DOCSLIB.ORG

Thrombospondin-1: a Proatherosclerotic Protein Augmented by Hyperglycemia

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Thrombospondin-1: a Proatherosclerotic Protein Augmented by Hyperglycemia View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector From the Eastern Vascular Society Thrombospondin-1: A proatherosclerotic protein augmented by hyperglycemia Kristopher G. Maier, PhD,a,c Xuan Han,a,c Benjamin Sadowitz, MD,a,c Karen L. Gentile, MPS,b Frank A. Middleton, PhD,b and Vivian Gahtan, MD,a,c Syracuse, NY Objective: Diabetes is associated with a more aggressive form of atherosclerosis. Thrombospondin-1 (TSP-1), an extracellular matrix protein, is an acute-phase reactant that induces vascular smooth muscle (VSMC) migration and proliferation in areas of vascular injury and is also up-regulated in VSMCs exposed to hyperglycemia. This study tested the hypothesis that hyperglycemia amplifies the expression of genes induced by TSP-1 in VSMCs. Methods: Human aortic VSMCs were cultured in Dulbecco Modified Eagle’s Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1% antibiotics. Cells were used between passages three and five. VSMCs were preincubated in DMEM containing 0.2% FBS with 5 mM glucose (normoglycemia), 25 mM glucose (hyperglycemia), 25 mM mannose (osmotic control), TSP-1 (20 ␮g/mL), 25 mM glucose ؉ TSP-1 (20 ␮g/mL), or 25 mM mannose ؉ TSP-1 (20 ␮g/mL). Total RNA was extracted. Microarray analysis was performed and analyzed by analysis of variance. P < .05 was considered significant. Quantitative real-time polymerase chain reaction (rtPCR) was used to confirm selected up-regulated genes. Results: Microarray analysis revealed: (1) hyperglycemia altered 30 genes; (2) TSP-1 altered 212 genes, of which 8 were altered similarly to VSMCs exposed to 25 mM glucose; (3) TSP-1 up-regulated 10 genes associated with atherosclerosis and 4 others with diabetic vascular disease; (4) hyperglycemia combined with TSP-1 altered expression of 2822 genes. The three genes most up-regulated by TSP-1 in a normoglycemic environment were uridine 5=-diphosphoglucose (UDP-glucose) dehydrogenase (UGDH, 127%), transforming growth factor ␤-2 (TGF␤2, 116%), and hyaluronan synthase 2 (HAS2, 113%). Further, TSP-1 altered the expression of genes in 13 canonical pathways; however, when combined with hyperglycemia, 53 canonical pathways were affected. Conclusion: Quantitative rtPCR confirmed that genes in several of these pathways for TSP-1 and hyperglycemia combined with TSP-1 were up-regulated. These findings suggest that TSP-1 may be germane to the progression of atherosclerosis and may have a large effect with concurrent hyperglycemia. (J Vasc Surg 2010;51:1238-47.) Clinical Relevance: Diabetes is increasing rapidly in the United States. One of the characteristics of this disease is accelerated atherosclerosis. Thrombospondin-1 (TSP-1) has been shown to be involved in atherosclerosis and up-regulated in the tissues of diabetic patients and in animal models of diabetes. Among other actions, TSP-1 has been shown to increase DNA synthesis in vascular smooth muscle cells; however, the specific genes increased have not been completely identified. Further, the influence of hyperglycemia on TSP-1–induced gene expression has not been fully determined. The present study demonstrates that TSP-1 causes the up-regulation of several genes involved in atherosclerosis and diabetes and that hyperglycemia has a substantial effect on this process. Understanding the apparent complex interaction between hyperglycemia and TSP-1 will help identify therapeutic targets and aid in the development of anti-TSP-1 strategies to reduce vascular disease in diabetes. The incidence of type 2 diabetes, a major cause of exceed $200 billion by the year 2020.1 Further, the mor- death, is dramatically increasing in the United States.1 The tality rate ultimately associated with cardiovascular