Screening for C-Di-GMP Effector Molecules in Vibrio Cholerae

Screening for c-di-GMP effector molecules in Vibrio cholerae

Rita Marques Raimundo

Thesis to obtain the Master of Science Degree in Microbiology

Supervisor: Dr. Sören Abel Co-Supervisor: Prof. Dr. Isabel Maria De Sá Correia Leite de Almeida

Examination Committee

Chairperson: Prof. Dr. Ana Cristina Anjinho Madeira Viegas Supervisor: Prof. Dr. Isabel Maria De Sá Correia Leite de Almeida Member of the Committee: Prof. Dr Jorge Humberto Gomes Leitão

October, 2019

1 Preface

The work presented in this thesis was performed within the Infection Biology research group (InfBio) at the Faculty of Farmacy (IFA) at the University of Tromsø – The Arctic University of Norway (UiT), during the period of September 2018-July 2019, under the supervision of Dr. Sören Abel and co- supervision of Dr. Bhupender Singh, and within the frame of the Erasmus exchange program. The thesis was co-supervised at Instituto Superior Técnico by Prof. Isabel de Sá Correia.

Declaration

I declare that this document is an original work of my own authorship and that it fulfils all the requirements of the Code of Conduct and Good Practices of the Universidade de Lisboa.

3 Acknowledgments

First and foremost, I would like to thank my two supervisors – Dr. Sören Abel and Dr. Bhupender Singh – for guidance through this year, both with the lab work and writing process. Your devotion to your work and expertise have been inspiring. Your patience to teach me science and to deal with me have been fundamental. Thank you for your willingness to help in spite of being busy.

I would also like to thank to all the other members of the Institute of Infection Biology (InfBio) that I had the pleasure to work with: Oyvind, Merete, Dr. Silje, Christina, Dr. Aaron, Dr. Anel and my Master’s colleagues, Aimé and Natasha.

I am also grateful to Dr. Jack-Ansgar Bruun and Toril Anne Grønset for assisting me with the protein identification within the Mass Spectrometry facilities.

To my friends back in Portugal, in special to Catarina Lima, Diogo Serrano, Marta Cardoso, Rute Vieira, Svitlana Zavalko and Ana Lima for listening to me in my most difficult times abroad and for always being with me, despite the distance.

To Helena, Andreia, Cláudia, and all the people I had the pleasure to meet during this journey.

To André, for all the love, support and patience and for making me see that everything was going to be alright in the end.

Last but not least, I would express my sincere gratitude to my family who have been unconditionally supportive. Thank you for putting things in their right place in my mind and for taking care. A special thanks for my mom, who has been always there for me.

Rita Raimundo

Abstract

c-di-GMP is a widely used bacterial signalling pathway that modulates adaptation to different environments. In Vibrio cholerae, the causative organism of the severe diarrheal disease cholera, this second messenger is responsible for several adaptation mechanisms that allow the pathogen to survive changes in their environment. c-di-GMP modulates these adaptations by binding to effector molecules and altering their activity. These will then mediate the regulation of multiple cellular processes. Even though great progress has been made in our understanding of c-di-GMP, many questions are still open. In particular, previous studies have only identified a small number of effector molecules and these can only explain a part of the phenotypes regulated by c-di-GMP. In this study, we aim to identify novel c-di-GMP effector proteins. We set out to optimize a protein pull-down assay with immobilized c-di-GMP as bait. Different washing conditions were tested in order to reduce the nonspecific binding and several candidate binding proteins were detected. Three selected candidates were investigated further and tested in competition assays with free c-di-GMP or free biotin to test their specificity to c-di-GMP. We identified MutT as a new putative c-di-GMP effector molecule.

Key-words: c-di-GMP, V. cholerae, cholera, effector molecule, pull-down, MutT

Resumo

A molécula c-di-GMP é um mensageiro secundário amplamente utilizado pelas bactérias, que modula a adaptação bacteriana a diferentes ambientes. No patogénio Vibrio cholerae, causador da severa e aguda diarreia característica da doença cólera, esta molécula permite-lhe possuir diferentes mecanismos de adaptação e sobreviver nos mais diversos ambientes. Este mensageiro secundário modula estes mecanismos através da sua ligação a diversas moléculas efetoras, modificando a sua atividade. Estas irão, posteriormente, ligar-se a vários alvos e mediar a regulação de múltiplos processos celulares. Embora tenha havido um grande progresso no estudo desta molécula, existem ainda muitas questões por responder, nomeadamente o facto de poucas moléculas efetoras terem sido descobertas até hoje, desvendando e explicando apenas alguns dos muitos fenótipos que se pensa serem regulados pelo c-di-GMP. No presente trabalho, pretendeu-se identificar novas possíveis moléculas efetoras. Para tal, otimizou-se primeiro um ensaio de pull-down, utilizando para tal c-di-GMP imobilizado que serviu para atrair as proteínas que a ele se ligam especificamente. Diferentes condições foram testadas de modo a reduzir o número de ligações não específicas e diversas proteínas candidatas foram detetadas. Três candidatos foram selecionados e testados em dois ensaios de competição com a adição de c-di-GMP livre ou biotina livre. Estes testes foram considerados positivos para a proteína MutT, que foi, deste modo, tida como uma possível nova proteína efetora.

Palavras-chave: c-di-GMP, V. cholerae, cólera, molécula efetora, pull-down, MutT

Table of contents

Preface ...... 2

Declaration ...... 3

Acknowledgments ...... 4

Abstract ...... 5

Resumo ...... 6

Table of contents ...... 7

Index of Figures ...... 8

Index of tables ...... 11

List of abbreviations ...... 12

I – Introduction ...... 13

The pathogen Vibrio cholerae ...... 13

The paradigm of c-di-GMP signalling ...... 16 c-di-GMP signalling in V. cholerae ...... 18 c-di-GMP effector molecules in V. cholerae...... 20

II - Materials and Methods ...... 23

Strains, media and growth conditions ...... 23

Harvesting and storage...... 23

Cell lysis ...... 23

Pull-down assay ...... 23

Mass spectrometry ...... 25

Statistical analysis of mass spectrometry data ...... 25

Candidate selection ...... 26

Cloning ...... 26

Harvesting cells for competition pull-down...... 31

Pull-down assays ...... 31

Western Blot ...... 31

III – Results ...... 33

Optimization of pull-down assays to identify c-di-GMP binding proteins ...... 33

Ionic strength has a limited impact on non-specific binding ...... Erro! Marcador não definido.

The biotin carboxyl carrier protein VC0296 was highly enriched in the biotinylated c-di-GMP screen ...... 34

Two more proteins were highly abundant in the biotinylated c-di-GMP screen when performing the pull-down assays under three other different growth stages ...... 37

The three proteins may not be specific to c-di-GMP ...... 38

VCA0020, VC2392 and VC1346 genes were chosen for genomic analysis ...... 41

Cloning and overexpression of VCA0020, VC1346 and VC2392 ...... 42

IV - Discussion and Conclusion...... 48

V – References ...... 50

VI – Supplements ...... 53

Index of Figures

Figure 1| Illustration of the V. cholerae life cycle. During infection, V. cholerae has to adapt to several different conditions. In the aquatic environment, bacteria can exist as a single cell, free-living form or be associated with a variety of biotic and abiotic surfaces, often in bacterial communities, in a form of a biofilm. When entering the human host, they encounter the acidic stomach. Those that survive that acid shock, then have to adapt to the basic pH and withstand the presence of bile and antimicrobial peptides in the small intestine, the main site of infection. Here, the pathogens express virulence factors, causing diarrhea. V. cholerae are shed from the host back to the environment, where they can persist or be ingested again by another human host to start a new infection cycle. 16 Figure 2| Schematic representation of the c-di-GMP signalling system. DGCs, characterized by GGDEF domains, catalyse the production of c-di-GMP from GTP, while PDEs catalyse its degradation. There are two types of PDEs that have either EAL or HD-GYP domains that break it down to the linear pGpG or GMP, respectively. Typically, these domains are fused to signal sensing domains that sense several environmental and cellular signals (yellow arrows) and regulate the activity of GGDEF, EAL or HD- GYP output domains. Effector molecules bind c-di-GMP and transduce the signal further to output systems. Together, these determine the lifestyle of bacteria. Usually, low intracellular c-di-GMP concentrations are associated with a motile, single cell lifestyle, and high levels with sessility and biofilm formation. 17 Figure 3| A condition where all the proteins were removed was found. SDS-PAGE analysis of the washes carried out using

TM 500 mM NaCl. The gel was stained with the ProteoSilver Silver Stain Kit. Lane M represents the molecular weight marker (SeeBlue Plus2 Pre-Stained Protein Standard). Lane 1 corresponds to the elute sample of the biotinylated c-di-GMP screen. Lanes 2 to 5 show the washes performed in this sample. Lane 6 represents the unbound fraction of proteins of this same sample (before any wash was performed). Lane 7 represents the elute of the control sample. Lanes 8 to 11 represent the washes performed in the control sample. 33 Figure 4| The NaCl concentration has a limited impact on non-specifically bound proteins. Effect of different salt concentrations on the total number of pulled-down proteins, both in the biotinylated c-di-GMP screen (blue line) and control screen (orange line). The salt concentration is given on the x-axis and y-axis indicates the total number of pulled-down proteins. Error bars indicate the standard deviation. Note, only the assay with 154 nM NaCl was repeated.Erro! Marcador não definido. Figure 5| A band at 17 kDa was highly enriched in the biotinylated c-di-GMP screens. SDS-PAGE analysis of the protein pull-down assay carried out with the early stationary phase (OD600 = 1.0). The gel was stained with the ProteoSilverTM Silver Stain Kit. Lane M represents the molecular weight marker (SeeBlue Plus2 Pre-Stained Protein Standard). Lanes 1 and 2 correspond to one set of technical replicates and lanes 3 and 4 to another set of technical replicates. Lanes 1 and 3 show the proteins pulled-down in the biotinylated c-di-GMP screen and lanes 2 and 4 are the respective control screens. 35

Figure 6| Mass spectrometry data from the early stationary phase (OD600 = 1.0) represented in the form of a volcano plot.

The data is plotted as log10 of the fold changes versus the -log10 of the adjusted P-value. Dots on the right side of the vertical dotted line represent proteins that are enriched in the biotinylated c-di-GMP screen (bt-cdG). Dots on the left of the dotted line represent proteins more decreased in the biotinylated c-di-GMP screen. The yellow dots represent proteins that have been found in previous screens for c-di-GMP binding proteins but not yet confirmed. The red dots are the proteins that have been previously confirmed to bind c-di-GMP. Brown dots represent the proteins identified on the SDS-PAGE. 36 Figure 7| Two proteins of approximately 60 kDa were specifically enriched in the biotinylated c-di-GMP screens in early and late stationary phase. SDS-PAGE analysis of the protein pull-down assays carried out with A) stationary (OD600 = 1.0), B) late stationary (OD600 = 2.0) and C) late stationary (OD600 = 4.0) cultures. The gel was stained with the ProteoSilverTM Silver Stain Kit. Lane M represents the molecular weight marker (SeeBlue Plus2 Pre-Stained Protein Standard). Lanes 1 and 2 correspond to one technical replicate and lanes 3 and 4 to the other. Lanes 1 and 3 show the proteins pulled-down in the biotinylated c-di-GMP screen and lanes 2 and 4 are the respective control screens. The arrows show the new detected band in all the growth stages. 38 Figure 8| As the concentration of free biotin increases, multiple bands get weaker. SDS-PAGE analysis of the free biotin pull-down competition assay carried out with an overnight culture (OD600 = 4.0). The gel was stained with the ProteoSilverTM Silver Stain Kit. Lane M represents the molecular weight marker (SeeBlue Plus2 Pre-Stained Protein Standard). Lanes 1 to 4 correspond to the biotinylated c-di-GMP samples with increased biotin concentration levels. See Table 1 for the concentration of each component. 39 8

Figure 9| The potential c-di-GMP binding proteins do not compete with free c-di-GMP. SDS-PAGE analysis of the free c- di-GMP pull-down competition assay carried out with an overnight culture (OD600 = 4.0). The gel was stained with the ProteoSilverTM Silver Stain Kit. Lanes M represents the molecular weight marker (SeeBlue Plus2 Pre-Stained Protein Standard). Lanes 1 to 4 correspond to biotinylated c-di-GMP samples. Concentrations of each component can be found in Table 2. 40 Figure 10| Mass spectrometry data from the combined data represented in the form of a volcano plot. The data is plotted as log10 of the fold changes versus the -log10 of the adjusted P-value. Dots on the right side of the vertical dotted line represent proteins that are enriched in the biotinylated c-di-GMP screen (bt-cdG). Dots on the left of the dotted line represent proteins more decreased in the biotinylated c-di-GMP screen. The yellow dots represent proteins that have been found in previous screens for c-di-GMP binding proteins but not yet confirmed. The red dots are the proteins that have been previously confirmed to bind c-di- GMP. Brown dots represent the proteins identified on the SDS-PAGE. Red squares represent the chosen proteins (VC2392, VC1346 and VCA0020). 41 Figure 11| Successful digestion of pBAD33 plasmid with SphI restriction enzyme. Lane M represents the DNA size marker (GeneRuler 1 kb Plus DNA Ladder). Lane 1 corresponds to the linearized pBAD33 plasmids and lane 2 shows the negative control (circular pBAD33 plasmids). 43 Figure 12| Successful amplification of VCA0020, VC1346 and VC2392 genes. Confirmation of the amplification of the three genes on a 1 % agarose gel. Lanes M represent the DNA size marker (GeneRuler 1 kb Plus DNA Ladder). Lane 1 corresponds to the amplified VCA0020 gene and lanes 2 and 3 to the amplified VC1346 and VC2392 genes, respectively. 44 Figure 13| Colony PCR of cloning reactions. Confirmation of the sizes of the constructs on a 1 % agarose gel. Lanes M represent the DNA size in base pairs (bp) (GeneRuler 1 kb Plus DNA Ladder). Lanes 1 to 8 correspond to the eight selected colonies per transformation: A) VC1346 (pBSB-RR01), B) VC2392 (pBSB-RR02), C) VCA0020 (pBSB-RR03, D) VCA0020 (pBSB-RR03). 44 Figure 14| The intensity of the bands does not indicate a possible specific binding to c-di-GMP. Lanes 1 represent the sample with only biotin-labelled c-di-GMP. Lanes 2 correspond to the sample with free c-di-GMP added. Lanes 3 show the condition in which free biotin was added. A) Western blot against his-tagged VC1346 gene. B) Western blot against his-tagged VCA0020 gene. The red colour represents the total protein intensity (at 700 nm), measured before the addition of the antibodies, and the green colour shows the intensity of the his-tagged protein bands (at 800 nm), in each condition. 45 Figure 15| MutT might be specifically binding to c-di-GMP. A) Western blot experiment on his-tagged mutT gene (VC2392). Lane 1 represents a sample with only biotin-labelled c-di-GMP. Lane 2 corresponds to the sample with free c-di-GMP added. Lane 3 shows the condition in which free biotin it was added. B) Representation of the relative intensities of the Western blot bands. The red color represents the total protein intensity (at 700 nm), measured before the addition of the antibodies, and the green color shows the intensity of the his-tagged protein bands (at 800 nm), in each condition. Bt-cdG/cdG represents the condition where an excess of free c-di-GMP was added to the sample. Bt-cdG/Bt corresponds to the condition where an excess of free biotin was added to the sample. 46 Figure 16| Pull-down assay workflow. Two different screens were used: in the biotinylated c-di-GMP (bt-cdG) screen, c-di- GMP was linked to biotin (green circles) by a linker; in the control screen, c-di-GMP was not bound to biotin. Streptavidin (represented by the black color) was coupled to a magnetic bead (yellow circles). Proteins that are specifically binding to c-di- GMP are represented by a blue color and proteins that do not have affinity to c-di-GMP are shown in grey. 53

Figure 17| Data from the exponential phase (OD600 = 0.5). A) SDS-PAGE analysis of the protein pull-down assay; The gel was stained with the ProteoSilverTM Silver Stain Kit. Lane M represents the molecular weight marker (SeeBlue Plus2 Pre-Stained Protein Standard). Lanes 1 and 2 correspond to one set of technical replicates and lanes 3 and 4 to another set of technical replicates. Lanes 1 and 3 show the proteins pulled-down in the biotinylated c-di-GMP screen and lanes 2 and 4 are the respective control screens. B) Mass spectrometry data represented in the form of a volcano plot; The data is plotted as log10 of the fold changes versus the -log10 of the adjusted P-value. Dots on the right side of the vertical dotted line represent proteins that are enriched in the biotinylated c-di-GMP screen (bt-cdG). Dots on the left of the dotted line represent proteins more decreased in the biotinylated c-di-GMP screen. The yellow dots represent proteins that have been found in previous screens for c-di-GMP binding proteins but not yet confirmed. The red dots are the proteins that have been previously confirmed to bind c-di-GMP. 57

Figure 18| Mass spectrometry data from the A) late stationary phase (OD600 = 2.0) and B) overnight culture (OD600 =4.0) represented in the form of a volcano plot. The data is plotted as log10 of the fold changes versus the -log10 of the adjusted P- value. Dots on the right side of the vertical dotted line represent proteins that are enriched in the biotinylated c-di-GMP screen (bt-cdG). Dots on the left of the dotted line represent proteins more decreased in the biotinylated c-di-GMP screen. The yellow 9

dots represent proteins that have been found in previous screens for c-di-GMP binding proteins but not yet confirmed. The red dots are the proteins that have been previously confirmed to bind c-di-GMP (72). The brown dots represent the proteins identified in the SDS-PAGE bands. 58 Figure 19| SeeBlue Plus2 Pre-Stained Protein Standard. 59 Figure 20| GeneRuler 1 kb Plus DNA Ladder 59 Figure 21| Cloning workflow. Each selected gene (VC1346, VC2392 and VCA0020) was cloned in a pBAD33 vector, under arabinose expression. SphI was used as the restriction enzyme. A his-tag at the C-terminal of each protein was inserted. The resulted constructs were transformed into E. coli TOP10 cells by chemical transformation and the cells were harvested. A pull- down assay was performed with three different conditions. A Western-blot experiment was made to search for the his-tag protein. 60 Figure 22| pBAD33 vector (5352 bp) used for the molecular cloning of the selected genes. SphI restriction site is located at the 1339 bp. It is regulated by the arabinose operon, used in this study to induce expression. It also contains bla (ampR) sequences following the rrnB terminator. It includes a gene that confers resistance to the chloramphenicol antibiotic (Guzman et al., 1995). 60

Index of tables

Table 1| Sequences of primers used in this study. Tm corresponds to the melting temperature. 28 Table 2| PCR conditions for the amplification of VC1346, VC2392 and VCA0020 genes. 29 Table 3| Components of the Gibson Assembly reaction mixture. 29 Table 4| Nomenclature of the resulting constructs. 29 Table 5| Colony PCR conditions. 30 Table 6| PCR conditions for the cycle sequencing of the plasmid constructs. 31 Table 7| Components of the performed pull-down assays. 31 Table 8| Biotinylated c-di-GMP, free biotin and free c-di-GMP concentrations used in the free biotin competition assay. 39 Table 9| Biotinylated c-di-GMP, free biotin and free c-di-GMP concentrations used in the free c-di-GMP competition assay. 40 Table 10| Total Protein and MutT band intensities and their normalization. 47 Table 11| Nutrient composition of used LB culture media. 53 Table 12| Nutrient composition of used S.O.Cculture media. 53

Table 13| Proteins present in the 17 kDa band from the early exponential phase (OD600 = 1.0) pull-down experiment, identified by mass spectrometry. MW represents the molecular weight in kDa. F represents each technical replicate: the odd numbers correspond to the biotinylated c-di-GMP protein abundance and the pair numbers to the abundance of the same protein in the control sample. A score of the protein was obtained dividing the first by the second. The green color evidences the hit gene. 54

Table 14| Proteins present in the band from the overnight culture (OD600 = 4.0) pull-down experiment, identified by mass spectrometry. . MW represents the molecular weight in kDa. F represents each technical replicate: the odd numbers correspond to the biotinylated c-di-GMP protein abundance and the pair numbers to the abundance of the same protein in the control sample. A score of the protein was obtained dividing the first by the second. The green color evidences the hit. N/I stands for not identified. 56 Table 15| Expected PCR products’ length (bp) after successful amplification of de genes. 61 Table 16| Expected PCR products’ length (bp) after successful colony PCR. 61

Table 17| Statistics used in the analysis of the mass spectrometry combined data. Log10 (mean1/mean2) and – log10 (P) were plotted in the form of a volcano plot. 62

List of abbreviations

bp – base pairs PMSF – phenylmethylsulphonyl fluoride BSA – bovine serum albumin RNA – ribonucleic acid Bt-cdG – biotinylated c-di-GMP RR – response regulator c-di-GMP – bis-(3,5’)-cyclic dimeric S.O.C media – super optimal broth with Catabolite guanosine monophosphate repression media cAMP – cyclic adenosine monophosphate SD – Shine-Dalgarno sequence CAP – catabolite activator protein SDS-PAGE – sodium dodecyl sulphate- polyacrylamide gel electrophoresis CmR – chloramphenicol resistance T6SS – type VI secretion system CRP – cyclic AMP receptor protein TBS – tris-buffered saline CT – cholera toxin TBS-T – tris buffered saline with tween DGC – diguanylate cyclase TCP – toxin co-regulated pilus dNTP – nucleoside triphosphate Tm – melting temperature EDTA – ethylenediamine tetra acetic acid UTR – untranslated region EPS – extracellular polysaccharides VPS – Vibrio polysaccharide GMP – guanosine monophosphate GTP – guanosine triphosphate HK – histidine kinase kDa – kilodalton LB – Luria broth LPS – lipopolysaccharide MS2 – tandem mass spectrometry Na+ – sodium

OD600 – optical density at 600 nm ORF – open reading frame PBS – phosphate-buffered saline PCR – polymerase chain reaction PDE – phosphodiesterase pGpG – 5’-phosphoguanylyl-(3’-5’)- guanosine

I – Introduction

1. The pathogen Vibrio cholerae

1.1. V. cholerae, the causative agent of cholera disease

The facultative pathogen V. cholerae is a gram-negative bacterium that causes the ancient disease cholera, an acute diarrheal disease responsible for 3 to 5 million cases every year and more than 100,000 deaths annually worldwide (Jason B. Harris, 2012). The severity of the disease can vary from a mild diarrheal illness to a rapidly fatal malady, characterized by a profuse watery diarrhea with volume depletion, metabolic acidosis and ultimately death from hypovolemic shock (Kavic et al., 1999).

1.2. Classification of V. cholerae strains by serogroups, bio- and serotypes V. cholerae can be classified by several different measures. Strains can be serologically differentiated on the basis of the O antigen of its lipopolysaccharide (LPS). More than 200 serogroups have been identified so far (Nelson et al., 2009). Interestingly, only two of them can cause epidemic cholerae – O1 and O139. This may be due to the presence of the O antigen, since it is itself a relevant virulence factor that makes these strains so dangerous (Kaper et al., 1995). In turn, V. cholerae serogroup O1 can be divided into two biotypes: classical and El Tor (Kaper et al., 1995). The El Tor strain was named after the El Tor station – one of the five quarantine stations opened along the Red Sea to isolate seek pilgrim in their way to Mecca, where it was fist isolated in 1905 (Hu et al., 2016). Today, it has largely replaced the older classical strain (Samadi et al., 1983). Both biotypes, classical and El Tor, can be further subdivided into two major serotypes, Ogawa and Inaba, which vary in prevalence over time (Longini et al., 2002).

1.3. Cholera disease: historical background

Cholera is considered an ancient disease and its descriptions date back to the times of Hippocrates (c. 460 – c. 370 BC) and Buddha (c. 500 – c. 400 BC) (Barua, 1992). However, the first detailed medical reports were only written in the 1500s. Later, in 1849, John Snow, a physician from London, determined that cholera is transmitted by water (Conner et al., 2017). This was contrary to what was thought at the time. Cholera was considered to be a diseased caused by miasma, i.e. “bad air”. Then, in 1883, Robert Koch isolated the causative bacteria, V. cholerae, for the first time (Howard-Jones, 1984). The modern history of cholera began in 1817, when it spread worldwide, facilitated by the expansion of global trade routes (Conner et al., 2017). This was the first cholera pandemic and it began in Bengal, spreading across the Indian continent in 1820. It is assumed that during the 19th century, six pandemics have occurred (Conner et al., 2017), all of them caused by the classical biotype and arising from the India subcontinent, affecting many countries over many years (Kaper et al., 1995).

In 1961, the seventh pandemic began on the island of Sulawesi, in Indonesia, and spread to the Indian subcontinent and the Middle East, moving to Africa in the 1970s. This pandemic reached South America in the early 1990s (Reidl and Klose, 2002). It remains a major health problem, with 3 to 5 million cases of infection every year, including the recent outbreaks in Haiti and Zimbabwe (Hu et al., 2016). Unlike prior pandemics that lasted 5 to 20 years, the seventh is the longest on record and outbreaks are increasing in frequency, severity and duration (Ryan, 2011). This pandemic is mainly caused by the El Tor biotype and is the most extensive in geographic spread, probably due to its high capacity to adapt to different environmental niches, contrary to the classical biotype (Ryan, 2011). In 1992, epidemic cholera was reported in India and Southern Bangladesh. However, even though the clinical syndrome was typical of cholera, the causative agent was a V. cholerae non-O1 strain, expressing a different surface antigen. It was later serotyped as O139 (Kaper et al., 1995). This serogroup was similar to V. cholerae O1 in its culture and biochemical characteristics but did not agglutinate with O1 antisera (Faruque et al., 1998). Cholera caused by this serogroup rapidly spread out to neighbouring countries and caused large explosive outbreaks. If these continue to occur, this might indicate the start of the eighth pandemic (Kaper et al., 1995).

1.4. The lifestyle of the pathogen V. cholerae

V. cholerae has evolved to effectively colonize two very different niches: the nutrient-rich human small intestine and aquatic environments (Faruque and Nair, 2002, Silva and Benitez, 2016). In the human gastrointestinal tract, bacteria are exposed to low pH, bile acids, elevated osmolarity, iron limitation, antimicrobial peptides and nutrient deprivation (Louis and O'Byrne, 2010). In the aquatic environment, the pathogen must withstand diverse physical, chemical and biological stresses that include extreme temperatures, bacteriophage predation, oxidative stress and protozoan grazing (Louis and O'Byrne, 2010). Thus, V. cholerae is able to adapt and live under very different conditions that challenge its growth and multiplication.

1.4.1. Aquatic environment This pathogen is a natural inhabitant of a wide range of aquatic ecosystems, including estuarine and coastal water. Here, it can subsist in a free-living, planktonic form or be associated with a variety of biotic and abiotic substrates (Mohammad Sirajul Islam, 1994). When associated with surfaces, bacteria often form biofilms – microbial aggregates in which cells are embedded within a self-produced matrix of extracellular polymeric substances and are attached to each other and/or to a surface (Shikuma and Hadfield, 2010, Costerton et al., 1995). In this biofilm form, the pathogen can exist in high abundance and survive long periods of stress (Costerton et al., 1995, Hall-Stoodley et al., 2004). V. cholerae can interact with chitinous organisms, such as crustaceans and specially copepods, degrading chitin (the most abundant organic polymer in the aquatic environment) and using it as a carbon and nitrogen source (Nalin et al., 1979). This interaction plays a huge influence on the lifestyle of the bacterium, as it provides the microorganism with a number of advantages, such as food 14

availability, adaptation to environmental nutrient gradients, tolerance to stress and protection from predators (Luigi Vezzulli, 2010). Its association with zooplankton allows the pathogen to survive longer than free-living cells, since it is protected from the external environment (Anwaruk Huq, 1982). In addition, marine and freshwater flora also provide survival advantages to associated V. cholerae (Mohammad Sirajul Islam, 1994).

1.4.2. Human gastrointestinal tract Cholera is contracted by ingestion of contaminated food or water (Figure 1). Following ingestion of V. cholerae through the oral route of the human host (the only known vertebrate host for this pathogen), bacteria face a sudden shift in many environmental parameters, such as temperature, osmolarity and pH conditions. V. cholerae is very sensitive to acidic pH and there is good evidence that the majority of bacteria do not survive stomach passage (Yves A. Millet, 2014), the first line of defence against enterobacterial infections. It has been shown that biofilm formation can increase the survival of V. cholerae at low pH (Zhu and Mekalanos, 2003). Those that survive the passage through the stomach, enter the lumen of the small intestine, the main site of infection, and begin colonization (Spagnuolo et al., 2011). In the small intestine, the surviving V. cholerae have to withstand the presence of toxic chemicals, such as bile and antimicrobial peptides (Hung et al., 2006). Those who survive penetrate the mucus layer covering the epithelium barrier of the gastrointestinal tract, attach and proliferate on its surface (Almagro-Moreno et al., 2015). Surface attachment protects V. cholerae from being removed by peristalsis. In the host, V. cholerae triggers the expression of genes that encode for virulence factors, such as cholera toxin (CT) and the toxin co-regulated pilus (TCP), a type IV pilus required for the colonization of the small intestine and which expression is co-regulated with CT (Klose, 2001). CT is mainly responsible for the profuse diarrhea that V. cholerae infections cause. Even though it is not directly required for bacterial colonization, the triggered diarrhea is thought to promote bacterial dissemination to new hosts (Yves A. Millet, 2014). In contrast, TCP is essential for V. cholerae colonization of the small intestine, since it promotes bacterial aggregation to the mucosal surface and protects the pathogen from antimicrobial agents in the intestine (Taylor, 2011). In addition to the production of virulence factors, motility is also important in the epithelium colonization process (Freter and Jones, 1976). Indeed, V. cholerae is extremely motile due to the presence of a single polar flagellum, which is needed at several steps of its lifecycle (Moisi et al., 2009, Seiji Kojima, 1999). Early studies conducted by Guentzel and co-workers suggested that motility could enable V. cholerae to penetrate the mucus layer covering the intestinal epithelium, as non-motile mutants showed reduced virulence (Guentzel, 1975). More recently, targeted mutations that inactivate V. cholerae’s single polar flagellum have also been shown to inhibit intestinal colonization (Lee et al., 2001). After attachment to the epithelium, the bacterium decreases motility, begins to proliferate, and initiates its virulence cascade. After being excreted from the host, V. cholerae cells have to adapt to the new conditions in the outside environment again. While most bacteria continue to persist in the aquatic environment, some 15

are ingested again by another human and can cause infection again (Figure 1). Because a single infected host sheds a massive number of bacteria, this can lead to explosive outbreaks that make cholera pandemics so dangerous.

