Nat, 160 (4): 99-127, 2002.

Cole JR, Chai B, Farris RJ, Wang Q, Kulam SA, McGarrell DM, Garrity GM, Tiedje JM. The Ribossomal Database Project (RDP-II): sequences and tools for high- throughput rRNA analysis. Nucleic Acids Res, 33: D294-D296, 2005.

Coleman-Derr D, S G.Tringe. Building the crops of tomorrow: advantages of symbiont-based approaches to improving abiotic stress tolerance. Front in Microbiol, 5 (283): 1-6, 2014.

Compant S, Clement C, Sessitsch A. Plant growth-promoting bacteria in the rhizo- and endosphere of plants: their role, colonization, mechanisms involved and prospects for utilization. Soil Biol & Biochem, 42: 669-678, 2010.

Dakora FD, Phillips DA. Root exudates as mediators of mineral acquisition in low nutrient environments. Plant Soil, 245: 35–47, 2002

Delmotte N, Knief C, Chaffronb S, Innerebnera G, Roschitzkic B, Schlapbachc R, Meringb C, Vorholta JA. Community proteogenomics reveals insights into the physiology of phyllosphere bacteria. PNAS, 106 (38): 16428–33, 2009.

de Souza RSC, Okura VK, Armanhi JSL, Jorrin B, Lozano N, Silva MJ, González- Guerrero M, Araújo LM, Verza NC, Bagheri HC, Imperial R, Arruda P. Unlocking the bacterial and fungal communities assemblages of sugarcane microbiome. Sci Rep, 6, 2016.

Dierking EC, Bilyeu KD. Raffinose and stachyose metabolism are not required for efficient soybean seed germination. Jour Plant Phys, 166: 1329-35, 2009.

Döbereiner J, Day JM, Dart PJ. Nitrogenase activity and oxygen sensitivity of the Paspalum notatum-Azotobacter paspali association. Jour of Gen Microbiol, 71: 103-116, 1972.

Döbereiner J. Nitrogen-fixing bacteria of the genus Beijerinckia derx in the rhizosphere of sugar cane. Plant and Soil, 15: 211-216, 1961.

Dos-Santos CM, de Souza DG, Balsanelli E, Cruz LM, de Souza EM, Baldani JI e Schwab S. A culture-independent approach to enrich endophytic bacterial cells from sugarcane stems for community characterization. Microb Ecol, 74 (2): 453-465, 2017.

Douds DD, Millner PD. Biodiversity of arbuscular mycorrhizal fungi in agroecossystems. Agric Ecosyst Environ, 74: 77-93, 1999.

Edgar RC. SINTAX: a simple non-Bayesian taxonomy classifier for 16S and ITS sequences. bioRxiv, 74161, 2016.

Edgar RC. UPARSE: highly accurate OTU sequences from microbial amplicon reads. Nat Methods, 10: 996-998, 2013.

Gans J, Murray W, Dunbar J. Computational improvements reveal great bacterial diversity and high metal toxicity in soil. Science, 309: 1387-90, 2005.

Glick BR. The enhancement of plant growth by free-living bacteria. Can Jour Micrbiol, 41: 19-117, 1995.

Gomes NCM, Heuer H, Schönfeld J, Costa R, Mendonça-Hagler L, Smalla K. Bacterial diversity of the rhizosphere of maize (Zea mays) grown in tropical soil studied by temperature gradient gel electrophoresis. Plant and Soil 232: 167-180, 2001.

Gore MA, Chia J, Elshire RJ, Sun Q, Ersoz ES, Hurwitz BL, Peiffer JA, McMullen MD, Grills GS, Ross-Ibarra J, et al. A first-generation haplotype map of maize. Science 326: 1115–17, 2009.

Gottel NR, Castro HF, Kerley M, Yang Z, Pelletier DA, Podar M, Karpinets T, Uberbacher E, Tuskan GA, Vilgalys R. Distinct microbial communities within the endosphere and rhizosphere of Populus deltoides roots across contrasting soil types. App And Envir Microbiol, 77 (17): 5934–44, 2011.

Govindarajan M, Balandreau J, Kwon SW, Weon HY, Lakshminarasimhan C. Effects of the inoculation of Burkholderia vietnamensis and related endophytic diazotrophic bacteria on grain yield of rice. Microb Ecol 55: 21–37, 2008.

Haichar FEZ, Marol C, Berge O, Rangel-Castro JI, Prosser JI, Balesdent J, Heulin T, Achouak W. Plant host habitat and root exudates shape soil bacterial community structure. The ISME Jour, 2: 1221–30, 2008.

Hardoim PR, Overbeek LS, Elsas, JD. Properties of bacterial endophytes and their proposed role in plant growth. Trends in Microbiol, 16 (10): 463-471, 2008.

Hawksworth DL. The fungal dimension of biodiversity: magnitude, significance, and conservation. Mycol Res, 95 (6): 641-655, 1991.

Hoagland DR, Arnon DI. The water-culture method for growing plants without soil. The College of Agriculture, University of California, Berkeley, 1950.

Innerebner G, Knief C, Vorholt JA. Protection of Arabidopsis thaliana against leaf- pathogenic Pseudomonas syringae by Sphingomonas strains in a controlled model system. Appl Environ Microbiol, 77: 3202–10, 2011.

Jones DL, Nguyen C, Finlay RD. Carbon flow in the rhizosphere: carbon trading at the soil-root interface. Plant Soil, 321: 5–33, 2009.

Kereszt A, Li D, Indrasumunar A, Nguyen CDT, Nontachaiyapoom S, Kinkema M, Gresshoff PM. Agrobacterium rhizogenes-mediated transformation of soybean to study root biology. Nature Protocols, 2 (4): 948-952, 2007.

Knief C, Delmotte N, Chaffron S, Stark M, Innerebner G, Wassmann R, Mering C, Vorholt, JA. Metaproteogenomic analysis of microbial communities in the phyllosphere and rhizosphere of rice. The ISME Jour, 6: 1378–90, 2012.

Lebeis SL, Paredes SH, Lundberg DS, Breakfield N, Gehring J, McDonald M, Malfatti S, Del Rio TG, Jones CD, Tringe SG, Dangl JL. Salicylic acid modulates colonization of the root microbiome by specific bacterial taxa. Science express, 10: 1126, 2015.

Lindow SE e Brandl MT. Microbiology of the Phyllosphere. Appl Environ Microbial, 69 (4): 1875–83, 2003.

Lundberg DS, Lebeis SL, Paredes SH, Yourstone S, Gehring J, Malfatti S, Tremblay J, Engelbrektson A, Kunin V, Glavina del Rio T, et al. Defining the core Arabidopsis thaliana root microbiome. Nature, 488: 86-91, 2012.

Malinowski DP, Belesky DP. Neotyphodium coenophialum‐endophyte infection affects the ability of tall fescue to use sparingly available phosphorus. Jour of Plant Nutri, 22 (4-5): 835-853, 1999.

Mei C, Flinn BS. The use of beneficial microbial endophytes for plant biomass and stress tolerance improvement. Recent Patents on Biotech 4: 81-95, 2010.

Murashige T, Skoog F. A revised medium for rapid growth and bio assays with tobacco tissue cultures. Phys Plant, 15: 473-497, 1962.

Niu B, Paulsonb JN, Zhengb X, Koltera R. Simplified and representative bacterial community of maize roots. PNAS, 10: 1073, 2017.

Olivares FL, Baldani VLD, Reis VM, Baldani JI, Döbereiner J. Occurrence of the endophytic diazotrophs Herbaspirillum spp in roots, stems and leaves, predominantly of Gramineae. Biol Fertil Soils, 21: 197-200, 1996.

Peiffer JA, Sporb A, Korenb O, Jinb Z, Tringed SG, Dangle JL, Bucklera ES, Leyb RE. Diversity and heritability of the maize rhizosphere microbiome under field conditions. PNAS, 110 (16): 6548–53, 2013.

Petrini O. Fungal Endophytes of Tree Leaves. Micro Eco of Leaves, Cap 9: 179- 180, 1991.

Rinke C, Schwientek P, Sczyrba A, Ivanova NN, Anderson IJ, Cheng JF, Darling A, Malfatti S, Swan BK, Gies EA, et al. Insights into the phylogeny and coding potential of microbial dark matter. Nature, 499: 431-437, 2013.

Saikkonen K, Faeth SH, Helander M, Sullivan TJ. Fungal Endophytes: A continuum of interactions with host plants. Ann Rev Eco and Syst, 29: 319-343, 1998.

Timm CM, Pelletier DA, Jawdy SS, Gunter LE, Henning JA, Engle N, et al. Two poplar-associated bacterial isolates induce additive favorable responses in a constructed plant- microbiome system. Front Plant Sci, 7: 497, 2016.

Tringe SG, Mering CV, Kobayashi A, Slamov AA, Chen K, Chang HW, Podar M, Short JM, Mathur EJ, Detter JC, et al. Comparative metagenomics of microbial communities. Science, 308: 554-57, 2005.

Urquiaga S, Cruz KHS, Boddey RM. Contribution of nitrogen fixation to sugar cane: nitrogen-15 and nitrogen balance estimates. Soil Sci Soci of Ame Jour, 56: 105-114, 1992.

Weyens N, Lelie D, Taghavi S, Vangronsveld J. Phytoremediation: plant– endophyte partnerships take the challenge. Cur Opi Biotech, 20: 248–254, 2009.

Whipps JM, Hand P, Pink D, Bending GD. Phyllosphere microbiology with special reference to diversity and plant genotype. Jour of App Microbiol, 105: 1744–55, 2008.

Zhang H, Kim MS, Krishnamachari V, Payton P, Sun Y. Rhizobacterial volatile emissions regulate auxin homeostasis and cell expansion in Arabidopsis. Planta, 226: 839–851, 2007.

8. Apêndice

Tabela A1. Classificação taxonômica, valores de confiança e abundância relativa média por órgão das OTUs identificadas no conjunto de dados de 16S em plantas de soja não inoculadas e inoculadas mantidas com solução nutritiva MS 1X. A abundância relativa de uma determinada OTU por amostra foi obtida com base na quantidade normalizada de reads gerados para cada amostra pelo número total de reads. Os valores médios representam a média entre as amostras para cada órgão por tratamento (não inoculada e inoculada). Valores em parênteses indicam o valor de confiança da classificação taxonômica utilizando o banco de dados SILVA. k, reino; p, filo; c, classe; o, ordem; f, família; g, gênero; s, espécie.

Não Inoculado Inoculado Taxonomia OTU_ID Raiz Caule Folha Raiz Caule Folha k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Bacilli(1.0000),o:Bacillales(0.9500),f:Bacillaceae(0.9300),g:Anaerobacillus(0.5700),s:Bacillus_gibsonii(0.0600) OTU_35 0,00000 0,00884 0,04895 0,00000 0,01274 0,06316 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(1.0000),f:Comamonadaceae(1.0000),g:Delftia(0.8100),s:beta_proteobacterium_KNU3(0.0500) OTU_29 0,00000 0,01103 0,03995 0,00000 0,01306 0,04678 k:Bacteria(1.0000),p:Proteobacteria(0.9200),c:Alphaproteobacteria(0.9200),o:Rhizobiales(0.9200),f:Brucellaceae(0.8800),g:Ochrobactrum(0.8700),s:Ochrobactrum_sp._SCTS14(0.5900) OTU_45 0,00000 0,00297 0,01565 0,00000 0,00498 0,02150 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Bacilli(1.0000),o:Bacillales(0.8000),f:Bacillaceae(0.7500),g:Bacillus(0.6500),s:Bacillus_thuringiensis_serovar_finitimus(0.1200) OTU_1294 0,00000 0,00106 0,01564 0,00000 0,00230 0,01684 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(1.0000),f:Alcaligenaceae(1.0000),g:Achromobacter(0.9400),s:Achromobacter_xylosoxidans(0.3300) OTU_42 0,00000 0,00503 0,01354 0,00000 0,03452 0,01729 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Bacilli(1.0000),o:Bacillales(0.9900),f:Bacillaceae(0.8500),g:Bacillus(0.7600),s:Bacillus_cohnii(0.3000) OTU_23 0,00000 0,00526 0,01536 0,00000 0,10452 0,01696 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Caulobacterales(1.0000),f:Caulobacteraceae(1.0000),g:Brevundimonas(0.9800),s:Brevundimonas_sp._SMXB12(0.2100) OTU_34 0,01039 0,00555 0,01330 0,00000 0,01075 0,01928 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Rhizobiaceae(0.9900),g:Rhizobium(0.9900),s:Agrobacterium_tumefaciens(0.5100) OTU_12 0,09630 0,08258 0,03897 0,05592 0,02531 0,02824 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Pseudomonadales(1.0000),f:Pseudomonadaceae(1.0000),g:Pseudomonas(1.0000),s:Pseudomonas_sp._FSB(0.2600) OTU_36 0,00000 0,03168 0,02376 0,00000 0,01274 0,02674 k:Bacteria(1.0000),p:Proteobacteria(0.7500),c:Gammaproteobacteria(0.7500),o:Enterobacteriales(0.7500),f:Enterobacteriaceae(0.7500),g:Escherichia-Shigella(0.6900),s:unidentified(0.2500) OTU_2 0,02756 0,01803 0,01881 0,05243 0,01785 0,03680 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Xanthomonadales(1.0000),f:Xanthomonadaceae(1.0000),g:Stenotrophomonas(1.0000),s:Stenotrophomonas_sp._AHL_1(0.8800) OTU_923 0,00000 0,00000 0,00546 0,00000 0,00000 0,00686 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Sphingomonadales(1.0000),f:Sphingomonadaceae(0.9900),g:Sphingomonas(0.9900),s:Sphingomonas_sp._AHM7(0.2300) OTU_16 0,04503 0,02313 0,01687 0,03673 0,02473 0,01752 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Bradyrhizobiaceae(1.0000),g:Bradyrhizobium(1.0000),s:Bradyrhizobium_sp._[ex_Lupinus](0.6100) OTU_20 0,01542 0,01323 0,01045 0,01285 0,00600 0,01093 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Caulobacterales(1.0000),f:Caulobacteraceae(1.0000),g:Phenylobacterium(0.0300),s:Phenylobacterium_sp._P-28(0.0200) OTU_117 0,00000 0,00000 0,00070 0,00000 0,00000 0,00389 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Xanthomonadales(1.0000),f:Xanthomonadaceae(1.0000),g:Xanthomonas(1.0000),s:Xanthomonas_gardneri(1.0000) OTU_647 0,00000 0,00000 0,00525 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Pseudomonadales(1.0000),f:Moraxellaceae(1.0000),g:Acinetobacter(1.0000),s:Acinetobacter_junii(0.4300) OTU_93 0,00000 0,00424 0,00000 0,00000 0,00000 0,00087 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(1.0000),f:Oxalobacteraceae(0.9700),g:Herbaspirillum(0.9400),s:Sclerotinia_homoeocarpa(0.3600) OTU_133 0,00000 0,00000 0,00110 0,00000 0,00000 0,00139 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Methylobacteriaceae(1.0000),g:Methylobacterium(1.0000),s:Methylobacterium_radiotolerans(0.5800) OTU_10 0,02621 0,03494 0,01078 0,03144 0,01109 0,01210 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(1.0000),f:Burkholderiaceae(1.0000),g:Burkholderia(1.0000),s:Burkholderia_sp._UYPR1.3(0.3900) OTU_11 0,07666 0,02064 0,03390 0,09698 0,02310 0,03242 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(1.0000),f:Comamonadaceae(1.0000),g:Comamonas(0.8900),s:Comamonas_testosteroni(0.3100) OTU_33 0,00000 0,03117 0,01820 0,00000 0,00982 0,02166 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Xanthomonadales(1.0000),f:Xanthomonadaceae(1.0000),g:Stenotrophomonas(1.0000),s:Stenotrophomonas_maltophilia(0.9800) OTU_8 0,03658 0,02206 0,12890 0,01218 0,06346 0,04103

k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Bacilli(1.0000),o:Bacillales(1.0000),f:Staphylococcaceae(0.8800),g:Staphylococcus(0.8800),s:Staphylococcus_pasteuri(0.1400) OTU_14 0,00000 0,00436 0,00438 0,00000 0,00826 0,01720 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Neisseriales(1.0000),f:Neisseriaceae(1.0000) OTU_38 0,00000 0,00194 0,00100 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Pseudomonadales(1.0000),f:Moraxellaceae(1.0000),g:Moraxella(1.0000),s:Moraxella_osloensis(1.0000) OTU_54 0,00000 0,00395 0,00312 0,00000 0,01316 0,01320 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Enterobacteriales(1.0000),f:Enterobacteriaceae(1.0000),g:Enterobacter(0.8900),s:Enterobacter_cloacae(0.2900) OTU_15 0,01645 0,02937 0,03538 0,06267 0,01695 0,01630 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(1.0000),f:Comamonadaceae(1.0000),g:Ottowia(0.6000),s:Acidovorax_avenae(0.6000) OTU_7 0,01710 0,03074 0,01854 0,03984 0,01704 0,01998 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Corynebacteriales(1.0000),f:Corynebacteriaceae(1.0000) OTU_125 0,00000 0,00000 0,00080 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(1.0000),f:Burkholderiaceae(0.9900),g:Ralstonia(0.9900),s:Ralstonia_solanacearum(0.2300) OTU_5 0,09734 0,07972 0,02501 0,03552 0,01357 0,01779 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Bacilli(1.0000),o:Bacillales(1.0000),f:Planococcaceae(0.9900),g:Lysinibacillus(0.9200),s:Lysinibacillus_fusiformis(0.5100) OTU_2463 0,00000 0,00000 0,00133 0,00000 0,00368 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Oceanospirillales(1.0000),f:Halomonadaceae(1.0000),g:Halomonas(1.0000),s:Halomonas_ventosae(0.3600) OTU_173 0,00000 0,00000 0,00188 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Bacilli(1.0000),o:Lactobacillales(1.0000),f:Streptococcaceae(1.0000),g:Lactococcus(0.9800),s:Lactococcus_lactis(0.2300) OTU_153 0,00000 0,00000 0,00000 0,00000 0,00000 0,00267 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Rhizobiaceae(1.0000),g:Rhizobium(1.0000),s:Rhizobium_larrymoorei(0.9300) OTU_917 0,02167 0,01405 0,01338 0,03966 0,01046 0,01396 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Micrococcales(1.0000),f:Micrococcaceae(1.0000),g:Arthrobacter(1.0000),s:Arthrobacter_sp._110(1.0000) OTU_17 0,04915 0,02677 0,01900 0,00890 0,00649 0,01293 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Pseudomonadales(1.0000),f:Pseudomonadaceae(1.0000),g:Pseudomonas(1.0000),s:Pseudomonas_sp._PAI-A(0.6300) OTU_172 0,00000 0,00000 0,00000 0,00000 0,00000 0,00074 k:Bacteria(1.0000),p:Firmicutes(0.9800),c:Bacilli(0.9800),o:Bacillales(0.9800),f:Bacillaceae(0.9500),g:Bacillus(0.9500),s:Bacillus_cereus(0.3400) OTU_240 0,00000 0,00000 0,00000 0,00000 0,00472 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(1.0000),f:Oxalobacteraceae(0.9800),g:Massilia(0.9200),s:bacterium_38(0.2600) OTU_1 0,15002 0,06251 0,03286 0,07410 0,01520 0,02794 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Xanthomonadales(1.0000),f:Xanthomonadaceae(1.0000),g:Dyella(0.6200),s:Dyella_ginsengisoli(0.4700) OTU_19 0,01639 0,00356 0,00229 0,07182 0,00651 0,00836 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Negativicutes(1.0000),o:Selenomonadales(1.0000),f:Veillonellaceae(1.0000),g:Veillonella(1.0000),s:Veillonella_parvula(0.2000) OTU_218 0,00000 0,00000 0,00110 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Sphingobacteriia(1.0000),o:Sphingobacteriales(1.0000),f:Sphingobacteriaceae(1.0000),g:Sphingobacterium(1.0000),s:Sphingobacterium_siyangense(0.6300) OTU_68 0,00000 0,00251 0,00000 0,00099 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Xanthomonadales(1.0000),f:Xanthomonadaceae(1.0000),g:Lysobacter(1.0000),s:unidentified(0.6500) OTU_3 0,02748 0,02395 0,13004 0,03550 0,06125 0,09025 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Methylobacteriaceae(1.0000),g:Methylobacterium(1.0000),s:Methylobacterium_populi(0.4300) OTU_22 0,00884 0,02717 0,00533 0,00845 0,00440 0,00658 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Pseudomonadales(1.0000),f:Moraxellaceae(1.0000),g:Acinetobacter(1.0000),s:Acinetobacter_sp._MUB1(0.4300) OTU_116 0,00000 0,00000 0,00086 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Bacilli(1.0000),o:Lactobacillales(1.0000),f:Streptococcaceae(1.0000),g:Streptococcus(1.0000),s:Streptococcus_oralis(0.1900) OTU_58 0,00000 0,00998 0,00533 0,00000 0,00000 0,00230 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Rhizobiaceae(0.9800),g:Ensifer(0.9600),s:Sinorhizobium_fredii(0.9000) OTU_4 0,03901 0,05517 0,04061 0,08320 0,07627 0,04528 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Sphingobacteriia(1.0000),o:Sphingobacteriales(1.0000),f:Sphingobacteriaceae(1.0000),g:Pedobacter(0.9100),s:Bacteroidetes_bacterium_EC2(0.9100) OTU_6 0,00753 0,02639 0,05350 0,00961 0,02074 0,03273 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rickettsiales(1.0000),f:Rickettsiaceae(1.0000),g:Rickettsia(1.0000),s:Rickettsia_sp._PAR_[pea_aphid_rickettsia](0.9900) OTU_39 0,00000 0,00000 0,00178 0,00000 0,00000 0,10452 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Rhizobiaceae(1.0000),g:Rhizobium(1.0000),s:Rhizobium_straminoryzae(0.3800) OTU_13 0,02506 0,04251 0,01135 0,00325 0,00417 0,00643 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Micrococcales(1.0000),f:Microbacteriaceae(1.0000),g:Curtobacterium(0.9700),s:Curtobacterium_flaccumfaciens_pv._basellae(0.6200) OTU_30 0,02782 0,01195 0,00832 0,02908 0,00599 0,00386 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Streptomycetales(1.0000),f:Streptomycetaceae(1.0000),g:Streptomyces(0.7500),s:Streptomyces_sp._QLS01(0.3600) OTU_9 0,00263 0,00000 0,00953 0,05358 0,00077 0,00883 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Micrococcales(1.0000),f:Micrococcaceae(1.0000),g:Sinomonas(0.9500),s:Sinomonas_atrocyanea(0.9500) OTU_21 0,02004 0,00376 0,00586 0,03427 0,00241 0,00355 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(1.0000),f:Burkholderiaceae(0.9900),g:Limnobacter(0.9900),s:drinking_water_bacterium_MB16(0.1100) OTU_27 0,00000 0,01260 0,02409 0,00000 0,01300 0,01140 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Bacilli(1.0000),o:Bacillales(1.0000),f:Paenibacillaceae(1.0000),g:Paenibacillus(1.0000),s:Paenibacillus_sp._436-1(0.9600) OTU_43 0,00000 0,00000 0,00000 0,00000 0,04777 0,00000

k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(0.9900),o:Burkholderiales(0.9600),f:Oxalobacteraceae(0.9600),g:Massilia(0.9600),s:Janthinobacterium_sp._IARI-PL7(0.5400) OTU_159 0,00312 0,03366 0,00488 0,00000 0,00000 0,00123 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Pseudomonadales(1.0000),f:Pseudomonadaceae(1.0000),g:Pseudomonas(1.0000),s:Pseudomonas_sp._OK-5(0.9200) OTU_41 0,00262 0,03272 0,00000 0,00455 0,00000 0,00000 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Sphingobacteriia(1.0000),o:Sphingobacteriales(1.0000),f:Chitinophagaceae(1.0000),g:Niastella(1.0000),s:Niastella_populi(0.8800) OTU_32 0,00000 0,00081 0,00000 0,03027 0,00177 0,00000 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Pseudonocardiales(1.0000),f:Pseudonocardiaceae(1.0000),g:Actinophytocola(0.7200),s:Actinophytocola_sp._I10A-01801(0.3600) OTU_37 0,00000 0,00000 0,00000 0,00000 0,03191 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(0.9600),o:Sphingomonadales(0.9600),f:Sphingomonadaceae(0.9300),g:Sphingomonas(0.9200),s:bacterium_815Y(0.7700) OTU_291 0,00000 0,00147 0,00000 0,00000 0,02603 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rickettsiales(1.0000),f:Mitochondria(1.0000),g:Phytophthora_ramorum_[Sudden_oak_death_agent](0.7200) OTU_144 0,00000 0,00000 0,00773 0,00000 0,00000 0,01898 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Caulobacterales(1.0000),f:Caulobacteraceae(1.0000),g:Brevundimonas(1.0000),s:Brevundimonas_sp._N17(0.3800) OTU_51 0,00000 0,00093 0,00000 0,00000 0,02037 0,00217 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Hyphomicrobiaceae(1.0000),g:Devosia(1.0000),s:Devosia_subaequoris(0.7900) OTU_73 0,00927 0,00178 0,00079 0,00000 0,01161 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhodospirillales(1.0000),f:Rhodospirillaceae(1.0000),g:Azospirillum(1.0000),s:Azospirillum_brasilense(1.0000) OTU_47 0,00000 0,00000 0,00000 0,00000 0,02223 0,00000 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Bacilli(1.0000),o:Bacillales(1.0000),f:Planococcaceae(0.8600),g:Lysinibacillus(0.7800),s:Lysinibacillus_sphaericus(0.4300) OTU_64 0,00000 0,00000 0,00000 0,00000 0,02137 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Xanthomonadales(1.0000),f:Xanthomonadaceae(1.0000),g:Dyella(1.0000),s:Dyella_sp._JP1(0.8200) OTU_26 0,00538 0,00000 0,00000 0,01362 0,00000 0,00195 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Sphingobacteriia(1.0000),o:Sphingobacteriales(1.0000),f:Sphingobacteriaceae(1.0000),g:Mucilaginibacter(0.9900),s:Sphingobacterium-like_sp._PC1.9(0.9900) OTU_28 0,00713 0,00381 0,00000 0,00856 0,00079 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(1.0000),f:Oxalobacteraceae(0.9000),g:Massilia(0.8300),s:beta_proteobacterium_HJ12(0.3800) OTU_517 0,00069 0,01665 0,00000 0,00105 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Xanthomonadales(1.0000),f:Xanthomonadaceae(1.0000),g:Pseudoxanthomonas(1.0000),s:Pseudoxanthomonas_mexicana(1.0000) OTU_52 0,00765 0,00352 0,00000 0,00000 0,00698 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Sphingomonadales(1.0000),f:Sphingomonadaceae(0.9900),g:Novosphingobium(0.6800),s:Sphingomonas_sp._SB5(0.3700) OTU_24 0,00880 0,00442 0,00121 0,00163 0,00000 0,00168 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Propionibacteriales(1.0000),f:Nocardioidaceae(1.0000),g:Nocardioides(1.0000),s:unidentified(0.0100) OTU_81 0,00000 0,00077 0,00396 0,00000 0,00957 0,00305 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Corynebacteriales(1.0000),f:Nocardiaceae(1.0000),g:Nocardia(1.0000),s:Nocardia_carnea(0.8800) OTU_79 0,00000 0,00000 0,00000 0,00000 0,01704 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Caulobacterales(1.0000),f:Caulobacteraceae(1.0000),g:Caulobacter(1.0000),s:Caulobacter_endosymbiont_of_Tamarixia_radiata(0.5400) OTU_55 0,00000 0,01659 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Corynebacteriales(1.0000),f:Nocardiaceae(1.0000),g:Gordonia(1.0000),s:Gordonia_terrae(0.5700) OTU_56 0,00000 0,00000 0,00266 0,00000 0,01142 0,00246 k:Bacteria(1.0000),p:Actinobacteria(0.9900),c:Actinobacteria(0.9900),o:Micrococcales(0.9900),f:Micrococcaceae(0.9900),g:Arthrobacter(0.9900),s:Arthrobacter_sp._FV1-1(0.2500) OTU_429 0,00786 0,00817 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Rhizobiaceae(0.9900),g:Shinella(0.7700),s:Rhizobium_sp._RZ6(0.7700) OTU_92 0,00584 0,00765 0,00000 0,00077 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Pasteurellales(1.0000),f:Pasteurellaceae(1.0000),g:Actinobacillus(0.3300),s:Actinobacillus_porcinus(0.2800) OTU_71 0,00000 0,00306 0,00503 0,00000 0,00000 0,00597 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Pseudonocardiales(1.0000),f:Pseudonocardiaceae(1.0000),g:Pseudonocardia(0.9400),s:Pseudonocardia_alni(0.4300) OTU_59 0,00000 0,00000 0,00000 0,00000 0,01361 0,00000 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Propionibacteriales(1.0000),f:Nocardioidaceae(1.0000),g:Nocardioides(1.0000),s:Nocardioides_sp._CCBAU_101009(0.6600) OTU_74 0,00895 0,00215 0,00000 0,00000 0,00159 0,00000 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Bacilli(1.0000),o:Bacillales(1.0000),f:Paenibacillaceae(1.0000),g:Paenibacillus(1.0000),s:Paenibacillus_sp._TDSAS2-39(0.9300) OTU_40 0,00976 0,00094 0,00179 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(0.8000),o:Enterobacteriales(0.7800),f:Enterobacteriaceae(0.7800),g:Pantoea(0.4600),s:Pantoea_wallisii(0.1000) OTU_178 0,00475 0,00000 0,00000 0,00750 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Methylobacteriaceae(0.9900),g:Methylobacterium(0.9900),s:Methylobacterium_komagatae(0.8700) OTU_50 0,00229 0,00429 0,00000 0,00563 0,00000 0,00000 k:Bacteria(1.0000),p:Bacteroidetes(0.9900),c:Cytophagia(0.9900),o:Cytophagales(0.9900),f:Cytophagaceae(0.9900),g:Dyadobacter(0.9900),s:Dyadobacter_fermentans(0.8500) OTU_174 0,00135 0,00189 0,00000 0,00494 0,00298 0,00080 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Bacilli(1.0000),o:Bacillales(1.0000),f:Paenibacillaceae(1.0000),g:Paenibacillus(0.9900),s:Paenibacillus_sp._ROO32A(0.3200) OTU_106 0,00000 0,00000 0,00000 0,00000 0,01095 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Sphingomonadales(1.0000),f:Sphingomonadaceae(0.9900),g:Novosphingobium(0.8300),s:Novosphingobium_sp._CC-ALB-2(0.1000) OTU_67 0,00000 0,01051 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(1.0000),f:Burkholderiaceae(0.9500),g:Burkholderia(0.8900),s:Burkholderia_sp.(0.1100) OTU_267 0,00865 0,00000 0,00000 0,00000 0,00000 0,00000

