UNIVERSITY OF CALIFORNIA
Los Angeles
The Role of Diet1 in Bile Acid Metabolism
A dissertation submitted in partial satisfaction of the
requirements for the degree Doctor of Philosophy
in Human Genetics
by
Jessica Mei-Ping Lee
2013
ABSTRACT OF THE DISSERTATION
The Role of Diet1 in Bile Acid Metabolism
by
Jessica Mei-Ping Lee
Doctor of Philosophy in Human Genetics
University of California, Los Angeles, 2013
Professor Karen Reue, Chair
Elevated cholesterol levels are associated with increased risk for atherosclerosis, heart disease and stroke. Variations in plasma cholesterol levels among individuals are determined by the interaction of environmental and genetic factors, many of which remain to be identified.
This dissertation presents the initial characterization of a novel gene Diet1, the product of which influences plasma cholesterol levels through its effects on bile acid metabolism. Bile acids are synthesized from cholesterol in the liver, and secreted into the small intestine to aid in digestion.
At the terminal end of the small intestine, bile acid are actively reabsorbed and sent to the liver
(reviewed in Chapter 1).
Preceding my studies, a mutation in Diet1 was identified as the underlying basis for resistance to diet-induced hypercholesterolemia and atherosclerosis in the C57BL/6ByJ inbred mouse strain. My studies have characterized the physiological and cellular function of Diet1, a
ii large modular protein consisting of repeating LDL receptor A2 and MAM (meprin-A5-receptor protein tyrosine phosphatase mu) domains. Diet1 expression is restricted to the small intestine and the kidney cortex. We determined that Diet1 influences the communication from small intestine to liver to modulate the rate at which bile acids are synthesized (Chapter 2).
Specifically, Diet1 affects production of the intestinal hormone fibroblast growth factor 15/19
(FGF15/19), which travels through the enterohepatic circulation and activates hepatic receptors, leading to down-regulation of bile acid synthesis. The absence of this regulation in Diet1– deficient mice explains the unregulated conversion of cholesterol to bile acids and protection from hypercholesterolemia that is observed in these animals.
The identification of Diet1 as a determinant of FGF15/19 and bile acid levels in the mouse led to the hypothesis that genetic variation in DIET1 may influence variations in plasma bile acid levels in the human population, and may also underlie disease states characterized by aberrant bile acid levels. To explore these possibilities we resequenced DIET1 in individuals affected with type 2 chronic bile acid diarrhea (Chapter 3), and in individuals from a small
Mexican population sample that have extremely high or low bile acid levels (Chapter 4). These studies led to the identification of a common DIET1 nonsynonymous polymorphism that influences the levels of FGF19 secreted from cultured human cells, and an enrichment of rare nonsynonymous DIET1 variants in the individuals with extreme low bile acid levels. Our studies establish Diet1 as a regulator of hepatic bile acid synthesis through its effect on the production of the intestinal hormone FGF15/19. They also implicate genetic variation in DIET1 as a determinant of human FGF19 and bile acid levels.
iii The dissertation of Jessica Mei-Ping Lee is approved.
Aldons J. Lusis
Peter A. Edwards
Katrina Dipple
Karen Reue, Committee Chair
University of California, Los Angeles
2013
iv
For Mom and Dad
and in loving memory
Yeng Hooi
v TABLE OF CONTENTS
Abstract of the Dissertation……………………………………………………………………... ii
List of tables and figures………………………………………………………………………… ix
Acknowledgements……………………………………………………………………………... xii
Vita……………………………………………………………………………………………... xiv
Chapter 1: Introduction………………………………………………………………………... 1
The relationship between cholesterol and bile acid…………………………………….... 2
A short history of the biology of bile…………………………………………………….. 3
Physiological role of bile………………………………………………………………… 5
Enterohepatic bile acid circulation ………………………………………………………. 6
Bile acid synthesis………………………………………………………………………... 7
Bile acids as metabolic signals……….………….………………………………………. 9
Regulation of bile acid synthesis……………………………………………….………. 10
The dissertation…………………………………………………………………………. 12
References………………………………………………………………………………. 17
Chapter 2: Diet1 Functions in the FGF15/19 Enterohepatic Signaling Axis to Modulate Bile
Acid and Lipid Levels…………………………………………………………………. 27
Preface....………………………………………………………………………..………. 28
Abstract…………………………………………………………………………………. 30
Introduction………………………………………………………………………….….. 30
Results…………………………………………………………………………………... 31
Discussion………………………………………………………………………………. 37
vi Experimental Procedures…………………………………………….……………...….. 40
References……………………………………………………………………………… 40
Supplemental Information……………………………………………………………… 43
Chapter 3: A common genetic variant in DIET1 influences cellular fibroblast growth factor
19 (FGF19) secretion…………………………………………………………………... 55
Preface....………………………………………………………………………..………. 56
Abstract…………………………………………………………………………………. 58
Introduction……………………………………………………………………………... 59
Results…………………………………………………………………………………... 63
Discussion………………………………………………………………………………. 67
Experimental Procedures……………………………………………………………….. 70
References………………………………………………………………………….…… 74
Figure Legends………………………………………………………………………….. 79
Supplemental Figures…………………………………………………………………… 87
Chapter 4: Genetic variants associated with human plasma bile acid levels……………… 91
Preface…………………………………………………………………………………... 92
Abstract…………………………………………………………………………………. 94
Introduction……………………………………………………………………………... 95
Results…………………………………………………………………………………... 98
Discussion……………………………………………………………………………... 103
Experimental Procedures………...……………………………………………………. 106
References…………………………………………………………………………...… 109
Figure Legends………………………………………………………………………… 112
vii Appendix………………………………………………………………………………. 124
References for Appendix……………………………………………………………… 130
Chapter 5: Conclusion……………………………………………………………………….. 139
The physiological and cellular role of Diet1…………………………………………... 140
Genetic variation in DIET1……………………………………………………………. 142
Genetic determinants of plasma bile acid levels………………………………………. 143
Bile acids as metabolic signaling molecules…………………………………………... 145
Concluding thoughts…………………………………………………………………... 146
References……………………………………………………………………………... 149
viii LIST OF TABLES AND FIGURES
Chapter 1
Figure 1.1 Schematic representation of the enterohepatic circulation of bile
acids…………………………………………………………………….. 15
Figure 1.2 The bile acid synthesis pathway………………………………………... 16
Chapter 2
Figure 2.1 Identification of the Diet1 Gene Mutation in C57BL/6ByJ Mice by
Positional Cloning………………………………………………………. 32
Figure 2.2 Diet1 Expression in Enterocytes of the Small Intestine………………… 33
Figure 2.3 Diet1-Deficient Mice Have Increased Bile Acid Pool Size and Reduced
Ileal FGF15 mRNA and Protein Levels………………………………… 35
Figure 2.4 In Vivo Correlation between Diet1, FGF15, and Cyp7a1 Expression, and
Cyp7a1 Normalization by Adenovirus-Mediated FGF15 Expression in
Diet1-Deficient Mice…………………………………………………… 36
Figure 2.5 Diet1 Levels Influence FGF19 Production at Both the mRNA and
Posttranscriptional Levels………………………………………………. 37
Figure 2.6 Diet1 and FGF15/FGF19 Proteins Interact……………………………... 38
Figure 2.7 Proposed Role of Diet1 in Enterohepatic Signaling for Regulation of Bile
Acid Homeostasis………………………………………………………. 39
Figure 2.S1 Expression levels of gene in the Diet1 gene critical interval (D2Mit360 to
D2Mit267), Related to Figure 1………………………………………… 43
ix Figure 2.S2 In situ hybridization analysis of Diet1 mRNA in mouse embryonic (e15.5)
and postnatal (p1 and p10) stages, Related to Figure 2………………… 44
Figure 2.S3 In situ hybridization analysis of Diet1 mRNA in the adult mouse
gastrointestinal tract, Related to Figure 2………………………………. 45
Figure 2.S4 Gene expression levels in Diet1 transgenic (Diet1-Tg) mice, Related to
Figure 4…………………………………………………………………. 46
Figure 2.S5 Validation of FGF15 ELISA specificity, Related to the Experimental
Procedures………………………………………………………………. 47
Table 2.S1 High resolution mapping of the Diet1 gene in C57BL/6ByJ (B6By) x
CAST/EiJ backcross, Related to Figure 1……………………………… 48
Chapter 3
Table 3.1 Single nucleotide variants in the coding region of DIET1……………… 81
Table 3.2 Single nucleotide variants and frequencies in the coding regions of
DIET1…………………………………………………………………… 82
Figure 3.1 Location of nonsynonymous single nucleotide variants
in human Diet1………………………………………………………….. 83
Figure 3.2 DIET1 variant rs12256835 influences secretion of FGF19
in a cell-based assay…………………………………………………….. 84
Figure 3.3 Diet1-1721H and –1721Q isoforms do not differentially affect
Diet1-FGF19 interaction………………………………………………... 85
Figure 3.4 Predicted iTASSER models of Diet1-1721H and -1721Q
protein structures.……………………………………………………….. 86
Figure 3.S1 Novel single nucleotide variants in the coding region of DIET1……….. 87
x Table 3.S1 Oligonucleotides used for PCR amplification and sequencing…………. 88
Chapter 4
Table 4.1 Bile acid metabolism gene panel……………………………………… 115
Table 4.2 Clinical characteristics of Mexican cohort……………………………. 116
Table 4.3 Targeted sequencing statistics…………………………………………. 117
Figure 4.1 Schematic diagram of bile acid metabolism panel genes……………... 118
Figure 4.2 Plasma bile acid level distribution of Mexican cohort………………… 119
Figure 4.3 Number of variants detected per 10 kB of genome region……………. 120
Figure 4.4 Rare coding synonymous and nonsynonymous variants by gene……... 121
Figure 4.5 Rare nonsynonymous variants by gene categories……………………. 122
Figure 4.6 Rare nonsynonymous variants in DIET1……………………………… 123
Chapter 4
Figure 5.1 Potential pleiotropic influence of Diet1 on common diseases………… 148
xi ACKNOWLEDGMENTS
During my doctoral studies I was extremely fortunate to work with and along side wonderful, supportive people who not only taught me about science but about life as well.
I would first like to thank my thesis advisor Karen Reue for being an amazing mentor.
She is always teaching me something new, and encouraging me to evolve as a scientist and as a person. The work presented here would not have been possible without her unwavering support, guidance and motivation.
I give many, many thanks to Laurent Vergnes for training me when I first started. He was always there to guide me in my experiments, for brainstorming and troubleshooting when things went wrong, always had time to discuss even my most outlandish ideas, and allowed me to join the Diet1 community. I am grateful for the opportunity to work and learn with him as we tackled a difficult project.
I would like to thank my committee members Jake Lusis, Peter Edwards and Katrina
Dipple for all of their advice and feedback throughout the years. I am very appreciative for their willingness to help me through the times when I was completely stumped, and for pointing out avenues of thought I had never considered.
I would also like to acknowledge the collaborators at UCLA and abroad who have made possible some of the work presented in this dissertation. I would like to acknowledge Julian
Walters and Carlos Aguilar-Salinas for providing DNA samples for the two sequencing projects.
I would like to thank Paivi Pajukanta and Elina Nikkola for providing their expertise and experience in our lab’s new ventures into the world of human genetics. I would also like to
xii thank Rita Cantor for teaching me statistics, and being willing to help with any statistical problem.
I must also thank my current and former lab mates, Jimmy Donkor, Bobby Chin, Ping
Xu, Kazuharu Takeuchi, Qin Han, Peixiang Zhang, Jennifer Dwyer, Lauren Csaki, Jenny Chen,
Jasmine Li, and Mariela Martinez for making the lab a special place to be. You are not only extremely supportive of the science, but also for being such fabulous people.
I want to thank all of the friends that help keep me sane, and my friends from ACCESS
13, and the GONDA building for making all the time spent in lab enjoyable.
Finally, I want to thank my family for their love and for keeping me grounded, reminding me that when nothing working, I always have a whole tribe of people looking out for me.
Special thanks to my parents who encouraged me to go wherever my intellectual curiosity would take me, and gave me my first microscope for my fifth birthday. I would like to thank my brother and sisters for making sure that I never got so absorbed in the lab that I forgot about them, and would always try to understand what exactly I do. I would also like to recognize my grandmother who passed away during my doctoral studies. She was the toughest woman I ever knew, and the biggest pushover when it came to her grandchildren. She had only the vaguest notion of what a Ph.D. is, but she was proud of me anyway.
Chapter 2 contains a reprint of “Diet1 Functions in the FGF15/19 Enterohepatic
Signaling Axis to Modulate Bile Acid and Lipid Levels” from Cell Metab. 2013 Jun;17(6): 916-
928 used with permission from Cell Press.
This research was supported in part by the Pre-doctoral Training Program in Genetic
Mechanisms (USPHS National Research Service Award GM07104).
xiii VITA
2001-2005 University of California, Berkeley B.A. Molecular, Cell and Developmental Biology B.A. History
2004 Foreign exchange student at the University of New South Wales Sydney, Australia
2006-2007 University of California, Los Angeles ACCESS Program
2007- University of California, Los Angeles Department of Human Genetics
2010-2011 Pre-doctoral training grant UCLA Pre-doctoral Training Program in Genetic Mechanisms
PUBLICATIONS
Vergnes L*, Lee JM*, Chin RG, Auwerx J, Reue K. 2013. Diet1 functions in the FGF15/19 enterohepatic signaling axis to modulate bile acid and lipid levels. Cell Metab. 17(6): 916-28 *Co-first authors
Dwyer JR, Donkor J, Zhang P, Csaki LS, Vergnes L, Lee JM, Dewald J, Brindley DN, Atti E, Tetradis S, Yoshinaga Y, De Jong PJ, Fong LG, Young SG, Reue K. Mouse lipin-1 and lipin-2 cooperate to maintain glycerolipid homeostasis in liver and aging cerebellum. Proc Nat l Acad Sci USA 109(37):E2486-95.
PRESENTATIONS
Lee JM, Vergnes L, Chin RG, Auwerx J, Reue K. “Diet1 functions in the FGF15/19 enterohepatic signaling axis to modulate bile acid and lipid levels”. DEUEL Conference on Lipids. March 5-8, 2013. Napa Valley, CA.
Lee JM, Vergnes L, Reue K. “The Diet1 gene is a determinant of cholesterol homeostasis”. FASEB Summer Research Conference, Lipid Droplets: Metabolic Consequences of the Storage of Neutral Lipids. July 25-30, 2010. Steamboat Springs, Colorado.
xiv
Chapter 1
Introduction
1 The relationship between cholesterol and bile acid
Heart attacks are a major cause of death in the United States, accounting for 1 of 3 deaths in 2009, while strokes accounted for 1 of 19 deaths (1). The root cause of both heart attack and stroke is atherosclerosis, the buildup of fatty plaque in the arteries. A landmark study examining the risk factors for heart disease was the Framingham Heart Study (2-5). The purpose of the study was to ask if serum cholesterol levels are correlated with atherosclerosis and heart disease.
The investigators measured plasma cholesterol levels in about 5000 men and women in
Framingham, Massachusetts over 14 years, and they demonstrated a positive correlation between heart disease and cholesterol, in particular low-density lipoprotein (LDL) cholesterol; the higher the plasma LDL levels, the greater the risk of developing heart disease (2-5).
Many subsequent studies in both humans and animal models established high plasma cholesterol levels as a major risk factor for heart disease (6), and statin drugs were developed to treat hypercholesterolemia (7). However, cholesterol is also an essential component of cellular membranes, and serves as the basic building block for steroid hormones and for bile acids, which are necessary for the absorption of lipids and lipid-soluble vitamins in the intestine (8-17).
During every digestive cycle, a small percentage of bile acids is excreted in the feces, which accounts for approximately half the cholesterol eliminated from the body each day (11-17). The body responds to the loss of bile acids by catabolizing cholesterol to produce more bile acids; the rate of bile acid synthesis and excretion may therefore influence plasma cholesterol levels (11-
17). In addition to the connection with plasma cholesterol levels, bile acids have been implicated in the metabolic syndrome, and type 2 diabetes, as well as various liver and diarrhea syndromes
(13, 16-21).
2 A short history of the biology of bile
Bile holds an interesting place in the history of Western medicine. In the ancient world bile accounted for two of the mystical “four humours.” While the origins of the concept of the humours is shrouded in mystery, the clearest explanation for the four humours is attributed to
Hippocrates, the father of medicine (22). In his view, humans are composed of four elements, each of which correspond to four invisible humours: air corresponds to blood, water to phlegm, fire to choler (yellow bile), earth to melancholer (black bile) (22). It was believed that the humours are in a delicate four-way balance, and that an imbalance is the cause of disease.
Treatments for various aliments focused on restoring the balance of humours in the body (22).
As the centuries passed, the idea that the humour called blood was different from the physical blood in a body proved to be inconvenient: how can one develop a treatment for the excess of humoural blood, if it is unrelated to physical blood?