2. The paradigm of c-di-GMP signalling Bis-(3,5’)-cyclic dimeric guanosine monophosphate (c-di-GMP) is a wide-spread bacterial second messenger, first discovered in 1987 by Moshe Benzimen (Benziman M, 1987). It can be found in most Gram-negative and many Gram-positive bacteria. It functions as a global regulatory molecule that plays key roles in lifestyle changes of many bacteria, allowing them to adapt to and survive in changing environments. In response to environmental signals, c-di-GMP triggers a specific physiological response: the transition from a free-living, motile cell, to a surface attached, community-forming biofilm lifestyle (Romling et al., 2013). Moreover, c-di-GMP controls the virulence of animal and plant pathogens (Hengge, 2009), progression of the cell cycle (Duerig et al., 2009), antibiotic production (Fineran et al., 2007) and other cellular functions. However, the mechanisms that underlie these processes are only beginning to emerge.

c-di-GMP is generated from two guanosine-5’-triphosphate (GTP) molecules by diguanylate cyclases (DGCs) and degraded into two guanosine-monophosphate (GMP) molecules or into the biologically unstable intermediate 5’-phosphoguanylyl-(3’-5’)-guanosine (pGpG) by phosphodiesterases (PDEs) (Tamayo et al., 2007). DGC activity is associated with the GGDEF domain, defined by this highly conserved set of amino acids, whereas EAL and HD-GYP domains have been shown to have PDE activity (Tamayo et al., 2007). EAL domains first degrade c-di-GMP into pGpG, which is then rapidly converted to two molecules of GMP in the cell. HD-GYP domains directly catalyse the conversion to two molecules of GMP (Tamayo et al., 2007) (Figure 2). The paradigm of c-di-GMP signalling is that low levels of this molecule promote a single cell lifestyle, usually associated with virulence, while high levels result in cell adhesion, matrix secretion and biofilm formation (Conner et al., 2017).

Figure 2| Schematic representation of the c-di-GMP signalling system. DGCs, characterized by GGDEF domains, catalyse the production of c-di-GMP from GTP, while PDEs catalyse its degradation. There are two types of PDEs that have either EAL or HD-GYP domains that break it down to the linear pGpG or GMP, respectively. Typically, these domains are fused to signal sensing domains that sense several environmental and cellular signals (yellow arrows) and regulate the activity of GGDEF, EAL or HD-GYP output domains. Effector molecules bind c- di-GMP and transduce the signal further to output systems. Together, these determine the lifestyle of bacteria. Usually, low intracellular c-di-GMP concentrations are associated with a motile, single cell lifestyle, and high levels with sessility and biofilm formation. Adapted from https://en.uit.no/forskning/forskningsgrupper/gruppe?p_document_id=418147.

DGCs and PDEs from V. cholerae have sensory domains (Mata et al., 2018), suggesting that their activity is controlled by external signals, allowing for c-di-GMP levels to be modulated by environmental parameters. These signals can be oxygen and redox conditions, starvation, temperature shifts and several chemical substances (Conner et al., 2017). In order to play its role, c-di-GMP levels need to be sensed in the cell. Specific molecules, called 17

effector molecules, allow bacteria to respond to those changing levels. Both c-di-GMP binding proteins and RNAs, such as riboswitches, have been described. c-di-GMP binds to and exerts its control by altering the structure and output function of the effector (Hengge, 2009).

3. c-di-GMP signalling in V. cholerae As described above, V. cholerae has to cope with changing environmental conditions both in the aquatic environment and during transitions to and from human hosts (Conner et al., 2017) and shifting between a single cell lifestyle and a biofilm form can be beneficial for survival at different stages of the infection cycle. This switch is commonly regulated by c-di-GMP (Conner et al., 2017). In fact, this second messenger is extensively utilized in V. cholerae and controls, among other things, biofilm formation, virulence and motility (Jones et al., 2015, Chiavelli et al., 2001).

3.1. V. cholerae biofilms

An important process regulated by c-di-GMP is the production of extracellular polysaccharides (EPS) that serve as an extracellular matrix for the formation and support of biofilms – complex communities of one or more species of microorganisms attached to a surface and to each other, embedded in a polysaccharide matrix (Tamayo et al., 2007). In V. cholerae, c-di-GMP positively regulates biofilm formation (Conner et al., 2017). The levels of the vibrio polysaccharide (VPS), the major component of the V. cholerae biofilm matrix (others include proteins and nucleic acids), are increased when c-di-GMP concentration is high in the cell. At the same time, the flagellar genes are repressed through c-di-GMP binding to the transcription factor FlrA, the master regulator of the V. cholerae flagellar biosynthesis regulon. In addition, the production of VPS itself inhibits motility in this microorganism (Lee et al., 1998, Ayala et al., 2018). The enzymes that synthetize the VPS are encoded by two operons: vps-I cluster (vpsU and vpsA to vpsK genes) and vps-II cluster (vpsL to vpsQ genes). The clusters are separated by an intergenic region containing the rbm gene cluster, which encodes for biofilm matrix proteins (Fong et al., 2010). While vps genes are necessary for the development of three-dimensional biofilm structures, the biofilm matrix proteins, such as RbmA (cell-to-cell adhesion), RbmC (forms dynamic, flexible and ordered envelops that encased the cell clusters) and Bap1 (allows the biofilm to adhere to surfaces), play a role in the maintenance of the structural integrity of the biofilm (Berk et al., 2012). The two operons are under the control of two transcriptional factors, VpsT and VpsR, activated by c-di-GMP (Catharina Casper-Lindley, 2004, Yildiz FH, 2001). There are factors other than VPS production that contribute to biofilm formation and that are also regulated by c-di-GMP. For example, there are two different cell-surface structures that are essential for the initial attachment and biofilm formation: the flagellum and a type IV mannose-sensitive hemagglutinin pilus (Msh), involved in the attachment to abiotic surfaces (Watnick et al., 1999, Watnick and Kolter, 1999). The pilus is composed of repeated units of the MshA protein, the major pilin protein (Chiavelli et al., 2001). The addition and disassembly of the pilin subunits is energized by the MshE

ATPase, enhancing the secretion of the MshA pili onto the surface of the bacteria (Chiavelli et al., 2001). The binding of the MshE protein to the c-di-GMP molecule is required for the MshA export (Chiavelli et al., 2001). This way, c-di-GMP is critical for the production of the Msh pilus.

3.2. Regulation of virulence in V. cholerae: the VieSAB system

One way V. cholerae senses changes in the external environment is through two-component signal transduction systems (Stephanie L Mitchell, 2015) . Two-component systems serve as a basic stimulus- response coupling mechanism to allow organisms to sense and respond to changes in many different environmental conditions. They consist of a histidine protein kinase (HK) and a response regulator (RR) protein. Upon an extracellular stimulus, the HK senses it and transfers a phosphoryl group to the RR, resulting in the activation of a downstream effector domain that produces the specific response (Stephanie L Mitchell, 2015) . VieSAB is a two-component system present in V. cholerae (Stephanie L Mitchell, 2015) that provides a mechanism by which this pathogen can lower c-di-GMP concentration in the small intestine (Tamayo et al., 2007). It is encoded in an operon harbouring three genes: vieS, vieA and vieB (Stephanie L Mitchell, 2015). VieS is a histidine kinase capable of autophosphorylation and subsequent transfer of a phosphate residue to the response regulator, VieA (Martinez-Wilson HF, 2008). VieA has an EAL domain with PDE activity (Lee et al., 1998). When phosphorylated by the sensor kinase VieS, VieA is activated and decreases the concentration of c-di-GMP in the cell, which in turn promotes the expression of virulence and motility genes and the repression of the biofilm formation genes during infection (Stephanie L Mitchell, 2015). It was shown that, when V. cholerae binds to epithelial cells, the transcription of vieA increases significantly, supporting the hypothesis that this response regulator is a major contributor to c-di-GMP cleavage during early infection (Stephanie L Mitchell, 2015). This way, as the expression of the vieSAB operon occurs at an early stage of infection, c-di-GMP must be reduced rapidly and early, in order to maximize the expression of virulence genes. VieB contains a conserved N-terminal phosphor-receiver domain but, in contrast to VieA, is predicted to have no output domain. Even though the mechanism of VieB remains unclear, it has been shown that this component acts as an inhibitor of VieS, preventing the activation of VieA (Stephanie L Mitchell, 2015). The VieSAB system plays a role in the inverse regulation of biofilm and virulence genes by controlling the intracellular concentration of c-di-GMP (Stephanie L Mitchell, 2015). The VieSAB system is critical for the virulence of V. cholerae (Conner et al., 2017). Inactivation of VieA results in high levels of this second messenger in the cell, which leads to an increase in the expression of vps genes and therefore in biofilm formation (Tischler and Camilli, 2004). In contrast, when VieA concentration is high in the cell, it positively regulates the expression of the major virulence gene transcriptional activator toxT and also the genes encoding the cholera toxin, ctxAB (Tischler and Camilli, 2005).

3.2.1. Motility regulation by c-di-GMP in V. cholerae V. cholerae is a highly motile bacterium that possesses a single polar flagellum as locomotion organelle, which is powered by a gradient of Na+ ions across the cytoplasmic membrane (Seiji Kojima, 1999). In this pathogen, motility is highly important during the free-swimming phase of the life cycle (Seiji Kojima, 1999). Besides, it is thought to contribute to the virulence of V. cholerae, even though the relationship between motility and virulence is not yet fully elucidated (Seiji Kojima, 1999). c-di-GMP negatively regulates motility in this organism (Srivastava et al., 2013). A large set of tightly regulated proteins are required for flagellum biosynthesis, assembly and function. The flagellar filament is composed of five distinct flagellins encoded by the flaA, flaB, flaC, flaD and flaE genes, but only one of them, FlaA, the major flagellin protein, is essential for motility. The other flagellar proteins play accessory roles (Echazarreta et al., 2018). The expression of motility genes requires a hierarchical regulatory cascade that involves the alternative RNA polymerase subunits σ54 and σ28 and the σ54-dependent transcriptional activators FlrA and FlrC (Prouty et al., 2001). The precise molecular mechanisms by which c-di-GMP affects motility in V. cholerae have not been totally understood yet. However, it is known that high c-di-GMP levels inhibit the production and function of V. cholerae’s single polar flagellum (Srivastava et al., 2013). A previous study that analysed the impact of c-di-GMP-generating and -degrading enzymes on motility revealed that the absence of certain DGCs enhances motility. In contrast, lack of PDEs RocS or CdgJ represses motility (Xianxian Liu, 2010). Overall, the lack of some of the c-di-GMP metabolizing enzymes impacts motility without impacting flagellum production. This suggests that c-di-GMP affects the function, i.e., rotation of the polar flagellum (Xianxian Liu, 2010). In addition to the control of flagellar rotation, c-di-GMP also represses the transcription of the flagellar genes. As mentioned above, a large set of proteins is required for a functional flagellum and their expression is regulated by a hierarchical regulatory cascade (Prouty et al., 2001). The transcriptional activation begins with the alternative sigma factor σ54-dependent regulator FlrA, to which c-di-GMP binds and alters its activity. This blocks FlrA from activating the expression of FlrB and FlrC and, as a consequence, to the repression of the transcription of the flagellar genes (Prouty et al., 2001).

4. c-di-GMP effector molecules in V. cholerae c-di-GMP regulates a wide range of functions in bacteria in general and V. cholerae in particular. This includes adhesion, biofilm formation, motility, synthesis of polysaccharides and synthesis of virulence factors in pathogens. Changes in cytosolic c-di-GMP concentration lead to these specific phenotypic alterations (Hengge, 2009). However, we are largely missing information on the proteins that bind c-di-GMP to effect these changes (Benach et al., 2007). In V. cholerae, there are only a few effector molecules known so far. For example, the PilZ domain family of proteins, a well characterized class of c-di-GMP effector proteins in other organisms, has five members encoded in the V. cholerae (Dorit Amikam, 2006), the transcription factors VpsT and VpsR (Srivastava et al., 2011), the MshE protein described above (Jones et al., 2015) and two riboswitches (Smith et al., 2009). However, these

effector molecules are not sufficient to explain all the c-di-GMP regulated phenotypes observed in V. cholerae.

4.1. PilZ domain For several years, it was thought that a single effector protein or protein domain should exist that acts the same way as the well-characterized cAMP-binding adaptor protein (CAP or CRP). The search for such a protein led to the identification of the first c-di-GMP effector molecule, the PilZ protein (Dorit Amikam, 2006). This single domain protein from Pseudomonas aeruginosa is the eponymous member of a conserved class of c-di-GMP binding protein domains. For example, PilZ domains were predicted to be part of the glycosyltransferase protein of the Gluconacetobacter xylinus cellulose synthase complex (Dorit Amikam, 2006) and in the YcgR protein of Escherichia coli, that controls motility in Enterobacteria (Koushik Paul, 2010, Ryjenkov DA, 2006). Several conserved residues are essential for the binding of the PilZ domain (Pratt et al., 2007), that contains two conserved motifs: an RxxxR motif with two conserved arginine residues surrounding one of the c-di-GMP guanine bases, and a D/NxSxxG motif that surrounds the other guanine base (Dorit Amikam, 2006). Subsequent studies revealed the existence of three distinct classes of PilZ domains that differ in the ability to bind c-di-GMP: the type I PilZ contains both the motifs mentioned above and it is apparently the only PilZ type that directly binds c-di-GMP (Dorit Amikam, 2006). Many PilZ domain proteins, such as the one present in P. aeruginosa, belong to the type II (Ko-Hsin Chin, 2012), which lacks the RxxxR motif and is not capable of binding the second messenger. Finally, PilZ type III forms a stable tetramer via a helical bundle and it also does not bind c-di-GMP (Li et al., 2011). In V. cholerae, five proteins of unknown function contain a PilZ domain and genes encoding these proteins have been annotated as plzA, plzB, plzC, plzD and plzE (Pratt et al., 2007). However, just four of them retain RxxxR and DxSxxG motifs required for the binding. So far, only PlzC and PlzD have been demonstrated to bind c-di-GMP (Benach et al., 2007). The function of V. cholerae PilZ domain-containing proteins are largely unknown.

4.2. The transcription factors VpsT and VpsR and the pilus protein MshE

VpsR and VpsT are the master regulators of biofilm genes and positively regulate one another’s expression and genes involved in biofilm formation. c-di-GMP binds to and activates VpsR (Srivastava et al., 2011), which additionally triggers the expression of a master virulence regulator, AphA. In turn, AphA activates VpsT expression (Srivastava et al., 2011). VpsT can also be directly activated through c-di-GMP binding (Catharina Casper-Lindley, 2004). Together, these two transcriptional factors positively control vps expression at high c-di-GMP levels, therefore regulating extracellular matrix production (Krasteva et al., 2010). Besides VpsT and VpsR, MshE can also bind to c-di-GMP. It functions as a c-di-GMP receptor, thereby providing an input for the c-di-GMP signal into the assembly of the MshA pilus (Jones et al., 2015). Jones and co-workers have shown that the induction of a DGC (VCA0956) in a ΔmshE strain did not increase the production of surface MshA pili (Jones et al., 2015). Another study showed that

ΔmshE strains were defective for MshA export (Roelofs et al., 2015). These data suggest that MshE is required for the c-di-GMP-dependent increase of MshA pili (Jones et al., 2015). However, the specific mechanisms of this interaction are not yet fully elucidated. The c-di-GMP binding site was identified at the N-terminus of the MshE protein and requires a conserved arginine residue in the ninth position (Jones et al., 2015).

4.3. Riboswitches

In addition to the PilZ domain family of proteins, the transcription factors VpsT and VpsR and the MshE protein, c-di-GMP also binds to RNA molecules that act as riboswitches (Sudarsan et al., 2008) – receptors for small molecules that are present in the 5’ untranslated region (UTR) of messenger RNAs and, upon binding to different metabolites, they activate or repress gene expression at the transcriptional or translational levels. Most riboswitches fold into complex tertiary structures that allow them to selectively bind small molecule metabolites. These RNAs contain two different domains: the aptamer, which is responsible for the recognition of the small molecule ligand, and the expression platform, to which the aptamer is connected. The expression platform is a downstream element that controls gene expression either at the transcriptional or translational level, in response to binding of a ligand (Koushik Paul, 2010, Srivastava et al., 2011). c-di-GMP can be sensed in a cell by riboswitches and it has been hypothesized that their existence could explain how this second messenger controls the transcription and translation of many genes in V. cholerae (Sudarsan et al., 2008). In this pathogen, two riboswitches known to bind c-di-GMP are designed Vc1 and Vc2, each located on each one of the two chromosomes. They are predicted to regulate the genes gbpA and tfoY, respectively (Sudarsan et al., 2008). The first gene, the glucose binding protein A, is an attachment factor expressed on the outer surface of the cell, which has been shown to recognize specific sugar moieties in both the lumen of the small intestine and the surface of some chitinous organisms, explaining in part the high specificity of the targets of V. cholerae virulence (Kirn et al., 2005, Edmond Wong, 2012). tfoY was shown to promote dispersive motility in the pathogen at low concentration of c-di-GMP and the Vc2 riboswitch functions as an off-switch by inhibiting its expression in response to c-di-GMP binding (Pursley, 2016). However, how Vc2 controls gene expression has never been fully demonstrated.

4.4. Unknown c-di-GMP effectors c-di-GMP regulates a wide breath of phenotypes in V. cholerae and many other organisms. So far, the few discovered effector molecules cannot explain the majority of them. This raises the possibility that many other c-di-GMP binding effectors are yet uncharacterized. Identifying these molecules and investigating their role in lifestyle switches, adaptation and virulence will be the next necessary step to further our understanding of c-di-GMP signalling. Especially in V. cholerae, a devastating pathogen and an organism which infection cycle is strongly dependent on c-di-GMP, a deeper understanding of effector molecules might offer new targets for intervention of infections.

II – Materials and Methods

1. Strains, media and growth conditions The bacterial strain used in this study was V. cholerae El Tor strain C6706, cultured in Luria Broth

(LB) (Table 11) at 37 ºC. Growth of the cultures was monitored by optical density (OD600nm) measurements using a Genesys 20 (Thermo Scientific, Waltham, Massachusetts, USA) spectrophotometer.

2. Harvesting and storage

Cells representing different phases of batch culture-growth were harvested: exponential (OD600 =

0.5), early stationary (OD600 = 1.0), late stationary (OD600 = 2.0) and overnight phase. Cells were harvested by centrifugation at 2250 x g for 10 minutes and resuspended in 15 % LB-glycerol to a final 30-fold concentration. 1 ml of this cell suspension was stored at -80 ºC until further use.

3. Cell lysis For cell lysis, cell suspensions stored at -80 ºC were thawed at room temperature and centrifuged at 2195 x g for 3 minutes at room temperature. Pelleted cells were lysed using 1 ml B-PERTM Bacterial Protein Extraction Reagent (Thermo Scientific, Waltham, Massachusetts, USA), 2 µl Pierce DNase I (2500 units/ml) (Thermo Scientific, Waltham, Massachusetts, USA), 2 µl Pierce Lysozyme (50 mg/ml) (Thermo Scientific, Waltham, Massachusetts, USA) and 1 µl 100 mM PMSF (Sigma-Aldrich, St. Louis, Missouri, EUA), at room temperature. The pellet was transferred to a FastProteinTM Blue Matrix Tube (MP Biomedicals, Santa Ana, California, USA), vortex mixed and incubated at room temperature for 5 minutes. The sample was homogenized for 2.30 minutes in MiniBeadBeater-16 (BioSpec, Bartlesville, USA), mixed and incubated at room temperature for 10 minutes. The pellet was centrifuged at 1893 x g for 5 minutes and the supernatant was transferred to a fresh microcentrifuge tube and either used immediately for further analysis or stored at 4 ºC.

4. Pull-down assay Pull-down experiments were performed according to Chamber and Sauer’s protocol (Chambers JR, 2017), with few modifications. This assay is based on protein-ligand interactions, where biotinylated c- di-GMP is used as bait to bind proteins from cell lysates and streptavidin-coated magnetic beads were used to pull-down the protein-biotinylated c-di-GMP complex (Figure 16).

4.1. Preparation of solutions used in the assay (all made in ultrapure water)

a) 100 mM PMSF (Sigma-Aldrich, St. Louis, Missouri, EUA): 1 ml 100 mM PMSF in isopropanol. Store at room temperature. b) Biotinylated c-di-GMP (Biolog, Hayward, California, USA): dissolve 0.1 µmol in 500 µl of Milli-Q water. Store at -20 ºC. c) c-di-GMP (Biolog, Hayward, California, USA): Dissolve 1 µmol in 1000 µl of Milli-Q water. Store -20 ºC. d) 1 mM Biotin (Sigma-Aldrich, St. Louis, Missouri, EUA): Dissolve 25 mg in 100 ml of Milli-Q water. Store at 4º C. e) 10 x Reaction buffer: Dissolve 1,21 g 100 mM Tris, 3,8 g 500 mM KCl and 154,2 g 10 mM DTT in 80 mL deionized water. Adjust pH to 7.5 and make the volume up to 100 mL with deionized water. Store at -20 °C. f) 0.5 M EDTA: Dissolve 18,61 g of disodium EDTA in 80 mL of deionized water. Adjust the pH to 8.0 and make the volume up to 100 mL with deionized water. Store at room temperature. g) TBS: Dissolve 1,57 g 50mM Tris-HCl and 5,84 g 154 mM/200 mM/250 mM/300 mM NaCl in 150 mL of deionized water. Adjust pH to 7.6 and make the volume up to 200 mL with deionized water. Store and 4 ºC. h) 0.1 % TBS-T: TBS containing 0.1 % Tween-20. Add 200 µl Tween-20 in 200 mL TBS. Store at 4 ºC. i) Elution buffer: Per 50 µl of reaction, add 12,5 µl of 4x Invitrogen Fluorescent Compatible Sample Buffer (Thermo Scientific) and 5 µl 10x Invitrogen™ Novex™ NuPAGE™ Sample Reducing Agent (Fisher Scientific).

4.2. Bead preparation

DYNAL Dynabeads M-270 Streptavidin (Invitrogen, Carlsbad, California, EUA) magnetic beads were washed twice with 0.1 % TBS-T. Beads were separated from liquid phase by exposure to a magnet for ~ 1 min in a magnetic tube stand. The TBS-T was removed while the tube remained in the magnetic stand. For the negative control, the streptavidin on beads was blocked using free biotin. Beads were incubated with 1 M biotin with shaking for 30 minutes at room temperature followed by two washes.

4.3. Incubation with biotinylated c-di-GMP 300 µl of cell lysate was incubated with 20 µl 200 pmol/µl biotinylated c-di-GMP in 40 µl 10x reaction buffer and 4 µl 500 mM EDTA at a final volume of 400 µl at room temperature for 30 minutes. As negative controls, the biotinylated c-di-GMP was replaced by 20 µl of 1 M free biotin and 36 µl of 1 nmol/µl free c-di-GMP.

4.4. Protein pull-down and visualization Washed beads were combined with the pre-incubated cell lysate and incubated at room temperature for 30 minutes. Next, streptavidin-biotin linked proteins were separated from the unbound fraction by magnet. The unbound fraction was collected as control. The loaded beads were washed five times with 0.1 % TBS-T to remove unspecifically bound proteins. Samples were eluted in elution buffer by heating the mix to 70 ºC for 10 minutes. Pulled down proteins were separated by SDS-PAGE on 4-15 % mini-PROTEAN TGX Precast Protein Gels (Bio- Rad, Hercules, California, USA). For mass spectrometry analysis, gels were run for 5.1 minutes at 120 V and stained with InvitrogenTM NovexTM SimplyBlueTM SafeStain (Invitrogen, Carlsbad, California, EUA). For silver staining protein detection, gels were run for 30 minutes at 120 V and stained with ProteoSilverTM Silver Stain Kit (Sigma-Aldrich, St. Louis, Missouri, EUA) according to the manufacturer’s instructions.

5. Mass spectrometry Gel pieces were subjected to in-gel reduction, alkylation and tryptic digestion, using 6 ng/μl trypsin (Promega, Madison, Wisconsin, EUA) (Shevchenko et al., 1996). OMIX C18 tips (Varian, Palo Alto, California, USA) were used for sample clean-up and concentration. Peptide mixtures containing 0.1 % formic acid were loaded onto EASY-nLC 1200 (Thermo Scientific, Waltham, Massachusetts, USA). Samples were injected to a Acclaim PepMap trap column (75 μm × 2 cm, C18, 3 μm, 100 Å) (Thermo Scientific, Waltham, Massachusetts, USA) for desalting before elution to the EASY-Spray separation column of 50 cm by 50 µm inner diameter (Thermo Scientific, Waltham, Massachusetts, USA). Peptides were fractionated using a 4–40 % gradient of increasing amounts of 80 % acetonitrile in water, over 60 minutes, at a flow rate of 300 nl/min. The mobile phases contained 0.1 % formic acid. Separated peptides were analysed using an Orbitrap Fusion Lumos mass spectrometer (Thermo Scientific, Waltham, Massachusetts, USA). The mass spectrometer was operated in a data-dependent mode with the precursor scan in the orbitrap over the range m/z 375–1500. The most intense ions were selected for Collision-induced dissociation using 3 seconds between each master scan. Dynamic exclusion was set to 60 seconds. The Orbitrap automatic gain control target was set to 4E5 and the MS2 scans in the Ion Trap was set to 3E3 with maximum injection times of 50 ms and 300 ms, respectively. Protein identification was done using the Proteome Discoverer 2.2 software (Thermo Scientific, Waltham, Massachusetts, USA) (Le Doujet et al., 2019). The mass spectrometry analysis was performed by Dr. Jack-Ansgar Bruun and Toril Anne Grønset within the mass spectrometry facilities.

6. Statistical analysis of mass spectrometry data To investigate the reproducibility and enrichment of the pull-down assay, the proteins puled-down by biotinylated-c-di-GMP were compared to the proteins pulled-down by free c-di-GMP control reaction. To facilitate the comparison, the relative protein abundance (the number of times that a specific protein was detected in the sample) was calculated by dividing the individual protein abundance by the sum of

the abundances of all proteins. In case a protein was pulled-down in the control assays but not in the biotinylated-c-di-GMP, the missing value was replaced by 1, an arbitrarily chosen number that is very small, to avoid dividing by zero. The mean relative abundance of each protein was calculated over all technical replicates and the fold changes between the biotinylated-c-di-GMP assay and the c-di-GMP control screen for each protein were determined (defined as protein scores). P-values were calculated with an unpaired t-test between the two different set of samples: the protein abundances in the biotinylated c-di-GMP screens and the abundances of the same protein in the c-di-GMP control 1 screens. The log10 of the fold changes (log10(mean1/mean2)) and the negative log10 of the P-values (- log10(P)) were plotted in a volcano plot. Data were processed and plotted in GraphPad Prism 7.0. This statistical analysis was performed by Rita Raimundo.

7. Candidate selection The candidate genes for future genomic analysis were chosen based on their significant abundance in the biotinylated c-di-GMP screen.

8. Cloning

8.1. Preparation of solutions

a) Lysis buffer: dissolve 6 g SDS in 50 mL deionized water. Add 60 mL 0.5 M EDTA and fill up with deionized water to a total volume of 300 mL with deionized water. Store at room temperature. b) Protein precipitation solution: dissolve 57.8 g 7.5 M ammonium acetate in 250 mL deionized water and mix it at 65 ºC. Store at room temperature. c) 1% agarose gel: 1 g of agarose (Lonza, Basel, Switzerland) was added to 100 ml of 1x TAE buffer by carefully heating the mixture to the boiling point in a microwave and stored at 60 ºC. 5 µl of Ethidium Bromide Dye (10 mg/mL) was added to 50 ml of the solution and mixed carefully. The solution was poured into an appropriate tray and left to solidify at room temperature for about 30 minutes. d) 20 % L-arabinose: dissolve 20 g L-arabinose in 100 mL deionized water, filter sterilize and store at 4º C.

8.2. Genomic DNA isolation Genomic DNA was isolated from V. cholerae C6706. 1 ml of an overnight culture was harvested by centrifugation at 1893 x at room temperature. The cell pellet was resuspended in 50 µL PBS and lysed by addition of 600 µl of the lysis buffer. The cells were incubated at 80 ºC for 5 minutes and cooled

1 Mean1 corresponds to the mean value of the protein abundances from the biotinylated c-di-GMP assays and mean2 to the mean value of the protein abundances from the control assays. 26

down to room temperature for 10 minutes. After that, 3 µl RNaseA was added and samples were incubated at 37 ºC for 30 minutes. 200 µl of protein precipitation solution was added and samples were incubated on ice for at least 10 minutes. After this, samples were centrifuged at 1893 x g for 10 minutes at 4 ºC. The supernatant was transferred to a new tube and samples were centrifuged again at 1893 x g for 15 minutes at 4 ºC. The supernatant was transferred to a new tube and 700 µl 100 % Isopropanol was added. Samples were mixed gently and centrifuged at 1893 x g for 5 minutes at room temperature. The supernatant was discarded and the remaining DNA pellet was washed with 600 µl 70 % ethanol. Samples were centrifuged at 1893 x g for 1 minute at room temperature. The supernatant was discarded and the pellets were dried at room temperature for 2 to 15 minutes. Genomic DNA pellets were dissolved in ultrapure water and stored at -20 ºC. The quality and concentration of the extracted genomic DNA were determined using a NanoDrop ND-1000 3.8.1 spectrophotometer (Thermo Scientific, Waltham, Massachusetts, USA).

8.3. Plasmid DNA extraction

pBAD33 plasmids were extracted from E. coli strain DH5alpha, using the QIAprep Spin Miniprep Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. Isolated plasmids were stored at -20 ºC until further use. The quality and concentration of the extracted plasmids were determined using a NanoDrop ND-1000 3.8.1 spectrophotometer (Thermo Scientific, Waltham, Massachusetts, USA).

8.4. Restriction digestion pBAD33 plasmids were digested with the restriction enzyme SphI (Promega, Madison, Wisconsin, USA). Each 20 µl restriction digestion mixture contained 2 µl of Buffer K (10X) (Promega, Madison, Wisconsin, USA), 0.2 µl of Ambion® Acetylated BSA (110 µg/µl) (Thermo Scientific, Waltham, Massachusetts, USA), 1 µg pBAD33 plasmid (101ng/µl) and 1 µl of the restriction enzyme SphI (1 µg/µl). The restriction digests were incubated at 37 °C for 1 hour, followed by an incubation at 65 °C for 20 minutes to heat inactivate SphI. The success of the restriction digest was confirmed by agarose gel electrophoresis (1 % agarose, 90 volts, 50 minutes). The linearized plasmids were stored at -20 °C until further use.

