USOO9636302B2
(12) United States Patent (10) Patent No.: US 9,636,302 B2 Constien et al. (45) Date of Patent: *May 2, 2017
(54) LIPIDS AND COMPOSITIONS FOR (52) U.S. Cl. INTRACELLULAR DELVERY OF CPC ...... A61K 9/145 (2013.01); A61K 9/1271 BOLOGICALLY ACTIVE COMPOUNDS (2013.01); A61 K3I/575 (2013.01); A61 K 3 1/70 (2013.01); A61 K3I/7088 (2013.01); (71) Applicant: AXOLABS GMBH, Kulmbach (DE) A6 IK3I/73 (2013.01); A6 IK 38/02 (2013.01); A61K 39/00 (2013.01); A61K 47/18 (72) Inventors: Reisty, Pil (2013.01); A61K 4 7/22 (2013.01); B82Y5/00 Hadwiger, kiGh (DE): EP (2013.01); C07C 2 II/II (2013.01); C07C Haneke, Kulmbach (DE); Ludger 211/13 (2013.01); C07C 211/14 (2013.01); Ickenstein, Kulmbach (DE); Carla C07C 211/22 (2013.01); C07C 217/08 Alexandra Hernandez Prata, (2013.01); C07C 217/28 (2013.01); C07C Kulmbach (DE); Andrea Schuster, 217/42 (2013.01); C07D 24I/04 (2013.01); Bayreuth (DE); Timo Weide, Kulmbach C07D 295/13 (2013.01); C07D 295/30 (DE) (2013.01) (58) Field of Classification Search (73) Assignee: AXOLABS GMBH, Kulmbach (DE) CPC ...... A61K 9/145: A61K 39/00; A61K 47/18: - A61K 3 1/575; A61K 38/02: A61K 47/22: (*) Notice: Subject to any disclaimer, the term of this A61K 31 (7088: A61K 31/713: A61 K patent is extended or adjusted under 35 31/07; CO7D 295/13. CO7D 295/30 U.S.C. 154(b) by 0 days. C07C 211/22; C07C 211/11: CO7C This patent is Subject to a terminal dis- 217/42; C07C 211/13 claimer. See application file for complete search history. (21) Appl. No.: 15/219,602 (56) References Cited (22) Filed: Jul. 26, 2016 U.S. PATENT DOCUMENTS (65) Prior Publication Data 3,547.875 A * 12/1970 Bonkowski ...... CO8K 5, 17 US 2016/0324781 A1 Nov. 10, 2016 524/100 5.948,902 A 9, 1999 Honkanen et al. O O 8,691,750 B2 4/2014 Constien et al. Related U.S. Application Data 2006/0148904 A1 7/2006 Protopopova et al. (60) Continuation of application No. 14/178,538, filed on (Continued) Feb. 12, 2014, now Pat. No. 9,433,681, which is a division of application No. 13/466,640, filed on May FOREIGN PATENT DOCUMENTS 8, 2012, now Pat. No. 8,691,750. JP 07.017138 A 1, 1995 (30) Foreign Application Priority Data W. SR3 A 1938,
MaVay 17,1 1, 2011 (EP) ...... 11166353 OTHER PUBLICATIONS (51) Int.C07D Cl. 295/13 (2006.01) Noticeis of All wance in reasrelated U.S..S. Appl. No. 14f178.853,, mallemailed CD7C 2 II/22 (2006.01) J. inued CD7C 2 II/II (2006.01) (Continued) C07D 295/30 (2006.01) C07C 21 7/42 (2006.01) Primary Examiner — Samantha Shterengarts CD7C 2 II/3 (2006.01) Assistant Examiner — Matt Mauro CO7D 24I/04 (2006.01) A6 IK 9/14 (2006.01) (74) Attorney, Agent, or Firm – Medler Ferro A 6LX 3/575 (2006.01) Woodhouse & Mills PLLC A6 IK3I/7088 (2006.01) A6 IK3I/73 (2006.01) 57 ABSTRACT B825/00 (2011.01) (57) CD7C 2 II/4 (2006.01) The present invention provides novel amino-lipids, compo C07C 217/08 (2006.01) sitions comprising Such amino-lipids and methods of pro C07C 21 7/28 (2006.01) ducing them. In addition, lipid nanoparticles comprising the A 6LX 9/27 (2006.01) novel amino-lipids and a biologically active compound are A6 IK3I/70 (2006.01) provided, as well as methods of production and their use for A6 IK 38/02 (2006.01) intracellular drug delivery. A6 IK 47/22 (2006.01) A6 IK 39/00 (2006.01) A6 IK 47/8 (2017.01) 22 Claims, 23 Drawing Sheets US 9,636,302 B2 Page 2
(56) References Cited Soni et al., “Biodistribution, stability, and antiviral efficacy of liposome-entrapped phosphorothioate antisense U.S. PATENT DOCUMENTS oligodeoxynucleotides in ducks for the treatment of chronic duck hepatitus B virus infection.” Hepatology, vol. 28, No. 5, 1996, pp. 2012fO295832 A1 1 1/2012 Constien et al. 1402-1410. 2014/0162934 A1 6/2014 Constien et al. Felgner et al., “Lipofection: a highly efficient, lipid-mediated DNA 2014/01701.75 A1 6/2014 Constien et al. transfection procedure.” Proceedings of the National Academy of Sciences, vol. 84, Nov. 1987, Biochemistry pp. 7413-7417. OTHER PUBLICATIONS Olson et al., “Preparation of liposomes of defined size distribution by extrusion through polycarbonate membranes.” Biochimica et Non-Final Office Action in related U.S. Appl. No. 14/178,853, Biophysica Acta Biomembranes, vol. 557, 1979, pp. 9-23. mailed Apr. 10, 2015. Szoka et al., “Preparation of unilamellar liposomes of intermediate Smith, D.R., “Preparation of Symmetrical N, N'-Disubstituted size (0.1-02 um) by a combination of reverse phase evaporation and Piperazines and their Quaternary Ammonium Salts,” Journal of the extrusion through polycarbonate membranes.” Biochimica et American Chemical Society 72.7 (1950): 2969-2970. Biophysica Acta-Biomembranes, vol. 601, 1980, pp. 559-571. De Fougerolles et al., “Interfereing with disease: a progress report Vemuri et al., “Preparation and characterization of liposomes as on siRNA-based therapeutics.” Nature Reviews Drug Discovery, therapeutic delivery systems: a review.’ Pharmaceutica Acta vol. 6, Jun. 2007, pp. 443-453. Helvetiae, vol. 70, 1995, pp. 96-111. Robbins et al., “siRNA and Innate Immunity.” Oligonucleotides, Watwe et al., “Manufacture of liposomes: A review” Current vol. 19, No. 2, Mar. 11, 2009, pp. 89-101. Science, vol. 66, No. 7, Apr. 10, 1995, pp. 715-724. Soutscheck et al., “Therapeutic silencing of an endogenous gene by Riaz, et al., "Liposomes preparation methods.” Pakistan Journal of systemic administration of modified siRNAs.” Nature, vol. 432, Pharmaceutical Sciences, vol. 19, No. 1, 1996, pp. 65-77. Nov. 11, 2004, pp. 173-178. Podesta et al., “Chapter Seventeen-Engineering Cationic Zimmermann et al., “RNAi-mediated gene silencing in non-human Liposomes: siRNA Complexes for in Vitro and in Vivo delivery.” primates.” Nature 04688, 2006, pp. 1-4. Methods in Enzymology, vol. 464, 2009, pp. 343-354. Akinc et al., “A combinatorial library of lipid-like materials for Bajaj et al., “Structure-activity investigation on the gene transfec delivery of RNAi therapeutics.” Nature Biotechnology, Apr. 27. tion properties of cardiolipin mimicking gemini lipid analogs.” 2008, pp. 1-9. Bioconjugate Chemistry, vol. 19, No. 6, May 29, 2006, pp. 1283 Love et al., "Lipid-like materials for low-dose, in vivo gene 1300. silencing.” Proceedings of the National Academy of Sciences, vol. Piancatelli et al., “Pyridinium Chlorochromate: A versatile oxidant 107, No. 5, Feb. 2, 2010, pp. 1864-1869. in organic synthesis.” Synthesis, Apr. 1982, pp. 245-258. Heyes et al., "Cationic lipid saturation influences intracellular Abdel-Magid et al., “Reductive amination of aldehydes and ketones delivery of encapsulated nucleic acids,” Journal of Controlled with sodium triacetoxyborohydride. Studies on the direct and indi Release, vol. 107, Jul. 28, 2005, pp. 276-287. rect reductive amination procedures,” Journal of Organic Chemis Semple et al., “Rational design of cationic lipids for siRNA deliv try, vol. 61, No. 11, pp. 3849-3862. ery,” Nature Biotechnology, vol. 28, No. 2, Jan. 17, 2010, pp. Wincott et al., “Synthesis, deprotection, analysis and purification of 172-176. RNA and ribozymes,” Nucleic Acids Research, vol. 23, No. 14. MacLachlan et al., “Progress towards a synthetic virus for systemic 1995, pp. 2677-2684. gene therapy,” Current Opinion in Molecular Therapeutics, vol. 1, No. 2, 1999, pp. 252-259. * cited by examiner
U.S. Patent May 2, 2017 Sheet 4 of 23 US 9,636,302 B2
Q. KL30, moi, wi. () is
R. K.32, now. 236.2
S. RL33, noi, wt. i477.8 rS-N-N-N-N-N-N-N-1 N-n-r-n---n------N------N- ----N1-a-N-1--N-1- T. K. 34, ao, wi. 4677 r-n-r-Y-1S-1N1 ~~~~--~~~ ------n,: - 1N-N-N:-n-Y-N-Y-1S-r---N-1 Y------1---- J. K. 35 inol, wi. 457.6 -N-N-N-N-s:-N:-N-N- Y-1-1-1N1-1s-1N1- 1\r-N---N-a-ra-ra-na-n-Y- N------'n'-i 'N------a-ra-r--N- W. K. 36 no wi. 7744
Crsu
FG CO. U.S. Patent May 2, 2017 Sheet S of 23 US 9,636,302 B2
X. K 37 in wt. 3725 n-n-n-n-n- -N-n-N-N-1---Y---- N-Ya-Y:----n-n-n-n---n-N-N-N-n-n-n-n-n-n N-1N1-a- n------Y. K39, moi, wt. 279.3
-----1-1------^r- C------a-ra-r-h-n - ---- 1N1-1------X='.Y
Z, KA3, moi, wit, 846.8- r : ------M; ^ -- Y- is-n------: ------. ------AA. K.44, no wi. 905.()
-Y. ^ ------
- ^^ ------Ns. ^^-N------\.
8 B. Ki-45, nics v. 929.0 -N-ra-ra-ra-rn-n 1--n-N1N--1-1-1N1-1 1N-ra-ra-rn-ra-ra----- N-ra-ra-ra-ra-ra
FG 1 Cort. U.S. Patent May 2, 2017 Sheet 6 of 23 US 9,636,302 B2
CC. KL47, Jaoi wi. 646.8
S. S.y D. KL49, moi, wi. 68.
1. Y ---it-in-irr-e-N-N-N- N- N- N------Yi, ^-1-1-N-1 r-ra-n-N 1-1---Y------1-- - ^-N-1--r ra-n-ra
EE. K5 no wi. 845.6 n-n- ~~~~ N------~~su
FG Cort. U.S. Patent May 2, 2017 Sheet 7 of 23 US 9,636,302 B2
FF. K.52, ino, wit, 700.7
) / 1s-s-s-s- y
\- - G. K. 53, incl. wt. 26. N------~~~~~~~~ HH. K56, moi, wt. 96.3
F.G. Cort.
U.S. Patent May 2, 2017 Sheet 9 of 23 US 9,636,302 B2
SWN&S 338cisi. A 38ee. Sciogo is e8. o. 3A eje (SS8itixe y Ni U.S. Patent May 2, 2017 Sheet 10 of 23 US 9,636,302 B2
s -- i
.
sixx-xxx-xx-xxxx s s & s Š SWNS 328ds. 3A bee88 schoir go see ... O & A. e.e. losse adxe tyN. U.S. Patent May 2, 2017 Sheet 11 of 23 US 9,636,302 B2
:
s à s Š SyNS 333ds. A 3e3e3: Scindigo Lee ... O & Aege. OSS8idx8 y : U.S. Patent May 2, 2017 Sheet 12 of 23 US 9,636,302 B2
s s s i.8XXXXXXXXXXXX & & Š SyN&S 3.38 Sir AA 283e3. Scio. 8 go uéau. O 8A3e3, Bosse Edixa y N. U.S. Patent May 2, 2017 Sheet 13 of 23 US 9,636,302 B2
*————————————————
es O. 8 Aee u ossed dxe y Nui U.S. Patent May 2, 2017 Sheet 14 of 23 US 9,636,302 B2
8:{}{} U.S. Patent May 2, 2017 Sheet 15 Of 23 US 9,636,302 B2
asssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssss %{}{}; %08 eles O. eaee, OSSeidxe WN. U.S. Patent US 9,636,302 B2
Áæuppiu??uæquoowNxjuuya1 U.S. Patent May 2, 2017 Sheet 17 Of 23 US 9,636,302 B2
|%001 |%08 %09 eues o 8A e8. ossed dx8 yNL U.S. Patent May 2, 2017 Sheet 18 of 23 US 9,636,302 B2
uunun?e?u??ue?uo3wNxjuuya1
%09 8 : es o e Aee Losse dxe WNL
U.S. Patent May 2, 2017 Sheet 20 of 23 US 9,636,302 B2
euleszoux|Zºn»||98TMSºn»vºixcºnx,ZITX
U.S. Patent May 2, 2017 Sheet 21 of 23 US 9,636,302 B2
******!!!!!!;)*******¿¿.*
·
~~~~
3 d r eties o 8 Aee. Lossei dixie WNui U.S. Patent May 2, 2017 Sheet 22 of 23 US 9,636,302 B2
|euleszoux||ZGT»..98T»Gen»vei»cºnxzenxzinx zsvs|z|+|H|zo?ezala?o?zv?v.
.SS eues o a wee. Losse idxe y Nui U.S. Patent May 2, 2017 Sheet 23 of 23 US 9,636,302 B2
zs|?sZHIHZ0,10z)Hza?a?qzo?olazwv auleszouxlenxgen»vºix||cºnxzenxzinx US 9,636,302 B2 1. 2 LPDS AND COMPOSITIONS FOR pharmacokinetic characteristics of the double stranded RNA INTRACELLULAR DELVERY OF molecule. It has been demonstrated that these small mol BIOLOGICALLY ACTIVE COMPOUNDS ecule siRNA conjugates are efficacious in a specific down regulation of a gene expressed in hepatocytes of rodents. CROSS-REFERENCE TO RELATED However, in order to elicit the desired biologic effect a large APPLICATIONS dose was needed (Nature 2004, 432:173). With the advent of lipid nanoparticle formulations the The present application is a continuation of U.S. appli siRNA doses necessary to achieve target knockdown in vivo cation Ser. No. 14/178,538, filed Feb. 12, 2014, which is a could be significantly reduced (Nature 2006, 441:111). Typi divisional of U.S. application Ser. No. 13/466,640, filed May 10 cally, Such lipid nanoparticle drug delivery systems are 8, 2012, now U.S. Pat. No. 8,691,750, which claims benefit multi-component formulations comprising cationic lipids, of EP 11166353, filed May 17, 2011, the disclosures of each helper lipids, lipids containing polyethylene glycol and of which are incorporated by reference herein in their cholesterol. The positively charged cationic lipids bind to entireties. the anionic nucleic acid, while the other components Support 15 a stable self-assembly of the lipid nanoparticles. SEQUENCE LISTING To improve delivery efficacy of these lipid nanoparticle formulations, many efforts are directed to develop more The present application contains a Sequence Listing appropriate cationic lipids. These efforts include high which has been submitted electronically in ASCII format throughput generation of cationic lipid libraries based on and is hereby incorporated by reference in its entirety. Said Solvent- and protecting group free chemical reaction Such as ASCII copy, created on Jul. 20, 2016, is named 0073 Michael additions of amines to acrylamides or acrylates AX02US5 SL.txt and is 65,865 bytes in size. (Nature Biotechnology 2008, 26:561) or ring-opening reac tions with amines and terminal epoxides (PNAS 2010, FIELD OF THE INVENTION 107:1854). Another strategy involves structure activity stud 25 ies, e.g. systematic variation of the degree of Saturation in The present invention provides novel amino-lipids, com the hydrophobic part (Journal of Controlled Release 2005, positions comprising such amino-lipids and methods of 107:276) or the polar head group of the cationic lipid producing them. In addition, lipid nanoparticles (LNPs) (Nature Biotechnology 2010, 28:172), resulting in an comprising the novel amino-lipids and a biologically active improved efficacy of the so-called stable nucleic acid-lipid compound are provided, as well as methods of production 30 particles (SNALP) technology (Current Opinion in Molecu and their use for intracellular drug delivery. lar Therapeutics 1999, 1:252). Despites these efforts, improvements in terms of BACKGROUND OF THE INVENTION increased efficacy and decreased toxicity are still needed, especially for lipid nanoparticle based drug delivery systems Lipid nanoparticles (LNPs), liposomes or lipoplexes are 35 intended for therapeutic uses. LNPs naturally accumulate in effective drug delivery systems for biologically active com the liver after intravenous injection into an animal (Hepa pounds such as therapeutic proteins, peptides or nucleic acid tology 1998, 28:1402). It has been demonstrated that gene based therapeutics, which are otherwise cell impermeable. silencing can be achieved in Vivo in hepatocytes which Liposomal formulations have also been developed for small account for the majority of the cells in the liver. Even the molecule drugs with the aim to enrich the drug in certain 40 simultaneous down-modulation of several target genes tissues. expressed in hepatocytes could be successfully achieved Drugs based on nucleic acids interact with a messenger (PNAS 2010, 107:1854). However, evidence of successful RNA or a gene and have to be delivered to the proper cellular gene regulation in other liver cell types is lacking. compartment in order to be effective. In particular double stranded nucleic acids, for example double stranded RNA 45 SUMMARY OF THE INVENTION molecules (dsRNA) such as siRNAs, suffer from their physico-chemical properties that render them impermeable The present invention provides novel amino-lipids, com to cells. Upon delivery into the proper compartment, siR positions comprising the inventive amino-lipids, as well as NAS block gene expression through a highly conserved methods of producing them. In particular, compositions regulatory mechanism known as RNA interference (RNAi). 50 comprising the amino-lipids of the invention that form lipid Typically, siRNAs are large in size with a molecular weight nanoparticles (LNPs) are provided, as well as methods of ranging from 12-17 kDa, and are highly anionic due to their producing and their use for the intracellular delivery of phosphate backbone with up to 50 negative charges. In biologically active compounds, for example nucleic acids. addition, the two complementary RNA strands result in a The methods of producing the amino-lipids provided herein rigid helix. These features contribute to the siRNA’s poor 55 are advantageous compared to those known in prior art as “drug-like' properties (Nature Reviews, Drug Discovery the amino-lipids can be produced with a higher yield and 2007, 6:443). When administered intravenously, the siRNA increased purity. is rapidly excreted from the body with a typical half-life in The lipid nanoparticles (LNPs) comprising the inventive the range of only 10 min. Additionally, siRNAs are rapidly amino-lipids significantly enhance the intracellular delivery degraded by nucleases present in blood and other fluids or in 60 of nucleic acids into hepatocytes compared to LNPs com tissues, and have been shown to stimulate strong immune prising lipids known in prior art. In addition, the lipid responses in vitro and in vivo (Oligonucleotides 2009, nanoparticles (LNPs) comprising the inventive amino-lipids 19:89). enable inhibition of gene expression in additional liver cell By introduction of appropriate chemical modifications types apart from hepatocytes, such as Kupffer cells, Stellate stability towards nucleases can be increased and at the same 65 cells and endothelial cells. Moreover, the lipid nanoparticles time immune stimulation can be suppressed. Conjugation of (LNPs) comprising the inventive amino-lipids are suitable lipophilic small molecules to the siRNAs improves the for cell-type specific delivery of nucleic acids into various US 9,636,302 B2 3 4 organs in Vivo, including jujunum, liver, kidney, lung and bDNA assay. For comparison and shown has hashed bar, a spleen. Importantly, these lipid nanoparticles can also be benchmark LNP in which XTC2 substituted the amino-lipid administered via the air ways enabling gene silencing in the was included. lung. FIG.9. Graph illustrating Tek mRNA levels in liver after siRNA treatment employing different LNPs of the present BRIEF DESCRIPTION OF THE DRAWINGS invention. The LNPs contained a pool of five different siRNAs directed against five different targets (FVII, Rein, FIG.1. Structures representing amino-lipids of the inven Clec4f. Tek, GFP). The siRNA dose was 0.5 mg/kg per tion. siRNA (total siRNA dose 2.5 mg/kg). LNPs were dosed i.v. FIG. 2. Bar graph illustrating improved LNP composition 10 and 48 h post dosing mRNA levels were measured using of the invention to reduce FVII mRNA levels in mice. bDNA assay. For comparison and shown has hashed bar, a FIG. 3. Graph illustrating GFP mRNA levels after oro benchmark LNP in which XTC2 substituted the amino-lipid tracheal instillation of LNPs of the present invention into was included. GFP transgenic mice (n=4). Individual siRNAs directed FIG. 10. Graph illustrating Tek mRNA levels in liver after against the targets indicated below the bars were formulated 15 siRNA treatment employing different LNPs of the present into LNPs consisting of 50% KL25, 10% DSPC, 38.5% invention. The LNPs contained a pool of five different cholesterol and 1.5% PEG2000-c-DOMG. 48 h post admin siRNAs directed against five different targets (FVII, Rein, istration animals were killed, bronchoalveolar lavage fluid Clec4f. Tek, GFP). The siRNA dose was 0.5 mg/kg per (BALf) prepared and the GFP mRNA level determined using siRNA (total siRNA dose 2.5 mg/kg). LNPs were dosed i.v. bDNA assay. Hatched bars represent GFP mRNA levels of 5 and 48 h post dosing mRNA levels were measured using animals treated with the unspecific siRNAs. bDNA assay. For comparison and shown has hashed bar, a FIG. 4. Graph illustrating CD45 mRNA levels after benchmark LNP in which XTC2 substituted the amino-lipid orotracheal instillation of LNPs of the present invention into was included. GFP transgenic mice (n=4). Individual siRNAs directed FIG. 11. Graph illustrating Tek mRNA levels in lung after against the targets indicated below the bars were formulated 25 siRNA treatment employing different LNPs of the present into LNPs consisting of 50% KL25, 10% DSPC, 38.5% invention. The LNPs contained a pool of five different cholesterol and 1.5% PEG2000-c-DOMG. 48 h post admin siRNAs directed against five different targets (FVII, Rein, istration animals were killed, bronchoalveolar lavage fluid Clec4f. Tek, GFP). The siRNA dose was 0.5 mg/kg per (BAL?) prepared and the CD45 mRNA level determined siRNA (total siRNA dose 2.5 mg/kg). LNPs were dosed i.v. using bDNA assay. Hatched bars represent CD45 mRNA 30 and 48 h post dosing mRNA levels were measured using levels of animals treated with the unspecific siRNAs. bDNA assay. For comparison and shown has hashed bar, a FIG. 5. Graph illustrating CD68 mRNA levels after benchmark LNP in which XTC2 substituted the amino-lipid orotracheal instillation of LNPs of the present invention into was included. GFP transgenic mice (n=4). Individual siRNAs directed FIG. 12. Graph illustrating Tek mRNA levels in jejunum against the targets indicated below the bars were formulated 35 after siRNA treatment employing different LNPs of the into LNPs consisting of 50% KL25, 10% DSPC, 38.5% present invention. The LNPs contained a pool of five dif cholesterol and 1.5% PEG2000-c-DOMG. 48 h post admin ferent siRNAs directed against five different targets (FVII, istration animals were killed, bronchoalveolar lavage fluid Reln, Clec4f. Tek, GFP). The siRNA dose was 0.5 mg/kg per (BAL?) prepared and the CD68 mRNA level determined siRNA (total siRNA dose 2.5 mg/kg). LNPs were dosed i.v. using bDNA assay. Hatched bars represent CD68 mRNA 40 and 48 h post dosing mRNA levels were measured using levels of animals treated with the unspecific siRNAs. bDNA assay. For comparison and shown has hashed bar, a FIG. 6. Graph illustrating ClecTa mRNA levels after benchmark LNP in which XTC2 substituted the amino-lipid orotracheal instillation of LNPs of the present invention into was included. GFP transgenic mice (n=4). Individual siRNAs directed FIG. 13. Graph illustrating Reln mRNA expression levels against the targets indicated below the bars were formulated 45 of 2 individual animals per LNP relative to saline treated into LNPs consisting of 50% KL25, 10% DSPC, 38.5% animals 48 h post iv. dosing. LNPs contained a pool of five cholesterol and 1.5% PEG2000-c-DOMG. 48 h post admin different siRNAs directed against FVII, GFP, Rein, Clec4f istration animals were killed, bronchoalveolar lavage fluid and Tek each at a dose of 0.5 mg/kg (total siRNA dose 2.5 (BALf) prepared and the ClecTa mRNA level determined mg/kg). LNPs were composed of 50 mol % amino-lipid using bDNA assay. Hatched bars represent Clec7a mRNA 50 designated by the KL numbers in the graphs below, 10 mol levels of animals treated with the unspecific siRNAs. % DSPC, 38.5 mol % cholesterol and 1.5 mol % PEG-c- FIG. 7. Graph illustrating Reln mRNA levels after siRNA OMOG. For comparison and shown as hashed bar, a bench treatment employing different LNPs of the present inven mark LNP in which XTC2 substituted the amino-lipid was tion. The LNPs contained a pool of five different siRNAs included. directed against five different targets (FVII, Rein, Clec4f. 55 FIG. 14. Graph illustrating Clec4f mRNA expression Tek, GFP). The siRNA dose was 0.5 mg/kg per siRNA (total levels of 2 individual animals per LNP relative to saline siRNA dose 2.5 mg/kg). LNPs were dosed i.v. and 48 h post treated animals 48 h post iv. dosing. LNPs contained a pool dosing mRNA levels were measured using bDNA assay. For of five different siRNAs directed against FVII, GFP, Rein, comparison and shown has hashed bar, a benchmark LNP in Clec4f and Tek each at a dose of 0.5 mg/kg (total siRNA which XTC2 substituted the amino-lipid was included. 60 dose 2.5 mg/kg). LNPs were composed of 50 mol % FIG. 8. Graph illustrating Clec4f mRNA levels after amino-lipid designated by the KL numbers in the graphs siRNA treatment employing different LNPs of the present below, 10 mol% DSPC, 38.5 mol % cholesterol and 1.5 mol invention. The LNPs contained a pool of five different % PEG-c-OMOG. For comparison and shown as hashed bar, siRNAs directed against five different targets (FVII, Rein, a benchmark LNP in which XTC2 substituted the amino Clec4f. Tek, GFP). The siRNA dose was 0.5 mg/kg per 65 lipid was included. siRNA (total siRNA dose 2.5 mg/kg). LNPs were dosed i.v. FIG. 15. Graph illustrating Tek mRNA expression levels and 48 h post dosing mRNA levels were measured using of 2 individual animals per LNP relative to saline treated US 9,636,302 B2 5 6 animals 48 h post iv. dosing. LNPs contained a pool of five different siRNAs directed against FVII, GFP, Rein, Clec4f and Tek each at a dose of 0.5 mg/kg (total siRNA dose 2.5 mg/kg). LNPs were composed of 50 mol % amino-lipid designated by the KL numbers in the graphs below, 10 mol 5 % DSPC, 38.5 mol % cholesterol and 1.5 mol % PEG-c- OMOG. For comparison and shown as hashed bar, a bench mark LNP in which XTC2 substituted the amino-lipid was included. FIG. 16. Graph illustrating Tek mRNA expression levels 10 of 2 individual animals per LNP relative to saline treated animals 48 h post iv. dosing. LNPs contained a pool of five different siRNAs directed against FVII, GFP, Rein, Clec4f and Tek each at a dose of 0.5 mg/kg (total siRNA dose 2.5 mg/kg). LNPs were composed of 50 mol % amino-lipid 15 designated by the KL numbers in the graphs below, 10 mol % DSPC, 38.5 mol % cholesterol and 1.5 mol % PEG-c- OMOG. For comparison and shown as hashed bar, a bench mark LNP in which XTC2 substituted the amino-lipid was included. FIG. 17. Graph illustrating Tek mRNA expression levels of 2 individual animals per LNP relative to saline treated animals 48 h post iv. dosing. LNPs contained a pool of five different siRNAs directed against FVII, GFP, Rein, Clec4f and Tek each at a dose of 0.5 mg/kg (total siRNA dose 2.5 25 mg/kg). LNPs were composed of 50 mol % amino-lipid designated by the KL numbers in the graphs below, 10 mol % DSPC, 38.5 mol % cholesterol and 1.5 mol % PEG-c- OMOG. For comparison and shown as hashed bar, a bench mark LNP in which XTC2 substituted the amino-lipid was 30 included.