Given the lack of practical utility of Hippocrates’ humours, the Roman physician and scholar Galen of Pergamon—who was central to transmitting Hippocrates’ teachings— specifically linked each humor to physiological functions. In Galen’s view, phlegm came from
“phlegmatic foods” which were “cooked in the stomach,” and turned into blood (22). Yellow and black bile were produced in the liver, and distributed by the bladder and the spleen, respectively (22). Specific ailments were thought to be caused by an overabundance of particular humours: inflammation was due to too much blood, tubercles were due to excess phlegm, too much yellow bile caused jaundice, and black bile caused cancer (23). The yellow bile Galen refers to might be urine, although he also classified any yellowish bodily substance as yellow bile (22), so presumably gallbladder bile was also classified as yellow bile.
3 From the time of Galen until the scientific revolution in the 17th century, human health and disease were dictated by humoural theory. Thus, a doctor examining a patient would diagnose the illness and attribute the disease to either too much or too little of one of the four humours. An illness caused by too much blood was treated by bleedings, and laxatives were prescribed for excessive yellow bile (22). During the Renaissance, Galen’s theories of human physiology began to be questioned. Renewed scholarly interest in physiology, combined with artistic skills and the printing press, allowed doctors such as Vesalius to produce highly detailed drawings of human anatomy (22, 23). These anatomical studies planted the first seeds of doubt in the previously unassailable concept of the four humours, and contradicted most of Galen’s teachings of human biology. For example, the new anatomical studies showed that men and women have the same number of ribs, and that the vena cava does not connect the liver to the heart (22). However, bile was still regarded as a sword of Damocles, a constant threat of ill- health.
During the 17th century, the natural philosophers of Europe were obtaining new insights and questioning the tenets passed down from the Ancient Greeks; this era became known as the
Scientific Revolution. During this explosion of empirical questioning an appreciation for bile as necessary for human physiology emerged. The prevailing theory of digestion was that food was literally cooked in the stomach, as Galen had described (22). The physician and scholar Jan
Baptista van Helmont questioned Galen’s theory in his book Ortus medicinae (ca. 1648) (22).
Based upon his studies of gases and acids, he hypothesized that digestion was facilitated by acid, which would liquefy the food that would be eventually turned into blood by the liver (24). Van
Helmont’s hypothesis was inspired by his observation that after his chickens accidentally ate some glass, the sharp edges of the glass shards had been smoothed upon their recovery from the
4 abdomens the chickens (24). Van Helmont hypothesized that digestion took place in six stages, and that choler (bile) was responsible for the second stage (24). He argued that choler was so important, that “nature hath framed for it a peculiar little Bladder or Bag…[and] placed the Gaul in the lap of the liver” (24), the liver being considered the most important organ in the human body at that time. While traditional knowledge lingers long in cultural consciousness, van
Helmont laid the foundation for rehabilitating bile’s public image from an unpopular semi- mystical humour, to a “noble” (24) necessity for life.
Physiological role of bile
Van Helmont realized that the emptying of the gallbladder’s contents into the small intestine was important for digestion (22, 24). However, bile was still a mysterious fluid, and the first chemical component discovered in bile was cholesterol (25). Much later (1848), a primary bile acid, cholic acid, was discovered in ox gall (17), but the source of cholic acid remained a mystery. The identification of cholesterol as the source of cholic acid was not demonstrated until the 1940s. Konrad Bloch and colleagues showed, by the infusion of stable isotope-labeled cholesterol into dogs and subsequent recovery of the label in newly synthesized bile acids, that bile acids are synthesized from cholesterol (26).
By the mid-19th century scientists knew that bile acids are excreted from the gallbladder into the intestine, and are largely reabsorbed in the ileum (15). Knowledge of this process was based primarily on experiments in animals. Studying bile in humans, however, was not so simple, as a few papers from the late 19th and early 20th centuries attest. The study of human bile was limited to samples taken from individuals who survived surgery and developed bile fistulas
(27-29). Although the methods were rather crude, investigators attempted to calculate the daily
5 secretion of bile and to determine its composition (27-29). Studies at the time also included an interesting observation: having a bile fistula increases the amount of fat found in the feces (28,
29). Building upon those initial observations, studies performed during the next few decades in dogs confirmed that without bile, intestinal absorption of lipids is greatly diminished (30).
Scientists observed that bile acids can emulsify fats to aid in intestinal absorption (8-10), and that bile is necessary for the absorption of cholesterol in the intestine (31). This later finding was definitively established in humans in 1967 (9).
Following the studies described above, it was accepted that bile consists of bile acids, cholesterol, phospholipids and a few other compounds, and plays an important role in absorbing lipids in the intestine. In essence, bile is a mixture of membrane building blocks (i.e. phospholipids and cholesterol) emulsified by bile acids. During digestion, bile acids aid in the formation of micelles, single layer membrane spheres, which are readily absorbed by the enterocytes, the absorptive cells lining the intestinal villi. Micelles have a hydrophobic core, and serves as a shuttle for lipids to move from the intestinal lumen into the enterocytes. Bile also disperses large lipid droplets into smaller and smaller droplets, increasing the surface area that is accessible for lypolysis by pancreatic lipase. Although the intestinal absorption of free fatty acids can occur without bile, the absorption of the more hydrophobic fatty acids and cholesterol are dependent on it.
Enterohepatic bile acid circulation
The macroscopic flow of bile acids in the body is from the liver to the gallbladder to intestine and back to the liver, as illustrated in Fig. 1.1. The liver produces primary bile acids from cholesterol. The primary bile acids are subsequently conjugated with glycine or taurine to
6 increase the solubility of the new bile salts, and prepare them for micelle formation. The primary bile salts are exported from the hepatocytes into small capillaries, bile canaliculi, which later merge to form bile ductules, and then the common hepatic bile duct that connects to the gallbladder. The gallbladder stores the bile produced by the liver and concentrates it. When a meal in consumed, the gallbladder contracts, emptying bile into the duodenum, the proximal section of the small intestine.
After bile is secreted into the intestine, bacteria in the gut deconjugate and modify some of the bile salts to form secondary bile acids. At the distal end of the small intestine, the ileum, the bulk of the bile acids—approximately 95%—are reabsorbed; only 5% is excreted in the feces
(11-17). From the ileum, bile acids travel through the portal vein directly to the liver, where the hepatocytes actively transport most of the bile acid back into the liver to be reused (11-17). Any bile acids that are not reabsorbed by the liver from enterohepatic recycling end up in the circulation (11-17). The recycled bile acids are modified and/or re-conjugated and sent back to the gallbladder to be reused. The liver synthesizes more bile acid from cholesterol to replenish what is lost during each cycle (11-17). The entire cycle of bile acid movement from the liver to the gallbladder, secretion into the small intestine, absorption in the ileum and transport back to the liver is known as enterohepatic circulation.
Bile acid synthesis
The human liver produces two major primary bile acid species from cholesterol: cholic acid (CA) and chenodeoxycholic acid (CDCA) (11-17). CA is synthesized through the classic bile acid synthetic pathway, and CDCA though the alternative pathway (Fig. 1.2) (12, 13, 16,
17). The first, and rate-limiting step, in the synthesis of CA from cholesterol is catalyzed by
7 cholesterol 7 α-hydroxylase (Cyp7a1) (32-35). The enzymatic product of Cyp7a1 can be modified to CA or CDCA (11-13, 16, 17). Cyp27a1 (cytochrome P450, family 27, subfamily A, polypeptide 1) is also able to modify cholesterol for the alternative bile acid synthesis pathway
(11-13, 16, 17). Both CA and CDCA are conjugated with taurine or glycine before being secreted into the bile canaliculi (11-13, 16, 17). There are 17 known genes that are expressed in the liver that are involved in the production of bile acids from cholesterol and their subsequent modification (12, 13, 16, 17). In the intestine, bacterial fauna deconjugate some of the bile salts and convert a portion of them into secondary bile acids (lithocholic acid, ursodeoxycholic acid, or deoxycholic acid) (12, 13, 16, 17). After reabsorption by the ileum, the primary and secondary bile acids travel back to liver and are recycled for use in the next digestive cycle.
The close relationship between bile acids and cholesterol was the basis for development of bile acid sequestrants as a treatment for hypercholesterolemia (36). Bile acid sequestrants, such as cholestyramine, function by binding to bile acids in the intestinal lumen and preventing reabsorption in the ileum, which results in a loss of a greater proportion of bile acids by excretion
(36). Bile acid sequestrants are also commonly used to treat some types of chonic diarrheas (14,
15, 37, 38). Although this treatment can effectively reduce plasma cholesterol levels, bile acid sequestrants fell out of favor due to unpalatability and patient noncompliance (36). Currently, bile acid sequestrants as a treatment for hypercholesterolemia have been largely replaced by statins, which reduce plasma cholesterol by inhibiting cholesterol synthesis (7). However, with the development of more tolerable sequestrants with better affinity to bind bile acids, sequestrants are a viable alternative to statins (36).
8 Bile acids as metabolic signals
The primary function of bile acids is to aid in the digestion of lipids in the intestine, but they also serve as important signaling ligands. The classification of bile acids as solely lipid solubilizers began to change with the identification of a bile acid-activated transcription factor, farnesoid X receptor (FXR) (12, 39, 40). FXR is an important metabolic regulator found in liver, kidney, intestine and the adrenal glands that regulates several genes involved in bile acid metabolism as well as glucose and lipid metabolism (17, 18, 40). In addition, a G protein- coupled bile acid receptor (GPBAR1/TGR5) was identified that displays a wider tissue distribution range than FXR (41). While not all the targets of TGR5 signaling are known, the activation of TGR5 in intestine induces the production of a hormone that signals to the pancreas to secrete insulin, and to the liver to promote insulin sensitivity (42, 43); TGR5 activation in brown adipocytes causes an increase in energy expenditure (44).
The connection between bile acids, glucose metabolism, and lipid metabolism have led to the development of bile acid sequestrants as a treatment option for type 2 diabetes (45) and FXR and TGR5 are potential drug targets (17, 18). Agonists for these two bile acid receptors must be carefully designed to avoid pleiotropic effects. For example, FXR is a regulator of two members of the flavin mono-oxygenase family, FMO1 and FMO3 (46). FMO1 and FMO3 oxidize trimethylamine (TMA), a byproduct of breakdown by intestinal bacteria of L-carnitine, choline, and phosphatidylcholine (46-48). The oxidation product of TMA is trimethylamine-N-oxide
(TMAO) (46, 48), which is strongly associated with atherosclerosis (47). The interconnectedness of metabolic pathways makes creating compounds that preferentially activate the “good” metabolic pathways, while avoiding the “unfavorable” pathways quite challenging.
9 Regulation of bile acid synthesis
Bile acids are detergents, and since cell membranes are made of lipids, high concentrations of bile acids can be toxic (12, 13, 16, 17). Thus, bile acid levels must be well controlled. Since the 1950s, scientists have hypothesized that bile acids negatively regulate their own synthesis (11, 49-51). These hypotheses resulted from studies of animal models with bile fistulas, which exhibit increased CA and CDCA synthesis (49-52). Complementary studies in humans and animal models showed that feeding bile acids represses bile acid synthesis (53, 54).
The molecular basis for this regulation is now partially understood; bile acids can regulate their own synthesis in the liver by activating FXR (12, 39, 40). When hepatocytes take up bile acids from the enterohepatic circulation, some bile acid species bind to FXR and induce the expression of another nuclear receptor, small heterodimer partner (SHP). SHP functions as a transcriptional repressor leading to the down-regulation of bile acid synthesis (39, 55, 56).
However, FXR-SHP−mediated repression of bile acid synthesis does not explain the observation that bile acids coming from the whole body circulation do not repress bile acid synthesis whereas bile acids coming from the enterohepatic circulation do (57, 58). Therefore there must be an additional signal from outside the liver involved in the regulation of bile acid synthesis. Further evidence for the requirement of an extrahepatic factor regulating bile acid synthesis comes from two knockout (KO) mouse models: the fibroblast growth factor receptor 4
(FGFR4) KO and the β-Klotho (KLB) KO mouse models (59, 60). Both mouse models have elevated Cyp7a1 expression levels, and increased bile acid excretion (59, 60); the fact that
FGFR4 and KLB are cell surface receptors, provides further evidence for the existence of an extrahepatic signal that regulates bile acid synthesis.
10 Studies performed by Mangelsdorf and Kliewer’s group in mouse models finally identified the mysterious extrahepatic factor that regulates bile acid synthesis: fibroblast growth factor 15 (FGF15; FGF19 in humans) (61). FGF19 was first implicated in bile acid metabolism in an FXR agonist screen in human hepatocytes (62). FGF19 was robustly induced by FXR activation, and would subsequently repress CYP7A1 (62). However, FGF19 is not expressed in healthy adult liver (63, 64), nor is Fgf15 expressed in the mouse liver (61). Consequently, it was unknown how biologically significant FGF15/19 was for regulating bile acid synthesis.
Mangelsdorf and Kliewer demonstrated that FGF15 is actually produced by the ileum, the site where bile acids are reabsorbed (61). As the bile acids pass through the enterocytes, they activate FXR, which induces transcription of Fgf15. The enterocytes then secrete FGF15, which travels through the enterohepatic circulation to the liver, and signals through the FGFR4/βKlotho receptor complex on the cell surface of hepatocytes, to down regulate Cyp7a1 expression (60,
61, 65, 66). Recombinant human FGF19 had the same effect as FGF15 on Cyp7a1 in mice, suggesting that the bile acid regulatory function of the two orthologs and the signaling pathways are conserved in humans (66). Recent studies confirmed that FGF19 is expressed in human ileum, and is inducible by an FXR agonist (67, 68).
FGF15/19 is a key player in the regulation of bile acid synthesis, but very little is known about its cellular biology. It is a confirmed FXR target gene, and FXR expression in the intestine is critical for its transcription (69), but little else has been described about the regulation of
FGF15/19 production and secretion. The Diet1 gene, discovered by our laboratory, is a novel player in the regulation of bile acid synthesis. The lack of Diet1 results in low levels of FGF15, and failure to repress Cyp7a1 when bile acid levels are high (70).
11 The dissertation
My dissertation will focus on Diet1 and its role in bile acid metabolism. When I began my studies in the laboratory, Diet1 had just been identified and isolated by positional cloning by
Dr. Laurent Vergnes. The Diet1 gene was completely novel, and was not annotated in the mouse or human genomes. Dr. Vergnes had demonstrated that Diet1 was expressed exclusively in the small intestine and kidney cortex, and that Diet1-deficient mice have altered bile acid levels.
However neither the molecular nor physiological role of Diet1 was known, and elucidating Diet1 function became my primary project. I also had the opportunity to perform the first studies designed specifically to assess common and rare variants in the human DIET1 gene.
Following this introductory chapter, Chapter 2 is entitled Diet1 functions in the
FGF15/19 enterohepatic signaling axis to modulate bile acid and lipid levels. This is the first publication reporting the isolation of the Diet1 gene. It describes the positional cloning of Diet1 from a mutant mouse strain, identified the causative mutation, and its tissue expression pattern.
The study also provides the first evidence of a role for Diet1 as a regulator of communication between the intestine and liver to modulate bile acid levels, with downstream effects on circulating cholesterol levels. My work in this publication involved the first subcellular localization of Diet1 in vivo and in vitro, the first quantification of FGF15 in vivo, and complementation of Diet1-deficiency with a Diet1 transgene. I also demonstrated that the level of Diet1 expression influences FGF19 production and secretion, and provided the first evidence for a physical interaction between Diet1 and FGF15/19. Before this publication, nothing was known about FGF15/19 intracellular itinerary, so our observations that Diet1 enhances FGF19 secretion are completely novel.
12 Chapter 3 is entitled A common genetic variant in DIET1 influences fibroblast growth factor 19 (FGF19) secretion. This study is a hypothesis-driven case-control study testing whether rare mutations in DIET1 are present in individuals with a chronic bile acid malabsorption syndrome known as type 2 bile acid diarrhea (BAD). Since type 2 BAD subjects and Diet1-deficient mice both exhibit enhanced bile acid synthesis and excretion as well as low levels of FGF15/19, we hypothesized that genetic variation in DIET1 could underlie some cases of type 2 BAD. While we found no DIET1 variants that can explain type 2 BAD disease status, we observed that a common variant in DIET1 encodes a Diet1 protein isoform that can significantly increase cellular FGF19 secretion. There are currently no publications reporting genetic variations that influence FGF19 levels, so our results are quite exciting.
The study described in Chapter 4, Genetic variants associated with human plasma bile acid levels, represents preliminary work aimed at uncovering the key genetic determinants of bile acid levels in humans. Many human studies have been performed to identify genetic variations that determine plasma lipid levels, but very few studies have characterized plasma bile acid levels in humans, or genetic variations that could potentially influence those levels (71-76). The existing studies of genetic factors that determine bile acid levels have been restricted to examining the variation of a few candidate genes. To begin to elucidate the role of DIET1, and to identify other genetic factors that contribute to variations in human bile acid levels, we collaborated with Dr. Carlos Aguilar-Salinas (Instituto Nacional de Ciencias Médicas y
Nutrición, Salvador Zubiran, Mexico City, Mexico) and Dr. Paivi Pajukanta (UCLA) to identify individuals in the Mexican population with high or low bile acid levels, and to sequence a panel of 38 metabolic genes involved in cholesterol and bile acid metabolism.
13 Chapter 5 provides a summary of the studies presented in this dissertation. Future directions for the study of Diet1 are also discussed.
14
Cho l.
Liver BA ~95%
BA BA
Gallbladder BA ~5%
Small intestine
Figure 1.1 Schematic representation of the enterohepatic circulation of bile acids.
