Oligodeoxynucleotide Stimulation TRAIL/Apo-2 Ligand After Cpg

Human B Cells Express Functional TRAIL/Apo-2 Ligand after CpG-Containing Oligodeoxynucleotide Stimulation

This information is current as Troy J. Kemp, Jill M. Moore and Thomas S. Griffith of September 29, 2021. J Immunol 2004; 173:892-899; ; doi: 10.4049/jimmunol.173.2.892 http://www.jimmunol.org/content/173/2/892 Downloaded from

References This article cites 63 articles, 29 of which you can access for free at: http://www.jimmunol.org/content/173/2/892.full#ref-list-1

Why The JI? Submit online. http://www.jimmunol.org/

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication

*average by guest on September 29, 2021

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2004 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

Human B Cells Express Functional TRAIL/Apo-2 Ligand after CpG-Containing Oligodeoxynucleotide Stimulation1

Troy J. Kemp,*† Jill M. Moore,* and Thomas S. Grifﬁth2*†‡

CpG-containing oligodeoxynucleotides (CpG ODN) have broad-ranging immunostimulatory effects, including the generation of antitumor immune responses. Analysis of different CpG ODN have identiﬁed two classes: CpG-A ODN, which stimulate high levels of IFN-␣ production from plasmacytoid dendritic cells and weakly activate B cells, and CpG-B ODN, which strongly activate B cells but stimulate low production of IFN-␣ from plasmacytoid dendritic cells. Previously, we observed that CpG-B ODN (2006) induces TRAIL/Apo-2 ligand (Apo-2L)-mediated killing of tumor cells by CD14؉ PBMC. In this study, we extend our investigation of CpG ODN-induced TRAIL/Apo-2L expression and activity in PBMC to include CpG-A ODN. Of the two classes, IFN-␣ ,production and TRAIL/Apo-2L-mediated killing of tumor cells was greatest with CpG-A ODN. Surprisingly, CD3؉, CD14؉ CD19؉, and CD56؉ PBMC expressed high levels of TRAIL/Apo-2L following CpG-A ODN stimulation. When isolated, the CD19؉ Downloaded from PBMC (B cells) were able to kill tumor cells in a TRAIL/Apo-2L-dependent manner. As with CD14؉ PBMC, CD19؉ sorted B cells were capable of up-regulating TRAIL/Apo-2L expression when stimulated with IFN-␣ alone. Interestingly, agonist anti-CD40 mAb further enhanced the IFN-␣-induced TRAIL/Apo-2L expression on CD19؉ B cells. These results are the ﬁrst to demonstrate human B cell-mediated killing of tumor cells in a TRAIL/Apo-2L-dependent fashion. The Journal of Immunology, 2004, 173: 892–899. http://www.jimmunol.org/

rompt recognition of, and response to, bacterial infections contain mixed phosphodiester-phosphorothioate backbones and is needed by higher organisms to prevent any pathological are particularly effective at stimulating plasmacytoid DC (pDC) to P consequences. Although a variety of bacterial cell wall produce high levels of IFN-␣ and activating NK cells, but have components are immunostimulatory, the genomic DNA may be the poor stimulatory effects on B cells (9). The ﬂexibility of the phos- strongest stimulating agent within the bacteria cell (1, 2). Indeed, phodiester backbone in CpG-A ODN, which allows it to form hair- bacterial DNA can stimulate various immune cells, including B pin loops, is essential to the induction of high levels of IFN-␣. 3 ␾ cells, dendritic cells (DC), monocytes/macrophages (M ), and CpG-B ODN, by comparison, have phosphorothioate backbones

NK cells (3). The strong stimulatory effect of bacterial DNA is and strongly activate human B cells to proliferate, secrete IL-6 and by guest on September 29, 2021 largely due to the presence of unmethylated CG-containing motifs, IL-10, and express increased levels of MHC class II, CD80, and which are the foundation for the design and testing of synthetic CD86 (10). CpG-B ODN also induce DC maturation and activa- CpG-containing oligodeoxynucleotides (CpG ODN) as immune tion, but relatively little pDC-derived IFN-␣ is produced with adjuvants and stand-alone therapeutics (4–6). Cellular recognition CpG-B ODN stimulation (9). The pDC-derived IFN-␣ is then ca- of CpG motifs is made possible by TLR9, a member of an evo- pable of affecting a myriad of cellular functions and immunolog- lutionarily conserved family of proteins that are responsible for mediating innate immune reactions, especially against bacterial in- ical responses. fections, through the recognition of pathogen-associated molecular IFNs were discovered for their antiviral activity (11), but their patterns (7, 8). effects reach far beyond resistance to viral infection. Specifically, ␣ Studies examining the immunological effects of CpG ODN have IFN- modulates immune responses to bacterial infections and is determined that there are two main classes based upon the cell the primary cytokine used to induce antitumor responses to various population stimulated and cytokines produced (3). CpG-A ODN cancers, including bladder carcinoma and chronic myelogenous leukemia (12, 13). IFN-␣ is capable of increasing MHC class I expression on normal cells and enhancing the effector functions of *Department of Urology, †Interdisciplinary Graduate Program in Immunology, and ‡Prostate Cancer Research Program of the Holden Comprehensive Cancer Center, the innate and adaptive immune system (11, 14). Several studies University of Iowa, Iowa City, IA 52242 demonstrated that IFN-␣ increases the lytic activity of NK cells Received for publication January 12, 2004. Accepted for publication May 5, 2004. and CTL, along with inducing B cell proliferation and Ig secretion The costs of publication of this article were defrayed in part by the payment of page (15–17). Moreover, the effects of IFN-␣ are essential to the acti- charges. This article must therefore be hereby marked advertisement in accordance vation and differentiation of M␾. IFN-␣ increases the expression with 18 U.S.C. Section 1734 solely to indicate this fact. of FcRs on M␾ and increases the phagocytosis of immune com- 1 This work was supported by a Department of Defense Prostate Cancer Research Program New Investigator Award (PC010599) and a Carver Medical Research Ini- plexes formed on foreign Ags and tumor cells (18). Furthermore, tiative Grant administered through the University of Iowa Carver College of IFN-␣ induces TRAIL/Apo-2L expression on human M␾, trans- Medicine. forming them into highly effective tumor cell killers (19). How- 2 Address correspondence and reprint requests to Dr. Thomas S. Griffith, Department ␾ of Urology, 3204 Medical Education and Biomedical Research Facility, University of ever, M have not been the only cell type identified as being able Iowa, 375 Newton Road, Iowa City, IA 52242-1089. E-mail address: thomas- to express TRAIL/Apo-2L upon IFN-␣ stimulation. DC, NK cells, griffi[email protected] and TCR-ligated T cells have been shown to express functional 3 Abbreviations used in this paper: DC, dendritic cell; M␾, macrophage; CpG ODN, G TRAIL/Apo-2L (20–22). Essentially, IFN-␣ is responsible for CpG-containing oligodeoxynucleotide; pDC, plasmacytoid DC; L-NMMA, N -monomethyl-L-arginine; CMA, concanamycin A; FasL, Fas ligand. eliciting a host of M␾ effector functions, whether making them