8.5. Gel purification Successful linearized plasmids were purified using the QIAquick Gel Extraction kit (Qiagen, Hilden, Germany). The quality and concentration of the isolated DNA was determined using a NanoDrop ND- 1000 3.8.1 spectrophotometer.

8.6. Primers Primers were designed to clone genes for overexpression into pBAD33 (Table 1). The forward primers were designed to bind to the open reading frame (ORF) of the gene of interest and include a Shine-Dalgarno (SD) sequence and an overhang which has homology to the pBAD33 multiple cloning site. The reverse primers were designed to bind to the ORF of the gene of interest and include a 6 x His-tag, stop codon and an overhang which has the homology for pBAD33 cloning site.

Table 1| Sequences of primers used in this study. Tm corresponds to the melting temperature.

Primer sequence Tm (º C) Gene Primers

5’GCGAATTCGAGCTCGGTACCCGGGGATCCTCTAGATTTAGGATACATTTTTATGAAATTAGCGACTCTGAAAAATGGAAT3’

54.4 1147F - P

VC1346

5’TTCTCTCATCCGCCAAAACAGCCAAGCTTGCATGCTCAATGATGATGATGATGATGCACTTCCTTGTTGTACTGCATCA3’ 53.5 1148R - P

5’GCGAATTCGAGCTCGGTACCCGGGGATCCTCTAGATTTAGGATACATTTTTTTGAAACGCATCCACATTGTTGCA3’

54 1149F - P

VC2392

5’TTCTCTCATCCGCCAAAACAGCCAAGCTTGCATGCTTAATGATGATGATGATGATGACCAAATTGAGCAATCACTTGCTTC3’ 54.4 1150R - P

5’GCGAATTCGAGCTCGGTACCCGGGGATCCTCTAGATTTAGGATACATTTTTATGAGTAATCCCAATCAAGCTGC3’

53.5 1151F - P

VCA0020 5’TTCTCTCATCCGCCAAAACAGCCAAGCTTGCATGCTTAATGATGATGATGATGATGACCTTTTCCTACAACGAGATTTCTTG3’ 54.8 1154R - P

5’CGCTTTTTATCGCAACTCTCTACT3’ 54 0554F - P

5’ATCTTCTCTCATCCGCCAAAACAG3’ 55 0555R - Sequencing primers P

8.7. PCR Each 50 µl PCR contained 1 µl genomic DNA, (30 ng/µl for VC1346, 54.1 ng/µl for VC2392 and 60.3 ng/nl for VCA0020)10 µl of 1X Phusion High Fidelity buffer, 1.0 µl of 200 µM dNTPs, 2.5 µl of 500 nM forward and reverse primer each and 0.5 µl of Phusion High Fidelity proofreading DNA polymerase (1 U) (Thermo Scientific, Waltham, Massachusetts, USA). The PCR was carried out using T100 Thermal Cycler (Bio-Rad, Hercules, California, USA) with conditions as follows (Table 2).

Table 2| PCR conditions for the amplification of VC1346, VC2392 and VCA0020 genes. 1) Initial denaturation; 2) Denaturation, primer annealing and extension; 3) Final extension.

Construct Steps VC1346 VC2392 VCA0020 1 98 ºC 40’’ 98 ºC 40’’ 98 ºC 40’’ 98 °C 10’’ 98 °C 10’’ 98 °C 10’’ 34 2 51 ºC 30’’ 51 ºC 30’’ 50 ºC 30’’ cycles 72 °C 34’’ 72 °C 16’’ 72 ºC 1’40’’ 3 72 °C 5’ 72 °C 5’ 72 °C 5’ 4 12 °C hold 12 °C hold 12 °C hold

8.8. Gibson cloning

Gibson cloning reactions with purified pBAD33 and PCR products of amplified genes were mixed according to Table 3. Resulting final vectors were named according to Table 4.

Table 3| Components of the Gibson Assembly reaction mixture.

pBSB-RR01 pBSB-RR02 pBSB-RR03 Insert 2 µl 2.5 µl 1 µl Vector 4 µl 4 µl 4 µl Assembly Master Mix 10 µl 10 µl 10 µl Milli-Q water 4 µl 3.5 µl 5 µl Total volume 20 µl 20 µl 20 µl

Table 4| Nomenclature of the resulting constructs.

Insert Vector Resulting construct VC1346 pBAD33 pBSB-RR01 VC2392 pBAD33 pBSB-RR02 VCA0020 pBAD33 pBSB-RR03

Samples were incubated at 50 ºC for 30 minutes and stored at 4 ºC until further use. 29

8.9. Desalting DNA by drop dialysis The resulting constructs (pBSB-RR01, pBSB-RR02 and pBSB-RR03) were dialyzed against Milli-Q water.

8.10. Chemical transformation into E. coli TOP10 competent cells For each transformation, one vial of One ShotTM TOP10 chemically competent cells (Thermo Scientific, Waltham, Massachusetts, USA) were thawed on ice and mixed with 5 µl DNA (VC0020 = 60,3 ng/µl; VC1346 = 29,6 ng/µl; VC2392 = 54,1 ng/µl). The mixtures were incubated on ice for 30 minutes. Cells were heat-shocked for 30 seconds at 42 ºC and placed on ice for 2 minutes. 250 µl of pre-warmed S.O.C medium (Table 12) was added to each vial and samples were incubated at 37 ºC for 1 hour. 100 µl of each transformation were spread on pre-warmed chloramphenicol plates and incubated overnight at 37 ºC. Per transformation eight different colonies were selected and analysed by colony PCR.

8.11. Colony PCR

A colony was picked a transferred to a 200 µl PCR tube (Thermo Scientific, Waltham, Massachusetts, USA). 25 µl of a premade Master Mix containing 100 µM primer P-554F, 100 µM primer P-555R and 1x of Taq Master Mix (New England BioLabs, Ipswich, Massachusetts, EUA) was added to each PCR tube. The PCR was run according to the conditions in Table 5.

Table 5| Colony PCR conditions. 1) Initial denaturation; 2) Denaturation, primer annealing and extension; 3) Final extension.

Construct Steps pBSB-RR01 pBSB-RR02 pBSB-RR03 1 95 ºC 2’ 95 ºC 2’ 95 ºC 2’ 95 °C 30’’ 95 °C 30’’ 95 °C 30’’ 30 2 51 ºC 30’’ 51 ºC 30’’ 51 ºC 30’’ cycles 72 °C 1’10’’ 72 °C 30’’ 72 ºC 3’30’’ 3 72 °C 5’ 72 °C 5’ 72 °C 5’ 4 12 °C hold 12 °C hold 12 °C hold

8.12. Sequencing BigDye™ Terminator v3.1 Cycle Sequencing Kit (Thermo Scientific, Waltham, Massachusetts, USA) was used for sequencing. For each sequencing reaction, 1 µl of the BigDye v3.1, 3 µl of the Sequencing buffer, 4 µl of the PCR product and 1 µl of the primer were mixed and filled up to 20 µl with water. The sequencing reactions were run on a T100 Thermal Cycler, using conditions described in Table 6. Used

primers are listed in Table 1. Sanger sequencing reactions were analysed by the UiT sequencing core facility.

Table 6| PCR conditions for the cycle sequencing of the plasmid constructs. 1) Initial denaturation; 2) Denaturation, primer annealing and extension; 3) hold

Steps Temperature Time 1 96 ºC 5’ 96 ºC 10’’ 25 2 50 ºC 5’’ cycles 60 ºC 4’ 3 4 ºC hold

9. Harvesting cells for competition pull-down

E. coli TOP 10 cells carrying pBSB-RR01, pBSB-RR02, or pBSB-RR03 were grown in 200 mL LB media with 20 mg/ml chloramphenicol at 37 ºC. Expression of cloned genes was induced by adding 5 mL of 20 % arabinose to the culture media. Cells were harvested by centrifugation at 2249 x g for 10 minutes and resuspended in 15 % LB-glycerol. Cells were concentrated 30-fold. 1 ml of this cell suspension was stored at - 80 ºC until further use.

10. Pull-down assays

Pull-down assays were performed as mentioned in section 2.4. In addition to a regular pull-down assay, either free c-di-GMP or free biotin was added in order to study the specificity of the binding. The conditions are shown in Table 7.

Table 7| Components of the performed pull-down assays.

Screen/reaction 1 Screen/reaction 2 Screen/reaction 3 Biotinylated c-di-GMP 4 µM 4 µM 4 µM Free c-di-GMP 0 µM 36 µM 0 µM Free biotin 0 µM 0 µM 1 mM

11. Western Blot After electrophoresis, proteins were transferred to a 0.2 μm nitrocellulose membrane (Trans- Blot® Turbo™ Mini Nitrocellulose Transfer Packs), using the Trans-Blot Turbo Transfer System (Bio- Rad, Hercules, California, USA). Electroblotting was carried out for 30 minutes at room temperature (25 V, 1.0 A ). RevertTM Total Protein Stain kit (LICOR, Lincoln, Nebraska, USA) was used to detect total proteins right after transfer from gel to membrane. The membrane was imaged at 700 nm using a Li- Cor Odyssey, S.a., scanning system (LICOR, Lincoln, Nebraska, USA). The membrane was then 31

blocked in Odyssey Blocking Buffer (TBS) for at least 1 hour at room temperature and incubated overnight at 4 ºC with primary antibodies raised against the His-tag (1:2500 monoclonal Anti-His mouse IgG1). Membranes were washed four times for 15 minutes each in TBS-T and incubated with fluorescent labelled secondary antibodies (1:15000 IRDye 800CW anti-mouse IgG) in TBS-T for 2 hours at room temperature. Finally, the membrane was washed five times for 10 minutes each in TBS-T solution and imaged at 800 nm using a Li-Cor Odyssey Sa scanning system.

III – Results

Optimization of pull-down assays to identify c-di-GMP binding proteins To identify novel c-di-GMP effector proteins, a protein pull-down assay was performed. In this pull- down assay, commercially available, biotinylated c-di-GMP was immobilized on streptavidin coated column material and incubated with V. cholerae cell lysate. Proteins bound to the c-di-GMP/column material were eluted with lysis buffer and visualized on a silver-stained SDS-PAGE gel. As control for nonspecific binding, the same assay was performed with non-biotinylated c-di-GMP. Preliminary experiments already revealed that the identification of novel c-di-GMP effector proteins is hampered by a substantial amount of non-specific binding [Singh, personal communication]. In order to reduce these non-specifically bound proteins, we first set out to determine how many times the column material needed to be washed in order to reduce the background. Therefore, the protein-loaded column material was washed sequentially four times with 500 mM NaCl in T-TBS and the eluted proteins were separated on a SDS-PAGE gel and visualized by silver staining (Figure 3).

Biotinylated c-di-GMP screen Control screen

M 1 2 3 4 5 6 7 8 9 10 11 Molecular weight (KDa)

198 98

62 49 38

28 17

14 6 3

Figure 3| A condition where all the proteins were removed was found. SDS-PAGE analysis of the washes

TM carried out using 500 mM NaCl. The gel was stained with the ProteoSilver Silver Stain Kit. Lane M represents the molecular weight marker (SeeBlue Plus2 Pre-Stained Protein Standard). Lane 1 corresponds to the elute sample of the biotinylated c-di-GMP screen. Lanes 2 to 5 show the washes performed in this sample. Lane 6 represents the unbound fraction of proteins of this same sample (before any wash was performed). Lane 7 represents the elute of the control sample. Lanes 8 to 11 represent the washes performed in the control sample.

As expected, only a small amount of proteins did bind to the pull-down bait (Figure 3 lanes 1 and 7), while a large amount of proteins did not interact with it (Figure 3 lane 6). In the wash fractions, the amount of eluted proteins was reduced after each sequential wash in both biotinylated c-di-GMP and control assays. The first wash (Figure 3, lanes 2 and 8) already removed a large part of the non-specific bindings. However, three more washes were performed in order to make sure that every non-specific binding protein would be washed off. Finally, an elution step was performed, in which the complex formed by the biotinylated c-di-GMP molecule and the bound proteins was broken (Figure 3, lanes 1 and 7). Unfortunately, there was no apparent difference between the elutes of both screens. This indicates that, while washing the samples several times reduces the amount of non-specific bindings, a significant amount of proteins that bind to the pull-down components independent of biotinylated c-di-GMP is still present.

The biotin carboxyl carrier protein VC0296 was highly enriched in the biotinylated c-di-GMP screen It has been previously shown that the c-di-GMP concentration changes at different growth phases of a bacterial culture (Koestler and Waters, 2014) and that different effector molecules can bind it at these different cell growth stages. This happens because the expression levels of the proteins that bind c-di-GMP might be different at different cell growth stages. Thus, in order to increase our chances to find new effector molecules, cells were collected at different cell growth phases: exponential (OD600 =

0.5), early (OD600 = 1.0) and late stationary (OD600 = 2.0 and OD600 = 4.0). Then, a pull-down assay was performed in all of them. The eluted proteins were visualized in a silver-stained SDS-PAGE gel and sent to mass spectrometry for total protein identification.

Figure 4| A band at 17 kDa was highly enriched in the biotinylated c-di-GMP screens. SDS-PAGE analysis of the protein pull-down assay carried out with the early stationary phase (OD600 = 1.0). The gel was stained with the ProteoSilverTM Silver Stain Kit. Lane M represents the molecular weight marker (SeeBlue Plus2 Pre-Stained Protein Standard). Lanes 1 and 2 correspond to one set of technical replicates and lanes 3 and 4 to another set of technical replicates. Lanes 1 and 3 show the proteins pulled-down in the biotinylated c-di-GMP screen and lanes 2 and 4 are the respective control screens.

We first started analysing the data from OD600 = 1.0. A unique and very intense band of approximately 17 kDa was observed exclusively in the biotinylated c-di-GMP samples (Figure 5, lanes

1 and 3). This band was also observed in the exponential phase (OD600 = 0.5), but with less intensity (Figure 17, A). This data indicates that this protein may be specifically binding to c-di-GMP. In order to identify it, the band was analysed by mass spectrometry (Table 13). Out of 18 identified proteins, the most enriched was the biotin carboxyl carrier protein (VC0296). VC0296 is part of the enzyme acetyl- CoA carboxylase and serves as a carrier protein for biotin throughout the ATP-dependent carboxylation of acetyl-CoA, forming malonyl-CoA in the first step of fatty acid biosynthesis. In order to get a more accurate result, the biotinylated c-di-GMP screen sample and the control sample (Figure 5, lanes 1 and 2) were sent for mass spectrometry analysis (Figure 6).

V o l c a n o p l o t ( O D = 1 . 0 ) 6 0 0

3 C o n t r o l s c r e e n B t - c d G s c r e e n

V C 0 6 9 5

V C 0 3 4 8

V C 1 7 4 6 V C 0 9 1 8

V C 0 5 5 1 ( O x a l o a c e t a t e d e c a r b o x y l a s e , b e t a ) 2

) V C 2 3 9 2 V C 0 5 4 9 P (

0 V C 0 5 5 0 ( O x a l o a c e t a t e d e c a r b o x y l a s e , a l p h a ) 1 V C 1 5 2 7 ( M o e A ) g V C 0 2 9 6 ( B i o t i n c a r b o x y l c a r r i e r p r o t e i n )

o V C 2 6 9 7 ( G G D E F ) L -

V C 0 7 9 3 V C A 0 5 3 0

V C A 0 9 2 3 V C 1 9 2 5

V C 2 5 2 9 ( R p o N )

V C 2 2 2 4 ( G G D E F )

V C 2 5 5 0 V C A 0 0 2 0 V C 1 3 4 6 V C A 0 0 4 2 ( P l z D ) V C 1 9 7 8 ( H D - G Y P ) V C 0 1 1 4 V C 1 3 7 2 ( G G D E F ) V C A 0 9 6 5 ( G G D E F ) V C 0 7 0 3 ( G G D E F + E A L )

V C 0 4 0 9 ( M s h A )

- 2 0 2 4 6 8

L o g ( B t - c d G / C o n t r o l ) 1 0

Figure 5| Mass spectrometry data from the early stationary phase (OD600 = 1.0) represented in the form of a volcano plot. The data is plotted as log10 of the fold changes versus the -log10 of the adjusted P-value. Dots on the right side of the vertical dotted line represent proteins that are enriched in the biotinylated c-di-GMP screen (bt- cdG). Dots on the left of the dotted line represent proteins more decreased in the biotinylated c-di-GMP screen. The yellow dots represent proteins that have been found in previous screens for c-di-GMP binding proteins but not yet confirmed. The red dots are the proteins that have been previously confirmed to bind c-di-GMP. Brown dots represent the proteins identified on the SDS-PAGE.

The mass spectrometry data were analysed and the abundance of detected proteins was given as protein score (see Materials and Methods for a definition of the score). These protein scores were plotted as volcano plot, where the x-axis represents the log10 of the fold changes, i.e., the protein score of each detected protein, calculated dividing its abundance in the biotinylated c-di-GMP screen by the abundance of that same protein in the control screen. The y-axis shows the -log10 of the adjusted P- value, i.e., the significance of the calculated score. The majority of the pulled down proteins are more abundant in the biotinylated c-di-GMP screen, meaning they were binding to the biotinylated c-di-GMP molecule. Some of the proteins, such as VCA0042, VCA0020 and VCA0530, were highly enriched in the biotinylated c-di-GMP screen, meaning they almost did not bind non-specifically to the magnetic beads or to the streptavidin molecule of the 36

control screen. A t-test was performed and the P-value was determined for all the detected proteins. P is the probability that, if there was no difference between the two screens, we would get, by chance, a difference as large as the one observed. This means that a large difference between the two sets results in a low P-value and vice-versa. In this work, a cut off of 0.05 was defined. This way, when the P-value is lower than 0.05, we defined it as being significant, and when it is higher than this value, we assumed it as not significant. In this case, we plotted its -log10 value, meaning that when this value is higher than 1.30, we define it as being significant. Taking this into account, VC0695, for example, seems to be significantly enriched in the biotinylated c-di-GMP screen. While significant differences are important, we are also interested in strong effects. Therefore, we defined a cut-off of 1.1 for the protein score. In this case, the corresponding log10 value is 0.04. This value was chosen because the well characterized c-di-GMP effector VC2344 (plzC) (Pratt et al., 2007) gave this score in earlier experiments and therefore real effector proteins can be found at these protein scores.

Despite having a low -log10 (P), some of the already known c-di-GMP binding proteins were pulled- down, such as VCA0042 (PlzD). Moreover, we managed to get some c-di-GMP binding proteins that were identified in previously published assays, for instance VC2529 (RpoN) and VC0409 (MshA) (Roelofs et al., 2015). While these have not yet confirmed to bind this second messenger by independent experiments, being able to detect proteins that were also found in screens with different techniques (DRACALA) gives us confidence in our screen. VC0296, which was highly enriched in the biotinylated c-di-GMP screen of the previously shown SDS-PAGE silver stained gel (Figure 5), was also enriched in the mass spectrometry data presented in the volcano plot. This data indicates that this protein might be a possible new effector molecule.

Two more proteins were highly abundant in the biotinylated c-di-GMP screen when performing the pull-down assays under three other different growth stages As previously mentioned, it is thought that different effector molecules might bind c-di-GMP under different cell growth stages. We therefore repeated our analysis with cultures grown until OD600 = 2.0 and OD600 4.0.

A B C

Molecular M 1 2 3 4 Molecular M 1 2 3 4 Molecular M 1 2 3 4 weight weight weight (KDa) (KDa) (KDa)

98 98 98

62 62 62 49 49 49 38 38 38

28 28 28 17 17 17 14 14 14 6 6 6 3 3 3

Figure 6| Two proteins of approximately 60 kDa were specifically enriched in the biotinylated c-di-GMP screens in early and late stationary phase. SDS-PAGE analysis of the protein pull-down assays carried out with A) stationary (OD600 = 1.0), B) late stationary (OD600 = 2.0) and C) late stationary (OD600 = 4.0) cultures. The gel was stained with the ProteoSilverTM Silver Stain Kit. Lane M represents the molecular weight marker (SeeBlue Plus2 Pre-Stained Protein Standard). Lanes 1 and 2 correspond to one technical replicate and lanes 3 and 4 to the other. Lanes 1 and 3 show the proteins pulled-down in the biotinylated c-di-GMP screen and lanes 2 and 4 are the respective control screens. The arrows show the new detected band in all the growth stages.

In these screens, we detected two prominent bands that are only detectable in the biotinylated c-di- GMP pull-down screen and not in the control pull-down. The first protein has a molecular weight of about 17 kDa and appears to be identical to the band we already investigated in our first pull-down screen with cells in early stationary growth phase (Figure 5 and Figure 7, A). In addition to this band, another protein running at ~ 60 kDa was also detected. It is similarly enriched in the biotinylated c-di- GMP screen, just as the 17 kDa band. To identify the protein(s), the band was cut out from the gel and analysed by mass spectrometry (Table 14). Two proteins were highly enriched, i.e., the protein score was very high (~ 100 for both proteins): VC1527 (MoeA –Molybdopterin molybdenumtransferase), and VC0550 (the alpha subunit of the oxaloacetate decarboxylase protein). This data suggests that, besides the biotin carboxyl carrier, these two identified proteins also specifically bind to c-di-GMP.

The three proteins (VC0296, VC1527 and VC0550) may not be specific c-di-GMP effectors Next, we wanted to confirm whether the three proteins mentioned in the previous sections were specific to c-di-GMP or not. For that, two different competition assays were performed.

Free biotin competition assay In the first assay, free biotin is added while the concentration of biotinylated c-di-GMP is being kept constant (Table 8). This way, the free biotin is competing with the biotinylated c-di-GMP for the streptavidin beads and less biotinylated c-di-GMP will be bound to the beads. This means that the proteins that specifically bind to c-di-GMP will also be pulled-down less. In contrast, proteins bound non-specifically to the other components of the pull-down assay (e.g. beads) will be unaffected. Thus, we expected to see a decrease in the intensity of the two bands with increasing free biotin concentration

if proteins bind specifically to c-di-GMP.

M 1 2 3 4 Molecular weight (KDa)

62 49

28 17 14 6

Figure 7| As the concentration of free biotin increases, multiple bands get weaker. SDS-PAGE analysis of the free biotin pull-down competition assay carried out with an overnight culture (OD600 = 4.0). The gel was stained with the ProteoSilverTM Silver Stain Kit. Lane M represents the molecular weight marker (SeeBlue Plus2 Pre- Stained Protein Standard). Lanes 1 to 4 correspond to the biotinylated c-di-GMP samples with increased biotin concentration levels. See Table 1 for the concentration of each component.

Table 8| Biotinylated c-di-GMP, free biotin and free c-di-GMP concentrations used in the free biotin competition assay.

Sample Components 1 2 3 4 Biotinylated c-di-GMP 200 µM 200 µM 200 µM 200 µM Free Biotin 0 µM 5 mM 10 mM 50 mM Free c-di-GMP 0 µM 0 µM 0 µM 0 µM

As shown in Figure 8, as the free biotin concentration increases, the two bands previously mentioned (~ 17 kDa and ~ 60 kDa) start to fade out. This behaviour is consistent with a protein that binds to c-di- GMP. Though, when the free biotin concentration is increased, not only the two bands fade out, but also the entire samples become less intense. This result was unexpected, since we believe that the majority of the proteins are unspecific binders. However, we did not have a loading control, making it difficult to see in this assay if the same amount of protein was loaded on the beads. If not, this could be a potential reason why all proteins are reduced with the addition of free biotin. Alternatively, the proteins could bind to biotin or the linker that connects c-di-GMP and biotin in the biotinylated c-di-GMP bait, indicating they were all non-specifically bindings.

Free c-di-GMP competition assay To distinguish if the pulled-down proteins interact with the c-di-GMP part of the biotinylated c-di- GMP bait or the linker/biotin, a second competition assay was performed (Figure 9 and Table 9). In this assay, the free c-di-GMP concentration is increased and the concentration of biotinylated c-di-GMP is kept constant. The free c-di-GMP is competing with the biotinylated c-di-GMP for the c-di-GMP binding proteins, which means that the proteins that specifically bind to c-di-GMP will not be pulled-down, as they start binding to the free c-di-GMP molecule. Therefore, we expected to see a decrease in the intensity of the bands of c-di-GMP specific proteins with increasing free c-di-GMP concentrations.

M M 1 2 3 4 Molecular weight (KDa)

62 49

28 17 14 6

Figure 8| The potential c-di-GMP binding proteins do not compete with free c-di-GMP. SDS-PAGE analysis of the free c-di-GMP pull-down competition assay carried out with an overnight culture (OD600 = 4.0). The gel was stained with the ProteoSilverTM Silver Stain Kit. Lanes M represents the molecular weight marker (SeeBlue Plus2 Pre-Stained Protein Standard). Lanes 1 to 4 correspond to biotinylated c-di-GMP samples. Concentrations of each component can be found in Table 2.

Table 9| Biotinylated c-di-GMP, free biotin and free c-di-GMP concentrations used in the free c-di-GMP competition assay.

Sample Components 1 2 3 4

Biotinylated c-di-GMP 200 µM 200 µM 200 µM 200 µM

Free Biotin 0 µM 0 µM 0 µM 0 µM Free c-di-GMP 0 µM 1,25 mM 5 mM 90 mM

As free c-di-GMP concentration is increased, the two bands (~ 17 kDa and ~ 60 kDa) remain highly visible. These finding indicates that the proteins present in these two bands may actually be not binding specifically to c-di-GMP.

VCA0020, VC2392 and VC1346 genes were chosen for genomic analysis

After plotting the mass spectrometry data from all the pull-down assays’ screens (at OD600 = 0.5,

OD600 = 1.0, OD600 = 2.0 and OD600 = 4.0) in separate volcano plots, we combined it in one single volcano plot. This way, we aimed to identify the most enriched proteins in all the growth stages and choose three to proceed with the genomic analysis.

V o l c a n o p l o t ( C o m b i n e d d a t a )

C o n t r o l s c r e e n B t - c d G s c r e e n

V C 0 5 5 0 ( O x a l o a c e t a t e d e c a r b o x y l a s e , a l p h a )

2 ) P ( 0 1 g o L

- V C 0 7 9 3

V C 0 5 5 1

1 V C 2 3 9 2 V C 0 5 4 9 V C 0 9 1 8 V C 1 7 4 6

V C 0 2 9 6 ( B i o t i n c a r b o x y l c a r r i e r p r o t e i n ) V C A 1 0 2 7 V C A 0 7 4 8

V C 2 2 9 2 V C A 0 5 3 0 V C 1 4 4 1 V C 1 5 2 7 ( M o e A ) V C 1 9 2 5 V C A 0 9 2 3 V C 2 5 2 9 ( R p o N )

V C 2 2 2 4 ( G G D E F ) V C A 0 9 5 2 ( V p s T ) V C 1 9 7 8 ( H D - G Y P ) V C 1 3 4 6 V C 2 5 5 0 V C A 0 0 4 2 ( P l z D ) V C A 0 6 8 1 ( H D - G Y P ) V C A 0 0 2 0 V C 0 1 1 4

V C 0 4 0 9 ( M s h A )

V C A 0 9 6 5 ( G G D E F ) V C A 0 7 3 5 ( P l z E )

V C 0 7 0 3 ( G G D E F + E A L ) V C 2 6 9 7 ( G G D E F ) V C 0 6 6 5 ( V p s R ) V C 1 2 0 1 ( H D - G Y P ) V C 1 3 7 2 ( G G D E F ) 0

- 2 0 2 4 6 8

L o g ( B t - c d G / C o n t r o l ) 1 0 Figure 9| Mass spectrometry data from the combined data represented in the form of a volcano plot. The data is plotted as log10 of the fold changes versus the -log10 of the adjusted P-value. Dots on the right side of the vertical dotted line represent proteins that are enriched in the biotinylated c-di-GMP screen (bt-cdG). Dots on the left of the dotted line represent proteins more decreased in the biotinylated c-di-GMP screen. The yellow dots represent proteins that have been found in previous screens for c-di-GMP binding proteins but not yet confirmed. The red dots are the proteins that have been previously confirmed to bind c-di-GMP. Brown dots represent the proteins identified on the SDS-PAGE. Red squares represent the chosen proteins (VC2392, VC1346 and VCA0020).

Interestingly, a clear group of enriched proteins is possible to see in the volcano plot (Figure 10), in which two of them have been previously confirmed to bind c-di-GMP: VpsT (Krasteva et al., 2010) and PlzD (Roelofs et al., 2015). The aim was to choose three of them to begin with, even though future work is needed in order to study the entire set of proteins. This way, VC2392, VC1346 and VCA0020 genes were chosen. VC2392 protein (mutT pyrophosphohydrolase protein) is involved in DNA repair. It contains hydrolase activity and it is important in preventing errors in DNA replication by hydrolysing mutagenic nucleotides (Mildvan et al., 1999). VC1346 gene encodes for an uncharacterized protein, 41

but it is known that it contains a fumarylacetoacetase N-terminal domain, whose function is also undetermined. Finally, VCA0020 protein is present in type VI secretion system (T6SS) of V. cholerae and contributes to T6SS-dependent killing of bacterial cells (Zheng et al., 2011).

Cloning and overexpression of VCA0020, VC1346 and VC2392 Next, in order to test the specificity of VCA0020, VC1346 and VC2392 to c-di-GMP, we cloned them on the expression vector pBAD33 (Figure 21 and Figure 22). This vector contains the inducable PBAD promotor, which is part of the arabinose operon. The genes araA, araB and araD code for the enzymes necessary to catabolize arabinose. The promoter of this operon contains regulatory regions including a site named araI. The transcription of the operon is regulated by the activator encoded by araC gene, which has affinity to the araI site. Depending on the concentration of arabinose, this operon can be under either positive or negative control: when arabinose is present in the cell, it binds to the araC protein and forms a complex that binds to the araI site. In this configuration, RNA polymerase binds to the operon and begins transcription of the genes that will break down arabinose, a source of energy for the cell; in contrary, when arabinose concentration is low, the AraC protein acts as a repressor – one monomer binds to the operator region araO of the araBAD genes and another monomer binds to the araI site, forming a DNA loop. This orientation blocks RNA polymerase from binding to the araBAD promoter. Therefore, transcription of structural genes araBAD is inhibited. (Guzman et al., 1995). VCA0020, VC1346 and VC2392 were cloned right after pBAD promotor, at the SphI restriction site (Figure 22). This way, by adding arabinose, we managed to regulate their expression. During cloning, a C-terminal His-tag was inserted. The resulting constructs were transformed into E. coli TOP 10 and a pull-down assay was performed. We tested three different conditions: a regular pull- down without competition and competitions with either excess of free biotin or excess of free c-di-GMP (section 10 of the Materials and Methods). Pulled-down proteins were tested with antibodies raised against the His-tag in Western blot analysis. Details of the workflow can be found in Figure 21. pBAD33 was successfully digested with the restriction enzyme SphI As a first step in cloning VCA0020, VC1346 and VC2392, the plasmid pBAD33 was linearized by restriction digested. SphI, a restriction enzyme that cuts at GCATG/C, was used. The success of the digestion was confirmed by running the end product of the digest on a 1 % agarose gel (Figure 11).