Primary bile acids (BA) are produced in the liver from cholesterol (Chol.). Bile acids travel from the liver to the gallbladder, then into the duodenum. Bile acids travel along the length of the small intestine and are actively taken up in the ileum. About 95% of bile acids are reabsorbed and sent back to the liver via the portal vein, while the rest are eliminated in the feces. The liver reabsorbs bile acids from the portal vein to be reused and synthesizes de novo primary bile acids to replenish the bile acids that were excreted.
15
Cholesterol
Cyp7a1 Cyp27a1 Classic Alternative Bile Acid Bile Acid Synthesis Synthesis Pathway Pathway
CA CDCA
TCA GCA TCDCA GCDCA
Cholesterol Phospholipids
Bile
Figure 1.2 The bile acid synthesis pathway
Two major primary bile acid species are produced from cholesterol: cholic acid (CA) and chenodeoxycholic acid (CDCA). CA is synthesized through the classic bile acid synthesis pathway in which Cyp7a1 catalyzes first, and rate-limiting step. CDCA is synthesized though the alternative bile acid synthesis pathway, and can be derived from the modification of cholesterol by Cyp27a1, or from enzymatic products of Cyp7a1. Both CA and CDCA are conjugated with taurine or glycine prior to secretion into bile. Bile is composed of conjugated bile acids, cholesterol and phospholipids
16 References
1. Go, A.S., Mozaffarian, D., Roger, V.L., Benjamin, E.J., Berry, J.D., Borden, W.B.,
Bravata, D.M., Dai, S., Ford, E.S., Fox, C.S., et al. 2013. Heart disease and stroke
statistics--2013 update: a report from the American Heart Association. Circulation
127:e6-e245.
2. Kannel, W.B., Castelli, W.P., Gordon, T., and McNamara, P.M. 1971. Serum cholesterol,
lipoproteins, and the risk of coronary heart disease. The Framingham study. Ann Intern
Med 74:1-12.
3. Kannel, W.B., Castelli, W.P., and Gordon, T. 1979. Cholesterol in the prediction of
atherosclerotic disease. New perspectives based on the Framingham study. Ann Intern
Med 90:85-91.
4. Gordon, T., Kannel, W.B., Castelli, W.P., and Dawber, T.R. 1981. Lipoproteins,
cardiovascular disease, and death. The Framingham study. Arch Intern Med 141:1128-
1131.
5. Kannel, W.B., Gordon, T., and Castelli, W.P. 1981. Role of lipids and lipoprotein
fractions in atherogenesis: the Framingham study. Prog Lipid Res 20:339-348.
6. LaRosa, J.C., Hunninghake, D., Bush, D., Criqui, M.H., Getz, G.S., Gotto, A.M., Jr.,
Grundy, S.M., Rakita, L., Robertson, R.M., Weisfeldt, M.L., et al. 1990. The cholesterol
facts. A summary of the evidence relating dietary fats, serum cholesterol, and coronary
heart disease. A joint statement by the American Heart Association and the National
Heart, Lung, and Blood Institute. The Task Force on Cholesterol Issues, American Heart
Association. Circulation 81:1721-1733.
17 7. Sirtori, C.R. 1990. Pharmacology and mechanism of action of the new HMG-CoA
reductase inhibitors. Pharmacol Res 22:555-563.
8. Frazer, A.C., Schulman, J.H., and Stewart, H.C. 1944. Emulsification of fat in the
intestine of the rat and its relationship to absorption. J Physiol 103:306-316.
9. Simmonds, W.J., Hofmann, A.F., and Theodor, E. 1967. Absorption of cholesterol from a
micellar solution: intestinal perfusion studies in man. J Clin Invest 46:874-890.
10. Westergaard, H., and Dietschy, J.M. 1976. The mechanism whereby bile acid micelles
increase the rate of fatty acid and cholesterol uptake into the intestinal mucosal cell. J
Clin Invest 58:97-108.
11. Russell, D.W., and Setchell, K.D. 1992. Bile acid biosynthesis. Biochemistry 31:4737-
4749.
12. Russell, D.W. 2003. The enzymes, regulation, and genetics of bile acid synthesis. Annu
Rev Biochem 72:137-174.
13. Hofmann, A.F., and Hagey, L.R. 2008. Bile acids: chemistry, pathochemistry, biology,
pathobiology, and therapeutics. Cell Mol Life Sci 65:2461-2483.
14. Hofmann, A.F. 2009. Chronic diarrhea caused by idiopathic bile acid malabsorption: an
explanation at last. Expert Rev Gastroenterol Hepatol 3:461-464.
15. Hofmann, A.F., Mangelsdorf, D.J., and Kliewer, S.A. 2009. Chronic diarrhea due to
excessive bile acid synthesis and not defective ileal transport: a new syndrome of
defective fibroblast growth factor 19 release. Clin Gastroenterol Hepatol 7:1151-1154.
16. Russell, D.W. 2009. Fifty years of advances in bile acid synthesis and metabolism. J
Lipid Res 50 Suppl:S120-125.
18 17. de Aguiar Vallim, T.Q., Tarling, E.J., and Edwards, P.A. 2013. Pleiotropic Roles of Bile
Acids in Metabolism. Cell Metab 17(5):657-69.
18. Thomas, C., Pellicciari, R., Pruzanski, M., Auwerx, J., and Schoonjans, K. 2008.
Targeting bile-acid signalling for metabolic diseases. Nat Rev Drug Discov 7:678-693.
19. Kubitz, R., Droge, C., Stindt, J., Weissenberger, K., and Haussinger, D. 2012. The bile
salt export pump (BSEP) in health and disease. Clin Res Hepatol Gastroenterol 36:536-
553.
20. Miao, X.P., Sun, X.N., Wei, H., and Ouyang, Q. 2012. Crohn's disease and primary
sclerosing cholangitis: a case report and review of the literature. Intern Med 51:2077-
2081.
21. Zarrinpar, A., and Loomba, R. 2012. Review article: the emerging interplay among the
gastrointestinal tract, bile acids and incretins in the pathogenesis of diabetes and non-
alcoholic fatty liver disease. Aliment Pharmacol Ther 36:909-921.
22. Arikha, N. 2007. Passions and Tempers: A History of the Humours.:6, 7-8, 27, 83, 91,
143-149, 127, 196.
23. Mukherjee, S. 2010. The Emperor of All Maladies: A Biography of Cancer.:48, 51-54.
24. Helmont, J.B.v. 1662. Oratrike, or Physick Refined.:113, 201, 210, 217.
25. Olson, R.E. 1998. Discovery of the lipoproteins, their role in fat transport and their
significance as risk factors. J Nutr 128:439S-443S.
26. Konrad Bloch, B.N.B., D. Rittenberg. 1943. The biological converion of cholesterol to
cholic acid. J Biol Chem 149:511-517.
27. Menzies, J.A. 1912. Observations on the Secretion and Composition of Human Bile.
Biochem J 6:210-218.
19 28. Paton, D.N. 1892. Observations on the Composition and Flow of the Bile in Man. Br Med
J 1:960-961.
29. Yeo, G.F., and Herroun, E.F. 1884. A Note on the Composition of Human Bile obtained
from a Fistula. J Physiol 5:116-123.
30. Sperry, W.M. 1930. Lipid Excretion. VII. The partition of fecal lipids in bile fistula dogs.
J Biol Chem 85:455-463.
31. Siperstein, M.D., Chaikoff, I.L., and Reinhardt, W.O. 1952. C14-Cholesterol. V.
Obligatory function of bile in intestinal absorption of cholesterol. J Biol Chem 198:111-
114.
32. Noshiro, M., Nishimoto, M., Morohashi, K., and Okuda, K. 1989. Molecular cloning of
cDNA for cholesterol 7 alpha-hydroxylase from rat liver microsomes. Nucleotide
sequence and expression. FEBS Lett 257:97-100.
33. Jelinek, D.F., Andersson, S., Slaughter, C.A., and Russell, D.W. 1990. Cloning and
regulation of cholesterol 7 alpha-hydroxylase, the rate-limiting enzyme in bile acid
biosynthesis. J Biol Chem 265:8190-8197.
34. Noshiro, M., and Okuda, K. 1990. Molecular cloning and sequence analysis of cDNA
encoding human cholesterol 7 alpha-hydroxylase. FEBS Lett 268:137-140.
35. Shefer, S., Hauser, S., Bekersky, I., and Mosbach, E.H. 1970. Biochemical site of
regulation of bile acid biosynthesis in the rat. J Lipid Res 11:404-411.
36. Insull, W., Jr. 2006. Clinical utility of bile acid sequestrants in the treatment of
dyslipidemia: a scientific review. South Med J 99:257-273.
37. Pattni, S., and Walters, J.R. 2009. Recent advances in the understanding of bile acid
malabsorption. Br Med Bull 92:79-93.
20 38. Wedlake, L., A'Hern, R., Russell, D., Thomas, K., Walters, J.R., and Andreyev, H.J.
2009. Systematic review: the prevalence of idiopathic bile acid malabsorption as
diagnosed by SeHCAT scanning in patients with diarrhoea-predominant irritable bowel
syndrome. Aliment Pharmacol Ther 30:707-717.
39. Goodwin, B., Jones, S.A., Price, R.R., Watson, M.A., McKee, D.D., Moore, L.B.,
Galardi, C., Wilson, J.G., Lewis, M.C., Roth, M.E., et al. 2000. A regulatory cascade of
the nuclear receptors FXR, SHP-1, and LRH-1 represses bile acid biosynthesis. Mol Cell
6:517-526.
40. Edwards, P.A., Kast, H.R., and Anisfeld, A.M. 2002. BAREing it all: the adoption of
LXR and FXR and their roles in lipid homeostasis. J Lipid Res 43:2-12.
41. Kawamata, Y., Fujii, R., Hosoya, M., Harada, M., Yoshida, H., Miwa, M., Fukusumi, S.,
Habata, Y., Itoh, T., Shintani, Y., et al. 2003. A G protein-coupled receptor responsive to
bile acids. J Biol Chem 278:9435-9440.
42. Katsuma, S., Hirasawa, A., and Tsujimoto, G. 2005. Bile acids promote glucagon-like
peptide-1 secretion through TGR5 in a murine enteroendocrine cell line STC-1. Biochem
Biophys Res Commun 329:386-390.
43. Thomas, C., Gioiello, A., Noriega, L., Strehle, A., Oury, J., Rizzo, G., Macchiarulo, A.,
Yamamoto, H., Mataki, C., Pruzanski, M., et al. 2009. TGR5-mediated bile acid sensing
controls glucose homeostasis. Cell Metab 10:167-177.
44. Watanabe, M., Houten, S.M., Mataki, C., Christoffolete, M.A., Kim, B.W., Sato, H.,
Messaddeq, N., Harney, J.W., Ezaki, O., Kodama, T., et al. 2006. Bile acids induce
energy expenditure by promoting intracellular thyroid hormone activation. Nature
439:484-489.
21 45. Out, C., Groen, A.K., and Brufau, G. 2012. Bile acid sequestrants: more than simple
resins. Curr Opin Lipidol 23:43-55.
46. Bennett, B.J., de Aguiar Vallim, T.Q., Wang, Z., Shih, D.M., Meng, Y., Gregory, J.,
Allayee, H., Lee, R., Graham, M., Crooke, R., et al. 2013. Trimethylamine-N-oxide, a
metabolite associated with atherosclerosis, exhibits complex genetic and dietary
regulation. Cell Metab 17:49-60.
47. Wang, Z., Klipfell, E., Bennett, B.J., Koeth, R., Levison, B.S., Dugar, B., Feldstein, A.E.,
Britt, E.B., Fu, X., Chung, Y.M., et al. 2011. Gut flora metabolism of
phosphatidylcholine promotes cardiovascular disease. Nature 472:57-63.
48. Koeth, R.A., Wang, Z., Levison, B.S., Buffa, J.A., Org, E., Sheehy, B.T., Britt, E.B., Fu,
X., Wu, Y., Li, L., et al. 2013. Intestinal microbiota metabolism of l-carnitine, a nutrient
in red meat, promotes atherosclerosis. Nat Med 19:576-585.
49. Thompson, J.C., and Vars, H.M. 1953. Biliary excretion of cholic acid and cholesterol in
hyper-, hypo-, and euthyroid rats. Proc Soc Exp Biol Med 83:246-248.
50. Eriksson, S. 1957. Biliary excretion of bile acids and cholesterol in bile fistula rats; bile
acids and steroids. Proc Soc Exp Biol Med 94:578-582.
51. Shefer, S., Hauser, S., Bekersky, I., and Mosbach, E.H. 1969. Feedback regulation of bile
acid biosynthesis in the rat. J Lipid Res 10:646-655.
52. Bergstrom, S., and Danielsson, H. 1958. On the regulation of bile acid formation in the
rat liver. Acta Physiol Scand 43:1-7.
53. Danzinger, R.C., Hofmann, A.F., Thistle, J.L., and Schoenfield, L.J. 1973. Effect of oral
chenodeoxycholic acid on bile acid kinetics and biliary lipid composition in women with
cholelithiasis. J Clin Invest 52:2809-2821.
22 54. Shefer, S., Hauser, S., Lapar, V., and Mosbach, E.H. 1973. Regulatory effects of sterols
and bile acids on hepatic 3-hydroxy-3-methylglutaryl CoA reductase and cholesterol
7alpha-hydroxylase in the rat. J Lipid Res 14:573-580.
55. Lu, T.T., Makishima, M., Repa, J.J., Schoonjans, K., Kerr, T.A., Auwerx, J., and
Mangelsdorf, D.J. 2000. Molecular basis for feedback regulation of bile acid synthesis by
nuclear receptors. Mol Cell 6:507-515.
56. Kerr, T.A., Saeki, S., Schneider, M., Schaefer, K., Berdy, S., Redder, T., Shan, B.,
Russell, D.W., and Schwarz, M. 2002. Loss of nuclear receptor SHP impairs but does not
eliminate negative feedback regulation of bile acid synthesis. Dev Cell 2:713-720.
57. Pandak, W.M., Li, Y.C., Chiang, J.Y., Studer, E.J., Gurley, E.C., Heuman, D.M.,
Vlahcevic, Z.R., and Hylemon, P.B. 1991. Regulation of cholesterol 7 alpha-hydroxylase
mRNA and transcriptional activity by taurocholate and cholesterol in the chronic biliary
diverted rat. J Biol Chem 266:3416-3421.
58. Nagano, M., Kuroki, S., Mizuta, A., Furukawa, M., Noshiro, M., Chijiiwa, K., and
Tanaka, M. 2004. Regulation of bile acid synthesis under reconstructed enterohepatic
circulation in rats. Steroids 69:701-709.
59. Yu, C., Wang, F., Kan, M., Jin, C., Jones, R.B., Weinstein, M., Deng, C.X., and
McKeehan, W.L. 2000. Elevated cholesterol metabolism and bile acid synthesis in mice
lacking membrane tyrosine kinase receptor FGFR4. J Biol Chem 275:15482-15489.
60. Ito, S., Fujimori, T., Furuya, A., Satoh, J., Nabeshima, Y., and Nabeshima, Y. 2005.
Impaired negative feedback suppression of bile acid synthesis in mice lacking
betaKlotho. J Clin Invest 115:2202-2208.
23 61. Inagaki, T., Choi, M., Moschetta, A., Peng, L., Cummins, C.L., McDonald, J.G., Luo, G.,
Jones, S.A., Goodwin, B., Richardson, J.A., et al. 2005. Fibroblast growth factor 15
functions as an enterohepatic signal to regulate bile acid homeostasis. Cell Metab 2:217-
225.
62. Holt, J.A., Luo, G., Billin, A.N., Bisi, J., McNeill, Y.Y., Kozarsky, K.F., Donahee, M.,
Wang, D.Y., Mansfield, T.A., Kliewer, S.A., et al. 2003. Definition of a novel growth
factor-dependent signal cascade for the suppression of bile acid biosynthesis. Genes Dev
17:1581-1591.
63. Schaap, F.G., van der Gaag, N.A., Gouma, D.J., and Jansen, P.L. 2009. High expression
of the bile salt-homeostatic hormone fibroblast growth factor 19 in the liver of patients
with extrahepatic cholestasis. Hepatology 49:1228-1235.
64. Nishimura, T., Utsunomiya, Y., Hoshikawa, M., Ohuchi, H., and Itoh, N. 1999. Structure
and expression of a novel human FGF, FGF-19, expressed in the fetal brain. Biochim
Biophys Acta 1444:148-151.
65. Wu, X., Ge, H., Gupte, J., Weiszmann, J., Shimamoto, G., Stevens, J., Hawkins, N.,
Lemon, B., Shen, W., Xu, J., et al. 2007. Co-receptor requirements for fibroblast growth
factor-19 signaling. J Biol Chem 282:29069-29072.
66. Lin, B.C., Wang, M., Blackmore, C., and Desnoyers, L.R. 2007. Liver-specific activities
of FGF19 require Klotho beta. J Biol Chem 282:27277-27284.
67. Zweers, S.J., Booij, K.A., Komuta, M., Roskams, T., Gouma, D.J., Jansen, P.L., and
Schaap, F.G. 2011. The human gallbladder secretes fibroblast growth factor 19 into bile:
towards defining the role of fibroblast growth factor 19 in the enterobiliary tract.