more receptive to phagocytosis or transforming them into tumori- lation as described above. WM 793 tumor cells were labeled with 100 ␮Ci cidal cells by a TRAIL/Apo-2L-dependent mechanism. of 51Crfor1hat37°C, washed three times, and resuspended in complete 51 Interestingly, previous work from our laboratory revealed that medium. To determine TRAIL-induced death, Cr-labeled tumor cells (104/well) were incubated with varying numbers of effector cells for 14 h. the stimulation of PBMC with CpG-B ODN induces, in an IFN- G In some cultures, TRAIL-R2:Fc or Fas:Fc (20 ␮g/ml), N -monomethyl-L- ␣ -dependent manner, the expression of functional TRAIL/Apo-2L arginine (L-NMMA; 300 ␮M; AerBio, Bloomington, IN), or concanamycin ϩ on CD14 M␾, which are able to kill tumor cell targets in vitro A (CMA; 20 nM; Sigma-Aldrich) were added to the PBMC or purified (23). These observations prompted us to evaluate the TRAIL/Apo- CD19ϩ B cells 15 min prior (2 h prior for CMA) to adding tumor cell 2L-stimulating capacity of CpG-A ODN. The results presented in targets. All cytotoxicity assays were performed in 96-well round-bottom ϫ this study demonstrate for the first time that CpG-A ODN stimu- plates and the percent specific lysis was calculated as follows: 100 (experimental cpm Ϫ spontaneous cpm)/(total cpm Ϫ spontaneous cpm). Spontane- lation of human PBMC leads to high levels of functional TRAIL/ 51 ϩ ous and total Cr release were determined in the presence of either medium Apo-2L expression on CD19 B cells. alone or 1% Nonidet P-40, respectively. The presence of TRAIL-R2:Fc or Fas:Fc during the assay had no effect on the level of spontaneous release by the Materials and Methods target cells. Reagents and mAb Reagents and sources were as follows: IFN-␣ (100 ng/ml; PeproTech, IFN-␣ neutralization Rocky Hill, NJ); RPA-T4, FITC-conjugated IgG1 anti-human CD4; HIT8a, FITC-conjugated IgG1 anti-human CD8; M5E2, FITC-conjugated PBMC (106 cells/0.3 ml in a 5-ml polypropylene round-bottom tube (Fal- IgG2a anti-human CD14; NCAM16.2, FITC-conjugated IgG2b anti- con BD Labware, Franklin Lakes, NJ)) were stimulated, as described above, with CpG ODN alone, or CpG ODN in the presence of rabbit human CD56 (BD Biosciences, San Diego, CA); HIB19, FITC-conjugated Downloaded from IgG1 anti-human CD19; RIK-2, biotinylated IgG1 anti-human TRAIL (a anti-human neutralizing IFN-␣ antiserum (10,000 U/ml; R&D Systems, gift from Dr. H. Yagita, Juntendo University, Tokyo, Japan); IgG1-biotin Minneapolis, MN) or a nonspecific rabbit IgG isotype control Ab (Sigma- isotype control (Caltag Laboratories, Burlingame, CA). The soluble fusion Aldrich). PBMC were then analyzed for TRAIL/Apo-2L expression by proteins TRAIL-R2:Fc and Fas:Fc were purchased from Alexis Biochemi- flow cytometry or cultured with 51Cr-labeled tumor cells to assess tumori- cals (San Diego, CA). cidal activity, as described above. CpG ODN http://www.jimmunol.org/ CpG ODN 2041 was obtained from Dr. R. Ashman (University of Iowa, IFN-␣ and IL-6 ELISA Iowa City, IA), CpG ODN 2006 and 2243 were purchased from Coley ␣ Pharmaceutical Group (Wellesley, MA), and CpG ODN 2216 was synthe- Human IFN- or IL-6 protein levels produced after CpG ODN stimulation sized by Sigma Genosys (The Woodlands, TX). All of the following se- were quantitated using a sandwich ELISA purchased from R&D Systems. quences are 5Ј–3Ј, lowercase letters are 5Ј of phosphothiorate linkages, and uppercase letter are 5Ј of phosphodiester linkages: CpG-A ODN 2216, ggGGGACGATCGTCgggggG; CpG-A control ODN 2243; ggGGGAG Results CATGCTGgggggG; CpG-B ODN 2006, tcgtcgttttgtcgttttgtcgtt; and CpG-B control ODN 2041, ctggtctttctggtttttttctcg. CpG-A ODN-stimulated human PBMC mediate increased TRAIL/Apo-2L-dependent tumor cell lysis vs CpG-B ODN-

Tumor cell line stimulated PBMC by guest on September 29, 2021 The human melanoma cell line WM 793 was obtained from Dr. M. Herlyn One of the distinguishing features of CpG-A ODN stimulation is (Wistar Institute, Philadelphia, PA), and cultured in DMEM supplemented ␣ with 10% FBS, penicillin, streptomycin, sodium pyruvate, nonessential the amount of IFN- produced by pDC compared with CpG-B amino acids, and HEPES (hereafter referred to as complete DMEM). ODN. Although they only comprise ϳ0.1% of the cells within PBMC, pDC are the only cells within PBMC that produce IFN-␣ Preparation of PBMC in response to CpG ODN (23–25). pDC are identical with the PBMC were isolated from normal, healthy donors by standard density gra- “natural type I IFN-producing cell” that has been described for dient centrifugation over Ficoll-Paque Plus (Pharmacia, Uppsala, Sweden). ϩ several years (26, 27). In the present study, PBMC stimulated for To isolate CD19 B cells from PBMC, a positive-selection isolation kit ␮ (Miltenyi Biotec, Auburn, CA) was used, containing magnetic beads con- 24 h with 1 g CpG-A ODN (2216) resulted in the production of jugated to a mouse anti-human CD19 mAb. To verify the purity of the over 20,000 pg/ml IFN-␣ (Fig. 1A). By comparison, just over 100 selected CD19ϩ cells, cells eluted from the selection column were stained pg/ml IFN-␣ was detected in the supernatants of PBMC stimula- with a FITC-conjugated anti-CD20 mAb (clone 2H7, IgG2b; eBioscience, tion with CpG-B ODN (2006). These are levels well within the San Diego, CA) and analyzed by flow cytometry. Purity was Ͼ98% for all purifications performed. range documented in other reports (24). There was no detectable IFN-␣ in the culture supernatants from CpG-A control ODN Flow cytometry (2243), CpG-B control ODN (2041)-stimulated PBMC, or un- Cell analysis was performed on a FACScan (BD Biosciences) with Ͼ104 stimulated PBMC. Based on the level of IFN-␣ produced, we hy- cells analyzed per sample. For multicolor cell analysis, cells were com- pothesized that PBMC stimulation with CpG-A ODN 2216 would ␮ ␮ bined in a 96-well round-bottom plate with 20 l of human IgG (12 g/ml; correlate with increased tumoricidal activity. As predicted, there Sigma-Aldrich, St. Louis, MO) to block Fc binding of the mAb and 20 ␮l each of the direct FITC-labeled and biotin-labeled mAb (60 ␮g/ml). Cells was increased tumor cell lysis when the PBMC were stimulated were then incubated at 4°C for 30 min. Following three washes with 200 with 2216 compared with 2006 stimulation (Fig. 1B). PBMC stim- ␮ ␮ l of PBS containing 2 mg/ml BSA and 0.02% NaN3,40 l of PE-labeled ulated with either control CpG ODN displayed lytic activity com- streptavidin (1/100 dilution; Caltag Laboratories) was added for an addi- parable to unstimulated PBMC. Previously, our laboratory dem- tional 30 min. Cells were either analyzed immediately following staining or fixed in 1% paraformaldehyde until analysis. onstrated that the tumoricidal activity of CpG-B-stimulated PBMC was TRAIL/Apo-2L specific with the inclusion of TRAIL-R2:Fc PBMC/B cell-mediated killing of human tumor cells (23). As with CpG-B ODN, CpG-A ODN-stimulated PBMC killed PBMC (107 cells/2 ml/well in a six-well plate) were cultured in RPMI 1640 WM 793 cells by a TRAIL/Apo-2L-dependent mechanism as in- supplemented with 10% FBS, penicillin, streptomycin, sodium pyruvate, dicated in Fig. 1C. CpG-A ODN-stimulated PBMC incubated with nonessential amino acids, and HEPES (hereafter referred to as complete Fas:Fc, a specific inhibitor of NO synthase, L-NMMA (28), or the RPMI) medium alone or CpG ODN (1 ␮g/ml) for 24 h, after which the cells were washed and resuspended in complete RPMI. In some experi- perforin inhibitor CMA (29) did not inhibit cell lysis, but only the ments, B cells were positively selected from the PBMC following stimu- addition of TRAIL-R2:Fc blocked cell lysis. 894 TRAIL/Apo-2L EXPRESSION ON HUMAN B CELLS

