DOCSLIB.ORG

Molecular Characterization and Antibiotic Susceptibility of Edwardsiella Tarda

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Molecular Characterization and Antibiotic Susceptibility of Edwardsiella Tarda Uganda Journal of Agricultural Sciences ISSN: 1026 - 0919 (Print); 2410 - 6909 (Online) Volume 1 9 Number 1 (201 9 ) pp. 5 1 – 6 4 DOI: http://dx.doi.org/10.4314/ ujas .v1 9 i 1 . 5 © 201 9 National Agricultural Research Organisation https://www.ajol.info/index.php/ujas Licensed under a Creative Commons Attribution International Licence (4.0) (Available at www.ajol.info) Molecular C haracterization and Antibiotic S usceptibility of Edwardsiella tarda isolated from Farmed Nile Tilapia and African C atfish from Wakiso, Uganda M. Nantongo 1, 3, * , E. M. Mkupasi 1 , D. K. Byarugaba 2 , S. P . Wamala 2 , R. H. Mdegela 1 , J. K. Walakira 3 1 College of Veterinary and Medical Sciences, Sokoine University of Agriculture, Tanzania . 2 College of Veterinary Medicine, Animal Science and Biosecur ity, Makerere University . 3 National Fisheries Resources Research Institute - NARO, Uganda. *Corresponding author. [email protected] Abstract. This study was conducted to isolate and characterize Edwardsiella tarda ( E. tarda ) and assess its antimicrobial susceptibility. The bacterium was isolated in Wakiso District, Uganda, from symptomatic and asymptomatic Nile tilapia and African catfish raised in earthen ponds, tanks and cages between September 2016 and February 2017. The bacterium was then identified using conventional biochemical tests and API 20E test kits and characterized by sequencing 16S rRNA gene. The a ntibiotic susceptibility of 16 drugs was established using the Kirby BeurDisc diffusion method. Eight E. tarda isolates were identified using conventional biochemical tests but only one iso late was confirmed to be E. tarda by PCR. Phylogenetic analysis indicated a distant relationship with other 16S rRNA gene sequences retrieved from the GenBank. Six virulence genes ( CitC , muk , gadB , katB , esaV , and fimA ) that enhance bacterial survival and pathogenesis in the host were detected. The isolate registered low levels of antibiotic resistance as it was resistant only to Oxacillin, Vancomycin and Penicillin, to whic h it is intrinsically resistant. This impl ies low antibiotic usage in aquaculture in the area . Despite its low occurrence, presence of virulent genes in E. tarda indicates its potential to affect fish and human health . Keywords : Aquaculture, Edwardsiella tarda , Phylogeny, Virulence Introduction Aquaculture in Uganda is increasing with a production of about 101659 tonnes (FAO, 2018). However, intensification of fish farming to meet the increasing fish demand is challenged with disease outbreaks (Bondad - Reantaso et al ., 2005). There is insufficient information on the type of fish pathogens affecting aquaculture systems in Uganda thus making management of disease outbreaks difficult. Fish diseases are known to cause economic losses, reduced growth and increased cost of production (Faruk et al ., 2004).Bacteria affect the health of both wild and Nantongo et al .: Molecular characterization and antibiotic susceptibility of Edwardsiella tarda farmed fish and Edwardsiella species are known pathogens affecting fish populations worldwide (Austin and Austin, 1987; Abowei & Briyai, 2011; Park et al ., 2012). Edwardsiella tard a is the causative agent of Edwardsiellosis in fish, characterized by systemic hemorrhagic septicemia, internal abscesses and skin lesions (Ewing et al ., 1965). The bacterium is opportunistic in nature, and disease outbreaks occur when poor environmental c onditions prevail like overcrowding, poor water quality conditions, high organic content and high temperature (Mohanty and Sahoo, 2007). These factors influence the production of substances such as haemolysin, siderophore, superoxide