M 1 2 DNA size (bp)

20000 10000 7000 5000 4000 3000

2000 1500

1000 700 500 400 300 200 75

Figure 10| Successful digestion of pBAD33 plasmid with SphI restriction enzyme. Lane M represents the DNA size marker (GeneRuler 1 kb Plus DNA Ladder). Lane 1 corresponds to the linearized pBAD33 plasmids and lane 2 shows the negative control (circular pBAD33 plasmids).

pBAD33 plasmid has a size of 5352 bp, which means that in the lane 1 (linearized pBAD33 plasmid) a band between 5000 bp and 7000 bp should be visible. As the Figure 11 shows, this band is present in the correct size. Besides the linearized plasmid, a few bands above the latter were also present, possibly due to some circular plasmids present in the sample that were not digested by the enzyme. As a negative control, a circular pBAD33 plasmid was run in the lane 2. As the DNA is circular, it may take on several conformations and therefore it may show up in a different position in the gel. These results suggest that we managed to get some linearized pBAD33 plasmids. To enrich for this cut pBAD33, DNA of the expected size was cut out of the gel and purification using the QIAquick Gel Extraction kit.

VCA0020, VC1346 and VC2392 genes were successfully amplified by PCR Next, the three genes were amplified by PCR with primers that brought in overhangs necessary for integration to pBAD33. Details of the primer design are explained in the section 8.6 of Materials and Methods. PCR products were visualized on a 1 % agarose gel (Figure 12).

Figure 11| Successful amplification of VCA0020, VC1346 and VC2392 genes. Confirmation of the amplification of the three genes on a 1 % agarose gel. Lanes M represent the DNA size marker (GeneRuler 1 kb Plus DNA Ladder). Lane 1 corresponds to the amplified VCA0020 gene and lanes 2 and 3 to the amplified VC1346 and VC2392 genes, respectively.

The size of each PCR product was consistent with the expected size of each amplified gene (Table 15). This indicates that the PCR amplification of the genes was successful.

Gibson assembly cloning, transformation and colony PCR Next, Gibson assembly cloning was used to ligate PCR amplified genes and linearized pBAD33. After the reaction, the mix was transformed into E. coli TOP10 competent cells by chemical transformation. Each transformation was spread on chloramphenicol plates and incubated at 37 ºC overnight. In order to confirm the success of the cloning, eight different colonies per transformation were selected and a colony PCR was performed (Figure 13).

Figure 12| Colony PCR of cloning reactions. Confirmation of the sizes of the constructs on a 1 % agarose gel. Lanes M represent the DNA size in base pairs (bp) (GeneRuler 1 kb Plus DNA Ladder). Lanes 1 to 8 correspond to the eight selected colonies per transformation: A) VC1346 (pBSB-RR01), B) VC2392 (pBSB- RR02), C) VCA0020 (pBSB-RR03, D) VCA0020 (pBSB-RR03).

pBSB-RR01 selected colonies (which contained the inserted VC1346 gene) were all successfully transformed, since the bands are present within the expected DNA sizes (see Table S6 for expected sizes) (Figure 13, A). Regarding the pBSB-RR02 constructs (with the inserted VC2392 gene), only one of the tested colonies was not transformed (Figure 13, B, lane 6). Finally, only two of the tested colonies were transformed with the pBSB-RR03 construct (containing the inserted VCA0020 gene) (Figure 13, C, lanes 3 and 4). Since three colonies were chosen to maximize the changes of getting one without mutations, a colony PCR was performed in another set of eight colonies transformed with the pBSB- RR03 constructs (Figure 13, D). In this case, only one of the tested colonies was transformed successfully (Figure 13, D, lane 3).

VC1346 and VCA0020 may not be specifically binding to c-di-GMP To study the specificity of the binding between VC1346/VCA0020 and c-di-GMP, a pull-down assay with three different competition reactions was performed. Pulled-down proteins were tested in Western blots with anti-His specific antibodies that can detect the His-tagged C-terminus of the cloned genes (Figure 14).

A B 1 2 3 1 2 3 His tag His - α Total Protein

Figure 13| The intensity of the bands does not indicate a possible specific binding to c-di-GMP. Lanes 1 represent the sample with only biotin-labelled c-di-GMP. Lanes 2 correspond to the sample with free c-di-GMP added. Lanes 3 show the condition in which free biotin was added. A) Western blot against his-tagged VC1346 gene. B) Western blot against his-tagged VCA0020 gene. The red colour represents the total protein intensity (at 700 nm), measured before the addition of the antibodies, and the green colour shows the intensity of the his-tagged protein bands (at 800 nm), in each condition.

If VC1346 and VCA0020 were specifically binding to c-di-GMP, a decrease in the intensity of the bands (before and after adding the antibodies) was expected. In the first condition (Figure 14, lanes 1), 45

only biotin-labelled c-di-GMP (bt-cdG) was present. In the second condition (Figure 14, lanes 2), free c-di-GMP was added (bt-cdG/cdG) and in the third (lanes 3), free biotin (bt-cdG/Bt). When adding free c-di-GMP (Figure 14, lanes 2), the proteins were expected to also bind it and be washed away with the salt. Free biotin (Figure 14, lanes 3) was expected to block the interaction between the biotin-labelled c-di-GMP and the streptavidin, leading to a reduction in the number of proteins pulled-down and, as a consequence, to a decrease in the intensity of the bands, comparing to the first condition (Figure 14, lanes 1). However, the observed intensity of lanes 1 and 2 are almost the same. When adding free biotin (Figure 14, lanes 3), the intensity of the bands decreased, but it was not considered meaningful, since it is not supported by the results from the free c-di-GMP assay. The same pattern was found after adding the antibodies. These data suggest that these proteins are not specifically binding to c-di-GMP.

MutT (VC2392) might be a novel c-di-GMP effector protein To study the specificity of the binding between VC2392 and c-di-GMP, the same experiment was performed (Figure 15).

1 2 3 A B 1 His tag His - α

0,5 Relative intensity

Total Protein 0 Bt-cdG Bt-cdG/cdG Bt-cdG/Bt

anti-His tag Total Protein

Figure 14| MutT might be specifically binding to c-di-GMP. A) Western blot experiment on his-tagged mutT gene (VC2392). Lane 1 represents a sample with only biotin-labelled c-di-GMP. Lane 2 corresponds to the sample with free c-di-GMP added. Lane 3 shows the condition in which free biotin it was added. B) Representation of the relative intensities of the Western blot bands. The red color represents the total protein intensity (at 700 nm), measured before the addition of the antibodies, and the green color shows the intensity of the his-tagged protein bands (at 800 nm), in each condition. Bt-cdG/cdG represents the condition where an excess of free c-di-GMP was added to the sample. Bt-cdG/Bt corresponds to the condition where an excess of free biotin was added to the sample.

Table 10| Total Protein and MutT band intensities and their normalization.

Total MutT intensity normalized MutT protein Condition Protein Normalization Normalization against Total Protein intensity intensity intensity Bt – cdG 1510000 0,877906977 46600 1 1,139072848 Bt–cdG/cdG 1720000 1 26900 0,577253219 0,577253219 Bt – cdG/Bt 1210000 0,703488372 14100 0,302575107 0,430106764

The same previous experiment was performed with MutT protein (VC2392) (Figure 15, A). Figure 15, B, represents the relative intensities of the MutT bands. We looked at the sample with the maximum band intensities in both MutT and total protein assays and gave it a value of 1. Then, the other lanes’ band intensities were normalized against the corresponding lane with the maximum intensity, in both MutT and total protein assays. With this, we aimed to facilitate the interpretation of the results. Finally, the MutT band intensities were normalized against the intensity of the respective total protein sample, in order to compare the protein level variation from one condition to another. More detailed data can be seen in Table 10. As previously mentioned, if MutT was specifically binding to c-di-GMP, a decrease in the intensities of the bands was expected. Regarding total protein, however, even though a reduction was observed when adding free biotin (Figure 15, B), the excess of free c-di-GMP led to an increase in the intensity, comparing to the biotinylated c-di-GMP condition (bt-cdG). That may have happened as a consequence of the loading or even the transfer efficiency – that is why the data was normalized. With respect to the his-tagged protein bands, when an excess of free c-di-GMP was added to the sample, a decrease of almost 50 % on the intensity was observed, which means that this protein also bound specifically to the free c-di-GMP and for this reason was washed off during the wash’s steps. Moreover, when adding free biotin, the decrease in the intensity of the bands was even bigger comparing to the first condition. Free biotin possibly blocked the binding between the biotin-labelled c-di-GMP and the streptavidin, and, as a consequence, MutT protein was not pulled-down together with the beads, since it was specifically binding to c-di-GMP. When looking to Table 10, it is possible to confirm in more detail this decrease in the protein level from one condition to another. These data indicate that MutT may be a novel c-di-GMP effector protein. However, further studies are needed in order to confirm these results, since this experiment was only performed once.

IV – Discussion and Conclusion

c-di-GMP regulates a wide breath of phenotypes in V. cholerae and many other organisms. So far, the few discovered effector molecules cannot explain the majority of them. This raises the possibility that additional c-di-GMP binding effector remain uncharacterized. Identifying these molecules and investigating their role in lifestyle switches, adaptation and virulence will be the next necessary step to further understanding of c-di-GMP signalling. Particularly in V. cholerae, a devastating pathogen and an organism which infection cycle is strongly dependent on c-di-GMP, a deeper understanding of effector molecules might offer new targets for intervention of infections. This study aimed to optimize a protein pull-down assay, in order to screen for novel candidate effector molecules. To reduce the nonspecific binding that impedes the detection of c-di-GMP effector, washing conditions with different stringency were tested and several candidate binding proteins were detected. Several selected candidates were investigated further and tested in competition assays with free c-di-GMP and free biotin. Ultimately, one candidate passed these tests and is therefore a new candidate effector molecule. Almost all proteins contain charged amino acids. Even though the charged groups are often present at the active site of the protein – where they interact electrostatically with substrates – they are also found on the surface of the protein. Interactions between charged groups are referred to as “electrostatics” in protein biochemistry (Gitlin et al., 2006). Since we aimed to pull-down the proteins that specifically bind to c-di-GMP, we tried to minimize the number of the non-specifically bound proteins. For that, the protein surface charges were neutralized using NaCl, preventing the unspecific clustering of proteins and, as a consequence, the pull-down of the non-specific binding proteins. After testing different concentrations, 154 mM was chosen, since it resulted in a higher difference between the number of proteins pulled-down in the biotinylated c-di-GMP screen and in the control screen (Figure 4). Additionally, this salt concentration was also used in a previous c-di-GMP pull-down study by Chamber and Sauer (Chambers and Sauer, 2017). Non-specific protein binding is a common problem in pull-down experiments and the most effective strategy must reserve all specific interaction events, which sometimes are inevitably removed when the salt concentration is increased. We did not manage to reduce the number of non-specifically bound proteins as we increased the salt concentration. One explanation may be the low number of repetitions of the assays (200 mM NaCl, 250 mM NaCl and 300 mM NaCl), which led to the absence of error bars, making it difficult to conclude whether there was or not a significant reduction in the number of non-specifically bound proteins. Alternatively, other interactions like Van der Wall forces, hydrophobic interactions, hydrogen bonds and covalent bonds can result in unspecific binding, so neutralizing the electrostatic interactions may not have been sufficient to reduce the background binding substantially (Gitlin et al., 2006). Therefore, looking at alternative ways to answer this problem might be a relevant future approach. The mass spectrometry data from all the pull-down assays’ screens (exponential, early stationary, late stationary phases and overnight cultures) was combined in a single volcano plot in order to identify the most enriched proteins in all growth stages. Sixteen proteins were clearly separated from the rest, having a higher protein score. In this cluster of proteins, VpsT and PlzD, two proteins previously proven to specifically bind c-di-GMP, were detected. However, MshE, also known to bind c-di-GMP, was not 48

found in the volcano plot. VC2392, VC1346 and VCA0020 were chosen as the first set of proteins to be further characterized. VC1346 and VCA0020 turned out to be non-specific bindings, but MutT protein (VC2392) was found as a new possible c-di-GMP effector molecule. There are few studies on MutT protein, being none of them on V. cholerae. However, it is known that is protein is involved in DNA repair, preventing errors in DNA replication by hydrolysing mutagenic nucleotides (Mildvan et al., 1999). Further work is needed in order to determine whether MutT is really specifically binding to c-di-GMP and if/how its function is altered by the second messenger. As a first step, it is necessary to reproduce the pull-down assays with the three competition conditions, in order to test the reproducibility of the experiment. After this, and having positive results in the competition assays, i.e., a decrease in the intensity of the Western blot bands (~ 17 kDa and ~ 60 kDa), the purification of the protein and the study of its role in V. cholerae would be the next step. One way to achieve it would be by deleting mutT and investigating the phenotypes of the deletion mutant and their relation to known c-di-GMP related phenotypes. While the modification of cellular c-di-GMP concentrations results in many phenotypic changes, the mutant should be “blind” to c-di-GMP and not change their behaviour for one of several of these phenotypes. Complementation of the mutant should revert the knock-out phenotypes and re- establish the sensitivity to changes in c-di-GMP. Additionally, the study of the other enriched proteins present in the volcano plot of the combined data will also be an objective.

V – References

1. VC0296 - acetyl-CoA carboxylase biotin carboxyl carrier protein subunit [Online]. NCBI. Available: https://www.ncbi.nlm.nih.gov/gene/2614966 [Accessed 20th october 2019]. 2. ALMAGRO-MORENO, S., PRUSS, K. & TAYLOR, R. K. 2015. Intestinal Colonization Dynamics of Vibrio cholerae. PLoS Pathog, 11, e1004787. 3. ANWARUK HUQ, E. B., SMALL PAUL A., EST M., IMDADUL HUQ, REZAUR, RAHMAN RITA R., COLWELL 1982. Ecological Relationships Between Vibrio cholerae and Planktonic Crustacean Copepods. APPLIED AND ENVIRONMENTAL MICROBIOLOGY, 45, 275-283. 4. AYALA, J. C., WANG, H., BENITEZ, J. A. & SILVA, A. J. 2018. Molecular basis for the differential expression of the global regulator VieA in Vibrio cholerae biotypes directed by H-NS, LeuO and quorum sensing. Mol Microbiol, 107, 330-343. 5. BARUA, D. 1992. History of Cholera. Current Topics in Infectious Disease, 1. 6. BENACH, J., SWAMINATHAN, S. S., TAMAYO, R., HANDELMAN, S. K., FOLTA-STOGNIEW, E., RAMOS, J. E., FOROUHAR, F., NEELY, H., SEETHARAMAN, J., CAMILLI, A. & HUNT, J. F. 2007. The structural basis of cyclic diguanylate signal transduction by PilZ domains. EMBO J, 26, 5153-66. 7. BENZIMAN M, R. P., WEINHOUSE H, ALONI Y, MICHAELI D, WEINBERGER-OHANA P 1987. Regulation of cellulose synthesis in Acetobacter xylinum by cyclic diguanylic acid. 325, 279. 8. BERK, V., FONG, J. C., DEMPSEY, G. T., DEVELIOGLU, O. N., ZHUANG, X., LIPHARDT, J., YILDIZ, F. H. & CHU, S. 2012. Molecular architecture and assembly principles of Vibrio cholerae biofilms. Science, 337, 236-9. 9. CATHARINA CASPER-LINDLEY, F. H. Y. 2004. VpsT Is a Transcriptional Regulator Required for Expression of vps Biosynthesis Genes and the Development of Rugose Colonial Morphology in Vibrio cholerae O1 El Tor. JOURNAL OF BACTERIOLOGY, 186, 1574–1578. 10. CHAMBERS, J. R. & SAUER, K. 2017. Detection of Cyclic di-GMP Binding Proteins Utilizing a Biotinylated Cyclic di- GMP Pull-Down Assay. Methods Mol Biol, 1657, 317-329. 11. CHAMBERS JR, S. K. 2017. Detection of cyclic di-GMP binding proteins utilizing a biotinylated cyclic di-GMP pulldown assay. Methods Mol Biol., 317-329. 12. CHIAVELLI, D. A., MARSH, J. W. & TAYLOR, R. K. 2001. The mannose-sensitive hemagglutinin of Vibrio cholerae promotes adherence to zooplankton. Appl Environ Microbiol, 67, 3220-5. 13. CONNER, J. G., ZAMORANO-SANCHEZ, D., PARK, J. H., SONDERMANN, H. & YILDIZ, F. H. 2017. The ins and outs of cyclic di-GMP signaling in Vibrio cholerae. Curr Opin Microbiol, 36, 20-29. 14. COSTERTON, J. W., LEWANDOWSKI, Z., CALDWELL, D. E., KORBER, D. R. & LAPPIN-SCOTT, H. M. 1995. Microbial biofilms. Annu Rev Microbiol, 49, 711-45. 15. DORIT AMIKAM, M. Y. G. 2006. PilZ domain is part of the bacterial c-di-GMP binding protein. Bioinformatics, 22, 3–6. 16. DUERIG, A., ABEL, S., FOLCHER, M., NICOLLIER, M., SCHWEDE, T., AMIOT, N., GIESE, B. & JENAL, U. 2009. Second messenger-mediated spatiotemporal control of protein degradation regulates bacterial cell cycle progression. Genes Dev, 23, 93-104. 17. ECHAZARRETA, M. A., KEPPLE, J. L., YEN, L. H., CHEN, Y. & KLOSE, K. E. 2018. A Critical Region in the FlaA Flagellin Facilitates Filament Formation of the Vibrio cholerae Flagellum. J Bacteriol, 200. 18. EDMOND WONG, G. V.-K., AVISHEK GHOSH, RAMON HURTADO-GUERRERO, PETER V. KONAREV, ADEL F. M. IBRAHIM, DMITRI I. SVERGUN, VINCENT G. H. EIJSINK, NABENDU S. CHATTERJEE, DAAN M. F. VAN AALTEN 2012. The Vibrio cholerae Colonization Factor GbpA Possesses a Modular Structure that Governs Binding to Different Host Surfaces. PLoS Pathog, 8. 19. FARUQUE, S. M., ALBERT, M. J. & MEKALANOS, J. J. 1998. Epidemiology, genetics, and ecology of toxigenic Vibrio cholerae. Microbiol Mol Biol Rev, 62, 1301-14. 20. FARUQUE, S. M. & NAIR, G. B. 2002. Molecular ecology of toxigenic Vibrio cholerae. Microbiol Immunol, 46, 59-66. 21. FINERAN, P. C., WILLIAMSON, N. R., LILLEY, K. S. & SALMOND, G. P. 2007. Virulence and prodigiosin antibiotic biosynthesis in Serratia are regulated pleiotropically by the GGDEF/EAL domain protein, PigX. J Bacteriol, 189, 7653- 62. 22. FONG, J. C., SYED, K. A., KLOSE, K. E. & YILDIZ, F. H. 2010. Role of Vibrio polysaccharide (vps) genes in VPS production, biofilm formation and Vibrio cholerae pathogenesis. Microbiology, 156, 2757-69. 23. FRETER, R. & JONES, G. W. 1976. Adhesive properties of Vibrio cholerae: nature of the interaction with intact mucosal surfaces. Infect Immun, 14, 246-56. 24. GITLIN, I., CARBECK, J. D. & WHITESIDES, G. M. 2006. Why are proteins charged? Networks of charge-charge interactions in proteins measured by charge ladders and capillary electrophoresis. Angew Chem Int Ed Engl, 45, 3022- 60. 25. GUENTZEL, B. 1975. Motility as a virulence factor for Vibrio cholerae. 26. GUZMAN, L. M., BELIN, D., CARSON, M. J. & BECKWITH, J. 1995. Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter. J Bacteriol, 177, 4121-30. 27. HALL-STOODLEY, L., COSTERTON, J. W. & STOODLEY, P. 2004. Bacterial biofilms: from the natural environment to infectious diseases. Nat Rev Microbiol, 2, 95-108. 28. HENGGE, R. 2009. Principles of c-di-GMP signalling in bacteria. Nat Rev Microbiol, 7, 263-73. 29. HOWARD-JONES, N. 1984. Robert Koch and the cholera vibrio: a centenary. Br Med J (Clin Res Ed), 288, 379-81.

30. HU, D., LIU, B., FENG, L., DING, P., GUO, X., WANG, M., CAO, B., REEVES, P. R. & WANG, L. 2016. Origins of the current seventh cholera pandemic. Proc Natl Acad Sci U S A, 113, E7730-E7739. 31. HUNG, D. T., ZHU, J., STURTEVANT, D. & MEKALANOS, J. J. 2006. Bile acids stimulate biofilm formation in Vibrio cholerae. Mol Microbiol, 59, 193-201. 32. JASON B. HARRIS, R. C. L., FIRDAUSI QADRI, EDWARD T. RYAN, STEPHEN B. CALDERWOOD 2012. Cholera. National Institute of Health, 379, 2466–2476. 33. JONES, C. J., UTADA, A., DAVIS, K. R., THONGSOMBOON, W., ZAMORANO SANCHEZ, D., BANAKAR, V., CEGELSKI, L., WONG, G. C. & YILDIZ, F. H. 2015. C-di-GMP Regulates Motile to Sessile Transition by Modulating MshA Pili Biogenesis and Near-Surface Motility Behavior in Vibrio cholerae. PLoS Pathog, 11, e1005068. 34. KAPER, J. B., MORRIS, J. G., JR. & LEVINE, M. M. 1995. Cholera. Clin Microbiol Rev, 8, 48-86. 35. KAVIC, S. M., FREHM, E. J. & SEGAL, A. S. 1999. Case studies in cholera: lessons in medical history and science. Yale J Biol Med, 72, 393-408. 36. KIRN, T. J., JUDE, B. A. & TAYLOR, R. K. 2005. A colonization factor links Vibrio cholerae environmental survival and human infection. Nature, 438, 863-6. 37. KLOSE, K. E. 2001. Regulation of virulence in Vibrio cholerae. Int J Med Microbiol, 291, 81-8. 38. KO-HSIN CHIN, W. T. K., YU-JEN YU, YI-TING LIAO, MING-TE YANG, SHAN-HO CHOU 2012. Structural polymorphism of c-di-GMP bound to an EAL domain and in complex with a type II PilZ-domain protein 39. KOESTLER, B. J. & WATERS, C. M. 2014. Bile acids and bicarbonate inversely regulate intracellular cyclic di-GMP in Vibrio cholerae. Infect Immun, 82, 3002-14. 40. KOUSHIK PAUL, V. N., WILLIAM C. CARLQUIST, DAVID F. BLAIR, RASIKA M. HARSHEY 2010. The c-di-GMP Binding Protein YcgR Controls Flagellar Motor Direction and Speed to Affect Chemotaxis by a “Backstop Brake” Mechanism 41. KRASTEVA, P. V., FONG, J. C., SHIKUMA, N. J., BEYHAN, S., NAVARRO, M. V., YILDIZ, F. H. & SONDERMANN, H. 2010. Vibrio cholerae VpsT regulates matrix production and motility by directly sensing cyclic di-GMP. Science, 327, 866-8. 42. LE DOUJET, T., DE SANTI, C., KLEMETSEN, T., HJERDE, E., WILLASSEN, N. P. & HAUGEN, P. 2019. Closely- related Photobacterium strains comprise the majority of bacteria in the gut of migrating Atlantic cod (Gadus morhua). Microbiome, 7, 64. 43. LEE, S. H., ANGELICHIO, M. J., MEKALANOS, J. J. & CAMILLI, A. 1998. Nucleotide sequence and spatiotemporal expression of the Vibrio cholerae vieSAB genes during infection. J Bacteriol, 180, 2298-305. 44. LEE, S. H., BUTLER, S. M. & CAMILLI, A. 2001. Selection for in vivo regulators of bacterial virulence. Proc Natl Acad Sci U S A, 98, 6889-94. 45. LI, T. N., CHIN, K. H., FUNG, K. M., YANG, M. T., WANG, A. H. & CHOU, S. H. 2011. A novel tetrameric PilZ domain structure from xanthomonads. PLoS One, 6, e22036. 46. LONGINI, I. M., JR., YUNUS, M., ZAMAN, K., SIDDIQUE, A. K., SACK, R. B. & NIZAM, A. 2002. Epidemic and endemic cholera trends over a 33-year period in Bangladesh. J Infect Dis, 186, 246-51. 47. LOUIS, P. & O'BYRNE, C. P. 2010. Life in the gut: microbial responses to stress in the gastrointestinal tract. Sci Prog, 93, 7-36. 48. LUIGI VEZZULLI, C. P., ANWAR HUQ, RITA R. COLWELL 2010. Environmental reservoirs of Vibrio cholerae and their role in cholera. Environmental Microbiology Reports, 2, 27–33. 49. MARTINEZ-WILSON HF, T. R., TISCHLER AD, LAZINSKI DW, CAMILLI A. 2008. The vibrio cholerae hybrid sensor kinase VieS contributes to motility and biofilm regulation by altering the cyclic diguanylate level. 50. MATA, A. R., PACHECO, C. M., CRUZ PEREZ, J. F., SAENZ, M. M. & BACA, B. E. 2018. In silico comparative analysis of GGDEF and EAL domain signaling proteins from the Azospirillum genomes. BMC Microbiol, 18, 20. 51. MILDVAN, A. S., WEBER, D. J. & ABEYGUNAWARDANA, C. 1999. Solution structure and mechanism of the MutT pyrophosphohydrolase. Adv Enzymol Relat Areas Mol Biol, 73, 183-207. 52. MOHAMMAD SIRAJUL ISLAM, B. S. D., R BRADLEY SACK 1994. The Aquatic Flora and Fauna as Reservoirs of Vibrio cholerae: A Review Journal of Diarrhoeal Diseases Research, 12, 87-96. 53. MOISI, M., JENUL, C., BUTLER, S. M., NEW, A., TUTZ, S., REIDL, J., KLOSE, K. E., CAMILLI, A. & SCHILD, S. 2009. A novel regulatory protein involved in motility of Vibrio cholerae. J Bacteriol, 191, 7027-38. 54. NALIN, D. R., DAYA, V., REID, A., LEVINE, M. M. & CISNEROS, L. 1979. Adsorption and growth of Vibrio cholerae on chitin. Infect Immun, 25, 768-70. 55. NELSON, E. J., HARRIS, J. B., MORRIS, J. G., JR., CALDERWOOD, S. B. & CAMILLI, A. 2009. Cholera transmission: the host, pathogen and bacteriophage dynamic. Nat Rev Microbiol, 7, 693-702. 56. PRATT, J. T., TAMAYO, R., TISCHLER, A. D. & CAMILLI, A. 2007. PilZ domain proteins bind cyclic diguanylate and regulate diverse processes in Vibrio cholerae. J Biol Chem, 282, 12860-70. 57. PROUTY, M. G., CORREA, N. E. & KLOSE, K. E. 2001. The novel sigma54- and sigma28-dependent flagellar gene transcription hierarchy of Vibrio cholerae. Mol Microbiol, 39, 1595-609. 58. PURSLEY, B. R. 2016. Defining the roles of the Vc2 riboswitch and tfoY in the c-di-GMP regulatory network of Vibrio cholerae. Michigan State University. 59. REIDL, J. & KLOSE, K. E. 2002. Vibrio cholerae and cholera: out of the water and into the host. FEMS Microbiol Rev, 26, 125-39. 60. ROELOFS, K. G., JONES, C. J., HELMAN, S. R., SHANG, X., ORR, M. W., GOODSON, J. R., GALPERIN, M. Y., YILDIZ, F. H. & LEE, V. T. 2015. Systematic Identification of Cyclic-di-GMP Binding Proteins in Vibrio cholerae Reveals

a Novel Class of Cyclic-di-GMP-Binding ATPases Associated with Type II Secretion Systems. PLoS Pathog, 11, e1005232. 61. ROMLING, U., GALPERIN, M. Y. & GOMELSKY, M. 2013. Cyclic di-GMP: the first 25 years of a universal bacterial second messenger. Microbiol Mol Biol Rev, 77, 1-52. 62. RYAN, E. T. 2011. The Cholera Pandemic, Still with Us after Half a Century: Time to Rethink. PLOS Negleted Tropical Diseases. 63. RYJENKOV DA, S. R., RÖMLING U, GOMELSKY M. 2006. The PilZ domain is a receptor for the second messenger c-di-GMP: the PilZ domain protein YcgR controls motility in enterobacteria. 64. SAMADI, A. R., HUQ, M. I., SHAHID, N., KHAN, M. U., EUSOF, A., RAHMAN, A. S., YUNUS, M. & FARUQUE, A. S. 1983. Classical Vibrio cholerae biotype displaces EL tor in Bangladesh. Lancet, 1, 805-7. 65. SEIJI KOJIMA, K. Y., IKURO KAWAGISHI, AND MICHIO HOMMA 1999. The Polar Flagellar Motor of Vibrio cholerae Is Driven by an Na+ Motive Force. JOURNAL OF BACTERIOLOGY, 181, 1927–1930. 66. SHEVCHENKO, A., WILM, M., VORM, O. & MANN, M. 1996. Mass spectrometric sequencing of proteins silver-stained polyacrylamide gels. Anal Chem, 68, 850-8. 67. SHIKUMA, N. J. & HADFIELD, M. G. 2010. Marine biofilms on submerged surfaces are a reservoir for Escherichia coli and Vibrio cholerae. Biofouling, 26, 39-46. 68. SILVA, A. J. & BENITEZ, J. A. 2016. Vibrio cholerae Biofilms and Cholera Pathogenesis. PLoS Negl Trop Dis, 10, e0004330. 69. SMITH, K. D., LIPCHOCK, S. V., AMES, T. D., WANG, J., BREAKER, R. R. & STROBEL, S. A. 2009. Structural basis of ligand binding by a c-di-GMP riboswitch. Nat Struct Mol Biol, 16, 1218-23. 70. SPAGNUOLO, A. M., DIRITA, V. & KIRSCHNER, D. 2011. A model for Vibrio cholerae colonization of the human intestine. J Theor Biol, 289, 247-58. 71. SRIVASTAVA, D., HARRIS, R. C. & WATERS, C. M. 2011. Integration of cyclic di-GMP and quorum sensing in the control of vpsT and aphA in Vibrio cholerae. J Bacteriol, 193, 6331-41. 72. SRIVASTAVA, D., HSIEH, M. L., KHATAOKAR, A., NEIDITCH, M. B. & WATERS, C. M. 2013. Cyclic di-GMP inhibits Vibrio cholerae motility by repressing induction of transcription and inducing extracellular polysaccharide production. Mol Microbiol, 90, 1262-76. 73. STEPHANIE L MITCHELL, A. M. I., SOPHIA A KENRICK, ANDREW CAMILLI 2015. The VieB auxiliary protein negatively regulates the VieSA signal transduction system in Vibrio cholerae 74. SUDARSAN, N., LEE, E. R., WEINBERG, Z., MOY, R. H., KIM, J. N., LINK, K. H. & BREAKER, R. R. 2008. Riboswitches in eubacteria sense the second messenger cyclic di-GMP. Science, 321, 411-3. 75. TAMAYO, R., PRATT, J. T. & CAMILLI, A. 2007. Roles of cyclic diguanylate in the regulation of bacterial pathogenesis. Annu Rev Microbiol, 61, 131-48. 76. TAYLOR, S. J. K. A. R. K. 2011. Protection and Attachment of Vibrio cholerae Mediated by the Toxin-Coregulated Pilus in the Infant Mouse Model. 193, 5260–5270. 77. TISCHLER, A. D. & CAMILLI, A. 2004. Cyclic diguanylate (c-di-GMP) regulates Vibrio cholerae biofilm formation. Mol Microbiol, 53, 857-69. 78. TISCHLER, A. D. & CAMILLI, A. 2005. Cyclic diguanylate regulates Vibrio cholerae virulence gene expression. Infect Immun, 73, 5873-82. 79. WATNICK, P. I., FULLNER, K. J. & KOLTER, R. 1999. A role for the mannose-sensitive hemagglutinin in biofilm formation by Vibrio cholerae El Tor. J Bacteriol, 181, 3606-9. 80. WATNICK, P. I. & KOLTER, R. 1999. Steps in the development of a Vibrio cholerae El Tor biofilm. Mol Microbiol, 34, 586-95. 81. XIANXIAN LIU, S. B., BENTLEY LIM, ROGER G. LININGTON, FITNAT H. YILDIZ 2010. Identification and Characterization of a Phosphodiesterase That Inversely Regulates Motility and Biofilm Formation in Vibrio cholerae. JOURNAL OF BACTERIOLOGY, 192, 4541–4552. 82. YILDIZ FH, D. N., SCHOOLNIK GK. 2001. VpsR, a Member of the Response Regulators of the Two-Component Regulatory Systems, Is Required for Expression of vps Biosynthesis Genes and EPS(ETr)-Associated Phenotypes in Vibrio cholerae O1 El Tor. 83. YVES A. MILLET, D. A., SIMON RINGGAARD, ULRICH H. VON ANDRIAN, BRIGID M. DAVIS, MATTHEW K. WALDOR 2014. Insights into Vibrio cholerae Intestinal Colonization from Monitoring Fluorescently Labeled Bacteria. PLOS Pathogens. 84. ZHENG, J., HO, B. & MEKALANOS, J. J. 2011. Genetic analysis of anti-amoebae and anti-bacterial activities of the type VI secretion system in Vibrio cholerae. PLoS One, 6, e23876. 85. ZHU, J. & MEKALANOS, J. J. 2003. Quorum sensing-dependent biofilms enhance colonization in Vibrio cholerae. Dev Cell, 5, 647-56.