CpG-A ODN stimulation induces high TRAIL/Apo-2L expression on multiple peripheral blood cell populations, including CD19ϩ B cells Having demonstrated the presence of elevated tumoricidal activity in CpG-A ODN-stimulated PBMC, we then evaluated the expression of TRAIL/Apo-2L on CD4ϩ, CD8ϩ, CD14ϩ, CD19ϩ, and CD56ϩ PBMC. The PBMC were analyzed by flow cytometry following 24-h stimulation with 2006, 2216, and their respective con- trols to determine whether the increased levels of IFN-␣ from CpG-A ODN-stimulated PBMC induced higher levels of TRAIL/ Apo-2L on the M␾ and/or stimulated the expression of TRAIL/ Apo-2L on additional cell types within PBMC as compared with CpG-B ODN. When stimulated with 2006, TRAIL/Apo-2L was expressed the highest on CD14ϩ M␾ and at an intermediate level on CD19ϩ B cells (Fig. 2). Low levels of TRAIL/Apo-2L were present on CD4ϩ T cells and CD56ϩ NK cells, and no detectable TRAIL/Apo-2L was seen on CD8ϩ cells. In contrast, stimulation with 2216 resulted in significant TRAIL/Apo-2L expression on all five PBMC populations. No detectable TRAIL/Apo-2L was ob- Downloaded from served on any cell population following stimulation with either control CpG ODN 2041 or 2243. From these observations, it can be concluded that the increase in PBMC lytic activity following CpG-A ODN stimulation shown in Fig. 1B may be the result of the overall high level of TRAIL/Apo-2L expression on all the cell types examined. http://www.jimmunol.org/ Previous studies have shown that peripheral blood T cells, NK cells, and M␾ can express functional TRAIL/Apo-2L (19, 21, 22); however, finding that CD19ϩ B cells expressed high levels of TRAIL/Apo-2L after 2216 stimulation was most intriguing. Con- sequently, we wished to determine whether the TRAIL/Apo-2L expressed on the CD19ϩ B cells conferred these cells with tumoricidal activity. To test this theory, PBMC were stimulated with CpG-A ODN 2216 or the control 2243 for 24 h. CD19ϩ B cells by guest on September 29, 2021 were then isolated by positive selection from the bulk PBMC, and used as effector cells against the TRAIL/Apo-2L-sensitive human melanoma cell line WM 793 (30). Analysis of the Ͼ98% pure B cells demonstrated very high TRAIL/Apo-2L surface levels (Fig. 3, A and B). As presented in Fig. 3C, significant tumor cell lysis was measured when using 2216-stimulated B cells. Unstimulated and 2243-stimulated B cells exhibited no target cell lysis. The

FIGURE 1. CpG-A ODN stimulates higher IFN-␣ production and PBMC-mediated tumoricidal activity compared with CpG-B ODN stimulation. A, PBMC were cultured for 24 h in the absence or presence of CpG-B ODN 2006, CpG-B ODN control 2041, CpG-A ODN 2216, or CpG-A ODN control 2243 (1 ␮g/ml). IFN-␣ levels in the culture supernatants were then determined by multispecies IFN-␣ ELISA. IFN-␣ levels represent the average amount measured from three independent experiments using different donors. ND, None detected. B, Isolated PBMC were cultured for 24 h in the absence or presence of CpG-B ODN 2006, CpG-B ODN control 2041, CpG-A ODN 2216, or CpG-A ODN control 2243 (1 ␮g/ml). The PBMC were then cultured for 14 h with 51Cr-labeled WM 793 target cells at the indicated E:T ratios. C, Isolated PBMC were cultured for 24 h in the absence or presence of CpG-A ODN 2216 (1 ␮g/ml). In addition, PBMC were incubated with L-NMMA (300 ␮M), CMA (20 nM), TRAIL-R2:Fc (20 ␮g/ml), or Fas:Fc (20 ␮g/ml) along with CpG-A ODN FIGURE 2. TRAIL/Apo-2L expression on human PBMC (CD4ϩ, 2216 (1 ␮g/ml). The PBMC were then cultured for 14 h with 51Cr-labeled CD8ϩ, CD14ϩ, CD19ϩ, and CD56ϩ cells) after incubation for 24 h in the WM 793 target cells at the indicated E:T ratios. Data points represent the absence or presence of CpG-B ODN 2006, CpG-B ODN control 2041, mean of triplicate wells, and the experiment was repeated on at least three CpG-A ODN 2216, or CpG-A ODN control 2243 (1 ␮g/ml). Histograms different donors that gave similar results. For clarity, SD bars were omitted represent 104 gated cells in all conditions, and viability was Ͼ95% as from the graphs, but were Ͻ10% of the value of all points. assessed by propidium iodide exclusion. Similar observations were observed using PBMC from four different donors. The Journal of Immunology 895