k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Micrococcales(1.0000),f:Promicromonosporaceae(1.0000),g:Cellulosimicrobium(1.0000),s:Cellulosimicrobium_sp._Chra-8(1.0000) OTU_75 0,00000 0,00000 0,00000 0,00000 0,00863 0,00000 k:Bacteria(1.0000),p:Proteobacteria(0.8800),c:Alphaproteobacteria(0.8700),o:Rickettsiales(0.8700),f:Mitochondria(0.8700),g:Zymoseptoria_tritici(0.4800),s:[Clostridium]_citroniae(0.0100) OTU_1389 0,00000 0,00000 0,00229 0,00000 0,00000 0,00605 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Micrococcales(1.0000),f:Intrasporangiaceae(1.0000),g:Terrabacter(0.9900),s:Terrabacter_sp._THG-e54(0.9900) OTU_76 0,00125 0,00081 0,00000 0,00447 0,00178 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Hyphomicrobiaceae(1.0000),g:Devosia(1.0000),s:Devosia_sp._CZGSY5(0.9500) OTU_544 0,00000 0,00000 0,00000 0,00000 0,00810 0,00000 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Sphingobacteriia(1.0000),o:Sphingobacteriales(1.0000),f:Chitinophagaceae(1.0000),g:Flavisolibacter(1.0000),s:Flavisolibacter_ginsengisoli(0.7700) OTU_60 0,00075 0,00727 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Caulobacterales(1.0000),f:Caulobacteraceae(1.0000),g:Asticcacaulis(1.0000),s:Asticcacaulis_sp._ZFGT-14(0.0500) OTU_57 0,00605 0,00088 0,00000 0,00000 0,00000 0,00106 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Bacilli(0.9900),o:Lactobacillales(0.9900),f:Streptococcaceae(0.9900),g:Streptococcus(0.9900),s:Streptococcus_salivarius_subsp._thermophilus(0.1600) OTU_1092 0,00000 0,00000 0,00573 0,00000 0,00000 0,00224 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Phyllobacteriaceae(0.9600),g:Mesorhizobium(0.9600),s:Mesorhizobium_plurifarium(0.7000) OTU_66 0,00398 0,00000 0,00000 0,00203 0,00000 0,00182 k:Bacteria(1.0000),p:Proteobacteria(0.9900),c:Alphaproteobacteria(0.9900),o:Rhizobiales(0.9900),f:Hyphomicrobiaceae(0.9300),g:Devosia(0.8700),s:Devosia_ginsengisoli(0.0600) OTU_728 0,00000 0,00000 0,00000 0,00000 0,00726 0,00000 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Sphingobacteriia(1.0000),o:Sphingobacteriales(1.0000),f:Chitinophagaceae(1.0000),g:Parasegetibacter(1.0000) OTU_25 0,00000 0,00223 0,00276 0,00000 0,00086 0,00110 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Cytophagia(1.0000),o:Cytophagales(1.0000),f:Cytophagaceae(1.0000),g:Dyadobacter(1.0000),s:Dyadobacter_fermentans_DSM_18053(0.7300) OTU_48 0,00316 0,00000 0,00076 0,00299 0,00000 0,00000 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Sphingobacteriia(1.0000),o:Sphingobacteriales(1.0000),f:Chitinophagaceae(1.0000),g:Chitinophaga(1.0000),s:Chitinophaga_filiformis(0.9300) OTU_31 0,00000 0,00137 0,00138 0,00269 0,00000 0,00118 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Corynebacteriales(1.0000),f:Mycobacteriaceae(1.0000),g:Mycobacterium(1.0000),s:Mycobacterium_canariasense(0.4500) OTU_100 0,00000 0,00000 0,00000 0,00000 0,00655 0,00000 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Sphingobacteriia(1.0000),o:Sphingobacteriales(1.0000),f:Chitinophagaceae(1.0000),g:Chitinophaga(1.0000),s:Chitinophaga_sp._MJM_38(1.0000) OTU_215 0,00086 0,00000 0,00166 0,00244 0,00000 0,00152 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Bacilli(1.0000),o:Bacillales(1.0000),f:Paenibacillaceae(1.0000),g:Paenibacillus(1.0000),s:Paenibacillus_cellulosilyticus(0.9800) OTU_82 0,00000 0,00000 0,00110 0,00000 0,00421 0,00083 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(1.0000),f:Comamonadaceae(0.9900),g:Methylibium(0.5100),s:Methylibium_sp._T2-YC6780(0.1300) OTU_139 0,00081 0,00358 0,00000 0,00000 0,00078 0,00094 k:Bacteria(1.0000),p:Firmicutes(0.9800),c:Bacilli(0.9800),o:Bacillales(0.9800),f:Paenibacillaceae(0.9000),g:Paenibacillus(0.9000),s:Paenibacillus_sp._J20-6(0.3800) OTU_99 0,00286 0,00000 0,00000 0,00302 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhodobacterales(0.9700),f:Rhodobacteraceae(0.9700),g:Paracocccus(0.8700),s:Paracoccus_sp._PaH2.06a(0.3400) OTU_102 0,00000 0,00423 0,00000 0,00000 0,00000 0,00117 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Sphingomonadales(1.0000),f:Sphingomonadaceae(1.0000),g:Novosphingobium(0.9800),s:Novosphingobium_sp._APW5(0.7700) OTU_65 0,00000 0,00390 0,00000 0,00109 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Rhizobiales_Incertae_Sedis(1.0000),g:Phreatobacter(1.0000) OTU_105 0,00000 0,00000 0,00349 0,00000 0,00000 0,00114 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Caulobacterales(1.0000),f:Caulobacteraceae(1.0000),g:Brevundimonas(1.0000),s:Brevundimonas_viscosa(0.8200) OTU_784 0,00203 0,00249 0,00000 0,00000 0,00000 0,00000 k:Bacteria(0.9900),p:Proteobacteria(0.4500),c:Alphaproteobacteria(0.3500),o:Rickettsiales(0.1800),f:Mitochondria(0.1800),g:Novosphingobium(0.0600),s:Tepidimicrobium_ferriphilum(0.0200) OTU_224 0,00000 0,00000 0,00085 0,00000 0,00000 0,00357 k:Bacteria(1.0000),p:Proteobacteria(0.9800),c:Alphaproteobacteria(0.9800),o:Rickettsiales(0.9700),f:Mitochondria(0.9700),g:Chlorella_sorokiniana(0.9600) OTU_83 0,00083 0,00000 0,00072 0,00070 0,00000 0,00159 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Corynebacteriales(1.0000),f:Nocardiaceae(1.0000),g:Nocardia(1.0000),s:Nocardia_nova(1.0000) OTU_104 0,00000 0,00000 0,00082 0,00000 0,00290 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Methylophilales(1.0000),f:Methylophilaceae(1.0000),g:Methylotenera(0.5500),s:Methylophilus_sp._EHg7(0.1600) OTU_46 0,00000 0,00000 0,00000 0,00339 0,00000 0,00000 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Bacilli(1.0000),o:Bacillales(1.0000),f:Paenibacillaceae(1.0000),g:Paenibacillus(1.0000),s:Paenibacillus_durus(0.2100) OTU_87 0,00000 0,00201 0,00114 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Cyanobacteria(1.0000),c:Cyanobacteria(0.9900),o:SubsectionII(0.3600),f:FamilyII(0.3900),g:Chroococcidiopsis(0.3600),s:Oscillatoria_kawamurae(0.0100) OTU_2649 0,00000 0,00000 0,00308 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Rhizobiales_Incertae_Sedis(1.0000),g:Phreatobacter(1.0000) OTU_103 0,00000 0,00000 0,00000 0,00000 0,00306 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhodobacterales(1.0000),f:Rhodobacteraceae(1.0000),g:Rhodobacter(0.8700),s:Rhodobacter_sp._WS22(0.6000) OTU_44 0,00000 0,00216 0,00000 0,00000 0,00000 0,00090 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Methylophilales(1.0000),f:Methylophilaceae(1.0000),g:Methylobacillus(0.8200),s:Methylobacillus_flagellatus(0.3900) OTU_89 0,00000 0,00076 0,00000 0,00215 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(1.0000),f:Burkholderiaceae(0.9500),g:Burkholderia(0.9200),s:Burkholderia_cepacia(0.2200) OTU_860 0,00284 0,00000 0,00000 0,00000 0,00000 0,00000

k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Sphingobacteriia(1.0000),o:Sphingobacteriales(1.0000),f:Chitinophagaceae(1.0000),g:Flavisolibacter(1.0000),s:Bacteroidetes_bacterium_RG1-1(0.9900) OTU_97 0,00000 0,00282 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(0.9800),c:Alphaproteobacteria(0.9600),o:Rickettsiales(0.9600),f:Mitochondria(0.9600),g:Pythium_ultimum(0.4700),s:Candidatus_Vidania_fulgoroideae(0.0200) OTU_345 0,00000 0,00000 0,00000 0,00000 0,00000 0,00270 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Micrococcales(1.0000),f:Cellulomonadaceae(1.0000),g:Cellulomonas(1.0000),s:Cellulomonas_sp._ZY-1(0.6200) OTU_61 0,00097 0,00000 0,00000 0,00169 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Sphingomonadales(1.0000),f:Sphingomonadaceae(1.0000),g:Sphingomonas(1.0000),s:Sphingomonas_paucimobilis(0.5700) OTU_2028 0,00000 0,00166 0,00000 0,00000 0,00092 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Xanthomonadales(1.0000),f:Xanthomonadaceae(1.0000),g:Xanthomonas(0.9900),s:Xanthomonas_sp._NA-Z-GYM-3(0.6800) OTU_121 0,00000 0,00000 0,00153 0,00000 0,00000 0,00099 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Cytophagia(1.0000),o:Cytophagales(1.0000),f:Cytophagaceae(1.0000),g:Flexibacter(1.0000),s:Flexibacter_flexilis_subsp._pelliculosus(0.2900) OTU_96 0,00000 0,00248 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Cyanobacteria(1.0000),c:Cyanobacteria(1.0000),o:SubsectionII(1.0000),f:FamilyI(1.0000),g:Stanieria(1.0000),s:Stanieria_cyanosphaera(0.5100) OTU_1326 0,00000 0,00000 0,00090 0,00000 0,00000 0,00149 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Bacilli(1.0000),o:Bacillales(1.0000),f:Paenibacillaceae(1.0000),g:Paenibacillus(1.0000),s:Paenibacillus_sp._GT-L27(0.9900) OTU_1044 0,00227 0,00000 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Bacilli(1.0000),o:Bacillales(1.0000),f:Paenibacillaceae(1.0000),g:Paenibacillus(1.0000),s:Paenibacillus_sp._CT-7(0.5100) OTU_725 0,00000 0,00000 0,00000 0,00000 0,00225 0,00000 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Corynebacteriales(1.0000),f:Corynebacteriaceae(1.0000),g:Corynebacterium_1(1.0000),s:Corynebacterium_sp._2002-79006(1.0000) OTU_288 0,00000 0,00000 0,00000 0,00000 0,00083 0,00127 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(1.0000),f:Comamonadaceae(1.0000),g:Aquabacterium(0.9100),s:Comamonas_margaretae(0.0500) OTU_90 0,00000 0,00131 0,00078 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Pseudomonadales(1.0000),f:Pseudomonadaceae(1.0000),g:Pseudomonas(1.0000),s:Pseudomonas_sp._strain_1087(0.8900) OTU_187 0,00000 0,00000 0,00208 0,00000 0,00000 0,00000 k:Bacteria(0.9900),p:Proteobacteria(0.9800),c:Alphaproteobacteria(0.9700),o:Rickettsiales(0.9700),f:Mitochondria(0.9700),g:Zymoseptoria_tritici(0.9000),s:Legionella_norrlandica(0.0100) OTU_253 0,00000 0,00000 0,00000 0,00000 0,00000 0,00203 k:Bacteria(1.0000),p:Tenericutes(1.0000),c:Mollicutes(1.0000),o:Entomoplasmatales(1.0000),f:Spiroplasmataceae(1.0000),g:Spiroplasma(1.0000),s:Spiroplasma_sp._'Gent'(0.6000) OTU_246 0,00000 0,00000 0,00000 0,00000 0,00000 0,00202 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Micrococcales(1.0000),f:Microbacteriaceae(1.0000),g:Gryllotalpicola(1.0000),s:Gryllotalpicola_koreensis(0.8700) OTU_166 0,00200 0,00000 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Flavobacteriia(1.0000),o:Flavobacteriales(1.0000),f:Flavobacteriaceae(1.0000),g:Elizabethkingia(1.0000),s:bacterium_K2-70(0.9100) OTU_114 0,00000 0,00000 0,00000 0,00000 0,00190 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:MNG7(1.0000),g:Hyphomicrobium_sp._16-60(0.4600) OTU_107 0,00000 0,00189 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhodospirillales(1.0000),f:Acetobacteraceae(1.0000),g:Roseomonas(1.0000),s:Roseomonas_sp._HH10H133(0.9200) OTU_191 0,00000 0,00184 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Xanthobacteraceae(0.9800),g:Variibacter(0.9400),s:alpha_proteobacterium_KC-IT-F6(0.2700) OTU_161 0,00000 0,00000 0,00000 0,00000 0,00175 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhodospirillales(1.0000),f:Rhodospirillaceae(1.0000),g:Azospirillum(1.0000),s:perchlorate-reducing_bacterium_SN1A(0.3100) OTU_119 0,00169 0,00000 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Pseudomonadales(1.0000),f:Moraxellaceae(1.0000),g:Acinetobacter(1.0000),s:Arthrobacter_sp._PD8(0.1800) OTU_2577 0,00000 0,00000 0,00000 0,00000 0,00000 0,00165 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Enterobacteriales(1.0000),f:Enterobacteriaceae(1.0000),g:Pantoea(0.7800),s:Pantoea_stewartii_subsp._stewartii(0.2200) OTU_2753 0,00000 0,00000 0,00000 0,00164 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Bradyrhizobiaceae(1.0000),g:Bosea(1.0000),s:Afipia_genosp._9(0.4100) OTU_53 0,00000 0,00000 0,00000 0,00070 0,00093 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhodospirillales(1.0000),f:Acetobacteraceae(1.0000),g:Roseomonas(1.0000),s:Roseomonas_mucosa(0.3900) OTU_186 0,00000 0,00155 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Aeromonadales(0.9900),f:Aeromonadaceae(0.9900),g:Aeromonas(0.9900),s:Vibrio_parahaemolyticus(0.0100) OTU_453 0,00000 0,00000 0,00000 0,00000 0,00000 0,00154 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Micrococcales(0.9800),f:Cellulosimicrobium_sp._137-9(0.4100),g:Microbacterium(0.1700),s:Microbacterium_arborescens(0.0800) OTU_669 0,00153 0,00000 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(1.0000),f:Burkholderiaceae(1.0000),g:Cupriavidus(1.0000),s:Ralstonia_sp._KACC_91255(0.5500) OTU_136 0,00072 0,00076 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Flavobacteriia(1.0000),o:Flavobacteriales(1.0000),f:Flavobacteriaceae(1.0000),g:Chryseobacterium(1.0000),s:Chryseobacterium_sp._549(0.8300) OTU_129 0,00000 0,00000 0,00000 0,00000 0,00146 0,00000 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Sphingobacteriia(1.0000),o:Sphingobacteriales(1.0000),f:Chitinophagaceae(1.0000),g:Flavisolibacter(0.6900),s:Flavisolibacter_ginsengisoli(0.0100) OTU_63 0,00073 0,00000 0,00071 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Methylobacteriaceae(1.0000),g:Microvirga(1.0000),s:Microvirga_lupini(0.4400) OTU_182 0,00142 0,00000 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Sphingomonadales(1.0000),f:Sphingomonadaceae(0.9900),g:Sphingomonas(0.9900),s:Sphingomonas_abaci(0.2700) OTU_271 0,00138 0,00000 0,00000 0,00000 0,00000 0,00000

k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Frankiales(1.0000),f:Geodermatophilaceae(1.0000),g:Blastococcus(1.0000),s:bacterium_Ellin6023(0.6800) OTU_2122 0,00000 0,00000 0,00000 0,00000 0,00000 0,00137 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Xanthomonadales(1.0000),f:Xanthomonadaceae(1.0000),g:Rhodanobacter(0.0100) OTU_111 0,00136 0,00000 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Chloroflexi(1.0000),c:Ktedonobacteria(1.0000),o:Ktedonobacterales(1.0000),f:Ktedonobacteraceae(1.0000),g:Ktedonobacter(0.0200),s:bacterium_SOSP1-79(0.0100) OTU_2817 0,00000 0,00000 0,00000 0,00000 0,00000 0,00134 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Xanthomonadales(1.0000),f:Xanthomonadaceae(1.0000),g:Lysobacter(1.0000),s:Lysobacter_sp._KO_CM43(0.9700) OTU_69 0,00000 0,00132 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(0.9200),c:Alphaproteobacteria(0.9100),o:Rickettsiales(0.9100),f:Mitochondria(0.9100),g:Talaromyces_purpureogenus(0.2000),s:Clostridium_sp._MR-10-11[3](0.0100) OTU_432 0,00000 0,00000 0,00000 0,00000 0,00000 0,00129 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Sphingobacteriia(1.0000),o:Sphingobacteriales(1.0000),f:Sphingobacteriaceae(1.0000),g:Nubsella(0.9700),s:Nubsella_zeaxanthinifaciens(0.6400) OTU_70 0,00000 0,00000 0,00000 0,00000 0,00000 0,00117 k:Bacteria(1.0000),p:Chloroflexi(1.0000),c:Ktedonobacteria(1.0000),o:Ktedonobacterales(1.0000),f:Ktedonobacteraceae(0.9900),g:Ktedonobacter(0.0200) OTU_283 0,00000 0,00000 0,00117 0,00000 0,00000 0,00000 k:Bacteria(0.9900),p:Proteobacteria(0.4700),c:Alphaproteobacteria(0.2100),o:Clostridiales(0.1500),f:Mitochondria(0.1000),g:Fusobacterium(0.0400),s:Halanaerobacter_lacunarum(0.0100) OTU_115 0,00111 0,00000 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Bacilli(1.0000),o:Bacillales(1.0000),f:Paenibacillaceae(0.9800),g:Paenibacillus(0.9800),s:Paenibacillus_glucanolyticus(0.5900) OTU_203 0,00000 0,00000 0,00000 0,00000 0,00111 0,00000 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Sphingobacteriia(1.0000),o:Sphingobacteriales(1.0000),f:Sphingobacteriaceae(1.0000),g:Arcticibacter(0.7000),s:Bacteroidetes_bacterium_OS-21A(0.0900) OTU_236 0,00000 0,00000 0,00000 0,00000 0,00110 0,00000 k:Bacteria(1.0000),p:Fusobacteria(1.0000),c:Fusobacteriia(1.0000),o:Fusobacteriales(1.0000),f:Fusobacteriaceae(1.0000),g:Fusobacterium(1.0000),s:Fusobacterium_periodonticum(0.8600) OTU_275 0,00000 0,00000 0,00109 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Hyphomicrobiaceae(1.0000),g:Devosia(0.8800),s:Devosia_yakushimensis(0.4600) OTU_80 0,00000 0,00000 0,00000 0,00000 0,00106 0,00000 k:Bacteria(0.9800),p:Proteobacteria(0.4000),c:Alphaproteobacteria(0.2200),o:Rickettsiales(0.1900),f:Mitochondria(0.1900),g:Bacillus(0.0400),s:Bacillus_anthracis(0.0400) OTU_393 0,00000 0,00000 0,00000 0,00000 0,00000 0,00105 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Aurantimonadaceae(1.0000),g:Aureimonas(1.0000),s:Aureimonas_frigidaquae(1.0000) OTU_1202 0,00000 0,00100 0,00000 0,00000 0,00000 0,00000 k:Bacteria(0.9900),p:Proteobacteria(0.4800),c:Alphaproteobacteria(0.2100),o:Clostridiales(0.1400),f:Mitochondria(0.0400),g:Candidatus_Captivus(0.0300),s:Bacillus_cereus(0.0200) OTU_651 0,00000 0,00000 0,00000 0,00000 0,00000 0,00098 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Bacteroidia(1.0000),o:Bacteroidales(1.0000),f:Prevotellaceae(1.0000),g:Prevotella_7(1.0000),s:Prevotella_melaninogenica(0.2500) OTU_2749 0,00000 0,00000 0,00097 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(0.9600),f:Oxalobacteraceae(0.9500),g:Massilia(0.8000),s:Massilia_sp._UMI-21(0.5000) OTU_1183 0,00097 0,00000 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rickettsiales(0.9900),f:Rickettsiales_Incertae_Sedis(0.9900),g:Candidatus_Captivus(0.9700) OTU_305 0,00000 0,00000 0,00000 0,00000 0,00000 0,00095 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rickettsiales(1.0000),f:Rickettsiaceae(1.0000) OTU_578 0,00000 0,00000 0,00000 0,00000 0,00000 0,00094 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Rhodocyclales(0.7300),f:Rhodocyclaceae(0.7300),g:Methyloversatilis(0.6500),s:iron- reducing_bacterium_enrichment_culture_clone_FeC_1_H2(0.0800) OTU_473 0,00000 0,00000 0,00000 0,00000 0,00089 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Sphingomonadales(1.0000),f:Sphingomonadaceae(0.9700),g:Sphingomonas(0.9700),s:Sphingomonas_sp._Cra20(0.4100) OTU_2939 0,00087 0,00000 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Corynebacteriales(1.0000),f:Nocardiaceae(0.9900),g:Rhodococcus(0.9800),s:Rhodococcus_ruber(0.5600) OTU_1158 0,00000 0,00000 0,00000 0,00000 0,00085 0,00000 k:Bacteria(1.0000),p:Deinococcus-Thermus(1.0000),c:Deinococci(1.0000),o:Deinococcales(1.0000),f:Deinococcaceae(1.0000),g:Deinococcus(1.0000),s:Deinococcus_sp._BE4-4(0.2600) OTU_476 0,00000 0,00000 0,00000 0,00000 0,00000 0,00085 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Sphingomonadales(1.0000),f:Sphingomonadaceae(0.9900),g:Sphingobium(0.9600),s:Pseudomonas_sp._DS7(0.4400) OTU_137 0,00000 0,00085 0,00000 0,00000 0,00000 0,00000 k:Bacteria(0.9700),p:Proteobacteria(0.3800),c:Gammaproteobacteria(0.2000),o:Xanthomonadales(0.1500),f:Xanthomonadaceae(0.1400),g:Mycoplasma(0.0800),s:denitrifying_Fe-oxidizing_bacterium(0.0200) OTU_382 0,00000 0,00000 0,00000 0,00000 0,00000 0,00084 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Micromonosporales(1.0000),f:Micromonosporaceae(1.0000),g:Micromonospora(0.5200),s:Verrucosispora_sp._e37(0.4800) OTU_489 0,00000 0,00000 0,00000 0,00000 0,00000 0,00084 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Clostridia(1.0000),o:Clostridiales(1.0000),f:Lachnospiraceae(1.0000),g:Lachnoanaerobaculum(1.0000),s:Eubacterium_sp._'Smarlab_BioMol-2301231'(0.7300) OTU_468 0,00000 0,00000 0,00082 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Bacilli(1.0000),o:Bacillales(1.0000),f:Paenibacillaceae(1.0000),g:Paenibacillus(1.0000),s:Paenibacillus_sp._O-3b(0.2600) OTU_344 0,00000 0,00000 0,00082 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Sphingomonadales(1.0000),f:Sphingomonadaceae(0.9500),g:Novosphingobium(0.7500),s:drinking_water_bacterium_Y15(0.4700) OTU_804 0,00000 0,00000 0,00000 0,00082 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Sphingomonadales(1.0000),f:Sphingomonadaceae(1.0000),g:Sphingobium(0.9800),s:Sphingobium_yanoikuyae(0.6100) OTU_1187 0,00000 0,00082 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Actinomycetales(1.0000),f:Actinomycetaceae(1.0000),g:Actinomyces(1.0000),s:Actinomyces_odontolyticus(0.3500) OTU_335 0,00000 0,00000 0,00081 0,00000 0,00000 0,00000

k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Oceanospirillales(1.0000),f:Oceanospirillaceae(1.0000),g:Marinomonas(1.0000),s:Marinomonas_sp._BSi20383(0.3200) OTU_311 0,00000 0,00000 0,00081 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Phyllobacteriaceae(0.8300),g:Mesorhizobium(0.5700),s:Mesorhizobium_sp._Acj_104(0.4000) OTU_1273 0,00000 0,00000 0,00000 0,00000 0,00079 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Alteromonadales(1.0000),f:Shewanellaceae(1.0000),g:Shewanella(1.0000),s:Shewanella_putrefaciens(0.5800) OTU_505 0,00000 0,00000 0,00078 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Bacilli(1.0000),o:Bacillales(1.0000),f:Paenibacillaceae(0.9400),g:Cohnella(0.9400),s:Cohnella_sp._G13(0.3000) OTU_94 0,00000 0,00000 0,00000 0,00000 0,00000 0,00078 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Pseudomonadales(0.9900),f:Pseudomonadaceae(0.9900),g:Pseudomonas(0.9900),s:Pseudomonas_sp._PCSAS2-20(0.6300) OTU_687 0,00000 0,00000 0,00000 0,00000 0,00000 0,00075 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Bacilli(1.0000),o:Bacillales(1.0000),f:Paenibacillaceae(1.0000),g:Paenibacillus(1.0000),s:Paenibacillus_sp._TY17OpD(0.7300) OTU_769 0,00000 0,00000 0,00000 0,00073 0,00000 0,00000 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Bacilli(1.0000),o:Bacillales(1.0000),f:Bacillaceae(1.0000),g:Bacillus(1.0000),s:Bacillus_megaterium(0.4100) OTU_176 0,00000 0,00000 0,00000 0,00071 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(0.9700),c:Alphaproteobacteria(0.9300),o:Rickettsiales(0.9200),f:LWSR-14(0.8900),g:Desulfobulbus(0.0100) OTU_2607 0,00000 0,00000 0,00000 0,00000 0,00000 0,00070 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Caulobacterales(1.0000),f:Caulobacteraceae(1.0000),g:Phenylobacterium(1.0000),s:Phenylobacterium_sp._T2-YC6777(0.8600) OTU_91 0,00070 0,00000 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(0.9900),f:Hyphomicrobiaceae(0.9600),g:Devosia(0.9600),s:Devosia_sp._c4M(0.1000) OTU_2987 0,00070 0,00000 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Rhizobiaceae(0.9800),g:Rhizobium(0.9800),s:Rhizobium_mesoamericanum(0.3600) OTU_165 0,00069 0,00000 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Xanthobacteraceae(1.0000),g:Labrys(1.0000),s:Labrys_portucalensis(1.0000) OTU_78 0,00000 0,00000 0,00068 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(1.0000),f:Burkholderiaceae(1.0000),g:Burkholderia(1.0000),s:Burkholderia_mimosarum(0.4400) OTU_260 0,00067 0,00000 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Propionibacteriales(1.0000),f:Nocardioidaceae(1.0000),g:Marmoricola(1.0000),s:Marmoricola_sp._Gsoil_818(1.0000) OTU_214 0,00000 0,00000 0,00000 0,00064 0,00000 0,00000 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Frankiales(1.0000),f:Geodermatophilaceae(1.0000),g:Modestobacter(1.0000),s:Geodermatophilus_taihuensis(1.0000) OTU_183 0,00000 0,00000 0,00000 0,00063 0,00000 0,00000

Tabela A2. Classificação taxonômica, valores de confiança e abundância relativa média por órgão das OTUs identificadas no conjunto de dados de 16S em plantas de soja não inoculadas e inoculadas mantidas com solução nutritiva MS 1/2X. A abundância relativa de uma determinada OTU por amostra foi obtida com base na quantidade normalizada de reads gerados para cada amostra pelo número total de reads. Os valores médios representam a média entre as amostras para cada órgão por tratamento (não inoculada e inoculada). Valores em parênteses indicam o valor de confiança da classificação taxonômica utilizando o banco de dados SILVA. k, reino; p, filo; c, classe; o, ordem; f, família; g, gênero; s, espécie.