Hepatology 55:575-583.
24 68. Zhang, J.H., Nolan, J.D., Kennie, S.L., Johnston, I.M., Dew, T., Dixon, P.H., Williamson,
C., and Walters, J.R. 2013. Potent stimulation of fibroblast growth factor 19 expression in
the human ileum by bile acids. Am J Physiol Gastrointest Liver Physiol 304:G940-948.
69. Kim, I., Ahn, S.H., Inagaki, T., Choi, M., Ito, S., Guo, G.L., Kliewer, S.A., and Gonzalez,
F.J. 2007. Differential regulation of bile acid homeostasis by the farnesoid X receptor in
liver and intestine. J Lipid Res 48:2664-2672.
70. Vergnes, L., Lee, J.M., Chin, R.G., Auwerx, J., and Reue, K. 2013. Diet1 functions in the
FGF15/19 enterohepatic signaling axis to modulate bile acid and lipid levels. Cell Metab
17(6):916-28.
71. Lundasen, T., Galman, C., Angelin, B., and Rudling, M. 2006. Circulating intestinal
fibroblast growth factor 19 has a pronounced diurnal variation and modulates hepatic bile
acid synthesis in man. J Intern Med 260:530-536.
72. Xiang, X., Han, Y., Neuvonen, M., Pasanen, M.K., Kalliokoski, A., Backman, J.T.,
Laitila, J., Neuvonen, P.J., and Niemi, M. 2009. Effect of SLCO1B1 polymorphism on
the plasma concentrations of bile acids and bile acid synthesis marker in humans.
Pharmacogenet Genomics 19:447-457.
73. Galman, C., Angelin, B., and Rudling, M. 2011. Pronounced variation in bile acid
synthesis in humans is related to gender, hypertriglyceridaemia and circulating levels of
fibroblast growth factor 19. J Intern Med 270:580-588.
74. Steiner, C., Othman, A., Saely, C.H., Rein, P., Drexel, H., von Eckardstein, A., and
Rentsch, K.M. 2011. Bile acid metabolites in serum: intraindividual variation and
associations with coronary heart disease, metabolic syndrome and diabetes mellitus.
PLoS One 6:e25006.
25 75. Xiang, X., Backman, J.T., Neuvonen, P.J., and Niemi, M. 2012. Gender, but not CYP7A1
or SLCO1B1 polymorphism, affects the fasting plasma concentrations of bile acids in
human beings. Basic Clin Pharmacol Toxicol 110:245-252.
76. Everson, G.T. 1987. Steady-state kinetics of serum bile acids in healthy human subjects:
single and dual isotope techniques using stable isotopes and mass spectrometry. J Lipid
Res 28:238-252.
26
Chapter 2
Diet1 Functions in the FGF15/19 Enterohepatic Signaling Axis
to Modulate Bile Acid and Lipid Levels
27 Preface
In Chapter 2, I present a study that is the first to identify and characterize the novel gene
Diet1. The gene was identified from a spontaneous mutation that occurred in the C57BL6/ByJ
(B6By) inbred mouse strain. Several years ago, Lusis and colleagues observed that the B6By inbred mouse strain was resistant to diet-induced hypercholesterolemia and atherosclerosis, compared to the closely related C57BL6/J mouse strain, which is highly susceptible to diet- induced atherosclerosis. Even on a chow diet, the B6By mice exhibit lower plasma lipid levels compared to C57BL6/J mice. Further investigation of this intriguing phenotype by our laboratory revealed that the low plasma cholesterol levels in B6By mice genetically segregated with elevated plasma bile acid levels. Given the close genetic relationship between the two mouse strains, we hypothesized that a single gene was responsible for the dramatically different responses to the atherogenic diet.
The manuscript contained in this chapter reports the identification of the Diet1 gene, and the characterization of how Diet1-deficiency results in dysregulation of bile acid metabolism.
Dr. Laurent Vergnes performed the mapping and positional cloning of Diet1 before I joined the laboratory. He also showed that Diet1 is expressed in the small intestine and kidney cortex, and nonetheless causes a reduction in expression of the hepatic enzyme responsible for the rate- limiting step of bile acid synthesis, Cyp7a1. It required our joint efforts to establish the mechanism by which Diet1 mediates the regulation of bile acid synthesis. A salient clue about the role of Diet1 was the reduced mRNA and protein levels for the hormone fibroblast growth factor 15 (FGF15) in the ileum of the Diet1-deficient mice. FGF15 is secreted from the ileum and signals to the liver through the FGFR4/β-klotho receptor complex to down-regulate Cyp7a1 and bile acid synthesis. I demonstrated a cause-effect relationship between Diet1 and FGF15
28 levels in vivo by rescuing FGF15 expression in the intestine of Diet1-deficient mice by introducing a Diet1 transgene. Furthermore, using in vitro experiments in which both Diet1 and
FGF19 were expressed in a human cell line under the control of heterologous promoters, I showed that Diet1 affects FGF19 production at the post-transcriptional level. My immunofluorescent confocal microscopy studies established that Diet1 and FGF15/19 exhibit overlapping subcellular distribution, and appear to inhabit vesicle-like structures that resemble endosomes. The Diet1-containing structures do not contain markers for early endosomes, late endosomes, or lysosomes. Spurred by the observation that Diet1 and FGF15/19 at times share the same cellular compartment, I determined that Diet1 and FGF15/19 proteins are present in a complex that can be detected by co-immunoprecipitation. My contributions to this study were important for proving that Diet1 influences the levels of FGF15 protein in the intestine, that
Diet1 and FGF15/19 proteins physically interact, and that Diet1 promotes the secretion of
FGF15/19 in a post-transcriptional manner.
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
Chapter 3
A common genetic variant in DIET1 influences cellular
fibroblast growth factor 19 (FGF19) secretion
55 Preface
This chapter describes the first assessment of genetic variation in DIET1 as it relates to human bile acid metabolism. As described in the previous chapter, Diet1-deficient mice have elevated plasma bile acid levels, increased bile acid pool size, and enhanced elimination of bile acids through the feces when fed an atherogenic diet. We showed that Diet1 can promote the secretion of the ileal hormone FGF15/19, both in mice and a human intestinal cell line.
Recently, Dr. Julian Walters’ group (Imperial College London, UK) described an inverse relationship between levels of a plasma marker for bile acid synthesis in humans, 7α-hydroxy- cholest-4-ene-3-one (C4), and plasma FGF19 levels. He also determined that low FGF19 and high C4 levels correlate with type 2 bile acid diarrhea (BAD). Type 2 BAD is characterized by chronic watery diarrhea, and the cause is unknown. Since Diet1 can affect FGF15/19 secretion in mouse and cell models, we hypothesized that genetic variation in DIET1 might contribute to type 2 BAD.
For our studies, we obtained DNA samples from 22 cases with type 2 BAD and 22 controls from Dr. Walters. I utilized these DNA samples to perform all the experiments presented in this chapter. This included designing primers and performing sequencing reactions for the coding regions and flanking non-coding regions for DIET1, analyzing all sequence traces, and validating the variants identified. I also developed recombinant Diet1 expression constructs and performed experiments to analyze the effects of the Diet1 H1721Q variant on FGF19 secretion in a cell-based assay and wrote the manuscript herein.
56
A common genetic variant in DIET1 influences cellular fibroblast growth factor 19
(FGF19) secretion
Jessica M. Lee1, Laurent Vergnes1, Julian R.F. Walters2, Karen Reue1,3
1Department of Human Genetics, David Geffen School of Medicine at UCLA
2 Department of Medicine, Section of Hepatology and Gastroenterology, Imperial College
London and Imperial College Healthcare, London, UK
3Molecular Biology Institute, University of California, Los Angeles
Abbreviated title: DIET1 variants and FGF19 secretion
Correspondence: Karen Reue, Dept. of Human Genetics, David Geffen School of Medicine at
UCLA, 695 Charles E. Young Drive South, Los Angeles, CA 90095. Email: [email protected];
Phone (310) 794-5631; Fax (310) 794-5446
57 ABSTRACT
Fibroblast growth factor 19 (FGF19) is an ileal-produced hormone with a central role in enterohepatic feedback regulation of bile acid synthesis. Recently, reduced circulating FGF19 levels have been implicated in type 2 bile acid diarrhea (BAD). DIET1 is a newly discovered gene whose protein product can promote secretion of FGF19 from human enterocytes. We hypothesized that genetic variation in DIET1 may contribute to type 2 BAD.
The exons and exon/intron boundaries for DIET1 were sequenced in a small case-control study.
No causative variants in DIET1 were identified in type 2 BAD subjects. However, the prevalence of a common variant in DIET1 (rs12256835) was significantly skewed between cases and controls. This variant causes an amino acid substitution, H1721Q. Functional studies revealed that the Diet1-1721Q isoform promotes FGF19 secretion with a 70% higher efficiency compared to Diet1-1721H. The DIET1 H1721Q variant occurs at significant levels in European and other populations and may contribute to the several-fold variation in plasma FGF19 levels that have been observed in the human population.
Supplementary key words: bile acids • enterohepatic circulation • feedback regulation • bile acid malabsoprtion • nonsynonymous variant
58 INTRODUCTION
A primary pathway for the elimination of cholesterol from the body is through the catabolism of cholesterol to bile acids, the secretion of cholesterol into bile, and the subsequent loss of bile acids in the feces (1-5). The augmentation of flux through this pathway is an attractive therapeutic mechanism to control plasma cholesterol levels (5-7). However, the amount of bile acids lost through excretion must be carefully regulated, because increasing the concentration of bile acids in the colon can trigger diarrhea by inducing the flow of water into the lumen of the colon (2, 3, 5, 8).
Chronic watery diarrhea is a condition known as bile acid malabsorption or bile acid diarrhea (BAD). BAD is classified into three types based on distinct etiologies (2, 3, 9, 10).
Type 1 BAD is defined as diarrhea due to surgical re-sectioning or disease of the terminal small intestine, both of which may interfere with the efficient hepatic reabsorption of bile acids from the intestinal lumen (2, 3, 9, 10). Type 2 BAD (also known as idiopathic or primary BAD) is characterized by increased bile acid production, rather than attenuated bile acid reabsorption, with no apparent histological defects (2, 3, 9-11). Type 3 BAD encompasses chronic diarrheas caused by other conditions that can affect bile acid absorption, such as cholecystectomy or bacterial overgrowth in the small intestine (2, 3, 9, 10).
Type 2 BAD is the most common of the bile acid malabsorption syndromes, estimated to affect about 1% of the European population (2, 3, 9, 10). The definitive test for idiopathic BAD is the measurement of the 7-day retention of a radiolabeled bile acid, selenium homocholic acid taurine (SeHCAT) (12). Patients with type 2 BAD eliminate the radiolabel more rapidly than controls, as determined by scanning with a gamma camera (12). This test is available in Europe, but is rarely used in the United States. In the US, type 2 BAD is typically diagnosed through
59 indirect means: by monitoring whether the condition improves by administration of bile acid sequestrants, the most common treatment for idiopathic BAD (10). Bile acid sequestrants inhibit diarrhea by binding excess bile acids in the small intestine, preventing them from triggering the flow of water into the colon (2, 3). An alternative screening method for BAD is the quantification of 7α-hydroxy-cholest-4-ene-3-one (C4). C4 is an intermediate in the bile acid synthesis pathway that accumulates in plasma in proportion to the activity of the rate-limiting enzyme in bile acid synthesis, cholesterol 7-alpha hydroxylase (Cyp7a1) (13-16). There is a reciprocal relationship between C4 levels and SeHCAT retention, which supports the hypothesis that type 2 BAD results from excess bile acid production, rather than impaired bile acid absorption (2, 3, 10, 16-19).
Genetic studies of type 2 BAD have focused on a few candidate genes with established roles in bile acid metabolism. A rare mutation in SLC10A2, encoding the ileal apical sodium- dependent bile acid transporter, was identified in one family with bile acid malabsorption, but variations in SLC10A2 have not been associated with adult-onset type 2 BAD (20, 21). Genetic variations in genes encoding receptors with roles in bile acid metabolism (FGFR4, KLB, TGR5) and the intestinal bile acid transporter (FABP6) have been examined for association with irritable bowel syndrome with diarrhea (22-24) or type 2 BAD (25), respectively; no replicable associations were identified. However, careful phenotypic analysis of type 2 BAD patients by
Walters et al. revealed a potential role for the intestinally derived hormone fibroblast growth factor 19 (FGF19). Individuals with type 2 BAD tend to have reduced intestinal expression of
FGF19 (25). FGF19 is secreted by the ileum into the enterohepatic circulation, and signals through hepatic co-receptors fibroblast growth factor receptor 4 (FGFR4) and β klotho(KLB), to down-regulate bile acid synthesis (2, 3, 5, 26). Walters et al. subsequently demonstrated an
60 inverse relationship between serum C4 and FGF19 levels, with high C4 levels and low FGF19 levels in BAD (17, 18). These studies implicate impaired FGF19-dependent down-regulation of bile acid synthesis as a likely contributor to bile acid dysregulation in BAD.
We recently reported the discovery of a novel gene, Diet1 (DIET1 in humans), which influences the levels of intestinal production of FGF15, the mouse ortholog of human FGF19
(27). In mice and humans, Diet1 and DIET1 are expressed primarily in the small intestine; mouse studies localized Diet1 mRNA specifically to intestinal epithelial cells (27). Diet1 expression levels in mouse intestine, and DIET1 expression levels in cultured human enterocytes, correlate with FGF15/19 protein production. Thus, Diet1-deficient mice have reduced FGF15 levels in the ileum, impaired feedback regulation of hepatic bile acid synthesis, and increased bile acid levels in the circulation and feces (27-29), reminiscent of patients with type 2 BAD.
Restoration of functional Diet1 expression in the intestine of Diet1-deficient mice by transgene expression normalizes hepatic bile acid synthesis and FGF15 expression, confirming that a key function of Diet1 is to promote FGF15 production (27). Furthermore, the modulation of DIET1 expression levels in a human intestinal cell line leads to corresponding changes in FGF15/19 secretion (27). The effect of Diet1 on FGF15/19 secretion appears to be post-transcriptional, and may involve a physical interaction between Diet1 and FGF15/19 proteins (27).
Given the similarity between the phenotype of Diet1-deficient mice and the clinical features of idiopathic BAD, as well as the role of Diet1 as a determinant of FGF15/19 secretion, we hypothesized that genetic variation in DIET1 may contribute to type 2 BAD. To test this hypothesis, we sequenced the coding region of DIET1 in 22 patients with idiopathic BAD and 22 controls. These studies led to the identification of a common DIET1 protein variant that
61 promotes enhanced cellular FGF19 secretion, and could be a determinant of inter-individual variations in bile acid levels.
62 RESULTS
Sequence Variation in DIET1
To evaluate the potential role of rare or common DIET1 variants in type 2 BAD, we sequenced the complete DIET1 coding region and exon/intron junctions in a type 2 BAD case- control cohort (22 cases, 22 controls). We observed a total of 34 variants distributed along the length of DIET1 (Table 1 and 2). Of these, 25 were nonsynonymous, including 5 novel variants
(Fig. 1A, Suppl. Fig. 1, and Table 1 and 2). In addition, we identified a novel single nucleotide deletion in exon 22 of DIET1 that results in a frame-shift and premature stop codon at position
1221, and presumably leads to a null allele (Table 2, Suppl. Fig. 1). The frame-shift mutation was present in the heterozygous state in a control individual, and therefore is not associated with
BAD. Each novel variant was confirmed using PCR products from independent amplification reactions and sequencing of both strands (Supp. Fig. 1). Thus, despite the relatively small sample size, we identified several novel sequence variants in the DIET1 coding region, including multiple nonsynonymous amino acid substitutions with the potential to affect Diet1 protein function.
DIET1 variant with distinct distribution between type 2 BAD case and control subjects
Of the 25 nonsynonymous DIET1 variants present in our study sample, the minor alleles for 9 of these variants were detected exclusively in either the cases or the controls (Table 1).
Most of these occurred at low frequency (1-3 times in 88 alleles sequenced), so their relevance to type 2 BAD is difficult to assess. However, one variant (rs12256835, 5163 T>G) had a minor allele frequency of 0.125 in our study sample, and notably, its prevalence differed significantly between case and control groups (Fig. 1B; Fisher’s Exact Test: nominal p = 0.0005; adjusted for
63 multiple testing, p = 0.0175; Table 2). The rs12256835 major allele encodes a histidine residue at position 1721 of the Diet1 protein, and the minor allele results in a glutamine residue at the same position (H1721Q). The minor (Q) allele was detected exclusively in the control samples
(11 of 44 alleles). This polymorphism has a frequency of 0.2816 in the 1000 Genomes dataset
(30) (Table 2, Fig. 1C), suggesting that it is a common source of structural variation in the Diet1 protein. Interestingly, in 1000 Genomes (30), the allele frequency for rs12256835 is similar in
European and East Asian individuals, but deviates substantially in the Luhya in Webuye, Kenya,
Yoruba in Ibadan Nigera, as well as individuals of African ancestry in southwestern United
States (Fig. 1C). Individuals of African descent were not present in our study sample, and cannot account for the difference in rs12256835 allele frequency that we observed between type
2 BAD cases and controls.
The Diet1 protein has a predicted modular structure, with repeating interspersed LDL receptor and MAM (meprin/A5-protein/PTPmu) domains (27). The H1721Q amino acid change occurs at the transition between the seventh LDL receptor domain and the adjacent MAM domain (Fig. 1A). Amino acid substitution prediction programs Polyphen2 and SIFT predict the
H to Q substitution to be benign and neutral. SIFT predictions are based exclusively upon sequence similarity (31, 32), whereas PolyPhen2 combines sequence similarity with known structural information (33). However, given that little is known about Diet1 protein structure, these prediction programs maybe less effective for uncharacterized proteins, so we set out to determine experimentally whether the H1721Q amino acid substitution influences Diet1 protein function.