dismutase, extracellul ar products and intracellular components that contribute to E. tarda pathogenicity and also expression of the two protein secretion systems that are involved in E. tarda virulence (Hossain et al ., 2010; Guijarro et al ., 2015; Huicab - Pech et al ., 2016). Occu rrence of Edwardsiella species in farmed Nile tilapia and African catfish has been reported in Uganda but partially characterized to genus level (Walakira et al ., 2014). Its prevalence in aquaculture systems is reported to vary with ponds not exceeding 5% , and tanks ranging between 50 - 70% (Mohanty and Sahoo, 2007; Joh et al ., 2010). Edwardsiella tarda is also zoonotic causing gastroenteritis and skin lesions in humans (Park et al ., 2012). Edwardsiella tarda is a facultative intracellular pathogen but its pa thogenicity in host cells is not clearly understood (Xu and Zhang, 2014).However, its virulence factors are reported to enhance the bacterial survival, and pathogenesis in hosts. Therefore, identification of virulence - related genes is essential for explain ing the pathogenesis of this bacterium. M ethods and Materials Th e study was conducted in Wakiso District, central Uganda (0 ° 4 ˊ S, 32 ° 45 ˊ E) (Fig ure 1) . Figure 1 . Map of Uganda showing the location of Wakiso District 52 Uganda Journal of Agricultural Sciences 19 (1) F ish farming is one of the main economic activities in the district. Samples were collected from 17 active commercial and subsistence fish farms with ponds, tanks and cages. The study applied a cross - sectional study design. Fish farms were purposively selec ted, the inclusion criteria being history of disease outbreaks during the study period and willingness of the farmer to participate in the study. Simple random sampling technique was applied to select clinically healthy fish, whereas in case of disease occ urrence, sick fish were purposively selected from the culture system. Healthy and sick fish samples were collected and transported in sterile containers to the laboratory between September 2016 and February 2017. Necropsy on fish samples was conducted to examine external and internal lesions following procedures described by Noga (2010). Samples of organs (liver, spleen and kidney) and swabs from gills and skin were collected and subjected to bacteriological examination following methods described by Noga (2010) Samples were homogenized, inoculated on Xylose Lysine Desoxycholate (XLD) agar plates and incubated at 28 ° C for 36 hours after which they were examined for primary cultures. A well - differentiated single black colony was picked and sub cultured on XL D agar to produce a pure culture which were subjected to various biochemical tests. Identification of the bacterium was done using cultural and morphological characteristics, conventional biochemical tests and Analytical Profile Index (API 20E) system (Bio Merieux, France) according to manufacturer’s instructions and the biochemical profiles of the isolates from API 20E were determined. The isolates were preserved in cryovials containing Brain Heart Infusion broth and glycerol and then stored in the freezer at ˗ 4 ° C until further testing. Genomic DNA extraction was done using QIAamp DNA mini kit (Qiagen) following manufacturer’s instructions. DNA concentration was measured using NanoDrop ND - 1000 spectrophotometer (Thermo Fisher Scientific, Inc). The extracted DNA was preserved and stored at ˗ 20 ° C. The 16S rRNA gene was amplified by Polymerase Chain Reaction (PCR) using the 16S universal bacteria primers 27F (5’ - AGAGTTTGATCCTGGCTCAG - 3’) and 1492R (5’ - GGTTACCTTGTTACGACTT - 3’) with the expected amplicon size of 1465bp (Lane 1991) from Invitroge n, Thermo Fisher Scientific (Waltham, MA USA). Polymerase Chain Reaction was performed in a thermo cycler (iCycler from Bio - Rad, United States of America). Each PCR reaction was performed in a final