VI – Supplements

Table 11| Nutrient composition of used LB culture media.

LB media Component g/L of medium Tryptone 10.0 Yeast extract 5.0 NaCl 10.0

Table 12| Nutrient composition of used S.O.C culture media.

S.O.C. media Component g/L of medium Tryptone 20.0 Yeast extract 5.0 NaCl 0.5 Glucose 3.6 KCl 0.186

MgCl2 0.96

Figure 15| Pull-down assay workflow. Two different screens were used: in the biotinylated c-di-GMP (bt-cdG) screen, c-di-GMP was linked to biotin (green circles) by a linker; in the control screen, c-di-GMP was not bound to biotin. Streptavidin (represented by the black color) was coupled to a magnetic bead (yellow circles). Proteins that are specifically binding to c-di-GMP are represented by a blue color and proteins that do not have affinity to c-di- GMP are shown in grey.

Gene Biological replicate A Biological replicate B MW (kDa) Gene name number F01/F02 F03/F04 F05/F06 F07/F08 F09/F10 F11/F12 VC2595 21,9 2,366 1,872 1,614 0,83 1,888 0,866 50S ribosomal protein L4 VC2581 18,8 1,397 7,118 1,695 0,623 1,597 0,921 50S ribosomal protein L6 VC2590 25,6 1,523 1,38 1,304 0,559 1,226 0,665 30S ribosomal protein S3 VCA0287 20,7 2,024 7,648 2,678 0,869 1,107 0,564 Translation initiator factor IF-3 VC0296 16 100 100 100 100 100 93,611 acetyl-CoA carboxylase biotin carboxyl carrier protein VC2589 15,5 3,172 8,342 1,672 0,43 1,977 1,088 50S ribosomal protein L16 VCA0290 13,4 1,88 3,323 2,231 0,714 1,299 1,337 50S ribosomal protein L20 VC2577 14,9 1,38 2,173 2,568 0,475 2,094 1,152 50S ribosomal protein L15 VC0570 16 1,156 0,833 1,151 0,359 1,588 1,34 50S ribosomal protein L13 VC2584 20,1 2,946 2,772 1,288 0,544 1,339 1,639 50S ribosomal protein L5 VC0359 13,7 1,367 1,46 1,957 0,766 1,217 1,215 30S ribosomal protein S12 VC0218 9 1,944 3,588 1,956 0,568 1,64 1,529 50S ribosomal protein L28 VC2579 17,6 1,448 1,958 2,13 0,58 1,986 3,78 30S ribosomal protein S5 VC0571 14,7 2,248 1,482 1,983 0,549 1,759 2,557 30S ribosomal protein S9 VC2614 23,6 1,625 2,464 2,355 0,326 1,726 0,706 cAMP-activated global transcriptional regulator CRP VC2021 26,4 0,989 100 1,955 80,544 2,427 0,126 Chain B, 1-3-oxoacyl-[acyl-carrier-protein] reductase FabG VC2021 26 0,989 100 1,955 80,544 2,427 0,126 Chain B, 1-3-oxoacyl-[acyl-carrier-protein] reductase FabG VC2021 26,3 0,989 100 1,955 80,544 2,427 0,126 Chain B, 1-3-oxoacyl-[acyl-carrier-protein] reductase FabG VC2021 25,8 0,989 100 1,955 80,544 2,427 0,126 Chain B, 1-3-oxoacyl-[acyl-carrier Protein] reductase FabG VC2021 26 0,989 100 1,955 80,544 2,427 0,126 Chain B, 1-3-oxoacyl-[acyl-carrier Protein] reductase FabG VC2021 26,3 0,989 100 1,955 80,544 2,427 0,126 Chain D, 1-3-oxoacyl-[acyl-carrier-protein] reductase FabG VC2021 25,6 0,989 100 1,955 80,544 2,427 0,126 3-oxoacyl-[acyl-carrier-protein] reductase FabG

54 VC2573 13,9 1,378 1,291 1,915 0,779 1,321 1,384 30S ribosomal protein S11 VC2225 22,7 2,417 100 2,161 100 100 100 Uracil phosphoribosyl transferase

Gene Biological replicate A Biological replicate B MW (kDa) Gene name number F13/F14 F15/F16 F17/F18 F19/F20 F21/F22 F23/F24 VC0550 64,8 100,00 100,00 60,55 69,98 100,00 100,00 oxaloacetate decarboxylase, alpha subunit VCA0906 63,8 4,21 N/I N/I 100,00 N/I 3,60 Methyl-accepting chemotaxis protein VC1527 65,9 100,00 100,00 100,00 100,00 100,00 100,00 molybdopterin biosynthesis MoeA protein VCA0923 70,3 100,00 100,00 N/I N/I N/I N/I methyl-accepting chemotaxis protein VC1394 47,4 0,47 100,00 2,91 0,84 0,01 2,63 methyl-accepting chemotaxis protein VCA1034 73,4 0,06 1,14 0,71 1,00 2,09 1,06 methyl-accepting chemotaxis protein VC1313 59,1 100,00 N/I N/I N/I 2,58 100,00 methyl-accepting chemotaxis protein VCA0923 67,1 100,00 100,00 N/I N/I N/I N/I methyl-accepting chemotaxis protein VCA0864 47,1 N/I 5,25 100,00 1,25 100,00 12,69 methyl-accepting chemotaxis protein VCA0864 51,4 N/I 5,25 100,00 1,25 100,00 12,69 methyl-accepting chemotaxis protein VC2249 17,3 0,49 0,37 0,56 0,60 4,09 0,39 (3R)-hydroxymyristoyl-(acyl-carrier-protein) dehydratase VC0633 37,6 1,56 1,34 0,81 1,09 2,81 8,56 outer membrane protein OmpU VC0642 54,9 N/I 100,00 N/I N/I N/I 100,00 N utilization substance protein A VC2089 64,5 0,73 2,11 1,03 0,01 4,20 0,51 succinate dehydrogenase, flavoprotein subunit VC0362 43,1 1,56 0,85 0,97 0,83 3,91 5,02 elongation factor TU VC0298 71,8 1,96 1,11 0,86 0,76 13,81 10,78 acetyl-CoA synthase VC0298 73,6 1,96 1,11 0,86 0,76 13,81 10,78 acetyl-CoA synthase VC2161 67,6 1,21 6,13 3,49 1,28 10,85 9,93 methyl-accepting chemotaxis protein VC2463 66 N/I N/I N/I 100,00 100,00 100,00 GTP-binding protein LepA VC2431 69,4 1,75 N/I N/I 100,00 1,35 N/I topoisomerase IV, subunit B VC0985 72,2 100,00 1,73 100,00 100,00 100,00 8,67 heat shock protein HtpG VC2664 57,1 0,07 0,77 0,49 0,44 5,54 0,31 chaperonin, 60 Kd subunit 56

A B

V o l c a n o p l o t ( O D = 0 . 5 ) 6 0 0

Molecular M 1 2 3 4 1 . 5 weight C o n t r o l s c r e e n B t - c d G s c r e e n (KDa)

V C 2 4 5 2

V C A 0 5 2 8

1 . 0 V C 0 4 3 2 62 ) P (

49 0 1

g V C 0 9 0 5 38 o

L V C 1 1 8 2 -

28 V C 1 4 3 2 0 . 5

17 V C 0 6 6 5 ( V p s R ) V C 1 9 0 5

V C 1 1 9 0

14 V C A 0 7 3 5 ( P l z E ) 6 V C 2 6 9 7 ( G G D E F ) V C 1 5 2 7 3 V C 2 5 2 9 ( R p o N )

V C A 0 6 8 1 ( H D - G Y P )

0 . 0 V C 0 2 9 6 ( B i o t i n c a r b o x y l c a r r i e r p r o t e i n )

- 0 . 5 0 . 0 0 . 5 1 . 0 1 . 5

L o g ( B t - c d G / C o n t r o l ) 1 0

TM Figure 16| Data from the exponential phase (OD600 = 0.5). A) SDS-PAGE analysis of the protein pull-down assay; The gel was stained with the ProteoSilver Silver Stain Kit. Lane M represents the molecular weight marker (SeeBlue Plus2 Pre-Stained Protein Standard). Lanes 1 and 2 correspond to one set of technical replicates and lanes 3 and 4 to another set of technical replicates. Lanes 1 and 3 show the proteins pulled-down in the biotinylated c-di-GMP screen and lanes 2 and 4 are the respective control screens. B) Mass spectrometry data represented in the form of a volcano plot; The data is plotted as log10 of the fold changes versus the -log10 of the adjusted P- value. Dots on the right side of the vertical dotted line represent proteins that are enriched in the biotinylated c-di-GMP screen (bt-cdG). Dots on the left of the dotted line represent proteins more decreased in the biotinylated c-di-GMP screen. The yellow dots represent proteins that have been found in previous screens for c-di-GMP binding proteins but not yet confirmed. The red dots are the proteins that have been previously confirmed to bind c-di-GMP.

A B

V o l c a n o p l o t ( O D = 2 . 0 ) 6 0 0 V o l c a n o p l o t ( O v e r n i g h t c u l t u r e )

5 4

C o n t r o l s c r e e n B t - c d G s c r e e n C o n t r o l s c r e e n B t - c d G s c r e e n V C 0 4 8 5

V C 0 7 4 2 V C A 0 8 6 7

V C 0 5 5 0 ( O x a l o a c e t a t e d e c a r b o x y l a s e , a l p h a ) 4

V C 1 5 2 7 ( m o l y b d o p t e r i n b i o s y n t h e s i s p r o t e i n , M o e A )

3 ) )

V C 2 2 9 3 P P ( ( 0 0 1 1 2 V C 1 4 4 1 g g o o L L -

- V C 0 5 5 1 ( O x a l o a c e t a t e d e c a r b o x y l a s e , b e t a ) 2

V C A 0 9 2 3 V C 0 5 4 3

V C 0 5 4 9 V C A 1 0 2 7

V C 0 5 5 0 ( O x a l o a c e t a t e d e c a r b o x y l a s e , a l p h a ) 1 V C A 0 2 9 0 V C 1 4 4 1 V C 0 2 9 6 ( B i o t i n c a r b o x y l c a r r i e r p r o t e i n ) 1 V C 0 2 9 6 ( B i o t i n c a r b o x y l c a r r i e r p r o t e i n )

V C 0 6 6 0 V C A 0 9 5 2 ( V p s T )

V C 0 4 0 9 ( M s h A )

V C 1 5 2 7 ( m o l y b d o p t e r i n b i o s y n t h e s i s p r o t e i n , M o e A )

0 0

- 2 0 2 4 6 8 - 2 0 2 4 6 8

L o g ( B t - c d G / C o n t r o l ) L o g ( B t - c d G / C o n t r o l ) 1 0 1 0

Figure 17| Mass spectrometry data from the A) late stationary phase (OD600 = 2.0) and B) overnight culture (OD600 =4.0) represented in the form of a volcano plot. The data is plotted as log10 of the fold changes versus the -log10 of the adjusted P-value. Dots on the right side of the vertical dotted line represent proteins that are enriched in the biotinylated c-di-GMP screen (bt-cdG). Dots on the left of the dotted line represent proteins more decreased in the biotinylated c-di-GMP screen. The yellow dots represent proteins that have been found in previous screens for c-di-GMP binding proteins but not yet confirmed. The red dots are the proteins that have been previously confirmed to bind c-di-GMP (72). The brown dots represent the proteins identified in the SDS-PAGE bands.

Figure 18| SeeBlue Plus2 Pre-Stained Protein Standard.

Figure 19| GeneRuler 1 kb Plus DNA Ladder

59 Figure 20| Cloning workflow. Each selected gene (VC1346, VC2392 and VCA0020) was cloned in a pBAD33 vector, under arabinose expression. SphI was used as the restriction enzyme. A his-tag at the C-terminal of each protein was inserted. The resulted constructs were transformed into E. coli TOP10 cells by chemical transformation and the cells were harvested. A pull-down assay was performed with three different conditions. A Western-blot experiment was made to search for the his-tag protein.

Figure 21| pBAD33 vector (5352 bp) used for the molecular cloning of the selected genes. SphI restriction site is located at the 1339 bp. It is regulated by the arabinose operon, used in this study to induce expression. It also contains bla (ampR) sequences following the rrnB terminator. It includes a gene that confers resistance to the chloramphenicol antibiotic (Guzman et al., 1995).

Table 15| Expected PCR products’ length (bp) after successful amplification of de genes.

PCR product PCR PCR annealing Plasmid Primers used Template Gene target total length number temp (º C) name (bp)

P-1147_VC1346sdF V. cholerae 01 VC1346 51 1124 pBSB-RR01 P-1148_VC1346HR C6706 P-1149_VC2392sdF V. cholerae 02 VC2392_mutT 51 503 pBSB-RR02 P-1150_VC2392HR C6706 P-1151_VCA0020sdF V. cholerae 03 VCA0020 50 3362 pBSB-RR03 P-1152_VCA0020HR C6706

Table 16| Expected PCR products’ length (bp) after successful colony PCR.

PCR product PCR annealing Plasmid PCR number Primers used Template Gene target total length temp (º C) name (bp)

P_0554_F_Primer 03 01 pBSB-RR01 VC1346 51 1054 N/A P_0555_R_Primer 04 P_0554_F_Primer 03 02 pBSB-RR02 VC2392_mutT 51 570 N/A P_0555_R_Primer 04 P_0554_F_Primer 03 03 pBSB-RR03 VCA0020 51 3429 N/A P_0555_R_Primer 04

Table 17| Statistics used in the analysis of the mass spectrometry combined data. Log10 (mean1/mean2) and – log10 (P) were plotted in the form of a volcano plot.

Gene P value Mean1 Mean2 Mean1/Mean2 Log10(mean1/mean2) - log10(P) Gene product label VC0003 0,919621 2,46E-06 2,22E-06 1,106258 0,043857 0,036391 thiophene and furan oxidation protein ThdF VC0004 0,997938 5,8E-06 5,81E-06 0,998279 -0,00075 0,000897 inner membrane protein, 60 kDa VC0007 0,287217 0,000578 0,000967 0,598448 -0,22297 0,54179 ribosomal protein L34 VC0012 0,774037 1,64E-06 2,1E-06 0,777936 -0,10906 0,111239 chromosomal DNA replication initiator DnaA VC0013 0,913947 4,45E-06 4,12E-06 1,081896 0,034185 0,039079 DNA polymerase III, beta chain VC0015 0,517475 0,002232 0,003297 0,676979 -0,16942 0,286111 DNA gyrase, subunit B VC0020 0,878367 5,16E-05 5,66E-05 0,912482 -0,03978 0,056324 glycyl-tRNA synthetase, beta chain VC0021 0,754726 4,23E-05 3,48E-05 1,215681 0,08482 0,12221 glycyl-tRNA synthetase, alpha chain VC0026 0,802138 8,54E-07 5,91E-07 1,445159 0,159916 0,095751 zinc-binding alcohol dehydrogenase VC0036 0,318363 3,05E-05 7,36E-06 4,147303 0,617766 0,497077 FixG-related protein VC0043 0,542345 9,1E-06 5,2E-06 1,750818 0,243241 0,265724 potassium uptake protein TrkA VC0044 0,28819 9,79E-06 6,86E-07 14,26552 1,154288 0,54032 sun protein VC0045 0,816361 8,66E-06 6,86E-06 1,262238 0,101141 0,088118 methionyl-tRNA formyltransferase VC0051 0,659647 1,09E-06 6,92E-07 1,576362 0,197656 0,180689 phosphoribosylaminoimidazole carboxylase, ATPase subunit VC0067 0,888885 6,26E-07 7,14E-07 0,876751 -0,05712 0,051154 aminopeptidase P VC0082 0,351015 2,2E-05 1,01E-06 21,77579 1,337974 0,454674 conserved hypothetical protein VC0083 0,773652 3,8E-06 4,86E-06 0,78125 -0,10721 0,111454 ubiquinone/menaquinone biosynthesis methlytransferase UbiE VC0093 0,890554 5,04E-06 5,71E-06 0,882425 -0,05432 0,05034 glycerol-3-phosphate acyltransferase VC0106 0,581337 5,67E-05 2,91E-05 1,951824 0,290441 0,235572 conserved hypothetical protein VC0108 0,985583 4,48E-05 4,42E-05 1,011986 0,005174 0,006307 DNA polymerase I VC0112 0,490093 7,35E-06 4,52E-06 1,627186 0,211437 0,309722 cytochrome c4 VC0114 0,325171 7,83E-07 4,2E-11 18638,1 4,270402 0,487888 conserved hypothetical protein VC0116 0,518233 9,89E-07 4,24E-07 2,329955 0,367348 0,285475 oxygen-independent coproporphyrinogen III oxidase VC0125 0,866954 1,45E-05 1,25E-05 1,165064 0,06635 0,062004 diaminopimelate decarboxylase VC0132 0,799649 1,56E-06 1,18E-06 1,32343 0,121701 0,097101 hypothetical protein VC0134 0,736331 2,17E-05 1,51E-05 1,439073 0,158083 0,132927 conserved hypothetical protein

62 VC0139 0,379653 0,000357 4,28E-05 8,350467 0,921711 0,420613 DPS family protein, response to stress, iron binding VC0147 0,967477 1,55E-05 1,49E-05 1,042367 0,018021 0,014359 cell division protein FtsY VC0149 0,608975 1,03E-05 1,35E-05 0,759822 -0,11929 0,215401 cell division protein FtsX VC0151 0,412314 3,89E-06 0,000002 1,9445 0,288808 0,384771 pyridine nucleotide-disulfide oxidoreductase, class I VC0152 0,747776 5,56E-07 3,61E-07 1,539015 0,187243 0,126228 transcriptional regulator, TetR family VC0156 0,702737 0,000557 0,000723 0,770678 -0,11313 0,153207 vitamin B12 receptor VC0159 0,21045 2,26E-05 2,72E-06 8,306392 0,919412 0,676852 RNA-binding protein VC0162 0,468034 1,05E-05 1,73E-05 0,606605 -0,21709 0,329723 ketol-acid reductoisomerase VC0164 0,808588 8,01E-05 6,62E-05 1,209731 0,082689 0,092273 multidrug resistance protein, putative VC0165 0,44343 0,000152 7,09E-05 2,142756 0,330973 0,353175 conserved hypothetical protein VC0170 0,721792 0,3163 0,3628 0,87183 -0,05957 0,141588 peptide ABC transporter, ATP-binding protein VC0179 0,535462 1,55E-05 1,07E-05 1,438547 0,157924 0,271271 hypothetical protein VC0187 0,84738 1,09E-06 8,49E-07 1,277523 0,106369 0,071922 conserved hypothetical protein VC0188 0,944824 0,000218 0,000204 1,069745 0,02928 0,024649 oligopeptidase A VC0209 0,525131 2,77E-05 1,82E-05 1,519231 0,181624 0,279733 conserved hypothetical protein VC0210 0,556811 3,52E-06 1,95E-06 1,803077 0,256014 0,254292 ribonuclease PH VC0212 0,865819 8,54E-07 1,05E-06 0,817033 -0,08776 0,062573 lipid A biosynthesis (kdo)2-(lauroyl)-lipid IVA acyltransferase VC0213 0,777334 1,09E-05 1,29E-05 0,849805 -0,07068 0,109393 lipid A biosynthesis lauroyl acyltransferase VC0216 0,983348 5,95E-05 5,89E-05 1,010194 0,004405 0,007293 methyl-accepting chemotaxis protein VC0218 0,767324 0,0022 0,002477 0,888171 -0,0515 0,115021 ribosomal protein L28 VC0219 0,949159 5,31E-05 5,12E-05 1,036907 0,01574 0,022661 ribosomal protein L33 VC0223 0,537798 8,33E-07 3,98E-07 2,09324 0,320819 0,26938 ADP-heptose--LPS heptosyltransferase II, putative VC0230 0,932412 0,000001 8,99E-07 1,112842 0,046434 0,030392 hypothetical protein VC0231 0,703827 9,15E-07 5,46E-07 1,677478 0,224657 0,152534 hypothetical protein VC0233 0,948192 1,26E-06 1,17E-06 1,068995 0,028976 0,023104 3-deoxy-D-manno-octulosonic-acid transferase VC0234 0,719333 8,27E-06 1,15E-05 0,722096 -0,14141 0,14307 conserved hypothetical protein VC0235 0,749193 2,94E-06 1,92E-06 1,529412 0,184524 0,125406 lipopolysaccharide biosynthesis protein, putative VC0239 0,728784 4,62E-05 6,12E-05 0,753756 -0,12277 0,137401 conserved hypothetical protein VC0240 0,443472 2,04E-05 9,56E-06 2,136654 0,329734 0,353134 ADP-L-glycero-D-mannoheptose-6-epimerase

VC0241 0,785032 5,32E-05 4,62E-05 1,153163 0,061891 0,105112 mannose-1-phosphate guanylyltransferase VC0242 0,678537 0,000106 8,4E-05 1,263697 0,101643 0,168426 phosphomannomutase VC0243 0,526485 0,000483 0,000674 0,71685 -0,14457 0,278614 GDP-mannose 4,6-dehydratase VC0244 0,740592 0,000225 0,000198 1,137235 0,05585 0,130421 perosamine synthase VC0245 0,590606 0,000117 7,9E-05 1,47487 0,168754 0,228702 rfbG protein VC0247 0,94244 1,83E-05 1,9E-05 0,964173 -0,01585 0,025746 lipopolysaccharide/O-antigen transport protein VC0249 0,845485 1,03E-05 1,2E-05 0,857855 -0,06659 0,072894 rfbL protein VC0250 0,258895 0,000121 0,000182 0,666667 -0,17609 0,586876 iron-containing alcohol dehydrogenase family protein RfbM VC0251 0,06596 0,000481 0,001207 0,398674 -0,39938 1,180719 acyl protein synthase/acyl-CoA reductase RfbN VC0260 0,94787 1,66E-05 1,74E-05 0,955043 -0,01998 0,023251 mannosyl-transferase VC0273 0,751332 2,5E-05 1,97E-05 1,264572 0,101943 0,124168 DNA-binding protein HU VC0282 0,745708 1,53E-05 1,19E-05 1,287521 0,109754 0,127431 methyl-accepting chemotaxis protein VC0294 0,779627 1,68E-05 1,35E-05 1,249258 0,096652 0,108113 hypothetical protein VC0295 0,685695 0,000223 0,000257 0,868093 -0,06143 0,163869 acetyl-CoA carboxylase, biotin carboxylase VC0296 0,144421 0,005437 0,000965 5,633029 0,750742 0,840368 acetyl-CoA carboxylase, biotin carboxyl carrier protein VC0298 0,5471 0,001317 0,001851 0,711507 -0,14782 0,261934 acetyl-CoA synthase VC0302 0,976554 9,16E-06 9,34E-06 0,980629 -0,0085 0,010304 conserved hypothetical protein VC0304 0,36169 3,94E-06 1,02E-06 3,884729 0,589361 0,441664 guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase VC0305 0,181139 0,002416 0,006094 0,396456 -0,40181 0,741987 ATP-dependent RNA helicase RhlB VC0307 0,922754 6,18E-05 5,74E-05 1,076267 0,03192 0,034914 transcription termination factor Rho VC0313 0,579221 1,09E-06 1,66E-06 0,657831 -0,18189 0,237156 hypothetical protein VC0316 0,579302 8,07E-05 4,73E-05 1,704267 0,231538 0,237095 hypothetical protein VC0322 0,333888 5,95E-06 3,39E-06 1,757379 0,244865 0,476399 preprotein translocase, SecE subunit VC0323 0,885418 1,24E-05 1,1E-05 1,125 0,051153 0,052851 transcription antitermination protein NusG VC0324 0,967701 0,000376 0,000366 1,027588 0,011819 0,014259 ribosomal protein L11 VC0325 0,500279 0,002603 0,001816 1,43337 0,156358 0,300787 ribosomal protein L1 VC0326 0,898073 0,00024 0,000215 1,119347 0,048965 0,046689 ribosomal protein L10 VC0327 0,532339 2,52E-05 4,3E-05 0,586223 -0,23194 0,273811 ribosomal protein L7/L12 VC0328 0,724529 0,000218 0,000245 0,890159 -0,05053 0,139944 DNA-directed RNA polymerase, beta subunit

VC0329 0,165659 0,000289 0,000477 0,606506 -0,21717 0,780786 DNA-directed RNA polymerase, beta' subunit VC0336 0,827974 5,86E-05 4,99E-05 1,174514 0,069858 0,081983 phosphoglycerate mutase, 2,3-bisphosphoglycerate-independent VC0340 0,424679 3,5E-05 1,51E-05 2,318994 0,3653 0,371939 conserved hypothetical protein VC0345 0,963261 5,34E-05 5,56E-05 0,961151 -0,01721 0,016256 DNA mismatch repair protein MutL VC0348 0,900012 2,29E-05 2,04E-05 1,123039 0,050395 0,045752 GTP-binding protein HflX VC0349 0,335422 0,000143 0,000201 0,711222 -0,14799 0,474409 hflK protein VC0350 0,854942 2,64E-05 2,32E-05 1,137753 0,056048 0,068063 hflC protein VC0354 0,438462 0,000442 0,000601 0,735774 -0,13326 0,358068 peptidyl-prolyl cis-trans isomerase, FKBP-type VC0359 0,964464 0,05269 0,05066 1,040071 0,017063 0,015714 ribosomal protein S12 VC0360 0,799556 4,7E-05 4,03E-05 1,167287 0,067178 0,097151 ribosomal protein S7 VC0361 0,958144 3,12E-05 3,24E-05 0,96174 -0,01694 0,018569 elongation factor G VC0362 0,312106 0,02647 0,03495 0,757368 -0,12069 0,505698 elongation factor TU VC0366 0,786211 4,94E-05 5,94E-05 0,83179 -0,07999 0,104461 ribosomal protein S6 VC0368 0,579822 0,000181 0,000143 1,269986 0,103799 0,236705 ribosomal protein S18 VC0369 0,957728 6,36E-05 6,1E-05 1,041953 0,017848 0,018758 ribosomal protein L9 VC0371 0,958535 1,06E-05 1,01E-05 1,053678 0,022708 0,018392 replicative DNA helicase VC0387 0,579221 1,09E-06 1,66E-06 0,657831 -0,18189 0,237156 hypothetical protein VC0391 0,594467 2,54E-06 1,49E-06 1,704775 0,231667 0,225872 aspartokinase III, lysine-sensitive VC0394 0,816809 2,26E-06 2,86E-06 0,788059 -0,10344 0,087879 excinuclease ABC, subunit A VC0395 0,640543 5,46E-05 3,83E-05 1,426071 0,154141 0,193452 UTP--glucose-1-phosphate uridylyltransferase VC0397 0,973669 2,18E-06 2,12E-06 1,027804 0,01191 0,011589 single-strand binding protein VC0409 0,520163 0,000172 0,000104 1,645594 0,216323 0,283861 MSHA pilin protein MshA VC0414 0,681135 8,49E-07 1,31E-06 0,647292 -0,1889 0,166767 hypothetical protein VC0415 0,839004 0,000114 0,0001 1,131474 0,053645 0,076236 rod shape-determining protein MreB VC0422 0,8203 1,11E-05 8,97E-06 1,241356 0,093896 0,086027 tldD protein VC0430 0,555473 2,54E-05 5,11E-05 0,497357 -0,30333 0,255337 immunogenic protein VC0431 0,938933 3,69E-05 3,93E-05 0,938947 -0,02736 0,027366 arginine repressor VC0432 0,647789 0,000194 0,0003 0,646784 -0,18924 0,188566 malate dehydrogenase VC0434 0,681259 3,92E-06 2,86E-06 1,368844 0,136354 0,166688 octaprenyl-diphosphate synthase