Diet1 H1721Q variant influences FGF19 secretion
64 We previously demonstrated that Diet1 influences bile acid levels by modulating FGF19 hormone secretion in intestine (27). Diet1 promotes FGF19 protein secretion largely at the post- transcriptional level, possibly through a Diet1-FGF19 protein-protein interaction (27). To determine whether the presence of a histidine or a glutamine at amino acid position 1721 affects
Diet1 function, we performed an FGF19 secretion assay in cultured human cells (27). We co- expressed epitope-tagged versions of Diet1 (1721H or 1721Q) with FGF19-Myc in HEK293T cells, collected the cells after 48 hours, and the FGF19 secreted into the medium during the final
24 hour period. Cellular and secreted FGF19 was quantified by Western blot analysis and normalized to the amount of Diet1 protein expressed. Since the secretion of FGF19 is sensitive to the Diet1 levels (27), we ensured that the levels of the 1721H and 1721Q proteins were within two-fold of one another. As a control for specificity of the Diet1 effect on FGF19, we analyzed the levels of FGF19 secretion when an irrelevant protein with a similar molecular weight to
Diet1 (Kdm5c-V5) was expressed.
A representative experiment (from a total of 9 individual experiments, each run in triplicate or quadruplicate) is shown in Fig. 2. The presence of either Diet1 protein variant significantly increased FGF19 secretion compared to the irrelevant control protein (Fig. 2A,B).
We observed that the amount of cellular FGF19 was similar when Diet1 1721H or 1721Q were expressed, but the amount of FGF19 secreted into the culture medium in 24 hours was significantly greater upon expression of Diet1 1721Q (Fig. 2A, B).
To confirm the difference in FGF19 secretion levels for Diet1 1721H versus 1721Q, we analyzed the combined the data from nine independent experiments using linear regression analysis for the amount of secreted FGF19 per cellular Diet1 protein (Figure 2C). While the slopes of the two linear regression lines were similar, the two Diet1 variants had significantly
65 different y-intercepts (p = 5.33 x 10-8, ANCOVA), indicating that the 1721Q variant promotes increased FGF19 secretion into the culture medium (Fig. 2C, D). Averaged over 9 independent experiments, the Diet1 1721Q variant enhanced FGF19 secretion by 70% compared to Diet1
1721H.
Physical interaction between Diet1 variants and FGF19
We previously demonstrated that Diet1 protein and FGF19 co-immunoprecipitate and display overlapping subcellular localization (27). A potential mechanism to explain the difference in FGF19 secretion observed for the 1721H and 1721Q variants is altered interaction between Diet1 and FGF19. To test this hypothesis, we co-expressed epitope-tagged Diet1 and
FGF19, immunoprecipitated the complex, and quantified the amount of each Diet1 isoform pulled down by FGF19. Expression of the two Diet1 variants at similar levels (see “Lysate” lanes in Fig. 3) led to the pull-down of a similar proportion of Diet1 by immunoprecipitation of
FGF19 (blue boxes in Fig. 3). Thus, the differential FGF19 secretion levels promoted by Diet1-
1721H and -1721Q appear not to be mediated by a difference in the efficiency with which the two Diet1 isoforms interact with FGF19. However, we cannot exclude the possibility that subtle differences in Diet1-FGF19 binding might occur for the two Diet1 isoforms at physiological expression levels within enterocytes in vivo.
66 DISCUSSION
The purpose of this study was to test whether genetic variation in the newly discovered
DIET1 gene may contribute to idiopathic bile acid diarrhea. We resequenced the DIET1 coding region and intron-exon junctions in samples from a type 2 BAD case-control study. We detected a novel single-nucleotide deletion that results in a frame-shift and premature stop codon in one
DIET1 allele in an individual from the control group. It is unknown at present whether this heterozygous DIET1 mutation results in a phenotype in the affected individual, but our data indicate that DIET1 null mutations are not a cause of type 2 BAD in the cohort examined here.
Nevertheless, our data provide the first targeted resequencing of the DIET1 coding region, and a catalog of the genetic heterogeneity in a group of individuals of largely European descent. In our relatively small sample, we detected 25 nonsynonymous amino acid substitutions. Of these, 20 were present in existing databases, but had not been placed in the context of a functional protein since DIET1 has only recently been identified and annotated. In addition, we observed five novel nonsynonymous variants, each present in the heterozygous state of single individuals. We have not yet assessed the functional significance of these novel variants, but they presumably do not contribute to type 2 BAD as they were all present in the heterozygous state.
Among the Diet1 nonsynonymous variants detected, we focused on rs12256835
(H1721Q) because the genotype for this variant differed significantly between cases and controls. The minor allele was detected exclusively in the control group, where it made up 25% of the alleles. To assess whether the H1721Q amino acid change affects Diet1 protein function, we compared the ability of Diet1-1721H and Diet1-1721Q to promote FGF19 secretion in cultured cells. When normalized to Diet1 protein levels, the Diet1-1721Q variant promoted the secretion of FGF19 more potently than Diet1 1721H. Therefore the genotype at rs12256835
67 may be one determinant of the 7-fold range of FGF19 plasma levels that have been observed in healthy individuals (26, 34), and likewise, a determinant of variation in bile acid levels. It is expected that enhanced secretion of FGF19 would lead to more effective down-regulation of bile acid synthesis. So it is possible that possession of the minor allele at rs12256835, which encodes the Diet1-1721Q isoform and is present at approximately 28% in the human population
(averaged across ethnic groups), may protect against excess bile acid production. It this context, it is notable that the protective allele was completely absent from the type 2 BAD cases, but present at the expected population frequency (25%) in the control subjects. Since FGF19 levels are correlated with plasma triglyceride levels (34), DIET1 variants may also indirectly influence plasma lipid levels. To test this possibility, it will be interesting to type rs12256835 in much larger cohorts that have been typed for FGF19, bile acid, and lipid levels.
No experimental data exists about the three dimensional structure of the Diet1 protein, and it is unknown whether the 1721 histidine to glutamine substitution will alter the protein topography. As a first approach, we modeled the structure of the final two-thirds of the Diet1 protein (residues 659-2156, the maximum size allowed by the algorithm iTASSER (35, 36)).
We built independent models for Diet1-1721H and Diet1-1721Q, and chose the model with the best C-score for each isoform (-0.54, and -0.74 for 1721H and 1721Q, respectively).
Interestingly, amino acid 1721 is predicted to reside at the protein surface, and exhibits slightly different positions relative to the plane of the protein depending on the identity of residue 1721.
When histidine is present (green residue in Fig. 4A), the residue points downward and lies flush with the protein surface. Glutamine in the same position projects outward from the protein surface (red residue in Fig 4B). Although such modeling must be interpreted with caution, the predicted position of residue 1721 in a location that is accessible to interact with other proteins is
68 consistent with a potential effect of this amino acid substitution on protein function. Along these lines, we assessed the ability of Diet1-1721H and -1721Q to bind FGF19 when these proteins are expressed in cultured cells. Although we detected similar binding efficiency for the two Diet1 isoforms, we cannot exclude the possibility that this variation affects binding with FGF19 (or other proteins) when all are present at physiological stoichiometry within the enterocyte milieu.
Bile acids are broadly implicated in human health and metabolic disease, and it is of interest to identify genetic variants that determine bile acid levels. To our knowledge, no studies presently exist in which bile acid levels have been quantified in large human cohorts to provide sufficient power for non-biased gene identification approaches, such as genome-wide association. The recent identification of DIET1 as a control point in enterohepatic bile acid signaling suggested it as a key candidate gene for the study of both rare bile acid diarrhea syndromes and common variations in bile acid levels. We have not, as yet, identified individuals with type 2 BAD that carry pathogenic DIET1 mutations. Nevertheless, the provocative finding that a relatively common DIET1 allele enhances the effect of Diet1 on cellular FGF19 protein secretion suggests that this gene may be an important determinant of bile acid levels in the general population. Furthermore, documented associations between bile acid levels or FGF19 levels and plasma triglyceride levels in humans (34), as well as the effects of Diet1 on plasma lipid levels in mice (27-29), suggest that Diet1 activity may also play an important role in human lipid homeostasis. Resequencing of DIET1 in larger human cohorts is underway to address these hypotheses.
69 EXPERIMENTAL PROCDEURES
Study Subjects
A cohort of 22 patients with chronic diarrhea and confirmed bile acid malabsorption was recruited retrospectively from patients on record at the Royal Bolton Hospital. Some of these have been reported before (25, 37). They all had 7-day SeHCAT values between 1 and 7%.
None had bile acid malabsorption secondary to intestinal resection or disease, although six patients had previously undergone cholecystectomy. Thirteen patients experienced satisfactory resolution of symptoms with cholestyramine, and eight reported a family history of chronic diarrhea.
A control group of 22 patients was randomly selected from patients with normal bowel habits undergoing X-ray absorptiometry. Some of these have been reported before (25). They had previously completed a questionnaire to exclude diarrhea and malabsorption and had been screened to exclude celiac disease. All cohorts were composed predominantly of subjects of
Caucasian origin. This research was approved by the Hammersmith, Queen Charlotte’s &
Chelsea and Acton Hospitals and by the Wrightington, Wigan and Leigh Local Research Ethics
Committees.
DNA Sequencing
The exons and flanking intron sequences of DIET1 were amplified by PCR using oligonucleotide primer sequences listed in Supplemental Table 1. PCR products were treated with recombinant exonuclease I and shrimp alkaline phosphatase (Agilent Technologies), and sequenced on a Biosystems 3730 Capillary DNA Analyzer using BigDye terminator cycle
70 sequencing reagents (Human Genetics Sequencing Core). Variants were confirmed by amplification of an independent PCR product and sequencing from on both strands.
Expression constructs and site-directed mutagenesis
V5-epitope-tagged DIET1 expression plasmids, and Myc-epitope-tagged FGF19 expression plasmids, were generated as previously described (27). Site-directed mutagenesis was performed on the plasmid expressing Diet1-1721H to generate Diet1-1721Q using the
QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies) with primers: gaagctcactgtgcacagtatacaagcacaacag (hDIET1_H1721Q-F) and ctgttgtgcttgtatactgtgcacagtgagcttc (hDIET1_H1721Q-R).
FGF19 secretion assay
The effect of Diet1 on FGF19 secretion was assessed as previously described (27).
Briefly, HEK293T cells (American Type Culture Collection) were propagated in Dulbecco’s
Modified Eagle’s Medium (DMEM) containing 10% fetal bovine serum and supplemented with antibiotics, and incubated at 37°C with 5% CO2. Cells were transfected (in triplicate or quadruplicate) with FGF19-pcDNA6 in combination with Diet1-1721H or diet1-1721Q using
BioT Transfection Reagent (Bioland). After 24 hours, an equal amount of fresh medium was added to each well. The following day, culture medium was collected to quantify the levels of
FGF19 secreted in 24 hours, and cells were collected to quantify cellular FGF19 and Diet1 protein levels. Secreted and cellular FGF19 protein levels and Diet1 protein levels were determined by Western blot. Diet1 was detected with rabbit anti-V5 (Bethyl Laboratories,
1:5000), FGF19 was detected with rabbit anti-Myc (Bethyl Laboratories, 1:10,000), and β-actin
71 was detected with a specific mouse monoclonal antibody (Sigma, 1:10,000). After secondary antibody application, specific protein bands were detected with ECL2 chemiluminescent reagent
(ThermoScientific) and the BioRad Gel Doc CCD camera with Image Lab software (BioRad).
The BioRad Gel Doc system utilizes the light emitted by the conjugated secondary antibody to capture a digital exposure. The digital camera allows for a much broader linear range, and the software indicates the saturation point for specific pixels with each exposure. All images analyzed were within the linear range (i.e., unsaturated bands). The protein band intensity from the resulting image was quantified with ImageJ 1.44 (National Institutes of Health). The amount of FGF19 was normalized to Diet1 protein levels. Western blot images shown in Fig. 2A were adjusted and cropped in Adobe Photoshop.
Diet1/FGF19 Co-immunoprecipitation
Protein coimmunoprecipitation was performed as previously described (27). Briefly,
HEK293T cells were co-transfected with FGF19-pcDNA6 in combination with Diet1-1721H or
Diet1-1721Q. After 24 hours, the transfection agent was removed, and an equal amount of fresh medium was added to each well. Cells were collected and lysed the next day in 1% NP-40
(Sigma), 1X Complete Mini Protease Inhibitor Cocktail (Roche), 0.1% phosphatase inhibitors 2 and 3 (Sigma), in 1X PBS. Cell lysates were incubated with 1 µg of mouse anti-V5 antibody
(Invitrogen), 4 µg of mouse anti-Myc antibody (Millipore) or 4 µg non-specific mouse IgG
(Jackson ImmunoResearch) overnight at 4°C. The next day, Protein A/G PLUS agarose beads
(Santa Cruz Biotechnologies) were added for 2-3 hours at 4°C. After three washes with 1X PBS
+ 0.1% NP-40, protein was eluted from the beads with 1X loading buffer and 1% β-
72 mercaptoenthanol, boiled for 5 minutes, and analyzed by Western blot as described in the preceding section.
Diet1 protein model construction
Diet1 protein structure was modeled using the iTASSER server (35, 36). The Diet1 primary amino acid sequence was translated from DIET1 mRNA (GenBank accession number
KC843478). 1498 amino acids corresponding to amino acid positions 659 to 2156 were submitted for analysis. Diet1-1721H and –1721Q sequences were submitted separately. The models with the best confidence-score were chosen from each run (c-score between -5 to 2; 2 shows the most confidence in the model). Jmol (http://www.jmol.org/) was used to capture screen shots of generated models and to highlight amino acid position 1721.
Statistical analysis
Fisher’s Exact tests and one-way analysis of covariance were preformed in the online
VasserStats website for Statistical Computation (http://www.vassarstats.net/). Student’s t-tests were calculated in Excel. Bars shown in Fig. 2 represent mean ± SD.
73 REFERENCES
1. Russell, D.W. 2003. The enzymes, regulation, and genetics of bile acid synthesis. Annu
Rev Biochem 72:137-174.
2. Hofmann, A.F. 2009. Chronic diarrhea caused by idiopathic bile acid malabsorption: an
explanation at last. Expert Rev Gastroenterol Hepatol 3:461-464.
3. Hofmann, A.F., Mangelsdorf, D.J., and Kliewer, S.A. 2009. Chronic diarrhea due to
excessive bile acid synthesis and not defective ileal transport: a new syndrome of
defective fibroblast growth factor 19 release. Clin Gastroenterol Hepatol 7:1151-1154.
4. Russell, D.W. 2009. Fifty years of advances in bile acid synthesis and metabolism. J
Lipid Res 50 Suppl:S120-125.
5. de Aguiar Vallim, T.Q., Tarling, E.J., and Edwards, P.A. 2013. Pleiotropic Roles of Bile
Acids in Metabolism. Cell Metab 17(5):657-69.
6. Galman, C., Ostlund-Lindqvist, A.M., Bjorquist, A., Schreyer, S., Svensson, L., Angelin,
B., and Rudling, M. 2003. Pharmacological interference with intestinal bile acid transport
reduces plasma cholesterol in LDL receptor/apoE deficiency. Faseb J 17:265-267.
7. Insull, W., Jr. 2006. Clinical utility of bile acid sequestrants in the treatment of
dyslipidemia: a scientific review. South Med J 99:257-273.
8. Mekhjian, H.S., Phillips, S.F., and Hofmann, A.F. 1979. Colonic absorption of
unconjugated bile acids: perfusion studies in man. Dig Dis Sci 24:545-550.
9. Pattni, S., and Walters, J.R. 2009. Recent advances in the understanding of bile acid
malabsorption. Br Med Bull 92:79-93.
10. Wedlake, L., A'Hern, R., Russell, D., Thomas, K., Walters, J.R., and Andreyev, H.J.
2009. Systematic review: the prevalence of idiopathic bile acid malabsorption as
74 diagnosed by SeHCAT scanning in patients with diarrhoea-predominant irritable bowel
syndrome. Aliment Pharmacol Ther 30:707-717.
11. Thaysen, E.H., and Pedersen, L. 1976. Idiopathic bile acid catharsis. Gut 17:965-970.
12. Merrick, M.V., Eastwood, M.A., and Ford, M.J. 1985. Is bile acid malabsorption
underdiagnosed? An evaluation of accuracy of diagnosis by measurement of SeHCAT
retention. Br Med J (Clin Res Ed) 290:665-668.