volume of 25µl containing 2.5µl of 10× reaction buffer (5 0 mM KCl, 75 mM Tris - HCl (pH 9.0), 2mM MgCl 2 , 20mM (NH 4 ) 2 SO 4 ), 0.5µl 10 mM deoxyribonucleotide mix, 0.2µl of Taq DNA polymerase, 1µl 10 mM of each forward and reverse primer, 2µl of DNA template and 16.8µl of sterile ultrapure water. PCR conditions include d initial denaturation at 94 ° C for three minutes, followed by 30 cycles of amplification as follows; denaturation at 94 ° C for 30 seconds, annealing at 56 ° C for 30 seconds and extension at 72 ° C for two minutes. This was followed by a final extension step at 72 ° C for five minutes and left to stand at 4 ° C until collected for further analysis. The PCR products were analysed on 1% agarose gel (Ultrapure agarose from Invitrogen, Thermos Fisher Scientific) at 100Volts for 60 minutes. The amplified DNA on the gel was visualized using Safe Imager™ from Invitrogen and bands of interest excised using a scalpel blade for gel purification. ChemiDoc™ XRS Molecular image (Bio Rad) was used for viewing and capturing gel pictures. The purified PCR products were sequenced wi th 16S 27F and 16S 1492R universal bacteria primers by Sanger sequencing techniques at GATC Biotech, Germany using ABI genetic analyser . 53 Nantongo et al .: Molecular characterization and antibiotic susceptibility of Edwardsiella tarda Both the forward and reverse sequences of the 16S rRNA gene were edited in Bioedit to generate a consensus sequence. B asic Local Alignment Search Tool (BLAST) searches were carried out in GenBanks particularly the National Centre for Biotech Information (NCBI). Related sequences were obtained and multiple sequence alignments were performed using ClustalW algorithm. The al ignments were used to construct a phylogenetic tree using MEGA 7.0 (Kumar et al ., 2016) using the Neighbour - Joining method (Saitou and Nei, 1987). The gene sequences used in phylogenetic analysis are shown in Table 1. Table 1 . Isolates whose sequences were used in phylogenetic analysis SN
Load more

Recommended publications
  • Evaluation of a Loop-Mediated Isothermal Amplification Method For
    Journal of Microbiological Methods 63 (2005) 36–44 www.elsevier.com/locate/jmicmeth Evaluation of a loop-mediated isothermal amplification method for rapid detection of channel catfish Ictalurus punctatus important bacterial pathogen Edwardsiella ictaluri Hung-Yueh YehT, Craig A. Shoemaker, Phillip H. Klesius United States Department of Agriculture, Agricultural Research Service, Aquatic Animal Health Research Unit, Post Office Box 952, Auburn, AL 36831-0952, USA Received 23 November 2004; received in revised form 17 February 2005; accepted 17 February 2005 Available online 31 March 2005 Abstract Channel catfish Ictalurus punctatus infected with Edwardsiella ictaluri results in $40–50 million annual losses in profits to catfish producers. Early detection of this pathogen is necessary for disease control and reduction of economic loss. In this communication, the loop-mediated isothermal amplification method (LAMP) that amplifies DNA with high specificity and rapidity at an isothermal condition was evaluated for rapid detection of E. ictaluri. A set of four primers, two outer and two inner, was designed specifically to recognize the eip18 gene of this pathogen. The LAMP reaction mix was optimized. Reaction temperature and time of the LAMP assay for the eip18 gene were also optimized at 65 8C for 60 min, respectively. Our results show that the ladder-like pattern of bands sizes from 234 bp specifically to the E. ictaluri gene was amplified. The detection limit of this LAMP assay was about 20 colony forming units. In addition, this optimized LAMP assay was used to detect the E. ictaluri eip18 gene in brains of experimentally challenged channel catfish. Thus, we concluded that the LAMP assay can potentially be used for rapid diagnosis in hatcheries and ponds.