DETAILED DESCRIPTION OF THE INVENTION 35 A. Amino-Lipids and Methods of Producing Them. The amino-lipids provided herein are produced by reduc tive amination of a (poly)amine and an aliphatic carbonyl compound according to the general reaction scheme: 40 wherein R is selected from alkyl, alkenyl or alkynyl carbon chains ranging from C6 to C20. In certain embodiments these chains comprise at least one, at least two or at least three sites of unsaturation, for example one or more double The amino-lipids may be prepared by reacting the ali bonds or triple bonds. In one embodiment, R comprises at phatic carbonyl compound and the (poly)amine in the pres 45 least one aromatic cycle, including for example a hetero ence of a reducing agent. cycle. In yet another embodiment, R may comprise at least In certain embodiments the aliphatic carbonyl compound one heteroatom in the carbon chain, for example O, NH, is a ketone. In certain embodiments the aliphatic carbonyl NW, S, SS, wherein R' is an acyl, alkyl, alkenyl or alkynyl compound is an aldehyde. Typically, the (poly)amine has group consisting of two to 20 carbon atoms. In still another two to five nitrogenatoms in its structure. In certain embodi 50 embodiment, at least one hydrogen in the hydrocarbon chain ments the (poly)amine contains primary and/or secondary R may be replaced by F, Cl, Br, I. In one embodiment, w and and/or tertiary nitrogenatoms. Depending on the structure of V are independently 2, 3 or 4. In one embodiment, y and u the (poly)amine, and the aliphatic carbonyl compound are independently 0, 1, 2, 3 or 4. In one embodiment, X and employed regioselective alkylations can be achieved. Par Z are independently 2, 3 or 4. ticularly, when ketones are reacted with polyamines display 55 In one aspect, the present invention provides cyclic ing primary and/or secondary and/or tertiary nitrogens under amino-lipids of the formula (I): reductive amination conditions selective alkylations of pri mary nitrogens can be achieved. The present invention covers procedures of making amino-lipids of the following (I) Structures:
65 US 9,636,302 B2 7 8 wherein The term “C6-40 alkenyl as used herein means a linear R" is independently selected from or branched, unsaturated hydrocarbon consisting of 6 to 40 —(CH2) N(R), carbon atoms, preferably of 6 to 30 carbon atoms, most —(CH), N(R)-(CH), N(R), wherein R is inde preferably of 6 to 15 carbon atoms. In one embodiment the pendently selected from —H, C6-40 alkyl, C6-40 alk enyl and C6-40 alkynyl, provided that N(R) is not C6-40 alkenyl groups comprise 1 to 4 double bonds, pref NH, and erably between 1 to 3 double bonds, most preferably 1 or 2 C6-40 alkyl, and C6-40 alkenyl: double bonds. R’ is C6-40 alkyl, C6-40 alkenyl, or C6-40 alkynyl: The term “C6-40 alkynyl' as used herein means a linear m is 0 or 1; and or branched, unsaturated hydrocarbon consisting of 6 to 40 pharmaceutically acceptable salts thereof. carbon atoms, preferably of 6 to 30 carbon atoms, most The term “C6-40 alkyl as used herein means a linear or preferably of 6 to 20 carbon atoms. In one embodiment the branched, saturated hydrocarbon consisting of 6 to 40 car C6-40 alkynyl groups comprise 1 to 4 triple bonds, prefer bon atoms, preferably of 6 to 30 carbon atoms, most ably 1 to 3 triple bonds, most preferably 1 or 2 triple bonds. preferably of 6 to 20 carbon atoms. Especially preferred are In another embodiment there are provided the cyclic alkyl groups containing 10, 14 or 15 carbon atoms. amino-lipids selected from
US 9,636,302 B2 11 12 -continued
Preferred therein are the cyclic amino-lipids selected from
C--~~~
55 In one aspect, the present invention provides linear wherein amino-lipids of the formula (II): R is independently selected from C1-40 alkyl or C6-40 alkenyl, wherein up to 4 carbonatoms may be replaced by a heteroatom selected from oxygen or nitrogen; (II) 60 R" is selected from C12-40 alkyl or C6-40 alkenyl, R3 wherein up to 4 carbon atoms may be replaced by a heteroatom selected from oxygen or nitrogen; S-N -R R is selected from hydrogen, C12-30 alkyl and C6-40 R6 * alkenyl: R5 65 R is selected from hydrogen and C1-12 alkyl; n is 1, 2, or 3; and k is 1, 2, 3 or 4. US 9,636,302 B2 13 14 In a preferred embodiment, a linear amino-lipids of the R is selected from hydrogen, C12-, C14- and C30-alkyl, formula (II) is provided wherein in which one carbon atom can be optionally replaced by R is independently selected from C1-, C12-, C14-, C27-, a nitrogen atom; C30- and C37-alkyl, wherein 1 or 2 carbon atOmS can R is selected from hydrogen, C1- and C12-alkyl; and be optionally replaced by an oxygen or a nitrogenatom; 5 R is selected from C12-, C14-, C27- C30- and C37- in and k have the meanings given in claim 1. alkyl, wherein 1 or 2 carbon atoms can be optionally In one embodiment there are provided the linear amino replaced by an oxygen or a nitrogen atom; lipids selected from
N-1N1-S-N-1a s US 9,636,302 B2 15 16 -continued
|IZ -Cl ZEI: ZEI: 1C US 9,636,302 B2 18 -continued ric
/ / N N s1a1a-1a
N
N
N
n-n-n- US 9,636,302 B2 19 20 -continued
1S-1a-1\-1N1-1S-1a1\-1S
Preferred therein is the linear amino-lipid
45 In yet another embodiment an amino-lipid of formula
O H H
H H --~~~~ O
55 is provided. In yet another embodiment an amino-lipid of formula
H cro-C.H is provided. US 9,636,302 B2 21 22 In yet another embodiment an amino-lipid of formula
H H Yor --~c-H is provided. 10 The term “cyclic amino-lipid as used herein refers to an In particular embodiments the amino-lipids of the present amino-lipid of the general formula (I). invention comprise Nitrogen atoms that are protonated The term “linear amino-lipid as used herein refers to an depending on the pH of the environment, preferably at least amino-lipid of the general formula (II). one Nitrogen atom is positively charged at physiological pH In another aspect, novel amino-lipids can be prepared by or below. The extent of pH dependent protonation is effected 15 reacting a suitable (poly)amine with a carbonyl compound in by an equilibrium reaction and hence not the entire, but only the presence of a reducing agent to form a cyclic or linear the predominant lipid species is positively charged. At amino-lipid. physiological pH at least one of the nitrogen atoms in the In certain embodiments the alkyl, alkenyl and alkynyl lipid structure is protonated. groups as covered in the present invention contain 2 to 20 carbon atoms. In certain other embodiments these groups As used herein, the term “(poly)amine” refers to a satu consists of 2 to 10 carbon atoms. In yet other embodiments rated hydrocarbon linear or branched wherein 2 to 5 Carbon the alkyl, alkenyl and alkynyl groups employed in this atoms are replaced by Nitrogen. Preferably said (poly)amine invention contain 2 to 8 carbon atoms. In still other embodi comprises two to five nitrogen atoms. Preferred therein are ments these groups contain two to six carbon atoms. In yet (poly)amines that comprise amine Nitrogens that are sepa other embodiments the alkyl, alkenyl and alkynyl groups of rated by 2 and/or 3 and/or 4 carbon atoms. Non-limiting 25 the invention contain 2 to four carbon atoms. examples of Suitable (poly)amines are ethylenediamine, The term “alkyl as used herein means a chain of satu diethylenetriamine, triethylenetetramine, tetraethylenepen rated hydrocarbons that is aliphatic, branched or cyclo tamine, tris-(2-aminoethyl)-amine, 3-dimethylamino-1-pro aliphatic. Saturated aliphatic hydrocarbons include methyl, pylamine, spermine, spermidine, 2,2'-(ethylenedioxy)-bis ethyl, n-propyl. n-butyl and the like. Saturated branched (ethylamine). The term “aliphatic carbonyl compound as 30 alkyls include isopropyl, isobutyl, tert-butyl and the like. used herein refers to a compound R CO R', wherein R is Representative cyclo-aliphatic alkyls include cyclopropyl. a ketone or an aldehyde comprising of alkyl and/or alkenyl cyclobutyl, cyclopentyl, cyclohexyl and the like. and/or alkynyl groups and R' is H or a ketone or an aldehyde The term “alkenyl denotes a chain of hydrocarbons that comprising of alkyl and/or alkenyl and/or alkynyl groups. has at least one carbon-carbon double bond. For example The term “reducing agent” as used herein refers to a 35 alkenyl groups include ethenyl, propenyl, butenyl, isopro reagent that enables the reduction of the iminium ion inter pylidene and the like. The term also covers cyclic alkenyls mediate in reductive amination reactions. Examples of Such Such as cyclopropenyl, cyclobutenyl, cyclopentenyl and the reagents include, but are not limited to hydride reducing like. reagents such as Sodium cyanoborohydride, Sodium triac The term “alkynyl' denotes a chain of hydrocarbons that etoxyborohydride and sodium borotetrahydride. Catalytic 40 has at least one carbon-carbon triple bond. Exemplary hydrogenation with metal catalyst Such as nickel, palladium alkynyl groups include ethynyl, propynyl, butynyl and the or platinum can also be used for this purpose. As used like. The term also covers cyclic alkynyls such as cyclopen herein, the term “lipid refers to amphiphilic molecules tynyl, cyclohexynyl, and the like. comprising a polar, water Soluble “headgroup' and a hydro The term “acyl refers to any alkyl, alkenyl or alkynyl phobic “tail. The headgroup preferably consists of a pH 45 group that is linked through a carbonyl group. For example, dependent charged group Such as an amine. The tail pref acyl groups are —(CO)-alkyl, —(CO)-alkenyl and —(CO)- erably comprises aliphatic residues. Lipids can be of natural alkynyl. origin or of synthetic origin. Examples include, but are not B. Lipid Nanoparticles (LNPs) Comprising the Inventive limited to, fatty acids (e.g. oleic acid, lineolic acid, Stearic Amino-Lipids acid), glycerolipids (e.g. mono-, di-, triglycerols such as 50 Also provided herein are compositions comprising the triglycerides), phospholipids (e.g. phosphatidyletha amino-lipids of the invention that form lipid nanoparticles nolamine, phosphatidylcholine), and sphingolipids (e.g. (LNPs). As used herein, the term “lipid nanoparticles' sphingomyelin) includes liposomes irrespective of their lamellarity, shape or As used herein, the term "amino-lipid refers to lipids structure and lipoplexes as described for the introduction of having at least one of the Nitrogen atoms incorporated in at 55 pDNA into cells (PNAS, 1987, 84, 7413). These lipid least one fatty acid chain. This fatty acid chain may be an nanoparticles can be complexed with biologically active alkyl, alkenyl or alkynyl carbon chain. Lipids containing compounds such as nucleic acids and are useful as in vivo carbon chain lengths in the range from C10 to C20 are delivery vehicles. Preferably said in vivo delivery is cell preferred. It is understood that the fatty acid portion of the type specific. amino-lipid of the present invention is incorporated through 60 In one embodiment, said lipid nanoparticles comprise one the use of Suitable carbonyl compounds such as aldehydes or more amino-lipids of the invention described above and (R-CHO) and ketones (R—CO—R). Through the use of may furthermore comprise additional lipids and other hydro asymmetrical ketones (R-CO—R") corresponding unsym phobic compounds such as sterol derivatives, e.g. choles metrical Substituted lipids can be prepared. Likewise, terol. Those additional components of a lipid nanoparticle of through the use of carbonyl ethers, esters, carbamates and 65 the present invention serve various purposes such as aiding amides and Suitable reducing agents the corresponding manufacturing and storage stability as well as modulation of amino-lipids are accessible. the biodistribution. Biodistribution may also be modulated US 9,636,302 B2 23 24 by incorporation of targeting ligands conjugated to the lipids compounds that can be used to stabilize lipid nanoparticles part of the lipid nanoparticle. Specific examples of addi include gangliosides (GMt, GM3, etc.). Preferred PEG lipids tional components of the lipid nanoparticles are given below. have a PEG size ranging from about 1 to about 2 KDa. In one embodiment, lipid nanoparticles are provided that Specific examples are methoxy-polyethyleneglycol-carbam comprise the amino-lipids described above and one or more oyl-dimyristyloxy-propylamine (PEG2000-c-DMA), and additional lipids. Additional lipids suitable to be incorpo (C-(3'-(1,2-dimyristoyl-3-propanoxy)-carboxamide-pro rated into the lipid nanoparticles of the invention comprise cationic lipids, helper lipids and PEG lipids. Hence in one pyl-co-methoxy-polyoxyethylene (PEG2000-c-DOMG). embodiment lipid nanoparticles are provided that comprise In one embodiment lipid nanoparticles are provided that the amino-lipids described above and one or more additional comprise the amino-lipids described above and one or more lipids selected from the group of cationic lipid, helper lipid 10 hydrophobic small molecule. The term “hydrophobic small and PEG lipid. “Cationic lipids” as used herein refers to any molecule' as used herein refers to a compound with a lipid comprising a quaternary amine and are consequently molecular weight of about 300 to about 700 Da comprising permanently positively charged. The term "quaternary 2 or more carbon- or heterocycles providing a rigid core amine' as used herein refers to a nitrogen atom having four structure. Preferably said hydrophobic small molecule is organic Substituents. For example, the nitrogen atom in 15 selected from the group of sterols such as cholesterol or Tetramethylammonium chloride is a quaternary amine. Stigmasterol or a hydrophobic vitamin Such as tocopherol. In Examples of cationic lipids comprising a quaternary a preferred embodiment said hydrophobic small molecule is amine include, but are not limited to, N-(2,3-dioleyloxy) cholesterol. propyl)-N.N.N-trimethylammonium chloride (“DOTAP), In one embodiment the lipid nanoparticle comprises an N.N.-Distearyl-N,N-dimethylammonium bromide amino-lipid of the present invention, one or more additional (“DDBA), 1-methyl-4-(cis-9-dioleyl)-methylpyridinium lipids selected from the group of cationic lipid, helper lipid chloride (“SAINT-solid'), N-(2,3-dioleyloxy)propyl)-NN, and PEG lipid. and a hydrophobic small molecule selected N-triethylammonium chloride (“DOTMA'), N,N-dioleyl-N, from the group of a sterol or a hydrophobic vitamin. In one N-dimethylammonium chloride (“DODAC), (1,2- embodiment said lipid nanoparticle comprises an amino dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethyl lipid of the present invention, a helper lipid selected from ammonium bromide (“DIMRIE’) and the like. 25 “Helper lipids”, as used herein are preferably neutral DSPC or DPPC, PEG-DOMG and a hydrophobic small Zwitterionic lipids. Examples of preferred helper lipids used molecule selected from the group of a sterol or a hydropho in this invention are 1,2-distearoyl-sn-glycero-3-phospho bic vitamin. choline (“DSPC), 1,2-dipalmitoyl-sn-glycero-3-phospho In one embodiment the lipid nanoparticle comprises an 30 amino-lipid of the present invention, a helper lipid, a PEG choline (“DPPC), or any related phosphatidylcholine such modified lipid and cholesterol. In preferred embodiments the as natural sphingomyelin (“SM) and synthetic derivatives molar ratios of these components are 30-70% amino-lipid, thereof Such as 1-oleoyl-2-cholesteryl-hemisuccinoyl-sn 0-60% helper lipid, 0.1-10% PEG lipid and 0-50% choles glycero-3-phosphocholine (“OChemsPC). Other preferred terol. More preferred lipid nanoparticle compositions com helper lipids include I.2-dileoyl-sn-3-phosphoethanolamine 35 prise the above mentioned components in a molar ratio of (“DOPE), 1,2-diphytanoyl-sn-glycero-3-phosphoethanol about 40% to 60% amino-lipid, 0 to 20% helper lipid, 0.1% amine (“ME 16:0 PE). In one embodiment, LNPs contain uncharged lipids modi to 5% PEG lipid and 30 to 50% cholesterol. In certain other fied with hydrophilic polymers, e.g. polyethylene glycol embodiments lipid nanoparticles are provided that do not (herein also referred to as “PEG-lipids”) to stabilize the lipid comprise cholesterol. These formulations contain up to nanoparticle and to avoid aggregation. The polyethylene 40 about 60 mol % of at least one helper lipid. Preferred helper glycol (PEG) size can vary from approximately 1 to 5 lipids in these lipid nanoparticles are DSPC, SM, DOPE, approximately kDa. Depending on the relative amounts of 4ME16:OPE these molecules in the formulation and the length of the In one embodiment the lipid nanoparticle comprises a hydrocarbon chain, the PEG-lipid can influence the phar cyclic amino-lipid of the present invention, DSPC or SM, macokinetic characteristics, biodistribution, and efficacy of PEG-c-DOMG and cholesterol. Preferably, said cyclic a formulation. PEG lipids having relatively short lipid amino-lipid has the structure of
hydrocarbon chains of about 14 carbons dissociate from the Preferred molar ratios of these components are about 50% LNP in vivo in plasma with a half-life of less than 1 h. In of said cyclic amino-lipid, about 10% helper lipid, about contrast, a PEG lipid with a relatively long lipid hydrocar 38% cholesterol and about 2% of the PEG lipid. Preferred bon chain length of about 18 carbons circulates fully asso N/P ratios range from approximately 6.9 to approximately ciated with the formulation for several days. Hence, in one 60 8.4. preferred embodiment, said PEG lipid comprises a lipid In another embodiment cholesterol free lipid nanopar hydrocarbon chain of 12 to 20 carbonatoms, 14 to 18 carbon ticles are provided. These comprise a cyclic amino-lipid, the atoms, preferably of 14 carbon atoms. helper lipids DSPC and DOPE, as well as the PEG-lipid Typically, the concentration of the PEG-lipid is about 0.5 PEG-c-DMOG. LNPs comprising these components are not to 10 mol%. Examples of suitable PEG modified lipids 65 taken up by Kupffer cells in the liver, but mediate functional include pegylated ceramide conjugates, pegylated dis drug delivery to hepatocytes, stellate cells and endothelial tearoylphosphatidyl-ethanolamine (PEG-DSPE). Other cells. Preferably said cyclic amino-lipid has the structure of US 9,636,302 B2 25 26
In yet another embodiment cholesterol free lipid nano 10 particles comprise just one helper lipid. In this case a preferred lipid nanoparticle contains a cyclic amino-lipid, the helper lipid 4ME 16:0PE and PEG-c-DMOG. LNPs comprising these components are barely taken up by hepato cytes, but mediate functional drug delivery to Kupffer cells, 15 stellate cells and endothelial cells. Preferably said cyclic amino-lipid has the structure of
In one embodiment the lipid nanoparticle comprises an amino-lipid of the present invention, DSPC, a PEG lipid 30 such as PEG-c-DOMG and cholesterol. Preferably, said amino-lipid has the structure of
H ScriH N
Preferred molar ratios of these components are 40% to Preferred molar ratios of these components are 40% to 60% of said amino-lipid, about 0% to 20% helper lipid, 60% of said amino-lipid, about 0% to 20% helper lipid, about 38% cholesterol and approximately 2% of a PEG 2000 45 lipid. The N/P ratio preferably is at least about 15:1, more about 30% to 40% cholesterol and about 0.5% to about 2% preferably at least about 10:1, even more preferably at least of a PEG 2000 lipid. The N/P ratio preferably is at least about 7:1, and most preferably at least about 5:1. LNPs comprising these compositions are particularly well Suited to about 8:1, more preferably at least about 15:1 and most functional deliver nucleic acids into endothelial cells of 50 preferably at least about 10:1. Various organs. In another embodiment the lipid nanoparticle comprises In another preferred embodiment the lipid nanoparticle an amino-lipid of the present invention, DSPC, a PEG lipid comprises an amino-lipid of the present invention, DSPC, a such as PEG-c-DOMG and cholesterol. Saidamino-lipid has PEG lipid such as PEG-c-DOMG and cholesterol. Said the structure of amino-lipid has the structure of
n-n-n-n- US 9,636,302 B2 27 28
H 1N 1n o o o o N-1a N^-N- o o H
In another preferred embodiment the lipid nanoparticle rally occurring nucleic acids in a sequence specific manner comprises a cyclic amino-lipid of the present invention, 10 analogous to that of two naturally occurring nucleic acids, DSPC, a PEG lipid such as PEG-c-DOMG and cholesterol. e.g., can participate in Watson-Crick base pairing interac Said amino-lipid has the structure of tions. Non-naturally occurring nucleic acids are oligomers
In another preferred embodiment the lipid nanoparticle or polymers which contain nucleobase sequences which do comprises a cyclic amino-lipid of the present invention, not occur in nature, or species which contain functional DSPC, a PEG lipid such as PEG-c-DOMG and cholesterol. 25 equivalents of naturally occurring nucleobases, sugars, or Said amino-lipid has the structure of inter-Sugar linkages, like peptide nucleic acids (PNA), thre n-n-n-n-n-n-n-n ra-n-n-n-n-n-n- o o O o o N