disease cost of diabetes to our health care system is estimated to in type 2 diabetes is approximately 65%.2 The most common cardiovascular complication of dia- From Division of Vascular Surgery and Endovascular Services,a and the b betes is atherosclerosis. Atherosclerosis is a complex process Department of Neuroscience and Physiology, SUNY Upstate Medical involving vascular remodeling in response to vessel injury. University; and the Department of Veterans Affairs VA Healthcare Net- work Upstate New York at Syracuse.c In early atherosclerosis, there are three distinct stages: This study was supported in part by a Bridge Funding grant from SUNY Upstate Medical University, a VA Merit Award, and a Lifeline Student 1. endothelial cell injury and dysfunction trigger medial Research Fellowship from the American Vascular Association. vascular smooth muscle cell (VSMC) proliferation and Competition of interest: none. migration across the internal elastic lamina to form the These data were presented at the Twenty-second meeting of the Eastern neointima; Vascular Society, September 18–20, 2008, Boston, Mass. 2. VSMC proliferation in the neointima3,4; and Correspondence: Vivian Gahtan, MD, SUNY Upstate Medical University College of Medicine, Division of Vascular Surgery and Endovascular 3. VSMCs switch to a synthetic phenotype and produce Services, 750 E Adams St, Syracuse, NY 13210 (e-mail: gahtanv@ extracellular matrix, which further expands the neoin- upstate.edu). tima.3,5,6 The editors and reviewers of this article have no relevant financial relation- ships to disclose per the JVS policy that requires reviewers to decline Mounting evidence indicates that glycoproteins, such review of any manuscript for which they may have a competition of as thrombospondin-1 (TSP-1), have an important role in interest. vascular remodeling by regulating the arterial response to 0741-5214/$36.00 3,5,6 Published by Elsevier Inc. on behalf of the Society for Vascular Surgery. injury. TSP-1 is a matricellular glycoprotein that is not doi:10.1016/j.jvs.2009.11.073 a part of the arterial wall structure.7 TSP-1 is increased 1238 JOURNAL OF VASCULAR SURGERY Volume 51, Number 5 Maier et al 1239 Table I. Sequences of the primers used for quantitative Table II. Genes are listed that were up-regulated by real-time polymerase chain reaction to confirm the thrombospondin-1 in vascular smooth muscle cells as canonical pathways determined by microarraya Gene symbol Sequence (5=-3=) Gene symbol Increase, % Gene description Disease 18 s rRNA UGDH 127.0 UDP-glucose dehydrogenase A Forward GTAACCCGTTGAACCCCATT TGFB2 116.0 Transforming growth factor-␤2A,D Reverse CCATCCAATCGGTAGTAGCG HAS2 113.0 Hyaluronan synthase 2 A, D TSP-1 SLC2A1 100.0 Solute carrier family 2 A Forward CTGCTCCAATGCCACAGTTC (facilitated glucose Reverse GGAGCCCTCACATCGGTTG transporter), member 1 TGF ␤2 TIMP3 76.0 Tissue inhibitor of A Forward AGAGTGCCTGAACAACGGATT metalloproteinase 3 Reverse CCATTCGCCTTCTGCTCTT SMAD7 66.0 MAD homolog 7 (Drosophila)A HAS2 THBS1 65.6 Thrombospondin-1 A Forward TCCAAAGAGTGTGGTTCCAA Serpine1 43.9 Serine (or cysteine) peptidase A Reverse GACAGGCTGAGGACGACTTT inhibitor, clade E, member 1 HES1 GART 43.0 Phosphoribosylglycineamide A Forward GGCTGGAGAGGCGGCTAA formyl transferase Reverse GAGAGGTGGGTTGGGGAGTT SRF 42.0 Serum response factor A, D FOS Forward AAAAGGAGAATCCGAAGGGAAA UDP-glucose, uridine 5=-diphosphoglucose. a Reverse GTCTGTCTCCGCTTGGAGTGTAT A standard cutoff of up-regulation by Ն30% was used. Genes are also UGDH identified by their association with atherosclerosis (A) or diabetes (D). Forward GCCAGGACTAAAAGAAGTGGTAG Reverse TGCACAATGCGTCTAGCACAA NFAT5 Previous studies have shown that hyperglycemia in- Forward CACCGCTTGTCTGACTCATT 16 Reverse GCCCAAGTCCCTCTACTCG creases the expression of TSP-1 in VSMCs. Further, PIK3CA TSP-1 is expressed in the arterial wall of animal models of Forward