    [Show full text]
  • Edwardsiellosis, an Emerging Zoonosis of Aquatic Animals
    Editorial provided by ZENODO View metadata, citation and similar papers at core.ac.uk CORE brought to you by Edwardsiellosis, an Emerging Zoonosis of Aquatic Animals Santander M Javier* The Biodesign Institute, Center for Infectious Diseases and Vaccinology. Arizona State University. * Corresponding author Biohelikon: Immunity & Diseases 2012, 1(1): http://biohelikon.org © 2012 by Biohelikon Abstract Edwardsiellosis, an Emerging Zoonosis of Aquatic Animals References Abstract Zoonotic diseases from aquatic animals have not received much attention even though contact between humans and aquatic animals and their pathogens have increased significantly in the last several decades. Currently, Edwardsiella tarda, the causative agent of Edwardsiellosis in humans, is considered an emerging gastrointestinal zoonotic pathogen, which is acquired from aquatic animals. However, there is little information about E. tarda pathogenesis in mammals. In contrast, significant progress has been made regarding to E. tarda fish pathogenesis. Undoubtedly, research about E. tarda pathogenesis in mammals is urgent, not only to evaluate the safety of current E. tarda live attenuated vaccines for the aquaculture industry but also to prevent emerging E. tarda human infections. Return to top Edwardsiellosis, an Emerging Zoonosis of Aquatic Animals Human food and health are inextricably linked to animal production. This link between humans and animals is particularly close in developing regions of the world where animals provide transportation, clothing, and food (meat, eggs and dairy). In both developing and industrialized countries, this proximity with farm animals can lead to a serious risk to public health with severe economic consequences. A number of diseases are transmitted from animals to humans (zoonotic diseases). According to the World Health Organization (WHO), about 75% of the new infectious diseases affecting humans during the past 10 years have been caused by pathogens originating from animals and derivative products.
    [Show full text]
  • Edwardsiella Tarda
    Zambon et al. Journal of Medical Case Reports (2016) 10:197 DOI 10.1186/s13256-016-0975-7 CASE REPORT Open Access Near-drowning-associated pneumonia with bacteremia caused by coinfection with methicillin-susceptible Staphylococcus aureus and Edwardsiella tarda in a healthy white man: a case report Lucas Santos Zambon*, Guilherme Nader Marta, Natan Chehter, Luis Guilherme Del Nero and Marina Costa Cavallaro Abstract Background: Edwardsiella tarda is an Enterobacteriaceae found in aquatic environments. Extraintestinal infections caused by Edwardsiella tarda in humans are rare and occur in the presence of some risk factors. As far as we know, this is the first case of near-drowning-associated pneumonia with bacteremia caused by coinfection with methicillin-susceptible Staphylococcus aureus and Edwardsiella tarda in a healthy patient. Case presentation: A 27-year-old previously healthy white man had an episode of fresh water drowning after acute alcohol consumption. Edwardsiella tarda and methicillin-sensitive Staphylococcus aureus were isolated in both tracheal aspirate cultures and blood cultures. Conclusion: This case shows that Edwardsiella tarda is an important pathogen in near drowning even in healthy individuals, and not only in the presence of risk factors, as previously known. Keywords: Near drowning, Edwardsiella tarda, Pneumonia, Bacterial, Bacteremia Background Lung infections are one of the most serious complica- The World Health Organization defines drowning as tions occurring in victims of drowning [6]. They may “the process of experiencing respiratory impairment represent a diagnostic challenge as the presence of water from submersion/immersion in liquid” [1] emphasizing in the lungs hinders the interpretation of radiographic the importance of respiratory system damage in drown- images [5].
    [Show full text]
  • Edwardsiellosis
    EAZWV Transmissible Disease Fact Sheet Sheet No. 80 EDWARDSIELLOSIS ANIMAL TRANS- CLINICAL FATAL TREATMENT PREVENTION GROUP MISSION SIGNS DISEASE? & CONTROL AFFECTED Freshwater Unclear Vary with the Not necessarily Systemic Stress reduction and marine species: antibiotic (including good fish, ulcerative treatment, water quality), especially in dermatitis, improvement hygiene warm fibrinous of water environment peritonitis, quality, stress granulomatous reduction lesions in multiple organs Fact sheet compiled by Last update Willem Schaftenaar, Head of the Veterinary Januari 2009 Dept. of the Rotterdam Zoo, The Netherlands Fact sheet reviewed by Dr. O. Haenen, Head of Fish Diseases Laboratory, CVI-Lelystad, P.O. Box 65, 8200 AB Lelystad, The Netherlands. Phone: + 31 320 238 352 Dr. T. Wahli, National Fish Disease Laboratory, Centre for Fish and Wildlife Health, Institute of Animal Pathology, University of Berne, Länggassstr. 122, CH-3012 Berne, Switzerland. Phone: +41 31 631 24 61 Susceptible animal groups Fresh water and marine fish. Most diseases seem to occur at higher temperatures. Examples of affected species are channel catfish, Chinook salmon, Japanese eel, striped bass, striped mullet, Japanese flounder, yellowtail, tilapia, goldfish, carp, red sea bream. Reptiles and amphibians are common carriers. Causative organism Edwardsiella tarda. Bacterium, member of the family Enterobacteriaceae, facultatively anaerobic Gram negative motile rod. Zoonotic potential Yes. E. tarda is a zoonotic problem and is a serious cause of gastroenteritis in humans. It has also been implicated in meningitis, biliary tract infections, peritonitis, liver and intra-abdominal abscesses, wound infections and septicaemia. It has been often isolated from catfish fillets in processing plants and can spread to man via the oral route or a penetrating wound.