VC0435 0,719698 2,82E-05 3,54E-05 0,795031 -0,09962 0,14285 ribosomal protein L21 VC0436 0,977475 0,000115 0,000112 1,018683 0,008039 0,009894 ribosomal protein L27 VC0437 0,482062 5,26E-05 8,17E-05 0,643452 -0,19148 0,316897 GTP1/Obg family protein VC0449 0,745708 1,53E-05 1,19E-05 1,287521 0,109754 0,127431 methyl-accepting chemotaxis protein VC0452 0,854347 1,99E-06 1,66E-06 1,202654 0,080141 0,068366 A/G-specific adenine glycosylase VC0453 0,867509 2,72E-06 2,29E-06 1,190289 0,075652 0,061726 conserved hypothetical protein VC0454 0,916976 8,62E-07 9,75E-07 0,88359 -0,05375 0,037642 glutaminase family protein VC0459 0,230989 2,07E-06 5,83E-07 3,542024 0,549252 0,636409 conserved hypothetical protein VC0468 0,778541 1,39E-05 1,14E-05 1,224472 0,087949 0,108718 glutathione synthetase VC0472 0,798219 8,66E-05 7,28E-05 1,190489 0,075725 0,097878 S-adenosylmethionine synthase VC0473 0,424498 0,000101 0,00019 0,530247 -0,27552 0,372125 transketolase 1 VC0476 0,688672 2,3E-06 1,48E-06 1,557133 0,192326 0,161988 D-erythrose 4-phosphate dehydrogenase VC0477 0,551322 0,000658 0,00053 1,240241 0,093506 0,258594 phosphoglycerate kinase VC0478 0,586295 0,000667 0,000423 1,577578 0,197991 0,231884 fructose-bisphosphate aldolase, class II VC0485 0,583807 0,001345 0,001048 1,283397 0,108361 0,233731 pyruvate kinase I VC0486 0,811739 7,19E-06 5,94E-06 1,211422 0,083295 0,090584 transcriptional regulator, DeoR family glucosamine--fructose-6-phosphate aminotransferase VC0487 0,116235 0,000215 0,000443 0,484664 -0,31456 0,934662 (isomerizing) VC0490 0,886269 2,54E-05 2,31E-05 1,100997 0,041786 0,052435 conserved hypothetical protein VC0493 0,80234 4,53E-06 3,78E-06 1,197302 0,078204 0,095642 hypothetical protein VC0512 0,745708 1,53E-05 1,19E-05 1,287521 0,109754 0,127431 methyl-accepting chemotaxis protein VC0514 0,745708 1,53E-05 1,19E-05 1,287521 0,109754 0,127431 methyl-accepting chemotaxis protein VC0516 0,818327 2,89E-06 2,28E-06 1,269416 0,103604 0,087073 phage integrase VC0517 0,968439 9,55E-05 9,78E-05 0,976186 -0,01047 0,013928 RNA polymerase sigma factor RpoD VC0520 0,266266 0,000355 0,000659 0,538952 -0,26845 0,574684 ribosomal protein S21 VC0522 0,847544 5,7E-06 6,54E-06 0,871481 -0,05974 0,071838 beta-ketoadipate enol-lactone hydrolase, putative VC0530 0,928189 1,21E-06 1,09E-06 1,111316 0,045837 0,032364 conserved hypothetical protein VC0533 0,75502 3,2E-07 2,01E-07 1,593625 0,202386 0,122042 lipoprotein NlpD VC0535 0,702549 1,58E-06 2,34E-06 0,673922 -0,17139 0,153323 DNA mismatch repair protein MutS

VC0543 0,60439 0,000253 0,0002 1,263868 0,101702 0,218683 recA protein VC0545 0,695533 0,000206 0,000165 1,251064 0,097279 0,157683 alanyl-tRNA synthetase VC0547 0,7378 2,04E-06 2,79E-06 0,730755 -0,13623 0,132061 aspartokinase, alpha and beta subunits VC0549 0,107338 9,94E-05 1,75E-05 5,678857 0,754261 0,969247 hypothetical protein VC0550 0,001942 0,1945 0,005425 35,85253 1,55452 2,711726 oxaloacetate decarboxylase, alpha subunit VC0551 0,069052 4,6E-05 4,79E-07 96,15465 1,98297 1,160826 oxaloacetate decarboxylase, beta subunit VC0554 0,716441 3,06E-05 3,98E-05 0,767512 -0,11491 0,14482 protease, insulinase family/protease, insulinase family VC0556 0,601078 4,48E-06 7,15E-06 0,626311 -0,20321 0,221069 glutamate--cysteine ligase VC0557 0,845679 6,59E-06 8,14E-06 0,80919 -0,09195 0,072794 autoinducer-2 production protein VC0560 0,732947 0,000268 0,000215 1,249069 0,096586 0,134928 signal recognition particle protein VC0561 0,757598 1,38E-05 1,01E-05 1,368682 0,136303 0,120561 ribosomal protein S16 VC0562 0,89813 1,61E-06 1,84E-06 0,870863 -0,06005 0,046661 16S rRNA processing protein RimM VC0564 0,345861 0,000719 0,0011 0,653545 -0,18472 0,461098 ribosomal protein L19 VC0566 0,576213 0,000106 6,75E-05 1,575048 0,197294 0,239417 protease DO VC0570 0,66725 0,003444 0,004195 0,820977 -0,08567 0,175712 ribosomal protein L13 VC0571 0,74421 0,00656 0,005835 1,12425 0,050863 0,128305 ribosomal protein S9 VC0573 0,649108 4,17E-05 0,000034 1,225 0,088136 0,187683 ubiquinol--cytochrome c reductase, iron-sulfur subunit VC0574 0,389267 0,000136 0,00021 0,647646 -0,18866 0,409752 ubiquinol--cytochrome c reductase, cytochrome B VC0575 0,353481 2,05E-05 9,46E-06 2,163248 0,335106 0,451634 ubiquinol--cytochrome c reductase, cytochrome c1 VC0576 0,706312 6,6E-06 4,53E-06 1,458122 0,163794 0,151003 stringent starvation protein A VC0578 0,507619 9,06E-06 4,07E-06 2,225553 0,347438 0,294462 hemolysin, putative VC0581 0,110847 0,00011 0,000358 0,307563 -0,51207 0,955276 lipoprotein, putative VC0585 0,345104 6,45E-06 2,65E-06 2,433799 0,386285 0,46205 hypoxanthine phosphoribosyltransferase VC0589 0,841722 4,31E-06 3,5E-06 1,23022 0,089983 0,074832 ABC transporter, ATP-binding protein VC0591 0,759691 2,44E-05 3,05E-05 0,800328 -0,09673 0,119363 pantoate--beta-alanine ligase VC0594 0,918342 4,73E-05 4,32E-05 1,094973 0,039404 0,036995 polyA polymerase VC0601 0,519395 1,93E-06 8,69E-07 2,219282 0,346213 0,284502 ATP-dependent helicase HrpB VC0602 0,934246 4,96E-06 5,36E-06 0,925947 -0,03341 0,029539 penicillin-binding protein 1B VC0604 0,074146 0,009575 0,0353 0,271246 -0,56664 1,129914 aconitate hydratase 2

VC0623 0,73375 1,02E-06 6,43E-07 1,591227 0,201732 0,134452 conserved hypothetical protein VC0626 0,975734 0,000113 0,000114 0,987741 -0,00536 0,010669 glutamate-1-semialdehyde 2,1-aminomutase VC0630 0,742289 2,66E-06 1,82E-06 1,464541 0,165702 0,129427 conserved hypothetical protein VC0631 0,793347 4,34E-05 3,49E-05 1,2437 0,094716 0,100537 tyrosyl-tRNA synthetase D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine- VC0632 0,741848 3,62E-06 2,58E-06 1,404033 0,147377 0,129685 endopeptidase VC0633 0,919287 0,0181 0,01901 0,95213 -0,0213 0,036549 outer membrane protein OmpU VC0636 0,671547 3,28E-05 2,69E-05 1,218587 0,085857 0,172924 cell division protein FtsJ VC0637 0,893826 9,24E-06 8,57E-06 1,078225 0,03271 0,048747 cell division protein FtsH phosphoglucomutase/phosphomannomutase family protein VC0639 0,649604 4,6E-05 3,44E-05 1,336723 0,126041 0,187351 MrsA VC0642 0,851859 0,000355 0,00032 1,106775 0,044059 0,069632 N utilization substance protein A VC0643 0,172963 0,01742 0,03033 0,574349 -0,24082 0,762048 initiation factor IF-2 VC0644 0,924736 5,07E-06 5,62E-06 0,903008 -0,04431 0,033982 ribosome-binding factor A VC0645 0,645486 5,77E-07 2,79E-07 2,071454 0,316275 0,190113 tRNA pseudouridine 55 synthase VC0646 0,878424 0,000134 0,000124 1,084746 0,035328 0,056296 ribosomal protein S15 VC0647 0,927774 8,95E-05 8,4E-05 1,065968 0,027744 0,032558 polyribonucleotide nucleotidyltransferase VC0659 0,824162 1,69E-05 1,48E-05 1,138514 0,056338 0,083987 peptide chain release factor 3 VC0660 0,445777 0,000134 7,83E-05 1,712241 0,233565 0,350882 ATP-dependent RNA helicase SrmB VC0663 0,636991 1,08E-05 6,03E-06 1,783936 0,251379 0,195866 UNKNOWN VC0664 0,720535 0,000176 0,000213 0,8277 -0,08213 0,142345 lysyl-tRNA synthetase, heat inducible VC0665 0,865875 2,43E-06 2,06E-06 1,180846 0,072193 0,062545 VpsR, sigma-54 dependent transcriptional regulator VC0667 0,946263 5,83E-06 5,51E-06 1,058429 0,024662 0,023988 oxidoreductase Tas, aldo/keto reductase family VC0679 0,41893 5,72E-05 9,95E-05 0,57496 -0,24036 0,377858 ribosomal protein S20 VC0682 0,735552 0,000112 9,4E-05 1,196381 0,07787 0,133387 isoleucyl-tRNA synthetase VC0685 0,753358 1,52E-05 1,2E-05 1,270451 0,103958 0,122998 lytB protein VC0690 0,311055 1,28E-05 3,06E-06 4,168572 0,619987 0,507162 glucokinase regulatory protein-related protein VC0695 0,811906 5,21E-06 4,19E-06 1,24385 0,094768 0,090494 phospho-2-dehydro-3-deoxyheptonate aldolase, tyr-sensitive VC0698 0,217219 0,000362 0,001082 0,334843 -0,47516 0,663103 ABC transporter, ATP-binding protein VC0703 0,722586 0,000457 0,000596 0,766739 -0,11535 0,14111 GGDEF+EAL, c-di-GMP phosphodiesterase A-related protein 68

VC0706 0,681476 5,29E-05 4,04E-05 1,310704 0,117505 0,166549 sigma-54 modulation protein, putative VC0708 0,949674 6,21E-07 6,61E-07 0,938464 -0,02758 0,022425 conserved hypothetical protein VC0709 0,48614 2,27E-06 9,16E-07 2,478175 0,394132 0,313239 ribosomal large subunit pseudouridine synthase D VC0711 0,165784 9,47E-05 0,000227 0,416953 -0,37991 0,780456 clpB protein VC0717 0,939921 1,4E-05 1,49E-05 0,935074 -0,02915 0,026909 protease, putative VC0718 0,438424 0,000777 0,001418 0,547814 -0,26137 0,358106 conserved hypothetical protein VC0723 0,385362 5,39E-06 2,57E-06 2,099727 0,322163 0,414131 polyphosphate kinase VC0731 0,73985 9,69E-06 1,3E-05 0,747531 -0,12637 0,130857 antioxidant, AhpC/Tsa family VC0737 0,228818 3,54E-06 6,28E-07 5,64123 0,751374 0,640509 acetoin utilization protein AcuB, putative VC0739 0,774508 7,42E-06 5,61E-06 1,321753 0,12115 0,110974 S-adenosylmethionine:tRNA ribosyltransferase-isomerase VC0742 0,364595 3,1E-05 1,56E-05 1,983344 0,297398 0,43819 conserved hypothetical protein VC0743 0,8519 8,53E-05 7,6E-05 1,121515 0,049805 0,069611 protein-export membrane protein SecD VC0744 0,586528 4,57E-06 6,9E-06 0,662511 -0,17881 0,231711 protein-export membrane protein SecF VC0745 0,666027 3,48E-05 2,26E-05 1,54078 0,187741 0,176508 inositol monophosphate family protein VC0748 0,508866 0,000115 7,15E-05 1,60979 0,206769 0,293397 aminotransferase NifS, class V VC0752 0,882113 2,46E-05 2,15E-05 1,144651 0,058673 0,054476 chaperone protein HscA VC0755 0,139421 1,64E-05 6,63E-06 2,467925 0,392332 0,855671 peptidase B VC0756 0,486389 2,1E-05 1,21E-05 1,732231 0,238606 0,313016 nucleoside diphosphate kinase VC0757 0,390751 0,002967 0,000579 5,124352 0,709639 0,408099 conserved hypothetical protein VC0758 0,396522 2,61E-06 3,38E-07 7,722831 0,887777 0,401733 conserved hypothetical protein VC0759 0,200835 6,03E-05 1,8E-05 3,342572 0,524081 0,697161 gcpE protein VC0760 0,880837 4,96E-06 4,16E-06 1,192687 0,076526 0,055104 histidyl-tRNA synthetase VC0762 0,885817 5,49E-06 6,31E-06 0,869827 -0,06057 0,052656 conserved hypothetical protein VC0763 0,938371 6,08E-05 5,68E-05 1,069166 0,029045 0,027625 GTP-binding protein VC0767 0,778377 0,000154 0,000135 1,136632 0,05562 0,10881 inosine-5`-monophosphate dehydrogenase VC0768 0,789795 0,000126 0,000103 1,228599 0,08941 0,102485 GMP synthase VC0770 0,188382 4,66E-05 2,62E-06 17,81131 1,250696 0,72496 conserved hypothetical protein VC0793 0,056138 9,24E-05 1,54E-06 59,90921 1,777494 1,250743 UNKNOWN VC0803 0,785118 2,9E-06 2,24E-06 1,2958 0,112538 0,105065 RNA methyltransferase, TrmH family

VC0821 0,63594 6,63E-06 3,85E-06 1,721328 0,235864 0,196584 hypothetical protein VC0824 0,905981 5,65E-06 6,34E-06 0,891078 -0,05008 0,042881 tagD protein VC0825 0,969447 5,19E-07 5,49E-07 0,946582 -0,02384 0,013476 toxin co-regulated pilus biosynthesis protein I VC0826 0,579812 2,87E-06 1,69E-06 1,697812 0,22989 0,236713 toxin co-regulated pilus biosynthesis protein P VC0827 0,700413 7,92E-07 1,26E-06 0,63031 -0,20045 0,154646 toxin co-regulated pilus biosynthesis protein H VC0840 0,745708 1,53E-05 1,19E-05 1,287521 0,109754 0,127431 accessory colonization factor AcfB VC0848 0,885773 0,000375 0,000331 1,132789 0,054149 0,052678 small protein B VC0855 0,761945 0,000191 0,000219 0,874199 -0,05839 0,118076 dnaK protein VC0856 0,827049 0,000546 0,000501 1,088388 0,036784 0,082469 dnaJ protein VC0860 0,440462 4,15E-05 1,24E-05 3,345161 0,524417 0,356092 hypothetical protein VC0863 0,349773 1,02E-05 4,61E-07 22,02691 1,342954 0,456214 conserved hypothetical protein VC0869 0,857379 5,99E-05 5,33E-05 1,125 0,051153 0,066827 phosphoribosylformylglycinamidine synthase VC0875 0,429255 8,65E-05 0,000139 0,621249 -0,20673 0,367285 prolyl-tRNA synthetase VC0894 0,88363 8,4E-06 7,33E-06 1,146112 0,059227 0,05373 thiamin biosynthesis protein ThiI VC0899 0,497321 9,41E-06 2,01E-05 0,469058 -0,32877 0,303363 conserved hypothetical protein VC0905 0,289691 0,000784 0,001407 0,557498 -0,25376 0,538065 lipoprotein YaeC VC0910 0,141311 5,66E-05 9,52E-05 0,594833 -0,2256 0,849823 PTS system, trehalose-specific IIBC component VC0913 0,901096 3,16E-06 2,79E-06 1,130326 0,053204 0,045229 conserved hypothetical protein VC0914 0,864642 1,67E-06 1,96E-06 0,850305 -0,07043 0,063164 multidrug resistance protein, putative VC0918 0,12512 1,56E-06 6,08E-11 25628,8 4,408728 0,902675 UDP-N-acetyl-D-mannosaminuronic acid dehydrogenase VC0941 0,656907 7,12E-05 5,27E-05 1,351367 0,130773 0,182496 serine hydroxymethyltransferase VC0942 0,746185 8,69E-07 1,27E-06 0,683871 -0,16503 0,127154 hypothetical protein VC0943 0,992136 1,02E-06 1E-06 1,011964 0,005165 0,003429 lipoic acid synthetase VC0945 0,777665 7,97E-05 8,96E-05 0,888976 -0,05111 0,109208 conserved hypothetical protein VC0947 0,757246 2,49E-06 1,79E-06 1,396417 0,145015 0,120763 D-alanyl-D-alanine carboxypeptidase VC0956 0,92847 4,79E-05 5,09E-05 0,94009 -0,02683 0,032232 leucyl-tRNA synthetase VC0959 0,549112 1,07E-05 5,65E-06 1,886058 0,275555 0,260339 hemolysin, putative VC0961 0,745626 7,51E-06 5,49E-06 1,368507 0,136247 0,127479 phoH family protein VC0962 0,767076 4,9E-05 3,98E-05 1,23247 0,090777 0,115161 conserved hypothetical protein

VC0964 0,983948 1,54E-07 1,5E-07 1,024667 0,010583 0,007028 PTS system, glucose-specific IIA component VC0965 0,665131 0,000323 0,000245 1,319166 0,1203 0,177093 phosphoenolpyruvate-protein phosphotransferase VC0966 0,985096 9,64E-07 9,46E-07 1,019668 0,008459 0,006522 phosphocarrier protein HPr VC0968 0,626883 0,000223 0,000159 1,403398 0,147181 0,202813 cysteine synthase A VC0971 0,868511 6,92E-05 6,28E-05 1,102772 0,042486 0,061225 DNA ligase VC0972 0,662534 0,000134 8,41E-05 1,587585 0,200737 0,178792 porin, putative VC0973 0,534625 6,53E-05 9,62E-05 0,678553 -0,16842 0,271951 hypothetical protein VC0983 0,842846 2,31E-06 2,84E-06 0,8114 -0,09076 0,074252 regulatory protein ToxS VC0985 0,465276 0,001151 0,001544 0,745466 -0,12757 0,33229 heat shock protein HtpG VC0991 0,961884 9,21E-05 8,98E-05 1,02585 0,011084 0,016877 asparagine synthetase B, glutamine-hydrolyzing VC0995 0,155989 0,000178 6,58E-05 2,710422 0,433037 0,806906 PTS system, N-acetylglucosamine-specific IIABC component VC0997 0,74695 0,000478 0,00038 1,257233 0,099416 0,126709 glutaminyl-tRNA synthetase VC1000 0,848671 3,37E-05 2,96E-05 1,13529 0,055107 0,071261 acetyl-CoA carboxylase, carboxyl transferase beta subunit VC1004 0,675946 2,9E-06 4,59E-06 0,631613 -0,19955 0,170088 amidophosphoribosyltransferase VC1010 0,457012 2,02E-06 4,55E-07 4,442249 0,647603 0,340072 lactoylglutathione lyase VC1015 0,558516 0,000239 0,000423 0,565351 -0,24768 0,252964 RnfC-related protein VC1017 0,822571 0,00255 0,003296 0,773665 -0,11145 0,084827 RnfA-related protein VC1023 0,77121 3,63E-05 4,85E-05 0,747219 -0,12655 0,112827 conserved hypothetical protein VC1028 0,556246 4,25E-07 6,73E-07 0,63197 -0,1993 0,254733 molybdenum cofactor biosynthesis protein E VC1033 0,731068 2,62E-07 1,56E-07 1,679257 0,225117 0,136042 cation transport ATPase, E1-E2 family VC1034 0,637852 2,46E-07 5,21E-07 0,472734 -0,32538 0,19528 uridine phosphorylase VC1036 0,811046 6,95E-05 8E-05 0,868467 -0,06125 0,090955 methionyl-tRNA synthetase VC1040 0,923523 3,02E-06 2,76E-06 1,093377 0,03877 0,034552 cob(I)alamin adenosyltransferase VC1041 0,737122 7,91E-05 5,97E-05 1,325905 0,122512 0,13246 phosphotyrosine protein phosphatase VC1047 0,292218 5,95E-07 1,67E-07 3,561078 0,551581 0,534293 fatty oxidation complex, alpha subunit VC1053 0,885823 1,5E-06 1,75E-06 0,859187 -0,06591 0,052653 adenine phosphoribosyltransferase VC1059 0,907509 7,26E-06 7,91E-06 0,917805 -0,03725 0,042149 oxidoreductase, short-chain dehydrogenase/reductase family VC1060 0,819086 5,02E-06 4,13E-06 1,21638 0,085069 0,086671 sohB protein, peptidase U7 family VC1064 0,466642 2,11E-06 4,31E-06 0,489204 -0,31051 0,331016 lipoprotein-related protein

VC1077 0,960918 3,34E-06 3,5E-06 0,953143 -0,02084 0,017314 hypothetical protein oligopeptide ABC transporter, periplasmic oligopeptide-binding VC1091 0,977268 5,97E-05 5,74E-05 1,039909 0,016995 0,009986 protein VC1095 0,740941 1,33E-05 1,09E-05 1,214808 0,084508 0,130217 oligopeptide ABC transporter, ATP-binding protein VC1097 0,423035 0,001646 0,002115 0,778251 -0,10888 0,373624 phosphate acetyltransferase VC1098 0,795215 0,000457 0,000398 1,147702 0,059829 0,099515 acetate kinase VC1110 0,914407 5,66E-06 5,13E-06 1,104114 0,043014 0,03886 seryl-tRNA synthetase VC1112 0,757389 4,44E-07 7,04E-07 0,630577 -0,20026 0,120681 biotin synthase VC1126 0,853159 7,63E-05 6,72E-05 1,135348 0,055129 0,06897 adenylosuccinate lyase VC1127 0,792812 2,35E-06 3,06E-06 0,768627 -0,11428 0,10083 conserved hypothetical protein VC1128 0,559632 3,21E-06 1,68E-06 1,904394 0,279757 0,252098 tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase VC1129 0,966662 2,46E-05 2,55E-05 0,967033 -0,01456 0,014725 inosine-guanosine kinase VC1130 0,753402 1,12E-05 1,45E-05 0,773702 -0,11143 0,122973 DNA-binding protein H-NS VC1141 0,669339 4,9E-05 3,86E-05 1,270277 0,103899 0,174354 isocitrate dehydrogenase VC1144 0,838231 0,000114 0,000101 1,124876 0,051105 0,076636 ATP-dependent Clp protease, ATP-binding subunit ClpA VC1147 0,33898 0,008486 0,003974 2,13538 0,329475 0,469826 iron-containing alcohol dehydrogenase VC1148 0,786411 1,41E-05 1,14E-05 1,231846 0,090556 0,10435 conserved hypothetical protein VC1149 0,61669 6,74E-06 3,83E-06 1,761955 0,245995 0,209933 glutamate decarboxylase, putative VC1154 0,213193 4,34E-06 1,55E-05 0,280194 -0,55254 0,671227 hypothetical protein VC1156 0,689585 7,83E-06 1,07E-05 0,731495 -0,13579 0,161412 sensor histidine kinase VC1159 0,180333 1,72E-05 5,35E-06 3,211883 0,50676 0,743926 phosphoserine aminotransferase VC1160 0,871888 1E-06 8,54E-07 1,17172 0,068824 0,059539 hypothetical protein VC1161 0,978131 2,25E-05 2,2E-05 1,025034 0,010738 0,009603 gonadoliberin III-related protein VC1166 0,819276 0,000225 0,000244 0,920524 -0,03596 0,08657 aspartyl-tRNA synthetase VC1178 0,70019 1,26E-06 7,46E-07 1,69237 0,228495 0,154784 conserved hypothetical protein VC1179 0,055216 0,0001 0,000371 0,270496 -0,56784 1,257938 pseudouridine synthase family 1 protein VC1180 0,71042 9,1E-06 6,12E-06 1,487255 0,172385 0,148485 transport ATP-binding protein CydC VC1181 0,858662 9,55E-06 8,12E-06 1,175905 0,070372 0,066178 transport ATP-binding protein CydD VC1182 0,281009 1,53E-06 3,21E-07 4,780168 0,679443 0,55128 thioredoxin reductase

VC1188 0,290451 4,63E-05 1,46E-05 3,172036 0,501338 0,536926 malate oxidoreductase phosphoribosylaminoimidazole-succinocarboxamide synthase, VC1190 0,31211 1,32E-05 1,06E-06 12,45515 1,095349 0,505692 putative VC1195 0,967967 2,7E-06 2,57E-06 1,050175 0,021262 0,014139 lipoprotein, putative VC1196 0,703999 3,81E-07 5,96E-07 0,639248 -0,19433 0,152428 hypothetical protein VC1197 0,218763 1,76E-05 8,39E-06 2,095159 0,321217 0,660026 hypothetical protein VC1201 0,895834 8,69E-07 1,02E-06 0,852993 -0,06905 0,047773 HD-GYP, hypothetical protein VC1203 0,45945 0,000283 0,000131 2,166794 0,335818 0,337762 urocanate hydratase VC1213 0,881933 1,29E-06 1,48E-06 0,875932 -0,05753 0,054564 transcriptional regulator, LuxR family VC1214 0,567011 1,43E-06 2,32E-06 0,617876 -0,2091 0,246408 excinuclease ABC, subunit C VC1220 0,574786 4,17E-06 6,41E-06 0,65064 -0,18666 0,240494 phenylalanyl-tRNA synthetase, beta chain VC1228 0,723957 6,51E-06 4,52E-06 1,43931 0,158154 0,140287 phosphoribosylglycinamide formyltransferase 2 VC1235 0,728091 2,15E-06 3E-06 0,71519 -0,14558 0,137814 sodium/dicarboxylate symporter nicotinate-nucleotide--dimethylbenzimidazole VC1237 0,858876 2,78E-07 2,15E-07 1,294035 0,111946 0,06607 phosphoribosyltransferase VC1240 0,544368 5,61E-06 9,92E-06 0,565178 -0,24781 0,264108 alpha-ribazole-5`-phosphate phosphatase CobC, putative VC1242 0,697846 0,000145 0,000191 0,756672 -0,12109 0,15624 succinylglutamate desuccinylase VC1245 0,364698 1,83E-05 2,51E-06 7,278154 0,862021 0,438066 vitamin B12 ABC transporter, ATP-binding protein BtuD, putative VC1246 0,949315 3,23E-06 3,02E-06 1,068851 0,028917 0,02259 hypothetical protein VC1248 0,745708 1,53E-05 1,19E-05 1,287521 0,109754 0,127431 methyl-accepting chemotaxis protein VC1255 0,618193 2,02E-06 1,3E-06 1,551036 0,190622 0,208876 ribonucleoside-diphosphate reductase, beta subunit VC1256 0,290488 0,000264 0,000143 1,844274 0,265825 0,536871 ribonucleoside-diphosphate reductase, alpha subunit VC1258 0,385594 0,08082 0,03429 2,356955 0,372351 0,41387 DNA gyrase, subunit A VC1259 0,800901 0,000123 0,000162 0,762995 -0,11748 0,096421 conserved hypothetical protein VC1263 0,972694 2,13E-06 2,21E-06 0,96647 -0,01481 0,012024 GTP cyclohydrolase II VC1264 0,701706 1,23E-05 8,1E-06 1,516535 0,180852 0,153845 iron-regulated protein A, putative VC1272 0,830266 3,79E-06 4,69E-06 0,809432 -0,09182 0,080783 hypothetical protein VC1273 0,358117 3,19E-06 3,09E-07 10,34349 1,014667 0,445976 extracellular solute-binding protein, family 7 VC1289 0,660236 1,97E-05 1,44E-05 1,374216 0,138055 0,180301 methyl-accepting chemotaxis protein VC1293 0,850626 5,17E-05 4,44E-05 1,164976 0,066317 0,070261 aspartate aminotransferase 73