CCTGATCTTCCTCGTGCTGCTC type 2 diabetes and in tissues from patients with diabe- Reverse ATGCCAATGGACAGTGTTCCTCTT tes.17,18 Given that TSP-1 contributes to the development ROCK2 Forward TTGTTTTTCCTCAAAGCAGGA of atherosclerosis, TSP-1 may be important in this compli- Reverse CGCTGATCCGAGACCCT cation of diabetes. The role TSP-1 has in this complication SOS1 of diabetes warrants further study. Forward CGAGCCCTTTTCACTCAAGCAA The mechanisms of TSP-1–induced VSMC prolifera- Reverse CAGGAGGAGGGACAGGCACTTC tion, VSMC migration, and atherosclerosis in type 2 diabe- tes have not been well characterized. The goal of this project was to examine the early molecular changes in acutely in areas of arterial injury and is expressed in athero- VSMCs associated with hyperglycemia and TSP-1. In the sclerotic plaque.8-12 The term “matricellular” refers to present study, we hypothesized that hyperglycemia ampli- matrix proteins with a modular structure that do not play a fies the expression of genes induced by TSP-1 in VSMCs. part in vascular wall structural integrity. Rather, these pro- teins influence vascular physiology by binding other MATERIALS AND METHODS proteins of the extracellular matrix, cell-surface receptors, Materials. Purified TSP-1 (derived from human plate- proteases, and cytokines, thus allowing these proteins to lets) was obtained from Calbiochem (Gibbstown, NJ). exert multiple effects on cells.8,13 This type of complex Glucose and mannose were obtained from Sigma (St. interaction clarifies the mechanisms by which TSP-1 exerts Louis, Mo). different effects on cells such as having both antiadhesive Cell culture. Human VSMCs and human growth me- and proadhesive properties.8 dia were purchased from Cell Applications (San Diego, Findings that implicate the role of TSP-1 in the devel- Calif). Growth media was supplemented with 1% vol/vol opment of vascular remodeling are that TSP-1 causes
Load more

Recommended publications
  • A Diverse Host Thrombospondin-Type-1
    RESEARCH ARTICLE A diverse host thrombospondin-type-1 repeat protein repertoire promotes symbiont colonization during establishment of cnidarian-dinoflagellate symbiosis Emilie-Fleur Neubauer1, Angela Z Poole2,3, Philipp Neubauer4, Olivier Detournay5, Kenneth Tan3, Simon K Davy1*, Virginia M Weis3* 1School of Biological Sciences, Victoria University of Wellington, Wellington, New Zealand; 2Department of Biology, Western Oregon University, Monmouth, United States; 3Department of Integrative Biology, Oregon State University, Corvallis, United States; 4Dragonfly Data Science, Wellington, New Zealand; 5Planktovie sas, Allauch, France Abstract The mutualistic endosymbiosis between cnidarians and dinoflagellates is mediated by complex inter-partner signaling events, where the host cnidarian innate immune system plays a crucial role in recognition and regulation of symbionts. To date, little is known about the diversity of thrombospondin-type-1 repeat (TSR) domain proteins in basal metazoans or their potential role in regulation of cnidarian-dinoflagellate mutualisms. We reveal a large and diverse repertoire of TSR proteins in seven anthozoan species, and show that in the model sea anemone Aiptasia pallida the TSR domain promotes colonization of the host by the symbiotic dinoflagellate Symbiodinium minutum. Blocking TSR domains led to decreased colonization success, while adding exogenous *For correspondence: Simon. TSRs resulted in a ‘super colonization’. Furthermore, gene expression of TSR proteins was highest [email protected] (SKD); weisv@ at early time-points during symbiosis establishment. Our work characterizes the diversity of oregonstate.edu (VMW) cnidarian TSR proteins and provides evidence that these proteins play an important role in the Competing interests: The establishment of cnidarian-dinoflagellate symbiosis. authors declare that no DOI: 10.7554/eLife.24494.001 competing interests exist.