    [Show full text]
  • International Journal of Systematic and Evolutionary Microbiology (2016), 66, 5575–5599 DOI 10.1099/Ijsem.0.001485
    International Journal of Systematic and Evolutionary Microbiology (2016), 66, 5575–5599 DOI 10.1099/ijsem.0.001485 Genome-based phylogeny and taxonomy of the ‘Enterobacteriales’: proposal for Enterobacterales ord. nov. divided into the families Enterobacteriaceae, Erwiniaceae fam. nov., Pectobacteriaceae fam. nov., Yersiniaceae fam. nov., Hafniaceae fam. nov., Morganellaceae fam. nov., and Budviciaceae fam. nov. Mobolaji Adeolu,† Seema Alnajar,† Sohail Naushad and Radhey S. Gupta Correspondence Department of Biochemistry and Biomedical Sciences, McMaster University, Hamilton, Ontario, Radhey S. Gupta L8N 3Z5, Canada [email protected] Understanding of the phylogeny and interrelationships of the genera within the order ‘Enterobacteriales’ has proven difficult using the 16S rRNA gene and other single-gene or limited multi-gene approaches. In this work, we have completed comprehensive comparative genomic analyses of the members of the order ‘Enterobacteriales’ which includes phylogenetic reconstructions based on 1548 core proteins, 53 ribosomal proteins and four multilocus sequence analysis proteins, as well as examining the overall genome similarity amongst the members of this order. The results of these analyses all support the existence of seven distinct monophyletic groups of genera within the order ‘Enterobacteriales’. In parallel, our analyses of protein sequences from the ‘Enterobacteriales’ genomes have identified numerous molecular characteristics in the forms of conserved signature insertions/deletions, which are specifically shared by the members of the identified clades and independently support their monophyly and distinctness. Many of these groupings, either in part or in whole, have been recognized in previous evolutionary studies, but have not been consistently resolved as monophyletic entities in 16S rRNA gene trees. The work presented here represents the first comprehensive, genome- scale taxonomic analysis of the entirety of the order ‘Enterobacteriales’.
    [Show full text]
  • Current State of Bacteria Pathogenicity and Their Relationship with Host and Environment in Tilapia Oreochromis Niloticus
    e Rese tur arc ul h c & a u D q e A v e f l o o Huicab-Pech et al., J Aquac Res Development 2016, 7:5 l p a m n Journal of Aquaculture r e u n o t DOI: 10.4172/2155-9546.1000428 J ISSN: 2155-9546 Research & Development Research Article OpenOpen Access Access Current State of Bacteria Pathogenicity and their Relationship with Host and Environment in Tilapia Oreochromis niloticus Huicab-Pech ZG1, Landeros-Sánchez C1*, Castañeda-Chávez MR2, Lango-Reynoso F2, López-Collado CJ1 and Platas Rosado DE1 1Post Graduate College, Campus Veracruz, via Paso De Ovejas, Tepetates, Municipality of Manlius, Veracruz, Mexico 2Technological Institute of Boca Del Rio, Division of Graduate Studies and Research, Boca Del Rio, Veracruz, Mexico Abstract Oreochromis niloticus (Nile tilapia) is a species having tolerance to low water quality and disease, yet in recent years its cultivation has been faced with problems related to infections with bacteria such as Aeromonas spp., Streptococcus spp., Edwardsiella spp. and Francisella spp., each characterized by mortality between 15% and 90% of aquaculture production. These economic losses are associated with poor management practices, minimal producer knowledge of disease control, and the maintenance of overly high densities; which they are directly related to electricity consumption, land use and water management, inputs of raw materials, and manpower for operating links in the value-chain. Mortalities are measured according to the degree of pathogenicity, which depends on the alteration and progression of physiological conditions of the host under the influence of environmental factors, health status and pathogen virulence.