FIGURE 3. TRAIL/Apo-2L-mediated tumoricidal activity by human B cells occurs after stimulation with CpG-A ODN. A, PBMC were incubated for 24 h in the absence or presence of either the stimulatory CpG-A ODN 2216 (1 ␮g/ ml) or control CpG-A ODN 2243 (1 ␮g/ml). CD19ϩ B cells were then isolated from the PBMC using magnetic bead separation. The purity of the isolated CD19ϩ B cells was veri- fied by CD20 staining. B, Surface TRAIL/ Apo-2L levels on unstimulated, CpG-A ODN 2216-, or CpG-A ODN control 2243-stimulated purified CD19ϩ B cells. Histograms represent 104 gated cells, and viability was Ͼ95% after incubation as assessed by propidium iodide exclusion. C, CpG-A ODN 2216-stimulated CD19ϩ B cells were cultured for 14 h with 51Cr-labeled WM 793 target cells at the indicated E:T ratios. Inclusion of the fusion protein TRAIL-R2:Fc (20 ␮g/ml) inhibited killing of Downloaded from WM 793 target cells, whereas addition of Fas:Fc (20 ␮g/ml) did not. Unstimulated or CpG-A ODN control 2243-stimulated purified CD19ϩ B cells displayed no cytotoxic activity. Data points represent the mean of triplicate wells, and experiments were repeated at least

three times using different donors with similar http://www.jimmunol.org/ results. For clarity, SD bars were omitted from the graphs, but were Ͻ10% of the value of all points. highest E:T ratio was limited to 17:1 due to the volumes of blood tralizing antiserum was included (Fig. 4C). Similar flow cytometry obtained and numbers of CD19ϩ B cells present. Furthermore, results were seen on CD3ϩ T cells and CD56ϩ NK cells (data not inclusion of the soluble fusion protein TRAIL-R2:Fc completely shown). However, in both cases, inclusion of control antiserum inhibited target cell lysis by the 2216-stimulated B cells, confirm- had no effect on modulating TRAIL/Apo-2L expression levels. by guest on September 29, 2021 ing the mechanism of death to be TRAIL/Apo-2L mediated. Sim- Collectively, these results clearly show the importance for IFN-␣ ilar results were obtained in all tested donors. To our knowledge, in the CpG-A ODN-induced expression of TRAIL/Apo2L these results are the first to clearly demonstrate functional TRAIL/ on PBMC. Apo-2L can be expressed on human peripheral blood B cells. B cells can receive positive stimuli from a variety of cytokines, including IFN, IL-4, and IL-6, as well as ligation of the BCR and ␣ TRAIL/Apo-2L expression on B cells is dependent on IFN- and CD40 that lead to proliferation, differentiation, cytokine produc- enhanced with CD40 ligation tion, and other effector functions. Furthermore, B cells have been Analysis of the human TRAIL/Apo-2L promoter has identified a shown to express mRNA for TLR9, correlating with their respon- DNA motif consistent with a near-consensus IFN-␥-activated se- siveness to CpG ODN (32). It became important to then test quence located at Ϫ108 to Ϫ100 bp upstream of the promoter start whether purified B cells could be directly stimulated by CpG ODN site (31). Human DC and M␾ stimulated with either IFN-␣ or to express TRAIL/Apo2L. Whereas CpG-A ODN 2216, CpG-B IFN-␥ express functional TRAIL/Apo-2L (19, 20), whereas ODN 2006, or IFN-␣ induced TRAIL/Apo-2L expression on B TRAIL/Apo-2L expression on T cells requires IFN-␣ and TCR cells in the context of bulk PBMC (see Figs. 2 and 4A), purified B ligation (22), suggesting that the IFN-␣ produced by CpG-stimu- cells stimulated with the two different classes of CpG in the same lated pDC may also be important in the TRAIL/Apo-2L expression manner did not (Fig. 5A). To demonstrate that our process of pu- on B cells. Thus, we cultured whole PBMC with IFN-␣ for 24 h, rifying the B cells did not alter responsiveness to CpG ODN, the and then examined the same five cell populations as in Fig. 2 for purified B cells were stimulated with the two different classes of TRAIL/Apo-2L expression by flow cytometry. Surprisingly, there CpG ODN for 24 h, and the amount of IL-6 produced was mea- was a dose-dependent increase in TRAIL/Apo-2L expression on sured by ELISA. As expected, the purified B cells produced IL-6 the B cells, as with CD4ϩ, CD14ϩ, and CD56ϩ cells (Fig. 4A). when stimulated with CpG ODN (Fig. 5B). CpG-B directly stim- TRAIL/Apo-2L expression was seen on CD8ϩ T cells only with ulates B cells to produce IL-6 to a higher degree than CpG-A, the highest dose of IFN-␣. Confirmation for the necessity of IFN-␣ which correlates with previous results (3, 5). These results also in the CpG-A ODN-induced up-regulation of TRAIL/Apo-2L on coincide with the general distinction that CpG-B is more condu- PBMC reported in Figs. 1–3 was demonstrated by including neu- cive to stimulating B cells and CpG-A is only a weak B cell stim- tralizing antiserum against IFN-␣. PBMC stimulated with CpG-A ulator. Overall, these data suggest that IFN-␣ produced by pDC ODN in the presence of the IFN-␣-neutralizing antiserum failed to and some other factor(s) expressed on or secreted by non-B cell display tumoricidal activity (Fig. 4B). Flow cytometric analysis of PBMC are needed to induce TRAIL/Apo-2L expression on B cells. CpG-A ODN-stimulated CD14ϩ M␾ and CD19ϩ B cells revealed Because TRAIL/Apo-2L expression on B cells was induced levels of TRAIL/Apo-2L expression comparable to unstimulated only when in the presence of unfractionated PBMC, we reasoned or control CpG-A ODN-stimulated PBMC when the IFN-␣-neu- that another stimulus was acting on the B cells and needed for 896 TRAIL/Apo-2L EXPRESSION ON HUMAN B CELLS

FIGURE 4. IFN-␣ up-regulates TRAIL/ Apo-2L expression on PBMC, and IFN-␣ neutralization of CpG-A ODN- stimulated PBMC results in the loss of functional TRAIL/Apo-2L expression. A, TRAIL/Apo-2L expression on human PBMC (CD4ϩ, CD8ϩ, CD14ϩ, CD19ϩ, and CD56ϩ cells) after incubation for 24 h in the absence or presence of IFN-␣ (10 ng/ml or 1 ␮g/ml). Histograms represent 104 gated cells in all conditions, and viability was Ͼ95% as assessed by propidium iodide exclusion. Similar observations were observed using PBMC from three different donors.