    [Show full text]
  • Thrombospondin-1, Human (ECM002)
    Thrombospondin-1, human recombinant, expressed in HEK 293 cells suitable for cell culture Catalog Number ECM002 Storage Temperature –20 C Synonyms: THBS1, THBS, TSP1, TSP This product is supplied as a powder, lyophilized from phosphate buffered saline. It is aseptically filled. Product Description Thrombospondin-1 (TSP1) is believed to play a role in The biological activity of recombinant human cell migration and proliferation, during embryogenesis thrombospondin-1 was tested in culture by measuring and wound repair.1-2 TSP1 expression is highly the ability of immobilized DTT-treated regulated by different hormones and cytokines, and is thrombospondin-1 to support adhesion of SVEC4-10 developmentally controlled. TSP1 stimulates the growth cells. of vascular smooth muscle cells and human foreskin fibroblasts. A combination of interferon and tumor Uniprot: P07996 necrosis factor inhibits TSP1 production in these cells.3 In endothelial cells, it controls adhesion and Purity: 95% (SDS-PAGE) migration as well as proliferation. It also exhibits antiangiogenic properties and regulates immune Endotoxin level: 1.0 EU/g FN (LAL) processes.4-5 TSP1 binds to various cell surface receptors, such as integrins and integrin-associated Precautions and Disclaimer protein CD47.1 It also plays a crucial role in This product is for R&D use only, not for drug, inflammatory processes and post-inflammatory tissue household, or other uses. Please consult the Safety dynamics.6 TSP1 has been used as a potential Data Sheet for information regarding hazards and safe regulator of tumor growth and metastasis.5 It is handling practices. upregulated in rheumatoid synovial tissues and might be associated with rheumatoid arthritis.7 Variants of this Preparation Instructions gene might be linked with increased risk of autism.8 Briefly centrifuge the vial before opening.
    [Show full text]
  • Matrix Mechanotransduction Mediated by Thrombospondin-1/Integrin/YAP in the Vascular Remodeling
    Matrix mechanotransduction mediated by thrombospondin-1/integrin/YAP in the vascular remodeling Yoshito Yamashiroa,1, Bui Quoc Thangb, Karina Ramireza,c, Seung Jae Shina,d, Tomohiro Kohatae, Shigeaki Ohataf, Tram Anh Vu Nguyena,c, Sumio Ohtsukie, Kazuaki Nagayamaf, and Hiromi Yanagisawaa,g,1 aLife Science Center for Survival Dynamics, Tsukuba Advanced Research Alliance, University of Tsukuba, Ibaraki 305-8577, Japan; bDepartment of Cardiovascular Surgery, University of Tsukuba, Ibaraki 305-8575, Japan; cPh.D. Program in Human Biology, School of Integrative and Global Majors, University of Tsukuba, Ibaraki 305-8577, Japan; dGraduate School of Life and Environmental Sciences, University of Tsukuba, Ibaraki 305-8577, Japan; eFaculty of Life Sciences, Kumamoto University, Kumamoto 862-0973, Japan; fGraduate School of Mechanical Systems Engineering, Ibaraki University, Ibaraki 316-8511, Japan; and gDivision of Biomedical Science, Faculty of Medicine, University of Tsukuba, Ibaraki 305-8577, Japan Edited by Kun-Liang Guan, University of California San Diego, La Jolla, CA, and accepted by Editorial Board Member Christine E. Seidman March 15, 2020 (received for review November 9, 2019) The extracellular matrix (ECM) initiates mechanical cues that highly context dependent, and extracellular regulators are not activate intracellular signaling through matrix–cell interactions. fully understood (6, 9). In blood vessels, additional mechanical cues derived from the pul- Thrombospondin-1 (Thbs1) is a homotrimeric glycoprotein satile blood flow and pressure play a pivotal role in homeostasis with a complex multidomain structure capable of interacting with and disease development. Currently, the nature of the cues from a variety of receptors such as integrins, cluster of differentiation the ECM and their interaction with the mechanical microenviron- (CD) 36, and CD47 (10).