VC1297 0,690148 0,000512 0,00042 1,218333 0,085766 0,161058 asparaginyl-tRNA synthetase VC1298 0,719535 1,57E-05 1,19E-05 1,324621 0,122091 0,142948 methyl-accepting chemotaxis protein VC1300 0,993365 1,93E-05 1,91E-05 1,007322 0,003168 0,002891 L-serine dehydratase 1 VC1304 0,917353 7,37E-05 7,97E-05 0,924737 -0,03398 0,037464 fumarate hydratase, class I, putative VC1313 0,535278 3,82E-05 2,76E-05 1,383696 0,141041 0,271421 methyl-accepting chemotaxis protein VC1321 0,706417 1,79E-05 1,19E-05 1,51308 0,179862 0,150939 hypothetical protein VC1336 0,460024 0,001522 0,000524 2,902918 0,462835 0,33722 carboxyphosphonoenolpyruvate phosphonomutase VC1344 0,303005 9,35E-06 3,69E-05 0,253663 -0,59574 0,51855 4-hydroxyphenylpyruvate dioxygenase VC1346 0,329737 4,94E-07 4,2E-11 11752,38 4,070126 0,481833 conserved hypothetical protein VC1350 0,562206 2,44E-07 4,92E-07 0,495428 -0,30502 0,250105 antioxidant, putative VC1354 0,747497 2,35E-05 1,84E-05 1,278474 0,106692 0,12639 conserved hypothetical protein VC1372 0,886314 2,41E-06 2,12E-06 1,134371 0,054755 0,052412 GGDEF, GGDEF family protein VC1374 0,920567 3,72E-06 4,1E-06 0,907561 -0,04212 0,035945 DnaK-related protein VC1382 0,993946 2,4E-05 2,38E-05 1,007137 0,003088 0,002637 ATP-dependent helicase HrpA VC1394 0,110023 0,000161 0,00046 0,348989 -0,45719 0,958517 methyl-accepting chemotaxis protein VC1406 0,745708 1,53E-05 1,19E-05 1,287521 0,109754 0,127431 methyl-accepting chemotaxis protein VC1410 0,784065 1,13E-05 8,62E-06 1,309344 0,117054 0,105648 multidrug resistance protein VceA VC1413 0,745708 1,53E-05 1,19E-05 1,287521 0,109754 0,127431 methyl-accepting chemotaxis protein VC1426 0,877616 1,53E-06 1,82E-06 0,843526 -0,0739 0,056695 spermidine/putrescine ABC transporter, permease protein VC1428 0,736561 2,71E-05 2,04E-05 1,324523 0,122059 0,132791 spermidine/putrescine ABC transporter, ATP-binding protein VC1432 0,291718 4,96E-06 5,2E-07 9,546154 0,979828 0,535036 conserved hypothetical protein VC1433 0,106169 2,2E-05 1,3E-06 16,94615 1,229071 0,974001 conserved hypothetical protein VC1434 0,956206 6,31E-06 6E-06 1,051851 0,021954 0,019448 fumarate and nitrate reduction regulatory protein VC1439 0,430063 0,00092 0,000611 1,504826 0,177486 0,366468 cytochrome c oxidase, subunit CcoP VC1441 0,206743 6,85E-05 1,8E-10 380923,2 5,580837 0,68457 cytochrome c oxidase, subunit CcoO VC1451 0,40924 2,19E-06 4,15E-06 0,528193 -0,27721 0,388022 RTX toxin RtxA VC1458 0,460364 6,11E-07 2,33E-07 2,622909 0,418783 0,336898 zona occludens toxin VC1470 0,769957 1,51E-06 1,93E-06 0,782721 -0,10639 0,113533 UNKNOWN VC1483 0,835944 3,07E-06 3,55E-06 0,863777 -0,0636 0,077823 3-hydroxydecanoyl-(acyl-carrier-protein) dehydratase

VC1485 0,277654 4,76E-06 8,86E-07 5,37246 0,730173 0,556497 hypothetical protein VC1487 0,920271 7,58E-06 8,28E-06 0,915297 -0,03844 0,036084 conserved hypothetical protein VC1488 0,779887 3,4E-05 2,71E-05 1,253869 0,098252 0,107968 conserved hypothetical protein VC1491 0,922832 3,58E-06 3,91E-06 0,91656 -0,03784 0,034877 dihydroorotate dehydrogenase VC1492 0,330039 0,000599 0,001058 0,566068 -0,24713 0,481434 conserved hypothetical protein VC1494 0,447557 1,07E-05 6,58E-06 1,6231 0,210345 0,349151 aminopeptidase N VC1496 0,899437 1,64E-05 1,81E-05 0,907028 -0,04238 0,046029 tail-specific protease VC1503 0,840967 1,28E-05 1,07E-05 1,198122 0,078501 0,075221 conserved hypothetical protein VC1508 0,261383 2,45E-07 6,78E-08 3,608856 0,55737 0,582722 conserved hypothetical protein VC1514 0,649367 0,000186 0,000266 0,701015 -0,15427 0,18751 hypothetical protein VC1520 0,779965 4,99E-07 6,93E-07 0,72045 -0,1424 0,107925 ABC transporter, ATP-binding protein VC1527 0,226899 0,00061 0,00017 3,576878 0,553504 0,644166 molybdopterin biosynthesis MoeA protein VC1535 0,745708 1,53E-05 1,19E-05 1,287521 0,109754 0,127431 methyl-accepting chemotaxis protein VC1540 0,941205 3,11E-07 3,41E-07 0,911678 -0,04016 0,026316 multidrug resistance protein NorM, putative VC1547 0,938719 3,71E-06 4,04E-06 0,918236 -0,03705 0,027465 biopolymer transport protein ExbB-related protein VC1548 0,184104 0,001701 0,004351 0,390945 -0,40788 0,734936 hypothetical protein VC1558 0,685279 3,51E-06 2E-06 1,757515 0,244899 0,164133 6-phospho-beta-glucosidase VC1560 0,67934 6,97E-05 0,000047 1,483617 0,171322 0,167913 catalase/peroxidase VC1577 0,880029 1,29E-05 1,47E-05 0,876443 -0,05728 0,055503 hypothetical protein VC1579 0,380393 2,86E-05 9,07E-06 3,15366 0,498815 0,419768 enterobactin synthetase component F-related protein VC1595 0,570752 3,29E-05 2,08E-05 1,58237 0,199308 0,243553 galactokinase VC1602 0,762105 1,7E-06 1,24E-06 1,36876 0,136327 0,117985 chemotaxis protein CheV VC1603 0,347621 7,69E-06 3,17E-07 24,27264 1,385117 0,458894 hypothetical protein VC1606 0,231994 9,82E-05 2,38E-05 4,123478 0,615264 0,634523 conserved hypothetical protein VC1607 0,802406 1,9E-05 1,52E-05 1,248521 0,096396 0,095606 conserved hypothetical protein VC1612 0,386847 1,8E-06 3,41E-07 5,26655 0,721526 0,412461 fimbrial biogenesis and twitching motility protein, putative VC1623 0,742483 1,53E-05 1,12E-05 1,359431 0,133357 0,129313 carboxynorspermidine decarboxylase VC1624 0,505037 2E-05 0,000009 2,224444 0,347222 0,296677 conserved hypothetical protein VC1635 0,785914 3,96E-06 2,96E-06 1,338181 0,126515 0,104625 ribosomal small subunit pseudouridine synthase A

VC1636 #DIV/0! #DIV/0! #NÚM! helicase-related protein VC1643 0,745708 1,53E-05 1,19E-05 1,287521 0,109754 0,127431 methyl-accepting chemotaxis protein VC1645 0,47959 2,18E-05 7,62E-06 2,858268 0,456103 0,31913 conserved hypothetical protein VC1650 0,619511 3,68E-06 2,09E-06 1,759694 0,245437 0,207951 collagenase VC1672 0,76495 4,35E-05 3,23E-05 1,347179 0,129425 0,116367 DNA-3-methyladenine glycosidase I VC1674 0,445367 1,74E-05 3,9E-06 4,453846 0,648735 0,351282 periplasmic linker protein, putative VC1703 0,783141 5,23E-06 6,56E-06 0,79753 -0,09825 0,10616 conserved hypothetical protein VC1713 0,337491 4,39E-06 1,56E-07 28,1306 1,449179 0,471738 transcriptional regulator, AsnC family VC1714 0,19831 2,39E-05 7,61E-06 3,139627 0,496878 0,702655 cell division protein MukB VC1715 0,987053 0,000126 0,000127 0,987411 -0,0055 0,005659 mukE protein VC1716 0,596882 9,96E-06 6,75E-06 1,475041 0,168804 0,224111 mukF protein VC1721 0,849735 1,44E-05 1,25E-05 1,15052 0,060894 0,070716 transcriptional regulator, LacI family VC1726 0,573076 3,34E-06 2,32E-06 1,441037 0,158675 0,241788 glycogen synthase VC1727 0,959637 0,000231 0,000226 1,022556 0,009687 0,017893 glucose-1-phosphate adenylyltransferase VC1730 0,855879 0,000121 0,000111 1,084381 0,035182 0,067588 DNA topoisomerase I VC1738 0,333215 3,09E-05 1,45E-05 2,125946 0,327552 0,477276 hypothetical protein VC1739 0,978071 0,000183 0,000186 0,983888 -0,00705 0,00963 hypothetical protein VC1741 0,540947 3,24E-05 2,03E-05 1,592028 0,201951 0,266845 transcriptional regulator, TetR family VC1746 0,124061 9,59E-06 6,08E-11 157701,8 5,197837 0,906365 transcriptional regulator, TetR family VC1751 0,720637 8,97E-06 6,45E-06 1,391965 0,143628 0,142283 conserved hypothetical protein VC1756 0,36384 1,94E-05 1,23E-06 15,76642 1,197733 0,43909 periplasmic linker protein, putative VC1765 0,770336 4,07E-07 5,74E-07 0,709379 -0,14912 0,11332 type I restriction enzyme HsdR, putative VC1769 0,900501 1,15E-05 1,3E-05 0,88829 -0,05145 0,045516 DNA methylase HsdM, putative VC1781 0,230436 2,28E-06 4,6E-07 4,945652 0,694224 0,63745 conserved hypothetical protein VC1803 0,79324 0,01228 0,01001 1,226773 0,088764 0,100595 hypothetical protein VC1819 0,198112 0,001195 0,004274 0,279598 -0,55347 0,703089 aldehyde dehydrogenase VC1821 0,809739 3,56E-06 2,84E-06 1,257143 0,099385 0,091655 PTS system, fructose-specific IIBC component VC1826 0,689412 3,38E-05 4,33E-05 0,781553 -0,10704 0,161521 PTS system, fructose-specific IIABC component VC1827 0,734687 1,55E-06 1,08E-06 1,438369 0,15787 0,133898 mannose-6-phosphate isomerase

VC1833 0,918093 1,95E-06 1,74E-06 1,125576 0,051375 0,037113 quinolinate synthetase A VC1835 0,298746 0,000324 0,000586 0,552465 -0,25769 0,524698 peptidoglycan-associated lipoprotein VC1836 0,43671 1,37E-06 4,05E-07 3,37284 0,527996 0,359807 tolB protein VC1843 0,328138 1,26E-05 1,53E-06 8,203788 0,914014 0,483944 cytochrome d ubiquinol oxidase, subunit II VC1844 0,943434 0,000393 0,000371 1,059299 0,025019 0,025288 cytochrome d ubiquinol oxidase, subunit I VC1848 0,97169 2,92E-05 2,85E-05 1,027065 0,011598 0,012472 cysteinyl-tRNA synthetase VC1849 0,947918 1,45E-06 1,55E-06 0,932903 -0,03016 0,023229 peptidyl-prolyl cis-trans isomerase B VC1850 0,310417 2,97E-06 1,21E-05 0,24493 -0,61096 0,508055 conserved hypothetical protein VC1854 0,55598 0,000172 0,000264 0,650379 -0,18683 0,254941 porin, putative VC1859 0,745708 1,53E-05 1,19E-05 1,287521 0,109754 0,127431 methyl-accepting chemotaxis protein VC1866 0,384378 0,000208 0,000275 0,75847 -0,12006 0,415241 formate acetyltransferase VC1868 0,745708 1,53E-05 1,19E-05 1,287521 0,109754 0,127431 methyl-accepting chemotaxis protein VC1872 0,56097 0,00016 0,000243 0,657061 -0,18239 0,251061 conserved hypothetical protein VC1873 0,239727 7,25E-06 0,000155 0,046891 -1,32891 0,620283 conserved hypothetical protein VC1874 0,784571 0,000275 0,000366 0,750478 -0,12466 0,105368 conserved hypothetical protein VC1878 0,949371 1,19E-05 1,26E-05 0,943038 -0,02547 0,022564 transport ATP-binding protein MsbA VC1882 0,503533 3,79E-06 1,74E-06 2,178366 0,338131 0,297972 conserved hypothetical protein VC1886 0,568445 3,84E-06 6,63E-06 0,579074 -0,23727 0,245312 transcription-repair coupling factor VC1890 0,879637 6,33E-05 5,61E-05 1,129861 0,053025 0,055696 NADH dehydrogenase VC1892 0,742888 2,24E-06 2,85E-06 0,787219 -0,1039 0,129077 conserved hypothetical protein VC1898 0,982556 3,29E-06 3,23E-06 1,018593 0,008001 0,007643 methyl-accepting chemotaxis protein VC1899 0,339743 0,000557 0,000981 0,567322 -0,24617 0,46885 hypothetical protein VC1904 0,159998 8,29E-05 3,04E-05 2,726496 0,435605 0,795886 leucine-responsive regulatory protein VC1905 0,5306 5,2E-06 1,83E-06 2,844177 0,453957 0,275233 alanine dehydrogenase VC1907 0,885329 2,49E-06 2,2E-06 1,131543 0,053671 0,052895 cys regulon transcriptional activator VC1910 0,591574 3,63E-07 6,89E-07 0,526766 -0,27838 0,227991 tRNA-(MS[2]IO[6]A)-hydroxylase VC1915 0,549661 0,001965 0,001467 1,339468 0,126932 0,259905 ribosomal protein S1 VC1916 0,949853 1,41E-06 1,32E-06 1,066009 0,027761 0,022343 cytidylate kinase VC1918 0,811974 2,77E-07 3,49E-07 0,79416 -0,10009 0,090458 peptidyl-prolyl cis-trans isomerse D

VC1919 0,439266 7,17E-06 3,24E-06 2,213889 0,345156 0,357272 DNA-binding protein HU-beta VC1920 0,776803 0,000324 0,000384 0,841571 -0,07491 0,109689 ATP-dependent protease LA VC1921 0,7955 3,88E-05 3,13E-05 1,240486 0,093592 0,09936 ATP-dependent Clp protease, ATP-binding subunit ClpX VC1923 0,489118 8,74E-05 4,14E-05 2,110145 0,324312 0,310586 trigger factor VC1925 0,233432 4,28E-07 4,2E-11 10188,1 4,008093 0,631839 C4-dicarboxylate transport sensor protein CDP-diacylglycerol--glycerol-3-phosphate 3- VC1935 0,38365 0,001484 0,000269 5,510583 0,741198 0,416064 phosphatidyltransferase-related protein methylenetetrahydrofolate VC1942 0,894057 8,62E-07 7,3E-07 1,180137 0,071932 0,048635 dehydrogenase/methenyltetrahydrofolate cyclohydrolase VC1951 0,831977 5,44E-06 4,36E-06 1,245646 0,095395 0,079889 cytochrome c-type protein YecK VC1956 0,679028 1,84E-07 1,07E-07 1,724977 0,236783 0,168112 lytic murein transglycosylase, putative VC1960 0,898957 5,74E-06 6,46E-06 0,889009 -0,05109 0,046261 septum site-determining protein MinD VC1972 0,520699 0,000166 9,39E-05 1,771222 0,248273 0,283413 o-succinylbenzoate-CoA synthase VC1978 0,344006 1,07E-06 4,27E-08 25,09951 1,399665 0,463434 HD-GYP, conserved hypothetical protein VC1983 0,992672 1,61E-06 1,59E-06 1,008788 0,0038 0,003194 peptidase, putative VC1985 0,880268 0,000389 0,000354 1,09825 0,040701 0,055385 long-chain-fatty-acid--CoA ligase VC1989 0,848541 1,02E-05 8,46E-06 1,206285 0,08145 0,071327 conserved hypothetical protein VC1994 0,773656 2,58E-06 2,09E-06 1,232903 0,090929 0,111452 protease IV VC2000 0,127648 0,000361 0,00075 0,480923 -0,31792 0,893986 glyceraldehyde 3-phosphate dehydrogenase VC2008 0,872847 6,28E-06 5,18E-06 1,21139 0,083284 0,059062 pyruvate kinase II VC2013 0,667699 0,000998 0,00116 0,86 -0,0655 0,175419 PTS system, glucose-specific IIBC component VC2019 0,711533 4,68E-05 3,57E-05 1,312027 0,117943 0,147805 3-oxoacyl-(acyl-carrier-protein) synthase II VC2021 0,814274 9,18E-05 7,8E-05 1,17755 0,070979 0,08923 3-oxoacyl-(acyl-carrier-protein) reductase VC2022 0,620549 3,09E-05 2,13E-05 1,450962 0,161656 0,207224 malonyl Coa-acyl carrier protein transacylase VC2023 0,851013 1,91E-05 2,16E-05 0,884508 -0,0533 0,070064 3-oxoacyl-(acyl-carrier-protein) synthase III VC2025 0,836889 1,79E-06 1,37E-06 1,299127 0,113651 0,077332 ribosomal protein L32 VC2026 0,763864 1,52E-05 1,2E-05 1,266055 0,102453 0,116984 conserved hypothetical protein VC2030 0,156801 0,0235 0,07012 0,33514 -0,47477 0,80465 ribonuclease E VC2033 0,56738 0,000864 0,001031 0,838118 -0,07669 0,246126 alcohol dehydrogenase/acetaldehyde dehydrogenase VC2037 0,729941 2,52E-06 3,41E-06 0,736888 -0,1326 0,136712 Na+/H+ antiporter 78

VC2039 0,894178 9,57E-07 8,39E-07 1,141307 0,057402 0,048576 conserved hypothetical protein VC2053 0,98336 6,41E-07 6,57E-07 0,975194 -0,01091 0,007287 cytochrome c-type biogenesis protein CcmE VC2059 0,519065 5,63E-05 8,27E-05 0,679961 -0,16752 0,284779 purine-binding chemotaxis protein CheW VC2062 0,837202 4,01E-06 3,26E-06 1,232044 0,090626 0,07717 protein-glutamate methylesterase CheB VC2063 0,723895 7,15E-05 9,2E-05 0,777005 -0,10958 0,140325 chemotaxis protein CheA VC2067 0,696333 8,98E-07 1,27E-06 0,707565 -0,15023 0,157183 MinD-related protein VC2068 0,93079 4,74E-07 5,16E-07 0,918474 -0,03693 0,031148 flagellar biosynthetic protein FlhF, putative VC2072 0,831168 2,24E-06 1,84E-06 1,221678 0,086957 0,080311 peptidase, insulinase family VC2074 0,704459 3,77E-05 5,07E-05 0,743929 -0,12847 0,152144 arginyl-tRNA synthetase VC2084 0,653668 6,34E-05 4,99E-05 1,27156 0,104337 0,184643 succinyl-CoA synthase, alpha subunit VC2085 0,56897 0,000386 0,000611 0,631114 -0,19989 0,244911 succinyl-CoA synthase, beta subunit 2-oxoglutarate dehydrogenase, E2 component, dihydrolipoamide VC2086 0,616984 7,05E-05 0,000101 0,697033 -0,15675 0,209726 succinyltransferase VC2087 0,106632 0,000733 0,002692 0,272103 -0,56527 0,97211 2-oxoglutarate dehydrogenase, E1 component VC2088 0,187484 0,000574 0,001106 0,518535 -0,28522 0,727037 succinate dehydrogenase, iron-sulfur protein VC2089 0,547106 0,000136 0,000188 0,724947 -0,13969 0,261929 succinate dehydrogenase, flavoprotein subunit VC2092 0,22206 9,51E-05 0,000413 0,230044 -0,63819 0,65353 citrate synthase VC2093 0,737144 1,12E-06 8,39E-07 1,330789 0,124109 0,132448 GTP cyclohydrolase 1 type 2 homolog VC2095 0,555933 2,79E-05 2,08E-05 1,342004 0,127754 0,254978 phosphoglucomutase VC2096 0,660411 7,42E-07 1,36E-06 0,543622 -0,2647 0,180186 seqA protein VC2107 0,902716 6,94E-06 6,14E-06 1,13023 0,053167 0,044449 aspartate-semialdehyde dehydrogenase, putative VC2116 0,939546 3,31E-06 3,07E-06 1,079127 0,033073 0,027082 chorismate synthase VC2125 0,998265 1,87E-06 1,86E-06 1,002682 0,001163 0,000754 flagellar motor switch protein FliN VC2126 0,624772 4,11E-06 2,29E-06 1,796588 0,254448 0,204278 flagellar motor switch protein FliM VC2127 0,898768 1,17E-05 1,06E-05 1,10586 0,0437 0,046352 flagellar protein FliL, putative VC2132 0,575981 0,000987 0,000489 2,018409 0,305009 0,239592 flagellar motor switch protein FliG VC2135 0,942786 3,72E-07 4,06E-07 0,917673 -0,03731 0,025587 sigma-54 dependent response regulator VC2137 0,598936 3,56E-06 2,22E-06 1,60216 0,204706 0,22262 sigma-54 dependent transcriptional activator VC2143 0,954798 3,04E-06 2,86E-06 1,0625 0,026329 0,020088 flagellin FlaD

VC2145 0,746765 1,3E-05 1,07E-05 1,213084 0,083891 0,126816 tyrA protein VC2157 0,506681 3,12E-05 2,08E-05 1,499039 0,175813 0,295265 dihydrodipicolinate synthase VC2159 0,746267 5,72E-07 8,37E-07 0,68367 -0,16515 0,127106 glycine cleavage system transcriptional repressor, putative VC2161 0,613952 0,000549 0,00079 0,695366 -0,15779 0,211866 methyl-accepting chemotaxis protein VC2174 0,099386 0,001257 0,004162 0,302018 -0,51997 1,002675 UDP-sugar hydrolase VC2175 0,6437 1,49E-05 1,04E-05 1,435996 0,157153 0,191317 2-dehydro-3-deoxyphosphooctonate aldolase VC2179 0,300093 2,5E-05 3,22E-06 7,77916 0,890933 0,522744 peptide chain release factor 1 VC2183 0,95492 5,53E-05 5,77E-05 0,958203 -0,01854 0,020033 ribose-phosphate pyrophosphokinase VC2185 0,933576 3,01E-05 2,81E-05 1,070463 0,029572 0,02985 GTP-binding protein VC2201 0,956319 6,75E-06 6,41E-06 1,053864 0,022785 0,019397 chemotaxis protein methyltransferase CheR VC2202 0,65564 2,15E-05 1,64E-05 1,306943 0,116257 0,183335 chemotaxis protein CheV VC2205 0,214587 2,08E-05 9,41E-05 0,220734 -0,65613 0,668397 hypothetical protein VC2208 0,964414 1,18E-06 1,13E-06 1,046018 0,019539 0,015736 hypothetical protein VC2213 0,726164 0,000269 0,000211 1,272986 0,104824 0,138966 outer membrane protein OmpA VC2214 0,872021 5,51E-05 6,2E-05 0,889104 -0,05105 0,059473 glutamyl-tRNA synthetase VC2224 0,285196 2,33E-07 7,24E-07 0,321448 -0,49289 0,544857 GGDEF, GGDEF family protein VC2225 0,981039 7,64E-05 7,5E-05 1,018931 0,008145 0,008314 uracil phosphoribosyltransferase VC2226 0,880695 5,18E-06 4,48E-06 1,156285 0,063065 0,055175 phosphoribosylformylglycinamidine cyclo-ligase VC2230 0,133041 5,21E-05 8,33E-07 62,497 1,795859 0,876013 phosphoheptose isomerase VC2237 0,507203 0,000183 9,37E-05 1,952417 0,290572 0,294818 membrane-bound lytic murein transglycosylase D VC2244 0,929259 1,24E-05 1,34E-05 0,927341 -0,03276 0,031863 acetyl-CoA carboxylase, carboxyl transferase alpha subunit VC2246 0,963458 9,69E-07 9,16E-07 1,057617 0,024328 0,016167 ribonuclease HII acyl-(acyl-carrier-protein)--UDP-N- acetylglucosamine O- VC2248 0,721963 2,31E-05 1,83E-05 1,263934 0,101725 0,141485 acyltransferase VC2249 0,179165 0,001814 0,004605 0,39392 -0,40459 0,746748 (3R)-hydroxymyristoyl-(acyl-carrier-protein) dehydratase VC2250 0,56239 2,16E-05 1,31E-05 1,65364 0,218441 0,249962 UDP-3-O-3-hydroxymyristoyl glucosamine N-acyltransferase VC2251 0,242613 4,93E-06 1,49E-06 3,30496 0,519166 0,615086 outer membrane protein OmpH VC2252 0,687456 1,49E-05 1,05E-05 1,422562 0,153071 0,162755 surface antigen VC2256 0,455987 1,13E-06 4,39E-07 2,563169 0,408777 0,341048 undecaprenyl diphosphate synthase

VC2258 0,91477 1,62E-05 1,46E-05 1,109364 0,045074 0,038688 uridylate kinase VC2259 0,629189 0,000529 0,000371 1,42657 0,154293 0,201219 elongation factor Ts VC2260 0,703075 0,003084 0,003699 0,833739 -0,07897 0,152998 ribosomal protein S2 VC2267 0,828339 6,8E-06 5,43E-06 1,252533 0,097789 0,081792 N utilization substance protein B VC2279 0,655215 4,4E-05 3,5E-05 1,25836 0,099805 0,183616 aminoacyl-histidine dipeptidase VC2282 0,62548 0,000013 8,07E-06 1,611903 0,207339 0,203786 conserved hypothetical protein VC2289 0,330588 1,44E-05 7,54E-07 19,15119 1,282196 0,480713 thiamin biosynthesis lipoprotein ApbE NADH:ubiquinone oxidoreductase, Na translocating, beta VC2290 0,740666 0,00071 0,000868 0,817794 -0,08736 0,130377 subunit NADH:ubiquinone oxidoreductase, Na translocating, VC2292 0,215516 7,2E-07 4,2E-11 17142,86 4,234083 0,666521 hydrophobic membrane protein NqrD NADH:ubiquinone oxidoreductase, Na translocating, gamma VC2293 0,181304 0,000144 2,36E-06 60,99321 1,785281 0,741592 subunit NADH:ubiquinone oxidoreductase, Na translocating, VC2294 0,285417 4,02E-05 5,13E-06 7,83473 0,894024 0,54452 hydrophobic membrane protein NqrB NADH:ubiquinone oxidoreductase, Na translocating, alpha VC2295 0,473561 0,000576 0,00037 1,556787 0,192229 0,324624 subunit VC2297 0,36371 2,64E-06 1,03E-06 2,560621 0,408345 0,439245 conserved hypothetical protein VC2298 0,016364 0,02296 0,08418 0,272749 -0,56424 1,786097 lipoprotein, putative VC2302 0,374754 3,84E-05 6,04E-06 6,354305 0,803068 0,426254 RNA polymerase sigma-70 factor, ECF subfamily VC2305 0,390817 0,000197 8,04E-05 2,444362 0,388165 0,408027 outer membrane protein OmpK VC2329 0,58367 0,000172 0,000113 1,528889 0,184376 0,233833 2,3,4,5-tetrahydropyridine-2-carboxylate N-succinyltransferase VC2333 0,369335 0,000207 0,000318 0,650709 -0,18661 0,43258 ribosomal protein S6 modification protein-related protein VC2341 0,734587 9,46E-06 1,58E-05 0,6 -0,22185 0,133957 long-chain-fatty-acid--CoA ligase, putative VC2342 0,686726 0,006353 0,006972 0,911216 -0,04038 0,163217 elongation factor G VC2343 0,842809 1,67E-05 1,95E-05 0,859784 -0,06561 0,074271 DNA repair protein RadA VC2345 0,866542 4,02E-07 4,91E-07 0,819849 -0,08627 0,06221 phosphoserine phosphatase VC2348 0,648356 4,84E-06 2,74E-06 1,765049 0,246757 0,188187 phosphopentomutase VC2352 0,959237 1,45E-05 1,51E-05 0,960797 -0,01737 0,018074 NupC family protein VC2355 0,656384 9,49E-06 6,39E-06 1,484517 0,171585 0,182842 conserved hypothetical protein

VC2362 0,986655 2,93E-07 2,86E-07 1,024109 0,010346 0,005835 threonine synthase VC2364 0,418879 5,47E-07 1,28E-06 0,428091 -0,36846 0,377911 aspartokinase I/homoserine dehydrogenase, threonine-sensitive VC2368 0,715543 4,59E-05 3,6E-05 1,276063 0,105872 0,145364 aerobic respiration control protein FexA VC2373 0,858074 4,42E-06 3,87E-06 1,143338 0,058175 0,066475 glutamate synthase, large subunit VC2380 0,091282 7,29E-06 1,01E-06 7,250497 0,860368 1,039613 cobalamin biosynthesis protein CbiB, putative VC2385 0,96919 3,91E-07 4,09E-07 0,954801 -0,02009 0,013591 RNA-directed DNA polymerase VC2386 0,522977 4,05E-05 6,67E-05 0,606233 -0,21736 0,281517 conserved hypothetical protein VC2387 0,557311 2,32E-06 3,94E-06 0,587563 -0,23095 0,253902 conserved hypothetical protein VC2389 0,851833 0,000353 0,000387 0,911651 -0,04017 0,069645 carbamoyl-phosphate synthase, large subunit VC2390 0,774934 1,7E-05 1,31E-05 1,299465 0,113765 0,110735 carbamoyl-phosphate synthase, small subunit VC2392 0,1133 1,01E-05 7,98E-11 126896,6 5,10345 0,94577 mutator MutT protein VC2394 0,773324 0,000239 0,000199 1,197593 0,078309 0,111638 preprotein translocase, SecA subunit VC2397 0,738672 0,00016 0,000185 0,864398 -0,06329 0,131548 cell division protein FtsZ VC2398 0,86706 9,53E-06 8,25E-06 1,155609 0,062811 0,061951 cell division protein FtsA VC2400 0,640659 1,6E-06 8,11E-07 1,9719 0,294885 0,193373 UDP-N-acetylmuramate--alanine ligase UDP-N-acetylmuramoylalanyl-D-glutamyl-2, 6-diaminopimelate-- VC2405 0,236213 1,02E-05 2,91E-06 3,490371 0,542872 0,626696 D-alanyl-D-alanyl ligase VC2407 0,906893 8,01E-05 8,82E-05 0,907298 -0,04225 0,042444 penicillin-binding protein 3 pyruvate dehydrogenase, E3 component, lipoamide VC2412 0,189431 3,34E-05 9,95E-05 0,336047 -0,4736 0,722548 dehydrogenase pyruvate dehydrogenase, E2 component, dihydrolipoamide VC2413 0,602065 9,58E-05 0,000127 0,752276 -0,12362 0,220356 acetyltransferase VC2414 0,732122 0,002119 0,002447 0,865958 -0,0625 0,135417 pyruvate dehydrogenase, E1 component VC2417 0,661842 2,31E-07 1,52E-07 1,521768 0,182348 0,179246 single-stranded-DNA-specific exonuclease RecJ VC2420 0,940685 4,79E-06 4,41E-06 1,084277 0,03514 0,026556 flavodoxin 2 VC2422 0,910093 9,29E-06 8,36E-06 1,110473 0,045508 0,040914 nicotinate-nucleotide pyrophosphorylase, carboxylating VC2430 0,527277 0,001017 0,001424 0,714185 -0,14619 0,277961 topoisomerase IV, subunit A VC2431 0,966085 4,33E-05 4,21E-05 1,028524 0,012214 0,014985 topoisomerase IV, subunit B VC2435 0,984439 3,53E-05 3,6E-05 0,981106 -0,00828 0,006811 MutT/nudix family protein VC2436 0,172234 0,000324 0,001003 0,32323 -0,49049 0,763881 outer membrane protein TolC 82