In one embodiment, the lipid nanoparticles described 35 ose nucleic acids (TNA), locked nucleic acids (LNA), or above are complexed with a biologically active compound. glycerol nucleic acids (GNA). This term includes oligomers The term “complexed as used herein relates to the non- that contain the naturally occurring nucleic acid nucleobases covalent interaction of the biologically active compound adenine (A), guanine (G), thymine (T), cytosine (C) and with specific components of the lipid nanoparticle. In case of 40 uracil (U), as well as oligomers that contain base analogs or a nucleic acid as the biologically active compound the modified nucleobases. Nucleic acids can derive from a negatively charged phosphate backbone of the nucleic acid variety of natural sources such as viral, bacterial and eukary interacts with the positively charged amino-lipid. This inter- otic DNAS and RNAs. Other nucleic acids can be derived action Supports the stable entrapment of the nucleic acid into from Synthetic sources, and include any of the multiple the LNP. 45 oligonucleotides that are being manufactured for use as The term “biologically active compound as used herein research reagents, diagnostic agents or potential and definite refers to an inorganic or organic molecule including a small therapeutic agents. The term includes oligomers comprising molecule, peptide (e.g. cell penetrating peptides), carbohy- a single strand nucleic acid or a double strand nucleic acid. drate (including monosaccharides, oligosaccharides, and Examples of nucleic acids useful therein are miRNA, anti polysaccharides), protein (including nucleoprotein, muco- 50 sense oligonucleotides, siRNA, immune-stimulatory oligo protein, lipoprotein, synthetic polypeptide, or a Small mol nucleotides, aptamers, ribozymes, or plasmids encoding a ecule linked to a protein, glycoprotein), Steroid, nucleic acid, specific gene or siRNA. lipid, hormone, or combination thereof, that causes a bio logical effect when administered in vivo to an animal, As used herein, the term "peptide' is used to refer to a including but not limited to birds and mammals, including 55 natural or synthetic molecule comprising two or more amino humans. Preferably said biologically active compound is acids linked by an amide bond consisting of the carboxylic negatively charged. acid group of one amino acid and the amino group by the In one embodiment the lipid nanoparticles described other amino acid. A peptide is not limited by the number of above are complexed with a biologically active compound amino acids and thus it can include polypeptides and pro selected from the group of small molecule, peptide, protein, 60 ens. carbohydrate, nucleic acid, or lipid. Preferably said biologi- Below embodiments are exemplified for the complexation cally effect is a therapeutic effect. and delivery of nucleic acids. It is understood that these The term “nucleic acid as used herein means an oligomer embodiments are also applicable for any other biologically or polymer composed of nucleotides, e.g., deoxyribonucle- active compound. otides or ribonucleotides, or compounds produced syntheti- 65 The complex comprising lipid nanoparticles and one or cally (e.g., PNA as described in U.S. Pat. No. 5.948,902 and more nucleic acid are characterized by the following param the references cited therein) which can hybridize with natu- eters: (1) nucleic acid to total lipid ratio; (2) nucleic acid to US 9,636,302 B2 29 30 amino-lipid ratio; (3) encapsulation efficacy; (4) particle Below embodiments are exemplified for the complexation size; (5) particle size distribution and (6) Zeta potential. and delivery of nucleic acids. It is understood that these The nucleic acid to total lipid ratio is the amount of the embodiments are also applicable for any other biologically nucleic acid in a defined volume divided by the amount of active compound. total lipid in the same volume. Total lipid refers to all 5 In one embodiment, the components of the lipid nano components in the particle formulations except for the particles as outlined above are mixed in a solvent that is nucleic acid. The ratio may be expressed on a mole per mole miscible with water, such as methanol, ethanol isopropanol or weight by weight basis. or acetone. Preferred solvents are alcohols, most preferable The nucleic acid to amino-lipid ratio is the amount of the ethanol. In most preferred embodiments the solvent is com 10 mercially available ethanol. In certain embodiments the lipid nucleic acid in a defined volume divided by the amount of mixture consists of the above components in a molar ratio of amino-lipid in the same Volume. The ratio may be expressed about 30 to 70% amino-lipid:0 to 60% helper lipid:0.1 to on a mole per mole or weight by weight basis; but is usually 10% PEG-lipid and 0 to 50% cholesterol. More preferred expressed as nitrogen to phosphorus (N/P) ratio. The (N/P) lipid nanoparticle compositions comprise the above men ratio is characterized by the number of positively charged tioned components in a molar ratio of about 40% to 60% nitrogen atoms present in the amino-lipid divided by the amino-lipid, 0 to 20% helper lipid, 0.1% to 5% PEG lipid number of negatively charged phosphorus atoms present in and 30 to 50% cholesterol. In certain other embodiments the nucleic acid. Encapsulation efficacy is defined as the lipid nanoparticles lack cholesterol. These formulations con percentage of nucleic acid that is encapsulated or otherwise tain up to about 60 mol % of at least one helper lipid. associated with the lipid nanoparticle. The encapsulation Preferred helper lipids in these lipid nanoparticles are efficiency is usually determined by quantifying the amount DSPC, SM, DOPE, 4ME16:0PE. of the nucleic acid in solution before and after breaking up In one embodiment, the nucleic acid is dissolved in an the lipid nanoparticle by Suitable organic solvents or deter aqueous buffer. The pH of the buffer is such that at least one gents. A high encapsulation efficiency is a desirable feature of the nitrogen atoms of the amino-lipids of the present of nucleic acid lipid nanoparticles particularly because of 25 invention will become protonated upon mixing the aqueous considerations regarding cost of goods. nucleic acid solution with the solution comprising the com The particle size of lipid nanoparticles is typically mea ponents of the lipid nanoparticles. Examples of appropriate Sured by dynamic light scattering. Sizes of lipid nanopar buffers include, but are not limited to acetate, phosphate, ticles in a given formulation are typically distributed over a citrate, EDTA and MES. Preferred concentration of the certain range The size of lipid nanoparticles is typically 30 buffers are in the range of about 1 to about 500 mM. expressed as the mean particle size or the Z value. The Typically the concentration of the nucleic acid in the aque particle size distribution of lipid nanoparticles is expressed ous buffer is in the range of about 0.1 to about 250 mg/mL, as the polydispersity index (PI). Particles in the size range of more preferably from about 0.5 to about 150 mg/mL. 30 to 300 nm are considered advantageous for in vivo The Solution comprising the components of the lipid applications. Lipid nanoparticles with a mean particle size 35 nanoparticles is then combined with the buffered aqueous less than approximately 150 nm are advantageous, in par solution of the nucleic acid. Acidic pH is preferred, particu ticular to assess tissues characterized by a leaky vasculature larly a pH below 6.8, more preferably a pH below 5.4 and as is the case for tumor tissue or liver. Lipid nanoparticles most preferably about 4.0. Optionally, the entire mixture with a mean particle size greater than approximately 150 nm may be sized according to known methods, e.g. by extru are advantageous, in particular to assess macrophages. 40 sion. Particles with a mean diameter of preferably 40 to 170 Nucleic acid lipid nanoparticles are also characterized by nm, most preferably of about 50 to 120 nm are generated. their Surface charge as measured by the Zeta (0-potential. Subsequently, the pH is neutralized yielding an at least The basis of the measurement is the movement of particles partially surface-neutralized nucleic acid lipid nanoparticle in an electrical field as measured by dynamic light scatter complex. Due to the fact that amino-lipids of the present ing. Particles with a near to neutral Surface charge are 45 invention have at least two nitrogen atoms, pKa values can advantageous for in vivo applications and are thus preferred differ substantially. Formation of complexes with nucleic herein. acids is most Supported at low pH in the range of about 3 to Particularly because of cost of goods and manufacturing about 5. At a pH of about 7, at least partial surface neutral reasons a high encapsulation efficiency of the nucleic acids ization is achieved. complexed with the lipid nanoparticles is desirable. Particles 50 In one embodiment, the ratio of lipid: nucleic acid is at in the size range of 30 to 300 nm with near to neutral surface least about 2:1, at least about 3:1, at least about 4:1, at least charge are known to be advantageous for in vivo applica about 5:1, at least about 6:1, at least about 7:1, at least about tions. 8:1, at least about 10:1, at least about 15:1. C. Methods of Producing Lipid Nanoparticles (LNPs) Com Techniques to combine the Solutions comprising the com prising the Inventive Amino-Lipids and Complexes Thereof 55 ponents of the lipid nanoparticles and the buffered aqueous with Biologically Active Compounds. Solution of the nucleic acid can vary widely and may be In general, any method known in the art can be applied to dependent on the scale of production. Preparations in the prepare the lipid nanoparticles comprising one or more range of a few mL may be made by pipetting one solution amino-lipids of the present invention and to prepare com into the other followed by mixing with e.g. a vortex mixture. plexes of biologically active compounds and said lipid 60 Larger Volumes can be preferentially prepared by a continu nanoparticles. Examples of Such methods are widely dis ous mixing method using pumps, e.g. a piston pump such as closed, e.g. in Biochimica et Biophysica Acta 1979, 557:9, Pump 33 (Harvard Apparatus) or most preferably HPLC Biochimica et Biophysica Acta 1980, 601:559, Liposomes. A pumps such as AKTA pumps (GE Healthcare). With the aid practical approach (Oxford University Press, 1990); Phar of Such pumps the two solutions are pumped out of their maceutica Acta Helvetiae 1995, 70:95, Current Science 65 individual reservoirs and combined by delivering the fluids 1995, 68:715, Pakistan Journal of Pharmaceutical Sciences through a suitable connector piece or mixing chamber. By 1996, 19:65, Methods in Enzymology 2009, 464:343. varying the concentrations of the two solutions and their US 9,636,302 B2 31 32 flow rates, the mean size of the resulting lipid nanoparticles lar, intraarticular, Subcapsular, Subarachnoid, intraspinal, can be controlled within a certain range. Preferably, the epidural and intrastemal injection and infusion. compositions provided herein are sized to a mean diameter Actual dosage levels of the active ingredients in the from about 50 nm to about 200 nm, more preferably about pharmaceutical compositions of the present invention may 50 nm to about 150 nm and most preferably about 50 nm to be varied so as to obtain an amount of the active ingredient 120 nm. which is effective to achieve the desired therapeutic In certain embodiments, methods of the present invention response for a particular patient, composition, and mode of further comprise a processing step that ensures the Substan administration, without being toxic to the patient. The tial removal of the solvent that was used to dissolve the lipid selected dosage level will depend upon a variety of phar mixture and to exchange the buffer used to dissolve the 10 macokinetic factors including the activity of the particular therapeutically active agent. Suitable techniques to carry out compositions of the present invention employed, the route of this processing step include, but are not limited to diafiltra administration, the time of administration, the rate of excre tion or tangential flow filtration. For buffer exchange a tion of the particular compound being employed, the dura physiologically compatible buffer Such as phosphate or 15 tion of the treatment, other drugs, compounds and/or mate HEPES buffered saline with a pH of about 7.4 or 5% rials used in combination with the particular compositions dextrose solution (DSW) is used. employed, the age, sex, weight, condition, general health Optionally, nucleic acid lipid nanoparticles can be pro and prior medical history of the patient being treated, and duced using the lipid film hydration method followed by like factors well known in the medical arts. extrusion. In this case, the components of the lipid nano The pharmaceutical composition must be sterile and fluid particle, i.e. one of the amino-lipids as described in the to the extent that the composition is deliverable through present invention, a helper lipid, a PEG-lipid (e.g. PEG-c- Syringe or infusion techniques. In addition to water, the DOMG) and a sterol, e.g. cholesterol, are dissolved in an carrier is preferably an isotonic Sugar Solution and most organic solvent Such as chloroform. The solvent is evapo preferably an isotonic buffered saline solution. rated yielding a thin lipid film, which is Subsequently 25 Proper fluidity can be maintained, for example, by use of hydrated with an aqueous buffer containing the therapeuti coating Such as lecithin, by maintenance of required particle cally active agent to form the desired lipid nanoparticle. size and by use of Surfactants. In many cases, it is preferable Alternatively, the lipid film is hydrated with buffer and the to include isotonic agents, for example, Sugars, polyalcohols nucleic acid is added in a Subsequent incubation step. Such as mannitol or Sorbitol, and Sodium chloride in the D. Pharmaceutical Compositions and Medical Uses. 30 composition. In another object the present invention relates to a phar maceutical composition comprising the amino-lipids of the In another object the present invention relates to the use invention. Preferably said pharmaceutical composition com of the lipid nanoparticles of the invention complexed to a prises the lipid nanoparticles of the present invention and a biologically active compound as a medicament for treatment biologically active compound. In one embodiment said 35 of a disease. In one embodiment the biologically active biologically active compound is selected from the group of compound is a nucleic acid that may comprise a single a small molecule, a peptide, a protein or a nucleic acid. In strand or a double strand DNA or RNA which may or may a preferred embodiment, said biologically active compound not be chemically modified. Examples of nucleic acids is a nucleic acid. Examples of nucleic acids useful therein useful therein are miRNA, short interfering RNA (siRNA), are miRNA, antisense oligonucleotides, siRNA, immune 40 antisense oligonucleotides, immune-stimulatory oligonucle stimulatory oligonucleotides, aptamers, ribozymes, or plas otides, aptamers, ribozymes, or plasmids encoding a specific mids encoding a specific gene or siRNA. gene or a siRNA. In particular embodiments the biologically The pharmaceutical compositions provided herein may active compound is a short interfering RNA (siRNA) and is additionally contain adjuvants such as preservatives, wetting complexed with the lipid nanoparticles of the present inven agents, emulsifying agents and dispersing agents. Preven 45 tion, thus enabling intracellular delivery of said biologically tion of presence of microorganisms may be ensured both by active compound. sterilization procedures, Supra, and by the inclusion of In one embodiment the present invention provides a various antibacterial and antifungal agents, for example, method of treating a disease that is caused by the over paraben, chlorobutanol, phenol, Sorbic acid, and the like. It expression of one or several proteins in a subject, said may also be desirable to include isotonic agents. Such as 50 method comprising administration of the a pharmaceutical Sugars, sodium chloride, and the like into the compositions. composition of the present invention to said Subject. The In addition, prolonged absorption of the injectable pharma pharmaceutical composition comprises the LNP of the ceutical form may be brought about by the inclusion of invention and a biologically active compound selected from agents which delay absorption Such as aluminum monoste the group of siRNA, miRNA, antisense oligonucleotides, arate and gelatin. 55 ribozyme or a plasmid encoding for an siRNA, all being able Regardless of the route of administration selected, the to interfere with the expression of the disease causing lipid nanoparticles of the present invention, which may be protein(s). used in a suitable hydrated form, and/or the pharmaceutical In another embodiment, the present invention provides a compositions of the present invention, are formulated into method of treating a disease that is caused by a reduced pharmaceutically acceptable dosage forms by conventional 60 expression or a Suppressed expression of one or several methods known to those of skill in the art. proteins in a Subject, said method comprising administration The phrases “administration' and “administered as used the pharmaceutical composition of the present invention to herein means modes of administration other than enteral and the Subject. The pharmaceutical composition comprises the topical administration, usually by injection, and includes, LNP of the invention and a biologically active compound without limitation, intravenous, intramuscular, intraarterial, 65 selected from the group of a plasmid encoding for the intrathecal, intracapsular, intraorbital, intracardiac, intrader corresponding protein(s) or a nucleic acid that interferes mal, intraperitoneal, transtracheal, Subcutaneous, Subcuticu with the Suppressor molecule. US 9,636,302 B2 33 34 In yet another embodiment, the present invention pro Ether containing alcohols were prepared following a vides for a method of generating an immune response in a published procedure (Bioconjugate Chemistry 2006, Subject upon administration of a pharmaceutical composi 19:1283). The subsequent oxidation to the corresponding tion of the present invention to said Subject. The pharma aldehyde was again accomplished with IBX according to the ceutical composition comprises the LNP of the invention procedure given above. and a biologically active compound, wherein the biologi cally active compound is an immune-stimulatory nucleic Bn O O acid Such as a CpG oligonucleotide. As used herein, “treat No 1. base O YR IBX ment” (and grammatical variations thereof such as “treat' or He- He 10 2. R-Br “treating) refers to clinical intervention in an attempt to -R alter the natural course of the individual being treated, and O O can be performed either for prophylaxis or during the course of clinical pathology. Desirable effects of treatment include, O but are not limited to, preventing occurrence or recurrence 15 of disease, alleviation of symptoms, diminishment of any direct or indirect pathological consequences of the disease, O NR preventing metastasis, decreasing the rate of disease pro gression, amelioration or palliation of the disease state, and O1 R remission or improved prognosis. In some embodiments, antibodies of the invention are used to delay development of a disease or to slow the progression of a disease. R:-dodecyl, -tetradecyl, -hexadecyl EXAMPLES 25 The aldehydes needed for the preparation of KL52 and The following are examples of methods and compositions KL56 were synthesized by oxidation of the corresponding of the invention. It is understood that various other embodi alcohols employing pyridinium chlorochromate (PCC) in ments may be practiced, given the general description pro Dichloromethane according to standard procedures (Synthe vided above. 30 sis, 1982, 245). Other aldehydes are commercially available. Although the foregoing invention has been described in The amine in KL 12, KL22, KL33, KL34 and KL35 was Some detail by way of illustration and example for purposes made pursuing a published synthesis route (PNAS 2010, of clarity of understanding, the descriptions and examples 5:1864). should not be construed as limiting the scope of the inven 35 B) Preparation of N-Peralkylated Amino-Lipids. tion. The disclosures of all patent and scientific literature KL4, KL9, KL22, KL33, KL34, KL35, KL36, KL37, cited herein are expressly incorporated in their entirety by KL51, KL52, KL53, and KL56 were prepared by combining reference. the corresponding aldehyde and corresponding amine in dichloroethane (DCE) in a ratio of 1.75 equivalents per Example 1. Amino-Lipids 40 amino function of the amine. To this solution was added at room temperature sodium triacetoxyborohydride (NaBH Examples of amino-lipids of the present invention syn (OAc)) (1.3 equivalents per aldehyde) and acetic acid thesized by reaction of an amine and a carbonyl compound (HOAc, 1.3 equivalents per aldehyde). The reaction mixture under reductive amination conditions are listed in Table 1. 45 was stirred at ambient temperature until thin layer chroma Solvents and reagents were purchased from Sigma Aldrich tography indicated completion of reaction. After hydrolysis (Taufkirchen, Germany) or TCI Europe (Eschborn, Ger with 2N NaOH, the reaction mixture was extracted twice many) and were used as received (FIG. 1). with dichloromethane (DCM). The combined organic layers A) General Synthesis Procedure for Amino-Lipids Gener were washed with saturated NaCl solution and dried over 50 NaSO. The solvent was removed under reduced pressure ated by Reaction of Amines and Aldehydes. and the crude product was Subject to flash chromatography The aldehydes needed for the preparation of KL5, KL6 or reversed phase (RP) HPLC. KL7, KL8, KL12, KL15, KL16, KL34, KL35, KL37 were prepared by oxidation of the corresponding alcohols using Amino-lipids were analyzed for purity using analytical 2-Iodoxybenzoic acid (IBX) according to the following reversed phase HPLC. For this purpose, an XBridge C4 general procedure: 55 column (2.1 x50 mm, 3.5 um) from Waters (Eschborn, The alcohol was dissolved in anhydrous ethyl acetate Germany) was used. Eluent was A 0.1% TFA in water and (EtOAc, 10 mL/1.0 mmol). IBX (1.1 eq) was added to form eluent B was 0.1% TFA in 90% Acetonitrile (ACN). Elution a suspension. The mixture was stirred briskly and refluxed at was achieved at a column temperature of 60° C. running a 80° C. under Argon. DMSO (2.2 eq.) was added via a 60 gradient from 50% to 100% B in 20 min at a flow rate of 0.5 syringe and the suspension was refluxed for 1.5 h. The mL/min. Amino-lipids were detected using an evaporative insoluble o-iodobenzoic acid by-product was filtered off. light scattering detector (PL-ELS 2100, Agilent, Waldbronn, The solvent was removed under reduced pressure and the Germany) with evaporation temperature set to 90° C., nebu crude product purified by flash-chromatography (Hexan lizer temperature set to 40° C. and a nitrogen flow of 1 Hexcan/EtOAc=10:1, Rf 0.35 in Hexan/EtOAc=5:1). The 65 mL/sec. Identity was established by electrospray ionization final products were characterized by HPLC and mass spec (ESI) mass spectrometry (MS) and direct infusion tech trometry. nique. US 9,636,302 B2 35 36 1) Synthesis of KL22.