    [Show full text]
  • Cell Surface-Localized Matrix Metalloproteinase-9 Proteolytically Activates TGF-␤ and Promotes Tumor Invasion and Angiogenesis
    Downloaded from genesdev.cshlp.org on September 23, 2021 - Published by Cold Spring Harbor Laboratory Press Cell surface-localized matrix metalloproteinase-9 proteolytically activates TGF-␤ and promotes tumor invasion and angiogenesis Qin Yu and Ivan Stamenkovic1 Molecular Pathology Unit, Massachusetts General Hospital, and Department of Pathology, Harvard Medical School, Boston, Massachusetts 02129 USA We have uncovered a novel functional relationship between the hyaluronan receptor CD44, the matrix metalloproteinase-9 (MMP-9) and the multifunctional cytokine TGF-␤ in the control of tumor-associated tissue remodeling. CD44 provides a cell surface docking receptor for proteolytically active MMP-9 and we show here that localization of MMP-9 to cell surface is required for its ability to promote tumor invasion and angiogenesis. Our observations also indicate that MMP-9, as well as MMP-2, proteolytically cleaves latent TGF-␤, providing a novel and potentially important mechanism for TGF-␤ activation. In addition, we show that MMP-9 localization to the surface of normal keratinocytes is CD44 dependent and can activate latent TGF-␤. These observations suggest that coordinated CD44, MMP-9, and TGF-␤ function may provide a physiological mechanism of tissue remodeling that can be adopted by malignant cells to promote tumor growth and invasion. [Key Words: MMP-9; CD44; TGF-␤; tumor angiogenesis; tumor invasion] Received September 10, 1999; revised version accepted December 7, 1999. The ability of tumor cells to establish a functional rela- nals transduced by integrins following engagement by tionship with their host tissue microenvironment and to ligands may provide tumor cells with critical survival utilize the local resources to their advantage are key fac- signals within the host tissue microenvironment (Frisch tors in determining tumor cell survival, local tumor de- and Ruoslahti 1997).
    [Show full text]
  • Extracellular Matrix Retention of Thrombospondin 1 Is Controlled by Its Conserved C-Terminal Region
    784 Research Article Extracellular matrix retention of thrombospondin 1 is controlled by its conserved C-terminal region Josephine C. Adams1,2,*, Amber A. Bentley1, Marc Kvansakul3,‡, Deborah Hatherley4 and Erhard Hohenester3 1Department of Cell Biology, Lerner Research Institute, and 2Department of Molecular Medicine, Cleveland Clinic Lerner College of Medicine, Cleveland Clinic Foundation, Cleveland, OH 44195, USA 3Division of Cell and Molecular Biology, Imperial College London, Biophysics Section, Blackett Laboratory, London, SW7 2AZ, UK 4Sir William Dunn School of Pathology, University of Oxford, South Parks Road, Oxford, OX1 3RE, UK *Author for correspondence (e-mail: [email protected]) ‡Present address: Structural Biology Division, The Walter and Eliza Hall Institute, 3050 Parkville, Victoria, Australia Accepted 3 December 2007 J. Cell Sci. 121, 784-795 Published by The Company of Biologists 2008 doi:10.1242/jcs.021006 Summary Thrombospondins (TSPs) are an evolutionarily ancient family domain or type 1 repeats. Using a novel mRFP-tagged TSP1 of extracellular calcium-binding glycoproteins. The five C-terminal trimer, we demonstrate that ECM retention involves mammalian TSPs collectively have important roles in the RGD site and a novel site in the L-lectin domain with angiogenesis and vascular biology, synaptogenesis, wound repair structural similarity to the ligand-binding site of cargo transport and connective tissue organisation. Their complex functions proteins. CD47 and ␤1 integrins are dispensable for ECM relate to the multiple postsecretion fates of TSPs that can involve retention, but ␤1 integrins enhance activity. These novel data endocytic uptake, proteolysis or retention within the advance concepts of the molecular processes that lead to ECM extracellular matrix (ECM).
    [Show full text]
  • Thrombospondin-1 Peptides Signaling by Thrombospondin-1
    b 1 Integrin- and Proteoglycan-Mediated Stimulation of T Lymphoma Cell Adhesion and Mitogen-Activated Protein Kinase Signaling by Thrombospondin-1 and Thrombospondin-1 Peptides Katherine E. Wilson,1 Zhuqing Li, Murat Kara, Kevin L. Gardner, and David D. Roberts2 Cell-cell and cell-matrix interactions play important regulatory roles in lymphocyte homeostasis. Thrombospondin-1 (TSP1) is a matricellular protein that differentially promotes the adhesion of resting and activated T cells. In this work, we show that adhesion b of Jurkat T cells on substrates coated with TSP1 or TSP1-derived peptides is mediated by 1 integrins, CD47, and heparan sulfate proteoglycans. Interactions with TSP1 or TSP1 peptides stimulated CD3-induced Ras activation and tyrosine phosphorylation of several T cell proteins. The signals from TSP1 and its derived peptides differentially synergized with activation of the TCR to induce phosphorylation of linker for activation of T cells (LAT) and extracellular signal-regulated kinase (ERK) 1/2, c-Jun N-terminal kinase, and p38 kinases. The phosphorylation of ERK in the presence of full-length TSP1 was transient and dependent b on a 1 integrin receptor. Interestingly, peptides derived from the type 1 repeats of TSP1 and a CD47-binding peptide from the carboxyl-terminal domain of TSP1 also stimulated mitogen-activated protein (MAP) kinase phosphorylation. Moreover, the TSP1 heparin-binding peptide synergized with Ab-ligated TCR to transduce signals to the nucleus, detected by activation of AP-1- and Elk-dependent transcription. This TSP1 peptide-dependent activation of AP-1 was inhibited by both heparin and the MAP/ERK kinase inhibitor PD98059, providing a functional link between adhesion molecule interaction and nuclear transactivation events via the MAP kinase pathways.