13. Bjorkhem, I., Reihner, E., Angelin, B., Ewerth, S., Akerlund, J.E., and Einarsson, K.
1987. On the possible use of the serum level of 7 alpha-hydroxycholesterol as a marker
for increased activity of the cholesterol 7 alpha-hydroxylase in humans. J Lipid Res
28:889-894.
14. Axelson, M., Aly, A., and Sjovall, J. 1988. Levels of 7 alpha-hydroxy-4-cholesten-3-one
in plasma reflect rates of bile acid synthesis in man. FEBS Lett 239:324-328.
15. Axelson, M., Bjorkhem, I., Reihner, E., and Einarsson, K. 1991. The plasma level of 7
alpha-hydroxy-4-cholesten-3-one reflects the activity of hepatic cholesterol 7 alpha-
hydroxylase in man. FEBS Lett 284:216-218.
16. Galman, C., Arvidsson, I., Angelin, B., and Rudling, M. 2003. Monitoring hepatic
cholesterol 7alpha-hydroxylase activity by assay of the stable bile acid intermediate
7alpha-hydroxy-4-cholesten-3-one in peripheral blood. J Lipid Res 44:859-866.
17. Walters, J.R., Tasleem, A.M., Omer, O.S., Brydon, W.G., Dew, T., and le Roux, C.W.
2009. A new mechanism for bile acid diarrhea: defective feedback inhibition of bile acid
biosynthesis. Clin Gastroenterol Hepatol 7:1189-1194.
75 18. Pattni, S.S., Brydon, W.G., Dew, T., and Walters, J.R. 2012. Fibroblast Growth Factor 19
and 7alpha-Hydroxy-4-Cholesten-3-one in the Diagnosis of Patients With Possible Bile
Acid Diarrhea. Clin Transl Gastroenterol 3:e18.
19. Hofmann, A.F. 1967. The syndrome of ileal disease and the broken enterohepatic
circulation: cholerhetic enteropathy. Gastroenterol 52:752-757.
20. Oelkers, P., Kirby, L.C., Heubi, J.E., and Dawson, P.A. 1997. Primary bile acid
malabsorption caused by mutations in the ileal sodium-dependent bile acid transporter
gene (SLC10A2). J Clin Invest 99:1880-1887.
21. Montagnani, M., Love, M.W., Rossel, P., Dawson, P.A., and Qvist, P. 2001. Absence of
dysfunctional ileal sodium-bile acid cotransporter gene mutations in patients with adult-
onset idiopathic bile acid malabsorption. Scand J Gastroenterol 36:1077-1080.
22. Camilleri, M., Vazquez-Roque, M.I., Carlson, P., Burton, D., Wong, B.S., and
Zinsmeister, A.R. 2011. Association of bile acid receptor TGR5 variation and transit in
health and lower functional gastrointestinal disorders. Neurogastroenterol Motil 23:995-
999, e458.
23. Wong, B.S., Camilleri, M., Carlson, P.J., Guicciardi, M.E., Burton, D., McKinzie, S.,
Rao, A.S., Zinsmeister, A.R., and Gores, G.J. 2011. A Klothobeta variant mediates
protein stability and associates with colon transit in irritable bowel syndrome with
diarrhea. Gastroenterol 140:1934-1942.
24. Wong, B.S., Camilleri, M., Carlson, P., McKinzie, S., Busciglio, I., Bondar, O., Dyer,
R.B., Lamsam, J., and Zinsmeister, A.R. 2012. Increased bile acid biosynthesis is
associated with irritable bowel syndrome with diarrhea. Clin Gastroenterol Hepatol
10:1009-1015 e1003.
76 25. Balesaria, S., Pell, R.J., Abbott, L.J., Tasleem, A., Chavele, K.M., Barley, N.F., Khair,
U., Simon, A., Moriarty, K.J., Brydon, W.G., et al. 2008. Exploring possible mechanisms
for primary bile acid malabsorption: evidence for different regulation of ileal bile acid
transporter transcripts in chronic diarrhoea. Eur J Gastroenterol Hepatol 20:413-422.
26. Angelin, B., Larsson, T.E., and Rudling, M. 2012. Circulating fibroblast growth factors
as metabolic regulators--a critical appraisal. Cell Metab 16:693-705.
27. Vergnes, L., Lee, J.M., Chin, R.G., Auwerx, J., and Reue, K. 2013. Diet1 functions in the
FGF15/19 enterohepatic signaling axis to modulate bile acid and lipid levels. Cell Metab
17(6):916-28.
28. Mouzeyan, A., Choi, J., Allayee, H., Wang, X., Sinsheimer, J., Phan, J., Castellani, L.W.,
Reue, K., Lusis, A.J., and Davis, R.C. 2000. A locus conferring resistance to diet-induced
hypercholesterolemia and atherosclerosis on mouse chromosome 2. J Lipid Res 41:573-
582.
29. Phan, J., Pesaran, T., Davis, R.C., and Reue, K. 2002. The Diet1 locus confers protection
against hypercholesterolemia through enhanced bile acid metabolism. J Biol Chem
277:469-477.
30. Abecasis, G.R., Auton, A., Brooks, L.D., DePristo, M.A., Durbin, R.M., Handsaker, R.E.,
Kang, H.M., Marth, G.T., and McVean, G.A. 2012. An integrated map of genetic
variation from 1,092 human genomes. Nature 491:56-65.
31. Sim, N.L., Kumar, P., Hu, J., Henikoff, S., Schneider, G., and Ng, P.C. 2012. SIFT web
server: predicting effects of amino acid substitutions on proteins. Nucleic Acids Res
40:W452-457.
77 32. Kumar, P., Henikoff, S., and Ng, P.C. 2009. Predicting the effects of coding non-
synonymous variants on protein function using the SIFT algorithm. Nat Protoc 4:1073-
1081.
33. Adzhubei, I.A., Schmidt, S., Peshkin, L., Ramensky, V.E., Gerasimova, A., Bork, P.,
Kondrashov, A.S., and Sunyaev, S.R. 2010. A method and server for predicting
damaging missense mutations. Nat Methods 7:248-249.
34. Galman, C., Angelin, B., and Rudling, M. 2011. Pronounced variation in bile acid
synthesis in humans is related to gender, hypertriglyceridaemia and circulating levels of
fibroblast growth factor 19. J Intern Med 270:580-588.
35. Zhang, Y. 2008. I-TASSER server for protein 3D structure prediction. BMC Bioinfor
9:40.
36. Roy, A., Kucukural, A., and Zhang, Y. 2010. I-TASSER: a unified platform for
automated protein structure and function prediction. Nat Protoc 5:725-738.
37. Sinha, L., Liston, R., Testa, H.J., and Moriarty, K.J. 1998. Idiopathic bile acid
malabsorption: qualitative and quantitative clinical features and response to
cholestyramine. Aliment Pharmacol Ther 12:839-844.
78 FIGURE LEGENDS
Figure 1. Location of nonsynonymous single nucleotide variants in human Diet1.
(A) Schematic diagram of Diet1 protein domain structure. Arrows above the cartoon indicate the 25 nonsynonymous variants, and one single-nucleotide deletion, detected in cases and controls. Arrows below the diagram indicate the novel nonsynonymous variants, the frame-shift mutation, and the position of rs12256835, which differs in frequency between cases and controls
(see B below) and functionally (see Fig. 2).
(B) rs12256835 genotypes in BAD cases and controls. The absence of the G allele in the cases is statistically significant by Fisher’s exact test (p = 0.0005).
C) Population frequencies for rs12256835 alleles. Data from the 1000 Genomes Project (30).
Figure 2. DIET1 variant rs12256835 influences secretion of FGF19 in a cell-based assay.
A) Representative results of a FGF19 secretion assay. HEK293T cells were co-transfected with an FGF19-Myc expression vector in combination with either Diet1-1721H-V5, or Diet1-1721Q-
V5, or an irrelevant control protein (Kdm5c-V5). Cellular Diet1 protein levels and secreted
FGF19 levels were visualized by Western blot. MW, molecular weight in kD.
B) Quantification of FGF19 secretion from experiment in (A). Amount of FGF19 secreted, per unit of V5 expression for control protein (Kdm5c), Diet1-1721H, or Diet1-1721Q. Bars represent mean + SD; * p < 0.05, ** p < 0.01.
C) Linear regression analysis of Diet1-1721H and Diet1-1721Q protein levels versus FGF19 secretion for 9 independent experiments. Graph shows experimental data from 9 independent
FGF19 secretion assays. Each experiment was performed in triplicate or quadruplicate. The y-
79 intercepts for the Diet1-1721H and Diet1-1721Q proteins are significantly different (p = 5.33 x
10-8, one-way ANCOVA), indicating different efficiencies of FGF19 secretion promoted by the two isoforms.
D) Average of normalized FGF19 secretion for experiments shown in (C). Bars indicate mean +
SD for 9 experiments performed in triplicate or quadruplicate; * p < 0.05.
Figure 3. Diet1-1721H and –1721Q isoforms do not differentially affect Diet1-FGF19 interaction.
Co-immunoprecipitation of Diet1-1721H and FGF19 versus Diet1-1721Q and FGF19. Epitope- tagged expression vector for FGF19 was co-expressed in HEK293T cells with Diet1-1721H-V5 or Diet1-1721Q-V5. Bands corresponding to Diet1-1721H + FGF19 IP are on the left of the dashed line, and bands corresponding to Diet1-1721Q + FGF19 IP are on the right. Input lanes show similar levels of expression of each Diet1 isoform. Red boxes indicate IP of Diet1 (V5 IP); blue boxes indicate IP of FGF19 (Myc IP). Both Diet1 isoforms interact with FGF19 with similar efficiency. Representative blot from 8 experiments is shown.
Figure 4. Predicted iTASSER models of Diet1-1721H and -1721Q protein structures.
(A) Predicted model for amino acid positions 659 to 2156 of Diet1-1721H by iTASSER(ref).
Histidine at position 1721 is highlighted in green spacefill, and green “H”. Confidence score for model on a scale from -5 to 2: -0.54.
(B) Predicted model for amino acid positions 659 to 2156 of Diet1-1721Q protein by iTASSER
(ref). Glutamine at position 1721 is highlighted in red spacefill, and red “Q”. Confidence score for model on a scale from –5 to 2: -0.74.
80
81
82
83
84
85
86
87 Supplemental Table 1: Oligonucleotides used for PCR amplification and sequencing
Exon Oligonucleotide strand Genomic start coordinate Purpose 1-F gctagataaagaaccagcgta + 19337636 PCR, seq 1-R ttcaggctgtacggggaat - 19338096 PCR, seq 2-F gacttatgtcatttgttgcta + 19355546 PCR 2-R gaaagggaggtgggaaag - 19355861 PCR, seq 3 & 4-F1 tcacttggcgccttaaattca + 19376417 PCR 3 & 4-R1 gtcctgggaaatccctcagt - 19377219 PCR 3&4-F2 gtaccctgtctcttctttctg + 19376744 seq 3&4-R2 acctgaaatctctgtgaactc - 19377096 seq 5-F tgcttcctattgcaggctct + 19392812 PCR, seq 5-R ttgcactgaaatctttaaacaca - 19393037 PCR, seq 6-F cttgagtctttccagttgcac + 19412363 PCR, seq 6-R cacagcctcccaaaaacac - 19412643 PCR, seq 7-F gttaagcagccactctagca + 19413396 PCR, seq 7-R ccaaggcctcctatgtaatg - 19413669 PCR, seq 8-F gtcagacagaaagaagctaatg + 19417091 PCR, seq 8-R tcgaaacacaagttgccaaga - 19417371 PCR, seq 9-F gtaaatgtgaagattagaatacgg + 19422728 PCR, seq 9-R ctttagcagtgcatggtcaattt - 19422939 PCR, seq 10-F gccttggttgctttaaacact + 19425385 PCR, seq 10-R gacttacctttgccttgatag - 19425787 PCR, seq 11-F gcaggcctcctaagatgatt + 19435034 PCR, seq 11-R tcattccacaacatgcaagaa - 19435311 PCR, seq 12-F gattgtggagcaaagaacagc + 19443932 PCR, seq 12-R caagctcagcgatttacaacc - 19444139 PCR, seq 13-F ccagagacaggtcaatggaa + 19454514 PCR, seq 13-R cctgaaaaggtatgagctatg - 19454819 PCR, seq 14-F gattggagaatgggacagatg + 19464026 PCR, seq 14-R cacaccctgtattaggtattcg - 19464342 PCR, seq 14 F2 Gtgatgtgtttttaacagtt + 19464097 seq 15&16-F1 gctctgccttttcaaagtgtg + 19492589 PCR 15&16-R1 ctgcaaacacttcaccacca - 19493387 PCR 15&16-F2 gagcagtttggagagccaac + 19492611 seq 15&16-R2 cagaaccgtactagctttcc - 19492876 seq 15&16-F3 cagtgtagggttaagagacag + 19493154 seq 15&16-R3 accaccagggtgaactg - 19493372 seq 17-F gggaaagaaaagcgtcttatg + 19493702 PCR, seq 17-R tatcggtttgattggcaagac - 19494264 PCR, seq 18-F gtggttgcatgtatttttgtcc + 19498138 PCR, seq 18-R ttgatcaaattccacttgctttt - 19498693 PCR, seq 19-F cctcttcatccattccataac + 19546532 PCR, seq 19-R ttgatttccttgcaagttttcc - 19546749 PCR, seq 88 20-F gcagtagaaaaccagaaaacc + 19568920 PCR, seq 20-R gatgctaggctgtgctactt - 19569217 PCR, seq 21-F aagattgtacagatagaaactgc + 19571884 PCR, seq 21-R ggcagaaatttgggagatgct - 19572158 PCR, seq 22-F cgtgcccggcctcttattc + 19612829 PCR, seq 22-R gcactgtgaacttttagagagaa - 19613066 PCR, seq 23-F ctaggggcacaatgctgtag + 19616313 PCR, seq 23-R ggggcaagaagactgtgagt - 19616675 PCR, seq 23-F2 cactggaagaattctacatg + 19616415 PCR, seq 23-R2 gcaagaagactgtgagtagag - 19616671 PCR, seq 24-F1 gcccaggttttgaacttcttg + 19620241 PCR, seq 24-R1 ccttaccttcccctggtgtt - 19620612 PCR, seq 24-F2 gtttaactgtaactggctt + 19620269 seq 25-F gcagttttgaattgcatgtttta + 19636626 PCR, seq 25-R cccccttcacatatccaaagt - 19637070 PCR, seq 26-F1 aagtgcagacagagcaagag + 19640787 PCR, seq 26-R1 tcacctttcaccatgcaaaaat - 19641256 PCR, seq 26-F2 Agaagagggcaatgtgatag + 19640847 PCR, seq 26-R2 cctttcaccatgcaaaaatacc - 19641253 PCR, seq 27-F gctttttgacctcactgaatg + 19676390 PCR, seq 27-R gctccccagttgctatcag - 19676764 PCR, seq 28-F1 ttggcagctcagatcatacg + 19678268 PCR, seq 28-R1 agccaagtcaactccctcag - 19678914 PCR, seq 28-F2 aatcccatcattgttatttcg + 19678330 PCR, seq 28-R2 tgcagcctgagtgacaga - 19678581 seq 29-F gcatcatcttcttttgtgtttg + 19739180 PCR, seq 29-R aaatggctagattaaaaatgtgc - 19739451 PCR, seq 30-F acaggaatcttcaagtctaatg + 19780379 PCR, seq 30-R tgaaggaaaatatctgctgaac - 19780606 PCR, seq 31-F gtagtagcaaatgtgatagaca + 19787356 PCR, seq 31-R ttcacacaaattgttaaagcaga - 19787624 PCR, seq 32-F cacattccgactcatgcgata + 19820061 PCR, seq 32-R ctgccccagaaagaaatgag - 19820402 PCR, seq 33-F gagctgttacatagccagag + 19856327 PCR, seq 33-R ggcgaagttcataggcagag - 19856785 PCR, seq 34-F1 ggagggaaactccctaatgc + 19884073 PCR, seq 34-R1 tcattttatctgtcgagctttc - 19884446 PCR, seq 34-F2 aatgtcccaacactggatgg + 19884055 PCR, seq 34-R2 ggacagatgccttgttttgc - 19884527 PCR, seq 35-F1 tgtgagaattcattgggacaaa + 19896637 PCR, seq 35-R1 gcaggttaagttgctggttc - 19896866 PCR, seq 35 F2 ttttttttttgcagccaac + 19896692 seq 36-F atcttcttcttcctcctaatac + 19904723 PCR, seq 36-R accacaaactgattgatgctc - 19904931 PCR, seq
89 37&38-F ccatgccagttgtgttcaaa + 19981140 PCR, seq 37&38-R ctgcccagaaaaataaatcca - 19981611 PCR, seq 39-F1 aatgtggttgccttggtgtc + 20019442 PCR, seq 39-R1 tcaagcaacactggttcagc - 20019781 PCR, seq 39-F2 atttttgatggccctgtgtg + 20019608 PCR, seq 39-R2 gtggttcagcctgtgtgtgt - 20019771 PCR, seq 40-F1 caagcagtgtgggctgtag + 20022921 PCR, seq 40-R1 atacggcaaagaaagagcattt - 20023488 PCR, seq 40-F2 gaacatcaggaagcctggaga + 20023123 PCR, seq 40-F3 gaagtctccacaatctgatag + 20023215 PCR, seq 40-R2 tctccaggcttcctgatgtt - 20023124 PCR, seq 40-R3 actggcatttacaatcctttct - 20023263 PCR, seq 40-R4 tgaagataaggtactgattctg - 20023345 PCR, seq
Table S1. Oligonucleotide sequences for PCR amplification and sequencing of DIET1
Oligonucleotide sequence, strand, genomic start position and purpose for each exon are listed by name.