15 To a solution of Dodecanal (11.6 g. 62.8 mmol, 9.0 eq, was subject to flash chromatography (DCM-DCM/ 1.75 eq/amine function) and 2-4-(2-Amino-ethyl)-piper CHOH=100:6. Rf=0.05 in DCM/CHOH=100:1 (0.5% azin-1-yl-ethyl-ethane-1,2-diamine (1.5 g, 7.0 mmol. 1.0 NEt)) to afford the title compound as a pale yellow oil. eq) in 100 mL dichloroethane (DCE) was added sodium triacetoxyborohydride (NaBH(OAc)) (17.3 g, 81.6 mmol. ESI-MS (direct infusion): M+H+: 1058.5 11.7 eq) and acetic acid (HOAc) (81.6 mmol. 5.0 mL) at A comparison of crude synthesis products obtained by an room temperature. The reaction mixture was stirred for 16 h alternate peralkylation procedure (ring opening reaction of at ambient temperature. After hydrolysis with 2N NaOH the terminal epoxides by amines) detailed in WO2010/ reaction mixture was extracted twice with dichloromethane 053572A2 and PNAS 2010, 5:1864 underscores the high (DCM). The combined organic layers were washed with 25 efficiency of the chemistry disclosed herein allowing for saturated NaCl-solution and dried over NaSO. The solvent high isolated yields (FIG. 1). was removed under reduced pressure and the crude product 2) Synthesis of KL10. N-----> ~~~~ N~~~~Nu
40 To a solution of Dodecanal (15.1 g, 82.1 mmol. 6.0 eq) and Tris-(2-aminoethyl)-amine (2.0 g, 13.7 mmol. 1.0 eq) in 100 mL DCE was added NaBH(OAc) (26.1 g, 123.1 mmol, 9.0 eq) and HOAc (123.1 mmol. 7.0 mL) at room tempera 45 ture. The reaction mixture was stirred for 16 h at ambient temperature. After hydrolysis with 2N NaOH the reaction mixture was extracted twice with DCM. The combined organic layers were washed with saturated NaCl-solution and dried over NaSO. The solvent was removed under 50 reduced pressure and the crude product was subject to flash chromatography (DCM-DCM/CHOH=10:1-DCM/ CHOH=5:1, Rf 0.01 in DCM (0.5% NEt)) to concentrate the title compound as a pale yellow oil. KL10 was further purified to homogeneity using RP HPLC. ESI-MS (direct 55 infusion): M+H+: 986.1 3) Synthesis of KL36. US 9,636,302 B2 37 To a solution of Dodecanal (3.22 g, 17.5 mmol. 4.5 eq) -continued and Diethylentriamine (0.40 g, 3.88 mmol. 1.0 eq) in 50 mL DCE was added NaBH(OAc), (5.56 g, 26.3 mmol. 6.75 eq) and HOAc (26.3 mmol, 1.6 mL) at room temperature. The reaction mixture was stirred for 16 hat ambient temperature. R -O N 1N1NX N OS R After hydrolysis with 2N NaOH the reaction mixture was H H R R extracted twice with DCM. The combined organic layers n O O1 were washed with saturated NaCl-solution and dried over NaSO. The solvent was removed under reduced pressure 10 and the crude product was Subject to flash chromatography R:-dodecyl, -tetradecyl, -hexadecyl (DCM-DCM/CHOH=10:1-DCM/CHOH=5:1, Rf-0.01 in DCM (0.5% NEt)) to concentrate the title compound as a pale yellow oil and to remove the excess aldehyde. The crude product was finally purified by HPLC employing a C4 15 reversed phase column (YMC-Pack C4, 150x20 mm, 10um. The corresponding aldehyde (2.0 eq) and amine (1.0 eq) Dienslaken, Germany). Eluent A was HO containing 0.1% were mixed in MeOH (20 mL/1.0 mmol) at room tempera Trifluoroacetic acid (TF A) and eluent B was 90% ACN ture under an Argon atmosphere. The mixture was stirred at containing 0.1% TFA. For elution at room temperature, a ambient temperature for 3 h, until the aldimine formation gradient from 70-100% Eluent B and a flow rate of 45 was completed. The solvent was removed under reduced mL/min was used. 5 ESI-MS (direct infusion): M+H+: pressure and the crude product was dissolved in DCE (20 776.7 mL/1.0 mmol) and treated with NaBH(OAc) (3.0 eq) and 4) Synthesis of KL37. AcOH (3.0 eq) and stirred under Argon for 3 h. The reaction n-n-n-n-n-n-n-n ra-n-n-n-n-n-n- Ncr
To a solution of octadecanal (1.20 g, 4.51 mmol. 5.5 eq) was quenched with 2M NaOH and the product was extracted and Tris-(2-aminoethyl)-amine (0.12 g, 0.82 mmol. 1.0 eq) 35 with EtOAc. The combined organic layers were dried over in 50 mL DCE was added NaBH(OAc) (1.43 g. 6.77 mmol, MgSO and the solvent was evaporated under reduced 6.75 eq) and HOAc (6.77 mmol, 0.4 mL) at room tempera pressure. The crude product was subject to flash chroma ture. The reaction mixture was stirred for 16 h at ambient tography (DCM-DCM/MeOH=9:1, Rf 0.25 in DCM/ temperature. After hydrolysis with 2N NaOH, the reaction MeOH=0:1 (0.5% NEt)) to afford the desired compound as mixture was extracted twice with DCM. The combined 40 a pale yellow oil. The final product was characterized by organic layers were washed with saturated NaCl-solution HPLC and mass spectrometry. and dried over NaSO. The solvent was removed under D. General Synthesis Procedure for Amino-Lipids Derived reduced pressure and the crude product was Subject to flash from Amines and Ketones. chromatography (DCM-DCM/CHOH=10:1-DCM/ CHOH=5:1, Rf 0.01 in DCM (0.5% NEt)) to concentrate 45 The ketone needed for the preparation of KL32 and KL39 the title compound as a pale yellow oil and to remove the was prepared in 4 steps according to a published synthesis excess aldehyde. The crude product was finally purified by route (Nature Biotechnology 2010, 28:172). Other ketones HPLC on a C4 reversed phase column (YMC-Pack C4. are commercially available. The amine in KL23, KL30 and 150x20 mm, 10 um). Eluent A was HO containing 0.1% KL39 was made pursuing a published synthesis route (PNAS Trifluoroacetic acid (TFA) and eluent B was 90% ACN 50 2010, 5:1864). containing 0.1% TFA. For elution at room temperature, a gradient from 70-100% Eluent Band a flow rate of 45 The amino-lipids KL23, KL24, KL25, KL26, KL27, mL/min was used. KL28, KL30, KL32, KL39, KL43, KL49 and KL58 were prepared by combining the corresponding ketone and the ESI-MS (direct infusion): M+H+: 1386.2 55 C) Preparation of Selectively Alkylated Amino-Lipids. corresponding amine in DCE in a ratio of one equivalent of Amino-lipids KL5, KL6, KL7, KL8, KLI2, KL15, KL16, were generated by a stepwise synthetic protocol published in ketone per amine group. Subsequently, NaBH(OAc) (3.0 J Org Chem. 1996, 61:3849-3862: eq) and HOAc was added and stirred at room temperature 60 until thin layer chromatography indicated completion of reaction. The reaction mixture was worked up by addition of 2N NaOH and extraction with DCM. The organic phase was NR h H N1N1 NN 1. Aldimine formation dried and the solvent removed under reduced pressure. The 2 2 2. Reduction 65 amino-lipids were purified by flash column chromatography O -R and analyzed by analytical reversed phase HPLC and direct infusion ESI-MS. US 9,636,302 B2 39 40 1) Preparation of KL25.
10 To a solution of Heptacosan-14-one (11.0 g, 27.9 mmol. introduced using 50 mM 3-((Dimethylamino-methylidene) 2.0 eq, 1.0 eq/amine function) and Triethylenetetraamine amino)-3H-1,2,4-dithiazole-3-thione (DDTT, AM Chemi (2.03 g, 13.9 mmol. 1.0 eq) in 200 mL DCE was added cals, Oceanside, Calif., USA) in a 1:1 (v/v) mixture of NaBH(OAc) (8.90 g, 41.9 mmol. 3.0 eq) and HOAc (41.9 pyridine and Acetonitrile. Upon completion of the solid mmol. 2.5 mL) at room temperature. The reaction mixture 15 phase synthesis oligoribonucleotides were cleaved from the was stirred for 72 hat ambient temperature. After hydrolysis Solid Support and deprotected using slight modification of with 2N NaOH the reaction mixture was extracted twice published methods (Wincott F. et al. “Synthesis, deprotec with DCM. The combined organic layers were washed with tion, analysis and purification of RNA and ribozymes.” saturated NaCl solution and dried over NaS0. The solvent Nucleic Acids Res 1995, 23:2677-2684). was removed under reduced pressure and the crude product Crude oligomers were purified by anionic exchange was subject to flash chromatography (DCM-DCM/ HPLC using a column packed with Source Q15 (GE Health CHOH=10: 1-DCM/CH-OH 5:1, Rf-0.3 in DCM/ care) and an Akta Explorer system (GE Healthcare). Buffer CHOH=4:1 (0.1% aq. NH)) to afford the title compound as A was 10 mM sodium perchlorate, 20 mM Tris, 1 mM a pale yellow wax. EDTA, pH 7.4 (Fluka, Buchs, Switzerland) and contained ESI-MS (direct infusion): M+H+: 904.0 25 20% Acetonitrile. Buffer B was the same as buffer A with the exception of 500 mM sodium perchlorate. A gradient of 22% Example 2. siRNA Synthesis B to 42% B within 32 column volumes (CV) was employed. UV traces at 280 nm were recorded. Appropriate fractions siRNAs were synthesized by standard solid phase RNA were pooled and precipitated with 3M NaOAc, pH 5.2 and oligomerization using the phosphoramidite technology. 30 70% ethanol Finally, the pellet was washed with 70% Depending on the scale either an ABI 394 synthesizer ethanol. (Applied Biosystems) or an Akta oligopilot 100 (GE Health Isolated RNAs were shown to be at least 85% pure by care, Freiburg, Germany) was used. In order to increase analytical strong anion exchange chromatography. Identity siRNA stability and abrogate immune responses. 2'-O- of the RNA single strands was confirmed by LC-ESI-MS. methyl modified nucleotides were placed within certain 35 siRNAS were prepared by combining equimolar amounts positions in the siRNA duplex. Ancillary synthesis reagents, of the complementary RNA strands in sodium citrate buffer RNA and 2'-O-Methyl RNA phosphoramidites were (10 mM Na-Citrate, 30 mM. NaCl, pH 6), heating to 70° C. obtained from SAFC Proligo (Hamburg, Germany). Specifi for 5 min and slow cooling to room temperature over a time cally, 5'-O-(4,4'-dimethoxytrityl)-3'-O-(2-cyanoethyl-N,N- period of 2 h. siRNAs were further characterized by capil diisopropyl) phosphoramidite monomers of uridine (U), 40 lary gel electrophoresis and were stored frozen until use. 4-N-acetylcytidine (C"), 6-N-benzoyladenosine (A') and siRNA sequences are listed in Table 2. As indicated in the 2-N-isobutyrlguanosine (G') with 2'-O-t-butyldimethylsi table, these siRNAS are directed against gene targets that are lyl were used to build the oligomers sequence. 2'-O-Methyl exclusively expressed in certain cells in the liver. In certain modifications were introduced employing the corresponding embodiments the individual siRNAs were employed in the phosphoramidites carrying the same nucleobase protecting 45 inventive formulations. In certain other embodiments a groups as the regular RNA building blocks. Coupling time mixture of all the indicated siRNAs were incorporated into for all phosphoramidites (100 mM in Acetonitrile) was 6 the inventive formulations to address siRNA delivery to min employing 5-Ethylthio-1H-tetrazole (ETT) as activator other cell types than hepatocytes. Those additional cell types (0.5 M in Acetonitrile). Phosphorothioate linkages were are listed in Table 2 as well. TABLE 2 siRNAs employed in LNPs of the present invention.
ssRNA ID (SEQ ID Duplex-ID NO: ) Sequence 5'-3' type Target Cell type 1/2 1. GcAAAGGcGuCoccAAculcAdTsdT is Factor VII hepatocytes 1/2 2 UGAGUUGGCACGCCUUUGCTS cT as
3/4 3 AcGucuAuAucAugGccGAdTsdT S EGFP ubiquitous 3/4 4. UCGGCcAUGAULAuAGACGUdTsdT as
7/8 7 cuuuuculcGuCACAAGAAGdTsdT S CLEC4F Kupffer cells 7/8 8 CUUCUUGUcACGAGAAAAGdTsdT as
9/10 9 GGucu.cAAGccAculcGuuud.TsdT is RELN Stellate cells 9/10 10 AAACGAGUGGCUUGAGACCoTsdT aS US 9,636,302 B2 41 42 TABLE 2 - continued siRNAs employed in LNPs of the present invention.
ssRNA ID (SEQ ID Duplex-ID NO: ) Sequence 5'-3' type Target Cell type 11/12 11 GAAGAugcAGuGAuuu.ACAdTscT S TEK endothelial 11/12 12 UGAAAUcACUGCAUCUUCdTST as cells
13/14 13 GcGcAGAAuucAucucuucdTscT S CD68 Macrophages 13/14 14 GAAGAGAUGAAUUCUGCGCdTsdT as
15 A16 15 cuCGcuGAAuuucAGAGcAdTscT s CD45 Leukocytes 15 A16 16 UGCUCUGAAAUUCAGCCAGoTST as
5/6 5 AAcGAGAAGcGcGAucAcAdTsdT is EGFP Ubiquitous 5/6 6 UGUGAUCGCGCUUCUCGUUTST as
17/18 17 agAuGGAuAuAcucAAuuAdTsdT s Clec fa Macrophages 17/18 18 uAAUUGAGuAuAUCcAUCUdTsdT as
Key: Upper case letters A, C, G, U represent RNA nucleotides; lower case letters a, C, g, u, are 2'-O-Methyl nucleotides. A phosphorothioate linkage is symbolized with a lower case 'S' . dT is deoxythimidline.
25 Example 3. Lipid Nanoparticles Subsequent to the initial testing in mice efficacious siRNA lipid nanoparticle formulations were further optimized. For A. siRNA Lipid Nanoparticle Preparation. mulation variations were generated by variation of the Helper lipids were purchased from Avanti Polar Lipids compositions. Differences between formulations reflect dif (Alabaster, Ala., USA). PEGylated lipids were obtained 30 ferences in the lipid species or differences in the molar from NOF (Bouwelven, Belgium). Small molecules such as percentages of the lipid components, or differences in the cholesterol were purchased from Sigma-Aldrich ratio between positively and negatively charged components (Taufkirchen, Germany). of the formulation. Lipid nanoparticles containing siRNAS as described in the The primary product, i.e. the product resulting by com section below were compared against a standard formulation 35 bining the two input solutions, was dialyzed 2x against containing the lipid 2.2-dilinoleyl-4-dimethylaminoethyl 1, phosphate buffered saline (PBS), pH 7.4 at volumes 100x of 3-dioxolane (XTC2) discovered by Tekmira Pharmaceuti that of the primary product using Spectra/Por dialysis tubing cals. XTC2 was synthesized according to published proce (Spectrum Europe B.V., Breda, The Netherlands) with a dures (Nature Biotechnology, 2010, 28:172). The 40 MWCO of 100 or 250 kDa (CE, or PVDF membrane) or corresponding standard formulation was prepared, unless using Slide-A-Lyzer cassettes (Thermo Fisher Scientific Inc. otherwise stated, according to a published composition Rockford, Ill.) with a MWCO of 10 kD (RC membrane). (PNAS, 2010, 107:1854). For this purpose, stock solutions of If desired siRNA lipid nanoparticles were concentrated at 1,2-distearoyl-3-phosphatidylcholine (DSPC, 10%), XTC2 a 4°C. by using Vivaspin 20 centrifugation tubes (Sartorius (50%), cholesterol (38.5%), and C-3'-(1,2-dimyristoyl-3- 45 AG, Gottingen, Germany) with a MWCO of 50 kD at 700 propanoxy)-carboxamide-propyl-(1)-methoxy-polyoxyeth g using a table-top centrifuge. ylene (PEG-c-DOMG 1.5%) were prepared at concentra The lipid nanoparticle Suspension was filtered through a tions of 50 mM in ethanol. Filtropur S 0.2 filter with a pore size of 0.2 um (Sarstedt, The inventive lipid nanoparticle formulations of the pres Numbrecht, Germany) and filled into glass vials with a ent invention contain the amino-lipids disclosed herein 50 crimp closure. instead of XTC2. Initially, the other components were kept B. siRNA Lipid Nanoparticle Characterization. unchanged. To determine the siRNA concentration, formulations were siRNA stock solutions at a concentration of 10-20 mg/mL diluted to a theoretical siRNA concentration of approxi in 10 mM sodium citrate buffer, 30 mM. NaCl, pH 6 were mately 0.02 mg/mL in phosphate buffered saline (PBS). A diluted in 50 mM citrate buffer, pH 4 to the desired total 55 volume of 100 uL of the diluted formulation was added to siRNA concentration (~ 1 mg/mL). 900 uL of a 4:1 (vol/vol) mixture of methanol and chloro siRNA lipid nanoparticles were manufactured at a total form. After vigorous mixing for 1 min, the absorbance lipid to siRNA mass ratio of 7 by combining the lipid spectrum of the Solution was recorded at wavelengths solution in ethanol with the buffered siRNA solution in a between 230 nm and 330 nm on a DU 800 spectrophotom mixing tee (e.g. CM1XPK, VICI AG International, Schen 60 eter (Beckman Coulter, Beckman Coulter, Inc., Brea, Calif.). kon, Switzerland) by using either a Harvard Pump 33 The siRNA concentration in the liposomal formulation was Syringe Pump (Harvard Apparatus Holliston, Mass.) or for determined based on the extinction coefficient of the siRNA larger batches (>15 mL) an Akta 900 HPLC Pump (GE used in the formulation. If extinction coefficient was not Healthcare Bio-Sciences Corp., Piscataway, N.J.). Flow known, an average value of 22 OD/mg was used. The siRNA rates ranged from (17 mL/min to 67 mL/min for the siRNA 65 concentration was calculated based on the difference solution and from 8 mL/min to 33 mL/min for the lipid between the absorbance maximum at a wavelength of ~260 Solution. nm and the baseline value at a wavelength of 330 nm. US 9,636,302 B2 43 44 To determine the mean size of siRNA lipid nanoparticles, genic mice in C57Bl/6 background) and were between 6 and formulations were diluted in PBS to a concentration of 8 weeks 30 old at the time of the experiments. Intravenously approximately 0.05 mg/mL siRNA in a disposable polysty administered LNPs were injected by infusion of 200 uL into rene cuvette. The mean particle size was determined by using a Zetasizer Nano ZS (Malvern Instruments Ltd, the tail vein. LNPs administered to the lung were orotra Malvern, Worcestershire, UK). cheally instilled by applying 50 uL into the pharynx of To determine the Zeta potential of siRNA lipid nanopar isoflurane anaesthetized mice and making mice breathe in ticles, formulations were diluted in PBS, pH 7.4 and in the LNP solution while blocking their obligate nose breath citrate buffer, pH 4 to a concentration of approximately 0.01 ing 48 h post administration, mice were anaesthetized by mg/mL siRNA in a disposable Zeta cell (DTS1060C. CO inhalation and sacrificed by cervical dislocation. Blood Malvern Instruments Ltd, Malvern, Worcestershire, UK). 10 was collected during the experiment by submandibular vein The Zeta potential was determined by using a Zetasizer Nano bleed or—after sacrificing the animals—by cardiac puncture ZS (Malvern Instruments Ltd, Malvern, Worcestershire, and serum isolated with serum separation tubes (Greiner UK). Bio-One, Frickenhausen, Germany). Factor VII protein lev To determine the percentage of siRNA entrapped in lipid els were analyzed by a chromogenic assay (see below). For nanoparticles the Quant-iTTM RiboGreen(R) RNA assay (In 15 vitrogen Corporation Carlsbad, Calif.) was used according preparation of bronchoalveolar lavage (BAL) fluid, the to the manufacturers instructions. In brief, Samples were lungs were flushed 3x with 1 ml PES via an intratracheally diluted to a concentration of approximately 5 ug/mL in TE inserted canula and cells were pelleted by centrifugation. For buffer (10 mM Tris-HCl, 1 mM EDTA, pH 7.5). Volumes of quantitation of mRNA levels, organs were harvested and 50 uL of the diluted samples were transferred to a polysty organ homogenates were prepared. Tissues were Snap frozen rene 96 well plate. To the samples, either 50 uL of TE buffer in liquid nitrogen and powdered with mortar and pestle on or 50 uL of a 2% Triton X-100 solution was added. The plate dry ice. 30-50 mg of tissue was transferred to a chilled 1.5 was incubated at 35° C. for 15 min. The RiboGreen reagent mL reaction tube. 1 mL Lysis Mixture (Epicenter Biotech was diluted 1:100 in TE buffer and a volume of 100 uL of nologies, Madison, USA) and 3.3 uL Proteinase K (50 ug/4) was added to each well. The fluorescence intensity in each 25 well was determined using a fluorescence plate reader (Epicenter Biotechnologies, Madison, USA) was added and (Wallac Victor 1420 Multilabel Counter; Perkin Elmer, tissues were lysed by Sonication for several seconds using a Waltham, Mass.) at an excitation wavelength of ~480 nm sonicator (HD2070, Bandelin, Berlin, Germany) and and an emission wavelength of -520 nm. The fluorescence digested with Proteinase K for 15 min at 65° C. in a values of the reagent blank were subtracted from that of each thermomixer (Thermomixer comfort, Eppendorf, Hamburg, of the samples and siRNA concentrations were determined 30 Germany). BAL lysates were obtained by resuspending based on a standard curve of fluorescence intensities versus BAL cells in 200 uL Lysis Mixture, followed by incubation RNA concentrations. The percentage of free siRNA was at 53° C. for 30 min. Lysates were stored at -80° C. until determined by dividing the fluorescence intensity of the analysis. For mRNA analyses, lysates were thawed and intact sample (without addition of Triton X-100) by the 35 mRNA levels were measured using either QuantiGene 1.0 or fluorescence value of the disrupted sample (with addition of Quantigene 2.0 branched DNA (bDNA) Assay Kit (Panom Triton X-100). ics, Fremont, Calif., USA, Cat-No: QG0004) according to Example 4. Animal Experiments the manufacturer's recommendations. In order to assess the FVII, EGFP, Clec4f, RELN, TEK, CD45, CD68, ClecTa and Mice (strain C57BL/6) were obtained from Charles River GAPDH mRNA content, the following probe sets were (Sulzfeld, Germany) or were bred in house (EGFP trans employed: TABLE 3 Quantigene l. O probe sets.