B and C, IFN-␣ neutralization abrogates Downloaded from CpG-A ODN-induced tumoricidal activity and TRAIL/Apo2L expression. PBMC were incubated for 24 h in the absence or presence of either 1 ␮g/ml CpG-A ODN 2243, 2216, IFN-␣-neutralizing antiserum (10,000 neutralizing U/ml), or a nonspeciﬁc control Ig. http://www.jimmunol.org/ The PBMC were then cultured for 14 h with 51Cr-labeled WM 793 target cells at the indicated E:T ratios. Data points represent the mean of triplicate wells, and the experiment was repeated three times with similar results. For clarity, SD bars were omitted from the graphs, but were Ͻ10% of the value of all

points. C, PBMC were stimulated as by guest on September 29, 2021 described in B, and then analyzed by ﬂow cytometry for TRAIL/Apo-2L surface expression on CD14ϩ and CD19ϩ cells. Histograms represent 104 gated cells in all conditions, and viability was Ͼ95% as assessed by propidium iodide exclusion. These observations were reproduced using PBMC from three different donors.

maximal TRAIL/Apo-2L expression. A recent report demonstrated sufficient to induce TRAIL/Apo-2L expression. Furthermore, co- that IFN-␣ induced the expression of CD40L (CD154) on human stimulation through CD40 ligation is capable of enhancing CD4ϩ T cells (33). Thus, we investigated whether IFN-␣, com- TRAIL/Apo-2L expression on B cells in comparison to IFN-␣ bined with CD40 ligation by agonistic mAb, induced the expres- alone. sion of TRAIL/Apo-2L on B cells. Purified B cells were incubated with IFN-␣ alone, and in combination with agonist Abs to the BCR Discussion or CD40 for 24 h. Stimulation with anti-CD40 or anti-BCR Ab The vertebrate immune system uses pattern recognition receptors alone did not induce TRAIL/Apo-2L expression (Fig. 5C), nor did to detect the presence of invading microbes and initiate an immune stimulation with the combination of CpG-A ODN and anti-CD40 response to eliminate the pathogen (34). The studies that demon- (data not shown). Interestingly, IFN-␣ alone was sufficient to stim- strated CpG ODN can mimic the pathogen-associated molecular ulate modest TRAIL/Apo-2L expression on purified B cells, and patterns present in bacteria and viruses were landmark events that costimulation through the BCR along with IFN-␣ did not enhance not only showed how the innate and adaptive immune systems can the level of TRAIL/Apo-2L expression. In contrast, there was en- communicate to deal with such attacks on the body, but were also hanced expression of TRAIL/Apo-2L when an agonist CD40 mAb the launching pad for examining the role of CpG ODN as immune was included with the IFN-␣. In conclusion, these results demon- adjuvants in multiple areas of immunology and disease treatment strate that B cells express functional TRAIL/Apo-2L and IFN-␣ is (2, 4, 35, 36). Of particular interest is the use of CpG ODN in The Journal of Immunology 897

FIGURE 5. IFN-␣ and CD40 ligation, but not CpG ODN, induces maximal TRAIL/ Apo2L expression on purified CD19ϩ B cells. A, Magnetic bead-purified CD19ϩ B cells were stimulated for 24 h in the absence or presence of CpG-B ODN 2006, CpG-B ODN control 2041, CpG-A ODN 2216, or CpG-A ODN control 2243 (1 ␮g/ml). Surface levels of TRAIL/ Apo-2L were then determined by flow cytometry. Histograms represent 104 gated cells in all conditions, and viability was Ͼ95% as assessed by propidium iodide exclusion. Similar observations were observed using PBMC from three different donors. B, Culture supernatants from the cells used in A were assayed for IL-6 by ELISA to demonstrate B cell responsiveness to CpG ODN stimulation. There was no detectable IL-6 in the supernatants of either control CpG ODN (2041 or 2243)-stimulated cells. C, Puri- ϩ fied CD19 B cells were incubated for 24 h in Downloaded from the absence or presence of either anti-CD40 mAb (20 ␮g/ml), IFN-␣ (100 ng/ml), anti-BCR (20 ␮g/ml), and IFN-␣ (100 ng/ml), or anti- CD40 mAb (20 ␮g/ml) and IFN-␣ (100 ng/ml), and then analyzed for TRAIL/Apo-2L surface expression. Histograms represent 104 gated cells in all conditions, and viability was Ͼ95% as as- http://www.jimmunol.org/ sessed by propidium iodide exclusion. These observations were reproduced using purified CD19ϩ B cells from three different donors.

cancer immunotherapeutic settings, which can be traced back to cally the mouse lines A20 and WEHI.231 and human lines BJAB the reports of Coley (37). Although studies with CpG ODN in and REH, constitutively expressed TRAIL/Apo-2L. They then tumor immunology have yielded exciting results (38–43), many demonstrated that TRAIL was present on freshly isolated mouse by guest on September 29, 2021 fundamental questions remain regarding the mechanism by which B220ϩ cells following LPS stimulation (46). Interestingly, the CpG ODN induces antitumor immune responses. Previously, we functional state of TRAIL/Apo-2L on the B cells in either of these demonstrated that CpG-B ODN induce peripheral blood pDC to studies was not investigated. Looking back, it is difficult to guess produce IFN-␣, which then stimulates M␾ to express functional why this was not tested. Both of these studies were comparing the TRAIL/Apo-2L (23). We have extended this observation to dem- differentially regulated expression of FasL and TRAIL/Apo-2L on onstrate that the two classes of CpG ODN lead to distinct differ- T and B cells, before and after stimulation, and did not rigorously ences in the PBMC populations that express TRAIL/Apo-2L, as test the functional state of either molecule. In the results presented well as the level of TRAIL/Apo-2L expressed on the PBMC. Al- in this study, the dramatic and surprising up-regulation of TRAIL/ though the finding that T cells, NK cells, and M␾ expressed high Apo-2L expression on B cells following CpG-A ODN stimulation levels of TRAIL/Apo-2L after stimulation with CpG-A ODN 2216 made the investigation into its functionality a necessity. was interesting, the most surprising observation was that 2216 Perhaps the most puzzling question that arises from our findings stimulation also induced TRAIL/Apo-2L expression on B cells, is why B cells would express functional TRAIL/Apo-2L. The most turning them into TRAIL/Apo-2L-expressing cytotoxic B cells. obvious answer is to eliminate tumor cells, and the fact that tumor- Moreover, the B cell expression of TRAIL/Apo-2L was dependent infiltrating B cells have been reported (47–49) suggests that there on IFN-␣, as it is with the other cell populations examined within could be some cell-mediated tumoricidal contribution from B cells PBMC. However, it is important to note that IFN-␣ was not the in such a situation. B cells function as APCs in certain scenarios sole stimulatory factor driving TRAIL/Apo-2L expression on B (50); thus, it is possible that Ags derived from tumor cells killed by cells, as it is for other peripheral blood cell populations (e.g., M␾ the TRAIL/Apo-2L-expressing B cells may be presented by the and CD11cϩ DC) (19, 20). CD40 ligation was needed for maximal same B cells and activate T cells in the vicinity. Another potential TRAIL/Apo-2L expression on purified B cells. At present, these function for TRAIL/Apo-2L-expressing B cells is to maintain im- results suggest that the IFN-␣ produced by CpG ODN stimulation mune homeostasis and down-regulate immune responses that induces TRAIL/Apo-2L on the main cellular components of the could lead to autoimmune inflammation. Studies using TRAILϪ/Ϫ peripheral blood (M␾), but also enhances with CD40-CD40L in- mice or soluble TRAIL-R2:Fc infused into TRAILϩ/ϩ mice to teraction to induce TRAIL/Apo-2L expression on less prevalent block TRAIL activity in vivo have found that experimental auto- cell populations (i.e., B cells). immune arthritis is exacerbated compared with control mice (51). The expression of a death-inducing ligand on B cells is not new Moreover, autocollagen Ab responses were dramatically increased to the scientific literature. Hahne et al. (44) reported in 1996 that in mice treated with TRAIL-R2:Fc, indicating that persistent either LPS or PMA-stimulated B cells can express functional Fas TRAIL/Apo-2L blockade in mice enhanced the humoral immune ligand (FasL). Several years later, Mariani and Krammer (45) re- responses that were related to the increased level of disease. Cel- ported that some transformed cells of the B cell lineage, specifi- lular immune responses to collagen were also augmented in the 898 TRAIL/Apo-2L EXPRESSION ON HUMAN B CELLS