    [Show full text]
  • The Kinetics of C9, Vitronectin and the Terminal Complement
    CERTIFICATE OF ORIGINALITY I hereby declare that this submission is my own work and that, to the best of my knowledge and belief, it contains no material previously published or written by another person nor material which to a substantial extent has been accepted for the award of any other degree or diploma of a university or other institute of higher learning, except where due acknowledgement is made in the text. I also declare that the intellectual content of this thesis is the product of my own work, even though I may have received assistance from others on style, presentation and language expression. (Signee THE KINETICS OF C9, VITRONECTIN AND THE TERMINAL COMPLEMENT COMPLEX by James David Greenstein Department of Nephrology, Prince Henry Hospital, Sydney, Australia and Faculty of Medicine, University of New South Wales, Sydney, Australia Submitted/or the degree ofDoctor ofPhilosophy 1997 u i'J s vv 1 4 MAY 1998 LlBHARY A n ABSTRACT The primary pathways of complement activation converge to produce the terminal complement complex (TCC). Assembly of the TCC on a cell surface may result in the formation of a cytolytic pore, or membrane attack complex (MAC, i.e. C5b- 9(m)), composed of the five terminal complement components. Alternatively, complement activation in the plasma produces the soluble form, SC5b-9, which by the inclusion of regulatory proteins, vitronectin (S-protein) and clusterin, is rendered unable to disrupt cells. Activation of the complement system occurs in several autoimmune diseases although the role of the terminal complex in their pathogenesis remains uncertain. Measurement of its concentration in the plasma, or that of its components, provides limited information about terminal complement pathway activity.
    [Show full text]
  • Regulation of Innate Immune Responses by The
    UNIVERSIDAD COMPLUTENSE DE MADRID FACULTAD DE CIENCIAS BIOLÓGICAS Departamento de Bioquímica y Biología Molecular I REGULACIÓN DE LA RESPUESTA INMUNE INNATA POR LA PROTEÍNA DE MATRIZ EXTRACELULAR TROMBOESPONDINA-1 MEMORIA PARA OPTAR AL GRADO DE DOCTOR PRESENTADA POR María Gema Martín Manso Madrid, 2008 • ISBN: 978-84-692-2767-1 REGULATION OF INNATE IMMUNE RESPONSES BY THE EXTRACELLULAR MATRIX PROTEIN THROMBOSPONDIN-1 I REGULATION OF INNATE IMMUNE RESPONSES BY THE EXTRACELLULAR MATRIX PROTEIN THROMBOSPONDIN-1 A THESIS DISSERTATION SUBMITTED TO THE DEPARTMENT OF BIOCHEMISTRY AND MOLECULAR BIOLOGY UNIVERSIDAD COMPLUTENSE DE MADRID BY María Gema Martín Manso Laboratory of Pathology National Cancer Institute, NIH Bethesda II Dedicada a las niñas de mis ojos, María y Beatriz. A mi Juanma, a mi hermano Ricardo y a mis queridos padres. III Contents Acknowledgments……………………………………………XIV Abbreviations………………………………………………….XVII I A.INTRODUCCIÓN..............................................................1 1. Las Trombospondinas.…………………………………….2 1.1. La Trombospondina-1……………………………………..8 IV 1.1.1. Organización estructural ……………………………....8 1.1.1. A. Dominio N-terminal ……………………………….9 1.1.1. B. Dominio trimérico de oligomerización …………11 1.1.1. C. Dominio con el Factor de von Willebrand (vWF) de tipo C……………………………………………………...11 1.1.1. D. Dominios de repetición o TSRs………………...12 1.1.1. E Dominio de identidad………….………………….13 1.1.2. Principales sitios de expresión……………………….15 1.1.3. Conexiones moleculares……………………………….16 1.1.4. Funciones de Trombospondina-1…………………….18 1.1.4.A. Regulación de las Respuestas Inmunes………..26 1.1.4.B. Regulación de las Respuestas Inmunes Innatas………………………………………………………..30 1.1.4.C. Regulación de la Respuesta Inmune Innata mediada por macrófagos contra el tumor………………...35 V B.INTRODUCTION.............................................................37 1.