SEO ID Oligo Name Sequence 5' -> 3' No mRNA mGAP 2 OO1 gaga.gcaatgc.cagcc ccTTTTTct cittggaaagaaagt 19 mouse GAPDH
mGAP 2002 ggit coagggitttct tact cott gTTTTTct cittggaaagaaagt 2O mouse GAPDH
mGAP 2003 c cc taggcc cct cotgttatt TTTTTct cittggaaagaaagt 21 mouse GAPDH
mGAP 2004 tgcagcgaactittattgatggTTTTTct cittggaaagaaagt 22 mouse GAPDH
mGAP 2005 gcacgtcagat coacgacgTTTTTagg catagg accc.gtgtct 23 mouse GAPDH
mGAP 2006 ggcaggtttct coaggcgTTTTTaggcataggaccc.gtgtct 24 mouse GAPDH
mGAP 2007 gcc ct cagatgcctgctt caTTTTTaggcataggaccc.gtgtct 25 mouse GAPDH
mGAP 2008 gcc.gtatt cattgt cataccaggTTTTTaggcataggaccc.gtgtct 26 mouse GAPDH
mGAP 2009 gtccaccaccctgttgctgtaTTTTTagg catagg accc.gtgtct 27 mouse GAPDH
mGAP 2010 aattgtgagggagatgct cagtTTTTTaggcataggaccc.gtgtct 28 mouse GAPDH
mGAP 2011 ccaccitt cittgatgtcat catactt 29 mouse GAPDH
mGAP 2012 Cccalagatgcc ctt cagtgg 3 O mouse GAPDH
US 9,636,302 B2 49 50 TABLE 3 - continued Quanticlene l. O probe sets. SEQ ID Oligo Name Sequence 5' -> 3' No mRNA mmReln. O18 totgagtacttittgg tagaacctaaatc O 6 mouse Reln mmTek OO1 tgagtic cctdggaagctitt caTTTTTct cittggaaagaaagt Of mouse Tek mmTek OO2 actitcc ccagat citc.cc cat TTTTTctic ttggaaagaaagt O8 mouse Tek mmTek OO3 taagc.cggctaaagagt cc at TTTTTct cittggaaagaaagt O9 mouse Tek mmTek OO4 aatgcaggtgagggatgtttTTTTTctic ttggaaagaaagt O mouse Tek mmTek OOs to citatggtgatgggct catggTTTTTct cittggaaagaaagt 1 mouse Tek mmTek OO6 cc.gct cqcatggit coactTTTTTagg catagg accc.gtgtct 2 mouse Tek mmTek OOf acaact cacaactittgcgactitcTTTTTaggcataggaccc.gtgtct 3 mouse Tek mmTek OO8 ccagcgt.ccacagatgagcaTTTTTagg catagg accc.gtgtct 4 mouse Tek mmTek OO9 agcaa.gctgactic cacagagaac TTTTTaggcataggaccc.gtgtct 5 mouse Tek mmTek O1 O gcqc ctitc tact act coataaaggTTTTTaggcataggaccc.gtgtct 6 mouse Tek mmTek O11 cggcatcagacacaa.gagg taggTTTTTaggcataggaccc.gtgtct 7 mouse Tek mmTek O12 gggtgccacccagaggcTTTTTaggcataggaccc.gtgtct 8 mouse Tek mmTek O13 gcaaggagaalacaccacagaag 9 mouse Tek mmTek O14 cgct Cttgtttacaagttggcg 2O mouse Tek mmTek O15 gaattgat Caagat Caggit coatg 21 mouse Tek
TABL E 4. Quantigene 2. O probe sets.
SEQ ID Oligo Name Sequence 5' -> 3' No mRNA Q2 mcD45 1 tgacgagttttacaccg.cgatTTTTTgaagttaccgttitt 22 mouse CD45
Q2 mcD45 2 aatctgtctgcacatttataa catttitTTTTTctgagt caaag cat 23 mouse CD45
Q2 mcD45 3 ggcgtttctggaatc.cccaTTTTTct cittggaaagaaagt 24 mouse CD45
Q2 mcD45 4 tggat.ccc cacaact aggcttaTTTTTgaagttaccgttitt 25 mouse CD45
Q2 mcD45 5 agagactaacgtttittcttgcago TTTTTctgagtcaaag cat 26 mouse CD45
Q2 mcD45 6 gtttagatacaggct caggccaTTTTTct cittggaaagaaagt 27 mouse CD45
O2 moD45 7 tggggtttagatgcagacticagTTTTTgaagttaccgttitt 28 mouse CD45
Q2 mcD45 8 attgttcttatagdataaaacatat coaTTTTTctgagtcaaag.cat 29 mouse CD45
Q2 mcD45 9 taggcaaacttittacatttittctgaTTTTTct cittggaaagaaagt 3 O mouse CD45
Q2 mcD45 10 ccacct caaaactggtcacattatTTTTTgaagttaccgttitt 31 mouse CD45
Q2 mcD45 11 tdatag tatttataaggtttcaa.gctitt TTTTTctgagtcaaag.cat 32 mouse CD45
Q2 mcD45 12 ttgacataggcaagtagggacact 33 mouse CD45
Q2 mcD45 13 cc catttctittgaatct tcc.caTTTTTct cittggaaagaaagt 34 mouse CD45
Q2 mcD45 14 tgaaaattgcacttct cagcagtTTTTTgaagttaccgttitt 35 mouse CD45
Q2 mcD45 15 ccggacgatctgcttttgtgTTTTTctgagtcaaag cat 36 mouse CD45
Q2 mcD45 16 ggittitt catt coattgaccttgtTTTTTct cittggaaagaaagt 37 mouse CD45
US 9,636 302 B2 55 56 TABLE 4 - continued Ouanticlene 2. O probe sets. SEQ ID Oligo Name Sequence 5' -> 3' No mRNA QG2 molec7a 10 ctaaagatgattctgtgggcttgTTTTTgaagttaccgttitt 210 mouse Cecta
QG2 molec7a 11 ggagggagccaccittct cat TTTTTctgagtcaaag cat 211 mouse Clecta
QG2 molec7a 12 ct cotgtagtttgggatgcct tTTTTTct cittggaaagaaagt 212 mouse Clecta
QG2 molec7a 13 ggaaggcaaggctgagaaaaacTTTTTgaagttaccgttitt 213 mouse Cecta
QG2 molec7a 14 ct tcc catgcatgat coaattaTTTTTctgagtcaaag cat 214 mouse Clecta QG2 molcc 7a 15 cctdagaa.gctaaataggtaa.ca.gctTTTTTct cittggaaagaaagt 215 mouse Cecta
QG2 molec7a 16 totcttactitccataccaggaattit TTTTTgaagttaccgttitt 216 mouse Cecta
QG2 molec7a 17 go acctagotgggagcagtgTTTTTctgagtcaaag cat 217 mouse Cecta
QG2 molec7a 18 ttittgagttgtctat citt cagtagatga 218 mouse Cecta
QG2 molec7a 19 tdgctittcaatgaactcaaattic TTTTTct cittggaaagaaagt 219 mouse Cecta
QG2 molec7a 20 gCattaatacggtgagacgatgttTTTTTgaagttaccgttitt 22O mouse Cecta
QG2 molec7a 21 cqggaaaggcct atccaaaat TTTTTctgagt caaag cat 221 mouse Clecta
QG2 molec7a 22 catggc cctt cactctgattgTTTTTct cittggaaagaaagt 222 mouse Clecta
QG2 molec7a 23 gotgat coat cotcc cagaac TTTTTct cittggaaagaaagt 223 mouse Cecta QG2 molec7a 24 titgaaacgagtggggaagaat TTTTTct cittggaaagaaagt 224 mouse Clecta
QG2 molec7a 25 cctdgggagctg tatttctgacTTTTTgaagttaccgttitt 225 mouse Cecta
QG2 molec7a 26 catacacaattgtgcagtaagctitt TTTTTctgagt caaag cat 226 mouse Cecta
The b)NA assay was performed using 20 uL lysate and 35 For measurement of FVII activity, plasma samples from the corresponding gene specific probe sets. For normaliza mice were prepared by collecting blood (9 volumes) by tion purposes GAPDH mRNA expression was analyzed Submandibular bleeding into microcentrifuge tubes contain using 40 uL lysate and Rattus norvegicus probe sets shown ing 0.109 mol/L sodium citrate anticoagulant (1 volume) to be cross-react with mice (sequences of probe sets see following standard procedures. FVII activity in plasma was above). As assay readout the chemiluminescence signal was 40 measured with a chromogenic method using a BIOPHEN measured in a Victor 2 Light luminescence counter (Perkin VII kit (Hyphen BioMed/Aniara, Mason, Ohio) following Elmer, Wiesbaden, Germany) as relative light units (RLU). manufacturer's recommendations. Absorbance of colorimet The signal for the corresponding mRNA was divided by the ric development was measured using a Tecan Safire2 signal for GAPDH mRNA from the same lysate. Values are microplate reader (Tecan, Crailsheim, Germany) at 405 nm. reported as mRNA expression normalized to GAPDH. Results are shown in FIGS. 2-17. TABLE 5
Composition and physico-chemical parameters of the benchmark formulation RLX-165 and the LNP RLK-044 containing lipid KL22 of the present invention. The benchmark formulation was prepared according to a published protocol (Nature Biotechnology 2010, 28:172) with the exception of a slightly different PEG-lipid. Instead of PEG2000-c-DMA (methoxypolyethyleneglycol-carbamoyl dimyristyloxy-propylamine), PEG2000-c-DMOG (C-3'-(1,2-dimyristoyl 3-propanoxy)-carboxamide-propyl-o-methoxy-polyoxyethylene) was used.
Amino-lipid Helper lipid Chol PEG2000-lipid Size Encap LNP mol % mol % mol % mol % N/P (nm) %
RLX-165 57.1 XTC2 7.1 DPPC 34.4 14 DMOG 2.2 92 92 RLK-044 SO KL22 10 DSPC 38.5 1.S DMOG 7.6 92 8O US 9,636,302 B2 57 TABLE 6 LNPS based on the amino-lipid KL10. Compositions, physico-chemical properties and serum FVII activity upon treatment with 0.1 mg/kg siRNA directed against FVII. PEG2000 KL10 DSPC Chol c-DOMG Size Encap FVII No mol % mol % mol % mol % N/P (nm) (%) (%) 1 50 10 38.5 5 4.9 106 74 81 2 50 10 38.5 5 6.9 108 78 55 3 60 O 38.5 5 5.9 79 36 S4 4 50 10% C16 38.5 5 5.9 110 84 69 Diether PC 5 50 10 38.5 5 8.4 8O 83 23 6 65 3.5 30 5 6.9 83 56 107 7 60 8.5 30 5 6.9 93 71 52 8 60 9.5 30 O.S 6.9 121 75 60 9 60 O 30 10 6.9 49 36 84 10 65 O 30 5 6.9 64 29 129 11 98.5 O O 5 6.9 122 53 110 12 50 10% DMPC 38.5 5 6.9 99 79 78 13 50 10% DPPC 38.5 5 6.9 100 81 43 14 50 10% DOPC 38.5 5 6.9 90 75 122 15 50 10% DLIPC 38.5 5 6.9 89 74 128 16 50 10% POPC 38.5 5 6.9 86 76 128 17 50 10% C18 38.5 5 6.9 96 86 46 Diether PC 18 50 10% C16 38.5 5 6.9 91 75 77 Lyso-PC 19 50 10% DOPE 38.5 5 6.9 88 69 124 2O 50 10% DOPG 38.5 5 6.9 92 39 77 21 50 10% SM 38.5 5 6.9 101 90 27 22 50 10 38.5% OChemSPC 5 6.9 75 89 140 23 50 10 38.5% DOPE 5 6.9 99 89 153 24 50 10 38.5 1.5% PEG- 6.9 129 88 97 1OOODM 25 50 10 38.5 1.5% PEG- 6.9 120 88 108 2OOODS 26 50 10 38.5 1.5% PEG- 6.9 109 88 91 2000 Chol 29 50 O 48.5% 4ME16:OPE 1.5 6.9 111 86 81 XTC2 57.1 7.19 DPPC 34.4 1.4 2.2 95 92 65
TABLE 7 LNPS based on the amino-lipid KL22. Compositions, physico-chemical properties and serum FVII activity upon treatment with 0.1 mg/kg siRNA directed against FVII.
PEG2000-c- KL22 DSPC Chol DOMG Size Encap FVII No mol % mol % mol % mol % N/P (nm) % %
1 50 10 38.5 .5 5.5 78 46 68 2 50 10 38.5 .5 10 76 63 45 3 50 10 38.5 .5 15 81 69 61 4 50 10 39.5 O.S 7.6 126 84 64 5 50 10 40 O 7.6 736 40 78 6 50 2O 30 O 7.6 414 9 ind 7 60 O 38.5 .5 7.6 84 28 ind 8 60 8.5 30 .5 7.6 92 36 8O 9 40 2O 38.5 .5 7.6 93 82 79 10 65 O 30 5 7.6 59 5 ind 11 98.5 O O .5 7.6 95 O ind 12 50 10% DMPC 38.5 .5 7.6 78 57 92 13 50 10% DPPC 38.5 .5 7.6 90 47 73 14 50 10% DOPC 38.5 .5 7.6 71 62 57 15 50 10% DLPC 38.5 .5 7.6 84 59 63 16 50 10% POPC 38.5 .5 7.6 74 55 81 17 50 10% C18 38.5 .5 7.6 96 61 103 Diether PC 18 50 10% C16 38.5 .5 7.6 75 38 75 Lyso-PC 19 50 10% DOPE 38.5 .5 7.6 75 49 59 2O 50 10% DOPG 38.5 .5 7.6 8O 48 131 21 50 10% SM 38.5 .5 7.6 92 64 68 22 50 10 38.5% OChemSPC .5 7.6 76 84 107 23 50 10 38.5% DOPE .5 7.6 93 75 127 24 50 10 38.5% DSPC .5 7.6 246 1 ind US 9,636,302 B2 59 TABLE 7-continued LNPS based on the amino-lipid KL22. Compositions, physico-chemical properties and serum FVII activity upon treatment with 0.1 mg/kg siRNA directed against FVII. PEG2000-c- KL22 DSPC Chol DOMG Size Encap FVII No mol % mol % mol % mol % N/P (nm) % % 25 50 10 38.5 1.5% PEG- 7.6 122 86 112 1OOODM 26 50 10 38.5 1.5% PEG- 7.6 91 36 ind SOOODM 27 50 10 38.5 1.5% PEG- 7.6 119 86 106 1OOODS 28 50 10 38.5 1.5% PEG- 7.6 106 68 107 2OOODS 29 50 10 38.5 1.5% PEG- 7.6 147 90 110 1000 Chol 30 50 10 38.5 1.5% PEG- 7.6 101 64 134 2000 Chol XTC2 57.1 7.19% OPPC 34.4 1.4 2.2 95 92 44
TABLE 8 LNPs based on the amino-lipid KL25. Compositions, physico-chemical properties and FVII mRNA levels upon treatment with 0.1 mg/kg siRNA directed against FVII. PEG2OOOc KL25 DSPC Cholesterol DOMG Size Encap FVII No mol % mol % mol % mol % N/P (nm) 90 % Std 50 10 38.5 1.5 6.7 42 90 81 1 50 10 38.5% DOPE 1.5 6.7 nd ind 2 50 10 40 O 6.7 nd ind 3 50 10 38.5 1.5 5 09 31 ind 4 50 10 38.5 1.5 10 28 68 35 5 50 10 38.5 1.5 15 2O 72 34 6 40 2O 38.5 1.5 6.7 11 47 39 7 60 O 38.5 1.5 6.7 13 34 40 8 50 10% C16 38.5 1.5 6.7 32 65 67 Diether PC 9 50 10% SM 38.5 1.5 6.7 23 58 51 10 50 10 38.5 1.5% PEG- 6.7 77 59 47 1OOODM 11 50 10 38.5 1.5% PEG- 6.7 22 8O 50 1OOODS 12 50 10 38.5 1.5% PEG- 6.7 23 49 74 2OOODS 13 50 10 38.5 1.5% PEG- 6.7 207 9 ind 1000 Chol 14 50 10 38.5 1.5% PEG- 6.7 41 46 68 2000 Chol
TABLE 9
LNPs based on the amino-lipid KL25. Compositions and physico-chemical properties.
PEG2000 KL25 DSPC Chol c-DOMG Size Encap No mol % mol % mol % mol % N/P (nm) %
stol 50 10 38.5 1.5 6.7 142 90 1 50 10 38.5% DOPE 1.5 6.7 nd 2 50 10 40 O 6.7 nd 3 50 10 38.5 1.5 5 109 31 4 50 10 38.5 1.5 10 128 68 5 50 10 38.5 1.5 15 120 72 US 9,636,302 B2 61 62 TABLE 9-continued LNPs based on the amino-lipid KL25. Compositions and physico-chemical properties.
PEG2000 KL25 DSPC Chol c-DOMG Size Encap No mol % mol % mol % mol % N/P (nm) % 6 40 2O 38.5 1.5 6.7 111 47 7 60 O 38.5 1.5 6.7 113 34 8 50 10% C16 38.5 1.5 6.7 132 65 Diether PC 9 50 10% SM 38.5 1.5 6.7 123 58 10 50 10 38.5 1.5% PEG- 6.7 177 59 1OOODM 11 50 10 38.5 1.5% PEG- 6.7 122 8O 1OOODS 12 50 10 38.5 1.5% PEG- 6.7 123 49 2OOODS 13 50 10 38.5 1.5% PEG- 6.7 207 9 1000 Chol 14 50 10 38.5 1.5% PEG- 6.7 141 46 2000 Chol
TABLE 10 TABLE 11
Tek mRNA levels in various organs upon treatment with LNPs 25 mRNA levels in liver after treatment with LNPs based on based on amino-lipid KL25. LNPs contained a pool of 5 siRNA amino-lipid KL25. LNPs contained a pool of 5 siRNAs directed of which one was directed against Tek (0.2 mg/kg of each siRNA, against the targets listed in the table (0.2 mg/kg of each total siRNA dose 1 mg/kg). Values are given as the mean of two siRNA, total siRNA dose 1 mg/kg). Values are given as the treated animals relative to saline treated animals. 30 mean of two treated animals relative to Saline treated animals.