TRAIL-R2:Fc-treated mice in the above-mentioned study, as mea- physicochemical characterization, and antitumor activity. J. Natl. Cancer Inst. sured by lymphocyte proliferation and cytokine production (IL-2 72:955. 2. Yamamoto, S., E. Kuramoto, S. Shimada, and T. Tokunaga. 1988. In vitro aug- and IFN-␥). The expression of TRAIL on B cells may also be mentation of natural killer cell activity and production of interferon-␣/␤ and -␥ important in the death of activated peripheral blood T cells. B cells with deoxyribonucleic acid fraction from Mycobacterium bovis BCG. Jpn. play a vital role in supplying help to T cells during immune re- J. Cancer Res. 79:866. 3. Krieg, A. M. 2002. CpG motifs in bacterial DNA and their immune effects. Annu. sponses, and it is well known that numbers of activated T cells are Rev. Immunol. 20:709. kept regulated by the phenomenon of activation-induced cell death 4. Kuramoto, E., O. Yano, Y. Kimura, M. Baba, T. Makino, S. Yamamoto, T. Yamamoto, T. Kataoka, and T. Tokunaga. 1992. Oligonucleotide sequences (52, 53). Although many studies have demonstrated a role of the required for natural killer cell activation. Jpn. J. Cancer Res. 83:1128. Fas-FasL system in peripheral deletion of T cells, there is growing 5. Krieg, A. M., A. K. Yi, S. Matson, T. J. Waldschmidt, G. A. Bishop, R. Teasdale, evidence that TRAIL is also involved in this process (54, 55). G. A. Koretzky, and D. M. Klinman. 1995. CpG motifs in bacterial DNA trigger direct B-cell activation. Nature 374:546. Activation-induced cell death can occur in a cell-autonomous fash- 6. Krieg, A. M. 1998. Leukocyte stimulation by oligodeoxynucleotides. In Applied ion, for example, but can also occur when activated T cells interact Antisense Oligonucleotide Technology. C. A. Stein and A. M. Krieg, eds. Wiley, with other T cells or nonlymphoid cells expressing FasL or New York, p. 431. 7. Akira, S., K. Takeda, and T. Kaisho. 2001. Toll-like receptors: critical proteins TRAIL/Apo-2L (52, 56). Therefore, it is possible that TRAIL/ linking innate and acquired immunity. Nat. Immunol. 2:675. Apo-2L-expressing B cells could participate in restoring immune 8. Takeda, K., and S. Akira. 2001. Roles of Toll-like receptors in innate immune homeostasis in a similar way. responses. Genes Cells 6:733. 9. Verthelyi, D., and R. A. Zeuner. 2003. Differential signaling by CpG DNA in It has been well documented that pDC express the highest DCs and B cells: not just TLR9. Trends Immunol. 24:519. amounts of TLR9 among the cells in the peripheral blood and, 10. Hartmann, G., J. Battiany, H. Poeck, M. Wagner, M. Kerkmann, N. Lubenow, consequently, are the most responsive to CpG ODN (32, 57, 58). S. Rothenfusser, and S. Endres. 2003. Rational design of new CpG oligonucle- Downloaded from ␣ otides that combine B cell activation with high IFN-␣ induction in plasmacytoid pDC produce high levels of IFN- when stimulated with CpG-A dendritic cells. Eur. J. Immunol. 33:1633. ODN, yet very low levels of IFN-␣ are produced following CpG-B 11. Isaacs, A., and J. Lindenmann. 1987. Virus interference. I. The interferon. By stimulation (24). It appears this difference relates to the fact that A. Isaacs and J. Lindenmann, 1957. J. Interferon. Res. 7:429. 12. Luo, Y., X. Chen, T. M. Downs, W. C. DeWolf, and M. A. O’Donnell. 1999. both CpG ODN trigger distinct regulatory pathways within the IFN-␣2B enhances Th1 cytokine responses in bladder cancer patients receiving pDC that determine the amount of IFN-␣ produced. CpG-B ODN Mycobacterium bovis bacillus Calmette-Gue´rin immunotherapy. J. Immunol. 162:2399. preferentially triggers type I IFN production within the ﬁrst 12 h of http://www.jimmunol.org/ 13. Kantarjian, H. M., M. J. Keating, E. H. Estey, S. O’Brien, S. Pierce, M. Beran, stimulation, whereas CpG-A ODN-stimulated pDC produce type I C. Koller, E. Feldman, and M. Talpaz. 1992. Treatment of advanced stages of IFN for 48 h after stimulation that peaks between 12 and 24 h (59). Philadelphia chromosome-positive chronic myelogenous leukemia with interfer- ␣ To further stimulate type I IFN production, CpG-A ODN triggers on- and low-dose cytarabine. J. Clin. Oncol. 10:772. 14. Gresser, I. 1990. Biologic effects of interferons. J. Invest. Dermatol. 95:66S. a positive-feedback loop based on the activation of the type I IFNR 15. Herberman, R. B., C. W. Reynolds, and J. R. Ortaldo. 1986. Mechanism of by endogenous type I IFN (59, 60). Clearly, our results show that cytotoxicity by natural killer (NK) cells. Annu. Rev. Immunol. 4:651. the amount of IFN-␣ produced following CpG ODN stimulation 16. Lindahl, P., P. Leary, and I. Gresser. 1972. Enhancement by interferon of the speciﬁc cytotoxicity of sensitized lymphocytes. Proc. Natl. Acad. Sci. USA was related to the distribution and extent of TRAIL/Apo-2L ex- 69:721. pression on PBMC. However, we believe it unlikely that the dif- 17. Morikawa, K., H. Kubagawa, T. Suzuki, and M. D. Cooper. 1987. Recombinant