Não Inoculado Inoculado Taxonomia OTU_ID Raiz Caule Folha Raiz Caule Folha k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Bacilli(1.0000),o:Bacillales(0.9500),f:Bacillaceae(0.9300),g:Anaerobacillus(0.5700),s:Bacillus_gibsonii(0.0600) OTU_35 0,00000 0,01394 0,04613 0,00000 0,01168 0,09194 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(1.0000),f:Comamonadaceae(1.0000),g:Delftia(0.8100),s:beta_proteobacterium_KNU3(0.0500) OTU_29 0,00000 0,01148 0,03536 0,00266 0,01235 0,06378 k:Bacteria(1.0000),p:Proteobacteria(0.9200),c:Alphaproteobacteria(0.9200),o:Rhizobiales(0.9200),f:Brucellaceae(0.8800),g:Ochrobactrum(0.8700),s:Ochrobactrum_sp._SCTS14(0.5900) OTU_45 0,00139 0,00679 0,01400 0,00000 0,00447 0,02571 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Bacilli(1.0000),o:Bacillales(0.8000),f:Bacillaceae(0.7500),g:Bacillus(0.6500),s:Bacillus_thuringiensis_serovar_finitimus(0.1200) OTU_1294 0,00000 0,00135 0,01568 0,00000 0,00247 0,02636 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(1.0000),f:Alcaligenaceae(1.0000),g:Achromobacter(0.9400),s:Achromobacter_xylosoxidans(0.3300) OTU_42 0,00000 0,01628 0,01496 0,00000 0,02323 0,02379 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Bacilli(1.0000),o:Bacillales(0.9900),f:Bacillaceae(0.8500),g:Bacillus(0.7600),s:Bacillus_cohnii(0.3000) OTU_23 0,00000 0,02897 0,03176 0,00000 0,05525 0,02295 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Caulobacterales(1.0000),f:Caulobacteraceae(1.0000),g:Brevundimonas(0.9800),s:Brevundimonas_sp._SMXB12(0.2100) OTU_34 0,00376 0,00693 0,01773 0,00000 0,01008 0,02432 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Rhizobiaceae(0.9900),g:Rhizobium(0.9900),s:Agrobacterium_tumefaciens(0.5100) OTU_12 0,04695 0,04972 0,01938 0,01232 0,02379 0,02279 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Pseudomonadales(1.0000),f:Pseudomonadaceae(1.0000),g:Pseudomonas(1.0000),s:Pseudomonas_sp._FSB(0.2600) OTU_36 0,00000 0,02407 0,07019 0,00000 0,02179 0,04311 k:Bacteria(1.0000),p:Proteobacteria(0.7500),c:Gammaproteobacteria(0.7500),o:Enterobacteriales(0.7500),f:Enterobacteriaceae(0.7500),g:Escherichia-Shigella(0.6900),s:unidentified(0.2500) OTU_2 0,02669 0,01049 0,01424 0,00978 0,01394 0,03082 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Xanthomonadales(1.0000),f:Xanthomonadaceae(1.0000),g:Stenotrophomonas(1.0000),s:Stenotrophomonas_sp._AHL_1(0.8800) OTU_923 0,00000 0,00000 0,00447 0,00000 0,00000 0,00678 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Sphingomonadales(1.0000),f:Sphingomonadaceae(0.9900),g:Sphingomonas(0.9900),s:Sphingomonas_sp._AHM7(0.2300) OTU_16 0,04658 0,02328 0,01528 0,01613 0,02515 0,02180 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Bradyrhizobiaceae(1.0000),g:Bradyrhizobium(1.0000),s:Bradyrhizobium_sp._[ex_Lupinus](0.6100) OTU_20 0,02711 0,01182 0,00575 0,01337 0,00778 0,01254 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Caulobacterales(1.0000),f:Caulobacteraceae(1.0000),g:Phenylobacterium(0.0300),s:Phenylobacterium_sp._P-28(0.0200) OTU_117 0,00000 0,00000 0,00170 0,00000 0,00000 0,00355 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Xanthomonadales(1.0000),f:Xanthomonadaceae(1.0000),g:Xanthomonas(1.0000),s:Xanthomonas_gardneri(1.0000) OTU_647 0,00000 0,00000 0,00399 0,00000 0,00000 0,00666 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Pseudomonadales(1.0000),f:Moraxellaceae(1.0000),g:Acinetobacter(1.0000),s:Acinetobacter_junii(0.4300) OTU_93 0,00000 0,00000 0,00179 0,00000 0,00000 0,00803 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(1.0000),f:Oxalobacteraceae(0.9700),g:Herbaspirillum(0.9400),s:Sclerotinia_homoeocarpa(0.3600) OTU_133 0,00000 0,00000 0,00200 0,00000 0,00000 0,00215 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Methylobacteriaceae(1.0000),g:Methylobacterium(1.0000),s:Methylobacterium_radiotolerans(0.5800) OTU_10 0,03849 0,01806 0,00897 0,02887 0,01264 0,01634 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(1.0000),f:Burkholderiaceae(1.0000),g:Burkholderia(1.0000),s:Burkholderia_sp._UYPR1.3(0.3900) OTU_11 0,02127 0,03807 0,01277 0,10820 0,02208 0,02683 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(1.0000),f:Comamonadaceae(1.0000),g:Comamonas(0.8900),s:Comamonas_testosteroni(0.3100) OTU_33 0,00000 0,02305 0,03614 0,00000 0,02306 0,03306 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Xanthomonadales(1.0000),f:Xanthomonadaceae(1.0000),g:Stenotrophomonas(1.0000),s:Stenotrophomonas_maltophilia(0.9800) OTU_8 0,06793 0,04374 0,02963 0,01370 0,08598 0,02181 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Bacilli(1.0000),o:Bacillales(1.0000),f:Staphylococcaceae(0.8800),g:Staphylococcus(0.8800),s:Staphylococcus_pasteuri(0.1400) OTU_14 0,00000 0,00361 0,00277 0,00000 0,00173 0,01411 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Neisseriales(1.0000),f:Neisseriaceae(1.0000) OTU_38 0,00000 0,00180 0,00350 0,00000 0,00135 0,00343

k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Pseudomonadales(1.0000),f:Moraxellaceae(1.0000),g:Moraxella(1.0000),s:Moraxella_osloensis(1.0000) OTU_54 0,00000 0,00000 0,00426 0,00000 0,00801 0,00551 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Enterobacteriales(1.0000),f:Enterobacteriaceae(1.0000),g:Enterobacter(0.8900),s:Enterobacter_cloacae(0.2900) OTU_15 0,02315 0,01668 0,07589 0,02591 0,01546 0,01705 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(1.0000),f:Comamonadaceae(1.0000),g:Ottowia(0.6000),s:Acidovorax_avenae(0.6000) OTU_7 0,01200 0,02877 0,02121 0,08766 0,02304 0,03038 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(1.0000),f:Comamonadaceae(1.0000),g:Schlegelella(1.0000),s:Schlegelella_thermodepolymerans(1.0000) OTU_210 0,00000 0,00000 0,00000 0,00000 0,00000 0,00082 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(1.0000),f:Burkholderiaceae(0.9900),g:Ralstonia(0.9900),s:Ralstonia_solanacearum(0.2300) OTU_5 0,15125 0,03927 0,02299 0,00866 0,03389 0,02486 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Bacilli(1.0000),o:Bacillales(1.0000),f:Planococcaceae(0.9900),g:Lysinibacillus(0.9200),s:Lysinibacillus_fusiformis(0.5100) OTU_2463 0,00000 0,00137 0,00000 0,00000 0,00403 0,00107 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Pseudomonadales(1.0000),f:Pseudomonadaceae(1.0000),g:Pseudomonas(1.0000),s:Pseudomonas_fluorescens(0.3300) OTU_259 0,00000 0,00000 0,00000 0,00000 0,00000 0,00103 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Oceanospirillales(1.0000),f:Halomonadaceae(1.0000),g:Halomonas(1.0000),s:Halomonas_ventosae(0.3600) OTU_173 0,00000 0,00000 0,00000 0,00000 0,00000 0,00153 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Bacilli(1.0000),o:Lactobacillales(1.0000),f:Streptococcaceae(1.0000),g:Lactococcus(0.9800),s:Lactococcus_lactis(0.2300) OTU_153 0,00000 0,00000 0,00000 0,00000 0,00000 0,00078 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Rhizobiaceae(1.0000),g:Rhizobium(1.0000),s:Rhizobium_larrymoorei(0.9300) OTU_917 0,04238 0,02188 0,00774 0,01709 0,01220 0,00988 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhodospirillales(1.0000),f:Rhodospirillaceae(1.0000),g:Elstera(0.0200),s:Lacibacterium_sp._UR7-11(0.0200) OTU_180 0,00000 0,00000 0,00000 0,00000 0,00000 0,00082 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Micrococcales(1.0000),f:Micrococcaceae(1.0000),g:Arthrobacter(1.0000),s:Arthrobacter_sp._110(1.0000) OTU_17 0,02643 0,02398 0,00549 0,00310 0,00651 0,01003 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Corynebacteriales(1.0000),f:Corynebacteriaceae(1.0000),g:Corynebacterium_1(1.0000),s:Corynebacterium_accolens(0.9200) OTU_98 0,00000 0,00000 0,00139 0,00000 0,00000 0,00306 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Pseudomonadales(1.0000),f:Pseudomonadaceae(1.0000),g:Pseudomonas(1.0000),s:Pseudomonas_sp._PAI-A(0.6300) OTU_172 0,00000 0,00000 0,00000 0,00000 0,00000 0,00150 k:Bacteria(1.0000),p:Firmicutes(0.9800),c:Bacilli(0.9800),o:Bacillales(0.9800),f:Bacillaceae(0.9500),g:Bacillus(0.9500),s:Bacillus_cereus(0.3400) OTU_240 0,00000 0,00082 0,00000 0,00000 0,00646 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(1.0000),f:Oxalobacteraceae(0.9800),g:Massilia(0.9200),s:bacterium_38(0.2600) OTU_1 0,20039 0,07758 0,03854 0,21749 0,05415 0,04693 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Xanthomonadales(1.0000),f:Xanthomonadaceae(1.0000),g:Dyella(0.6200),s:Dyella_ginsengisoli(0.4700) OTU_19 0,00579 0,00102 0,00000 0,02745 0,00191 0,00704 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Flavobacteriia(1.0000),o:Flavobacteriales(1.0000),f:Flavobacteriaceae(1.0000),g:Cloacibacterium(0.9800),s:Flavobacteriaceae_bacterium_CD-6(0.4100) OTU_194 0,00000 0,00000 0,00000 0,00000 0,00000 0,00284 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Sphingobacteriia(1.0000),o:Sphingobacteriales(1.0000),f:Sphingobacteriaceae(1.0000),g:Sphingobacterium(1.0000),s:Sphingobacterium_siyangense(0.6300) OTU_68 0,00817 0,00188 0,00000 0,00000 0,00146 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Xanthomonadales(1.0000),f:Xanthomonadaceae(1.0000),g:Lysobacter(1.0000),s:unidentified(0.6500) OTU_3 0,01542 0,06802 0,03361 0,07509 0,04138 0,02951 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Methylobacteriaceae(1.0000),g:Methylobacterium(1.0000),s:Methylobacterium_populi(0.4300) OTU_22 0,00725 0,00915 0,00559 0,00165 0,00391 0,01074 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Bacilli(1.0000),o:Lactobacillales(1.0000),f:Streptococcaceae(1.0000),g:Streptococcus(1.0000),s:Streptococcus_oralis(0.1900) OTU_58 0,00000 0,00099 0,00405 0,00000 0,00119 0,00566 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Rhizobiaceae(0.9800),g:Ensifer(0.9600),s:Sinorhizobium_fredii(0.9000) OTU_4 0,03391 0,06789 0,02578 0,07074 0,06140 0,03863 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Sphingobacteriia(1.0000),o:Sphingobacteriales(1.0000),f:Sphingobacteriaceae(1.0000),g:Pedobacter(0.9100),s:Bacteroidetes_bacterium_EC2(0.9100) OTU_6 0,02940 0,04712 0,02824 0,02934 0,05236 0,03023 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rickettsiales(1.0000),f:Rickettsiaceae(1.0000),g:Rickettsia(1.0000),s:Rickettsia_sp._PAR_[pea_aphid_rickettsia](0.9900) OTU_39 0,00000 0,00000 0,18402 0,00000 0,00000 0,02390 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Streptomycetales(1.0000),f:Streptomycetaceae(1.0000),g:Streptomyces(0.7500),s:Streptomyces_sp._QLS01(0.3600) OTU_9 0,00000 0,00262 0,00486 0,09004 0,00174 0,00503 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(1.0000),f:Burkholderiaceae(0.9900),g:Limnobacter(0.9900),s:drinking_water_bacterium_MB16(0.1100) OTU_27 0,00000 0,02949 0,00653 0,00000 0,01705 0,02891 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(0.9900),o:Burkholderiales(0.9600),f:Oxalobacteraceae(0.9600),g:Massilia(0.9600),s:Janthinobacterium_sp._IARI-PL7(0.5400) OTU_159 0,00543 0,01206 0,00252 0,04201 0,00700 0,00863 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Rhizobiaceae(1.0000),g:Rhizobium(1.0000),s:Rhizobium_straminoryzae(0.3800) OTU_13 0,02016 0,01072 0,00882 0,00916 0,01269 0,00836 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Pseudonocardiales(1.0000),f:Pseudonocardiaceae(1.0000),g:Actinophytocola(0.7200),s:Actinophytocola_sp._I10A-01801(0.3600) OTU_37 0,00000 0,01711 0,00351 0,00000 0,03675 0,00000 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Bacilli(1.0000),o:Bacillales(1.0000),f:Paenibacillaceae(1.0000),g:Paenibacillus(1.0000),s:Paenibacillus_sp._436-1(0.9600) OTU_43 0,00000 0,01965 0,00302 0,00000 0,02227 0,00000

k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Micrococcales(1.0000),f:Micrococcaceae(1.0000),g:Sinomonas(0.9500),s:Sinomonas_atrocyanea(0.9500) OTU_21 0,01436 0,01679 0,00443 0,00000 0,00129 0,00097 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(0.9600),o:Sphingomonadales(0.9600),f:Sphingomonadaceae(0.9300),g:Sphingomonas(0.9200),s:bacterium_815Y(0.7700) OTU_291 0,00000 0,01059 0,00234 0,00000 0,02382 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Caulobacterales(1.0000),f:Caulobacteraceae(1.0000),g:Brevundimonas(1.0000),s:Brevundimonas_sp._N17(0.3800) OTU_51 0,00000 0,01037 0,00611 0,00000 0,01821 0,00082 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Xanthomonadales(1.0000),f:Xanthomonadaceae(1.0000),g:Dyella(1.0000),s:Dyella_sp._JP1(0.8200) OTU_26 0,00278 0,00000 0,00000 0,02433 0,00081 0,00227 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Micrococcales(1.0000),f:Microbacteriaceae(1.0000),g:Curtobacterium(0.9700),s:Curtobacterium_flaccumfaciens_pv._basellae(0.6200) OTU_30 0,01728 0,00182 0,00000 0,00333 0,00472 0,00186 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhodospirillales(1.0000),f:Rhodospirillaceae(1.0000),g:Azospirillum(1.0000),s:Azospirillum_brasilense(1.0000) OTU_47 0,00000 0,00985 0,00000 0,00000 0,01774 0,00000 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Corynebacteriales(1.0000),f:Nocardiaceae(1.0000),g:Nocardia(1.0000),s:Nocardia_carnea(0.8800) OTU_79 0,00000 0,00860 0,00099 0,00000 0,01696 0,00000 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Pseudonocardiales(1.0000),f:Pseudonocardiaceae(1.0000),g:Pseudonocardia(0.9400),s:Pseudonocardia_alni(0.4300) OTU_59 0,00000 0,00743 0,00112 0,00000 0,01362 0,00090 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Bacilli(1.0000),o:Bacillales(1.0000),f:Planococcaceae(0.8600),g:Lysinibacillus(0.7800),s:Lysinibacillus_sphaericus(0.4300) OTU_64 0,00000 0,00563 0,00318 0,00000 0,01308 0,00086 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Corynebacteriales(1.0000),f:Nocardiaceae(1.0000),g:Gordonia(1.0000),s:Gordonia_terrae(0.5700) OTU_56 0,00000 0,00872 0,00000 0,00000 0,01058 0,00246 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Sphingobacteriia(1.0000),o:Sphingobacteriales(1.0000),f:Sphingobacteriaceae(1.0000),g:Mucilaginibacter(0.9900),s:Sphingobacterium-like_sp._PC1.9(0.9900) OTU_28 0,00981 0,00071 0,00000 0,00876 0,00000 0,00105 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Bacilli(1.0000),o:Bacillales(1.0000),f:Paenibacillaceae(1.0000),g:Paenibacillus(1.0000),s:Paenibacillus_sp._TDSAS2-39(0.9300) OTU_40 0,00755 0,00834 0,00074 0,00000 0,00139 0,00152 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Methylophilales(1.0000),f:Methylophilaceae(1.0000),g:Methylotenera(0.5500),s:Methylophilus_sp._EHg7(0.1600) OTU_46 0,00162 0,00700 0,00088 0,00648 0,00328 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Hyphomicrobiaceae(1.0000),g:Devosia(1.0000),s:Devosia_subaequoris(0.7900) OTU_73 0,00000 0,00387 0,00091 0,00000 0,01068 0,00082 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Sphingobacteriia(1.0000),o:Sphingobacteriales(1.0000),f:Chitinophagaceae(1.0000),g:Parasegetibacter(1.0000) OTU_25 0,00106 0,00403 0,00458 0,00129 0,00191 0,00094 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Micrococcales(1.0000),f:Promicromonosporaceae(1.0000),g:Cellulosimicrobium(1.0000),s:Cellulosimicrobium_sp._Chra-8(1.0000) OTU_75 0,00000 0,00326 0,00000 0,00000 0,01030 0,00000 k:Bacteria(1.0000),p:Cyanobacteria(1.0000),c:Cyanobacteria(1.0000),o:SubsectionII(0.0300),f:FamilyII(0.0300),g:Chroococcidiopsis(0.0300) OTU_2299 0,00000 0,00000 0,01238 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Hyphomicrobiaceae(1.0000),g:Devosia(1.0000),s:Devosia_sp._CZGSY5(0.9500) OTU_544 0,00000 0,00482 0,00082 0,00000 0,00669 0,00000 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Propionibacteriales(1.0000),f:Nocardioidaceae(1.0000),g:Nocardioides(1.0000),s:unidentified(0.0100) OTU_81 0,00068 0,00306 0,00104 0,00153 0,00317 0,00126 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Cytophagia(1.0000),o:Cytophagales(1.0000),f:Cytophagaceae(1.0000),g:Dyadobacter(1.0000),s:Dyadobacter_sp._DCB47(0.2800) OTU_331 0,00590 0,00392 0,00000 0,00064 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Rhizobiaceae(0.9900),g:Shinella(0.7700),s:Rhizobium_sp._RZ6(0.7700) OTU_92 0,00429 0,00000 0,00000 0,00000 0,00615 0,00000 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Micrococcales(1.0000),f:Cellulomonadaceae(1.0000),g:Cellulomonas(1.0000),s:Cellulomonas_sp._ZY-1(0.6200) OTU_61 0,00822 0,00000 0,00000 0,00000 0,00110 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Xanthomonadales(1.0000),f:Xanthomonadaceae(1.0000),g:Pseudoxanthomonas(1.0000),s:Pseudoxanthomonas_mexicana(1.0000) OTU_52 0,00000 0,00251 0,00161 0,00000 0,00442 0,00078 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Cytophagia(1.0000),o:Cytophagales(1.0000),f:Cytophagaceae(1.0000),g:Dyadobacter(1.0000),s:Dyadobacter_fermentans_DSM_18053(0.7300) OTU_48 0,00489 0,00000 0,00000 0,00000 0,00284 0,00091 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Phyllobacteriaceae(0.9600),g:Mesorhizobium(0.9600),s:Mesorhizobium_plurifarium(0.7000) OTU_66 0,00419 0,00214 0,00090 0,00071 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rickettsiales(1.0000),f:Mitochondria(1.0000),g:Phytophthora_ramorum_[Sudden_oak_death_agent](0.7200) OTU_144 0,00000 0,00000 0,00096 0,00000 0,00000 0,00673 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Sphingobacteriia(1.0000),o:Sphingobacteriales(1.0000),f:Chitinophagaceae(1.0000),g:Chitinophaga(1.0000),s:Chitinophaga_filiformis(0.9300) OTU_31 0,00000 0,00075 0,00410 0,00000 0,00083 0,00196 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Corynebacteriales(1.0000),f:Mycobacteriaceae(1.0000),g:Mycobacterium(1.0000),s:Mycobacterium_canariasense(0.4500) OTU_100 0,00000 0,00194 0,00000 0,00000 0,00511 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Rhizobiaceae(0.9300),g:Rhizobium(0.9300),s:Aureimonas_ferruginea(0.0200) OTU_101 0,00583 0,00000 0,00121 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(1.0000),f:Burkholderiaceae(1.0000),g:Cupriavidus(1.0000),s:Ralstonia_sp._KACC_91255(0.5500) OTU_136 0,00000 0,00434 0,00193 0,00000 0,00076 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Pasteurellales(1.0000),f:Pasteurellaceae(1.0000),g:Actinobacillus(0.3300),s:Actinobacillus_porcinus(0.2800) OTU_71 0,00000 0,00000 0,00405 0,00000 0,00000 0,00284

k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Pseudomonadales(1.0000),f:Pseudomonadaceae(1.0000),g:Pseudomonas(1.0000),s:Pseudomonas_sp._strain_1087(0.8900) OTU_187 0,00000 0,00000 0,00686 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Xanthomonadales(1.0000),f:Xanthomonadaceae(1.0000),g:Xanthomonas(0.9900),s:Xanthomonas_sp._NA-Z-GYM-3(0.6800) OTU_121 0,00000 0,00258 0,00071 0,00000 0,00079 0,00262 k:Bacteria(1.0000),p:Proteobacteria(0.8800),c:Alphaproteobacteria(0.8700),o:Rickettsiales(0.8700),f:Mitochondria(0.8700),g:Zymoseptoria_tritici(0.4800),s:[Clostridium]_citroniae(0.0100) OTU_1389 0,00000 0,00000 0,00315 0,00000 0,00000 0,00350 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Sphingobacteriia(1.0000),o:Sphingobacteriales(1.0000),f:Chitinophagaceae(1.0000),g:Chitinophaga(1.0000),s:Chitinophaga_sp._MJM_38(1.0000) OTU_215 0,00000 0,00000 0,00000 0,00528 0,00000 0,00129 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Bradyrhizobiaceae(1.0000),g:Bosea(1.0000),s:Afipia_genosp._9(0.4100) OTU_53 0,00000 0,00000 0,00000 0,00253 0,00380 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(0.8000),o:Enterobacteriales(0.7800),f:Enterobacteriaceae(0.7800),g:Pantoea(0.4600),s:Pantoea_wallisii(0.1000) OTU_178 0,00523 0,00000 0,00000 0,00107 0,00000 0,00000 k:Bacteria(1.0000),p:Verrucomicrobia(1.0000),c:Opitutae(1.0000),o:Opitutales(0.9300),f:Opitutaceae(0.9300),g:Opitutus(0.9300),s:Verrucomicrobia_sp._TSB47(0.0900) OTU_62 0,00000 0,00000 0,00000 0,00625 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(0.9900),c:Alphaproteobacteria(0.9900),o:Rhizobiales(0.9900),f:Hyphomicrobiaceae(0.9300),g:Devosia(0.8700),s:Devosia_ginsengisoli(0.0600) OTU_728 0,00000 0,00231 0,00000 0,00000 0,00388 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Caulobacterales(1.0000),f:Caulobacteraceae(1.0000),g:Phenylobacterium(1.0000),s:Phenylobacterium_sp._T2-YC6777(0.8600) OTU_91 0,00000 0,00000 0,00094 0,00522 0,00000 0,00000 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Propionibacteriales(1.0000),f:Nocardioidaceae(0.9900),g:Nocardioides(0.9700),s:Nocardioides_perillae(0.8400) OTU_2364 0,00000 0,00485 0,00000 0,00000 0,00000 0,00115 k:Bacteria(1.0000),p:Cyanobacteria(1.0000),c:Cyanobacteria(1.0000),o:SubsectionII(0.5900),f:FamilyII(0.5900),g:Chroococcidiopsis(0.5900),s:Oscillatoria_kawamurae(0.0100) OTU_2165 0,00000 0,00000 0,00568 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Methylobacteriaceae(0.9900),g:Methylobacterium(0.9900),s:Methylobacterium_komagatae(0.8700) OTU_50 0,00231 0,00122 0,00000 0,00075 0,00000 0,00085 k:Bacteria(1.0000),p:Proteobacteria(0.9800),c:Alphaproteobacteria(0.9800),o:Rickettsiales(0.9700),f:Mitochondria(0.9700),g:Chlorella_sorokiniana(0.9600) OTU_83 0,00102 0,00142 0,00000 0,00000 0,00067 0,00200 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(1.0000),f:Oxalobacteraceae(0.9000),g:Massilia(0.8300),s:beta_proteobacterium_HJ12(0.3800) OTU_517 0,00360 0,00000 0,00000 0,00000 0,00000 0,00146 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Sphingomonadales(1.0000),f:Sphingomonadaceae(0.9900),g:Novosphingobium(0.6800),s:Sphingomonas_sp._SB5(0.3700) OTU_24 0,00184 0,00000 0,00248 0,00000 0,00073 0,00000 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Frankiales(0.9300),f:Geodermatophilaceae(0.9300),g:Geodermatophilus(0.8600),s:Geodermatophilus(0.0900) OTU_2826 0,00000 0,00000 0,00000 0,00000 0,00000 0,00494 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhodospirillales(1.0000),f:Acetobacteraceae(1.0000),g:Asaia(0.8900),s:proteobacterium_symbiont_of_Nilaparvata_lugens(0.6800) OTU_337 0,00000 0,00000 0,00000 0,00000 0,00000 0,00477 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Pseudomonadales(1.0000),f:Pseudomonadaceae(1.0000),g:Pseudomonas(1.0000),s:Pseudomonas_sp._OK-5(0.9200) OTU_41 0,00294 0,00000 0,00000 0,00000 0,00098 0,00082 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(1.0000),f:Burkholderiaceae(0.9500),g:Burkholderia(0.8900),s:Burkholderia_sp.(0.1100) OTU_267 0,00464 0,00000 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Rhizobiales_Incertae_Sedis(1.0000),g:Phreatobacter(1.0000) OTU_103 0,00000 0,00094 0,00000 0,00000 0,00364 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Caulobacterales(1.0000),f:Caulobacteraceae(1.0000),g:Caulobacter(1.0000),s:Caulobacter_endosymbiont_of_Tamarixia_radiata(0.5400) OTU_55 0,00000 0,00000 0,00000 0,00365 0,00081 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Sphingomonadales(1.0000),f:Sphingomonadaceae(0.9900),g:Novosphingobium(0.8300),s:Novosphingobium_sp._CC-ALB-2(0.1000) OTU_67 0,00000 0,00000 0,00257 0,00187 0,00000 0,00000 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Sphingobacteriia(1.0000),o:Sphingobacteriales(1.0000),f:Chitinophagaceae(1.0000),g:Niastella(0.9600),s:Niastella_yeongjuensis(0.9600) OTU_914 0,00443 0,00000 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Frankiales(1.0000),f:Geodermatophilaceae(1.0000),g:Blastococcus(1.0000),s:bacterium_Ellin6023(0.6800) OTU_2122 0,00000 0,00000 0,00000 0,00000 0,00000 0,00442 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Rhodocyclales(0.7300),f:Rhodocyclaceae(0.7300),g:Methyloversatilis(0.6500),s:iron- reducing_bacterium_enrichment_culture_clone_FeC_1_H2(0.0800) OTU_473 0,00000 0,00000 0,00000 0,00342 0,00000 0,00087 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Streptosporangiales(1.0000),f:Nocardiopsaceae(1.0000),g:Nocardiopsis(1.0000),s:Nocardiopsis_dassonvillei(0.8600) OTU_357 0,00000 0,00000 0,00000 0,00000 0,00000 0,00399 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(1.0000),f:Comamonadaceae(1.0000),g:Aquabacterium(0.9100),s:Comamonas_margaretae(0.0500) OTU_90 0,00000 0,00071 0,00086 0,00000 0,00109 0,00126 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Propionibacteriales(1.0000),f:Nocardioidaceae(1.0000),g:Nocardioides(1.0000),s:Nocardioides_ganghwensis(0.6500) OTU_571 0,00000 0,00391 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Bacilli(1.0000),o:Bacillales(1.0000),f:Paenibacillaceae(1.0000),g:Paenibacillus(1.0000),s:Paenibacillus_durus(0.2100) OTU_87 0,00000 0,00256 0,00134 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Xanthomonadales(1.0000),f:Xanthomonadaceae(1.0000),g:Lysobacter(1.0000),s:Lysobacter_sp._KO_CM43(0.9700) OTU_69 0,00183 0,00195 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Flavobacteriia(1.0000),o:Flavobacteriales(1.0000),f:Flavobacteriaceae(1.0000),g:Elizabethkingia(1.0000),s:bacterium_K2-70(0.9100) OTU_114 0,00000 0,00085 0,00087 0,00000 0,00198 0,00000

k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Hyphomicrobiaceae(1.0000),g:Devosia(0.8800),s:Devosia_yakushimensis(0.4600) OTU_80 0,00064 0,00097 0,00000 0,00000 0,00208 0,00000 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Bacilli(1.0000),o:Bacillales(1.0000),f:Paenibacillaceae(1.0000),g:Paenibacillus(1.0000),s:Paenibacillus_sp._CT-7(0.5100) OTU_725 0,00000 0,00094 0,00000 0,00000 0,00271 0,00000 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Bacilli(1.0000),o:Bacillales(1.0000),f:Paenibacillaceae(1.0000),g:Paenibacillus(0.9900),s:Paenibacillus_sp._ROO32A(0.3200) OTU_106 0,00000 0,00242 0,00000 0,00000 0,00113 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Xanthobacteraceae(1.0000),g:Labrys(1.0000),s:Labrys_portucalensis(1.0000) OTU_78 0,00000 0,00000 0,00081 0,00265 0,00000 0,00000 k:Bacteria(1.0000),p:Bacteroidetes(0.9900),c:Cytophagia(0.9900),o:Cytophagales(0.9900),f:Cytophagaceae(0.9900),g:Dyadobacter(0.9900),s:Dyadobacter_fermentans(0.8500) OTU_174 0,00000 0,00104 0,00000 0,00230 0,00000 0,00000 k:Bacteria(1.0000),p:Cyanobacteria(1.0000),c:Cyanobacteria(1.0000),o:SubsectionI(1.0000),f:FamilyI(1.0000),g:Chroogloeocystis(1.0000),s:Gloeocapsopsis_crepidinum_LEGE_06123(0.8800) OTU_1745 0,00000 0,00000 0,00000 0,00000 0,00000 0,00310 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Corynebacteriales(1.0000),f:Nocardiaceae(0.9900),g:Rhodococcus(0.9800),s:Rhodococcus_ruber(0.5600) OTU_1158 0,00000 0,00000 0,00000 0,00000 0,00277 0,00000 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Corynebacteriales(1.0000),f:Nocardiaceae(1.0000),g:Nocardia(1.0000),s:Nocardia_nova(1.0000) OTU_104 0,00000 0,00000 0,00099 0,00000 0,00000 0,00172 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Flavobacteriia(1.0000),o:Flavobacteriales(1.0000),f:Flavobacteriaceae(1.0000),g:Flavobacterium(1.0000),s:Flavobacterium_anhuiense(1.0000) OTU_135 0,00000 0,00000 0,00000 0,00265 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Pseudomonadales(1.0000),f:Moraxellaceae(1.0000),g:Acinetobacter(1.0000),s:Arthrobacter_sp._PD8(0.1800) OTU_2577 0,00000 0,00000 0,00262 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Sphingobacteriia(1.0000),o:Sphingobacteriales(1.0000),f:Chitinophagaceae(1.0000),g:Flavisolibacter(0.6900),s:Flavisolibacter_ginsengisoli(0.0100) OTU_63 0,00000 0,00184 0,00000 0,00000 0,00000 0,00077 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Xanthobacteraceae(0.9800),g:Variibacter(0.9400),s:alpha_proteobacterium_KC-IT-F6(0.2700) OTU_161 0,00000 0,00079 0,00000 0,00000 0,00172 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rickettsiales(1.0000),f:AKIW1012(1.0000) OTU_1897 0,00000 0,00000 0,00252 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhodospirillales(1.0000),f:Acetobacteraceae(1.0000),g:Craurococcus(1.0000) OTU_248 0,00000 0,00000 0,00000 0,00000 0,00237 0,00000 k:Bacteria(1.0000),p:Bacteroidetes(0.9900),c:Cytophagia(0.9900),o:Cytophagales(0.9900),f:Cytophagaceae(0.9900),g:Dyadobacter(0.9900),s:unidentified(0.0200) OTU_112 0,00000 0,00000 0,00000 0,00235 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Enterobacteriales(1.0000),f:Enterobacteriaceae(1.0000),g:Pantoea(0.7800),s:Pantoea_stewartii_subsp._stewartii(0.2200) OTU_2753 0,00222 0,00000 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(1.0000),f:Comamonadaceae(1.0000),g:Ramlibacter(0.7400),s:Ramlibacter_sp._7B-217(0.3900) OTU_1879 0,00219 0,00000 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(1.0000),f:Oxalobacteraceae(1.0000),g:Massilia(0.9100),s:Massilia_albidiflava(0.1700) OTU_157 0,00130 0,00085 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Bacilli(0.9900),o:Lactobacillales(0.9900),f:Streptococcaceae(0.9900),g:Streptococcus(0.9900),s:Streptococcus_salivarius_subsp._thermophilus(0.1600) OTU_1092 0,00000 0,00000 0,00201 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(0.9500),f:Burkholderiaceae(0.8600),g:Ralstonia(0.7600),s:Ralstonia_sp._C13(0.1300) OTU_2884 0,00191 0,00000 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(0.4100),c:Alphaproteobacteria(0.1400),o:Clostridiales(0.1100),f:Mitochondria(0.0500),g:Reyranella(0.0200),s:Brevundimonas_sp._BJ-22(0.0100) OTU_533 0,00000 0,00000 0,00000 0,00000 0,00000 0,00186 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Rhizobiales_Incertae_Sedis(1.0000),g:Phreatobacter(1.0000) OTU_105 0,00000 0,00000 0,00108 0,00000 0,00000 0,00077 k:Bacteria(1.0000),p:Deinococcus-Thermus(1.0000),c:Deinococci(1.0000),o:Deinococcales(1.0000),f:Deinococcaceae(1.0000),g:Deinococcus(1.0000),s:Deinococcus_gobiensis(0.8100) OTU_449 0,00000 0,00000 0,00179 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Phyllobacteriaceae(0.8300),g:Mesorhizobium(0.5700),s:Mesorhizobium_sp._Acj_104(0.4000) OTU_1273 0,00000 0,00000 0,00000 0,00000 0,00176 0,00000 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Bacilli(1.0000),o:Bacillales(1.0000),f:Paenibacillaceae(0.9400),g:Cohnella(0.9400),s:Cohnella_sp._G13(0.3000) OTU_94 0,00000 0,00000 0,00174 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Micrococcales(1.0000),f:Intrasporangiaceae(1.0000),g:Terrabacter(0.9900),s:Terrabacter_sp._THG-e54(0.9900) OTU_76 0,00000 0,00160 0,00000 0,00000 0,00000 0,00000 k:Bacteria(0.9800),p:Proteobacteria(0.4000),c:Alphaproteobacteria(0.2200),o:Rickettsiales(0.1900),f:Mitochondria(0.1900),g:Bacillus(0.0400),s:Bacillus_anthracis(0.0400) OTU_393 0,00000 0,00000 0,00080 0,00000 0,00000 0,00076 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Streptomycetales(1.0000),f:Streptomycetaceae(1.0000),g:Streptomyces(1.0000),s:Streptomyces_tendae(0.5700) OTU_343 0,00000 0,00000 0,00000 0,00000 0,00000 0,00155 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Micrococcales(0.9800),f:Cellulosimicrobium_sp._137-9(0.4100),g:Microbacterium(0.1700),s:Microbacterium_arborescens(0.0800) OTU_669 0,00155 0,00000 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(0.9900),o:Rickettsiales(0.9900),f:Mitochondria(0.9900),g:Chlorella_sorokiniana(0.9600) OTU_128 0,00154 0,00000 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Pseudonocardiales(1.0000),f:Pseudonocardiaceae(1.0000),g:Saccharothrix(1.0000),s:Saccharothrix_sp._MK2172(1.0000) OTU_155 0,00000 0,00079 0,00000 0,00000 0,00072 0,00000