Kidney Lung Jejunum Spleen Muscle No 96 FVII % Clec4f % Rein % Tek 96 GFP No % Tek % Tek % Tek % Tek % Tek 35 stol 81 51 32 51 8O stol 41 43 72 47 77 3 35 29 28 57 61 3 2O 21 25 31 34 4 34 29 23 60 58 4 18 17 27 25 38 5 39 31 51 91 75 5 35 35 58 32 40 40 6 40 27 58 66 72 6 22 18 41 28 25 7 67 44 41 64 8O 7 38 33 57 31 48 8 51 36 40 59 84 8 42 43 47 40 65 9 47 36 57 58 74 9 51 48 39 32 43 45 10 50 33 30 61 8O 10 40 42 26 27 47 11 74 46 43 65 82 11 45 37 67 60 88 12 68 59 55 66 89 12 S4 49 60 62 56 13 65 63 55 59 72 13 S4 64 47 48 73 14 55 42 17 67 70 50 14 53 52 S4 51 68 saline 100 1OO 1OO 100 1OO Saline 1OO 100 100 100 1OO
TABLE 12 Composition and physico-chemical properties of Selected LNPS based on amino-lipid KL10. KL10 DSPC Chol PEG2000 mol mol mol c-DOMG Size Encap No % % % mol % N/P (nm) % 21 50 10% SM 38.5 1.5 6.9 92 64 23 50 10 38.5 DOPE 1.5 6.9 93 75 29 50 O 48.5% 4ME16:OPE 1.5 6.9 111 86 US 9,636,302 B2 63 64 TABLE 13 TABLE 13-continued mRNA levels of targets expressed in the liver upon mRNA levels of targets expressed in the liver upon treatment with LNPs based on amino-lipid KL10. LNPs treatment with LNPs based on amino-lipid KL10. LNPs contained a pool of 5 siRNA directed against the targets 5 contained a pool of 5 siRNA directed against the targets in the table below (0.5 mg/kg of each siRNA). in the table below (0.5 mg/kg of each siRNA). LNP Animal Rein GFP Tek Cec4f FVII LNP Animal Rein GFP Tek Cec4f FVII KL. 10-29 H1 12% 770, 33% 59 88% KL. 10-21 K1 13% 82% 25% 19% 1.02% H2 13% 65% 33% 12% 86% K2 15% 10496 30% 13%. 106% 10 Saline S1 95% 1.01%. 100% 97%. 1019/o KL. 10-23 L1 1796 10% 46%. 13.6% 28% S2 105% 99%. 100% 1.03% 99% L2 14% 8% 35%. 11.3% 22%
SEQUENCE LISTING
<16 Os NUMBER OF SEO ID NOS: 226
<21 Os SEQ ID NO 1 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic sense strand of dsRNA targeting mouse Factor 7 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Combined DNA/RNA Molecule: Synthetic sense strand of dsRNA targeting mouse Factor 7 22 Os. FEATURE: <221s NAMEAKEY: modified base &222s. LOCATION: 1 <223> OTHER INFORMATION: nucleoside: lacks 5'-phosphate group 22 Os. FEATURE: <221s NAMEAKEY: modified base <222s. LOCATION: 2, 8, 10, 12, 13, 16, 17, 18 <223> OTHER INFORMATION: 2'-O-methyl corresponding nucleoside 22 Os. FEATURE: <221s NAMEAKEY: modified base <222> LOCATION: 1, 3, 4, 5, 6, 7, 9, 11, 14, 15, 19 <223> OTHER INFORMATION: 2'-hydroxy corresponding nucleoside 22 Os. FEATURE: <221s NAMEAKEY: modified base &222s. LOCATION: 21 <223> OTHER INFORMATION: 5'-phosphorothioate thymidine
<4 OOs SEQUENCE: 1
gcaaaggcgu go caaculcat t 21
<21 Os SEQ ID NO 2 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic antisense strand of dsRNA targeting mouse Factor 7 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Combined DNA/RNA Molecule: Synthetic antisense strand of dsRNA targeting mouse Factor 7 22 Os. FEATURE: <221s NAMEAKEY: modified base &222s. LOCATION: 1 <223> OTHER INFORMATION: nucleoside: lacks 5'-phosphate group 22 Os. FEATURE: <221s NAMEAKEY: modified base &222s. LOCATION: 9 <223> OTHER INFORMATION: 2'-O-methyl corresponding nucleoside 22 Os. FEATURE: <221s NAMEAKEY: modified base <222> LOCATION: 1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 17, <223> OTHER INFORMATION: 2'-hydroxy corresponding nucleoside 22 Os. FEATURE: <221s NAMEAKEY: modified base &222s. LOCATION: 21 <223> OTHER INFORMATION: 5'-phosphorothioate thymidine US 9,636,302 B2 65 66 - Continued
<4 OOs, SEQUENCE: 2 ugaguuggca cqccuulugct t 21
<210s, SEQ ID NO 3 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic sense strand of dsRNA targeting EGFP 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Combined DNA/RNA Molecule: Synthetic sense strand of dsRNA targeting EGFP 22 Os. FEATURE: <221 > NAMEAKEY: modified base &222s. LOCATION: 1 <223> OTHER INFORMATION: nucleoside: lacks 5'-phosphate group 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222> LOCATION: 2, 4, 5, 6, 8, 10, 11, 13, 16, 17 <223> OTHER INFORMATION: 2'-O-methyl corresponding nucleoside 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222> LOCATION: 1, 3, 7, 9, 12, 14, 15, 18, 19 <223> OTHER INFORMATION: 2'-hydroxy corresponding nucleoside 22 Os. FEATURE: <221 > NAMEAKEY: modified base &222s. LOCATION: 21 <223> OTHER INFORMATION: 5'-phosphorothioate thymidine
<4 OOs, SEQUENCE: 3 acguiculaulau Caluggc.cgat t 21
<210s, SEQ ID NO 4 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic antisense strand of dsRNA targeting EGFP 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Combined DNA/RNA Molecule: Synthetic antisense strand of dsRNA targeting EGFP 22 Os. FEATURE: <221 > NAMEAKEY: modified base &222s. LOCATION: 1 <223> OTHER INFORMATION: nucleoside: lacks 5'-phosphate group 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: 6, 11, 13 <223> OTHER INFORMATION: 2'-O-methyl corresponding nucleoside 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222> LOCATION: 1, 2, 3, 4, 5, 7, 8, 9, 10, 12, 14, 15, 16, 17, 18, 19 <223> OTHER INFORMATION: 2'-hydroxy corresponding nucleoside 22 Os. FEATURE: <221 > NAMEAKEY: modified base &222s. LOCATION: 21 <223> OTHER INFORMATION: 5'-phosphorothioate thymidine
<4 OOs, SEQUENCE: 4 ulcggcCauga luaulagacgut t 21
<210s, SEQ ID NO 5 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic sense strand of dsRNA targeting EGFP 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Combined DNA/RNA Molecule: US 9,636,302 B2 67 68 - Continued Synth etic sense strand of dsRNA targeting EGFP FEATU RE: NAME/ KEY: modified base LOCAT ION: 1 OTHER INFORMATION: nucleoside: lacks 5'-phosphate group FEATU RE: NAME/ KEY: modified base LOCAT ION: 3, 10, 12, 15, 16, 18 OTHER INFORMATION: 2'-O-methyl corresponding nucleoside FEATU RE: NAME/ KEY: modified base LOCAT ION: 1, 2, 4, 5, 6, 7, 8, 9, 11, 13, 14, 17, 19 OTHER INFORMATION: 2'-hydroxy corresponding nucleoside FEATU RE: NAME/ KEY: modified base LOCAT ION: 21 OTHER INFORMATION: 5'-phosphorothioate thymidine
SEQUENCE: 5 aacgagaa.gc gcgaucacat t 21
SEQ I D NO 6 LENGT H: 21 TYPE : DNA ORGAN ISM: Artificial Sequence FEATU RE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic antis ense strand of dsRNA targeting EGFP FEAT RE: OTHE R INFORMATION: Description of Combined DNA/RNA Molecule: Syn etic antisense strand of dsRNA targeting EGFP FEA U RE: NAME A KEY: modified base A.T ION: 1 OTHE R INFORMATION: nucleoside: lacks 5'-phosphate group U RE: NAME/ KEY: modified base OCAT ION: (1) . . (19 E R INFORMATION: 2'-hydroxy corresponding nucleoside T U RE: E/ KEY: modified base LOCAT ION: 21 OTHER INFORMATION: 5'-phosphorothioate thymidine
<4 OOs, SEQUENCE: 6 lugu gaucgcg cullcucgulut t 21
SEQ I D NO 7 LENGT H: 21 TYPE : DNA ORGAN ISM: Artificial Sequence FEATU RE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic SeeSee strand of dsRNA targeting mouse Clec4f FEATU RE: OTH INFORMATION: Description of Combined DNA/RNA Molecule: Syn etic sense strand of dsRNA targeting mouse Clec4f FEA RE: NA KEY: modified base OC ION: 1 OTH INFORMATION: nucleoside: lacks 5'-phosphate group FEA RE: NA KEY: modified base OC ION: 1, 2, 3, 4, 5, 6, 7, 8, 10, 13 OTH INFORMATION: 2'-O-methyl corresponding nucleoside RE: KEY: modified base OE CA. ION: 9, 11, 12, 14, 15, 16, 17, 18, 19 INFORMATION: 2'-hydroxy corresponding nucleoside E A. U RE: E/ KEY: modified base LOCAT ION: 21 ER INFORMATION: 5'-phosphorothioate thymidine
SEQUENCE: 7 US 9,636,302 B2 69 70 - Continued cuuuucucgu gacaagaagt t 21
SEQ ID NO 8 LENGTH: 21 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic antisense strand of dsRNA targeting mouse Clec4f FEATURE: OTHER INFORMATION: Description of Combined DNA/RNA Molecule: Synthetic antisense strand of dsRNA targeting mouse Clec4f FEATURE: NAMEAKEY: modified base LOCATION: 1 OTHER INFORMATION: nucleoside: lacks 5'-phosphate group FEATURE: NAMEAKEY: modified base LOCATION: 9 OTHER INFORMATION: 2'-O-methyl corresponding nucleoside FEATURE: NAMEAKEY: modified base LOCATION: 1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 OTHER INFORMATION: 2'-hydroxy corresponding nucleoside FEATURE: NAMEAKEY: modified base LOCATION: 21 OTHER INFORMATION: 5'-phosphorothioate thymidine
SEQUENCE: 8 cuuculugu.ca Cagaaaagt t 21
SEO ID NO 9 LENGTH: 21 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic sense strand of dsRNA targeting mouse Reln FEATURE: OTHER INFORMATION: Description of Combined DNA/RNA Molecule: Synthetic sense strand of dsRNA targeting mouse Reln FEATURE: NAMEAKEY: modified base LOCATION: 1 OTHER INFORMATION: nucleoside: lacks 5'-phosphate group FEATURE: NAMEAKEY: modified base LOCATION: 3, 4, 5, 6, 10, 11, 13, 14, 15, 17, 18, 19 OTHER INFORMATION: 2'-O-methyl corresponding nucleoside FEATURE: NAMEAKEY: modified base LOCATION: 1, 2, 7, 8, 9, 12, 16 OTHER INFORMATION: 2'-hydroxy corresponding nucleoside FEATURE: NAMEAKEY: modified base LOCATION: 21 OTHER INFORMATION: 5'-phosphorothioate thymidine
SEQUENCE: 9 gglucuCaagc cacucguluut t 21
SEQ ID NO 10 LENGTH: 21 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic antisense strand of dsRNA targeting mouse Reln FEATURE: OTHER INFORMATION: Description of Combined DNA/RNA Molecule: Synthetic antisense strand of dsRNA targeting mouse Reln US 9,636,302 B2 71 72 - Continued
FEATU RE: NAME/ KEY: modified base LOCAT ION: 1 OTHER INFORMATION: nucleoside: lacks 5'-phosphate group FEATU RE: NAME/ KEY: modified base LOCAT ION: (1) . . (19) OTHER INFORMATION: 2'-hydroxy corresponding nucleoside FEATU RE: NAME/ KEY: modified base LOCAT ION: 21 OTHER INFORMATION: 5'-phosphorothioate thymidine
<4 OOs, SEQUENCE: 10 aaacgagugg Culugagacct t 21
<210s, SEQ ID NO 11 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic sense strand of dsRNA targeting mouse Tek 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Combined DNA/RNA Molecule: Synthetic sense strand of dsRNA targeting mouse Tek 22 Os. FEATURE: <221 > NAMEAKEY: modified base &222s. LOCATION: 1 <223> OTHER INFORMATION: nucleoside: lacks 5'-phosphate group 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222> LOCATION: 6, 8, 11, 14, 15, 16, 18 <223> OTHER INFORMATION: 2'-O-methyl corresponding nucleoside & 22 O FEATURE; <221 > NAMEAKEY: modified base <222> LOCATION: 1, 2, 3, 4, 5, 7, 9, 10, 12, 13, 17, 19 <223> OTHER INFORMATION: 2'-hydroxy corresponding nucleoside 22 Os. FEATURE: <221 > NAMEAKEY: modified base &222s. LOCATION: 21 <223> OTHER INFORMATION: 5'-phosphorothioate thymidine
<4 OOs, SEQUENCE: 11 gaagaluggag lugaulululacat t 21
<210s, SEQ ID NO 12 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic antisense strand of dsRNA targeting mouse Tek 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Combined DNA/RNA Molecule: Synthetic antisense strand of dsRNA targeting mouse Tek 22 Os. FEATURE: <221 > NAMEAKEY: modified base &222s. LOCATION: 1 <223> OTHER INFORMATION: nucleoside: lacks 5'-phosphate group 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: 3, 8, 13 <223> OTHER INFORMATION: 2'-O-methyl corresponding nucleoside 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222> LOCATION: 1, 2, 4, 5, 6, 7, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19 <223> OTHER INFORMATION: 2'-hydroxy corresponding nucleoside 22 Os. FEATURE: <221 > NAMEAKEY: modified base &222s. LOCATION: 21 <223> OTHER INFORMATION: 5'-phosphorothioate thymidine
<4 OOs, SEQUENCE: 12 US 9,636,302 B2 73 74 - Continued uguaaaucac ugcaucuuct t 21
<210 SEQ ID NO 13 &211s LENGTH: 21 212. TYPE : DNA <213> ORGANISM: Artificial Sequence &22 Os FEAT URE: &223s OTHE R INFORMATION: Description of Artificial Sequence: Synthetic sense strand of dsRNA targeting mouse CD68 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Combined DNA/RNA Molecule: Synthetic sense strand of dsRNA targeting mouse CD68 22 Os. FEATURE: <221 > NAMEAKEY: modified base &222s. LOCATION: 1 <223> OTHER INFORMATION: nucleoside: lacks 5'-phosphate group 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222> LOCATION: 2, 4, 9, 10, 11, 13, 14, 15, 16, 17, 18, 19 <223> OTHER INFORMATION: 2'-O-methyl corresponding nucleoside 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: 1, 3, 5, 6, 7, 8, 12 <223> OTHER INFORMATION: 2'-hydroxy corresponding nucleoside 22 Os. FEATURE: <221 > NAMEAKEY: modified base &222s. LOCATION: 21 <223> OTHER INFORMATION: 5'-phosphorothioate thymidine
<4 OOs, SEQUENCE: 13 gcgcagaalulu caucucuuct t 21
<210s, SEQ ID NO 14 <211 LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence &22 Os FEAT URE: &223s OTHE R INFORMATION: Description of Artificial Sequence: Synthetic antisense strand of dsRNA targeting mouse CD68 22 Os. FEATURE: <223> OTHERR INFORMATION: Description of Combined DNA/RNA Molecule: Synthetic antisense strand of dsRNA targeting mouse CD68 22 Os. FEATURE:U <221s NAME/KEY:A modified base &222s. LOCATION:T 1 <223> OTHERR INFORMATION: nucleoside: lacks 5'-phosphate group 22 Os. FEATURE:U &221st NAME AKEY: modified base <222s. LOCAT ION: (1) . . (19 &223s OTH R INFORMATION: 2'-hydroxy corresponding nucleoside &22 Os FEA U RE: <221s NA. E A KEY: modified base <222s. LOCAT ION: 21 E R INFORMATION: 5'-phosphorothioate thymidine
<4 OOs, SEQU ENCE: 14 galagagaluga aullclugcgct t 21
<210 SEQ ID NO 15 &211s LENG TH: 21 212. TYPE : DNA <213> ORGANISM: Artificial Sequence &22 Os FEAT URE: &223s OTHE R INFORMATION: Description of Artificial Sequence: Synthetic SeS e strand of dsRNA targeting mouse CD45 &22 Os FEAT URE: &223s OTHE R INFORMATION: Description of Combined DNA/RNA Molecule: Synt hetic sense strand of dsRNA targeting mouse CD45 &22 Os FEAT URE: &221st NAME AKEY: modified base &222s. LOCATION: 1 &223s OTHE R INFORMATION: nucleoside: lacks 5'-phosphate group &22 Os FEAT URE: &221st NAME AKEY: modified base US 9,636,302 B2 75 76 - Continued
<222> LOCATION: 1, 2, 5, 6, 10, 11, 12, 13, 18 <223> OTHER INFORMATION: 2'-O-methyl corresponding nucleoside 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: 3, 4, 7, 8, 9, 14, 15, 16, 17, 19 <223> OTHER INFORMATION: 2'-hydroxy corresponding nucleoside 22 Os. FEATURE: <221 > NAMEAKEY: modified base &222s. LOCATION: 21 <223> OTHER INFORMATION: 5'-phosphorothioate thymidine
<4 OOs, SEQUENCE: 15 cluggculgaalu ulucagagc at t 21
<210s, SEQ ID NO 16 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic antisense strand of dsRNA targeting mouse CD45 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Combined DNA/RNA Molecule: Synthetic antisense strand of dsRNA targeting mouse CD45 22 Os. FEATURE: <221 > NAMEAKEY: modified base &222s. LOCATION: 1 <223> OTHER INFORMATION: nucleoside: lacks 5'-phosphate group 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: 13, 17 <223> OTHER INFORMATION: 2'-O-methyl corresponding nucleoside 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222 LOCATION: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 18, 19 <223> OTHER INFORMATION: 2'-hydroxy corresponding nucleoside 22 Os. FEATURE: <221 > NAMEAKEY: modified base &222s. LOCATION: 21 <223> OTHER INFORMATION: 5'-phosphorothioate thymidine
<4 OOs, SEQUENCE: 16 lugcuculgaaa lulucago Cagt t 21
<210s, SEQ ID NO 17 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic sense strand of dsRNA targeting mouse Clec7A 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Combined DNA/RNA Molecule: Synthetic sense strand of dsRNA targeting mouse Clec7A 22 Os. FEATURE: <221 > NAMEAKEY: modified base &222s. LOCATION: 1 <223> OTHER INFORMATION: nucleoside: lacks 5'-phosphate group 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222> LOCATION: 1, 2, 4, 8, 10, 12, 13, 14, 17, 18 <223> OTHER INFORMATION: 2'-O-methyl corresponding nucleoside 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: 3, 5, 6, 7, 9, 11, 15, 16, 19 <223> OTHER INFORMATION: 2'-hydroxy corresponding nucleoside 22 Os. FEATURE: <221 > NAMEAKEY: modified base &222s. LOCATION: 21 <223> OTHER INFORMATION: 5'-phosphorothioate thymidine
<4 OOs, SEQUENCE: 17 agaluggallau aculcalaululat t 21 US 9,636,302 B2 77 78 - Continued
SEQ I D NO 18 LENGT H: 21 TYPE : DNA ORGAN ISM: Artificial Sequence FEATU RE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic antis ense strand of dsRNA targeting mouse Clec7A FEAT RE: OTHE INFORMATION: Description of Combined DNA/RNA Molecule: Syn etic antisense strand of dsRNA targeting mouse Clec7A FEA RE: NAME KEY: modified base O CA. ION: 1 E INFORMATION: nucleoside: lacks 5'-phosphate group T RE: NAME KEY: modified base OCA ION: 1, 9, 11, 15 E INFORMATION: 2'-O-methyl corresponding nucleoside T RE: NAME KEY: modified base OCA ION: 2, 3, 4, 5, 6, 7, 8, 10, 12, 13, 14, 16, 17, 18, 19 E INFORMATION: 2'-hydroxy corresponding nucleoside T RE: E KEY: modified base OCA ION: 21 OTHE INFORMATION: 5'-phosphorothioate thymidine
<4 OOs, SEQUENCE: 18 ulaaluugagua luauccalucut t 21
SEQ I D NO 19 LENGT H: 39 TYPE; DNA ORGAN ISM: Artificial Sequence FEATU RE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse GAPDH
SEQUENCE: 19 gaga.gcaatig C cagcc cctt tttct Cttgg aaagaaagt 39
SEQ I D NO 2 O LENGT H: 44 TYPE : DNA ORGAN ISM: Artificial Sequence FEATU RE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse GAPDH <4 OOs, SEQUENCE: 2O ggtc.cagggit ttct tact co ttgtttitt ct cittggaaaga aagt 44
SEQ I D NO 21 LENGT H: 42 TYPE : DNA ORGAN ISM: Artificial Sequence FEATU RE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse GAPDH
SEQUENCE: 21 c cctagg.ccc ctic ctdtt at ttttittct ct tdgaaagaaa git 42
SEQ I D NO 22 LENGT H: 42 TYPE : DNA ORGAN ISM: Artificial Sequence FEATU RE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic US 9,636,302 B2 79 80 - Continued bDNA probes for mouse GAPDH <4 OOs, SEQUENCE: 22 tgcagogaac tittattgatg gtttittct ct tdgaaagaaa git 42
<210s, SEQ ID NO 23 &211s LENGTH: 43 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse GAPDH
<4 OOs, SEQUENCE: 23 gcacgt caga t cc acgacgt ttt taggcat aggaccc.gtg tct 43
<210s, SEQ ID NO 24 &211s LENGTH: 42 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse GAPDH <4 OOs, SEQUENCE: 24 ggcaggtttc. tcc aggcgtt tttaggcata ggaccc.gtgt ct 42
<210s, SEQ ID NO 25 &211s LENGTH: 44 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse GAPDH <4 OOs, SEQUENCE: 25 gcc ct cagat gcc tigctt catttittaggca taggaccc.gt gtct 44
<210s, SEQ ID NO 26 &211s LENGTH: 47 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse GAPDH
<4 OOs, SEQUENCE: 26 gccg tatt cattgtcatacc aggtttittag goatagg acc cqtgtct 47
<210s, SEQ ID NO 27 &211s LENGTH: 45 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse GAPDH
<4 OOs, SEQUENCE: 27 gtccaccacc ctdttgctgt atttittaggc at aggacccg tdt ct 45
<210s, SEQ ID NO 28 &211s LENGTH: 46 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse GAPDH US 9,636,302 B2 81 82 - Continued
<4 OOs, SEQUENCE: 28 aattgtgagg gagatgctica gttttittagg cataggaccc gtgtct 46
<210s, SEQ ID NO 29 &211s LENGTH: 25 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse GAPDH <4 OOs, SEQUENCE: 29 ccacct tctt gatgtcatca tactt 25
<210s, SEQ ID NO 3 O &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse GAPDH
<4 OOs, SEQUENCE: 30 Cccalagatgc cct tcagtgg