    [Show full text]
  • Intraspecific Variability of Edwardsiella Piscicida and Cross-Protective Efficacy of A
    Mississippi State University Scholars Junction Theses and Dissertations Theses and Dissertations 8-1-2020 Intraspecific ariabilityV of Edwardsiella piscicida and Cross- Protective Efficacy of a Live-Attenuated Edwardsiella ictaluri Vaccine in Channel and Channel × Blue Hybrid Catfi Adrian Lopez Porras Follow this and additional works at: https://scholarsjunction.msstate.edu/td Recommended Citation Lopez Porras, Adrian, "Intraspecific ariabilityV of Edwardsiella piscicida and Cross-Protective Efficacy of a Live-Attenuated Edwardsiella ictaluri Vaccine in Channel and Channel × Blue Hybrid Catfi" (2020). Theses and Dissertations. 2789. https://scholarsjunction.msstate.edu/td/2789 This Graduate Thesis - Open Access is brought to you for free and open access by the Theses and Dissertations at Scholars Junction. It has been accepted for inclusion in Theses and Dissertations by an authorized administrator of Scholars Junction. For more information, please contact [email protected]. Template C with Schemes v4.1 (beta): Created by L. 11/15/19 Intraspecific Variability of Edwardsiella piscicida and Cross-Protective Efficacy of a Live-Attenuated Edwardsiella ictaluri Vaccine in Channel and Channel × Blue Hybrid Catfish By TITLE PAGE Adrian Lopez Porras Approved by: David J. Wise (Major Professor) Suja Aarattuthodiyil (Co-Major Professor) Matthew J. Griffin (Thesis Director) Thomas G. Rosser (Committee Member) Kevin M. Hunt (Graduate Coordinator) George M. Hopper (Dean, College of Forest Resources) A Thesis Submitted to the Faculty of Mississippi State University in Partial Fulfillment of the Requirements for the Degree of Master of Science in Wildlife, Fisheries and Aquaculture in the Department of Wildlife, Fisheries and Aquaculture Mississippi State, Mississippi August 2020 Copyright by COPYRIGHT PAGE Adrian Lopez Porras 2020 Name: Adrian Lopez Porras ABSTRACT Date of Degree: August 7, 2020 Institution: Mississippi State University Major Field: Wildlife, Fisheries and Aquaculture Major Professor: David J.
    [Show full text]
  • Cdc 7690 DS1.Pdf
    Dept* ENTEROBACTERIACEAE TAXONOMY AND NOMENCLATURE W. H. Ewing December 1966 U.S. DEPARTMENT OF HEALTH, EDUCATION, AND WELFARE P u b l ic h e a l t h s e r v ic e BUREAU OF DISEASE PREVENTION AND ENVIRONMENTAL CONTROL N A T IO N A L COMMUNICABLE DISEASE CENTER Atlanta, Georgia 30333 CDCCfNTFRSFon OlS€*Si CONI not. INFORMATION CENTER ¿SWIC*, c D C Pn" f o r m aT. o W c Ï' n t e r 5 ■ ■ ■ DEPARTMENT OF HEALTH AND HUMAN SERVICES 134309 Public Health Service Centers for Disease Control Atlanta, Georgia 30333 QW 140 E95e 1966 Ewing, William H. (William Howell), 1914- QW 140 E95e 1966 Ewing, William H. (William Howell), 1914- Enterobacteriaceae 134309 DATE ISSUED TO ENTEROBACTERIACEAE TAXONOMY AMD NOMENCLATURE W. H. Ewing Enteric Bacteriology Laboratories National Communicable Disease Center, Atlanta, Georgia 30333 Definition (revised) of the family Enterobacteriaceae The family Enterobacteriaceae consists of gram negative, asporogenous, rod-shaped bacteria that grow well on artificial media. Some species are atrichous, and nonmotile variants of motile species also may occur. Motile forms are peritrichously flagellated. Nitrates are reduced to nitrites, and glucose is fermented with the formation of acid or of acid and gas. The indophenol oxidase test is negative and neither pectate nor alginate is liquefied. TAXONOMY At the outset a differentiation should be made between what is meant by Taxonomy and what is meant by Nomenclature. While these two fields or areas are closely related, a clear line of distinction may be drawn between them. One may establish a taxonomic system for a group of related microorganisms and use the letters of an alphabet, Arabic or Roman numerals, the names of places, or practically any other kind of designation one wishes for the dif­ ferent biotypes, serotypes, bacteriophage types, etc.