    [Show full text]
  • A Review of the Complement Membrane Attack Complex
    Downloaded from http://rstb.royalsocietypublishing.org/ on July 18, 2017 The mystery behind membrane insertion: a review of the complement membrane rstb.royalsocietypublishing.org attack complex Charles Bayly-Jones1,2, Doryen Bubeck3 and Michelle A. Dunstone1,2 1Department of Biochemistry and Molecular Biology, Biomedicine Discovery Institute, 2ARC Centre of Excellence Review in Advanced Molecular Imaging, Biomedicine Discovery Institute, Monash University, Clayton Campus, Melbourne, Victoria 3800, Australia Cite this article: Bayly-Jones C, Bubeck D, 3Department of Life Sciences, Imperial College London, South Kensington Campus, London SW2 7AZ, UK Dunstone MA. 2017 The mystery behind MAD, 0000-0002-6026-648X membrane insertion: a review of the complement membrane attack complex. Phil. The membrane attack complex (MAC) is an important innate immune effect- Trans. R. Soc. B 372: 20160221. or of the complement terminal pathway that forms cytotoxic pores on the http://dx.doi.org/10.1098/rstb.2016.0221 surface of microbes. Despite many years of research, MAC structure and mechanism of action have remained elusive, relying heavily on modelling and inference from biochemical experiments. Recent advances in structural Accepted: 8 November 2016 biology, specifically cryo-electron microscopy, have provided new insights into the molecular mechanism of MAC assembly. Its unique ‘split-washer’ One contribution of 17 to a discussion meeting shape, coupled with an irregular giant b-barrel architecture, enable an atyp- issue ‘Membrane pores: from structure and ical mechanism of hole punching and represent a novel system for which to assembly, to medicine and technology’. study pore formation. This review will introduce the complement terminal pathway that leads to formation of the MAC.
    [Show full text]
  • Type I Collagen Is a Molecular Target for Inhibition of Angiogenesis by Endogenous Thrombospondin-1
    Oncogene (2006) 25, 536–545 & 2006 Nature Publishing Group All rights reserved 0950-9232/06 $30.00 www.nature.com/onc ORIGINAL ARTICLE Type I collagen is a molecular target for inhibition of angiogenesis by endogenous thrombospondin-1 L Zhou1, JS Isenberg1, Z Cao and DD Roberts Laboratory of Pathology, National Cancer Institute, National Institutes of Health, Bethesda, MD, USA Three-dimensional explant cultures of muscle tissue were stat-Saslow et al., 1994; Tenan et al., 2000; Streit et al., used to characterize secreted proteins regulated by 2002).TSP1 gene expression is lost during progression endogenous levels of the angiogenesis modulator thrombo- of a number of cancer types, but TSP1 levels in some spondin (TSP)-1. Explants from TSP1 null mice exhibit tumor types remain high due to induced expression of enhanced neovascularization associated with increased TSP1 by stromal cells (reviewed in Lawler and Detmar, endothelial outgrowth but decreased outgrowth of peri- (2004)).Studies using transgenic mice confirmed that vascular smooth muscle cells . The absence of endogenous host endogenous TSP1 plays an important role in TSP1 did not diminish activation of latent transforming limiting neovascularization of tumors (Lawler et al., growth factor-b and moderately decreased matrixmetal- 2001; Hamano et al., 2004). loproteinase levels. However, significant changes in other Antiangiogenic fragments and peptides derived from secreted proteins were observed. Endogenous TSP1 TSP1 can inhibit angiogenesis and tumor growth in decreased mRNA levels for collagens Ia1, Ia2, and IIIa1 animals (Tolsma et al., 1993; Guo et al., 1997b; and laminin a4 and increased collagen IVa1 mRNA Bogdanov Jr et al., 1999; Iruela-Arispe et al., 1999; expression.