<210s, SEQ ID NO 31 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence & 22 O FEATURE; <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse GAPDH <4 OOs, SEQUENCE: 31 gaga caacct ggt cct cagt gtag 24
<210s, SEQ ID NO 32 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse GAPDH
<4 OOs, SEQUENCE: 32 ggagttgctg ttgaagtc.gc ag 22
<210s, SEQ ID NO 33 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse GAPDH
<4 OOs, SEQUENCE: 33 ggcatcgaag gttggalaga.gt g 21
<210s, SEQ ID NO 34 &211s LENGTH: 25 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse GAPDH US 9,636,302 B2 83 84 - Continued
<4 OOs, SEQUENCE: 34 aaatgagctt gacaaagttg to att 25
<210s, SEQ ID NO 35 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse GAPDH <4 OOs, SEQUENCE: 35 gaggc.catgt aggc.catgag
<210s, SEQ ID NO 36 &211s LENGTH: 18 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse GAPDH
<4 OOs, SEQUENCE: 36 gtcCttgctg gggtgggit 18
<210s, SEQ ID NO 37 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse GAPDH
<4 OO > SEQUENCE: 37 tagggcct ct cittgct cagt
<210s, SEQ ID NO 38 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse GAPDH <4 OOs, SEQUENCE: 38 gttgggggcc gagttggga 19
<210s, SEQ ID NO 39 &211s LENGTH: 18 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse GAPDH
<4 OOs, SEQUENCE: 39 atgggggtct giggatgga 18
<210s, SEQ ID NO 4 O &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse GAPDH
<4 OOs, SEQUENCE: 4 O US 9,636,302 B2 85 86 - Continued tatt Caagag agtagggagg gct 23
<210s, SEQ ID NO 41 &211s LENGTH: 4 O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Factor VII <4 OOs, SEQUENCE: 41 gagalagcagc agcc catgct ttittct ctitg gaaagaaagt 4 O
<210s, SEQ ID NO 42 &211s LENGTH: 41 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Factor VII <4 OOs, SEQUENCE: 42 tggagctgga gcagaaag.ca tttittctictt ggaaagaaag t 41
<210s, SEQ ID NO 43 &211s LENGTH: 43 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Factor VII <4 OOs, SEQUENCE: 43 tgct tcct co togggittatga aatttittct c ttggaaagaa agt 43
<210s, SEQ ID NO 44 &211s LENGTH: 39 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Factor VII <4 OOs, SEQUENCE: 44 ccgggccaaa gct cotcc tt tttct cittgg aaagaaagt 39
<210s, SEQ ID NO 45 &211s LENGTH: 4 O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Factor VII <4 OOs, SEQUENCE: 45 cittgaagatc. tcc.cgggcct ttittct cittg gaaagaaagt 4 O
<210s, SEQ ID NO 46 &211s LENGTH: 42 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Factor VII
<4 OOs, SEQUENCE: 46 US 9,636,302 B2 87 88 - Continued ctgcttggtc. citcticagggc titttittct ct tdgaaagaaa git 42
<210s, SEQ ID NO 47 &211s LENGTH: 45 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Factor VII <4 OOs, SEQUENCE: 47 actgcagt cc ctagaggit co Ctttittaggc at aggacccg tdt ct 45
<210s, SEQ ID NO 48 &211s LENGTH: 46 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Factor VII <4 OOs, SEQUENCE: 48 tittgcctgtg taggacacca totttittagg cataggaccc gtgtct 46
<210s, SEQ ID NO 49 &211s LENGTH: 45 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Factor VII <4 OOs, SEQUENCE: 49 t cct caaagg agcactgttc ctittittaggc at agg acccg togt ct 45
<210s, SEQ ID NO 50 &211s LENGTH: 49 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Factor VII <4 OOs, SEQUENCE: 50 ccc.cat cact gtaaacaatic cagaatttitt agg catagga ccc.gtgtct 49
<210s, SEQ ID NO 51 &211s LENGTH: 44 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Factor VII <4 OOs, SEQUENCE: 51 tggatt.cgag gcacactggt tttittaggca taggaccc.gt gtct 44
<210s, SEQ ID NO 52 &211s LENGTH: 47 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Factor VII
<4 OOs, SEQUENCE: 52 tggCagg tac Ctacgttctg acatttittag gcataggacc C9tgtct 47 US 9,636,302 B2 89 90 - Continued
<210s, SEQ ID NO 53 &211s LENGTH: 46 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Factor VII <4 OOs, SEQUENCE: 53 cittgctttitc. tca cagttcc gatttittagg cataggaccc gtgtct 46
<210s, SEQ ID NO 54 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Factor VII <4 OOs, SEQUENCE: 54 aggagtgagt tdcacgc.c 19
<210s, SEQ ID NO 55 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Factor VII < 4 OO SEQUENCE: 55 t cattgcact citct ct coag agag 24
<210s, SEQ ID NO 56 &211s LENGTH: 25 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Factor VII <4 OOs, SEQUENCE: 56 gCagacgtaa gactitgagat gat CC 25
<210s, SEQ ID NO 57 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Factor VII <4 OO > SEQUENCE: 57
CCCtcaaagt ctaggaggca gaa 23
<210s, SEQ ID NO 58 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Factor VII
<4 OOs, SEQUENCE: 58 ttgcacagat cagctgct catt 22 US 9,636,302 B2 91 92 - Continued
<210s, SEQ ID NO 59 &211s LENGTH: 37 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for EGFP <4 OO > SEQUENCE: 59 ggcacgggca gcttgcttitt tot Cttggala agaaagt 37
<210s, SEQ ID NO 60 &211s LENGTH: 4 O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for EGFP <4 OOs, SEQUENCE: 60 ggtagcggct galagcactgt ttittct ctitg gaaagaaagt 4 O
<210s, SEQ ID NO 61 &211s LENGTH: 4 O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for EGFP
<4 OOs, SEQUENCE: 61
Cctggacgta gcc titcgggt ttitt Ctcttg gaaagaaagt 4 O
<210s, SEQ ID NO 62 &211s LENGTH: 42 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for EGFP <4 OOs, SEQUENCE: 62
CCttgaagaa gatggtgcgc titttittct ct taaagaaa git 42
<210s, SEQ ID NO 63 &211s LENGTH: 39 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for EGFP
<4 OOs, SEQUENCE: 63 cgaact tcac ct cqgcgctt tttct cittgg aaagaaagt 39
<210s, SEQ ID NO 64 &211s LENGTH: 39 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for EGFP
<4 OOs, SEQUENCE: 64 cctt cagotc gatgcggttt tttct cittgg aaagaaagt 39 US 9,636,302 B2 93 94 - Continued
<210s, SEQ ID NO 65 &211s LENGTH: 42 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for EGFP
<4 OOs, SEQUENCE: 65 gtcacgaggg togc.cagtt tttaggcata ggaccc.gtgt ct 42
<210s, SEQ ID NO 66 &211s LENGTH: 43 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for EGFP <4 OOs, SEQUENCE: 66 cacgc.cgtag gtcagggtgt ttt taggcat aggaccc.gtg tct 43
<210s, SEQ ID NO 67 &211s LENGTH: 44 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for EGFP
<4 OO > SEQUENCE: 67 gtgctgct tc atgtggtcgg tttitt aggca tagga CCCst gtct 44
<210s, SEQ ID NO 68 &211s LENGTH: 42 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for EGFP
<4 OOs, SEQUENCE: 68 t caccagggit gtc.gcc ctitt tttaggcata ggaccc.gtgt ct 42
<210s, SEQ ID NO 69 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for EGFP <4 OOs, SEQUENCE: 69 cggtggtgca gatgaact tc a 21
<210s, SEQ ID NO 70 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for EGFP
<4 OO > SEQUENCE: 7 O
Catggcggac ttgaagaagt c 21
<210s, SEQ ID NO 71 US 9,636,302 B2 95 96 - Continued
&211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for EGFP
<4 OOs, SEQUENCE: 71 cgt.cct cott gaagttcgatg c 21
<210s, SEQ ID NO 72 &211s LENGTH: 43 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Clec4f
<4 OOs, SEQUENCE: 72 ggtc.cc.ttct cagggtctgt aatttittct c ttggaaagaa agt 43
<210s, SEQ ID NO 73 &211s LENGTH: 43 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Clec4f <4 OO > SEQUENCE: 73 tctgtc.ttgg ccctctgaag atttitttct c ttggaaagaa agt 43
<210s, SEQ ID NO 74 &211s LENGTH: 39 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Clec4f
<4 OOs, SEQUENCE: 74 c cccagg.cga ttctgct citt tttct cittgg aaagaaagt 39
<210s, SEQ ID NO 75 &211s LENGTH: 42 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Clec4f <4 OO > SEQUENCE: 75 tctgct cotg cittctgtgca gtttittct ct tdgaaagaaa git 42
<210s, SEQ ID NO 76 &211s LENGTH: 41 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Clec4f
<4 OO > SEQUENCE: 76 cagaacttct cagcct cocq tttitt ct citt ggaaagaaag t 41
<210s, SEQ ID NO 77 &211s LENGTH: 39 US 9,636,302 B2 97 98 - Continued
&212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Clec4f <4 OO > SEQUENCE: 77 tgcgct coct gggacg tatt tttct cttgg aaagaaagt 39
<210s, SEQ ID NO 78 &211s LENGTH: 49 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Clec4f
<4 OO > SEQUENCE: 78 gactitcaaag ctgaga catc act catttitt agg catagga ccc.gtgtct 49
<210s, SEQ ID NO 79 &211s LENGTH: 47 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Clec4f <4 OO > SEQUENCE: 79 gatctgcctt caaactictogc atc.tttittag goatagg acc cqtgtct 47
<210s, SEQ ID NO 8O &211s LENGTH: 41 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Clec4f <4 OOs, SEQUENCE: 80 ggctittggtc gcc tec attt ttagg catag gaccc.gtgtc. t 41
<210s, SEQ ID NO 81 &211s LENGTH: 43 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Clec4f
<4 OOs, SEQUENCE: 81 titccagttct gcgcgatcat ttittagg.cat agg accc.gtg tct 43
<210s, SEQ ID NO 82 &211s LENGTH: 43 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Clec4f
<4 OOs, SEQUENCE: 82 agaggt cacc gaa.gc.caggt ttt taggcat aggaccc.gtg tct 43
<210s, SEQ ID NO 83 &211s LENGTH: 23 &212s. TYPE: DNA US 9,636,302 B2 99 100 - Continued ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Clec4f SEQUENCE: 83 tgct Ctgtag Catctggaca ttg 23
SEQ ID NO 84 LENGTH: 21 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Clec4f SEQUENCE: 84
CCCctgaatc ttggcagtgag 21
SEO ID NO 85 LENGTH 19 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Clec4f
SEQUENCE: 85 ccacagct tc Ctgcagggc 19
SEQ ID NO 86 LENGTH: 24 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Clec4f SEQUENCE: 86 gctggagaac Ctgattctgagtict 24
SEO ID NO 87 LENGTH: 29 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Clec4f
SEQUENCE: 87 aaaagtaata aaagtttcca ttgaagtac 29
SEO ID NO 88 LENGTH: 2O TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Clec4f
SEQUENCE: 88 ccacggct tc ttgtcacgag
SEO ID NO 89 LENGTH: 45 TYPE: DNA ORGANISM: Artificial Sequence US 9,636,302 B2 101 102 - Continued
22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Reln
<4 OOs, SEQUENCE: 89 cagagat citt gaactgcatg atcCtttitt c ticttggaaag aaagt 45
<210s, SEQ ID NO 90 &211s LENGTH: 39 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Reln <4 OOs, SEQUENCE: 90 tcggcgggta agcactgatt tttct cttgg aaagaaagt 39
<210s, SEQ ID NO 91 &211s LENGTH: 41 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Reln
<4 OOs, SEQUENCE: 91 cgct tccaga acactittggg tttitt ct citt ggaaagaaag t 41
<210s, SEQ ID NO 92 & 211 LENGTH: 41 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Reln
<4 OOs, SEQUENCE: 92 ttcaggaagc ggg taggtga tttittctictt ggaaagaaag t 41
<210s, SEQ ID NO 93 &211s LENGTH: 43 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Reln <4 OOs, SEQUENCE: 93 gtc.cat catg gctgccacat titt tagg.cat agg accc.gtg tot 43
<210s, SEQ ID NO 94 &211s LENGTH: 49 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Reln
<4 OOs, SEQUENCE: 94 t catgagt ca citgcatacac ct citctttitt agg catagga ccc.gtgtct 49
<210s, SEQ ID NO 95 &211s LENGTH: 44 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: US 9,636,302 B2 103 104 - Continued <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Reln
<4 OO > SEQUENCE: 95 ttcaggcact ttgcatccaa tttittaggca taggaccc.gt gtct 44
<210s, SEQ ID NO 96 &211s LENGTH: 47 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Reln
<4 OOs, SEQUENCE: 96 tgaatttgat tctgggcaat ttitttitt tag goatagg acc cqtgtct 47
<210s, SEQ ID NO 97 &211s LENGTH: 48 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Reln <4 OO > SEQUENCE: 97 gggact aaat aactic cagct cacgtttitta ggCataggac ccgtgtct 48
<210s, SEQ ID NO 98 &211s LENGTH: 45 & 212 TYPE DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Reln
<4 OOs, SEQUENCE: 98 t ccttitt.cca ccctitcagtt gtttittaggc at agg acccg togt ct 45
<210s, SEQ ID NO 99 &211s LENGTH: 46 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Reln <4 OOs, SEQUENCE: 99 ttacaggatt coccgittaag ctitttittagg cataggaccc gtgtct 46
<210s, SEQ ID NO 100 &211s LENGTH: 48 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Reln
<4 OOs, SEQUENCE: 1.OO gggt cacaga tacactgttc ctitttittitta ggcataggac ccgtgtct 48
<210s, SEQ ID NO 101 &211s LENGTH: 26 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic US 9,636,302 B2 105 106 - Continued bDNA probes for mouse Reln <4 OOs, SEQUENCE: 101 agt cacagaa tottt coact gtacag 26
<210s, SEQ ID NO 102 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Reln
<4 OOs, SEQUENCE: 102 gaggatgaca C catctggcg
<210s, SEQ ID NO 103 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Reln <4 OOs, SEQUENCE: 103 agttct cagt gggcgt cagg
<210s, SEQ ID NO 104 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Reln <4 OOs, SEQUENCE: 104 cCaaagttcag tagaaaactg. cacg 24
<210s, SEQ ID NO 105 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Reln
<4 OOs, SEQUENCE: 105 ggaagaacac agacggttga gaaa 24
<210s, SEQ ID NO 106 &211s LENGTH: 28 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Reln
<4 OOs, SEQUENCE: 106 tctgagtact tttggtagaa cctaaatc 28
<210s, SEQ ID NO 107 &211s LENGTH: 42 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Tek US 9,636,302 B2 107 108 - Continued
<4 OOs, SEQUENCE: 107 tgagtic cctd ggaagctittc atttittct ct tdgaaagaaa git 42
<210s, SEQ ID NO 108 &211s LENGTH: 41 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Tek <4 OOs, SEQUENCE: 108 actitcc ccag atc tocc cat tttitt ct citt ggaaagaaag t 41
<210s, SEQ ID NO 109 &211s LENGTH: 42 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Tek
<4 OOs, SEQUENCE: 109 taagc.cggct aaagagtic catttitt totct tdgaaagaaa git 42
<210s, SEQ ID NO 110 &211s LENGTH: 41 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence & 22 O FEATURE; <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Tek <4 OOs, SEQUENCE: 110 aatgcaggtgagggatgttt tttittctictt ggaaagaaag t 41
<210s, SEQ ID NO 111 &211s LENGTH: 43 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Tek
<4 OOs, SEQUENCE: 111 t cct atggtg atgggct cat ggtttittctic ttggaaagaa agt 43
<210s, SEQ ID NO 112 &211s LENGTH: 42 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Tek
<4 OOs, SEQUENCE: 112 cc.gct cqcat gigt ccactitt tttaggcata ggaccc.gtgt ct 42
<210s, SEQ ID NO 113 &211s LENGTH: 47 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Tek US 9,636,302 B2 109 110 - Continued
<4 OOs, SEQUENCE: 113 acaact caca actittgcgac ttcttitt tag goatagg acc cqtgtct 47
<210s, SEQ ID NO 114 &211s LENGTH: 44 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Tek <4 OOs, SEQUENCE: 114
Ccagcgt.cca Cagatgagca tttittaggca taggaccc.gt gtct 44
<210s, SEQ ID NO 115 &211s LENGTH: 47 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Tek
<4 OOs, SEQUENCE: 115 agcaa.gctga citccacagag aacttitt tag gcataggacc C9tgtct 47
<210s, SEQ ID NO 116 &211s LENGTH: 48 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Tek
<4 OOs, SEQUENCE: 116 gcqc ctitcta c tactic cata aaggitttitta ggcataggac ccgtgtct 48
<210s, SEQ ID NO 117 &211s LENGTH: 47 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Tek <4 OOs, SEQUENCE: 117 cggcatcaga cacaagaggt aggtttittag gcataggacc C9tgtct 47
<210s, SEQ ID NO 118 &211s LENGTH: 41 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Tek
<4 OOs, SEQUENCE: 118 gggtgccacc cagaggcttt ttagg catag gaccc.gtgtc. t 41
<210s, SEQ ID NO 119 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Tek
<4 OOs, SEQUENCE: 119 US 9,636,302 B2 111 112 - Continued gcaaggagaa acaccacaga ag 22
<210s, SEQ ID NO 120 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Tek
<4 OOs, SEQUENCE: 120 cgct Cttgtt tacaagttgg C9 22
<210s, SEQ ID NO 121 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Tek <4 OOs, SEQUENCE: 121 gaattgat ca agat Cagg to catg 24
<210s, SEQ ID NO 122 &211s LENGTH: 4 O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse CD45
<4 OOs, SEQUENCE: 122 tgacgagttt tacaccg.cga titttittgaag ttaccgttitt 4 O
<210s, SEQ ID NO 123 &211s LENGTH: 46 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse CD45
<4 OOs, SEQUENCE: 123 aatctgtctg. cacatttata acatttitttt ttctgagtica aag cat 46
<210s, SEQ ID NO 124 &211s LENGTH: 4 O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse CD45 <4 OOs, SEQUENCE: 124 gg.cgtttctg gaatcc cc at ttittct cittg gaaagaaagt 4 O
<210s, SEQ ID NO 125 &211s LENGTH: 41 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse CD45
<4 OOs, SEQUENCE: 125 US 9,636,302 B2 113 114 - Continued tggat.ccc.ca caactaggct tatttittgaa gttaccgttt t 41
<210s, SEQ ID NO 126 &211s LENGTH: 43 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse CD45
<4 OOs, SEQUENCE: 126 agagactaac gtttitt cittg cagctttittctgagt caaag cat 43
<210s, SEQ ID NO 127 &211s LENGTH: 43 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse CD45
<4 OOs, SEQUENCE: 127 gtttagatac aggcticaggc catttittct c ttggaaagaa agt 43
<210s, SEQ ID NO 128 &211s LENGTH: 41 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse CD45
<4 OOs, SEQUENCE: 128 tggggtttag atgcagactic agtttittgaa gtt accgttt t 41
<210s, SEQ ID NO 129 &211s LENGTH: 47 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse CD45
<4 OOs, SEQUENCE: 129 attgttctta tag cataaaa catat coatt tttctgagtic aaag.cat 47
<210s, SEQ ID NO 130 &211s LENGTH: 46 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse CD45 <4 OOs, SEQUENCE: 130 taggcaaact tttacatttt totgatttitt citcttggaaa gaaagt 46
<210s, SEQ ID NO 131 &211s LENGTH: 43 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse CD45
<4 OOs, SEQUENCE: 131 ccacct caaa actggit caca ttatttitttg aagttaccgt titt 43 US 9,636,302 B2 115 116 - Continued
<210s, SEQ ID NO 132 &211s LENGTH: 47 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse CD45 <4 OOs, SEQUENCE: 132 t catag tatt tataaggttt caa.gctttitt tttctgagtic aaag.cat 47
<210s, SEQ ID NO 133 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse CD45
<4 OOs, SEQUENCE: 133 ttgacatagg caagtaggga cact 24
<210s, SEQ ID NO 134 &211s LENGTH: 43 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse CD45 < 4 OO SEQUENCE: 134 cc catttctt tdaatctitcc catttittct c ttggaaagaa agt 43
<210s, SEQ ID NO 135 &211s LENGTH: 42 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse CD45 <4 OOs, SEQUENCE: 135 tgaaaattgc acttct cago agttttittga agttaccgtt tt 42
<210s, SEQ ID NO 136 &211s LENGTH: 39 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse CD45
<4 OOs, SEQUENCE: 136 ccggacgatc togcttttgtg tttittctgag toaaag.cat 39
<210s, SEQ ID NO 137 &211s LENGTH: 44 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse CD45
<4 OOs, SEQUENCE: 137 ggttitt catt coattgacct tdttttitt ct cittggaaaga aagt 44 US 9,636,302 B2 117 118 - Continued
<210s, SEQ ID NO 138 &211s LENGTH: 36 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse CD45 <4 OOs, SEQUENCE: 138 ttgttctgtcg gcc.gggattt ttgaagttac cqttitt 36
<210s, SEQ ID NO 139 &211s LENGTH: 46 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse CD45 <4 OOs, SEQUENCE: 139 ggaggaccac atgtaacatt tatact attt ttctgagtica aag cat 46
<210s, SEQ ID NO 140 &211s LENGTH: 46 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse CD45
<4 OOs, SEQUENCE: 140 ggttittaggg ccattagttt cataatttitt citc.ttggaaa gaaagt 46
<210s, SEQ ID NO 141 &211s LENGTH: 4 O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse GAPDH <4 OOs, SEQUENCE: 141 cgaggctggc actgcaca at ttitt Ctcttg gaaagaaagt 4 O
<210s, SEQ ID NO 142 &211s LENGTH: 41 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse GAPDH