    [Show full text]
  • Edwardsiella Tarda Infection Triggering Acute Relapse in Pediatric Crohn’S Disease
    Western University Scholarship@Western Paediatrics Publications Paediatrics Department 3-2019 Edwardsiella tarda Infection Triggering Acute Relapse in Pediatric Crohn’s Disease A K Li Western University M Barton Western University J A Delport London Health Sciences Centre D Ashok Western University Follow this and additional works at: https://ir.lib.uwo.ca/paedpub Part of the Pediatrics Commons Citation of this paper: Li, A K; Barton, M; Delport, J A; and Ashok, D, "Edwardsiella tarda Infection Triggering Acute Relapse in Pediatric Crohn’s Disease" (2019). Paediatrics Publications. 376. https://ir.lib.uwo.ca/paedpub/376 Hindawi Case Reports in Infectious Diseases Volume 2019, Article ID 2094372, 3 pages https://doi.org/10.1155/2019/2094372 Case Report Edwardsiella tarda Infection Triggering Acute Relapse in Pediatric Crohn’s Disease A. K. Li,1 M. Barton,1 J. A. Delport,2 and D. Ashok 1 1Department of Pediatrics, Western University, London, Ontario, Canada N6A 3K7 2Pathology and Laboratory Medicine, London Health Sciences Centre, London, Ontario, Canada N6A 5W9 Correspondence should be addressed to D. Ashok; [email protected] Received 28 August 2018; Revised 26 November 2018; Accepted 20 December 2018; Published 20 March 2019 Academic Editor: Raul Colodner Copyright © 2019 A. K. Li et al. (is is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Crohn’s disease exacerbations can often be associated with bacterial infections causing gastroenteritis. We report a child who experienced exacerbation of his Crohn’s disease associated with a positive stool culture for Edwardsiella tarda (E.
    [Show full text]
  • Edwardsiella Infections of Fishes
    University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln US Fish & Wildlife Publications US Fish & Wildlife Service 1985 EDWARDSIELLA INFECTIONS OF FISHES G. L. Bullock U.S. Fish and Wildlife Service Roger L. Herman U.S. Fish and Wildlife Service Follow this and additional works at: https://digitalcommons.unl.edu/usfwspubs Part of the Aquaculture and Fisheries Commons Bullock, G. L. and Herman, Roger L., "EDWARDSIELLA INFECTIONS OF FISHES" (1985). US Fish & Wildlife Publications. 132. https://digitalcommons.unl.edu/usfwspubs/132 This Article is brought to you for free and open access by the US Fish & Wildlife Service at DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in US Fish & Wildlife Publications by an authorized administrator of DigitalCommons@University of Nebraska - Lincoln. EDWARDS/ELLA INFECTIONS OF FISHES G. L. Bullock and Roger L. Herman u.s. Fish and Wildlife Service National Fisheries Center-Leetown National Fish Health Research Laboratory Box 700, Kearneysville, West Virginia 25430 FISH DISEASE LEAFLET 71 UNITED STATES DEPARTMENT OF THE INTERIOR Fish and Wildlife Service Division of Fishery Research Washington, D.C. 20240 1985 Introduction ing or erratic pattern. Gross external lesions vary with species. Channel catfish often develop small, cutane­ The genus Edwardsiella was suggested by Ewing et ous ulcerations; in advanced cases, however, larger al. (1965) to encompass a group of enteric bacteria depigmented areas mark the sites of deep muscle generally described under vernacular names such as abscesses (Meyer and Bullock 1973). The flounder paracolon. The type species is E. tarda, which is an Para/iehthys olivaeeus and the cichlid Ti/apia nUotiea opportunistic pathogen of many animals.