␣ ␤ ␥ by guest on September 29, 2021 ferences in expression on the different PBMC populations were interferon- ,- , and - enhance the proliferative response of human B cells. J. Immunol. 139:761. simply a consequence of the amount of IFN-␣ produced. In hu- 18. Vogel, S., D. Finbloom, K. English, D. Rosenstreich, and S. Langreth. 1983. mans, there are multiple IFN-␣ genes, with at least 13 IFN-␣ genes Interferon-induced enhancement of macrophage Fc receptor expression: ␤-interferon treatment of C3H/HeJ macrophages results in increased numbers and den- transcribed (61). The coding sequences of these genes diverge up sity of Fc receptors. J. Immunol. 130:1210. to 8%, giving rise to 12 different functional subtype proteins 19. Griffith, T. S., S. R. Wiley, M. Z. Kubin, L. M. Sedger, C. R. Maliszewski, and (IFN-␣1 and -␣13 are identical). All IFN-␣ subtypes are structur- N. A. Fanger. 1999. Monocyte-mediated tumoricidal activity via the tumor necrosis factor-related cytokine, TRAIL. J. Exp. Med. 189:1343. ally similar and share a common cell surface receptor; however, 20. Fanger, N. A., C. R. Maliszewski, K. Schooley, and T. S. Griffith. 1999. Human there is evidence that individual IFN subtypes bind to different dendritic cells mediate cellular apoptosis via tumor necrosis factor-related apop- sites of the type I IFNR and have different binding affinities, lead- tosis-inducing ligand (TRAIL). J. Exp. Med. 190:1155. 21. Zamai, L., M. Ahmad, I. M. Bennett, L. Azzoni, E. S. Alnemri, and B. Perussia. ing to the formation of distinct signaling complexes, which might 1998. Natural killer (NK) cell-mediated cytotoxicity: differential use of TRAIL be expected to differentially recruit downstream signaling path- and Fas ligand by immature and mature primary human NK cells. J. Exp. Med. ways (60, 62, 63). Moreover, evidence for the differential induc- 88:2375. ␣ ␣ 22. Kayagaki, N., N. Yamaguchi, M. Nakayama, H. Eto, K. Okumura, and H. Yagita. tion of IFN- -responsive genes in an IFN- subtype- and cell 1999. Type I interferons (IFNs) regulate tumor necrosis factor-related apoptosis- type-specific manner has been recently shown (64). Gene expres- inducing ligand (TRAIL) expression on human T cells: a novel mechanism for sion profiling of T cells stimulated with IFN-␣1, -␣2, or -␣21 the antitumor effects of type I IFNs. J. Exp. Med. 189:1451. 23. Kemp, T. J., B. D. Elzey, and T. S. Griffith. 2003. Plasmacytoid dendritic cell- found no difference in TRAIL/Apo-2L mRNA levels; however, derived IFN-␣ induces TNF-related apoptosis-inducing ligand/Apo-2L-mediated there was a Ͼ2-fold increase in TRAIL/Apo-2L mRNA in DC antitumor activity by human monocytes following CpG oligodeoxynucleotide after stimulation with IFN-␣2. This would suggest that tailoring stimulation. J. Immunol. 171:212. 24. Krug, A., S. Rothenfusser, V. Hornung, B. Jahrsdorfer, S. Blackwell, the contribution of TRAIL/Apo-2L, both at the level at which cells Z. K. Ballas, S. Endres, A. M. Krieg, and G. Hartmann. 2001. Identification of express TRAIL/Apo-2L and how much, in an antitumor immune CpG oligonucleotide sequences with high induction of IFN-␣/␤ in plasmacytoid response may be possible by using distinct IFN-␣ subtype(s). dendritic cells. Eur. J. Immunol. 31:2154. 25. Blackwell, S. E., and A. M. Krieg. 2003. CpG-A-induced monocyte IFN-␥-inducible protein-10 production is regulated by plasmacytoid dendritic cell-derived IFN-␣. J. Immunol. 170:4061. Acknowledgments 26. Siegal, F. P., N. Kadowaki, M. Shodell, P. A. Fitzgerald-Bocarsly, K. Shah, We thank Drs. Bennett Elzey, David Lubaroff, and Timothy Ratliff for S. Ho, S. Antonenko, and Y. J. Liu. 1999. The nature of the principal type 1 careful reading of the manuscript. We also acknowledge Linda Buckner for interferon-producing cells in human blood. Science 284:1835. 27. Cella, M., D. Jarrossay, F. Facchetti, O. Alebardi, H. Nakajima, A. Lanzavecchia, secretarial assistance. and M. Colonna. 1999. Plasmacytoid monocytes migrate to inflamed lymph nodes and produce large amounts of type I interferon. Nat. Med. 5:919. 28. Martin, J. H., and S. W. Edwards. 1993. Changes in mechanisms of monocyte/ References macrophage-mediated cytotoxicity during culture: reactive oxygen intermediates 1. Tokunaga, T., H. Yamamoto, S. Shimada, H. Abe, T. Fukuda, Y. Fujisawa, are involved in monocyte-mediated cytotoxicity, whereas reactive nitrogen in- Y. Furutani, O. Yano, T. Kataoka, T. Sudo, et al. 1984. Antitumor activity of termediates are employed by macrophages in tumor cell killing. J. Immunol. deoxyribonucleic acid fraction from Mycobacterium bovis BCG. I. Isolation, 150:3478. The Journal of Immunology 899

29. Kataoka, T., K. Takaku, J. Magae, N. Shinohara, H. Takayama, S. Kondo, and 47. Eerola, A. K., Y. Soini, and P. Paakko. 1999. Tumour infiltrating lymphocytes in K. Nagai. 1994. Acidification is essential for maintaining the structure and func- relation to tumour angiogenesis, apoptosis and prognosis in patients with large tion of lytic granules of CTL: effect of concanamycin A, an inhibitor of vacuolar cell lung carcinoma. Lung Cancer 26:73. type Hϩ-ATPase, on CTL-mediated cytotoxicity. J. Immunol. 153:3938. 48. Tormanen-Napankangas, U., Y. Soini, and P. Paakko. 2001. High number of 30. Griffith, T. S., W. A. Chin, G. C. Jackson, D. H. Lynch, and M. Z. Kubin. 1998. tumour-infiltrating lymphocytes is associated with apoptosis in non-small cell Intracellular regulation of TRAIL-induced apoptosis in human melanoma cells. lung carcinoma. APMIS 109:525. J. Immunol. 161:2833. 49. Nzula, S., J. J. Going, and D. I. Stott. 2003. Antigen-driven clonal proliferation, 31. Wang, Q., Y. Ji, X. Wang, and B. M. Evers. 2000. Isolation and molecular somatic hypermutation, and selection of B lymphocytes infiltrating human ductal characterization of the 5Ј-upstream region of the human TRAIL gene. Biochem. breast carcinomas. Cancer Res. 63:3275. Biophys. Res. Commun. 276:466. 50. Lanzavecchia, A. 1990. Receptor-mediated antigen uptake and its effect on an- 32. Hornung, V., S. Rothenfusser, S. Britsch, A. Krug, B. Jahrsdorfer, T. Giese, tigen presentation to class II-restricted T lymphocytes. Annu. Rev. Immunol. S. Endres, and G. Hartmann. 2002. Quantitative expression of Toll-like receptor 8:773. 1–10 mRNA in cellular subsets of human peripheral blood mononuclear cells and 51. Song, K., Y. Chen, R. Goke, A. Wilmen, C. Seidel, A. Goke, and B. Hilliard. sensitivity to CpG oligodeoxynucleotides. J. Immunol. 168:4531. 2000. Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) is an 33. Shibuya, H., T. Nagai, A. Ishii, K. Yamamoto, and S. Hirohata. 2003. Differential ϩ inhibitor of autoimmune inflammation and cell cycle progression. J. Exp. Med. regulation of Th1 responses and CD154 expression in human CD4 T cells by 191:1095. ␣ IFN- . Clin. Exp. Immunol. 132:216. 52. Brunner, T., R. J. Mogil, D. LaFace, N. J. Yoo, A. Mahboubi, F. Echeverri, 34. Takeda, K., T. Kaisho, and S. Akira. 2003. Toll-like receptors. Annu. Rev. Im- S. J. Martin, W. R. Force, D. H. Lynch, C. F. Ware, et al. 1995. Cell-autonomous munol. 21:335. Fas (CD95)/Fas-ligand interaction mediates activation-induced apoptosis in T- 35. Krieg, A. M., W. C. Gause, M. F. Gourley, and A. D. Steinberg. 1989. A role for cell hybridomas. Nature 373:441. endogenous retroviral sequences in the regulation of lymphocyte activation. 53. Brunner, T., N. J. Yoo, T. S. Griffith, T. A. Ferguson, and D. R. Green. 1996. J. Immunol. 143:2448. Regulation of CD95 ligand expression: a key element in immune regulation? 36. Krieg, A. M., J. Tonkinson, S. Matson, Q. Zhao, M. Saxon, L. M. Zhang, Behring Inst. Mitt. 97:161. U. Bhanja, L. Yakubov, and C. A. Stein. 1993. Modification of antisense phos- 54. Jeremias, I., I. Herr, T. Boehler, and K. M. Debatin. 1998. TRAIL/Apo-2-ligand- phodiester oligodeoxynucleotides by a 5Ј cholesteryl moiety increases cellular