<4 OOs, SEQUENCE: 142 citt cac catt ttgttctacgg gatttittgaa gttaccgttt t 41
<210s, SEQ ID NO 143 &211s LENGTH: 39 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse GAPDH
<4 OOs, SEQUENCE: 143 c caaatcc.gt toacaccgac tttittctgag toaaag.cat 39 US 9,636,302 B2 119 120 - Continued
<210s, SEQ ID NO 144 &211s LENGTH: 38 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse GAPDH
<4 OOs, SEQUENCE: 144 cCaggcgc.cc aatacggttt ttct cttgga aagaaagt 38
<210s, SEQ ID NO 145 &211s LENGTH: 38 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse GAPDH <4 OOs, SEQUENCE: 145 caaatggcag ccctggtgat ttittgaagtt accottitt 38
<210s, SEQ ID NO 146 &211s LENGTH: 41 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse GAPDH
<4 OOs, SEQUENCE: 146 aacaat ct co actittgccac tatttittctgagt caaag.ca t 41
<210s, SEQ ID NO 147 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse GAPDH
<4 OOs, SEQUENCE: 147 tgaagggg.tc gttgatggc 19
<210s, SEQ ID NO 148 &211s LENGTH: 26 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse GAPDH <4 OOs, SEQUENCE: 148
Catgtag acc atgtagttga ggt cala 26
<210s, SEQ ID NO 149 &211s LENGTH: 44 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse GAPDH
<4 OOs, SEQUENCE: 149 cc.gtgagtgg agt catactg gaatttittct Cttggaaaga aagt 44
<210s, SEQ ID NO 150 US 9,636,302 B2 121 122 - Continued
&211s LENGTH: 42 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse GAPDH
<4 OOs, SEQUENCE: 150 ttgactgtgc cqttgaattt gtttittct ct tdgaaagaaa git 42
<210s, SEQ ID NO 151 &211s LENGTH: 37 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse GAPDH
<4 OOs, SEQUENCE: 151 agct tcc.cat t ct cqgcctt tttgaagtta ccgttitt 37
<210s, SEQ ID NO 152 &211s LENGTH: 38 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse GAPDH <4 OOs, SEQUENCE: 152 gggct tcc.cg ttgatgacat ttittctgagt caaag cat 38
<210s, SEQ ID NO 153 &211s LENGTH: 41 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse GAPDH
<4 OOs, SEQUENCE: 153 cgct Cotgga agatggtgat tttittctictt ggaaagaaag t 41
<210s, SEQ ID NO 154 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse GAPDH <4 OOs, SEQUENCE: 154 cc catttgat gttagtgggg tot 23
<210s, SEQ ID NO 155 &211s LENGTH: 41 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse GAPDH
<4 OO > SEQUENCE: 155 at acticagoa ccggcct cac tttitt ct citt ggaaagaaag t 41
<210s, SEQ ID NO 156 &211s LENGTH: 37 US 9,636,302 B2 123 124 - Continued
&212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse CD68 <4 OOs, SEQUENCE: 156
Ctgggagc.cg ttggccttitt t ct cttggaa agaaagt 37
<210s, SEQ ID NO 157 &211s LENGTH: 4 O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse CD68
<4 OO > SEQUENCE: 157 ggcttggagc tigaacacaag gtttittgaag ttaccgttitt 4 O
<210s, SEQ ID NO 158 &211s LENGTH: 44 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse CD68 <4 OOs, SEQUENCE: 158 ggtataggat t cqgatttga atttgtttitt ctdagt caaa gcat 44
<210s, SEQ ID NO 159 &211s LENGTH: 43 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse CD68 <4 OOs, SEQUENCE: 159 acct ttctitc. caccctgaat tdtttittct c ttggaaagaa agt 43
<210s, SEQ ID NO 160 &211s LENGTH: 42 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse CD68
<4 OOs, SEQUENCE: 160 t ctittaagcc ccactittago tttitttittga agttaccgtt tt 42
<210s, SEQ ID NO 161 &211s LENGTH: 38 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse CD68
<4 OOs, SEQUENCE: 161 acagatatgc cccaag.ccct ttittctgagt caaag cat 38
<210s, SEQ ID NO 162 &211s LENGTH: 41 &212s. TYPE: DNA US 9,636,302 B2 125 126 - Continued ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse CD68 SEQUENCE: 162 cittggttttgttgggattica aatttittgaa gttaccgttt t 41
SEQ ID NO 163 LENGTH: 39 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse CD68 SEQUENCE: 163 cc.gt cacaac ctic cct ggac tttittctgag toaaag.cat 39
SEQ ID NO 164 LENGTH: 42 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse CD68
SEQUENCE: 164 agagacaggt ggggatgggt atttittct ct taaagaaa git 42
SEQ ID NO 165 LENGTH: 44 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse CD68 SEQUENCE: 165 ggtaagctgt C cataaggala atgagtttitt gaagttaccg ttitt 44
SEQ ID NO 166 LENGTH: 42 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse CD68
SEQUENCE: 166 tgtagg to ct gtttgaatcc aaatttittct gag to aaag.c at 42
SEO ID NO 167 LENGTH: 44 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse CD68
SEQUENCE: 167 ggtag actgt act cqggctic tatttittct Cttggaaaga aagt 44
SEQ ID NO 168 LENGTH: 38 TYPE: DNA ORGANISM: Artificial Sequence US 9,636,302 B2 127 128 - Continued
22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse CD68
<4 OOs, SEQUENCE: 168 tccaccgc.ca totagt cc at ttittgaagtt accottitt 38
<210s, SEQ ID NO 169 &211s LENGTH: 42 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse CD68 <4 OOs, SEQUENCE: 169
Cctgtgggaa ggacacattg tatttitttct gag to aaagc at 42
<210s, SEQ ID NO 170 &211s LENGTH: 4 O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse CD68
<4 OOs, SEQUENCE: 170 c catgaatgt ccactgtgct gtttittgaag ttaccgttitt 4 O
<210s, SEQ ID NO 171 & 211 LENGTH: 41 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse CD68
<4 OOs, SEQUENCE: 171 t citcgaagag atgaattctg cqtttittctgagt caaag.ca t 41
<210s, SEQ ID NO 172 &211s LENGTH: 39 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse CD68 <4 OOs, SEQUENCE: 172
Ccca agggag Cttggagctt tttct cttgg aaagaaagt 39
<210s, SEQ ID NO 173 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse CD68
<4 OOs, SEQUENCE: 173 titt.ccacagc agaagctttgg 21
<210s, SEQ ID NO 174 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: US 9,636,302 B2 129 130 - Continued <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse CD68
<4 OOs, SEQUENCE: 174
Ctggagaaag alactatgctt gca 23
<210s, SEQ ID NO 175 &211s LENGTH: 44 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse CD68
<4 OO > SEQUENCE: 175 agaga.gcagg tdalaggtgaa cagtttittct Cttggaaaga aagt 44
<210s, SEQ ID NO 176 &211s LENGTH: 37 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for EGFP <4 OOs, SEQUENCE: 176 ggctgaagica citgcacgctt tttgaagtta ccgttitt 37
<210s, SEQ ID NO 177 &211s LENGTH: 39 & 212 TYPE DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for EGFP
<4 OO > SEQUENCE: 177 gaagttcgatg ccc.ttcagct tttittctgag toaaag cat 39
<210s, SEQ ID NO 178 &211s LENGTH: 38 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for EGFP <4 OOs, SEQUENCE: 178 ggatgttgcc gtc.ctic ctitt ttittgaagtt accottitt 38
<210s, SEQ ID NO 179 &211s LENGTH: 38 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for EGFP
<4 OO > SEQUENCE: 179 tact coagct tdtgcc cc at ttittctgagt caaag cat 38
<210s, SEQ ID NO 18O &211s LENGTH: 42 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic US 9,636,302 B2 131 132 - Continued bDNA probes for EGFP <4 OOs, SEQUENCE: 18O agacgttgttg gctgttgtag ttgtttittga agttaccgtt tt 42
<210s, SEQ ID NO 181 &211s LENGTH: 4 O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for EGFP
<4 OOs, SEQUENCE: 181 tctgcttgtc. g.gc.catgata ttttittctgagtcaaag cat 4 O
<210s, SEQ ID NO 182 &211s LENGTH: 41 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for EGFP <4 OOs, SEQUENCE: 182 aagttcacct tdatgcc.gtt ctitttittgaa gttaccgttt t 41
<210s, SEQ ID NO 183 &211s LENGTH: 39 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for EGFP <4 OOs, SEQUENCE: 183 cgatgttgttg gcggat Cttgtttittctgag ticaaagcat 39
<210s, SEQ ID NO 184 &211s LENGTH: 38 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for EGFP
<4 OOs, SEQUENCE: 184 ctgcacgctg ccdtcc tittt ttct cittgga aagaaagt 38
<210s, SEQ ID NO 185 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for EGFP
<4 OOs, SEQUENCE: 185 gctgg tagt gttcggcgag 19
<210s, SEQ ID NO 186 &211s LENGTH: 18 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for EGFP US 9,636,302 B2 133 134 - Continued
<4 OOs, SEQUENCE: 186 cgc.cgatggg ggtgttct 18
<210s, SEQ ID NO 187 &211s LENGTH: 39 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for EGFP <4 OOs, SEQUENCE: 187
Ctt catgtgg togggg tagc tittittctgag ticaaagcat 39
<210s, SEQ ID NO 188 &211s LENGTH: 15 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for EGFP
<4 OOs, SEQUENCE: 188 gCagcacggg gcc.gt 15
<210s, SEQ ID NO 189 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence & 22 O FEATURE; <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for EGFP <4 OOs, SEQUENCE: 189 Cagg tagtgg ttgtcgggca
<210s, SEQ ID NO 190 &211s LENGTH: 38 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for EGFP
<4 OOs, SEQUENCE: 190 agggcggact gggtgcttitt ttct cttgga aagaaagt 38
<210s, SEQ ID NO 191 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for EGFP
<4 OOs, SEQUENCE: 191 tctcgttggg gtctttgctic
<210s, SEQ ID NO 192 &211s LENGTH: 4 O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for EGFP US 9,636,302 B2 135 136 - Continued
<4 OOs, SEQUENCE: 192 aggaccatgt gatcgc.gctt ttitt Ctcttg gaaagaaagt 4 O
<210s, SEQ ID NO 193 &211s LENGTH: 39 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for EGFP <4 OOs, SEQUENCE: 193 gcggtcacga act coagctt tttct Cttgg aaagaaagt 39
<210s, SEQ ID NO 194 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for EGFP
<4 OOs, SEQUENCE: 194 cggactitgaa gaagtcgtgc tig 22
<210s, SEQ ID NO 195 &211s LENGTH: 39 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for EGFP
<4 OOs, SEQUENCE: 195 cgtagcct tc gggcatggitt tttct cttgg aaagaaagt 39
<210s, SEQ ID NO 196 &211s LENGTH: 38 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for EGFP <4 OOs, SEQUENCE: 196 aagatggtgc gct Cotggat ttittgaagtt accgttitt 38
<210s, SEQ ID NO 197 &211s LENGTH: 39 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for EGFP
<4 OO > SEQUENCE: 197 agttgc.cgt.c gtc.cttgaag tttittctgag toaaag.cat 39
<210s, SEQ ID NO 198 &211s LENGTH: 16 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for EGFP
<4 OOs, SEQUENCE: 198 US 9,636,302 B2 137 138 - Continued tcggcgcggg tdttgt 16
<210s, SEQ ID NO 199 &211s LENGTH: 4 O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for EGFP
<4 OOs, SEQUENCE: 199 gtc.gcc ct cq aactitcacct ttittct cittg gaaagaaagt 4 O
<210s, SEQ ID NO 2 OO &211s LENGTH: 38 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for EGFP <4 OOs, SEQUENCE: 2OO cgatgcggitt Caccagggitt ttittgaagtt accgttitt 38
<210s, SEQ ID NO 2 O1 &211s LENGTH: 38 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Clec7a <4 OOs, SEQUENCE: 2O1 tittct ctdat cocctgggct ttittgaagtt accottitt 38
<210s, SEQ ID NO 202 &211s LENGTH: 39 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Clec 7a
<4 OOs, SEQUENCE: 2O2 gaagatggag cctggctt CC tittittctgag tdaaagcat 39
<210s, SEQ ID NO 203 &211s LENGTH: 39 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Clec 7a <4 OOs, SEQUENCE: 2O3 gcaatgggcc ticcaaggttt tttct Cttgg aaagaaagt 39
<210s, SEQ ID NO 204 &211s LENGTH: 41 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Clec 7a
<4 OOs, SEQUENCE: 204 US 9,636,302 B2 139 140 - Continued gcacaggatt cotaaaccca citttitttgaa gttaccgttt t 41
<210s, SEQ ID NO 205 &211s LENGTH: 42 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Clec 7a
<4 OOs, SEQUENCE: 205 gcagdalacca c tactaccac aaatttittct gag to aaag.c at 42
<210s, SEQ ID NO 206 &211s LENGTH: 4 O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Clec 7a
<4 OOs, SEQUENCE: 2O6 tgctagggca cccago actt ttittct cittg gaaagaaagt 4 O
<210s, SEQ ID NO 2 O7 &211s LENGTH: 39 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Clec 7a
<4 OOs, SEQUENCE: 2O7 cctgaattgt gtc.gc.caaaa tttittgaagt taccgttitt 39
<210s, SEQ ID NO 208 &211s LENGTH: 43 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Clec 7a
<4 OOs, SEQUENCE: 208 ttgtc.tttct c ct ctdgatt tot ctittittctgagt caaag cat 43
<210s, SEQ ID NO 209 &211s LENGTH: 48 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Clec 7a <4 OOs, SEQUENCE: 209 tggttct citt tatttcttga taggaagttt ttct cittgga aagaaagt 48
<210s, SEQ ID NO 210 &211s LENGTH: 42 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Clec 7a
<4 OOs, SEQUENCE: 210 ctaaagatga ttctgtgggc ttgtttittga agttaccgtt tt 42 US 9,636,302 B2 141 142 - Continued
SEQ ID NO 211 LENGTH: 39 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Clec 7a
SEQUENCE: 211 ggagggagcc acct tct cat tttittctgag toaaag cat 39
SEQ ID NO 212 LENGTH: 43 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Clec 7a
SEQUENCE: 212 citcc td tagt ttgggatgcc tittttittct c ttggaaagaa agt 43
SEQ ID NO 213 LENGTH: 41 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Clec 7a
SEQUENCE: 213 ggaaggcaag gctgagaaaa actttittgaa gtt accgttt t 41
SEQ ID NO 214 LENGTH: 41 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Clec 7a
SEQUENCE: 214 citt.cccatgc atgatccaat tatttittctgagt caaag.ca t 41
SEQ ID NO 215 LENGTH: 47 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Clec 7a
SEQUENCE: 215 cctgagaa.gc taaataggta acagotttitt tot cittggaa agaaagt 47
SEQ ID NO 216 LENGTH: 44 TYPE: DNA US 9,636,302 B2 143 144 - Continued <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Clec 7a <4 OOs, SEQUENCE: 216 t citct tactt coataccagg aatttitttitt gaagttaccg ttitt 44
<210s, SEQ ID NO 217 &211s LENGTH: 39 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Clec 7a <4 OOs, SEQUENCE: 217 gCacct agct gggagcagtg tttittctgag tdaaagcat 39
<210s, SEQ ID NO 218 &211s LENGTH: 28 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Clec 7a
<4 OOs, SEQUENCE: 218 ttittgagttgtctatott ca gtagatga 28
<210s SEO ID NO 219 &211s LENGTH: 44 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Clec 7a
<4 OOs, SEQUENCE: 219 tggctttcaa tdaact caaa ttctttitt ct cittggaaaga aagt 44
<210s, SEQ ID NO 220 &211s LENGTH: 43 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Clec 7a
<4 OOs, SEQUENCE: 220 gcattaatac gigtgagacga tigtttittittgaagttaccgt titt 43
<210s, SEQ ID NO 221 &211s LENGTH: 4 O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Clec 7a
<4 OOs, SEQUENCE: 221 cgggaaaggc citat coaaaa ttttittctgagtcaaag cat 4 O
<210s, SEQ ID NO 222 &211s LENGTH: 42 US 9,636,302 B2 145 146 - Continued
&212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Clec 7a <4 OOs, SEQUENCE: 222 catggc cctt cactctgatt gtttittct ct tdgaaagaaa git 42
<210s, SEQ ID NO 223 &211s LENGTH: 42 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Clec 7a
<4 OOs, SEQUENCE: 223 gctgat coat cotcc.cagaa citttittct ct tdgaaagaaa git 42
<210s, SEQ ID NO 224 &211s LENGTH: 43 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Clec 7a <4 OOs, SEQUENCE: 224 ttgaaacgag ttggggaaga atttitttctic ttggaaagaa agt 43
<210s, SEQ ID NO 225 &211s LENGTH: 41 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Clec 7a <4 OOs, SEQUENCE: 225 cctggggagc tigt atttctg acttitttgaa gttaccgttt t 41
<210s, SEQ ID NO 226 &211s LENGTH: 44 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic bDNA probes for mouse Clec 7a
<4 OOs, SEQUENCE: 226 catacacaat tdtgcagtaa gotttitttitt ctdag to aaa gcat 44
What is claimed is: wherein: 1. A cyclic amino-lipid of the formula: 55 R1 is independently selected from —(CH2) N(R): —(CH), N(R)—(CH), N(R), wherein R is inde pendently selected from —H, (I) C6-40 alkyl, C6-40 alkenyl and C6-C40 alkynyl, pro R2 60 vided that —N(R) is not NH; R- iii. C6-40 alkyl, and C6-40 alkenyl; and 1-Rl R2 is C6-40 alkyl, C6-40 alkenyl or C6-40 alkynyl; and r N m is 0 or 1, provided that when m is 0, R1 is not C6-C40 Nu alkyl or C6-C40 alkenyl: R11 65 and pharmaceutically acceptable salts thereof. 2. The cyclic amino-lipid of claim 1, selected from the group of US 9,636,302 B2 147 148
3. A lipid nanoparticle comprising a cyclic amino-lipid of 13. The lipid nanoparticle of claim 7, wherein the nucleic claim 1. 40 acid is in the form of a single stranded or partially double 4. The lipid nanoparticle of claim3, further comprising an Stranded oligomer or a polymer composed of ribonucle otides. additional lipid selected from the group consisting of a 14. The lipid nanoparticle of claim 7, wherein the nucleic cationic lipid, a helper lipid, and a PEG-lipid. acid is selected from the group consisting of miRNA, 5. The lipid nanoparticle of claim 3, further comprising a antisense oligonucleotides, siRNA, immune-stimulatory oli hydrophobic small molecule. 45 gonucleotides, aptamers, ribozymes, and plasmids encoding 6. The lipid nanoparticle of claim 3, further comprising a a specific gene or siRNA. biologically active compound. 15. A pharmaceutical composition comprising a cyclic amino-lipid according to claim 1. 7. The lipid nanoparticle of claim 6, wherein the biologi 16. A pharmaceutical composition comprising a lipid cally active compound is selected from the group consisting 50 nanoparticle according to claim 3. of a small molecule, a peptide, a protein, a carbohydrate, a 17. The pharmaceutical composition of claim 16, further nucleic acid, and a lipid. comprising a biologically active compound. 8. The lipid nanoparticle of claim 4, wherein the cationic 18. The pharmaceutical composition of claim 17, wherein lipid is a lipid comprising a quaternary amine with a nitrogen the biologically active compound is a nucleic acid. atom having four organic Substituents. 55 19. The pharmaceutical composition of claim 18, wherein 9. The lipid nanoparticle of claim 4, wherein the helper the nucleic acid is in the form of a single Stranded or partially lipid is a neutral Zwitterionic lipid. double Stranded oligomer or a polymer composed of ribo 10. The lipid nanoparticle of claim 5, wherein the hydro nucleotides. phobic Small molecule is selected from the group consisting 20. A method of treating a disease that is caused by the 60 over-expression of one or several proteins in a Subject, said of a sterol and a hydrophobic vitamin. method comprising the administration of a lipid nanoparticle 11. The lipid nanoparticle of claim 10, wherein the according to claim 6 to the Subject, wherein the biologically hydrophobic small molecule is cholesterol. active compound is a nucleic acid, and wherein treatment 12. The lipid nanoparticle of claim 7, wherein the protein refers to alleviation of symptoms, decreasing the rate of is selected from the group consisting of a nucleoprotein, a 65 disease progression, amelioration or palliation of the disease mucoprotein, a lipoprotein, a synthetic polypeptide, a small state, remission or improved prognosis, or slowing the molecule linked to a protein, and a glycoprotein. progression of the disease. US 9,636,302 B2 149 150 21. A method of treating a disease that is caused by a reduced, Suppressed or missing expression of one or several proteins in a Subject, said method comprising administration of a lipid nanoparticle according to claim 6 to the Subject, wherein the biologically active compound is a nucleic acid, and wherein treatment refers to alleviation of symptoms, decreasing the rate of disease progression, amelioration or palliation of the disease state, remission or improved prog nosis, or slowing the progression of the disease. 22. A method for generating an immune response in a 10 Subject, said method comprising the administration of the lipid nanoparticle according to claim 6 to the Subject, wherein the biologically active compound is an immune stimulatory nucleic acid. k k k k k 15