    [Show full text]
  • Oxidative Status and Intestinal Health of Gilthead Sea Bream (Sparus Aurata) Juveniles Fed Diets with Diferent ARA/EPA/DHA Ratios R
    www.nature.com/scientificreports OPEN Oxidative status and intestinal health of gilthead sea bream (Sparus aurata) juveniles fed diets with diferent ARA/EPA/DHA ratios R. Magalhães1,2*, I. Guerreiro1, R. A. Santos1,2, F. Coutinho1, A. Couto1,2, C. R. Serra1, R. E. Olsen3, H. Peres1,2 & A. Oliva‑Teles1,2 The present work assessed the efects of dietary ratios of essential fatty acids, arachidonic (ARA), eicosapentaenoic (EPA) and docosahexaenoic acid (DHA), on liver and intestine oxidative status, intestinal histomorphology and gut microbiota of gilthead sea bream. Four isoproteic and isolipidic plant‑based diets were formulated containing a vegetable oil blend as the main lipid source. Diets were supplemented with ARA/EPA/DHA levels (%DM) equivalent to: 2%:0.2%:0.1% (Diet A); 1.0%:0.4%:0.4% (Diet B); 0%:0.6%:0.6% (Diet C); 0%:0.3%:1.5% (Diet D) and tested in triplicate groups for 56 days. Lipid peroxidation was higher in fsh fed diets C and D while no diferences were reported between diets regarding total, oxidized, and reduced glutathione, and oxidative stress index. Glutathione reductase was higher in fsh fed diet A than diets C and D. No histological alterations were observed in the distal intestine. Lower microbiota diversity was observed in intestinal mucosa of fsh fed diet C than A, while diets C and D enabled the proliferation of health‑promoting bacteria from Bacteroidetes phylum (Asinibacterium sp.) and the absence of pathogenic species like Edwardsiella tarda. Overall, results suggest that a balance between dietary ARA/EPA + DHA promotes gilthead sea bream juveniles’ health however higher dietary content of n‑3 LC‑PUFA might limited the presence of microbial pathogens in intestinal mucosa.
    [Show full text]
  • Isolation and Identification of Edwardsiella Tarda from Lake Zeway and Langano, Southern Oromia, Ethiopia
    Aquacu nd ltu a r e s e J i o r u e r h n s a i l F Fisheries and Aquaculture Journal Kebede and Habtamu T, Fish Aqua J 2016, 7:4 ISSN: 2150-3508 DOI: 10.4172/2150-3508.1000184 Research Article Open Access Isolation and Identification of Edwardsiella tarda from Lake Zeway and Langano, Southern Oromia, Ethiopia Kebede B1* and Habtamu T2 1Wacale District Livestock and Fisheries Development Office, Oromia, Ethiopia 2Veterinary Drug and Animal Feed Administration and Control Authority, Ethiopia *Corresponding author: Bedaso Kebede, Veterinary Drug and Animal Feed Administration and Control Authority, Ministry of Livestock and Fisheries Development, Addis Ababa, Oromia 251, Ethiopia, Tel: +251913136824; E-mail: [email protected] Received date: July 25, 2016; Accepted date: October 03, 2016; Published date: October 10, 2016 Copyright: © 2016 Kebede B, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Abstract A study was carried out from October, 2009 to April, 2010 with the objective of isolating Edwardsiella tarda an important fish pathogen from fish harvested for human consumption from Lake Zeway and Langanoo. A total of 372 tissue samples (three from each fish) comprising liver, intestine and kidney were collected from 124 fish (Clarias gariepinus and Oreochromis niloticus originated from Lake Langanoo and Zeway. Distribution of E. tarda infection among the three organs examined indicated that E. tarda was isolated most frequently from liver (6.5%) followed by intestine (2.4%) and kidney (0.8%) with significant difference among organs.
    [Show full text]