k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Sphingomonadales(1.0000),f:Sphingomonadaceae(1.0000),g:Sphingomonas(1.0000),s:Sphingomonas_paucimobilis(0.5700) OTU_2028 0,00065 0,00000 0,00000 0,00000 0,00000 0,00084 k:Bacteria(1.0000),p:Deinococcus-Thermus(1.0000),c:Deinococci(1.0000),o:Deinococcales(1.0000),f:Deinococcaceae(1.0000),g:Deinococcus(1.0000),s:Methylobacterium_adhaesivum(1.0000) OTU_168 0,00144 0,00000 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Flavobacteriia(1.0000),o:Flavobacteriales(1.0000),f:Flavobacteriaceae(1.0000),g:Chryseobacterium(1.0000),s:Chryseobacterium_sp._549(0.8300) OTU_129 0,00000 0,00000 0,00000 0,00000 0,00000 0,00136 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Bacilli(1.0000),o:Lactobacillales(0.9900),f:Enterococcaceae(0.8800),g:Enterococcus(0.8800),s:Enterococcus_sp._812(0.1600) OTU_2549 0,00000 0,00000 0,00000 0,00000 0,00000 0,00130 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Deltaproteobacteria(1.0000),o:Myxococcales(1.0000),f:Myxococcaceae(1.0000),g:Myxococcus(1.0000),s:Myxococcus_sp._92002(0.8800) OTU_177 0,00000 0,00000 0,00000 0,00000 0,00124 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Rhizobiaceae(0.9800),g:Rhizobium(0.9800),s:Rhizobium_mesoamericanum(0.3600) OTU_165 0,00124 0,00000 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(0.9600),f:Oxalobacteraceae(0.9500),g:Massilia(0.8000),s:Massilia_sp._UMI-21(0.5000) OTU_1183 0,00119 0,00000 0,00000 0,00000 0,00000 0,00000 k:Bacteria(0.9900),p:Proteobacteria(0.9800),c:Alphaproteobacteria(0.9700),o:Rickettsiales(0.9700),f:Mitochondria(0.9700),g:Zymoseptoria_tritici(0.9000),s:Legionella_norrlandica(0.0100) OTU_253 0,00000 0,00000 0,00000 0,00000 0,00000 0,00117 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Bacilli(0.9800),o:Bacillales(0.9800),f:Planococcaceae(0.9100),g:Solibacillus(0.7200),s:Bacillus_sp._SM1(0.2200) OTU_243 0,00000 0,00000 0,00000 0,00000 0,00114 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Caulobacterales(1.0000),f:Caulobacteraceae(1.0000),g:Asticcacaulis(1.0000),s:Asticcacaulis_sp._ZFGT-14(0.0500) OTU_57 0,00111 0,00000 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Flavobacteriia(1.0000),o:Flavobacteriales(1.0000),f:Flavobacteriaceae(1.0000),g:Flavobacterium(1.0000),s:Flavobacterium_sp._TISTR_1610(0.9800) OTU_2126 0,00000 0,00000 0,00000 0,00111 0,00000 0,00000 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Bacilli(1.0000),o:Bacillales(1.0000),f:Paenibacillaceae(1.0000),g:Paenibacillus(1.0000),s:Paenibacillus_sp._O-3b(0.2600) OTU_344 0,00000 0,00108 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(1.0000),f:Comamonadaceae(0.9900),g:Methylibium(0.5100),s:Methylibium_sp._T2-YC6780(0.1300) OTU_139 0,00000 0,00000 0,00105 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Armatimonadetes(1.0000),c:Fimbriimonas_ginsengisoli_Gsoil_348(0.1000) OTU_142 0,00000 0,00000 0,00103 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Micrococcales(1.0000),f:Brevibacteriaceae(1.0000),g:Brevibacterium(1.0000),s:Brevibacterium_linens(1.0000) OTU_445 0,00000 0,00000 0,00103 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Sphingobacteriia(1.0000),o:Sphingobacteriales(1.0000),f:Sphingobacteriaceae(1.0000),g:Nubsella(0.9700),s:Nubsella_zeaxanthinifaciens(0.6400) OTU_70 0,00000 0,00000 0,00000 0,00000 0,00000 0,00100 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Sphingomonadales(1.0000),f:Sphingomonadaceae(1.0000),g:Novosphingobium(0.9800),s:Novosphingobium_sp._APW5(0.7700) OTU_65 0,00100 0,00000 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(1.0000),f:Burkholderiaceae(0.9500),g:Burkholderia(0.9200),s:Burkholderia_cepacia(0.2200) OTU_860 0,00099 0,00000 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Bacilli(1.0000),o:Bacillales(1.0000),f:Paenibacillaceae(1.0000),g:Paenibacillus(1.0000),s:Paenibacillus_sp._tjsxy2003-e-4(0.2700) OTU_113 0,00000 0,00000 0,00000 0,00000 0,00000 0,00099 k:Bacteria(1.0000),p:Firmicutes(0.3800),c:Clostridia(0.2200),o:Clostridiales(0.1800),f:Veillonellaceae(0.0700),g:Sporomusa(0.0500),s:Sporomusa_malonica(0.0300) OTU_662 0,00000 0,00000 0,00000 0,00000 0,00000 0,00099 k:Bacteria(1.0000),p:Planctomycetes(1.0000),c:Planctomycetacia(1.0000),o:Planctomycetales(1.0000),f:Planctomycetaceae(1.0000),g:Planctomyces(1.0000),s:Planctomyces_sp._Io1-3(0.9400) OTU_167 0,00000 0,00000 0,00097 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Cyanobacteria(0.9900),c:Cyanobacteria(0.9800),o:SubsectionIII(0.3800),f:FamilyI(0.3900),g:Chroococcidiopsis(0.2100),s:Aiptasia_pallida(0.0300) OTU_2830 0,00000 0,00000 0,00096 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Cytophagia(1.0000),o:Cytophagales(1.0000),f:Cytophagaceae(1.0000),g:Spirosoma(1.0000),s:Spirosoma-like_sp._PC5.1A(0.6800) OTU_196 0,00095 0,00000 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Bacilli(1.0000),o:Bacillales(1.0000),f:Paenibacillaceae(1.0000),g:Paenibacillus(1.0000),s:Paenibacillus_sp._TY17OpD(0.7300) OTU_769 0,00095 0,00000 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Cyanobacteria(1.0000),c:Cyanobacteria(1.0000),o:SubsectionII(1.0000),f:FamilyII(1.0000),g:Chroococcidiopsis(1.0000),s:Chroococcidiopsis_sp._PCC_7431(0.8200) OTU_1665 0,00000 0,00000 0,00000 0,00000 0,00000 0,00093 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Bacilli(1.0000),o:Lactobacillales(1.0000),f:Lactobacillaceae(1.0000),g:Lactobacillus(1.0000),s:Lactobacillus_iners(0.3100) OTU_265 0,00000 0,00091 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Deinococcus-Thermus(1.0000),c:Deinococci(1.0000),o:Deinococcales(1.0000),f:Trueperaceae(1.0000),g:Truepera(1.0000) OTU_583 0,00000 0,00000 0,00000 0,00000 0,00000 0,00090 k:Bacteria(1.0000),p:Proteobacteria(0.3800),c:Gammaproteobacteria(0.1600),o:Bacillales(0.1200),f:Bacillaceae(0.0700),g:Bacillus(0.0700),s:Bacillus_sp._HJ16(0.0200) OTU_618 0,00000 0,00000 0,00090 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Micromonosporales(1.0000),f:Micromonosporaceae(1.0000),g:Micromonospora(0.5200),s:Verrucosispora_sp._e37(0.4800) OTU_489 0,00000 0,00000 0,00000 0,00000 0,00000 0,00086 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Propionibacteriales(1.0000),f:Nocardioidaceae(1.0000),g:Nocardioides(1.0000),s:Nocardioides_sp._CCBAU_101009(0.6600) OTU_74 0,00000 0,00000 0,00000 0,00000 0,00000 0,00086 k:Bacteria(0.9700),p:Proteobacteria(0.3800),c:Gammaproteobacteria(0.2000),o:Xanthomonadales(0.1500),f:Xanthomonadaceae(0.1400),g:Mycoplasma(0.0800),s:denitrifying_Fe-oxidizing_bacterium(0.0200) OTU_382 0,00000 0,00000 0,00000 0,00000 0,00000 0,00086

k:Bacteria(0.9900),p:Proteobacteria(0.4500),c:Alphaproteobacteria(0.3500),o:Rickettsiales(0.1800),f:Mitochondria(0.1800),g:Novosphingobium(0.0600),s:Tepidimicrobium_ferriphilum(0.0200) OTU_224 0,00000 0,00000 0,00000 0,00000 0,00000 0,00085 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Xanthomonadales(1.0000),f:Xanthomonadaceae(1.0000),g:Rhodanobacter(0.0100) OTU_111 0,00085 0,00000 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Bacilli(1.0000),o:Bacillales(1.0000),f:Paenibacillaceae(0.9600),g:Cohnella(0.8200),s:Cohnella_soli(0.1900) OTU_88 0,00000 0,00000 0,00000 0,00000 0,00000 0,00083 k:Bacteria(1.0000),p:TM6(1.0000),c:candidate_division_TM6_bacterium_JCVI_TM6SC1(0.0100) OTU_140 0,00000 0,00000 0,00000 0,00000 0,00080 0,00000 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Cytophagia(1.0000),o:Cytophagales(1.0000),f:Cytophagaceae(1.0000),g:Fibrisoma(1.0000) OTU_482 0,00000 0,00000 0,00000 0,00000 0,00000 0,00080 k:Bacteria(1.0000),p:Proteobacteria(0.2600),c:Gammaproteobacteria(0.1300),o:Spirochaetales(0.0800),f:Spirochaetaceae(0.0800),g:Candidatus_Phytoplasma(0.0500),s:Candidatus_Blochmannia_floridanus(0.0200) OTU_916 0,00000 0,00000 0,00000 0,00000 0,00000 0,00079 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Enterobacteriales(1.0000),f:Enterobacteriaceae(1.0000),g:Pantoea(0.9300),s:Dickeya_chrysanthemi(0.9000) OTU_2034 0,00000 0,00000 0,00000 0,00000 0,00000 0,00079 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Flavobacteriia(1.0000),o:Flavobacteriales(1.0000),f:Flavobacteriaceae(1.0000),g:Chryseobacterium(0.9600),s:Chryseobacterium_koreense(0.2300) OTU_709 0,00000 0,00000 0,00000 0,00000 0,00000 0,00079 k:Bacteria(1.0000),p:Proteobacteria(0.9300),c:Alphaproteobacteria(0.9300),o:Rickettsiales(0.9300),f:Mitochondria(0.9300),g:Zymoseptoria_tritici(0.7700),s:[Clostridium]_neopropionicum(0.0100) OTU_374 0,00000 0,00000 0,00077 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Propionibacteriales(1.0000),f:Nocardioidaceae(1.0000),g:Aeromicrobium(0.9900),s:Aeromicrobium_kwangyangensis(0.7000) OTU_181 0,00000 0,00077 0,00000 0,00000 0,00000 0,00000 k:Bacteria(0.9700),p:Proteobacteria(0.3200),c:Bacilli(0.2000),o:Bacillales(0.1700),f:Bacillaceae(0.1500),g:Bacillus(0.1400),s:Bacillus_cereus(0.0300) OTU_389 0,00000 0,00000 0,00077 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Sphingomonadales(1.0000),f:Sphingomonadaceae(0.9900),g:Sphingopyxis(0.9700),s:Sphingopyxis_sp._DNG2(0.5500) OTU_909 0,00000 0,00000 0,00077 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Pseudomonadales(1.0000),f:Moraxellaceae(1.0000),g:Acinetobacter(1.0000),s:Acinetobacter_sp._DG880(0.1100) OTU_1828 0,00000 0,00000 0,00000 0,00000 0,00000 0,00076 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Cytophagia(1.0000),o:Cytophagales(1.0000),f:Cytophagaceae(1.0000),g:Hymenobacter(1.0000),s:Hymenobacter_flocculans(0.0200) OTU_385 0,00000 0,00000 0,00000 0,00000 0,00000 0,00075 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Methylophilales(1.0000),f:Methylophilaceae(1.0000),g:Methylophilus(0.9600),s:Methylotenera_mobilis(0.2900) OTU_77 0,00000 0,00000 0,00000 0,00000 0,00000 0,00074 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Micrococcales(1.0000),f:Micrococcaceae(1.0000),g:Rothia(1.0000),s:Rothia_mucilaginosa(0.4800) OTU_2000 0,00000 0,00000 0,00073 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Bifidobacteriales(1.0000),f:Bifidobacteriaceae(1.0000),g:Bifidobacterium(1.0000),s:Bifidobacterium_sp.(0.5800) OTU_580 0,00000 0,00000 0,00073 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Methylophilales(1.0000),f:Methylophilaceae(1.0000),g:Methylobacillus(0.8200),s:Methylobacillus_flagellatus(0.3900) OTU_89 0,00000 0,00000 0,00000 0,00073 0,00000 0,00000 k:Bacteria(1.0000),p:Firmicutes(0.9900),c:Clostridia(0.9900),o:Clostridiales(0.9900),f:Family_XVIII(0.9900),g:Symbiobacterium(0.0400),s:Symbiobacterium_terraclitae(0.0100) OTU_255 0,00000 0,00069 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(1.0000),f:Burkholderiaceae(0.8800),g:Ralstonia(0.8700),s:Ralstonia_solanacearum(0.2500) OTU_2785 0,00069 0,00000 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Sphingomonadales(1.0000),f:Sphingomonadaceae(0.9500),g:Novosphingobium(0.7500),s:drinking_water_bacterium_Y15(0.4700) OTU_804 0,00000 0,00000 0,00000 0,00068 0,00000 0,00000

Tabela A3. Classificação taxonômica, valores de confiança e abundância relativa média por órgão das OTUs identificadas no conjunto de dados de 16S em plantas de soja não inoculadas e inoculadas mantidas com solução nutritiva MS 1/4X. A abundância relativa de uma determinada OTU por amostra foi obtida com base na quantidade normalizada de reads gerados para cada amostra pelo número total de reads. Os valores médios representam a média entre as amostras para cada órgão por tratamento (não inoculada e inoculada). Valores em parênteses indicam o valor de confiança da classificação taxonômica utilizando o banco de dados SILVA. k, reino; p, filo; c, classe; o, ordem; f, família; g, gênero; s, espécie.

Não Inoculado Inoculado Taxonomia OTU_ID Raiz Caule Folha Raiz Caule Folha k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Bacilli(1.0000),o:Bacillales(0.9500),f:Bacillaceae(0.9300),g:Anaerobacillus(0.5700),s:Bacillus_gibsonii(0.0600) OTU_35 0,00000 0,01895 0,02321 0,00000 0,01239 0,04533 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(1.0000),f:Comamonadaceae(1.0000),g:Delftia(0.8100),s:beta_proteobacterium_KNU3(0.0500) OTU_29 0,01502 0,01939 0,03655 0,00178 0,03792 0,03226 k:Bacteria(1.0000),p:Proteobacteria(0.9200),c:Alphaproteobacteria(0.9200),o:Rhizobiales(0.9200),f:Brucellaceae(0.8800),g:Ochrobactrum(0.8700),s:Ochrobactrum_sp._SCTS14(0.5900) OTU_45 0,00000 0,00534 0,02219 0,00000 0,00180 0,01857 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Bacilli(1.0000),o:Bacillales(0.8000),f:Bacillaceae(0.7500),g:Bacillus(0.6500),s:Bacillus_thuringiensis_serovar_finitimus(0.1200) OTU_1294 0,00000 0,00562 0,00684 0,00000 0,00314 0,01253 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(1.0000),f:Alcaligenaceae(1.0000),g:Achromobacter(0.9400),s:Achromobacter_xylosoxidans(0.3300) OTU_42 0,00000 0,01023 0,00937 0,00000 0,00633 0,01822 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Bacilli(1.0000),o:Bacillales(0.9900),f:Bacillaceae(0.8500),g:Bacillus(0.7600),s:Bacillus_cohnii(0.3000) OTU_23 0,00000 0,00526 0,00662 0,00000 0,01409 0,01801 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Caulobacterales(1.0000),f:Caulobacteraceae(1.0000),g:Brevundimonas(0.9800),s:Brevundimonas_sp._SMXB12(0.2100) OTU_34 0,00067 0,00657 0,04529 0,00000 0,00744 0,03237 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Rhizobiaceae(0.9900),g:Rhizobium(0.9900),s:Agrobacterium_tumefaciens(0.5100) OTU_12 0,02127 0,02172 0,04344 0,00232 0,00776 0,00995 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Pseudomonadales(1.0000),f:Pseudomonadaceae(1.0000),g:Pseudomonas(1.0000),s:Pseudomonas_sp._FSB(0.2600) OTU_36 0,00000 0,04046 0,02341 0,00000 0,05488 0,02567 k:Bacteria(1.0000),p:Proteobacteria(0.7500),c:Gammaproteobacteria(0.7500),o:Enterobacteriales(0.7500),f:Enterobacteriaceae(0.7500),g:Escherichia-Shigella(0.6900),s:unidentified(0.2500) OTU_2 0,00070 0,00925 0,01277 0,00000 0,01053 0,02494 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Xanthomonadales(1.0000),f:Xanthomonadaceae(1.0000),g:Stenotrophomonas(1.0000),s:Stenotrophomonas_sp._AHL_1(0.8800) OTU_923 0,00000 0,00000 0,00185 0,00000 0,00000 0,00358 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Sphingomonadales(1.0000),f:Sphingomonadaceae(0.9900),g:Sphingomonas(0.9900),s:Sphingomonas_sp._AHM7(0.2300) OTU_16 0,01595 0,02444 0,01403 0,01164 0,03102 0,01633 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Bradyrhizobiaceae(1.0000),g:Bradyrhizobium(1.0000),s:Bradyrhizobium_sp._[ex_Lupinus](0.6100) OTU_20 0,02123 0,01287 0,00464 0,00947 0,01055 0,00456 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Caulobacterales(1.0000),f:Caulobacteraceae(1.0000),g:Phenylobacterium(0.0300),s:Phenylobacterium_sp._P-28(0.0200) OTU_117 0,00000 0,00000 0,00000 0,00000 0,00000 0,00349 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Xanthomonadales(1.0000),f:Xanthomonadaceae(1.0000),g:Xanthomonas(1.0000),s:Xanthomonas_gardneri(1.0000) OTU_647 0,00000 0,00129 0,00000 0,00000 0,00155 0,00826 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Pseudomonadales(1.0000),f:Moraxellaceae(1.0000),g:Acinetobacter(1.0000),s:Acinetobacter_junii(0.4300) OTU_93 0,00000 0,00178 0,00854 0,00000 0,00345 0,00259 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(1.0000),f:Oxalobacteraceae(0.9700),g:Herbaspirillum(0.9400),s:Sclerotinia_homoeocarpa(0.3600) OTU_133 0,00000 0,00000 0,00000 0,00000 0,00000 0,00113 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Methylobacteriaceae(1.0000),g:Methylobacterium(1.0000),s:Methylobacterium_radiotolerans(0.5800) OTU_10 0,06839 0,02692 0,04962 0,02265 0,01727 0,00702 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(1.0000),f:Burkholderiaceae(1.0000),g:Burkholderia(1.0000),s:Burkholderia_sp._UYPR1.3(0.3900) OTU_11 0,01394 0,02439 0,00889 0,06284 0,02727 0,01468 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(1.0000),f:Comamonadaceae(1.0000),g:Comamonas(0.8900),s:Comamonas_testosteroni(0.3100) OTU_33 0,00000 0,02447 0,01326 0,00000 0,01561 0,01984 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Xanthomonadales(1.0000),f:Xanthomonadaceae(1.0000),g:Stenotrophomonas(1.0000),s:Stenotrophomonas_maltophilia(0.9800) OTU_8 0,00263 0,02646 0,00554 0,01014 0,02239 0,04034 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Bacilli(1.0000),o:Bacillales(1.0000),f:Staphylococcaceae(0.8800),g:Staphylococcus(0.8800),s:Staphylococcus_pasteuri(0.1400) OTU_14 0,00000 0,01535 0,00254 0,00000 0,00422 0,27969 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Rubrobacteria(1.0000),o:Rubrobacterales(1.0000),f:Rubrobacteriaceae(1.0000),g:Rubrobacter(1.0000),s:Rubrobacter_sp._VS-111(0.6200) OTU_131 0,00000 0,00072 0,00000 0,00000 0,00000 0,00000

k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Neisseriales(1.0000),f:Neisseriaceae(1.0000) OTU_38 0,00000 0,00628 0,00236 0,00000 0,00122 0,06027 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Pseudomonadales(1.0000),f:Moraxellaceae(1.0000),g:Moraxella(1.0000),s:Moraxella_osloensis(1.0000) OTU_54 0,00000 0,00000 0,00078 0,00000 0,01503 0,01554 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Enterobacteriales(1.0000),f:Enterobacteriaceae(1.0000),g:Enterobacter(0.8900),s:Enterobacter_cloacae(0.2900) OTU_15 0,00383 0,02074 0,01714 0,00543 0,02492 0,01950 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(1.0000),f:Comamonadaceae(1.0000),g:Ottowia(0.6000),s:Acidovorax_avenae(0.6000) OTU_7 0,03875 0,03903 0,00834 0,12128 0,05302 0,01759 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(1.0000),f:Comamonadaceae(1.0000),g:Schlegelella(1.0000),s:Schlegelella_thermodepolymerans(1.0000) OTU_210 0,00000 0,00000 0,00000 0,00000 0,00000 0,00153 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Corynebacteriales(1.0000),f:Corynebacteriaceae(1.0000) OTU_125 0,00000 0,00000 0,00000 0,00000 0,00000 0,00237 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(1.0000),f:Burkholderiaceae(0.9900),g:Ralstonia(0.9900),s:Ralstonia_solanacearum(0.2300) OTU_5 0,12613 0,04361 0,01164 0,01738 0,02496 0,00890 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Bacilli(1.0000),o:Lactobacillales(1.0000),f:Streptococcaceae(1.0000),g:Lactococcus(0.9800),s:Lactococcus_lactis(0.2300) OTU_153 0,00000 0,00000 0,00000 0,00000 0,00000 0,00091 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Actinomycetales(1.0000),f:Actinomycetaceae(1.0000),g:Actinotignum(1.0000),s:Actinotignum_urinale(0.0100) OTU_170 0,00000 0,00000 0,00000 0,00000 0,00000 0,00120 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Rhizobiaceae(1.0000),g:Rhizobium(1.0000),s:Rhizobium_larrymoorei(0.9300) OTU_917 0,00725 0,01530 0,00108 0,00474 0,01314 0,00495 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhodospirillales(1.0000),f:Rhodospirillaceae(1.0000),g:Elstera(0.0200),s:Lacibacterium_sp._UR7-11(0.0200) OTU_180 0,00000 0,00000 0,00000 0,00000 0,00000 0,00106 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Micrococcales(1.0000),f:Micrococcaceae(1.0000),g:Arthrobacter(1.0000),s:Arthrobacter_sp._110(1.0000) OTU_17 0,00963 0,04814 0,01390 0,00000 0,01752 0,00399 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Corynebacteriales(1.0000),f:Corynebacteriaceae(1.0000),g:Corynebacterium_1(1.0000),s:Corynebacterium_accolens(0.9200) OTU_98 0,00000 0,00078 0,00214 0,00000 0,00079 0,03098 k:Bacteria(1.0000),p:Firmicutes(0.9800),c:Bacilli(0.9800),o:Bacillales(0.9800),f:Bacillaceae(0.9500),g:Bacillus(0.9500),s:Bacillus_cereus(0.3400) OTU_240 0,00000 0,00000 0,02634 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(1.0000),f:Oxalobacteraceae(0.9800),g:Massilia(0.9200),s:bacterium_38(0.2600) OTU_1 0,13764 0,05871 0,02260 0,18269 0,05714 0,02578 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Xanthomonadales(1.0000),f:Xanthomonadaceae(1.0000),g:Dyella(0.6200),s:Dyella_ginsengisoli(0.4700) OTU_19 0,00000 0,00138 0,00104 0,00000 0,00000 0,00136 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Flavobacteriia(1.0000),o:Flavobacteriales(1.0000),f:Flavobacteriaceae(1.0000),g:Cloacibacterium(0.9800),s:Flavobacteriaceae_bacterium_CD-6(0.4100) OTU_194 0,00000 0,00000 0,00000 0,00000 0,00000 0,00307 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Negativicutes(1.0000),o:Selenomonadales(1.0000),f:Veillonellaceae(1.0000),g:Veillonella(1.0000),s:Veillonella_parvula(0.2000) OTU_218 0,00000 0,00176 0,00107 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Sphingobacteriia(1.0000),o:Sphingobacteriales(1.0000),f:Sphingobacteriaceae(1.0000),g:Sphingobacterium(1.0000),s:Sphingobacterium_siyangense(0.6300) OTU_68 0,00000 0,00000 0,01069 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Xanthomonadales(1.0000),f:Xanthomonadaceae(1.0000),g:Lysobacter(1.0000),s:unidentified(0.6500) OTU_3 0,02021 0,07537 0,00416 0,16935 0,06766 0,01222 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Methylobacteriaceae(1.0000),g:Methylobacterium(1.0000),s:Methylobacterium_populi(0.4300) OTU_22 0,01603 0,00739 0,00532 0,00805 0,01091 0,00384 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Pseudomonadales(1.0000),f:Moraxellaceae(1.0000),g:Acinetobacter(1.0000),s:Acinetobacter_sp._MUB1(0.4300) OTU_116 0,00000 0,00158 0,00000 0,00000 0,00333 0,00000 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Bacilli(1.0000),o:Lactobacillales(1.0000),f:Streptococcaceae(1.0000),g:Streptococcus(1.0000),s:Streptococcus_oralis(0.1900) OTU_58 0,00000 0,01803 0,00281 0,00000 0,00911 0,00192 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Rhizobiaceae(0.9800),g:Ensifer(0.9600),s:Sinorhizobium_fredii(0.9000) OTU_4 0,02976 0,06811 0,00622 0,09809 0,08949 0,01700 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Sphingobacteriia(1.0000),o:Sphingobacteriales(1.0000),f:Sphingobacteriaceae(1.0000),g:Pedobacter(0.9100),s:Bacteroidetes_bacterium_EC2(0.9100) OTU_6 0,03499 0,03412 0,00216 0,06458 0,05281 0,00811 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Rhizobiaceae(1.0000),g:Rhizobium(1.0000),s:Rhizobium_straminoryzae(0.3800) OTU_13 0,11393 0,02187 0,00426 0,01926 0,01605 0,00391 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Streptomycetales(1.0000),f:Streptomycetaceae(1.0000),g:Streptomyces(0.7500),s:Streptomyces_sp._QLS01(0.3600) OTU_9 0,00000 0,00336 0,00000 0,08241 0,00785 0,00500 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Sphingomonadales(1.0000),f:Sphingomonadaceae(0.9900),g:Novosphingobium(0.6800),s:Sphingomonas_sp._SB5(0.3700) OTU_24 0,03065 0,00654 0,02077 0,00000 0,02414 0,00298 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Sphingobacteriia(1.0000),o:Sphingobacteriales(1.0000),f:Chitinophagaceae(1.0000),g:Chitinophaga(1.0000),s:Chitinophaga_filiformis(0.9300) OTU_31 0,04926 0,00670 0,00000 0,00000 0,01821 0,00271 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(1.0000),f:Burkholderiaceae(0.9900),g:Limnobacter(0.9900),s:drinking_water_bacterium_MB16(0.1100) OTU_27 0,00144 0,03068 0,00165 0,00000 0,02780 0,00976 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Caulobacterales(1.0000),f:Caulobacteraceae(1.0000),g:Brevundimonas(1.0000),s:Brevundimonas_sp._N17(0.3800) OTU_51 0,00000 0,00449 0,05831 0,00000 0,00316 0,00099