90
Chapter 4
Genetic variants associated with human plasma bile acid levels
91 Preface
Very little is known about which genes influence plasma bile acid levels in humans. The study described in this chapter represents a preliminary characterization of the genetic variation in 38 candidate genes for bile acid metabolism as relates to high and low bile acid levels.
Despite wide-scale efforts to catalogue a variety of human clinical and disease phenotypes, plasma bile acids are not routinely typed. Studies performed to date have focused on a few well- characterized genes, and have largely failed to uncover significant genetic associations with human plasma bile acid levels. In collaboration with Dr. Carlos Aguliar-Salinas in Mexico City,
Mexico, 135 Mexican individuals were typed for total plasma bile acids. We chose 16 individuals with the lowest, and 16 with the highest bile acid levels for targeted resequencing. I selected the 38 genes involved in bile acid and lipid metabolism, including DIET1 and FGF19.
In collaboration with Dr. Paivi Pajukanta and Elina Mikkola, we prepared the samples for sequencing, mapped the reads to the reference genome, and called the variants. With much guidance from Dr. Rita Cantor, I performed a preliminary analysis of the sequence data, focusing on the rare coding variants.
92
Genetic variants associated with human plasma bile acid levels
Jessica M. Lee1, Elina Nikkola1, Rita Cantor1, Teresa Tusie-Luna2,3, Carlos A. Aguilar-Salinas4,
Paivi Pajukanta1, Karen Reue1,5
1Department of Human Genetics, David Geffen School of Medicine at UCLA
2Molecular Biology and Genomic Medicine Unit, Instituto Nacional de Ciencias Médicas y
Nutrición, Salvador Zubiran, Mexico City, Distrito federal, Mexico
3Department of Biologia Molecular y Medicina Genomica, Instituto de Investigaciones
4Department of Endocrinology and Metabolism, Instituto Nacional de Ciencias Médicas y
Nutrición, Salvador Zubiran, Mexico City, Distrito federal, Mexico
5Molecular Biology Institute, University of California, Los Angeles
93
ABSTRACT
Compared to the extensive data available regarding genetic determinants of plasma lipid levels in the human population, the genetic determinants of plasma bile acid levels are understudied. Previous studies of genetic variation underlying bile acid levels have focused largely on searches for rare mutations in bile acid metabolism disorders, or analysis of a handful of candidate genes in healthy individuals. To gain additional insight into the genetic determinants of plasma bile acid levels, we selected 32 individuals from the high and low tails of the bile acid level distribution in a Mexican cohort, and utilized next-generation sequencing technologies to resequence a panel of 38 genes involved in bile acid metabolism. The selected genes encode bile acid synthetic enzymes, hepatic and enterocytic bile acid transporters, relevant hormones and receptors, nuclear receptor transcription factors, and the recently identified regulator of enterohepatic communication, DIET1. In this pilot sample, we noted an enrichment of rare nonsynonymous variants in the individuals with low bile acid levels, and an unexpectedly high proportion of variants were present in DIET1. These data suggest novel candidate genes as determinants of human bile acid levels, which should be assessed in future studies in larger cohorts.
94 INTRODUCTION
Many genome-wide studies have been performed to identify genetic variations that control plasma lipid levels in humans (1, 2). Primary reasons for the strong focus on genetic loci controlling lipid levels includes the documented association of lipid levels with common diseases such as the metabolic syndrome and coronary artery disease, and the availability of plasma lipid data for large human cohorts, providing substantial statistical power.
In contrast to the abundance of genetic data on the genetic control of plasma lipid levels, the identification of genetic variations that determine bile acid levels, which play a critical role in lipid metabolism, has received little attention. Bile acids are catabolic products of cholesterol produced by the liver, and are secreted into the gallbladder along with cholesterol and phospholipids to produce bile (3-7). In response to feeding, bile is secreted into the duodenum to aid in the emulsification and absorption of lipids and lipid-soluble vitamins (3-7). About 95% of the bile acids secreted into the small intestine are reabsorbed by the ileum and sent back to the liver to be recycled; the remaining 5% of bile acids are excreted in the feces (3-7). During each digestive cycle, the liver synthesizes new bile acids to replenish the bile acid pool (3-7). The roundtrip journey of bile acids between the liver and intestine is referred to as enterohepatic circulation (3-6).
The level of bile acids in the circulation reflects the balance between bile acid synthesis in the liver, excretion in the feces, and reabsorption in the intestine and liver. However, despite the growing recognition of bile acids as important metabolic signals (3, 8), few studies have characterized plasma bile acid levels in humans or genetic factors that regulate them (9-14). For the most part, genetic studies of human bile acid metabolism have focused on disorders characterized by aberrations in bile acid metabolism such as gallstones and biliary cirrhosis (3).
95 Thus far, there has been limited assessment of genetic variation underlying inter-individual differences in bile acid levels in the human population. Plasma bile acids in the general population have not been typed in large enough cohorts to permit the genome-wide analyses that have been routinely applied to plasma lipid levels. A handful of studies have evaluated the association of bile acid levels in healthy individuals with genetic variation in specific candidate genes with roles in bile acid metabolism, including cholesterol 7α-hydroxylase (CYP7A1) and organic anion transporting polypeptde 1B1 (SLCO1B1 or OATP1B1) (11, 14). However, despite the crucial role of CYP7A1 in bile acid synthesis, and SLCO1B1 in the hepatic uptake of bile acids from the enterohepatic circulation, neither of these genes showed replicable associations with plasma bile acid levels (11, 14). This suggests that additional processes in bile acid metabolism may be regulators of variations in bile acid levels in the general population.
The application of next-generation DNA sequencing technology has opened the door to perform comprehensive sequence analysis of targeted regions or of entire genomes for large numbers of samples. We used targeted resequencing to assess genetic variation in a panel of 38 genes that were selected based upon their known or suspected roles in bile acid metabolism
(Table 1). Genes in this panel encode proteins known to have essential roles in hepatic bile acid synthesis, modification, and secretion, as well as bile acid uptake and recycling in the intestine
(Fig. 1). Among these are numerous genes that, to our knowledge, have not been previously assessed for genetic variation in relation to bile acid levels, as well as the newly identified gene
DIET1, which plays a role in the intestine-liver axis for regulation of bile acid synthesis. In our initial study, we resequenced the panel of genes in 16 individuals each from the upper and lower tails of bile acid levels in a cohort of 135 individuals from Mexico City, Mexico. The results from this initial screen identify genes that are good candidates for analysis in a larger cohort of
96 individuals, and suggest that pathways other than those that have been traditionally considered merit attention in future studies.
97 RESULTS
Study population
Subjects were recruited from Mexico City, Mexico by Dr. Carlos Aguilar-Salinas
(Instituto Nacional de Ciencias Medicas y Nutricion, Salvador Zubiran, Mexico City, Mexico).
Due to an interest in how bile acid levels relate to low-density lipoprotein cholesterol levels
(LDL-C), 134 individuals having LDL-C in the 10th and 90th percentiles were selected and typed for total plasma bile acids. The clinical characteristics of the study sample for age, weight, height, body mass index (BMI), total cholesterol (TC), high-density lipoprotein-cholesterol
(HDL-C), LDL-C, triglycerides (TG), glucose and bile acid levels are shown in Table 2. Total bile acid levels did not correlate with TC, HDL-C, or LDL-C levels. Bile acid levels positively correlated with fasting glucose levels, and showed trends towards correlation with BMI, weight and TG levels.
The average fasting plasma total bile acid levels in our study sample was 2.61 ± 3.0 µM
(Table 2), which is similar to the levels reported in the Finnish population (3.44 for males, 2.28 for females) (14). While Xiang et al. reported a sexual difference in fasting bile acid levels (14), bile acid levels in our cohort did not exhibit sexual dimorphism, possibly due to the disproportionate number of females in our study (Table 2). The distribution of bile acid levels among the 132 individuals is not normally distributed, exhibiting a long tail at the high bile acid level end of the distribution (Fig. 2). As an initial assessment of how genetic variation in bile acid metabolism genes relate to bile acid levels, we selected 16 individuals from each tail of the distribution for targeted sequencing (shaded areas in Fig. 2).
98 Bile acid metabolism gene panel
The genetic factors contributing to inter-individual variation in human plasma bile acid levels have not been systematically assessed. We set out to simultaneously determine the sequence of more than three dozen genes with known or suspected roles in bile acid metabolism by targeted sequencing of the entire gene (exons and introns) plus 10 kb of upstream and downstream sequence. We selected each gene based upon its role in bile acid metabolism, lipid metabolism, or evidence in the literature of a connection to either bile acids or related aspects of lipid metabolism (Table 1). Specific processes represented in our gene panel include bile acid synthesis and modification, bile acid uptake and efflux from enterocytes and hepatocytes, enterohepatic hormones and their receptors, and bile acid and lipid responsive nuclear hormone receptor transcription factors. Fig. 1 illustrates the general location and position in the enterohepatic cycle of the genes expressed in hepatocytes or enterocytes. A detailed rationale for gene selection, and a description of the role of each selected protein in bile acid metabolism, are provided in the Appendix.
Quality of sequencing
A targeted library was prepared for each of the 32 DNA samples. The sequencing run produced approximately 22 million reads, 5 million of which uniquely mapped to the reference genome (Table 2). The average depth of coverage was 200X, and a total of 11,191 variants were detected after filtering out variants with a quality control score of less than 40, and a handful of variants in which the major allele is mislabeled as the minor allele in dbSNP (Table 2). The genomic regions sequenced varied in size from 22.6 kB for SHP, to 705.7 kB for DIET1. To
99 account for differences in the size of each gene region, the number of variants per 10 kB of gene region was calculated and is presented in Fig. 3.
Enrichment of rare nonsynonymous variants in the low bile acid levels group and in DIET1
For our initial analysis of the sequencing data, we focused on the rare coding variants, of which we detected 57 across all genes (Fig. 4A). Rare variants were defined as variants not currently present in SNP databases, or with a minor allele frequency of less than 1% according to
1000 genomes (15). Based on studies of human variation, we expected the ratio of rare nonsynonynous (NS) alleles to rare synonymous alleles to be 1:2 (15). We asked whether rare
NS variants were distributed equally between the high and low bile acid level groups. We observed that the high bile acid group had the expected proportion of rare NS alleles (p = 0.346,
Exact Binomial Test), whereas the low bile acid group had a greater proportion of rare NS variants than expected (p = 0.000654, Exact Binomial Test). Despite the fact that we specifically chose individuals from the tails of the bile acid level distribution—and thereby increased our chances of detecting rare NS variants—the accumulation of rare variants specifically in the group with low bile acid levels was unexpected.
Of the 30 rare NS variants observed in our sample of individuals with both high and low bile acid levels, 8 of those reside in DIET1, suggesting that there is an enrichment of rare NS variants in DIET1. To further evaluate this possibility, we compared the number of rare NS variants in DIET1 to the number of rare NS variants expected based on the size of the DIET1 coding region. Indeed, the rare NS variants in DIET1 account for significantly more of the 30 total NS variants than can be explained by chance (p = 0.00650; Randomization Test with 10,000 replications).
100
Rare nonsynonymous variation across the bile acid metabolic gene panel
Figs. 4B and 4C graphically demonstrate the number of rare NS variants detected in each of the genes. Due to the enrichment of rare NS variants in DIET1, we classified DIET1 into its own group. Fig. 4B shows the number of rare NS variants that were detected in the individuals with low bile acid levels, and Fig. 4C shows the number of rare NS variants that were detected in the high bile acid level group. The dotted lines indicate the expected number of variants in each gene based upon the size of its coding sequence. Of the 8 rare NS variants observed in DIET1, 7 were observed the group of individuals with low bile acid levels (Fig. 4B, p = 0.033, Exact
Binomial Test). The number of rare variants in the ileal bile acid transporter, ASBT, showed a trend towards accumulating in the high bile acid group, but did not reach statistical significance
(Fig. 4C, p = 0.080, Exact Binomial Test). The number of rare variants detected in the other 36 genes did not significantly differ from expected in either the low or high bile acid level groups.
Our study is underpowered to detect rare NS variants in small genes, which have an expected occurrence of rare NS variants of less that 1 per gene (Fig. 4B and 4C). However, by grouping the genes together into functional categories, we can evaluate the contribution of each functional classification to high or low bile acid levels. Apart from the accumulation of rare variants in DIET1, two other gene groupings were notable for the lack of rare NS variants. The nuclear receptor group was significant for having zero rare NS variants in the individuals with high bile acid levels (Fig. 5, p = 0.022, Exact Binomial Test), as did the bile acid modifier group
(Fig. 5, p = 0.047). Neither group had more or fewer variants than expected in the individuals with low bile acid levels (Fig. 5), although the nuclear receptor group showed a trend towards having fewer rare NS variants than expected (Fig. 5, p = 0.059, Exact Binomial Test). These
101 results suggest that rare NS mutations in nuclear receptor transcription factors and bile acid modification genes occur with reduced frequency compared to the other functional categories of defined here.
Rare nonsynonymous variation in DIET1
Given the importance of Diet1 in the regulation of bile acid synthesis together with the preponderance of rare NS variants in DIET1, we chose to focus on DIET1 variants. Of the eight rare NS variants in DIET1, five of them are novel (i.e., not found in SNP databases), and 3 are known variants. Seven of the variants are amino acid substitutions, and one is a nonsense mutation. All of the eight rare NS variants in DIET1 occur in the one of the recurring LDLR A2
(Class A low density lipoprotein domain 2) or MAM (Meprin, A5, receptor protein tyrosine phosphatase mu) domains of DIET1: no variants were detected within the C- and N-terminal regions of the Diet1 protein, which do contain unique sequence (Fig. 6A). The variants are all present in the heterozygous state, although two individuals each have two rare DIET1 variants.
Given the striking accumulation of rare NS variants in DIET1 we tested whether an individual’s plasma bile acid levels show a correlation with the number of DIET1 rare NS variants. The bile acid levels for all 32 study subjects are plotted against the number of DIET1 rare variants the individual carries in Fig. 6B. We observed a suggestive correlation between the number of rare DIET1 variants and plasma bile acid levels (r = 0.267, p = 0.139), which may not have reached statistical significance due to the small sample size. Nonetheless, the results in this pilot cohort provide evidence to merit further investigation of DIET1 and its potential role in plasma bile acid levels in the Mexican population.
102 DISCUSSION
Despite the well-documented connections between lipids and bile acids, compared to the number of studies to characterize genetic determinants of plasma lipid levels, the data about genetic determinants of plasma bile acid levels in humans is limited. The purpose of this pilot study was to identify potential genetic determinants of plasma total bile acid levels in Mexicans.
We utilized targeted resequencing to assess genetic variation in a panel of 38 genes that encode proteins known to have important roles in bile acid synthesis and modification, bile secretion in the liver, as well as bile acid uptake and recycling in the intestine (Fig. 1). This bile acid metabolism panel also incorporates a number of genes that, to our knowledge, have not been previously assessed for genetic variation in relation to bile acid levels, including the newly identified gene DIET1, which plays a role in the intestine-liver axis for regulation of bile acid synthesis. We resequenced this panel of genes in 32 individuals chosen from the upper and lower tails of bile acid levels in a cohort of 135 individuals from Mexico City, Mexico.
Within the study population, total bile acids showed a weak correlation with plasma glucose levels, suggestive correlations with weight, BMI, and TG, and no correlation with sex,
TC, HDL-C, LDL-C levels. Although a correlation between plasma bile acid levels and glucose levels has been observed in other cohorts (16), our study did not replicate the reported correlations between bile acids and BMI (13), TG (12), or sex (14). Our study population size may not have enough power to detect associations between bile acid and these metabolic parameters, or there may be differences between the genetic background of the cohort analyzed here (Mexican) and those reported previously (12, 13, 14, 16 all performed in Western
Europeans). Further analysis of additional individuals from the Mexican population, currently underway, will shed light on this issue.
103 Targeted resequencing of the bile acid metabolism gene panel was performed on 32 individuals. For a preliminary analysis of the data, we focused on only the rare coding variants.
The decision to sequence a wider array of genes than just the strict bile acid synthesis and transporter genes, allowed for an interesting observation: we noticed that CYP7A1 and FXR— perhaps the most well-studied genes in the field of bile acid metabolism—did not exhibit any rare NS variants. Since our study is underpowered for detecting rare variants in such small genes, we categorized the genes into functional groups to ask if particular processes in bile acid metabolism may be strongly associated with bile acid levels. This analysis showed a striking lack of rare NS variants in the nuclear hormone receptor transcription factors and the bile acid modification enzymes.