induced apoptosis in human T cells. Eur. J. Immunol. 28:143. Downloaded from association and improves efﬁcacy. Proc. Natl. Acad. Sci. USA 90:1048. 55. Martinez-Lorenzo, M. J., M. A. Alava, S. Gamen, K. J. Kim, A. Chuntharapai, 37. Wiemann, B., and C. O. Starnes. 1994. Coley’s toxins, tumor necrosis factor and A. Pineiro, J. Naval, and A. Anel. 1998. Involvement of APO2 ligand/TRAIL in cancer research: a historical perspective. Pharmacol. Ther. 64:529. activation-induced death of Jurkat and human peripheral blood T cells. Eur. 38. Weiner, G. J., H. M. Liu, J. E. Wooldridge, C. E. Dahle, and A. M. Krieg. 1997. J. Immunol. 28:2714. Immunostimulatory oligodeoxynucleotides containing the CpG motif are effec- 56. Bonfoco, E., P. M. Stuart, T. Brunner, T. Lin, T. S. Grifﬁth, Y. Gao, H. Nakajima, tive as immune adjuvants in tumor antigen immunization. Proc. Natl. Acad. Sci. P. A. Henkart, T. A. Ferguson, and D. R. Green. 1998. Inducible nonlymphoid USA 94:10833. expression of Fas ligand is responsible for superantigen-induced peripheral de- 39. Heckelsmiller, K., K. Rall, S. Beck, A. Schlamp, J. Seiderer, B. Jahrsdorfer, letion of T cells. Immunity 9:711.

A. Krug, S. Rothenfusser, S. Endres, and G. Hartmann. 2002. Peritumoral CpG http://www.jimmunol.org/ DNA elicits a coordinated response of CD8 T cells and innate effectors to cure 57. Bauer, M., V. Redecke, J. W. Ellwart, B. Scherer, J. P. Kremer, H. Wagner, and G. B. Lipford. 2001. Bacterial CpG-DNA triggers activation and maturation of established tumors in a murine colon carcinoma model. J. Immunol. 169:3892. Ϫ ϩ 40. Heckelsmiller, K., S. Beck, K. Rall, B. Sipos, A. Schlamp, E. Tuma, human CD11c , CD123 dendritic cells. J. Immunol. 166:5000. S. Rothenfusser, S. Endres, and G. Hartmann. 2002. Combined dendritic cell- and 58. Kadowaki, N., S. Ho, S. Antonenko, R. W. Malefyt, R. A. Kastelein, F. Bazan, CpG oligonucleotide-based immune therapy cures large murine tumors that resist and Y. J. Liu. 2001. Subsets of human dendritic cell precursors express different chemotherapy. Eur. J. Immunol. 32:3235. Toll-like receptors and respond to different microbial antigens. J. Exp. Med. 41. Hafner, M., R. Zawatzky, C. Hirtreiter, W. A. Buurman, B. Echtenacher, 194:863. T. Hehlgans, and D. N. Mannel. 2001. Antimetastatic effect of CpG DNA me- 59. Kerkmann, M., S. Rothenfusser, V. Hornung, A. Towarowski, M. Wagner, diated by type I IFN. Cancer Res. 61:5523. A. Sarris, T. Giese, S. Endres, and G. Hartmann. 2003. Activation with CpG-A 42. Lonsdorf, A. S., H. Kuekrek, B. V. Stern, B. O. Boehm, P. V. Lehmann, and and CpG-B oligonucleotides reveals two distinct regulatory pathways of type I M. Tary-Lehmann. 2003. Intratumor CpG-oligodeoxynucleotide injection in- IFN synthesis in human plasmacytoid dendritic cells. J. Immunol. 170:4465.

duces protective antitumor T cell immunity. J. Immunol. 171:3941. 60. Marie, I., J. E. Durbin, and D. E. Levy. 1998. Differential viral induction of by guest on September 29, 2021 43. Stern, B. V., B. O. Boehm, and M. Tary-Lehmann. 2002. Vaccination with tumor distinct interferon-␣ genes by positive feedback through interferon regulatory peptide in CpG adjuvant protects via IFN-␥-dependent CD4 cell immunity. J. Im- factor-7. EMBO J. 17:6660. munol. 168:6099. 61. De Maeyer, E., and J. De Maeyer-Guignard. 1998. Type I interferons. Int. Rev. 44. Hahne, M., T. Renno, M. Schroeter, M. Irmler, L. French, T. Bornard, Immunol. 17:53. H. R. MacDonald, and J. Tschopp. 1996. Activated B cells express functional Fas 62. Hiscott, J., K. Cantell, and C. Weissmann. 1984. Differential expression of human ligand. Eur. J. Immunol. 26:721. interferon genes. Nucleic Acids Res. 12:3727. 45. Mariani, S. M., and P. H. Krammer. 1998. Differential regulation of TRAIL and 63. MacDonald, N. J., D. Kuhl, D. Maguire, D. Naf, P. Gallant, A. Goswamy, CD95 ligand in transformed cells of the T and B lymphocyte lineage. Eur. J. Im- H. Hug, H. Bueler, M. Chaturvedi, J. de la Fuente, et al. 1990. Different pathways munol. 28:973. mediate virus inducibility of the human IFN-␣1 and IFN-␤ genes. Cell 60:767. 46. Mariani, S. M., and P. H. Krammer. 1998. Surface expression of TRAIL/Apo-2 64. Hilkens, C. M., J. F. Schlaak, and I. M. Kerr. 2003. Differential responses to ligand in activated mouse T and B cells. Eur. J. Immunol. 28:1492. IFN-␣ subtypes in human T cells and dendritic cells. J. Immunol. 171:5255.