k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Sphingobacteriia(1.0000),o:Sphingobacteriales(1.0000),f:Chitinophagaceae(1.0000),g:Parasegetibacter(1.0000) OTU_25 0,03028 0,00925 0,00481 0,00000 0,01524 0,00152 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Sphingobacteriia(1.0000),o:Sphingobacteriales(1.0000),f:Sphingobacteriaceae(1.0000),g:Nubsella(0.9700),s:Nubsella_zeaxanthinifaciens(0.6400) OTU_70 0,00000 0,00000 0,04205 0,00000 0,00000 0,00510 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhodobacterales(1.0000),f:Rhodobacteraceae(1.0000),g:Rhodobacter(0.8700),s:Rhodobacter_sp._WS22(0.6000) OTU_44 0,01343 0,00451 0,00000 0,00000 0,01717 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Pasteurellales(1.0000),f:Pasteurellaceae(1.0000),g:Actinobacillus(0.3300),s:Actinobacillus_porcinus(0.2800) OTU_71 0,00000 0,02605 0,00267 0,00000 0,00485 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(0.9900),o:Burkholderiales(0.9600),f:Oxalobacteraceae(0.9600),g:Massilia(0.9600),s:Janthinobacterium_sp._IARI-PL7(0.5400) OTU_159 0,02485 0,00167 0,00464 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Hyphomicrobiaceae(1.0000),g:Devosia(0.8800),s:Devosia_yakushimensis(0.4600) OTU_80 0,00000 0,00000 0,02616 0,00000 0,00000 0,00154 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Bradyrhizobiaceae(0.9400),g:Rhodopseudomonas(0.4900),s:Rhodopseudomonas_palustris_BisA53(0.2200) OTU_226 0,00000 0,00000 0,02394 0,00000 0,00000 0,00172 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(1.0000),f:Comamonadaceae(1.0000),g:Aquabacterium(0.9100),s:Comamonas_margaretae(0.0500) OTU_90 0,00000 0,00605 0,00000 0,00000 0,00943 0,00702 k:Bacteria(1.0000),p:Verrucomicrobia(1.0000),c:Spartobacteria(1.0000),o:Chthoniobacterales(1.0000),f:FukuN18_freshwater_group(1.0000) OTU_124 0,00000 0,00000 0,02037 0,00000 0,00000 0,00171 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Xanthomonadales(1.0000),f:Xanthomonadaceae(1.0000),g:Dyella(1.0000),s:Dyella_sp._JP1(0.8200) OTU_26 0,00000 0,00131 0,00091 0,01413 0,00481 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Caulobacterales(1.0000),f:Caulobacteraceae(1.0000),g:Brevundimonas(1.0000),s:Brevundimonas_sp._Y10(0.7600) OTU_109 0,00000 0,00000 0,02101 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Corynebacteriales(1.0000),f:Nocardiaceae(1.0000),g:Gordonia(1.0000),s:Gordonia_terrae(0.5700) OTU_56 0,00000 0,00527 0,00000 0,00000 0,01451 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(1.0000),f:Oxalobacteraceae(0.9000),g:Massilia(0.8300),s:beta_proteobacterium_HJ12(0.3800) OTU_517 0,00794 0,00361 0,00000 0,00331 0,00300 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Caulobacterales(1.0000),f:Caulobacteraceae(1.0000),g:Phenylobacterium(1.0000),s:Phenylobacterium_sp._T2-YC6777(0.8600) OTU_91 0,00000 0,00187 0,01205 0,00247 0,00000 0,00102 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Methylobacteriaceae(1.0000),g:Methylobacterium(1.0000),s:Methylobacterium_oxalidis(0.6200) OTU_49 0,00000 0,00098 0,00000 0,01352 0,00281 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Sphingomonadales(1.0000),f:Sphingomonadaceae(0.9900),g:Novosphingobium(0.8300),s:Novosphingobium_sp._CC-ALB-2(0.1000) OTU_67 0,00788 0,00146 0,00388 0,00394 0,00000 0,00000 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Sphingobacteriia(1.0000),o:Sphingobacteriales(1.0000),f:Chitinophagaceae(1.0000),g:Ferruginibacter(0.0400) OTU_110 0,00000 0,00000 0,01653 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Micrococcales(1.0000),f:Micrococcaceae(1.0000),g:Sinomonas(0.9500),s:Sinomonas_atrocyanea(0.9500) OTU_21 0,00518 0,00632 0,00279 0,00000 0,00077 0,00102 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Propionibacteriales(1.0000),f:Nocardioidaceae(1.0000),g:Nocardioides(1.0000),s:unidentified(0.0100) OTU_81 0,00000 0,00720 0,00000 0,00000 0,00783 0,00101 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Propionibacteriales(1.0000),f:Nocardioidaceae(1.0000),g:Nocardioides(1.0000),s:unidentified_eubacterium_clone_FJ21-A(0.4800) OTU_122 0,00000 0,00000 0,01389 0,00000 0,00000 0,00203 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhodospirillales(1.0000),f:Rhodospirillaceae(1.0000),g:Azospirillum(1.0000),s:Azospirillum_brasilense(1.0000) OTU_47 0,00000 0,00000 0,01274 0,00000 0,00306 0,00000 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Sphingobacteriia(1.0000),o:Sphingobacteriales(1.0000),f:Chitinophagaceae(1.0000),g:Flavisolibacter(0.6900),s:Flavisolibacter_ginsengisoli(0.0100) OTU_63 0,00816 0,00344 0,00000 0,00417 0,00000 0,00000 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Sphingobacteriia(1.0000),o:Sphingobacteriales(1.0000),f:Chitinophagaceae(1.0000),g:Taibaiella(1.0000),s:Taibaiella_chishuiensis(0.5800) OTU_120 0,00000 0,00000 0,01376 0,00000 0,00000 0,00155 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Brucellaceae(0.9600),g:Pseudochrobactrum(0.9400),s:Brucellaceae_bacterium_47211606(0.9300) OTU_126 0,00000 0,00073 0,01295 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Xanthomonadales(1.0000),f:Xanthomonadaceae(1.0000),g:Pseudoxanthomonas(1.0000),s:Pseudoxanthomonas_mexicana(1.0000) OTU_52 0,00588 0,00000 0,00664 0,00000 0,00000 0,00093 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Sphingobacteriia(1.0000),o:Sphingobacteriales(1.0000),f:Chitinophagaceae(1.0000),g:Flavisolibacter(1.0000),s:Flavisolibacter_ginsengisoli(0.7700) OTU_60 0,00640 0,00609 0,00000 0,00000 0,00093 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(0.9600),o:Sphingomonadales(0.9600),f:Sphingomonadaceae(0.9300),g:Sphingomonas(0.9200),s:bacterium_815Y(0.7700) OTU_291 0,00000 0,00000 0,00868 0,00000 0,00426 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Beijerinckiaceae(0.9500),g:Chelatococcus(0.7100),s:Chelatococcus_sp._BSN07(0.3600) OTU_130 0,00000 0,00000 0,01258 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Bacteroidetes_VC2.1_Bac22(1.0000) OTU_132 0,00000 0,00000 0,01225 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Deltaproteobacteria(1.0000),o:Myxococcales(1.0000),f:Cystobacteraceae(0.9800),g:Melittangium(0.6500),s:Melittangium_boletus(0.6500) OTU_287 0,00000 0,00000 0,00000 0,00000 0,00000 0,01175 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(1.0000),f:Comamonadaceae(1.0000),g:Pelomonas(0.7900),s:bacterium_G23(0.7800) OTU_269 0,00000 0,00000 0,00000 0,01142 0,00000 0,00000

k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Rhizobiaceae(0.9900),g:Shinella(0.7700),s:Rhizobium_sp._RZ6(0.7700) OTU_92 0,00750 0,00378 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Sphingobacteriia(1.0000),o:Sphingobacteriales(1.0000),f:Chitinophagaceae(1.0000),g:Chitinophaga(1.0000),s:Chitinophaga_sp._MJM_38(1.0000) OTU_215 0,00000 0,00096 0,00000 0,00670 0,00350 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Bradyrhizobiaceae(1.0000),g:Bosea(1.0000),s:Afipia_genosp._9(0.4100) OTU_53 0,00000 0,00000 0,00577 0,00449 0,00079 0,00000 k:Bacteria(1.0000),p:Armatimonadetes(1.0000),c:Fimbriimonas_ginsengisoli_Gsoil_348(0.1000) OTU_142 0,00000 0,00000 0,01097 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Actinobacteria(0.9900),c:Actinobacteria(0.9900),o:Micrococcales(0.9900),f:Micrococcaceae(0.9900),g:Arthrobacter(0.9900),s:Arthrobacter_sp._FV1-1(0.2500) OTU_429 0,00194 0,00650 0,00000 0,00000 0,00149 0,00087 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Caulobacterales(0.9800),f:Caulobacteraceae(0.9800),g:Caulobacter(0.6000),s:Caulobacter_mirabilis(0.4700) OTU_2695 0,00000 0,00000 0,00975 0,00000 0,00000 0,00090 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Micrococcales(1.0000),f:Microbacteriaceae(1.0000),g:Curtobacterium(0.9700),s:Curtobacterium_flaccumfaciens_pv._basellae(0.6200) OTU_30 0,00000 0,00292 0,00255 0,00000 0,00000 0,00457 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Sphingomonadales(1.0000),f:Sphingomonadaceae(0.9900),g:Sphingomonas(0.9900),s:Sphingomonas_abaci(0.2700) OTU_271 0,00337 0,00090 0,00000 0,00000 0,00573 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Xanthomonadales(1.0000),f:Xanthomonadaceae(1.0000),g:Lysobacter(1.0000),s:Lysobacter_sp._KO_CM43(0.9700) OTU_69 0,00230 0,00284 0,00000 0,00000 0,00445 0,00000 k:Bacteria(1.0000),p:Planctomycetes(1.0000),c:Planctomycetacia(1.0000),o:Planctomycetales(1.0000),f:Planctomycetaceae(1.0000),g:Isosphaera(0.9900) OTU_134 0,00000 0,00000 0,00928 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Sphingobacteriia(1.0000),o:Sphingobacteriales(1.0000),f:Chitinophagaceae(1.0000),g:Niastella(1.0000),s:Niastella_populi(0.8800) OTU_32 0,00000 0,00194 0,00000 0,00727 0,00000 0,00000 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Flavobacteriia(1.0000),o:Flavobacteriales(1.0000),f:Flavobacteriaceae(1.0000),g:Flavobacterium(1.0000),s:Flavobacterium_sp._YIM_97465(0.2400) OTU_145 0,00000 0,00000 0,00902 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Bacilli(1.0000),o:Bacillales(1.0000),f:Paenibacillaceae(0.9600),g:Cohnella(0.8200),s:Cohnella_soli(0.1900) OTU_88 0,00503 0,00294 0,00000 0,00079 0,00000 0,00000 k:Bacteria(1.0000),p:Cyanobacteria(1.0000),c:Cyanobacteria(1.0000),o:SubsectionI(1.0000),f:FamilyI(1.0000),g:Mastigocladopsis(1.0000) OTU_833 0,00000 0,00239 0,00000 0,00000 0,00480 0,00145 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Pseudonocardiales(1.0000),f:Pseudonocardiaceae(1.0000),g:Actinophytocola(0.7200),s:Actinophytocola_sp._I10A-01801(0.3600) OTU_37 0,00000 0,00000 0,00000 0,00000 0,00832 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Caulobacterales(1.0000),f:Caulobacteraceae(1.0000),g:Caulobacter(1.0000),s:Caulobacter_endosymbiont_of_Tamarixia_radiata(0.5400) OTU_55 0,00782 0,00000 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Caulobacterales(1.0000),f:Caulobacteraceae(1.0000),g:Phenylobacterium(0.9000),s:Afipia_genosp._14(0.5200) OTU_141 0,00000 0,00000 0,00777 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Verrucomicrobia(1.0000),c:Opitutae(1.0000),o:Opitutales(0.9300),f:Opitutaceae(0.9300),g:Opitutus(0.9300),s:Verrucomicrobia_sp._TSB47(0.0900) OTU_62 0,00000 0,00000 0,00000 0,00753 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Methylophilales(1.0000),f:Methylophilaceae(1.0000),g:Methylophilus(0.9600),s:Methylotenera_mobilis(0.2900) OTU_77 0,00451 0,00000 0,00000 0,00299 0,00000 0,00000 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Sphingobacteriia(1.0000),o:Sphingobacteriales(1.0000),f:Sphingobacteriaceae(1.0000),g:Mucilaginibacter(0.9900),s:Sphingobacterium-like_sp._PC1.9(0.9900) OTU_28 0,00218 0,00073 0,00000 0,00451 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(0.9600),f:Oxalobacteraceae(0.9500),g:Massilia(0.8000),s:Massilia_sp._UMI-21(0.5000) OTU_1183 0,00701 0,00000 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Bacilli(1.0000),o:Bacillales(1.0000),f:Paenibacillaceae(1.0000),g:Paenibacillus(1.0000),s:Paenibacillus_cellulosilyticus(0.9800) OTU_82 0,00495 0,00204 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Sphingomonadales(1.0000),f:Sphingomonadaceae(1.0000),g:Sphingopyxis(1.0000),s:Sphingopyxis_sp._DG892(0.4900) OTU_123 0,00000 0,00000 0,00620 0,00000 0,00000 0,00075 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhodobacterales(0.9900),f:Rhodobacteraceae(0.9900),g:Rubellimicrobium(0.9300),s:Rubellimicrobium_aerolatum(0.0200) OTU_292 0,00000 0,00000 0,00000 0,00000 0,00000 0,00689 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Flavobacteriia(1.0000),o:Flavobacteriales(1.0000),f:Flavobacteriaceae(1.0000),g:Moheibacter(1.0000),s:Moheibacter_sediminis(0.2900) OTU_162 0,00000 0,00000 0,00684 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Sphingomonadales(1.0000),f:Sphingomonadaceae(1.0000),g:Sphingomonas(1.0000),s:Sphingomonas_paucimobilis(0.5700) OTU_2028 0,00237 0,00185 0,00000 0,00000 0,00161 0,00079 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Methylophilales(1.0000),f:Methylophilaceae(1.0000),g:Methylotenera(0.5500),s:Methylophilus_sp._EHg7(0.1600) OTU_46 0,00418 0,00000 0,00000 0,00164 0,00078 0,00000 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Pseudonocardiales(1.0000),f:Pseudonocardiaceae(1.0000),g:Pseudonocardia(0.9400),s:Pseudonocardia_alni(0.4300) OTU_59 0,00000 0,00000 0,00248 0,00000 0,00408 0,00000 k:Bacteria(1.0000),p:Planctomycetes(1.0000),c:Planctomycetacia(1.0000),o:Planctomycetales(1.0000),f:Planctomycetaceae(1.0000),g:Planctomyces(1.0000),s:Planctomyces_sp._Io1-3(0.9400) OTU_167 0,00000 0,00000 0,00630 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Phyllobacteriaceae(0.9600),g:Mesorhizobium(0.9600),s:Mesorhizobium_plurifarium(0.7000) OTU_66 0,00414 0,00000 0,00000 0,00119 0,00093 0,00000 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Bacilli(1.0000),o:Bacillales(1.0000),f:Paenibacillaceae(0.9400),g:Cohnella(0.9400),s:Cohnella_sp._G13(0.3000) OTU_94 0,00000 0,00326 0,00000 0,00089 0,00198 0,00000

k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Bacilli(0.9900),o:Lactobacillales(0.9900),f:Streptococcaceae(0.9900),g:Streptococcus(0.9900),s:Streptococcus_salivarius_subsp._thermophilus(0.1600) OTU_1092 0,00000 0,00343 0,00000 0,00000 0,00092 0,00169 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Neisseriales(1.0000),f:Neisseriaceae(1.0000),g:Neisseria(1.0000),s:Neisseria_meningitidis(0.0100) OTU_151 0,00000 0,00179 0,00158 0,00000 0,00166 0,00085 k:Bacteria(1.0000),p:Gemmatimonadetes(1.0000),c:Gemmatimonadetes(1.0000),o:Gemmatimonadales(1.0000),f:Gemmatimonadaceae(1.0000),g:Gemmatimonas(1.0000),s:Gemmatimonas_aurantiaca(0.4600) OTU_190 0,00000 0,00000 0,00498 0,00000 0,00000 0,00084 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhodobacterales(0.9700),f:Rhodobacteraceae(0.9700),g:Paracocccus(0.8700),s:Paracoccus_sp._PaH2.06a(0.3400) OTU_102 0,00000 0,00570 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Bacteroidetes(0.9900),c:Cytophagia(0.9900),o:Cytophagales(0.9900),f:Cytophagaceae(0.9900),g:Dyadobacter(0.9900),s:Dyadobacter_fermentans(0.8500) OTU_174 0,00084 0,00000 0,00000 0,00240 0,00236 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rickettsiales(1.0000),f:Mitochondria(1.0000),g:Pythium_ultimum(0.7500) OTU_198 0,00000 0,00544 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Caulobacterales(1.0000),f:Caulobacteraceae(1.0000),g:Asticcacaulis(1.0000),s:Asticcacaulis_sp._ZFGT-14(0.0500) OTU_57 0,00220 0,00000 0,00000 0,00296 0,00000 0,00000 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Corynebacteriales(1.0000),f:Nocardiaceae(1.0000),g:Nocardia(1.0000),s:Nocardia_carnea(0.8800) OTU_79 0,00000 0,00000 0,00000 0,00000 0,00505 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Deltaproteobacteria(1.0000),o:Bdellovibrionales(1.0000),f:Bacteriovoracaceae(1.0000),g:Peredibacter(1.0000),s:Bacteriovorax_sp._EPC3(0.9400) OTU_251 0,00000 0,00000 0,00313 0,00000 0,00000 0,00191 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Pseudomonadales(1.0000),f:Moraxellaceae(1.0000),g:Acinetobacter(1.0000),s:Acinetobacter_sp._DS1(0.8800) OTU_1915 0,00000 0,00000 0,00478 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Sphingobacteriia(1.0000),o:Sphingobacteriales(1.0000),f:Chitinophagaceae(1.0000),g:Flavisolibacter(1.0000),s:Bacteroidetes_bacterium_RG1-1(0.9900) OTU_97 0,00274 0,00198 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Propionibacteriales(1.0000),f:Nocardioidaceae(0.9900),g:Nocardioides(0.9700),s:Nocardioides_perillae(0.8400) OTU_2364 0,00000 0,00470 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Flavobacteriia(1.0000),o:Flavobacteriales(1.0000),f:Flavobacteriaceae(1.0000),g:Chryseobacterium(1.0000),s:Chryseobacterium_sp._KBL621(0.7000) OTU_175 0,00000 0,00000 0,00469 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Verrucomicrobia(1.0000),c:Spartobacteria(1.0000),o:Chthoniobacterales(1.0000),f:FukuN18_freshwater_group(1.0000),g:Spartobacteria_bacterium_Gsoil_133(0.2700) OTU_221 0,00000 0,00000 0,00453 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(0.9500),f:Burkholderiaceae(0.8600),g:Ralstonia(0.7600),s:Ralstonia_sp._C13(0.1300) OTU_2884 0,00449 0,00000 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Methylobacteriaceae(0.9900),g:Methylobacterium(0.9900),s:Methylobacterium_adhaesivum(0.0900) OTU_149 0,00000 0,00000 0,00430 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Sphingobacteriia(1.0000),o:Sphingobacteriales(1.0000),f:Chitinophagaceae(1.0000),g:Chitinophaga(1.0000),s:Chitinophaga_sp._37C7(0.7900) OTU_233 0,00000 0,00000 0,00417 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Verrucomicrobia(1.0000),c:Verrucomicrobiae(1.0000),o:Verrucomicrobiales(1.0000),f:Verrucomicrobiaceae(1.0000),g:Luteolibacter(0.5400),s:Luteolibacter_sp._JJ2210(0.5400) OTU_146 0,00000 0,00000 0,00403 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(1.0000),f:Comamonadaceae(0.9900),g:Methylibium(0.5100),s:Methylibium_sp._T2-YC6780(0.1300) OTU_139 0,00323 0,00075 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Sphingomonadales(1.0000),f:Sphingomonadaceae(1.0000),g:Novosphingobium(0.9800),s:Novosphingobium_sp._APW5(0.7700) OTU_65 0,00392 0,00000 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Phyllobacteriaceae(0.8300),g:Mesorhizobium(0.5700),s:Mesorhizobium_sp._Acj_104(0.4000) OTU_1273 0,00000 0,00000 0,00389 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Chlorobi(1.0000),c:Chlorobia(1.0000),o:Chlorobiales(1.0000),f:OPB56(1.0000),g:unidentified_Cytophagales/green_sulfur_bacterium_OPB56(0.5300) OTU_202 0,00000 0,00000 0,00298 0,00000 0,00000 0,00076 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Sphingobacteriia(0.6600),o:Sphingobacteriales(0.6600),f:Sphingobacteriaceae(0.6600),g:Sphingobacterium(0.6600),s:Sphingobacterium_sp._GR11(0.6600) OTU_204 0,00000 0,00000 0,00360 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Bacilli(1.0000),o:Bacillales(1.0000),f:Paenibacillaceae(1.0000),g:Paenibacillus(1.0000),s:Paenibacillus_durus(0.2100) OTU_87 0,00000 0,00273 0,00000 0,00000 0,00000 0,00082 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Cytophagia(1.0000),o:Cytophagales(1.0000),f:Cytophagaceae(1.0000),g:Flexibacter(1.0000),s:Flexibacter_flexilis_subsp._pelliculosus(0.2900) OTU_96 0,00343 0,00000 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Sphingobacteriia(1.0000),o:Sphingobacteriales(1.0000),f:Sphingobacteriaceae(1.0000),g:Pedobacter(1.0000),s:Pedobacter_sp._AS82(0.6200) OTU_676 0,00000 0,00000 0,00342 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Methylobacteriaceae(0.9900),g:Methylobacterium(0.9900),s:Methylobacterium_komagatae(0.8700) OTU_50 0,00209 0,00127 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Cytophagia(1.0000),o:Cytophagales(1.0000),f:Cytophagaceae(1.0000),g:Dyadobacter(1.0000),s:Dyadobacter_fermentans_DSM_18053(0.7300) OTU_48 0,00238 0,00096 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Propionibacteriales(1.0000),f:Nocardioidaceae(1.0000),g:Nocardioides(1.0000),s:Nocardioides_ganghwensis(0.6500) OTU_571 0,00000 0,00175 0,00000 0,00000 0,00152 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(1.0000),f:Comamonadaceae(1.0000),g:Tepidimonas(0.9800),s:Tepidimonas_arfidensis(0.0600) OTU_328 0,00000 0,00000 0,00000 0,00000 0,00000 0,00324 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Corynebacteriales(1.0000),f:Nocardiaceae(1.0000),g:Nocardia(1.0000),s:Nocardia_nova(1.0000) OTU_104 0,00000 0,00000 0,00079 0,00000 0,00154 0,00088

k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rickettsiales(1.0000),f:Mitochondria(1.0000),g:Phytophthora_ramorum_[Sudden_oak_death_agent](0.7200) OTU_144 0,00000 0,00000 0,00000 0,00000 0,00000 0,00313 k:Bacteria(1.0000),p:Proteobacteria(0.9900),c:Alphaproteobacteria(0.9900),o:Rhizobiales(0.9900),f:Hyphomicrobiaceae(0.9300),g:Devosia(0.8700),s:Devosia_ginsengisoli(0.0600) OTU_728 0,00000 0,00000 0,00304 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Micrococcales(1.0000),f:Micrococcaceae(1.0000),g:Rothia(1.0000),s:bacterium_3D705(0.7000) OTU_169 0,00000 0,00301 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Flavobacteriia(1.0000),o:Flavobacteriales(1.0000),f:Flavobacteriaceae(1.0000),g:Chryseobacterium(1.0000),s:Chryseobacterium_sp._549(0.8300) OTU_129 0,00000 0,00000 0,00088 0,00000 0,00203 0,00000 k:Archaea(1.0000),p:Thaumarchaeota(1.0000),c:Soil_Crenarchaeotic_Group[SCG](0.9900),o:Crenarchaeota(0.1400) OTU_410 0,00000 0,00000 0,00000 0,00000 0,00000 0,00287 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Bacilli(1.0000),o:Bacillales(1.0000),f:Planococcaceae(0.8600),g:Lysinibacillus(0.7800),s:Lysinibacillus_sphaericus(0.4300) OTU_64 0,00000 0,00000 0,00000 0,00000 0,00282 0,00000 k:Bacteria(1.0000),p:Cyanobacteria(1.0000),c:Cyanobacteria(1.0000),o:SubsectionII(1.0000),f:FamilyII(1.0000),g:Chroococcidiopsis(1.0000),s:Chroococcidiopsis_sp._PCC_7431(0.8200) OTU_1665 0,00000 0,00000 0,00184 0,00000 0,00000 0,00079 k:Bacteria(1.0000),p:Fusobacteria(1.0000),c:Fusobacteriia(1.0000),o:Fusobacteriales(1.0000),f:Leptotrichiaceae(1.0000),g:Leptotrichia(1.0000) OTU_244 0,00000 0,00255 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Caulobacterales(1.0000),f:Caulobacteraceae(1.0000),g:Brevundimonas(0.9100),s:Brevundimonas_diminuta(0.3700) OTU_2163 0,00000 0,00000 0,00251 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Flavobacteriia(1.0000),o:Flavobacteriales(1.0000),f:Flavobacteriaceae(1.0000),g:Elizabethkingia(1.0000),s:bacterium_K2-70(0.9100) OTU_114 0,00000 0,00000 0,00249 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Bacteroidia(1.0000),o:Bacteroidales(1.0000),f:Prevotellaceae(1.0000),g:Prevotella_7(1.0000),s:Prevotella_veroralis(0.1100) OTU_303 0,00000 0,00247 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Propionibacteriales(1.0000),f:Nocardioidaceae(1.0000),g:Nocardioides(1.0000),s:Nocardioides_sp._CCBAU_101009(0.6600) OTU_74 0,00000 0,00164 0,00000 0,00000 0,00000 0,00082 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Cytophagia(1.0000),o:Cytophagales(1.0000),f:Cytophagaceae(1.0000),g:Larkinella(1.0000),s:Larkinella_bovis(0.6200) OTU_118 0,00076 0,00000 0,00000 0,00168 0,00000 0,00000 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Sphingobacteriia(1.0000),o:Sphingobacteriales(1.0000),f:Chitinophagaceae(1.0000),g:Flavihumibacter(0.3800),s:Flavobacteriaceae_bacterium_KACC_17467(0.3500) OTU_147 0,00242 0,00000 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rickettsiales(1.0000),f:Anaplasmataceae(1.0000),g:Wolbachia(1.0000),s:Wolbachia_sp.(0.9900) OTU_222 0,00000 0,00235 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:1174-901-12(0.9100),g:Rhizobiales_bacterium_Pao05(0.4700),s:Hyphomicrobium_denitrificans(0.0100) OTU_242 0,00000 0,00231 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(1.0000),f:Burkholderiaceae(1.0000),g:Cupriavidus(1.0000),s:Ralstonia_sp._KACC_91255(0.5500) OTU_136 0,00000 0,00000 0,00000 0,00000 0,00079 0,00145 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Corynebacteriales(1.0000),f:Mycobacteriaceae(1.0000),g:Mycobacterium(1.0000),s:Mycobacterium_sp._BJC15-C31(0.6200) OTU_1519 0,00000 0,00000 0,00000 0,00000 0,00222 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:MNG7(1.0000),g:Hyphomicrobium_sp._16-60(0.4600) OTU_107 0,00143 0,00078 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Pseudomonadales(1.0000),f:Pseudomonadaceae(1.0000),g:Pseudomonas(1.0000),s:Pseudomonas_sp._OK-5(0.9200) OTU_41 0,00219 0,00000 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Caulobacterales(1.0000),f:Caulobacteraceae(1.0000),g:Brevundimonas(1.0000),s:Brevundimonas_viscosa(0.8200) OTU_784 0,00000 0,00000 0,00000 0,00000 0,00214 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Caulobacterales(1.0000),f:Caulobacteraceae(1.0000),g:Phenylobacterium(0.9200),s:Phenylobacterium_lituiforme(0.9000) OTU_127 0,00000 0,00000 0,00000 0,00092 0,00108 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhodospirillales(1.0000),f:Rhodospirillales_Incertae_Sedis(1.0000),g:Reyranella(1.0000),s:alpha_proteobacterium_BAC233(0.6800) OTU_148 0,00000 0,00000 0,00199 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Sphingomonadales(1.0000),f:Sphingomonadaceae(0.9900),g:Sphingopyxis(0.9700),s:Sphingopyxis_sp._DNG2(0.5500) OTU_909 0,00000 0,00000 0,00196 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Micrococcales(1.0000),f:Promicromonosporaceae(1.0000),g:Cellulosimicrobium(1.0000),s:Cellulosimicrobium_sp._Chra-8(1.0000) OTU_75 0,00000 0,00000 0,00000 0,00000 0,00196 0,00000 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Bacilli(1.0000),o:Bacillales(1.0000),f:Paenibacillaceae(1.0000),g:Paenibacillus(1.0000),s:Paenibacillus_sp._436-1(0.9600) OTU_43 0,00000 0,00000 0,00000 0,00000 0,00195 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhodospirillales(1.0000),f:Acetobacteraceae(1.0000),g:Craurococcus(1.0000) OTU_679 0,00000 0,00000 0,00000 0,00000 0,00195 0,00000 k:Bacteria(1.0000),p:Fusobacteria(1.0000),c:Fusobacteriia(1.0000),o:Fusobacteriales(1.0000),f:Fusobacteriaceae(1.0000),g:Fusobacterium(1.0000),s:Fusobacterium_periodonticum(0.8600) OTU_275 0,00000 0,00000 0,00192 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(0.8800),c:Alphaproteobacteria(0.8700),o:Rickettsiales(0.8700),f:Mitochondria(0.8700),g:Zymoseptoria_tritici(0.4800),s:[Clostridium]_citroniae(0.0100) OTU_1389 0,00000 0,00000 0,00000 0,00000 0,00000 0,00190 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Pseudomonadales(1.0000),f:Pseudomonadaceae(1.0000),g:Pseudomonas(1.0000),s:Pseudomonas_sp._strain_1087(0.8900) OTU_187 0,00000 0,00000 0,00186 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rickettsiales(1.0000),f:Rickettsiaceae(1.0000),g:Rickettsia(1.0000),s:Rickettsia_sp._PAR_[pea_aphid_rickettsia](0.9900) OTU_39 0,00000 0,00000 0,00000 0,00000 0,00000 0,00183