VC2439 0,640872 2,03E-05 1,48E-05 1,369168 0,136457 0,193229 methyl-accepting chemotaxis protein VC2443 0,893538 7,42E-06 8,16E-06 0,908746 -0,04156 0,048887 conserved hypothetical protein VC2447 0,246188 0,001923 0,00396 0,485606 -0,31372 0,608734 enolase VC2448 0,874566 0,000167 0,000183 0,912425 -0,0398 0,058207 CTP synthase VC2451 0,880506 4E-06 4,45E-06 0,899101 -0,04619 0,055268 GTP pyrophosphokinase VC2452 0,191773 4,75E-06 9,69E-07 4,903539 0,69051 0,717213 TrmA family RNA methyltransferase, putative VC2453 0,590453 6,66E-05 8,99E-05 0,740461 -0,1305 0,228815 sensor histidine kinase/response regulator VC2461 0,868876 8,5E-06 7,33E-06 1,159503 0,064272 0,061042 ribonuclease III VC2462 0,720739 8,91E-06 7,1E-06 1,254366 0,098424 0,142222 signal peptidase I VC2463 0,753674 0,000631 0,000544 1,160015 0,064463 0,122816 GTP-binding protein LepA VC2465 0,413414 2,51E-05 5,67E-05 0,44223 -0,35435 0,383615 sigma-E factor regulatory protein RseB VC2469 0,775905 6,37E-06 5,45E-06 1,169787 0,068107 0,110192 l-aspartate oxidase VC2472 0,85739 4,08E-07 4,72E-07 0,865254 -0,06286 0,066821 conserved hypothetical protein VC2480 0,971128 5,35E-05 5,53E-05 0,967649 -0,01428 0,012724 ribose-5-phosphate isomerase VC2481 0,926996 1,05E-05 9,63E-06 1,089644 0,037285 0,032922 D-3-phosphoglycerate dehydrogenase VC2482 0,325677 1,39E-05 0,000149 0,093231 -1,03044 0,487212 acetolactate synthase III, small subunit VC2483 0,547969 1,26E-06 6,09E-07 2,064092 0,314729 0,261244 acetolactate synthase III, large subunit VC2484 0,857418 2,34E-06 2,8E-06 0,837384 -0,07708 0,066807 long-chain-fatty-acid--CoA ligase, putative VC2485 0,898026 1,01E-06 8,9E-07 1,133708 0,054501 0,046711 transcriptional regulator, LysR family VC2487 0,360174 3,73E-05 4,52E-06 8,25 0,916454 0,443487 conserved hypothetical protein VC2492 0,936852 7,62E-07 6,91E-07 1,102546 0,042397 0,028329 3-isopropylmalate dehydratase, large subunit VC2494 0,403237 4,3E-05 8,68E-06 4,951009 0,694694 0,394439 hypothetical protein VC2501 0,078 0,000914 0,006843 0,133596 -0,87421 1,107904 aminopeptidase A/I VC2503 0,88739 0,00019 0,000172 1,104408 0,04313 0,051885 valyl-tRNA synthetase VC2506 0,790395 1,21E-05 1,44E-05 0,843315 -0,07401 0,102156 RNA polymerase-associated protein HepA VC2507 0,864631 1,92E-05 2,16E-05 0,890589 -0,05032 0,063169 conserved hypothetical protein VC2513 0,843121 1,41E-06 1,72E-06 0,816125 -0,08824 0,07411 1-acyl-sn-glycerol-3-phosphate acyltransferase VC2514 0,622677 5,52E-05 3,94E-05 1,402287 0,146837 0,205737 UDP-N-acetylglucosamine 1-carboxyvinyltransferase VC2520 0,989401 2,19E-06 2,16E-06 1,013445 0,0058 0,004628 ABC transporter, ATP-binding protein

VC2523 0,625701 8,54E-07 3,9E-07 2,189231 0,340292 0,203633 conserved hypothetical protein VC2528 0,837954 6,02E-06 6,92E-06 0,868969 -0,061 0,07678 ABC transporter, ATP-binding protein VC2529 0,235014 4,12E-05 1,57E-05 2,617292 0,417852 0,628907 RpoN, RNA polymerase sigma-54 factor VC2544 0,821454 9,63E-05 7,36E-05 1,308246 0,116689 0,085417 fructose-1,6-bisphosphatase VC2550 0,306237 8,89E-07 4,2E-11 21157,14 4,325457 0,513943 conserved hypothetical protein VC2564 0,77525 1,81E-06 1,36E-06 1,332597 0,124699 0,110558 ATP-dependent RNA helicase DbpA VC2570 0,961816 1,88E-05 1,82E-05 1,034047 0,01454 0,016908 ribosomal protein L17 VC2571 0,677944 0,000109 7,79E-05 1,39299 0,143948 0,168806 DNA-directed RNA polymerase, alpha subunit VC2572 0,644455 0,002647 0,002013 1,314953 0,11891 0,190808 ribosomal protein S4 VC2573 0,400451 0,01127 0,01814 0,621279 -0,20671 0,397451 ribosomal protein S11 VC2574 0,537126 0,0008 0,000616 1,298895 0,113574 0,269924 ribosomal protein S13 VC2575 0,491275 3,36E-05 0,000059 0,568814 -0,24503 0,308675 ribosomal protein L36 VC2576 0,79794 3,89E-05 4,68E-05 0,830273 -0,08078 0,09803 preprotein translocase, SecY subunit VC2577 0,623869 0,001793 0,002353 0,762006 -0,11804 0,204907 ribosomal protein L15 VC2578 0,957007 0,000045 4,66E-05 0,965665 -0,01517 0,019085 ribosomal protein L30 VC2579 0,845202 0,00306 0,002733 1,119649 0,049082 0,073039 ribosomal protein S5 VC2580 0,719454 0,000852 0,00105 0,810952 -0,091 0,142997 ribosomal protein L18 VC2581 0,942265 0,002576 0,00267 0,964794 -0,01557 0,025827 ribosomal protein L6 VC2582 0,777141 0,000552 0,000472 1,169208 0,067892 0,1095 ribosomal protein S8 VC2583 0,441517 0,000621 0,000816 0,761554 -0,1183 0,355053 ribosomal protein S14 VC2584 0,712308 0,003752 0,00324 1,158025 0,063718 0,147332 ribosomal protein L5 VC2585 0,801218 0,000396 0,000468 0,847733 -0,07174 0,096249 ribosomal protein L24 VC2586 0,457801 0,002313 0,003192 0,724624 -0,13989 0,339323 ribosomal protein L14 VC2589 0,718485 0,002449 0,00206 1,188835 0,075122 0,143582 ribosomal protein L16 VC2590 0,822005 0,02991 0,03276 0,913004 -0,03953 0,085126 ribosomal protein S3 VC2591 0,833487 0,000104 9,15E-05 1,13224 0,053939 0,079101 ribosomal protein L22 VC2593 0,844086 0,000892 0,001015 0,878719 -0,05615 0,073614 ribosomal protein L2 VC2594 0,76363 1,24E-05 1,85E-05 0,672264 -0,17246 0,117117 ribosomal protein L23 VC2595 0,924119 0,004888 0,004657 1,049603 0,021025 0,034272 ribosomal protein L4

VC2596 0,715447 0,000277 0,000231 1,201127 0,079589 0,145423 ribosomal protein L3 VC2597 0,981338 0,001088 0,001103 0,986401 -0,00595 0,008181 ribosomal protein S10 VC2598 0,914215 1,9E-06 1,7E-06 1,12 0,049218 0,038952 RNA methyltransferase, TrmH family VC2599 0,923605 0,009618 0,01008 0,954167 -0,02038 0,034514 ribonuclease R VC2602 0,412433 0,000307 0,000425 0,723033 -0,14084 0,384647 adenylosuccinate synthetase VC2608 0,682688 3,32E-05 4,73E-05 0,700972 -0,1543 0,165777 ABC transporter, ATP-binding protein VC2614 0,251064 0,000341 0,000586 0,581983 -0,23509 0,600215 cyclic AMP receptor protein VC2617 0,52857 3,23E-05 5,22E-05 0,617816 -0,20914 0,276898 arginine/ornithine succinyltransferase, putative VC2620 0,827815 5,34E-06 4,28E-06 1,247196 0,095935 0,082067 conserved hypothetical protein VC2624 0,981672 5,3E-07 5,48E-07 0,967683 -0,01427 0,008034 phosphoglycolate phosphatase VC2627 0,97429 6,86E-07 7,09E-07 0,968671 -0,01382 0,011312 DamX-related protein VC2629 0,858709 1,39E-05 1,2E-05 1,161371 0,064971 0,066154 shikimate kinase VC2635 0,921105 8,81E-06 9,6E-06 0,918021 -0,03715 0,035691 penicillin-binding protein 1A VC2646 0,823726 2,68E-05 3,13E-05 0,85728 -0,06688 0,084217 phosphoenolpyruvate carboxylase VC2647 0,965712 1,48E-05 1,54E-05 0,958549 -0,01839 0,015153 conserved hypothetical protein VC2651 0,889766 3,2E-06 2,85E-06 1,123639 0,050627 0,050724 glycerol-3-phosphate dehydrogenase (NAD+) VC2653 0,841457 9,11E-05 8E-05 1,137931 0,056116 0,074968 protein-transport protein SecB VC2654 0,63895 7,75E-06 1,08E-05 0,719406 -0,14303 0,194533 conserved hypothetical protein VC2656 0,727047 7,28E-05 5,96E-05 1,221252 0,086805 0,138438 fumarate reductase, flavoprotein subunit VC2657 0,297172 2,91E-05 1,59E-05 1,833018 0,263167 0,526992 fumarate reductase, iron-sulfur protein VC2660 0,65617 3,44E-05 2,36E-05 1,458599 0,163936 0,182983 elongation factor P VC2662 0,968523 5,31E-06 5,51E-06 0,963158 -0,0163 0,01389 conserved hypothetical protein VC2664 0,383004 0,001359 0,004048 0,335721 -0,47402 0,416797 chaperonin, 60 Kd subunit VC2674 0,903504 7,86E-05 8,67E-05 0,905998 -0,04287 0,04407 protease HslVU, ATPase subunit HslU VC2675 0,647214 1,73E-05 1,25E-05 1,3832 0,140885 0,188952 protease HslVU, subunit HslV VC2677 0,941826 5,06E-07 5,52E-07 0,916863 -0,0377 0,026029 transcriptional repressor, LacI family VC2679 0,871539 5,88E-05 5,19E-05 1,131934 0,053821 0,059713 ribosomal protein L31 aspartokinase II/homoserine dehydrogenase, methionine- VC2684 0,246941 3,11E-06 1,05E-06 2,955281 0,470599 0,607407 sensitive

VC2688 0,752258 4,9E-06 3,45E-06 1,42029 0,152377 0,123633 glpX protein VC2689 0,720187 1,12E-05 1,45E-05 0,774483 -0,11099 0,142555 6-phosphofructokinase, isozyme I VC2691 0,354777 2,17E-05 2,07E-06 10,48769 1,02068 0,450044 periplasmic protein cpxP, putative VC2693 0,432874 4,38E-05 2,07E-05 2,116965 0,325714 0,363638 sensor protein CpxA VC2697 0,782621 0,000286 0,000222 1,284878 0,108862 0,106448 GGDEF, GGDEF family protein VC2698 0,973172 0,000585 0,000574 1,020227 0,008697 0,01181 aspartate ammonia-lyase VC2710 0,920691 2,35E-05 2,58E-05 0,912301 -0,03986 0,035886 guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase VC2714 0,730391 1,12E-06 1,51E-06 0,741208 -0,13006 0,136444 transcriptional regulator OmpR VC2715 0,974902 8,06E-07 8,33E-07 0,968183 -0,01404 0,011039 transcription elongation factor GreB VC2716 0,762155 4,53E-05 5,75E-05 0,788174 -0,10338 0,117957 conserved hypothetical protein VC2719 0,063648 0,005874 0,01741 0,337392 -0,47186 1,196218 ComF-related protein VC2732 0,888406 3,19E-06 3,61E-06 0,883527 -0,05378 0,051389 general secretion pathway protein E VC2734 0,149056 5,21E-05 0,0004 0,130317 -0,885 0,82665 general secretion pathway protein C VC2736 0,854527 1,18E-05 1,39E-05 0,847873 -0,07167 0,068274 conserved hypothetical protein VC2738 0,135084 0,000396 0,001549 0,255713 -0,59225 0,869395 phosphoenolpyruvate carboxykinase VC2740 0,787559 2,33E-06 1,81E-06 1,291644 0,111143 0,103717 conserved hypothetical protein VC2741 0,985406 6,75E-07 6,91E-07 0,977849 -0,00973 0,006385 conserved hypothetical protein VC2744 0,803669 0,000247 0,000215 1,149302 0,060434 0,094923 GTP-binding protein TypA VC2746 0,550367 5,05E-06 7,76E-06 0,650548 -0,18672 0,259347 glutamate--ammonia ligase VC2751 0,966935 1,05E-05 1,01E-05 1,039643 0,016884 0,014603 adenosine deaminase VC2761 0,553141 5,14E-07 2,48E-07 2,073476 0,316699 0,257164 multidrug resistance protein VC2762 0,43116 0,000243 0,000487 0,498973 -0,30192 0,365362 UDP-N-acetylglucosamine pyrophosphorylase VC2763 0,822166 2,2E-06 1,67E-06 1,316577 0,119446 0,08504 ATP synthase F1, epsilon subunit VC2764 0,08135 0,000652 0,000277 2,357556 0,372462 1,089644 ATP synthase F1, beta subunit VC2765 0,69698 6,18E-05 4,54E-05 1,361913 0,134149 0,15678 ATP synthase F1, gamma subunit VC2766 0,522818 0,002086 0,001563 1,334613 0,125355 0,281649 ATP synthase F1, alpha subunit VC2767 0,977345 2,86E-06 2,77E-06 1,033562 0,014336 0,009952 ATP synthase F1, delta subunit VC2768 0,422842 9,28E-05 0,000191 0,485251 -0,31403 0,373822 ATP synthase F0, B subunit VC2769 0,797128 7,55E-05 9,06E-05 0,833168 -0,07927 0,098472 ATP synthase F0, C subunit

VC2775 0,307061 2,76E-05 1,06E-05 2,593985 0,413967 0,512775 glucose inhibited division protein A VCA0002 0,998902 2,52E-05 2,52E-05 0,998811 -0,00052 0,000477 hypothetical protein VCA0006 0,7796 2,2E-06 2,8E-06 0,786071 -0,10454 0,108128 conserved hypothetical protein VCA0007 0,741848 3,23E-06 4,15E-06 0,77759 -0,10925 0,129685 3-hydroxyisobutyrate dehydrogenase, putative VCA0008 0,745708 1,53E-05 1,19E-05 1,287521 0,109754 0,127431 methyl-accepting chemotaxis protein VCA0013 0,826248 0,0106 0,01317 0,80486 -0,09428 0,082889 maltodextrin phosphorylase VCA0014 0,440984 2,85E-05 1,9E-05 1,505541 0,177693 0,355578 4-alpha-glucanotransferase VCA0020 0,346998 8,15E-06 6,08E-11 133914,2 5,126827 0,459673 hypothetical protein VCA0031 0,745708 1,53E-05 1,19E-05 1,287521 0,109754 0,127431 methyl-accepting chemotaxis protein VCA0042 0,324947 4,55E-06 4,2E-11 108357,1 5,034858 0,488188 PilZ(plzD), hypothetical protein VCA0053 0,801182 9,58E-08 1,33E-07 0,719684 -0,14286 0,096269 purine nucleoside phosphorylase VCA0059 0,865583 0,000357 0,000388 0,919156 -0,03661 0,062691 major outer membrane lipoprotein VCA0061 0,763723 4,99E-05 3,87E-05 1,287891 0,109879 0,117064 ATP-dependent RNA helicase, DEAD box family VCA0068 0,745708 1,53E-05 1,19E-05 1,287521 0,109754 0,127431 methyl-accepting chemotaxis protein VCA0103 0,613675 1,23E-05 1,94E-05 0,635427 -0,19693 0,212062 sulfate permease family protein VCA0116 0,64486 4,56E-05 8,79E-05 0,519522 -0,2844 0,190534 clpB protein VCA0131 0,654346 4,3E-05 2,92E-05 1,471072 0,167634 0,184193 ribokinase VCA0132 0,957812 3,38E-07 3,13E-07 1,078569 0,032848 0,01872 ribose operon repressor VCA0137 0,58539 9,58E-05 0,000171 0,559404 -0,25227 0,232555 glycerol-3-phosphate transporter VCA0146 0,380594 1,38E-05 2,21E-06 6,259611 0,796547 0,419538 conserved hypothetical protein VCA0161 0,485162 0,000222 0,000468 0,474258 -0,32399 0,314113 tryptophanase VCA0167 0,459064 7,92E-07 1,81E-07 4,38219 0,641691 0,338127 conserved hypothetical protein VCA0176 0,745708 1,53E-05 1,19E-05 1,287521 0,109754 0,127431 methyl-accepting chemotaxis protein VCA0182 0,420319 1,25E-05 4,84E-06 2,586849 0,412771 0,376421 sigma-54 dependent transcriptional regulator VCA0192 0,443774 3,99E-06 1,87E-06 2,127535 0,327877 0,352838 D-lactate dehydrogenase VCA0199 0,76556 6,61E-06 5,69E-06 1,161307 0,064947 0,116021 hypothetical protein VCA0200 0,312938 5,19E-06 1,59E-06 3,25345 0,512344 0,504541 hypothetical protein VCA0205 0,588308 3,67E-06 2,51E-06 1,462919 0,16522 0,230395 C4-dicarboxylate transporter, anaerobic VCA0207 0,79885 2,49E-06 1,96E-06 1,27129 0,104245 0,097535 NH(3)-dependent NAD(+) synthetase

VCA0220 0,745708 1,53E-05 1,19E-05 1,287521 0,109754 0,127431 hemolysin secretion protein HylB iron(III) ABC transporter, periplasmic iron-compound-binding VCA0227 0,804283 7,36E-07 5,12E-07 1,439296 0,15815 0,094591 protein VCA0235 0,529668 4,73E-05 3,25E-05 1,452813 0,16221 0,275996 acetate kinase VCA0237 0,649234 1,23E-05 8,51E-06 1,444693 0,159775 0,187599 hypothetical protein VCA0268 0,745708 1,53E-05 1,19E-05 1,287521 0,109754 0,127431 methyl-accepting chemotaxis protein VCA0278 0,816823 3,57E-06 2,81E-06 1,270492 0,103972 0,087872 serine hydroxymethyltransferase VCA0283 0,341545 7,66E-06 1,43E-06 5,347067 0,728116 0,466552 hypothetical protein VCA0287 0,67801 0,000225 0,000172 1,306217 0,116015 0,168764 threonyl-tRNA synthetase VCA0288 0,850907 8,86E-05 7,72E-05 1,147299 0,059677 0,070118 UNKNOWN VCA0289 0,934095 0,00016 0,000169 0,946619 -0,02382 0,029609 ribosomal protein L35 VCA0290 0,169909 0,003121 0,009002 0,346701 -0,46005 0,769784 ribosomal protein L20 VCA0511 0,517128 1,85E-05 1,14E-05 1,626432 0,211236 0,286402 anaerobic ribonucleoside-triphosphate reductase VCA0514 0,306246 1,13E-05 5,74E-05 0,197176 -0,70515 0,51393 hypothetical protein VCA0516 0,557559 6,5E-06 3,51E-06 1,852464 0,26775 0,253709 PTS system, fructose-specific IIBC component VCA0518 0,767615 1,94E-05 1,56E-05 1,244701 0,095065 0,114857 PTS system, fructose-specific IIA/FPR component VCA0528 0,80836 5,42E-06 4,27E-06 1,269258 0,10355 0,092395 conserved hypothetical protein VCA0530 0,178823 1,1E-05 6,08E-11 180338,6 5,256089 0,747576 pyruvate-flavoredoxin oxidoreductase VCA0540 0,319262 9,31E-06 3,98E-06 2,338191 0,36888 0,495853 formate transporter 1, putative VCA0544 0,891483 2,17E-06 1,83E-06 1,185894 0,074046 0,049887 conserved hypothetical protein VCA0563 0,632132 2,7E-05 1,9E-05 1,418507 0,151831 0,199192 NAD(P) transhydrogenase, alpha subunit VCA0564 0,676957 4,04E-06 2,8E-06 1,445637 0,160059 0,169439 NAD(P) transhydrogenase, beta subunit VCA0566 0,812786 2,29E-06 1,79E-06 1,275516 0,105686 0,090024 transcriptional regulator VCA0572 0,857949 1,93E-06 1,6E-06 1,209142 0,082477 0,066539 D-alanine--D-alanine ligase VCA0573 0,532686 9,34E-05 0,000125 0,746683 -0,12686 0,273528 DamX-related protein VCA0578 0,43896 2,36E-07 4,67E-08 5,058899 0,704056 0,357575 conserved hypothetical protein VCA0592 0,786363 1,54E-06 1,94E-06 0,79474 -0,09978 0,104377 MutT/nudix family protein VCA0605 0,663645 8,3E-05 0,000113 0,733481 -0,13461 0,178064 aminotransferase, class III VCA0612 0,773435 1,37E-06 1,79E-06 0,765198 -0,11623 0,111576 large-conductance mechanosensitive channel

VCA0623 0,71979 0,000497 0,000431 1,1549 0,062544 0,142794 transaldolase B VCA0624 0,272023 0,000954 0,000603 1,582186 0,199258 0,565394 transketolase 1 VCA0628 0,653155 7,05E-05 9,6E-05 0,734084 -0,13425 0,184984 SecA-related protein VCA0657 0,599298 1,87E-05 1,22E-05 1,532298 0,185343 0,222357 aerobic glycerol-3-phosphate dehydrogenase VCA0658 0,745708 1,53E-05 1,19E-05 1,287521 0,109754 0,127431 methyl-accepting chemotaxis protein VCA0663 0,745708 1,53E-05 1,19E-05 1,287521 0,109754 0,127431 methyl-accepting chemotaxis protein VCA0678 0,979185 7,66E-07 7,46E-07 1,025857 0,011087 0,009135 periplasmic nitrate reductase VCA0681 0,402307 0,000133 5,9E-05 2,249364 0,35206 0,395442 HD-GYP, conserved hypothetical protein VCA0735 0,553264 3,17E-06 1,42E-06 2,23012 0,348328 0,257067 PilZ (plzE), hypothetical protein VCA0744 0,634629 0,000237 0,000169 1,408309 0,148698 0,19748 glycerol kinase VCA0747 0,149334 3,28E-05 1,1E-05 2,991781 0,47593 0,825842 anaerobic glycerol-3-phosphate dehydrogenase, subunit A VCA0748 0,156188 3,15E-06 6,08E-11 51800,1 4,714331 0,806353 anaerobic glycerol-3-phosphate dehydrogenase, subunit B VCA0749 0,675717 5,7E-05 7,13E-05 0,799158 -0,09737 0,170235 anaerobic glycerol-3-phosphate dehydrogenase, subunit C VCA0751 0,727155 3,89E-07 2,29E-07 1,695026 0,229176 0,138373 3-oxoacyl-(acyl-carrier-protein) synthase III VCA0756 0,112238 7,45E-06 9,15E-07 8,138519 0,910545 0,949862 transcriptional regulator, LysR family VCA0768 0,727293 2,38E-05 1,72E-05 1,385332 0,141554 0,13829 ATP-dependent RNA helicase, DEAD box family VCA0773 0,680548 1,93E-05 1,43E-05 1,353889 0,131583 0,167141 methyl-accepting chemotaxis protein VCA0774 0,103864 3,43E-05 0,000011 3,12 0,494155 0,983533 UDP-glucose 4-epimerase VCA0779 0,353698 1,64E-06 4,23E-06 0,388141 -0,41101 0,451368 hypothetical protein VCA0795 0,727796 7,59E-07 1,03E-06 0,737901 -0,132 0,13799 resolvase, putative VCA0798 0,797979 4,89E-06 3,77E-06 1,298539 0,113455 0,098008 CbbY family protein VCA0801 0,828157 9,38E-06 7,5E-06 1,2508 0,097188 0,081887 inosine-guanosine kinase VCA0802 0,811034 2,2E-06 2,77E-06 0,7938 -0,10029 0,090961 conserved hypothetical protein VCA0804 0,799203 0,000118 0,000143 0,830877 -0,08046 0,097343 ATP-dependent RNA helicase DeaD VCA0805 0,470382 3,64E-06 1,47E-06 2,479918 0,394437 0,32755 exoribonuclease II VCA0806 0,376105 8,88E-06 1,2E-06 7,373754 0,867689 0,424691 hypothetical protein VCA0815 0,482559 4,38E-05 3E-05 1,462796 0,165184 0,316449 biosynthetic arginine decarboxylase VCA0832 0,421281 7,38E-06 4,06E-06 1,816593 0,259258 0,375428 methyltransferase, putative VCA0837 0,734016 4,99E-07 7,46E-07 0,669438 -0,17429 0,134295 hemolysin, putative

VCA0840 0,987221 3,63E-06 3,56E-06 1,017677 0,00761 0,005586 deoxycytidylate deaminase, putative VCA0843 0,749868 5,33E-05 4,33E-05 1,231285 0,090358 0,125015 glyceraldehyde 3-phosphate dehydrogenase VCA0864 0,888611 0,000105 9,28E-05 1,133987 0,054608 0,051288 methyl-accepting chemotaxis protein VCA0866 0,881596 8,31E-07 6,95E-07 1,195571 0,077575 0,054731 hypothetical protein VCA0867 0,165705 0,000237 6,32E-05 3,757518 0,574901 0,780666 outer membrane protein OmpW VCA0885 0,308487 5,7E-05 3,36E-05 1,695743 0,22936 0,510763 threonine 3-dehydrogenase VCA0886 0,658219 2,24E-06 1,51E-06 1,484406 0,171553 0,181629 2-amino-3-ketobutyrate coenzyme A ligase VCA0896 0,594803 4,68E-07 1,95E-07 2,403392 0,380825 0,225627 glucose-6-phosphate 1-dehydrogenase VCA0898 0,866474 0,000127 0,000113 1,123446 0,050552 0,062244 6-phosphogluconate dehydrogenase, decarboxylating VCA0903 0,356307 0,005488 0,000588 9,33016 0,969889 0,448176 conserved hypothetical protein VCA0904 0,934418 1,2E-05 1,12E-05 1,073477 0,030793 0,029459 permease VCA0906 0,639621 4,22E-05 3,02E-05 1,396095 0,144915 0,194077 methyl-accepting chemotaxis protein VCA0919 0,887185 6,74E-06 7,94E-06 0,849672 -0,07075 0,051986 conserved hypothetical protein VCA0921 0,822586 4,9E-06 3,88E-06 1,263212 0,101476 0,084818 hypothetical protein VCA0923 0,223735 5,38E-05 1,2E-10 449832,8 5,653051 0,650266 methyl-accepting chemotaxis protein VCA0924 0,996486 1,13E-05 1,12E-05 1,003568 0,001547 0,001529 conserved hypothetical protein VCA0940 0,710984 2,06E-06 2,78E-06 0,739475 -0,13108 0,14814 transcriptional regulator, DeoR family VCA0944 0,344428 1,36E-05 3,33E-06 4,073295 0,609946 0,462901 maltose ABC transporter, permease protein VCA0946 0,447351 3,22E-05 1,97E-05 1,630699 0,212374 0,349352 maltose/maltodextrin ABC transporter, ATP-binding protein VCA0951 0,800097 2,13E-05 3,09E-05 0,689198 -0,16166 0,096857 conserved hypothetical protein VCA0952 0,30594 3,18E-05 6,08E-11 523261,5 5,718719 0,514363 VpsT, transcriptional regulator, LuxR family VCA0955 0,350891 0,000171 1,92E-05 8,915537 0,950148 0,454828 transcriptional regulator, MarR family VCA0965 0,601923 3,07E-05 4,8E-05 0,638484 -0,19485 0,220459 VpsT, GGDEF family protein VCA0974 0,161312 0,000371 0,001477 0,251388 -0,59966 0,792333 methyl-accepting chemotaxis protein VCA0979 0,745708 1,53E-05 1,19E-05 1,287521 0,109754 0,127431 methyl-accepting chemotaxis protein VCA0984 0,532257 1,42E-05 6,96E-06 2,033338 0,30821 0,273879 L-lactate dehydrogenase VCA0987 0,757219 6,31E-06 5,11E-06 1,234972 0,091657 0,120779 phosphoenolpyruvate synthase VCA0988 0,224 0,000641 0,0019 0,337579 -0,47162 0,649751 methyl-accepting chemotaxis protein VCA0994 0,806428 4,04E-05 4,74E-05 0,852383 -0,06937 0,093434 hypothetical protein

VCA0996 0,969142 5,95E-07 6,25E-07 0,95264 -0,02107 0,013613 ABC transporter, ATP-binding protein VCA1001 0,283725 6,25E-05 0,000213 0,293427 -0,5325 0,547103 transcriptional regulator, AraC/XylS family VCA1027 0,171314 3,17E-05 9,13E-11 347397,3 5,540826 0,766206 maltose operon periplasmic protein, putative VCA1028 0,191175 0,00024 3,24E-05 7,411183 0,869888 0,718569 maltoporin VCA1034 0,178385 0,001007 0,002629 0,383035 -0,41676 0,748641 methyl-accepting chemotaxis protein VCA1041 0,61933 2,03E-05 1,59E-05 1,277358 0,106313 0,208078 phosphomannomutase, putative VCA1048 0,392494 2,17E-05 3,93E-06 5,503305 0,740624 0,406167 oxidoreductase, Gfo/Idh/MocA family VCA1056 0,745708 1,53E-05 1,19E-05 1,287521 0,109754 0,127431 methyl-accepting chemotaxis protein VCA1067 0,338668 1,02E-06 1,81E-07 5,644715 0,751642 0,470226 aldehyde dehydrogenase VCA1069 0,612651 1,99E-05 1,33E-05 1,493233 0,174128 0,212787 methyl-accepting chemotaxis protein VCA1071 0,169554 0,001347 0,000297 4,539939 0,65705 0,770691 sodium/proline symporter VCA1073 0,168619 0,001412 0,003534 0,399547 -0,39843 0,773092 UNKNOWN VCA1075 0,691419 2,72E-05 1,87E-05 1,452508 0,162119 0,160259 hypothetical protein VCA1077 0,73373 8,19E-06 5,21E-06 1,571785 0,196393 0,134464 conserved hypothetical protein VCA1114 0,429527 2,85E-05 1,65E-05 1,730746 0,238233 0,367009 ParB family protein VCA1115 0,954609 3,3E-06 3,13E-06 1,053304 0,022554 0,020175 ParA family protein