    [Show full text]
  • Association of Serum Cyr61 Levels with Peripheral Arterial Disease In
    Feng et al. Cardiovasc Diabetol (2020) 19:194 https://doi.org/10.1186/s12933-020-01171-9 Cardiovascular Diabetology ORIGINAL INVESTIGATION Open Access Association of serum Cyr61 levels with peripheral arterial disease in subjects with type 2 diabetes Bin Feng1, Guidong Xu2, Kangyun Sun2, Kaipeng Duan3, Bimin Shi1 and Nannan Zhang2* Abstract Background: The prevalence of peripheral artery disease (PAD) is obviously increased in patients with diabetes. Exist- ing evidence shows that cysteine-rich angiogenic inducer 61 (Cyr61), a 40-kD secreted protein, plays important roles in regulating cellular physiological processes. Recent studies have demonstrated a signifcant correlation between serum Cyr61 and atherosclerosis. However, the relationship between Cyr61 levels and PAD in patients with type 2 diabetes (T2DM) remains obscure. Methods: Data from a total of 306 subjects with T2DM were cross-sectionally analysed. The extent of PAD was deter- mined by using the Fontaine classifcation, which defnes four stages. We measured serum Cyr61 concentrations by ELISA in subjects with and without PAD at Fontaine’s stage II, III, or IV. Logistic regression models were used to examine the independent association of Cyr61 with PAD. Results: Out of the 306 subjects enrolled, 150 were free from PAD, while 156 had clinically signifcant PAD. In subjects with PAD, the prevalences of Fontaine classifcation stages II, III and IV were 48.7%, 32.1%, and 19.2%, respectively. Patients with more advanced PAD had signifcantly higher Cyr61 (P for trend < 0.001). The prevalence of PAD on the basis of severity increased with increasing Cyr61 quartiles (all P values for trends < 0.001), and the severity of PAD was positively correlated with Cyr61 quartiles (r 0.227, P 0.006).
    [Show full text]
  • A Diverse Host Thrombospondin-Type-1 Repeat Protein Repertoire Promotes Symbiont Colonization During Establishment of Cnidarian
    1 A diverse host thrombospondin-type-1 repeat protein repertoire promotes symbiont 2 colonization during establishment of cnidarian-dinoflagellate symbiosis 3 4 Authors: Emilie-Fleur Neubauer1, Angela Z. Poole2,3, Philipp Neubauer4, Olivier Detournay5, 5 Kenneth Tan3, Simon K. Davy1* & Virginia M. Weis3* 6 1School of Biological Sciences, Victoria University of Wellington, Wellington, New Zealand 7 2Department of Biology, Western Oregon University, Monmouth, OR, USA 8 3Department of Integrative Biology, Oregon State University, Corvallis, OR, USA 9 4Dragonfly Data Science, Wellington, New Zealand 10 5 Planktovie sas, 13190 Allauch, France 11 12 13 Keywords: TSR, thrombospondin, coral, symbiosis, Symbiodinium, innate immunity, Aiptasia 14 pallida 15 16 Corresponding author: 17 *Corresponding authors: [email protected] ; Tel: +64-4-4635573, [email protected]; 18 Tel: 1-541-737-4359 19 20 1 21 Abstract 22 23 The mutualistic endosymbiosis between cnidarians and dinoflagellates is mediated by complex 24 inter-partner signaling events, where the host cnidarian innate immune system plays a crucial 25 role in recognition and regulation of symbionts. To date, little is known about the diversity of 26 thrombospondin-type-1 repeat (TSR) domain proteins in basal metazoans and or their potential 27 role in regulation of cnidarian-dinoflagellate mutualisms. We reveal a large and diverse 28 repertoire of TSR proteins in seven anthozoan species, and show that in the model sea anemone 29 Aiptasia pallida the TSR domain promotes colonization of the host by the symbiotic 30 dinoflagellate Symbiodinium minutum. Blocking TSR domains led to decreased colonization 31 success, while adding exogenous TSRs resulted in a ‘super colonization’.
    [Show full text]