k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Sphingobacteriia(1.0000),o:Sphingobacteriales(1.0000),f:Chitinophagaceae(1.0000),g:Hydrotalea(0.8900),s:Sediminibacterium_salmoneum(0.0400) OTU_164 0,00182 0,00000 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Beijerinckiaceae(0.9800),g:Rhizobium(0.0200) OTU_219 0,00000 0,00000 0,00179 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Micrococcales(1.0000),f:Micrococcaceae(1.0000),g:Micrococcus(1.0000),s:Micrococcus_luteus(0.6800) OTU_1207 0,00000 0,00178 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Cyanobacteria(1.0000),c:Chloroplast(1.0000),o:Acutodesmus_obliquus(0.7100) OTU_163 0,00174 0,00000 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Flavobacteriia(1.0000),o:Flavobacteriales(1.0000),f:Flavobacteriaceae(1.0000),g:Flavobacterium(1.0000),s:Flavobacterium_sp._TISTR_1610(0.9800) OTU_2126 0,00000 0,00000 0,00169 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(1.0000),f:Burkholderiaceae(0.9500),g:Burkholderia(0.8900),s:Burkholderia_sp.(0.1100) OTU_267 0,00169 0,00000 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Propionibacteriales(1.0000),f:Nocardioidaceae(1.0000),g:Aeromicrobium(0.9900),s:Aeromicrobium_kwangyangensis(0.7000) OTU_181 0,00000 0,00000 0,00000 0,00000 0,00166 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Xanthomonadales(1.0000),f:Xanthomonadaceae(1.0000),g:Rhodanobacter(0.0100) OTU_111 0,00165 0,00000 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Sphingobacteriia(1.0000),o:Sphingobacteriales(1.0000),f:Sphingobacteriaceae(1.0000),g:Mucilaginibacter(1.0000),s:proteobacterium_symbiont_of_Nilaparvata_lugens(0.3800) OTU_152 0,00000 0,00000 0,00000 0,00074 0,00085 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Hyphomicrobiaceae(1.0000),g:Devosia(1.0000),s:Devosia_sp._CZGSY5(0.9500) OTU_544 0,00000 0,00000 0,00000 0,00000 0,00159 0,00000 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Propionibacteriales(1.0000),f:Nocardioidaceae(1.0000),g:Nocardioides(1.0000),s:Nocardioides_alkalitolerans(0.2200) OTU_258 0,00000 0,00000 0,00000 0,00000 0,00000 0,00154 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhodospirillales(1.0000),f:Acetobacteraceae(1.0000),g:Craurococcus(1.0000) OTU_1995 0,00000 0,00000 0,00000 0,00000 0,00146 0,00000 k:Bacteria(1.0000),p:Deinococcus-Thermus(1.0000),c:Deinococci(1.0000),o:Deinococcales(1.0000),f:Deinococcaceae(1.0000),g:Deinococcus(1.0000),s:Deinococcus_sp._5A5(0.5400) OTU_366 0,00000 0,00000 0,00000 0,00000 0,00143 0,00000 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Micrococcales(1.0000),f:Dermatophilaceae(0.9700),g:Dermatophilus(0.8800),s:Dermatophilus_sp._AD3(0.6500) OTU_625 0,00000 0,00000 0,00000 0,00000 0,00000 0,00139 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Xanthomonadales(1.0000),f:Xanthomonadaceae(1.0000),g:Silanimonas(1.0000),s:Lysobacter_xinjiangensis(0.4500) OTU_1492 0,00000 0,00000 0,00000 0,00000 0,00000 0,00139 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Propionibacteriales(1.0000),f:Nocardioidaceae(1.0000),g:Nocardioides(1.0000),s:Nocardioides_sp._MSL_24(0.7000) OTU_326 0,00000 0,00138 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:1174-901-12(1.0000) OTU_2109 0,00000 0,00137 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Rhizobiales_Incertae_Sedis(1.0000),g:Phreatobacter(1.0000) OTU_105 0,00000 0,00136 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Frankiales(1.0000),f:Frankiaceae(0.0100),g:Frankia(0.0100),s:Frankia_sp.(0.0100) OTU_199 0,00000 0,00000 0,00000 0,00000 0,00136 0,00000 k:Bacteria(1.0000),p:Fusobacteria(1.0000),c:Fusobacteriia(1.0000),o:Fusobacteriales(1.0000),f:Leptotrichiaceae(1.0000),g:Leptotrichia(1.0000),s:Leptotrichia_sp._PTE15(0.5400) OTU_299 0,00000 0,00136 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Acidobacteria(1.0000),c:Acidobacteria(1.0000),o:Acidobacteriales(1.0000),f:Acidobacteriaceae_[Subgroup_1](1.0000),g:Bryocella(0.7400),s:Granulicella_pectinivorans(0.1100) OTU_355 0,00000 0,00131 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Cytophagia(1.0000),o:Cytophagales(1.0000),f:Cytophagaceae(1.0000),g:Spirosoma(1.0000) OTU_138 0,00000 0,00000 0,00000 0,00130 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Rhizobiales_Incertae_Sedis(0.9700),g:Alsobacter(0.9700) OTU_188 0,00130 0,00000 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Methylophilales(1.0000),f:Methylophilaceae(1.0000),g:Methylobacillus(0.8200),s:Methylobacillus_flagellatus(0.3900) OTU_89 0,00000 0,00000 0,00000 0,00128 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Pseudomonadales(1.0000),f:Moraxellaceae(1.0000),g:Acinetobacter(1.0000),s:Acinetobacter_radioresistens(0.7900) OTU_862 0,00000 0,00000 0,00000 0,00000 0,00000 0,00126 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Sphingomonadales(1.0000),f:Sphingomonadaceae(0.9900),g:Sphingobium(0.9600),s:Pseudomonas_sp._DS7(0.4400) OTU_137 0,00122 0,00000 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Micrococcales(1.0000),f:Microbacteriaceae(1.0000),g:Gryllotalpicola(1.0000),s:Gryllotalpicola_koreensis(0.8700) OTU_166 0,00000 0,00000 0,00121 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Deltaproteobacteria(1.0000),o:Myxococcales(1.0000),f:Cystobacteraceae(1.0000),g:Melittangium(0.9400),s:Melittangium_lichenicola(0.9400) OTU_313 0,00000 0,00000 0,00000 0,00000 0,00000 0,00119 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Pseudomonadales(1.0000),f:Moraxellaceae(1.0000),g:Acinetobacter(1.0000),s:Arthrobacter_sp._PD8(0.1800) OTU_2577 0,00000 0,00000 0,00000 0,00000 0,00000 0,00118 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Pseudomonadales(1.0000),f:Pseudomonadaceae(1.0000),g:Pseudomonas(1.0000),s:Pseudomonas_stutzeri(0.5000) OTU_1307 0,00000 0,00000 0,00000 0,00000 0,00117 0,00000 k:Bacteria(1.0000),p:Cyanobacteria(1.0000),c:Chloroplast(1.0000),o:Watanabea_reniformis(0.2400) OTU_2270 0,00000 0,00116 0,00000 0,00000 0,00000 0,00000

k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Gammaproteobacteria(1.0000),o:Enterobacteriales(1.0000),f:Enterobacteriaceae(1.0000),g:Pantoea(0.7800),s:Pantoea_stewartii_subsp._stewartii(0.2200) OTU_2753 0,00000 0,00000 0,00000 0,00000 0,00000 0,00115 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Bacilli(1.0000),o:Bacillales(1.0000),f:Paenibacillaceae(1.0000),g:Paenibacillus(1.0000),s:Paenibacillus_sp._TY17OpD(0.7300) OTU_769 0,00113 0,00000 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Firmicutes(0.9800),c:Bacilli(0.9800),o:Bacillales(0.9800),f:Paenibacillaceae(0.9000),g:Paenibacillus(0.9000),s:Paenibacillus_sp._J20-6(0.3800) OTU_99 0,00000 0,00112 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Methylobacteriaceae(1.0000),g:Microvirga(1.0000),s:Microvirga_lupini(0.4400) OTU_182 0,00000 0,00112 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Methylobacteriaceae(0.9500),g:Methylobacterium(0.8900),s:Methylobacterium_suomiense(0.2500) OTU_877 0,00000 0,00000 0,00000 0,00109 0,00000 0,00000 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Sphingobacteriia(1.0000),o:Sphingobacteriales(1.0000),f:Sphingobacteriaceae(1.0000),g:Sphingobacterium(1.0000),s:Sphingobacterium_spiritivorum(0.3600) OTU_296 0,00000 0,00000 0,00108 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Rhizobiaceae(0.9800),g:Rhizobium(0.9800),s:Rhizobium_mesoamericanum(0.3600) OTU_165 0,00106 0,00000 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Propionibacteriales(1.0000),f:Nocardioidaceae(1.0000),g:Marmoricola(1.0000),s:Marmoricola_sp._Gsoil_818(1.0000) OTU_214 0,00000 0,00000 0,00000 0,00000 0,00106 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(0.9200),f:Comamonadaceae(0.3800),g:Ramlibacter(0.2100),s:Ramlibacter_tataouinensis(0.0700) OTU_1208 0,00103 0,00000 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Propionibacteriales(1.0000),f:Nocardioidaceae(1.0000),g:Nocardioides(0.9900),s:unidentified(0.0200) OTU_342 0,00000 0,00000 0,00000 0,00000 0,00103 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(1.0000),f:Comamonadaceae(1.0000),g:Ramlibacter(0.7400),s:Ramlibacter_sp._7B-217(0.3900) OTU_1879 0,00102 0,00000 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Sphingobacteriia(1.0000),o:Sphingobacteriales(1.0000),f:Sphingobacteriaceae(1.0000),g:Arcticibacter(0.7000),s:Bacteroidetes_bacterium_OS-21A(0.0900) OTU_236 0,00000 0,00101 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Cytophagia(1.0000),o:Cytophagales(1.0000),f:Cytophagaceae(1.0000),g:Hymenobacter(1.0000),s:Hymenobacter_flocculans(0.0200) OTU_385 0,00000 0,00101 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Clostridia(1.0000),o:Clostridiales(1.0000),f:Family_XI(1.0000),g:Anaerococcus(1.0000),s:Anaerococcus_octavius(1.0000) OTU_330 0,00000 0,00000 0,00000 0,00000 0,00000 0,00100 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Micrococcales(1.0000),f:Micrococcaceae(1.0000),g:Rothia(1.0000),s:Rothia_mucilaginosa(0.4800) OTU_2000 0,00000 0,00000 0,00000 0,00000 0,00099 0,00000 k:Bacteria(1.0000),p:Cyanobacteria(1.0000),c:ML635J-21(1.0000) OTU_206 0,00000 0,00000 0,00000 0,00099 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Hyphomicrobiaceae(1.0000),g:Devosia(1.0000),s:Devosia_subaequoris(0.7900) OTU_73 0,00000 0,00098 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Sphingomonadales(1.0000),f:Sphingomonadaceae(0.9900),g:Sphingomonas(0.9700),s:Sphingomonadaceae_bacterium_TM7(0.2600) OTU_426 0,00000 0,00097 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Micrococcales(1.0000),f:Micrococcaceae(1.0000),g:Kocuria(0.9700),s:Kocuria_sp._2F(0.9100) OTU_261 0,00000 0,00097 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Chloroflexi(1.0000),c:Ktedonobacteria(1.0000),o:Ktedonobacterales(1.0000),f:Ktedonobacteraceae(1.0000) OTU_515 0,00000 0,00000 0,00000 0,00000 0,00000 0,00096 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Actinomycetales(1.0000),f:Actinomycetaceae(1.0000),g:Actinomyces(1.0000),s:Actinomyces_naeslundii(0.5400) OTU_213 0,00000 0,00000 0,00096 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(1.0000),f:Burkholderiaceae(1.0000),g:Burkholderia(1.0000),s:Burkholderia_sp._JBA3(0.6200) OTU_189 0,00096 0,00000 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Cytophagia(1.0000),o:Cytophagales(1.0000),f:Cytophagaceae(1.0000),g:Runella(1.0000),s:Runella_zeae(0.6400) OTU_205 0,00000 0,00000 0,00095 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Verrucomicrobia(1.0000),c:Opitutae(1.0000),o:Opitutales(1.0000),f:Opitutaceae(1.0000),g:Opitutus(0.9800),s:Verrucomicrobia_sp._TSB47(0.1300) OTU_500 0,00000 0,00000 0,00000 0,00094 0,00000 0,00000 k:Bacteria(1.0000),p:TM6(1.0000),c:candidate_division_TM6_bacterium_JCVI_TM6SC1(0.0100) OTU_140 0,00000 0,00000 0,00090 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Sphingobacteriia(1.0000),o:Sphingobacteriales(1.0000),f:Sphingobacteriaceae(1.0000),g:Pedobacter(1.0000),s:bacterium_Wuba47(0.9100) OTU_108 0,00000 0,00000 0,00000 0,00000 0,00000 0,00089 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Cytophagia(1.0000),o:Cytophagales(1.0000),f:Cytophagaceae(1.0000),g:Rudanella(1.0000),s:Rudanella_lutea(1.0000) OTU_158 0,00089 0,00000 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Aurantimonadaceae(0.9400),g:Aureimonas(0.9200),s:Aurantimonas_sp._AU22(0.9000) OTU_2405 0,00000 0,00000 0,00000 0,00000 0,00088 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(0.9800),f:Oxalobacteraceae(0.9700),g:Massilia(0.9000),s:beta_proteobacterium_HJ12(0.3000) OTU_1128 0,00087 0,00000 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Pseudonocardiales(0.9800),f:Pseudonocardiaceae(0.9800),g:Lentzea(0.5600),s:Lentzea_kentuckyensis(0.5200) OTU_356 0,00000 0,00000 0,00000 0,00000 0,00000 0,00087 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Bacilli(1.0000),o:Bacillales(1.0000),f:Paenibacillaceae(1.0000),g:Cohnella(0.9800),s:Cohnella_soli(0.7100) OTU_2392 0,00000 0,00087 0,00000 0,00000 0,00000 0,00000

k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rickettsiales(1.0000),f:Rickettsiales_Incertae_Sedis(1.0000),g:Candidatus_Odyssella(1.0000),s:Holosporaceae_bacterium_Serialkilleuse_9403403(0.3400) OTU_211 0,00000 0,00000 0,00086 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Corynebacteriales(1.0000),f:Corynebacteriaceae(1.0000),g:Corynebacterium(0.9900),s:Corynebacterium_durum(0.5100) OTU_387 0,00000 0,00000 0,00085 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Cyanobacteria(1.0000),c:Cyanobacteria(1.0000),o:SubsectionI(1.0000),f:FamilyI(1.0000),g:Chroogloeocystis(1.0000),s:Gloeocapsopsis_crepidinum_LEGE_06123(0.8800) OTU_1745 0,00000 0,00000 0,00000 0,00000 0,00000 0,00085 k:Bacteria(1.0000),p:Cyanobacteria(1.0000),c:Cyanobacteria(1.0000),o:SubsectionII(0.0300),f:FamilyII(0.0300),g:Chroococcidiopsis(0.0300) OTU_2299 0,00000 0,00000 0,00085 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Sphingomonadales(1.0000),f:Sphingomonadaceae(0.9500),g:Novosphingobium(0.7500),s:drinking_water_bacterium_Y15(0.4700) OTU_804 0,00085 0,00000 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Gemmatimonadetes(1.0000),c:Gemmatimonadetes(1.0000),o:Gemmatimonadales(1.0000),f:Gemmatimonadaceae(1.0000) OTU_229 0,00000 0,00000 0,00084 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Clostridia(1.0000),o:Clostridiales(1.0000),f:Family_XI(1.0000),g:Peptoniphilus(1.0000),s:Peptoniphilus_harei(0.1000) OTU_273 0,00000 0,00000 0,00000 0,00000 0,00000 0,00082 k:Bacteria(1.0000),p:Cyanobacteria(1.0000),c:Cyanobacteria(1.0000),o:SubsectionII(1.0000),f:FamilyI(1.0000),g:Stanieria(1.0000),s:Stanieria_cyanosphaera(0.5100) OTU_1326 0,00000 0,00000 0,00000 0,00000 0,00000 0,00080 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Clostridia(0.9700),o:Clostridiales(0.9700),f:Family_XVIII(0.9600),g:Paenibacillus(0.0200),s:Paenibacillus_sp._WP-BT2-8(0.0200) OTU_371 0,00000 0,00080 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(0.5500),f:Oxalobacteraceae(0.5500),g:Herminiimonas(0.5500),s:Methylophilus_sp._C2(0.0500) OTU_1045 0,00000 0,00000 0,00000 0,00000 0,00079 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Bradyrhizobiaceae(0.8200),g:Variibacter(0.1800) OTU_1902 0,00000 0,00000 0,00078 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Actinomycetales(1.0000),f:Actinomycetaceae(1.0000),g:Actinomyces(1.0000),s:Actinomyces_odontolyticus(0.3500) OTU_335 0,00000 0,00000 0,00078 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhodobacterales(0.9600),f:Rhodobacteraceae(0.9600),g:Paracocccus(0.8700),s:Paracoccus_sp._TM12(0.1600) OTU_1055 0,00000 0,00078 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Chlamydiae(1.0000),c:Chlamydiae(1.0000),o:Chlamydiales(1.0000),f:Parachlamydiaceae(1.0000),g:Candidatus_Protochlamydia(1.0000),s:Protochlamydia_naegleriophila(1.0000) OTU_212 0,00000 0,00000 0,00076 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(1.0000),f:Burkholderiaceae(1.0000),g:Cupriavidus(1.0000),s:Cupriavidus_sp._YN-8(0.2400) OTU_143 0,00000 0,00075 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Cytophagia(1.0000),o:Cytophagales(1.0000),f:Cytophagaceae(1.0000),g:Dyadobacter(1.0000),s:Dyadobacter_sp._DCB47(0.2800) OTU_331 0,00000 0,00000 0,00000 0,00000 0,00074 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhodospirillales(1.0000),f:Acetobacteraceae(1.0000),g:Roseomonas(1.0000),s:Roseomonas_mucosa(0.3900) OTU_186 0,00000 0,00000 0,00074 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Bacteroidetes(1.0000),c:Cytophagia(1.0000),o:Cytophagales(1.0000),f:Cytophagaceae(1.0000) OTU_217 0,00070 0,00000 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Actinobacteria(1.0000),c:Actinobacteria(1.0000),o:Micrococcales(1.0000),f:Cellulomonadaceae(1.0000),g:Cellulomonas(1.0000),s:Cellulomonas_sp._ZY-1(0.6200) OTU_61 0,00069 0,00000 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Bacilli(1.0000),o:Bacillales(1.0000),f:Paenibacillaceae(1.0000),g:Paenibacillus(1.0000),s:Paenibacillus_sp._TDSAS2-39(0.9300) OTU_40 0,00068 0,00000 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Betaproteobacteria(1.0000),o:Burkholderiales(0.8900),f:Comamonadaceae(0.5600),g:Pseudorhodoferax(0.2900),s:Acidovorax_sp._3Re21(0.0300) OTU_465 0,00067 0,00000 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Firmicutes(1.0000),c:Bacilli(1.0000),o:Bacillales(1.0000),f:Paenibacillaceae(1.0000),g:Paenibacillus(1.0000),s:Paenibacillus_sp._tjsxy2003-e-4(0.2700) OTU_113 0,00066 0,00000 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Cyanobacteria(0.9900),c:Chloroplast(0.9800),o:Acutodesmus_obliquus(0.6400),f:Paenibacillaceae(0.0100),g:Paenibacillus(0.0100),s:Paenibacillus_sp._M7-3(0.0100) OTU_856 0,00065 0,00000 0,00000 0,00000 0,00000 0,00000 k:Bacteria(1.0000),p:Proteobacteria(1.0000),c:Alphaproteobacteria(1.0000),o:Rhizobiales(1.0000),f:Xanthobacteraceae(1.0000),g:Labrys(1.0000),s:Labrys_portucalensis(1.0000) OTU_78 0,00000 0,00000 0,00000 0,00063 0,00000 0,00000

9. Anexos

9.1 Publicação

A Community-Based Culture Collection for Targeting Novel Plant Growth-Promoting Bacteria from the Sugarcane Microbiome

Jaderson Silveira Leite Armanhi1, 2, Rafael Soares Correa de Souza1, 2, Natália de Brito Damasceno1, 2, Laura M. de Araújo1, 2, Juan Imperial3, 4 and Paulo Arruda1, 2*

1 Centro de Biologia Molecular e Engenharia Genética, Universidade Estadual de Campinas, Campinas, Brazil, 2 Departamento de Genética e Evolução, Instituto de Biologia, Universidade Estadual de Campinas, Campinas, Brazil, 3 Centro de Biotecnología y Genómica de Plantas, Universidad Politécnica de Madrid, Instituto Nacional de Investigación y Tecnología Agraria y Alimentaria, Madrid, Spain 4 Consejo Superior de Investigaciones Científicas, Madrid, Spain.

ORIGINAL RESEARCH published: 04 January 2018 doi: 10.3389/fpls.2017.02191

A Community-Based Culture Collection for Targeting Novel Plant Growth-Promoting Bacteria from the Sugarcane Microbiome

Jaderson Silveira Leite Armanhi 1, 2,RafaelSoaresCorreadeSouza1, 2, Natália de Brito Damasceno 1, 2,LauraM.deAraújo1, 2, Juan Imperial 3, 4 and Paulo Arruda 1, 2*

1 Centro de Biologia Molecular e Engenharia Genética, Universidade Estadual de Campinas, Campinas, Brazil, 2 Departamento de Genética e Evolução, Instituto de Biologia, Universidade Estadual de Campinas, Campinas, Brazil, 3 Centro de Biotecnología y Genómica de Plantas, Universidad Politécnica de Madrid, Instituto Nacional de Investigación y Tecnología Agraria y Alimentaria, Madrid, Spain, 4 Consejo Superior de Investigaciones Cientíﬁcas, Madrid, Spain

Edited by: The soil-plant ecosystem harbors an immense microbial diversity that challenges Stéphane Hacquard, Max Planck Institute for Plant investigative approaches to study traits underlying plant-microbe association. Studies Breeding Research (MPG), Germany solely based on culture-dependent techniques have overlooked most microbial diversity. Reviewed by: Here we describe the concomitant use of culture-dependent and -independent Collin M. Timm, techniques to target plant-beneficial microbial groups fromthesugarcanemicrobiome. Applied Physics Laboratory, Johns Hopkins University, United States The community-based culture collection (CBC) approach was used to access microbes Vasvi Chaudhry, from roots and stalks. The CBC recovered 399 unique bacteria representing 15.9% of Institute of Microbial Technology (CSIR), India the rhizosphere core microbiome and 61.6–65.3% of the endophytic core microbiomes Yang Bai, of stalks. By cross-referencing the CBC (culture-dependent) with the sugarcane Max Planck Institute for Plant microbiome profile (culture-independent), we designed a synthetic community comprised Breeding Research (MPG), Germany of naturally occurring highly abundant bacterial groups from roots and stalks, most of *Correspondence: Paulo Arruda which has been poorly explored so far. We then used maize as a model to probe the [email protected] abundance-based synthetic inoculant. We show that when inoculated in maize plants, members of the synthetic community efficiently colonize plant organs, displace the Specialty section: This article was submitted to natural microbiota and dominate at 53.9% of the rhizosphere microbial abundance. As a Plant Microbe Interactions, result, inoculated plants increased biomass by 3.4-fold as compared to uninoculated asectionofthejournal Frontiers in Plant Science plants. The results demonstrate that abundance-based synthetic inoculants can be

Received: 06 October 2017 successfully applied to recover beneﬁcial plant microbes from plant microbiota. Accepted: 12 December 2017 Keywords: community-based culture collection (CBC), maize, microbiome, plant growth-promoting (PGP), Published: 04 January 2018 sugarcane, synthetic community Citation: Armanhi JSL, de Souza RSC, Damasceno NB, de Araújo LM, INTRODUCTION Imperial J and Arruda P (2018) A Community-Based Culture Collection Microbial community proﬁling by culture-independent techniques has transformed our knowledge for Targeting Novel Plant Growth-Promoting Bacteria from the of the diversity and extent of plant-associated microbiomes (Bulgarelli et al., 2012, 2013, 2015; Sugarcane Microbiome. Lundberg et al., 2012; Edwards et al., 2015; Panke-Buisse et al., 2015; Zarraonaindia et al., 2015; Front. Plant Sci. 8:2191. Coleman-Derr et al., 2016; Castrillo et al., 2017). Culturing representative microbes of plant- doi: 10.3389/fpls.2017.02191 associated microbiota and performing direct inoculation experiments are therefore crucial steps

Frontiers in Plant Science | www.frontiersin.org 1 January 2018 | Volume 8 | Article 2191 Armanhi et al. Plant Growth-Promoting Bacteria from Sugarcane toward understanding the mechanisms involved in growth of whether they comprise single or multiple microorganisms, promotion, interspecies interactions and community assemblage therefore, allowing culturing communities instead of solely pure (Zengler et al., 2002; Vartoukian et al., 2010; Bai et al., 2015; colonies. Lebeis et al., 2015; Castrillo et al., 2017; Finkel et al., 2017). Here, we present a strategy to target and investigate Several studies have reported the beneficial contributions ofkey plant growth-promoting (PGP) bacteria based on microbial microorganisms or microbial communities in plant development community profile of plant organs. We use the CBC approach by conducting inoculation assays under sterile conditions (Bai (Armanhi et al., 2016)toannotateourentiresugarcaneculture et al., 2015; Timm et al., 2016; Castrillo et al., 2017). However, collection and identify representatives of dominant microbial the isolation of plant-associated microorganisms has been driven groups associated to sugarcane. A synthetic community by the screening of known traits for plant growth promotion, comprising highly abundant bacteria from root and stalk using group-specific culture media, which may restrict discovery core microbiomes was assembled as an inoculant. Then the of novel mechanisms and neglect dominant microbial groups abundance-based synthetic inoculant was probed using maize as associated to plants. The development of new approaches a plant model. The results are discussed in the context of using to target microorganisms based on microbial ecology data, relative abundance profile of plant microbiota to target beneficial such as assemblage pattern and abundance, may help unravel microbes. novel mechanisms and traits associated with the plant-microbe interaction. Root-colonizing bacteria that exert beneficial effects such MATERIALS AND METHODS as nitrogen fixation and phytohormone production have been The Sugarcane Community-Based Culture identified in sugarcane in the past decades (Döbereiner, Collection (CBC) 1961; Döbereiner et al., 1972; Cavalcante and Döbereiner, A CBC representative of the sugarcane microbiome was 1988; Olivares et al., 1996; Bastián et al., 1998; Fuentes- constructed by sampling the rhizosphere, endophytic root, Ramirez and Caballero-Mellado, 2005). However, the organ and endophytic stalks of mature sugarcane (Saccharum sp.) distribution and abundance of these bacterial groups compared variety SP 80-3280. Plants were harvested from the same site with other microorganisms inhabiting the sugarcane plant where samples were collected to profile sugarcane microbiome remained unknown until recently, when the diversity, organ- by culture-independent methods (de Souza et al., 2016). specific assemblages, and abundance of bacterial and fungal Rhizosphere community was obtained by washing roots in communities during plant development have been investigated ice-cold 1 × PBS (137mMNaCl, 2.7mMKCl, 10mM Na2HPO4, (de Souza et al., 2016). It was found that a core microbiome 2mM KH2PO4, and pH 7.0) with 0.05% Tween 20 solution. comprised of < ∼20% of the total microbial diversity represented Microorganisms from endophytic root and stalk were collected over ∼90% of the relative abundance of bacterial and fungal by homogenizing plant tissue in PBS. For each plant organ, OTUs (operational taxonomic units) assembled in the different an enriched microbial sample was obtained by centrifugation plant organs. Surprisingly, the commonly investigated microbial (Supplementary Figure S1). Enriched microbial samples groups in association to sugarcane comprise a small fraction of were plated on half-strength Luria-Bertani (LB) medium, the total diversity. On the other hand, highly abundant microbial − supplemented with sugarcane juice containing 8 or 35 g l 1 groups inhabiting sugarcane are comprised by understudied of total reducing sugars (TRS; Supplementary Table S1), and microbes (de Souza et al., 2016). yeast-peptone-dextrose (YPD) medium. Microbial isolates were Microorganisms have traditionally been isolated from plants recovered by picking colonies from these primary platings as axenic cultures, using culture media specific to microbial regardless of whether they contain single or multiple microbes. groups (Brown et al., 2012; Bai et al., 2015; Castrillo et al., Isolates were grown in liquid media, tested for growth viability 2017). These methods require successive rounds of picking (Supplementary Figure S2) and stored in 96-well plates (see and streaking to obtain pure cultures. Although this approach “Construction of the sugarcane CBC” in Supplementary has allowed the identification of plant-beneficial bacteria, Methods S1). the medium selectivity prevents the growth of most plant- associated microbes (Schloss and Handelsman, 2005; Lebeis DNA Extraction, 16S rRNA Gene et al., 2012; Stewart, 2012; Turner et al., 2013). Moreover, some microorganisms might not be amenable to isolation due to strict Sequencing for Microbe Identification, and mutual dependencies among microbes (Schink, 2002; Barea et al., Taxonomic Classification 2005). We have recently introduced the concept of community- Microbial identification was performed by the 16S rRNA gene based culture collection (CBC) (Armanhi et al., 2016)asan multiplex amplicon sequencing by PacBio (Armanhi et al., alternative method for large-scale isolation of microorganisms 2016) using 8f and 1492r primers to target the V1–V9 regions of plant-associated microbiota. The CBC approach is based on (Supplementary Table S2). Raw data were deposited at Sequence picking non-confluent colonies from primary platings regardless Read Archive (SRA) database under the accession number SRP126483. The assembly of raw sequences into CCSs (circular Abbreviations: CBC, community-based culture collection; CCS, circular consensus sequences), CCS demultiplexing, quality filtering, and consensus sequence; cOTUs, collection-OTUs; mOTUs, microbiome-OTUs; OTU, clustering into OTUs were carried out as previously described operational taxonomic unit; TRS, total reducing sugars; wOTUs, well-OTUs. (Armanhi et al., 2016). The CCSs were firstly clustered into

Frontiers in Plant Science | www.frontiersin.org 2 January 2018 | Volume 8 | Article 2191 Armanhi et al. Plant Growth-Promoting Bacteria from Sugarcane well-OTUs (wOTUs, i.e., OTUs obtained after CCS clustering soaked in 15% (v/v) commercial bleach solution for 10 min within the wells). Then, wOTUs sequences were reclustered under constant agitation. Seeds were then seven times washedin into collection-OTUs (cOTUs, i.e., OTUs obtained after wOTU distilled deionized water to eliminate remaining Tween 20 and clustering among the wells; Supplementary Figure S3A and bleach solutions. Surface-sterilized seeds were properly arranged “Sequencing and data processing” in Supplementary Methods in sterile filter papers rolls, maintained moist and sterile. Seeds S1). The taxonomic prediction was assigned for cOTUs using were pre-germinated in the dark at 28◦Cfor3d. “utax” in USEARCH v8.1 (Edgar, 2010) and RDP (Cole Seedlings were aseptically dissected from their endosperm and et al., 2005) database (www.drive5.com/utax/rdp_16s.fa) with a scutellum to limit the nutrient availability and force plants to confidence score of 0.9. acquire nutrients from the substrate. Endosperm-free seedlings Phylogenetic analysis was performed by multiple alignments were planted in bottom-holed pots of 25cm height and 10cm of cOTU sequences using Clustal Omega v1.2.1 (Sievers et al., diameter filled with vermiculite. Plants were subjected to three 2011) with 1,000 iterations. A phylogenetic tree was constructed inoculation events: germinated embryo axes were soaked in by maximum likelihood using QIIME v1.8.0 (Caporaso et al., the inoculum for 30 min right before planting and 1 mL of 2010)andFastTreev2.1.3(Price et al., 2009). The tree was inoculum was pipetted to each planted seedling, and two visualized using GraPhlAn v0.9.7 (Asnicar et al., 2015). further direct applications to the plant base at 2 d and 1 week after planting. Plants were maintained well-watered with sterile Cross-Referencing of CBC distilled deionized water and irrigated every 3 d with 50 mL (Culture-Dependent) Data with the of modified Hoagland’s nutrient solution (see “Maize growth Sugarcane Microbiome conditions” in Supplementary Methods S1). Thirteen replicates were used for each treatment in a randomized experimental (Culture-Independent) Data design. Eight 4-week-old plants per treatment were harvested and The CBC dataset was cross-referenced with the sugarcane had their fresh and dry weight measured. To assess dry weight microbiome dataset (de Souza et al., 2016)bysequencealignment plants were dried at 65◦Cfor7d. (Supplementary Figures S3B–D). Initially, the sugarcane profile dataset was filtered by aligning the microbiome-OTUs (mOTUs, Microbiota Profiling of Inoculated and i.e., OTUs obtained by community assemblage analysis of the sugarcane microbiome) with the Greengenes database (DeSantis Uninoculated Plants et al., 2006) using “usearch_global” in USEARCH v8.1. Sequences Five inoculated and five uninoculated 4-week-old plants with <75% identity were discarded (Supplementary Figure S3B). were harvested, and their leaves, stems and roots microbial The cross-referencing was performed by sequence alignment communities sampled by methods adapted from previously of the filtered mOTUs (culture-independent method) with the described protocol (de Souza et al., 2016). DNA was extracted CCSs from the microbe identification dataset of the CBC from enriched microbial samples and used for library preparation (culture-dependent method; Supplementary Figure S3C). The for 16S rRNA gene sequencing as previously described (de Souza link between mOTUs and cOTUs were made by mapping back et al., 2016). Libraries were sequenced in the HiSeq 2500 Illumina the CCSs to its respective cOTUs (Supplementary Figures S3C,D sequencer. All raw data were deposited at SRA database under and “Cross-referencing” in Supplementary Methods S1). Stalk the accession number SRP116051. The bioinformatics pipeline regions were divided in bottom, medium and upper stalk by used USEARCH v9.2 commands (Edgar, 2010)unlessotherwise similar number of internodes as previously described (de Souza specified (Supplementary Figure S4). Sequences were filtered et al., 2016). using maximum expected error 0.25 (Edgar and Flyvbjerg, 2015), and by size, from 230 to 270 nucleotides. Plastid sequences were Assemblage and Inoculation of an removed using the DUK (Li et al., 2011). OTUs were obtained Abundance-Based Synthetic Community by sequence clustering at 97% identity using an UPARSE- based (Edgar, 2013) pipeline (see “Microbiota profiling” in Atotalof17wellscontaininghighlyabundantbacteriafromthe Supplementary Methods S1). sugarcane core microbiome was selected to construct a synthetic community. Bacteria from each well were individually grown in liquid culture media to late exponential phase, and equivalent Analysis of the Colonization Pattern of the optical density (OD) were mixed to reach the final OD620 nm Abundance-Based Synthetic Community of 0.6. The culture mix was centrifuged and the pelleted was The OTUs from inoculated and uninoculated plants were resuspended in 0.1 × Hoagland’s solution (Hoagland and Arnon, identified using SINTAX (Edgar, 2016) in USEARCH v9.2 1950). and the SINTAX-compatible SILVA 16S rRNA gene database The abundance-based synthetic inoculum was probed using (www.drive5.com/sintax/silva_16s_v123.fa.gz). The Bray– maize as a plant model. Seeds of the commercial maize (Zea Curtis dissimilarity matrix was calculated and employed for mays L.) hybrid DKB 177 (DeKalb; Monsanto, Brazil) were principal coordinates analysis (PCoA) and analysis of similarity surface-sterilized by firstly rinsing twice in a solution of 0.1% (ANOSIM) using QIIME. The differential relative abundance of (v/v) Tween 20 (Sigma, Saint Louis, MO, USA) for 5min under each OTU among samples was determined with a Kruskal–Wallis constant agitation. After washing seeds twice in sterile distilled test with P < 0.05 (see “Colonization analysis” in Supplementary deionized water to remove remaining Tween 20, seeds were Methods S1).

Frontiers in Plant Science | www.frontiersin.org 3 January 2018 | Volume 8 | Article 2191 Armanhi et al. Plant Growth-Promoting Bacteria from Sugarcane

RESULTS 35 g l−1 TRS, and 31 growing in only YPD medium (Figure 2C). The bottom and medium stalk bacterial groups that grew in The Sugarcane CBC Targeted a Significant a single culture medium showed higher relative abundance Portion of the Sugarcane Core Microbiome compared to those growing in all media. Interestingly, more than We used the multiplex amplicon sequencing method (Armanhi one-third of the total stalk bacterial endophytes grew specifically et al., 2016) to elucidate the bacterial composition of each well in one of the three culture media used, regardless of the type of our sugarcane CBC. The raw sequences were assembled into of media. Contrastingly, in both exophytic upper stalk and top 205,411 CCSs that were filtered by coverage (≥2×)andreliability. leaves, the microbes that grew in all media were those which We considered a CCS as reliable when it was above a threshold together presented a higher relative abundance (Figure 2D). of similarity to a sequence deposited in a curated database The correlation between the relative abundances of the and/or above a threshold of similarity to any other sequence of bacterial groups of the sugarcane CBC with those in the the CBC dataset (Armanhi et al., 2016). After filtering, 80,959 sugarcane organs (de Souza et al., 2016)wasinvestigatedby CCSs were recovered, allowing the identification of the bacterial grouping cOTUs at the deepest known taxonomic level and composition of 2,942 wells (Supplementary Table S3). Among displaying them according to their number of representatives these, 1,717 wells were obtained from colonies of rhizosphere in the CBC and their relative abundance in the sugarcane enriched microbiota, 923 from endophytic root and 302 from microbiome. Overall, a positive correlation was maintained, as endophytic stalk of sugarcane. the most represented groups in the CBC were also present at high To investigate whether the sugarcane CBC targeted a abundances in the sugarcane organs. For example, members of representative set of the sugarcane microbiome, we cross- the families Rhizobiaceae, Xanthomonadaceae, Burkholderiaceae, referenced the CBC with the sugarcane microbiome profile (de and Enterobacteriaceae,whicharehighlyabundantinthe Souza et al., 2016). We found that 48, 40, and 33 cOTUs sugarcane organs, were also highly redundant in the CBC, from the CBC are representatives of groups that colonize the although Acinetobacter and Pseudomonas,whicharehighly endophytic bottom, medium and upper stalk, respectively. These abundant in sugarcane organs, were less represented in the CBC cOTUs matched a total of 66, 56, 48 mOTUs from the sugarcane (Figure 3 and Supplementary Table S6). microbiome and accounted for 61.6, 63, 65.3% of the total relative abundance in the core microbiomes of these respective CBC Representation of the Sugarcane organs. Although the microbial diversity is higher in the root Microbiome compartments than other plant organs (de Souza et al., 2016), the The predominant phylum in the CBC was “Proteobacteria”, sugarcane CBC recovered 75 cOTUs that matched 128 mOTU in found in 2,106 wells (Table 1). The representatives of the sugarcane microbiome and accounted for 15.9% of relative families Rhizobiaceae, Xanthomonadaceae, Burkholderiaceae, abundance in the rhizosphere core microbiome. The microbes Enterobacteriaceae, Comamonadaceae, Caulobacteraceae, from the leaves were not sampled for the microbial collection, Sphingomonadaceae, Moraxellaceae, Pseudomonadaceae, however, the culture collection targeted unrelated representatives Oxalobacteraceae, and Bradyrhizobiaceae were found among this that accounted for 56.1 and 64.5% of the exophytic and phylum (Figure 4). At the family level, Rhizobiaceae was the endophytic leaf core microbiomes, respectively (Figure 1 and second most represented family (found in 634 wells), followed Supplementary Table S4). by Burkholderiaceae and Xanthomonadaceae,foundin539and Bacterial Composition of the Sugarcane 482 wells, respectively. Firmicutes is the second most represented phylum in the CBC (found in 832 wells). Within this phylum, CBC Plate Wells 661 wells contained members of Bacillaceae_1,followedby The bacterial composition of each CBC plate well were accessed Paenibacillaceae_1, identified in 184 wells. “Bacteroidetes”, by individually clustering the CCSs from each well into wOTUs. “Actinobacteria”,and“Acidobacteria” are the less represented This analysis revealed that 1,450 wells (49.3%) contained phyla in the CBC. Interestingly, from the 566 wells identified single bacterial wOTUs, and the remaining 1,492 wells (50.7%) as “Bacteroidetes”, 389 wells harbored members of the family harbored multiple bacterial wOTUs (Figure 2A). The clustering Chitinophagaceae. Within this phylum, Sphingobacteriaceae of the wOTU sequences revealed a total of 399 unique cOTUs. and Flavobacteriaceae families were identified in 122 and 56 The most redundant cOTU was present in 575 CBC wells. wells, respectively. CBC also harbors 146 wells containing Conversely, 303 of the 399 cOTUs were found in less than members of the family Microbacteriaceae,includedinthe five wells, and among these, 200 were found in single wells phylum “Actinobacteria” (Figure 4 and Table 1). of the entire culture collection (Figure 2B and Supplementary Table S5). Probing the Plant Beneficial Impact of an We then investigated if the nutrient composition of the different culture media was selective for some bacterial groups. Abundance-Based Synthetic Community Among the 399 unique cOTUs, only 38 (9.5%) grew in all Assembled from the Sugarcane CBC culture media. Contrastingly, 294 cOTUs (74%) showed culture A synthetic community was assembled by using 17 wells of the media specificity, with 160 growing only in half-strength LB sugarcane CBC comprising 20 OTUs with the top high relative supplemented with sugarcane juice at 8 g l−1 TRS, 103 growing abundances in the sugarcane root and stalk core microbiomes in half-strength LB supplemented with sugarcane juice at (de Souza et al., 2016) (Supplementary Figure S5). These OTUs

Frontiers in Plant Science | www.frontiersin.org 4 January 2018 | Volume 8 | Article 2191 Armanhi et al. Plant Growth-Promoting Bacteria from Sugarcane

FIGURE 1 | Estimated recovery of bacterial groups from sugarcane organs accessed by the CBC. Recovery estimates in terms of abundance for roots, stalks (bottom, medium, and upper), and leaves were calculated by cross-referencing the CBC with the sugarcane community profile. Pie charts separately display the relative abundance of mOTUs (OTUs obtained by community assemblage analysis of the sugarcane microbiome). The CBC contains representative sets of bacterial members of the sugarcane core microbiomes, stable, and highly abundant microbial communities with putative impact on plant development. accounted for 4.9 and 6.8% of the rhizosphere and endophytic uninoculated plants. A significant shift in the community root, and 17.5–20% of the sugarcane endophytic stalk core profile was observed in exophytic and endophytic roots and microbiomes, respectively (Figure 5A). The abundance-based exophytic stems of inoculated as compared with the uninoculated synthetic community was inoculated in maize plants grown in plants (Figure 6A). The OTUs identification is shown in vermiculite and irrigated with Hoagland’s nutrient solution. The Supplementary Table S8. The synthetic community bacteria inoculated plants increased their fresh weight by 3.4× (average Asticcacaulis, Burkholderia, Chitinophaga, Ensifer, Lysobacter, of 7.82g per plant) compared with uninoculated plants (2.31g Pedobacter, Rhizobium, Stenotrophomonas,andtwounknown per plant). Similar differences were observed for the plant dry genera of the families Comamonadaceae and Streptomycetaceae weights (0.7g per plant for inoculated and 0.23g per plant for efficiently colonized and became predominant in the roots and uninoculated plants; Figure 5B and Supplementary Table S7). stems of inoculated plants. Interestingly, 10 bacteria of the Compared with uninoculated plants, the inoculated ones were synthetic inoculant, although highly abundant in the sugarcane more vigorous, with dark green leaves and presented increased core microbiome, did not robustly colonize the maize plants. branched root systems with an increased number of lateral roots The natural microbiota of the uninoculated plants contained (Figure 5C). OTUs that were classified in the same groups as those of the synthetic community. However, the total abundance of these OTUs was minimal compared with that of the inoculated Members of the Abundance-Based plants (3.7, 2.4, and 1.2% for uninoculated plants against Synthetic Community Efficiently Colonizes 53.9, 49.1, and 9.6% for inoculated plants exophytic root, Plants and Displaces Its Natural Microbiota endophytic root, and exophytic stem, respectively; Figure 6B). The colonization pattern of the synthetic community was verified Natural microbiota was considered as the communities naturally by 16S sequencing of samples from exophytic and endophytic acquired by the plant from the environment. The microbiota of compartments of roots, stems, and leaves of inoculated and the uninoculated plants was more diverse and widespread among

Frontiers in Plant Science | www.frontiersin.org 5 January 2018 | Volume 8 | Article 2191 Armanhi et al. Plant Growth-Promoting Bacteria from Sugarcane

FIGURE 2 | Characterization of OTU composition from isolated communities in sugarcane CBC. (A) Number of OTUs per well (wOTUs) as determined by clustering sequences within wells. (B) Redundancy of OTUs in the CBC determined by clustering wOTU sequences into cOTUs. The cOTUs represent unique OTUs in the CBC. (C) cOTU preference for culture media. Results are derived by cOTUs that were grown in only one medium, two media, or all used culture media. (D) Relative abundance of cOTUs per their preference for culture medium. groups. The results led to the conclusion that the OTUs of the for exophytic and endophytic, respectively) and exophytic stems abundance-based synthetic inoculant displaced the OTUs of the (ANOSIM; R = 0.484, P < 0.01; Figure 6C). Inoculation was the natural microbiota and changed the bacterial profiling both in first principal coordinate in the roots and the second in the stems, diversity and abundance compared with the uninoculated plants explaining over 50 and 18% of differences between the samples, (Figure 6A and Supplementary Figure S6). Of the 20 OTUs of the respectively. This pattern was not observed for the endophytic synthetic community, 10 were identified as efficient colonizers stems and leaves (Supplementary Figure S7). based on their abundance (Kruskal–Wallis test, P < 0.05) in the roots of inoculated plants compared with uninoculated DISCUSSION plants. These robust colonizers accounted for 53.9 and 49.1% of the total relative abundance in exophytic and endophytic The Use of CBC for Microbial Discovery roots, respectively. Four OTUs from the synthetic community Sugarcane microbiota has long been investigated for its potential efficiently colonized the exophytic stem (Kruskal–Wallis test, beneficial impact on plant growth and development. However, P < 0.05) and accounted for 9.6% of the total abundance in this the knowledge of the potential role of the sugarcane microbiota organ (Figure 6B). has been restricted to the characterization of diazotrophic Despite none of the synthetic community OTUs displayed bacteria discovered by selective culture media (Döbereiner, differential abundances in the leaves of inoculated plants, they 1961; Döbereiner et al., 1972; Cavalcante and Döbereiner, 1988; displaced several abundant, naturally occurring bacterial groups Olivares et al., 1996). We recently revealed, in sugarcane, in this organ (Figure 6A and Supplementary Figure S6). This highly abundant microbial groups whose functional role in adjustment in the community profile of the inoculated plants was plant remains to be determined (de Souza et al., 2016). We corroborated by principal coordinates analysis (PCoA) of Bray– also developed the CBC method to construct microbial culture Curtis dissimilarity matrix. The inoculated plants clearly formed collections (Armanhi et al., 2016) and used this strategy to distinct clusters, which could be observed in both compartments identify and annotate our entire sugarcane culture collection of roots (ANOSIM; R = 0.748, P < 0.01 and R = 0.684, P < 0.01 described here.

Frontiers in Plant Science | www.frontiersin.org 6 January 2018 | Volume 8 | Article 2191 Armanhi et al. Plant Growth-Promoting Bacteria from Sugarcane

FIGURE 3 | Correlation of genera relative abundance in plant organs andtheiroccurrenceinculturemedia.(A) The occurrence of genera in the sugarcane community-based culture collection (CBC) calculated by thenumberofwellscontainingatleastonememberofagivengenus. (B) Relative abundance of genera in sugarcane roots, stalks (bottom, medium, and upper), and leaves of sugarcane based on their community proﬁles. Genera arerepresentedbygreencircles,andcircle sizes are proportional to the relative abundance of genera inagivenorgan.Taxonomiclevelsconsidered“unknown”werecollapsed to the deepest common levels, which are comma-separated, and “unknown” taxa are represented as “−”.

The use of sterile sugarcane juice as an additive in the culture bacteria, indigenous yeasts and other fungi inhabiting sugarcane medium has been shown to improve the growth of bacterial stalks (da Silva-Filho et al., 2005; Basso et al., 2008; de Souza groups adapted to the sugars, amino acids, vitamins, organic et al., 2016). YPD is a conventional fungal culture medium which acids, and other small molecules (Gupta and Mukerji, 2002; allowed growth of some specific bacterial groups that may coexist Uren, 2007; Kim and Day, 2011). Some bacterial groups such as with fungi in some of the wells, perhaps reflecting their natural Pseudomonas, Flavobacterium, Agrobacterium, and Enterobacter, environment. for instance, have been shown to respond to rhizosphere exudates (Curl and Truelove, 1986; Taghavi et al., 2015)that The Sugarcane CBC Recovered Relevant directly affect bacterial growth (Grayston et al., 1998; Hadacek Bacterial Groups and Kraus, 2002; Singh and Mukerji, 2006). By using culture Culturing representatives of the microbial diversity from host- media supplemented with sterile sugarcane juice, we retrieved associated and natural ecosystems is challenging (Bulgarelli et al., microbial composition and taxonomic classification of 2,942 2012, 2013, 2015; Lundberg et al., 2012; Edwards et al., 2015; wells resulting in the identification of 399 unique OTUs. The CBC Panke-Buisse et al., 2015; Zarraonaindia et al., 2015; Coleman- redundancy may have occurred due to (1) the high abundance Derr et al., 2016; Castrillo et al., 2017). It is recognized that of some bacterial groups in the organ core microbiome or there is a gap between the diversity found in cultured microbes (2) an unintentional imposed selection by the culture media and the full community profiles (Goodman et al., 2011; Lebeis used. et al., 2012). Thus, a critical step in establishing extensive Bacterial culture collections have been constructed from the cultivation of microorganisms is to validate the extent of the environment or human-derived samples by using defined culture microbial composition recovered from microbiomes. While in media (Goodman et al., 2011; Paungfoo-Lonhienne et al., 2014; humans substantial portions from the gut microbiome have Bai et al., 2015; Browne et al., 2016).Inonecase,theuseofasingle been recovered (Goodman et al., 2011; Browne et al., 2016), broad-spectrum medium allowed targeting a large proportion in crops this is still a poorly explored topic, despite the of the vast gut bacterial diversity (Browne et al., 2016). In the fact that many bacterial groups have been shown to contain present study, the use of three broad-spectrum culture media cultivable members in plants (Bai et al., 2015). Our results revealed that most identified OTUs comprise bacteria that grow demonstrate that the use of the CBC method (Armanhi et al., specifically in a single medium. Only a small proportion of the 2016) allowed the recover of bacterial groups accounting for OTUs thrived in all three media. The use of YPD aimed to target 15.9–65.3% of the core microbiomes of roots, stalks, and leaves

Frontiers in Plant Science | www.frontiersin.org 7 January 2018 | Volume 8 | Article 2191 Armanhi et al. Plant Growth-Promoting Bacteria from Sugarcane 2 3 1 3 3 7 1 2 1 1 1 9 1 1 5 7 1 1 11 11 15 55 43 88 29 29 20 13 38 65 25 63 100 359 well (Continued) Acidobacteria_Gp1 Dermabacteraceae Sphingobacteriia Intrasporangiaceae Flavobacteriaceae Chitinophagaceae “Flavobacteriales” Sphingobacteriaceae Microbacteriaceae Micrococcaceae “Sphingobacteriales” Nocardiaceae Nocardioidaceae Promicromonosporaceae Propionibacteriaceae Streptomycetaceae Actinomycetales Patulibacteraceae Actinobacteria Dyadobacter u_ Flavobacterium Asticcacaulis Genus No. of Actinomyces u_ u_ Mucilaginibacter Pedobacter u_ Curtobacterium Microbacterium u_ Arthrobacter u_ Mycobacterium Aeromicrobium u_ Microlunatus u_ Chitinophaga Streptomyces u_ Patulibacter u_ 1 Trilbs3 6Terriglobus 3u_ 3u_ 1u_ 2 1u_ 1u_ 2 8 1u_ 11 56 51 15 u_ 50 10 65 u_ 29 63 u_ 122 146 389 wells Acidobacteria_Gp1 “Flavobacteriales” Sphingobacteriia “Sphingobacteriales” Actinomycetales Actinobacteria Cytophagaceae Flavobacteriaceae Caulobacteraceae Family No. of Actinomycetaceae Dermabacteraceae Intrasporangiaceae u_ Sphingobacteriaceae u_ Microbacteriaceae Mycobacteriaceae Micrococcaceae Nocardiaceae Nocardioidaceae Propionibacteriaceae Chitinophagaceae Promicromonosporaceae Streptomycetaceae u_ Patulibacteraceae 6u_ 8 1u_ 11 57 51 15 u_ 346 496 wells Acidobacteria_Gp1 Sphingobacteriia Actinobacteria Order No. of Cytophagales Actinomycetales “Flavobacteriales” Caulobacterales u_ “Sphingobacteriales” Solirubrobacterales u_ mic level in the sugarcane CBC. 6u_ 11 57 353 941 511 wells ClassAcidobacteria_Gp1 Actinobacteria No. of Cytophagia Alphaproteobacteria Flavobacteriia Sphingobacteriia 6 353 566 wells 2,106 Taxonomic prediction and number of wells of wOTUs per taxono TABLE 1 | PhylumAcidobacteria No. of Actinobacteria Bacteroidetes Proteobacteria

Frontiers in Plant Science | www.frontiersin.org 8 January 2018 | Volume 8 | Article 2191 Armanhi et al. Plant Growth-Promoting Bacteria from Sugarcane 6 6 9 5 1 2 4 1 5 1 6 2 2 6 1 4 2 2 4 3 30 23 40 20 29 12 24 23 20 11 496 328 113 197 143 262 well (Continued) Caulobacteraceae “Aurantimonadaceae” Bradyrhizobiaceae Acetobacteraceae Beijerinckiaceae Rhodospirillaceae Brucellaceae Rhizobiaceae Burkholderiaceae Methylobacteriaceae Xanthobacteraceae Comamonadaceae Oxalobacteraceae Phyllobacteriaceae Sphingomonadales Alphaproteobacteria Sphingomonadaceae Rhizobiales Alcaligenaceae GenusBrevundimonas Caulobacter u_ No. of Bosea u_ Novosphingobium Inquilinus u_ u_ Pandoraea u_ Methylobacterium u_ Labrys u_ Devosia Hyphomicrobium Delftia Variovorax u_ Mesorhizobium u_ Sphingomonas u_ Advenella u_ Rhizobium Burkholderia 1u_ 4u_ 1u_ 8 4 6 10 48 23 u_ 41 23 29 u_ 1224 u_ u_ 14 118 197 u_ 634 539 wells Rhizobiales Sphingomonadales Alphaproteobacteria Family No. of “Aurantimonadaceae” Acetobacteraceae Bradyrhizobiaceae Sphingomonadaceae Beijerinckiaceae Brucellaceae Rhodospirillaceae Xanthobacteraceae Hyphomicrobiaceae Comamonadaceae Methylobacteriaceae Phyllobacteriaceae u_ Oxalobacteraceae u_ Rhizobiaceae Burkholderiaceae Alcaligenaceae 45 60 24 u_ 818 739 wells Alphaproteobacteria Order No. of Rhizobiales Rhodospirillales Sphingomonadales u_ Burkholderiales 754 wells Class No. of Betaproteobacteria wells Continued TABLE 1 | Phylum No. of

Frontiers in Plant Science | www.frontiersin.org 9 January 2018 | Volume 8 | Article 2191 Armanhi et al. Plant Growth-Promoting Bacteria from Sugarcane 6 3 2 3 1 2 7 1 2 5 1 1 26 17 76 90 39 34 14 22 61 84 95 32 427 145 291 620 well Paenibacillaceae_1 Paenibacillaceae_2 Gammaproteobacteria Planococcaceae Bacillales Moraxellaceae Xanthomonadaceae Pseudomonadaceae Bacilli “Proteobacteria” Bacteria Pseudomonadales Xanthomonadales Bacillaceae_1 Burkholderiales Betaproteobacteria Clostridia Enterobacteriaceae Cohnella Paenibacillus u_ Staphylococcus Acinetobacter u_ Pseudomonas u_ Dokdonella Lysobacter u_ u_ Brevibacillus Selenomonas Genus No. of Bacillus 3u_ 2 2u_ 7u_ 1u_ 2u_ 5u_ 1 1u_ 76 u_ 9039 u_ u_ 34 34 95 u_ 32 u_ 482 184 291 u_ 661 wells u_” was added when prediction is below the minimum conﬁdence score of 0.9. Bacilli Gammaproteobacteria “Proteobacteria” Bacillales Bacteria Pseudomonadales Xanthomonadales Clostridia Burkholderiales Betaproteobacteria Paenibacillaceae_2 Staphylococcaceae Xanthomonadaceae Planococcaceae u_ Moraxellaceae u_ Pseudomonadaceae u_ Paenibacillaceae_1 Veillonellaceae u_ Family No. of Enterobacteriaceae Bacillaceae_1 2u_ 7u_ 1u_ 1 1u_ 76 u_ 69 32 u_ 486 291 830 wells Gammaproteobacteria Bacilli “Proteobacteria” Bacteria Clostridia Betaproteobacteria Xanthomonadales u_ u_ Pseudomonadales Selenomonadales u_ Order No. of “Enterobacteriales” Bacillales 7u_ 1u_ 1 1u_ base. Taxon names were kept the same as described in the database. Preﬁx “ 869 831 wells Bacteria “Proteobacteria” u_ Negativicutes Clostridia Gammaproteobacteria Class No. of Bacilli 1u_ 832 wells Continued Bacteria u_ TABLE 1 | Phylum No. of Firmicutes Taxonomic prediction was obtained using “utax” in USEARCH and RDP data

Frontiers in Plant Science | www.frontiersin.org 10 January 2018 | Volume 8 | Article 2191 Armanhi et al. Plant Growth-Promoting Bacteria from Sugarcane

FIGURE 4 | Phylogenetic tree of cOTUs of the sugarcane CBC. Outer rings show OTU relative abundance in sugarcane organs by color scale, from white (lower abundance) to strong green (higher abundance). Microbial groups representing the sugarcane core microbiome were highlighted for their putative beneficial activities or organ-colonization features. The relative abundances ofcOTUsineachorganwerecoloredfromthelowesttothehighest value for a given cOTU. of sugarcane. Most of the identified OTUs belong to highly (Gammaproteobacteria class), the genus Acinetobacter,which abundant bacterial phyla inhabiting the sugarcane organs (de presents members that have long been studied for its nitrogen Souza et al., 2016). fixation ability, phytohormone production and mineral The most represented phylum in the CBC was solubilization (Rokhbakhsh-Zamin et al., 2011; Yuan et al., “Proteobacteria”,whosemembershavebeenshownto 2011). Members of the family Enterobacteriaceae,suchasthe promote plant growth by diverse mechanisms (Pisa et al., genera Erwinia and Enterobacter, are also well known as plant 2011; Yuan et al., 2011; Beneduzi et al., 2013). Members of growth promoters (Loiret et al., 2004; Yuan et al., 2011). Within the order Rhizobiales (Alphaproteobacteria class), found in the phylum “Bacteroidetes”, Chitinophagaceae is a lesser known the CBC, belong to groups of bacteria with representatives bacterial family, but one of the most abundant in the sugarcane capable of nitrogen fixation (Carvalho et al., 2010; Gnat root core microbiome (de Souza et al., 2016). Over half of et al., 2015; Melorose et al., 2015)andsoildenitrification the CBC wells containing this phylum belong to the family (Yoshida et al., 2012). Moreover, the genus Burkholderia Chitinophagaceae. This phylum also includes Flavobacterium, (Betaproteobacteria class), comprises endophytic bacteria (Perin agenusthathasbeenisolatedfromthesugarcaneleavesand et al., 2006; Luvizotto et al., 2010; Beneduzi et al., 2013)that demonstrated to fix nitrogen and produce phytohormones has been shown to be involved in the denitrification process (Fischer et al., 1993; Yuan et al., 2011). The CBC also targeted the (Yoshida et al., 2012). The CBC representatives of the family genera Microbacterium and Curtobacterium (“Actinobacteria” Burkholderiaceae are especially abundant in young shoots and phylum), and the phylum “Acidobacteria”,whichincludes bottom stalks (de Souza et al., 2016). Beyond Burkholderia, members with plant-beneficial activities (Anandham et al., 2008; the order Burkholderiales includes the genus Herbaspirillum Magnani et al., 2010; de Pereira et al., 2012; Qin et al., 2014; (Oxalobacteraceae family), well known for its nitrogen fixation Kielak et al., 2016). capacity (Pimentel et al., 1991; Olivares et al., 1996). The Overall, most CBC representatives have their organ preference sugarcane CBC targeted a member of the family Moraxellaceae consistent with their abundance in sugarcane organs. This

Frontiers in Plant Science | www.frontiersin.org 11 January 2018 | Volume 8 | Article 2191 Armanhi et al. Plant Growth-Promoting Bacteria from Sugarcane

FIGURE 5 | Asyntheticcommunitycomposedofdominantmicrobialgroupsisolatedfromsugarcaneinducesmaizeplantgrowth.(A) Relative abundance of the microbial groups comprising members of the synthetic community. (B) Effect of inoculation in fresh and dry weight of maize seedlings after 4 weeks of growth. Inoculated plants showed more than three times the biomass compared with uninoculated plants. (C) Plant growth and biomass of plants treated with a nutrient solution in the absence (i,left)orpresence(i,right)ofthesyntheticcommunity.Theeffectonrootgrowthinuninoculatedplants(ii,iv) and inoculated plants (iii,v). ***p ≤ 0.001. Scale bars: 3 cm (i) and 1 cm (ii–v). assumption could be observed particularly for Moraxellaceae, Pseudomonadaceae,andEnterobacteriaceae are phylogenetically Pseudomonadaceae,andEnterobacteriaceae in the endophytic close groups and they showed endophytic stalks and leaves compartment of stalks and leaves, for Burkholderiaceae in as their preferred organs (de Souza et al., 2016). Thus, it the young shoots and endophytic bottom stalks, and for seems that some phylogenetically close bacterial groups, might Xanthomonadaceae in the exophytic stalks (de Souza et al., have similar preferred organs while other groups may not 2016). As observed in the sugarcane microbiome, leaves follow the same rule. For example, the CBC representatives are the preferred organ for the cultivable bacteria of the of Xanthomonadaceae are bacteria with contrasting organ family Sphingomonadaceae (de Souza et al., 2016). Although preferences, mostly found in the exophytic compartment of representatives of the family Rhizobiaceae are enriched in stalks (de Souza et al., 2016). The order Rhizobiales and exophytic stalk and leaf core microbiomes (de Souza et al., 2016), families Caulobacteraceae and Sphingomonadaceae are closely their CBC representatives are mostly found in roots and young related groups, although they did not present the same shoots. colonization preference of sugarcane organs. However, upon We also determined the organ preferences of the OTU clusters close inspection, we observed subsets of OTUs within these of the CBC formed by closely related taxa. Moraxellaceae, groups that show similar preferred organs. The limitations

Frontiers in Plant Science | www.frontiersin.org 12 January 2018 | Volume 8 | Article 2191 Armanhi et al. Plant Growth-Promoting Bacteria from Sugarcane

FIGURE 6 | The synthetic community robustly colonizes maize plants anddisplacesthenaturalOTUrelativeabundancepattern.(A) Heatmap of relative abundances of OTUs found in organs of uninoculated and inoculated plants. Color range is given by row. OTUs in the synthetic communityarehighlighted,andtheirtaxonomic prediction is shown on the right. The complete heatmap is shown in Supplementary Figure S6. (B) Relative abundance of OTUs present in the synthetic community in maize inoculation. (C) Principal coordinates analysis (PCoA) of Bray–Curtis dissimilarity matrix of exophytic and endophytic roots and exophytic stem tissues of inoculated and uninoculated plants. Exo, exophytic; End, endophytic; u_, unknown taxa. ***p ≤ 0.001. imposed by the existing 16S rRNA gene sequence databases did Abundant Microbial Groups from the not allow the classification of some of the OTUs at a generic or Sugarcane Microbiome Have a High Impact specific level; therefore, our findings indicate that phylogenetic on Plant Growth Promotion in Maize distance might not be directly related to organ-preferences.This Traditionally, beneficial microbes are isolated based on screening observation may suggest that while beneficial plant functions for known plant growth-promoting (PGP) related activities or could be conserved among the members of some of the taxonomic affiliation. However, there is no evidence that a pre- closely related taxa, within families such as Pseudomonadaceae, existing PGP activity or taxonomic affiliation is correlated tothe Moraxellaceae, Chitinophagaceae, and Microbacteriaceae,the representativeness of a microbial group in plant organs. In fact, consistent preferences appeared within just a small subset of in sugarcane, the sole use of these strategies have targeted minor representatives of other groups. Identifying these functions components of the microbial diversity (de Souza et al., 2016). and correlations may help understand the plant-microbial In this work, we chose to select microbial groups based on the community association. community profile and assemblage pattern targeting neglected

Frontiers in Plant Science | www.frontiersin.org 13 January 2018 | Volume 8 | Article 2191 Armanhi et al. Plant Growth-Promoting Bacteria from Sugarcane microbial groups from the sugarcane microbiome. A synthetic CONCLUSIONS bacterial community was assembled by selecting naturally dominant groups in the sugarcane microbiome regardless of The guided use of microorganisms to promote plant growth, pre-existing traits or taxonomic affiliation. development and health have a great potential for agriculture Recently, synthetic communities have been designed as sustainability. The establishment of plant-derived culture inoculants to study colonization and beneficial impacts on collections is key for the exploration of the biological potential growth and development (Bai et al., 2015; Lebeis et al., 2015; of microbial communities. The creation of the sugarcane CBC Niu et al., 2017). Synthetic communities have the advantage allowed the isolation of bacterial groups belonging to diverse of carrying redundant functions together with individual groups that have been understudied. The cross-referencing of contributions of specific functions. Collectively, these functions microbial data of the culture collection with the microbiome could be advantageous for the plant, which would explain why profile of sugarcane was key to identify highly abundant different bacterial groups are kept at high abundance during plant naturally occurring bacteria from the core microbiome of development. the plant organs. This strategy allowed the assemblage of an We evaluated the effect of the abundance-based synthetic abundance-based synthetic community that was probed as an community using maize as a crop model. Maize was selected inoculant using maize as a plant model. The fact that members of as a candidate crop because it is phylogenetically close to the abundance-based synthetic community robustly colonize the sugarcane. The synthetic inoculant produced a remarkable inoculated maize plants in an assemblage pattern similar to that effect on plant growth. Bacterial members of the synthetic naturally found in sugarcane plant organs is a significant finding. community efficiently colonized exophytic and endophytic roots Additionally, the displacement of the naturally occurring maize and exophytic stems of maize plants in an organ-preferred microbiota and the dramatic impact on plant biomass and root pattern similar to that observed for the sugarcane plant (de stimulation is a sound proof of the concept for the abundance- Souza et al., 2016). Notably, the 16S rRNA gene sequences based synthetic community for the assembly of plant inoculants. of naturally occurring bacteria in uninoculated plants were The present study is unique in describing a rational workflow for clustered in the same groups (OTUs) of the synthetic community. obtaining CBCs from plant or environmental samples and assess However, these bacteria were less efficient in colonizing and their relevance by cross-referencing with the microbiome promote plant growth and development. This result suggests that data to find key microorganisms useful for sustainable the abundance-based synthetic community has plant beneficial agriculture. functions that are absent in the maize natural microbiota. These functions may arise from genomic scale differential AUTHOR CONTRIBUTIONS expression and genetic polymorphism at the protein level, established throughout the microbiome/plant co-evolution and PA and JI: managed the project. PA, JI, and RdS: coordinated the could explain its superiority over the maize resident plant-borne project. JA, LdA, and RdS: performed plant organ sampling and microbiome. This hypothesis is in keeping with previous studies microbiota isolation. JA and LdA: performed microbial plating, describing that microorganisms from the same species confer isolation and storage and isolated DNA from stored cultures. different beneficial effects on plant survival depending on their JA: prepared sequencing libraries of 16S rRNA gene for microbe habitat, which has been described as habitat adapted-symbioses identification of the CBC. JA and RdS: performed bioinformatics (Rodriguez et al., 2008). analyses. RdS: designed the inoculation experiments and The robustness of colonization of maize plants by members prepared the synthetic community for inoculation assays. RdS, of the abundance-based synthetic community displaced the JA, and ND: performed the inoculation experiments and plant naturally occurring maize OTUs in the inoculated plants. The phenotyping. JA and RdS: prepared sequencing libraries for displacement of natural microbiota may include bacteria that analyses of colonization in maize and performed bioinformatics somehow negatively impact plant growth and development. analyses. JA: created figures with the help of RdS. JA: wrote Interestingly, the microbial displacement also occurred in plant the manuscript with significant input from RdS and PA. PA, JI, organs that have not been robustly colonized by the members and RdS: critically revised the manuscript. All authors read and of the synthetic community. This effect can be seen in leaves approved the final manuscript. and suggests that the synthetic inoculant might also affect microbial assemblage by factors other than local competition FUNDING against the natural community and could be related to plant differential gene expression induced by the plant-microbe We acknowledge Repsol and Repsol Sinopec for funding interaction. the project. JA received a Ph.D. fellowship from FAPESP It is remarkable that the abundance-based synthetic (2016/04322-0). ND received a Master’s fellowship from FAPESP community assembled from the sugarcane microbiome had (2016/23425-5). PA is a CNPq productivity research fellow. a tremendous impact on maize plant growth. The results suggest that selection based on relative abundance in the ACKNOWLEDGMENTS plant microbiome could be used for the identification of beneficial microorganisms with a broader impact cross- We are grateful to the staffof the Life Sciences Core Facility species. (LaCTAD) of the State University of Campinas (UNICAMP,

Frontiers in Plant Science | www.frontiersin.org 14 January 2018 | Volume 8 | Article 2191 Armanhi et al. Plant Growth-Promoting Bacteria from Sugarcane

Campinas, Brazil) for Illumina sequencing and to the High- Biotechnology (Campinas, Brazil) for providing the sugarcane Throughput Sequencing Facility (HTSF) at the University of juice. North Carolina (UNC, Chapel Hill, North Carolina, USA) for PacBio sequencing. The following reagent was obtained SUPPLEMENTARY MATERIAL through BEI Resources, NIAID, NIH as part of the Human Microbiome Project: Genomic DNA from Microbial Mock The Supplementary Material for this article can be found Community B (Staggered, Low Concentration), v5.2L, for 16S online at: https://www.frontiersin.org/articles/10.3389/fpls.2017. rRNA Gene Sequencing, HM-783D. We acknowledge Amyris 02191/full#supplementary-material

REFERENCES Carvalho, F. M., Souza, R. C., Barcellos, F. G., Hungria, M., and Vasconcelos, A. T. R. (2010). Genomic and evolutionary comparisons of diazotrophic Anandham, R., Indira Gandhi, P., Madhaiyan, M., and Sa, T. (2008). Potential and pathogenic bacteria of the order Rhizobiales. BMC Microbiol. 10:37. plant growth promoting traits and bioacidulation of rock phosphate by doi: 10.1186/1471-2180-10-37 thiosulfate oxidizing bacteria isolated from crop plants. J. Basic Microbiol. 48, Castrillo, G., Teixeira, P. J., Paredes, S. H., Law, T. F., de Lorenzo,L., 439–447. doi: 10.1002/jobm.200700380 Feltcher, M. E., et al. (2017). Root microbiota drive direct integration of Armanhi, J. S. L., de Souza, R. S. C., de Araújo, L. M., Okura, V. K., Mieczkowski, phosphate stress and immunity. Nature 543, 513–518. doi: 10.1038/nature P., Imperial, J., et al. (2016). Multiplex amplicon sequencing for microbe 21417 identification in community-based culture collections. Sci. Rep. 6:29543. Cavalcante, V. A., and Döbereiner, J. (1988). A new acid-tolerant nitrogen- doi: 10.1038/srep29543 fixing bacterium associated with sugarcane. Plant Soil 108, 23–31. Asnicar, F., Weingart, G., Tickle, T. L., Huttenhower, C., and Segata, N. (2015). doi: 10.1007/BF02370096 Compact graphical representation of phylogenetic data and metadata with Cole, J. R., Chai, B., Farris, R. J., Wang, Q., Kulam, S. A., McGarrell, D. GraPhlAn. PeerJ 3:e1029. doi: 10.7717/peerj.1029 M., et al. (2005). The Ribosomal Database Project (RDP-II): sequences and Bai, Y., Müller, D. B., Srinivas, G., Garrido-Oter, R., Potthoff,E., Rott, M., et al. tools for high-throughput rRNA analysis. Nucleic Acids Res.33,294–296. (2015). Functional overlap of the Arabidopsis leaf and root microbiota. Nature doi: 10.1093/nar/gki038 528, 364–369. doi: 10.1038/nature16192 Coleman-Derr, D., Desgarennes, D., Fonseca-Garcia, C., Gross, S., Clingenpeel, Barea, J.-M., Pozo, M. J., Azcón, R., and Azcán-Aguilar, C. (2005). Microbial co- S., Woyke, T., et al. (2016). Plant compartment and biogeography affect operation in the rhizosphere. J. Exp. Bot. 56, 1761–1778. doi: 10.1093/jxb/eri197 microbiome composition in cultivated and native Agave species. New Phytol. Basso, L. C., De Amorim, H. V., De Oliveira, A. J., and Lopes, M. L. (2008). Yeast 209, 798–811. doi: 10.1111/nph.13697 selection for fuel ethanol production in Brazil. FEMS Yeast Res. 8, 1155–1163. Curl, E. A., and Truelove, B. (1986). The Rhizosphere. Berlin: Springer-Verlag. doi: 10.1111/j.1567-1364.2008.00428.x Döbereiner, J., Day, J. M., and Dart, P. J. (1972). Nitrogenase activity in the Bastián, F., Cohen, A., Piccoli, P., Luna, V., Baraldi, R., and Bottini, R. (1998). rhizosphere of sugarcane and some other tropical grasses. Plant Soil 196, Production of indole-3-acetic acid and gibberellins A1 and A3 by Acetobacter 191–196. doi: 10.1007/BF01578494 diazotrophicus and Herbaspirillum seropedicae in chemically-defined culture Döbereiner, J. (1961). Nitrogen-fixing bacteria of the genus Beijerinckia Derx media. Plant Growth Regul. 24, 7–11. doi: 10.1023/A:1005964031159 in the rhizosphere of sugar cane. Plant Soil 15, 211–216. doi: 10.1007/BF01 Beneduzi, A., Moreira, F., Costa, P. B., Vargas, L. K., Lisboa, B. B., Favreto, 400455 R., et al. (2013). Diversity and plant growth promoting evaluation abilities da Silva-Filho, E. A., dos Santos, S. K., Resende Ado, M., de Morais of bacteria isolated from sugarcane cultivated in the South of Brazil. Agric. Jo, F., de Morais, M. A., and Simões, D. A. (2005). Yeast population Ecosyst. Environ. Appl. Soil Ecol. 63, 94–104. doi: 10.1016/j.apsoil.2012. dynamics of industrial fuel-ethanol fermentation process assessedbyPCR- 08.010 fingerprinting. Antonie Van Leeuwenhoek 88, 13–23. doi: 10.1007/s10482-005- Brown, S. D., Utturkar, S. M., Klingeman, D. M., Johnson, C. M., Martin, S. L., 7283-3 Land, M. L., et al. (2012). Twenty-one genome sequences from Pseudomonas de Pereira, G. V. M., Magalhães, K. T., Lorenzetii, E. R., Souza, T.P.,andSchwan,R. species and 19 genome sequences from diverse bacteria isolated fromthe F. (2012). A multiphasic approach for the identification of endophytic bacterial rhizosphere and endosphere of Populus deltoides. J. Bacteriol. 194, 5991–5993. in strawberry fruit and their potential for plant growth promotion. Microb. Ecol. doi: 10.1128/JB.01243-12 63, 405–417. doi: 10.1007/s00248-011-9919-3 Browne, H. P., Forster, S. C., Anonye, B. O., Kumar, N., Neville, B. A., Stares, DeSantis, T. Z., Hugenholtz, P., Larsen, N., Rojas, M., Brodie, E. L., Keller, K., M. D., et al. (2016). Culturing of “unculturable” human microbiota reveals et al. (2006). Greengenes, a chimera-checked 16S rRNA gene database and novel taxa and extensive sporulation. Nature 533, 1–15. doi: 10.1038/nature workbench compatible with ARB. Appl. Environ. Microbiol. 72, 5069–5072. 17645 doi: 10.1128/AEM.03006-05 Bulgarelli, D., Garrido-Oter, R., Münch, P. C., Weiman, A., Dröge, J., de Souza, R. S. C., Okura, V. K., Armanhi, J. S. L., Jorrín, B., Lozano, N., da Silva, M. Pan, Y., et al. (2015). Structure and function of the bacterial root J., et al. (2016). Unlocking the bacterial and fungal communities assemblages of microbiota in wild and domesticated barley. Cell Host Microbe 17, 392–403. sugarcane microbiome. Sci. Rep. 6:28774. doi: 10.1038/srep28774 doi: 10.1016/j.chom.2015.01.011 Edgar, R. (2016). SINTAX: a simple non-Bayesian taxonomy classifierfor16Sand Bulgarelli, D., Rott, M., Schlaeppi, K., van Themaat, E. V. L., Ahmadinejad, ITS sequences. bioRxiv 74161. doi: 10.1101/074161 N., Assenza, F., et al. (2012). Revealing structure and assembly cues Edgar, R. C. (2010). Search and clustering orders of magnitude faster than BLAST. for Arabidopsis root-inhabiting bacterial microbiota. Nature 488, 91–95. Bioinformatics 26, 2460–2461. doi: 10.1093/bioinformatics/btq461 doi: 10.1038/nature11336 Edgar, R. C. (2013). UPARSE: highly accurate OTU sequences from microbial Bulgarelli, D., Schlaeppi, K., Spaepen, S., van Themaat, E. V. L., and Schulze- amplicon reads. Nat. Methods 10, 996–998. doi: 10.1038/nmeth.2604 Lefert, P. (2013). Structure and functions of the bacterial microbiota of plants. Edgar, R. C., and Flyvbjerg, H. (2015). Error filtering, pair assembly and error Annu. Rev. Plant Biol. 64, 807–838. doi: 10.1146/annurev-arplant-050312- correction for next-generation sequencing reads. Bioinformatics 31, 3476–3482. 120106 doi: 10.1093/bioinformatics/btv401 Caporaso, J. G., Kuczynski, J., Stombaugh, J., Bittinger, K., Bushman, Edwards, J., Johnson, C., Santos-Medellín, C., Lurie, E., Podishetty, N. K., F. D., Costello, E. K., et al. (2010). QIIME allows analysis of high- Bhatnagar, S., et al. (2015). Structure, variation, and assembly of the root- throughput community sequencing data. Nat. Methods 7, 335–336. associated microbiomes of rice. Proc. Natl. Acad. Sci. U.S.A. 112, E911–E920. doi: 10.1038/nmeth.f.303 doi: 10.1073/pnas.1414592112

Frontiers in Plant Science | www.frontiersin.org 15 January 2018 | Volume 8 | Article 2191 Armanhi et al. Plant Growth-Promoting Bacteria from Sugarcane

Finkel, O. M., Castrillo, G., Paredes, S. H., González, I. S., and Dangl, J. L. (2017). Olivares, F. L., Baldani, V. L. D., Reis, V. M., Baldani, J. I., and Döbereiner, J. Understanding and exploiting plant beneficial microbes. Curr. Opin. Plant Biol. (1996). Occurrence of the endophytic diazotrophs Herbaspirillum spp. in roots, 38, 155–163. doi: 10.1016/j.pbi.2017.04.018 stems, and leaves, predominantly of Gramineae. Biol. Fertil. Soils 21, 197–200. Fischer, G., Jena, V., Pati, B. R., and Chandra, A. K. (1993). Diazotrophic doi: 10.1007/BF00335935 bacterial population and other associated organisms on the Panke-Buisse, K., Poole, A. C., Goodrich, J. K., Ley, R. E., and Kao- phyllosphere of some crop plants. Zentralbl. Mikrobiol.148,392–402. Kniffin, J. (2015). Selection on soil microbiomes reveals reproducible doi: 10.1016/S0232-4393(11)80304-5 impacts on plant function. ISME J. 9, 980–989. doi: 10.1038/ismej. Fuentes-Ramirez, L. E., and Caballero-Mellado, J. (2005). “Bacterial biofertilizers,” 2014.196 in PGPR: Biocontrol and Biofertilization, ed Z. A. Siddiqui (Dordrecht: Paungfoo-Lonhienne, C., Lonhienne, T. G. A., Yeoh, Y. K., Webb, R. I., Springer), 143–172. Lakshmanan, P., Chan, C. X., et al. (2014). A new species of Burkholderia Gnat, S., Małek, W., Olenska, E., Wdowiak-Wróbel, S., Kalita, M.,Łotocka,B., isolated from sugarcane roots promotes plant growth. Microb. Biotechnol. 7, et al. (2015). Phylogeny of symbiotic genes and the symbiotic properties 142–154. doi: 10.1111/1751-7915.12105 of rhizobia specific to Astragalus glycyphyllos L. PLoS ONE 10:e0141504. Perin, L., Martínez-Aguilar, L., Castro-González, R., Estrada-DeLosSantos, doi: 10.1371/journal.pone.0141504 P., Cabellos-Avelar, T., Guedes, H. V., et al. (2006). Diazotrophic Goodman, A. L., Kallstrom, G., Faith, J. J., Reyes, A., Moore, A., Dantas, G., Burkholderia species associated with field-grown maize and sugarcane. et al. (2011). Extensive personal human gut microbiota culture collections Appl. Environ. Microbiol. 72, 3103–3110. doi: 10.1128/AEM.72.5.3103-31 characterized and manipulated in gnotobiotic mice. Proc. Natl. Acad. Sci. U.S.A. 10.2006 108, 6252–6257. doi: 10.1073/pnas.1102938108 Pimentel, J. P., Olivares, F., Pitard, R. M., Urquiaga, S., Akiba, F.,and Grayston, S. J., Wang, S., Campbell, C. D., and Edwards, A. C. (1998). Döbereiner, J. (1991). Dinitrogen fixation and infection of grass leaves by Selective influence of plant species on microbial diversity in the Pseudomonas rubrisubalbicans and Herbaspirillum seropedicae. Plant Soil 137, rhizosphere. Soil Biol. Biochem. 30, 369–378. doi: 10.1016/S0038-0717(97) 61–65. doi: 10.1007/BF02187433 00124-7 Pisa, G., Magnani, G. S., Weber, H., Souza, E. M., Faoro, H., Monteiro, Gupta, R., and Mukerji, K. G. (2002). “Root exudate — biology,” in Techniques in R. A., et al. (2011). Diversity of 16S rRNA genes from bacteria of Mycorrhizal Studies, eds K. G. Mukerji, C. Manoharachary, and B. P. Chamola sugarcane rhizosphere soil. Braz. J. Med. Biol. Res.44,1215–1221. (Dordrecht: Springer), 103–131. doi: 10.1590/S0100-879X2011007500148 Hadacek, F., and Kraus, G. F. (2002). Plant root carbohydrates affect growth Price, M. N., Dehal, P. S., and Arkin, A. P. (2009). FastTree: computing large behaviour of endophytic microfungi. FEMS Microbiol. Ecol. 41, 161–170. minimum evolution trees with profiles instead of a distance matrix. Mol. Biol. doi: 10.1111/j.1574-6941.2002.tb00977.x Evol. 26, 1641–1650. doi: 10.1093/molbev/msp077 Hoagland, D. R., and Arnon, D. I. (1950). The water-culture method for growing Qin, S., Zhang, Y. J., Yuan, B., Xu, P. Y., Xing, K., Wang, J., et al. (2014). plants without soil. Calif. Agric. Exp. Stn. Circ.347,1–32. Isolation of ACC deaminase-producing habitat-adapted symbiotic bacteria Kielak, A. M., Cipriano, M. A., and Kuramae, E. E. (2016). Acidobacteria strains associated with halophyte Limonium sinense (Girard) Kuntze and evaluating from subdivision 1 act as plant growth-promoting bacteria. Arch. Microbiol. their plant growth-promoting activity under salt stress. Plant Soil 374, 753–766. 198, 987–993. doi: 10.1007/s00203-016-1260-2 doi: 10.1007/s11104-013-1918-3 Kim, M., and Day, D. F. (2011). Composition of sugar cane, energy cane, Rodriguez, R. J., Henson, J., Van Volkenburgh, E., Hoy, M., Wright,L.,Beckwith, and sweet sorghum suitable for ethanol production at Louisiana sugar F., et al. (2008). Stress tolerance in plants via habitat-adapted symbiosis. ISME mills. J. Ind. Microbiol. Biotechnol.38,803–807.doi:10.1007/s10295-010- J. 2, 404–416. doi: 10.1038/ismej.2007.106 0812-8 Rokhbakhsh-Zamin, F., Sachdev, D., Pour, N.-K., Engineer, A., Pardesi, K. Lebeis, S. L., Paredes, S. H., Lundberg, D. S., Breakfield, N., Gehring, J., McDonald, R., Zinjarde, S., et al. (2011). Characterization of plant-growth-promoting M., et al. (2015). Salicylic acid modulates colonization of the root microbiome traits of Acinetobacter species isolated from rhizosphere of Pennisetum by specific bacterial taxa. Science 349, 860–864. doi: 10.1126/science. glaucum. J. Microbiol. Biotechnol. 21, 556–566. doi: 10.4014/jmb.1012. aaa8764 12006 Lebeis, S. L., Rott, M., Dangl, J. L., and Schulze-Lefert, P. (2012). Culturing a Schink, B. (2002). Synergistic interactions in the microbial world. Antonie Van plant microbiome community at the cross-Rhodes. New Phytol.196,341–344. Leeuwenhoek 81, 257–261. doi: 10.1023/A:1020579004534 doi: 10.1111/j.1469-8137.2012.04336.x Schloss, P. D., and Handelsman, J. (2005). Metagenomics for studying Li, M., Copeland, A., and Han, J. (2011). DUK – A Fast and Efficient unculturable microorganisms: cutting the Gordian knot. Genome Biol. 6:229. Kmer Matching Tool. Available online at: https://publications.lbl.gov/islandora/ doi: 10.1186/gb-2005-6-8-229 object/ir%3A155200/datastream/PDF/download/citation.pdf (Accessed March Sievers, F., Wilm, A., Dineen, D., Gibson, T. J., Karplus, K., Li, W., et al. 17, 2017). (2011). Fast, scalable generation of high-quality protein multiple sequence Loiret, F. G., Ortega, E., Kleiner, D., Ortega-Rodés, P., Rodés, R., alignments using Clustal Omega. Mol. Syst. Biol. 7:539. doi: 10.1038/msb. and Dong, Z. (2004). A putative new endophytic nitrogen-fixing 2011.75 bacterium Pantoea sp. from sugarcane.J.Appl.Microbiol.97,504–511. Singh, G., and Mukerji, K. G. (2006). “Root exudates as determinant of doi: 10.1111/j.1365-2672.2004.02329.x rhizospheric microbial biodiversity,” in Microbial Activity in the Rhizosphere, Lundberg, D. S., Lebeis, S. L., Paredes, S. H., Yourstone, S., Gehring, J., Malfatti, S., eds K. G. Mukerji, C. Manoharachary, and J. Singh (Berlin; Heidelberg: et al. (2012). Defining the core Arabidopsis thaliana root microbiome. Nature Springer), 39–53. 488, 86–90. doi: 10.1038/nature11237 Stewart, E. J. (2012). Growing unculturable bacteria. J. Bacteriol. 194, 4151–4160. Luvizotto, D. M., Marcon, J., Andreote, F. D., Dini-Andreote, F., Neves, A. A. C., doi: 10.1128/JB.00345-12 Araújo, W. L., et al. (2010). Genetic diversity and plant-growth related features Taghavi, S., Wu, X., Ouyang, L., Zhang, Y. B., Stadler, A., McCorkle, of Burkholderia spp. from sugarcane roots. World J. Microbiol. Biotechnol.26, S., et al. (2015). Transcriptional responses to sucrose mimic the 1829–1836. doi: 10.1007/s11274-010-0364-0 plant-associated life style of the plant growth promoting endophyte Magnani, G. S., Didonet, C. M., Cruz, L. M., Picheth, C. F., Pedrosa, F. O., and Enterobacter sp. 638. PLoS ONE 10:e0115455. doi: 10.1371/journal.pone. Souza, E. M. (2010). Diversity of endophytic bacteria in Brazilian sugarcane. 0115455 Genet. Mol. Res. 9, 250–258. doi: 10.4238/vol9-1gmr703 Timm, C. M., Pelletier, D. A., Jawdy, S. S., Gunter, L. E., Henning, J. A., Engle, N., Melorose, J., Perroy, R., and Careas, S. (2015). Bacteria in Agrobiology: Plant et al. (2016). Two poplar-associated bacterial isolates induce additive favorable Probiotics. Berlin: Springer-Verlag. responses in a constructed plant-microbiome system. Front. Plant Sci.7:497. Niu, B., Paulson, J. N., Zheng, X., and Kolter, R. (2017). Simplified and doi: 10.3389/fpls.2016.00497 representative bacterial community of maize roots. Proc. Natl. Acad. Sci. U.S.A. Turner, T. R., James, E. K., and Poole, P. S. (2013). The plant microbiome. Genome 114, E2450–E2459. doi: 10.1073/pnas.1616148114 Biol. 14, 209–219. doi: 10.1186/gb-2013-14-6-209

Frontiers in Plant Science | www.frontiersin.org 16 January 2018 | Volume 8 | Article 2191 Armanhi et al. Plant Growth-Promoting Bacteria from Sugarcane

Uren, N. (2007). “Types, amounts, and possible functions of compounds released Zengler, K., Toledo, G., Rappe, M., Elkins, J., Mathur, E. J., Short, J. M., et al. (2002). into the rhizosphere by soil-grown plants,” in The Rhizosphere: Biochemistry Cultivating the uncultured. Proc. Natl. Acad. Sci. U.S.A. 99, 15681–15686. and Organic Substances at the Soil-Plant Interface, eds R. Pinton, Z. Varanini, doi: 10.1073/pnas.252630999 and P. Nannipieri (New York, NY: CRC Press), 1–21. Vartoukian, S. R., Palmer, R. M., and Wade, W. G. (2010). Strategies Conflict of Interest Statement: The authors declare that the research was for culture of “unculturable” bacteria. FEMS Microbiol. Lett. 309, 1–7. conducted in the absence of any commercial or financial relationships that could doi: 10.1111/j.1574-6968.2010.02000.x be construed as a potential conflict of interest. Yoshida, M., Ishii, S., Fujii, D., Otsuka, S., and Senoo, K. (2012). Identification of active denitrifiers in rice paddy soil by DNA- and RNA-based analyses. Microbes The reviewer YB and handling Editor declared their shared affiliation. Environ. 27, 456–461. doi: 10.1264/jsme2.ME12076 Yuan, C. L., Mou, C. X., Wu, W. L., and Guo, Y. B. (2011). Effect Copyright © 2018 Armanhi, de Souza, Damasceno, de Araújo, Imperial and Arruda. of different fertilization treatments on indole-3-acetic acid producing This is an open-access article distributed under the terms oftheCreativeCommons bacteria in soil. J. Soils Sediments 11, 322–329. doi: 10.1007/s11368-010- Attribution License (CC BY). The use, distribution or reproduction in other forums 0315-2 is permitted, provided the original author(s) or licensor are credited and that the Zarraonaindia, I., Owens, S., Weisenhorn, P., West, K., Hampton-Marcell, J., original publication in this journal is cited, in accordancewithacceptedacademic Lax, S., et al. (2015). The soil microbiome influences grapevine-associated practice. No use, distribution or reproduction is permittedwhichdoesnotcomply microbiota. MBio 6:e02527-14. doi: 10.1128/mBio.02527-14 with these terms.

Frontiers in Plant Science | www.frontiersin.org 17 January 2018 | Volume 8 | Article 2191 11699

9.2 Declaração de bioética e biossegurança

100117

9.3 Declaração referente a direitos