At the outset of the study, we expected to observe more rare NS variants in both the high and low bile acid level groups, as compared to the general population (such as in the 1000
Genomes Project). Unexpectedly, analysis of the rare coding variants across all of the genes, showed an enrichment of rare NS variants in the group with low bile acid levels, while the high bile acid group had the expected number of rare NS variants. Given the small sample size, it is premature to draw broad conclusions from these data. It could be that our high bile acid level group did not include individuals with sufficiently high bile acid tail levels (i.e. 3 standard deviations above the mean) to detect such variants. Nevertheless, the accumulation of rare NS variants in the low bile acid group raises the possibility that low bile acid levels may be pathological. Furthermore, it is clear that DIET1 harbored more variation than any other gene, or group of genes and that most of these (7/8) were present exclusively in the low bile acid group.
We also observed a trend for a decrease in bile acid levels with increasing numbers of rare NS
DIET1 variants carried by an individual. It will be essential to characterize the NS DIET1
104 variants identified here for possible functional effects. Since Diet1 plays an important role in governing FGF19 secretion, the newly identified NS DIET1 variants can be assessed using our cell-based FGF19 secretion assay ((17); Chapter 3).
105 EXPERIMENTAL PROCEDURES
Study subjects
Subjects were recruited by Dr. Carlos A. Aguilar-Salinas from the patients visiting the
Dyslipidemia Clinic at the Department of Endocrinology and Metabolism, Instituto Nacional de
Ciencias Medicas y Nutricion, Salvador Zubiran, Mexico City, Mexico. The clinic sees patients referred for cardiovascular complications or severe dyslipidemias. They also conduct several ongoing population-based research studies from which control subjects are recruited. The eligibility of all subjects was determined by Dr. Aguliar-Salinas. All DNAs of this project are isolated in Dr. Teresa Tusié-Luna’s research laboratory in the Instituto Nacional de Ciencias
Medicas y Nutricion, in Mexico City. The studies were approved by The Human Biomedical
Research Institutional Committee of the INCMNSZ, and written informed consent was obtained from all subjects. All clinical investigation was conducted according to the principles expressed in the Declaration of Helsinki.
The following phenotypic information is collected and available from Mexican individuals:
Age, sex, height, weight, fasting triglycerides (TG), fasting total cholesterol (TC), fasting high density lipoprotein-cholesterol (HDL-C,) fasting low density lipoprotein-cholesterol )LDL-
C), fasting glucose, fasting total bile acids, medical history, including history of type 2 diabetes, coronary artery disease, hypertension, dyslipidemia, and current medication. BMI was calculated from subjects’ height and weight.
106 Biochemical measurements
Dr. Carlos Aguilar-Salinas’ laboratory at the Departmento de Endocrinologia y
Metabolismo of the Instituto Nacional de Ciencias Medicas y Nutricion, Salvador Zubiron, in
Mexico City, Mexco performed all lipid and clinical laboratory measurements of all subjects in the study using standardized procedures. The laboratory is certified for standardization of tests by the External Comparative Evaluation of Laboratories Program of the College of American
Pathologists. Blood samples were taken after an overnight fast (9-12 hours). Patients were carefully instructed about the importance of the required fasting. All measurements were performed with commercially available standardized methods. Glucose was measured using the glucose oxidation method; total serum TC and TGs were measured using an enzymatic method
(SERA-PAK); HDL-C levels were assessed using phosphotungstic acid and Mg2+; LDL-C concentrations were estimated by the Friedewald formula (18); total plasma bile acid levels were measured using an enzyme cycling based assay (Diazyme).
DNA sequencing
DNA libraries were prepared from each sample by shearing 3 µg of genomic DNA, generating fragments of 150 to 200 bp. Gene region boundaries were obtained via UCSC
Genome Browser query of 37 annotated genes, and a BLAT query of DIET1 cDNA sequence against the Genome Reference Consortium Build 37. If there were multiple transcript variants, the longest or most well characterized isoform was chosen. 10,000 bases of flaking sequence were added to each gene region, for a total of 2,932,106 bases. Libraries were amplified with 6
PCR cycles. The target regions were captured using a custom Agilent Technologies (Santa
Clara, CA) SureSelect Capture Library. Index tags for each sample were added post-
107 hybridization, allowing for combination of 16-sample pools. The sequencing run consisted of
100bp paired-end reads, on two lanes using the Illumina Hiseq2000. Samples with low and high bile acids were equally distributed between the two lanes.
SNP calling
Reads were aligned and variants called using the Genomic Analysis Toolkit (19, 20).
Candidate SNV sites were identified for each sample where a genotype, including the non- reference allele, was called with a minimum quality control score of 40, and minimum sequence depth of 40. Rare variants analysis included variants that occur in the coding region of the longest or best characterized transcript variant, are not present in the SNV databases, or have a minor allele frequency of less than 1% according to 1000 genomes (15). Expected number of rare NS variants per coding region was calculated as follows: 30 variants/67,485 bp or 1 variant per 2445 bp.
Statistical Analysis
Binomial Exact Tests were calculated in the NCSS & SPSS statistical package (2002).
The Randomization Test was calculated in Excel, as implemented in The Handbook of
Biological Statistics (http://udel.edu/~mcdonald/statintro.html). P-values from linear regression analysis were calculated by VasserStats Website for Statistical Computation
(http://vassarstats.net/index.html).
108 REFERENCES
1. Kathiresan, S., Willer, C.J., Peloso, G.M., Demissie, S., Musunuru, K., Schadt, E.E.,
Kaplan, L., Bennett, D., Li, Y., Tanaka, T., et al. 2009. Common variants at 30 loci
contribute to polygenic dyslipidemia. Nat Genet 41:56-65.
2. Teslovich, T.M., Musunuru, K., Smith, A.V., Edmondson, A.C., Stylianou, I.M., Koseki,
M., Pirruccello, J.P., Ripatti, S., Chasman, D.I., Willer, C.J., et al. 2010. Biological,
clinical and population relevance of 95 loci for blood lipids. Nature 466:707-713.
3. de Aguiar Vallim, T.Q., Tarling, E.J., and Edwards, P.A. 2013. Pleiotropic Roles of Bile
Acids in Metabolism. Cell Metab 17(5):657-69.
4. Hofmann, A.F., and Hagey, L.R. 2008. Bile acids: chemistry, pathochemistry, biology,
pathobiology, and therapeutics. Cell Mol Life Sci 65:2461-2483.
5. Russell, D.W. 2003. The enzymes, regulation, and genetics of bile acid synthesis. Annu
Rev Biochem 72:137-174.
6. Russell, D.W. 2009. Fifty years of advances in bile acid synthesis and metabolism. J
Lipid Res 50 Suppl:S120-125.
7. Russell, D.W., and Setchell, K.D. 1992. Bile acid biosynthesis. Biochemistry 31:4737-
4749.
8. Thomas, C., Pellicciari, R., Pruzanski, M., Auwerx, J., and Schoonjans, K. 2008.
Targeting bile-acid signalling for metabolic diseases. Nat Rev Drug Discov 7:678-693.
9. Everson, G.T. 1987. Steady-state kinetics of serum bile acids in healthy human subjects:
single and dual isotope techniques using stable isotopes and mass spectrometry. J Lipid
Res 28:238-252.
109 10. Galman, C., Angelin, B., and Rudling, M. 2005. Bile acid synthesis in humans has a rapid
diurnal variation that is asynchronous with cholesterol synthesis. Gastroenterology
129:1445-1453.
11. Xiang, X., Han, Y., Neuvonen, M., Pasanen, M.K., Kalliokoski, A., Backman, J.T.,
Laitila, J., Neuvonen, P.J., and Niemi, M. 2009. Effect of SLCO1B1 polymorphism on
the plasma concentrations of bile acids and bile acid synthesis marker in humans.
Pharmacogenet Genomics 19:447-457.
12. Galman, C., Angelin, B., and Rudling, M. 2011. Pronounced variation in bile acid
synthesis in humans is related to gender, hypertriglyceridaemia and circulating levels of
fibroblast growth factor 19. J Intern Med 270:580-588.
13. Steiner, C., Othman, A., Saely, C.H., Rein, P., Drexel, H., von Eckardstein, A., and
Rentsch, K.M. 2011. Bile acid metabolites in serum: intraindividual variation and
associations with coronary heart disease, metabolic syndrome and diabetes mellitus.
PLoS One 6:e25006.
14. Xiang, X., Backman, J.T., Neuvonen, P.J., and Niemi, M. 2012. Gender, but not CYP7A1
or SLCO1B1 polymorphism, affects the fasting plasma concentrations of bile acids in
human beings. Basic Clin Pharmacol Toxicol 110:245-252.
15. Abecasis, G.R., Auton, A., Brooks, L.D., DePristo, M.A., Durbin, R.M., Handsaker, R.E.,
Kang, H.M., Marth, G.T., and McVean, G.A. 2012. An integrated map of genetic
variation from 1,092 human genomes. Nature 491:56-65.
16. Valentini, L., Glaser, S., Schuetz, T., Omar, A., Kasim, E., Kroencke, T., Tietge, U.J.,
Lochs, H., Schulzke, J.D., Brabant, G., et al. 2012. Serum bile acids and leptin interact
with glucose metabolism in patients with liver cirrhosis. Clin Nutr 32:122-129.
110 17. Vergnes, L., Lee, J.M., Chin, R.G., Auwerx, J., and Reue, K. 2013. Diet1 functions in the
FGF15/19 enterohepatic signaling axis to modulate bile acid and lipid levels. Cell Metab
17(6):916-28.
18. Friedewald, W.T., Levy, R.I., and Fredrickson, D.S. 1972. Estimation of the
concentration of low-density lipoprotein cholesterol in plasma, without use of the
preparative ultracentrifuge. Clin Chem 18:499-502.
19. McKenna, A., Hanna, M., Banks, E., Sivachenko, A., Cibulskis, K., Kernytsky, A.,
Garimella, K., Altshuler, D., Gabriel, S., Daly, M., et al. 2010. The Genome Analysis
Toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data.
Genome Res 20:1297-1303.
20. DePristo, M.A., Banks, E., Poplin, R., Garimella, K.V., Maguire, J.R., Hartl, C.,
Philippakis, A.A., del Angel, G., Rivas, M.A., Hanna, M., et al. 2011. A framework for
variation discovery and genotyping using next-generation DNA sequencing data. Nat
Genet 43:491-498.
111 FIGURE LEGENDS
Figure 1. Schematic diagram of bile acid metabolism panel genes.
Schematic diagram showing enterohepatic circulation between a hepatocyte and an enterocyte.
Genes selected for the targeted resequencing bile acid metabolism panel are illustrated in their respective positions thoughout the enterohepatic cycle. Genes included for sequencing that are not expressed in hepatocytes or enterocytes are listed in the upper left corner of the figure. β- klotho is shown in the figure, but was not included in the sequencing panel.
Figure 2. Plasma bile acid level distribution of Mexican cohort.
The graph depicts the distribution of bile acid levels among the 135 Mexican individuals in our cohort. The range of plasma bile acid levels was 0.12 µΜ to 23.82 µΜ. Histogram bin size was determined based upon the inter-quartile range of the study population. Darker grey areas indicate the 32 individuals at the low and high bile acid tails that were selected for targeted resequencing.
Figure 3. Number of variants detected per 10 kB of genome region.
Each gene sequenced is labeled on the x-axis, color-coded by functional group. DIET1 is classified as a unique group. Bars represent the total number of variants detected per gene
(including 10 kB upstream and downstream sequence), scaled to size of the region. BA = bile acid.
112 Figure 4. Rare coding synonymous and nonsynonymous variants by gene
(A) The table lists the combined size of the coding regions for 38 genes, and the total number of rare NS and S variants detected.
(B) The number of rare NS variants detected in each gene in the low bile acid level group.
Dotted lines indicate the number of rare NS variants expected per gene based upon its coding region size. We observed significantly more rare NS variants in DIET1 than expected normalized to size (p = 0.0331, Exact Binomial Test).
(C) The number of rare NS variants detected in each gene in the high bile acid level group.
Dotted lines indicate the number of rare NS variants expected per gene based upon the size of its coding region. The number of variants observed in ASBT showed a trend towards having more rare NS variants than expected normalized to size (p = 0.080, Exact Binomial Test).
Figure 5. Rare nonsynonymous variants by gene categories
The number of rare NS variants detected in each category of genes, with DIET1 in an isolated group. Light grey bars represent the number of rare NS variants present in the low bile acid level group. Black bars show the number of rare NS variants present in the high bile acid level group.
Dotted lines indicate the number of expected rare NS variants based upon total coding region size of all the genes in a grouping. Besides the replication of DIET1 from Fig. 4B and 4C, the
Nuclear receptor (p = 0.0216, Exact Binomial Test) and bile acid modifier (p = 0.0466, Exact
Binomial Test) categories are statistically significant for less rare NS variants than expected in the high bile acid level group (nuclear receptor genes) or the low bile acid level group (bile acid modifier genes).
113 Figure 6. Rare nonsynonymous variants in DIET1
(A) Schematic drawing of the predicted protein structure of human Diet1. Black arrows above schematic indicate positions of the 8 rare NS DIET1 variants. Key for protein domains is shown beneath the diagram.
(B) Graph of the number of rare NS DIET1 variants versus total bile acid levels for the 32 sequenced samples. Pink lines indicate the mean bile acid levels for individuals with zero rare
NS DIET1 variants, 1 rare NS DIET1 variant, or 2 NS DIET1 variants, as indicated. The correlation is not statistically significant (r = 0.267, p = 0.139).
114
115
116
117
118
119
120
121
122
123 APPENDIX
Bile acid metabolism gene panel
Here, the detailed rationale for gene selection and a description of the role of each selected protein are listed according to their functional groups: bile acid synthetic genes, bile acid modifiers, bile acid transporters, enterohepatic hormones and receptors, bile acid and lipid responsive nuclear receptor transcription factors, and lipid transporters.
Bile acid synthetic genes
The first set of genes we selected for resequencing are genes that encode three of the enzymes that synthesize bile acids from cholesterol, CYP7A1, cytochrome P450 27A1
(CYP27A1), and cytochrome P450 8B1 (CYP8B1). Cyp7a1 catalyzes the first, rate-limiting step of the classic pathway of bile acid synthesis (1-3). Cyp27a1 participates in both the classic and alternative pathways for bile acid synthesis (4). Cyp8b1 catalyzes a reaction downstream from
Cyp7a1 (5, 6).
Bile acid modifiers
Next, we selected a set of enzymes that modify bile acids following their synthesis in the liver, or return from the intestine by the enterohepatic circulation. Bile salt sulfotransferase 2A1
(SULT2A1) catalyzes the sulfonation of bile acids and steroids in the liver, which makes these moelcules more hydrophilic and easily excreted (7). Cytochrome P450 3A4 (encoded by
CYP3A4) catalyzes the oxidation of a wide variety of molecules, including some bile acid species to render them more hydrophilic and easily excreted (8, 9). Very long chain acyl-CoA synthetase, VLCS (official gene symbol SLC27A2), is an enzyme that catalyzes the attachment
124 of acyl-CoA to cholic acid (10, 11). This step is necessary for the eventual conjugation of bile acids with glycine or taurine. Bile acyl-CoA synthetase, BACS (official gene symbol SLC27A5) is an isozyme of VLCS, but its substrate is chenodeoxycholic acid (10). Bile acid-CoA: amino acid N-acyltransferase (BAAT) catalyzes an enzymatic step downstream of VLCS and BACS.
BAAT transfers bile acids from the CoA thioester to glycine or taurine (12, 13). Acyl-CoA thioesterase 8, PTE-2 (official gene symbol ACOT8) catalyzes the hydrolysis of acyl-CoAs, and competes with BAAT for bile acid CoA conjugates (14). Acyl-CoA thioesterase 1, ACOT1 (also known as CTE-1) catalyzes the hydrolysis of specifically of long-chain acyl-CoA (15). While this gene has not been implicated directly in bile acid metabolism, it is important for the metabolism of triglycerides, and is involved in the differentiation of brown adipocytes and energy homeostasis (15, 16); bile acids have been associated with triglycerides, and can signal to brown adipose tissue and influence energy homeostasis (17, 18).
Bile acid transporters
Bile acid transport proteins actively reabsorb the bile salts that have been used to aid in digestion from the intestinal lumen or portal blood. The intestinal bile acid transporters we chose to sequence are: apical bile salt transporter, ASBT (official gene symbol SLC10A2), the fatty acid binding protein 6 (FABP6, more commonly known as ileal bile acid binding protein,
IBABP), and organic solute transporters alpha and beta (OSTA and OSTB). ASBT actively transports bile salt from the lumen into the enterocyte(19, 20), IBABP is thought to be an intracellular bile salt shuttle (21, 22), and OSTα/β is a heterodimeric transporter that actively pumps bile salts out of the enterocyte and into the capillaries that feed into the portal vein (23,
24). The liver bile acid transporters we chose to target are: Na(+)/taurocholate cotransporting
125 polypeptide, NTCP (official gene symbol SLC10A1) and bile salt export pump, BSEP (official gene symbol ABCB11). NTCP functions on the basolateral membrane of hepatocytes to actively transport bile salts coming from the intestine via the enterohepatic circulation (25), while BSEP functions on the apical membrane to export bile acids from the cell into the network of bile canaliculi that feed into the gallbladder (26, 27).
Hormones, receptors and hormone modifiers
There are some metabolic hormones known to be responsive to bile acid levels, and we chose a few of them for sequencing. Fibroblast growth factor 19 (FGF19) is the signal that is produced in the ileum during the reabsorption of bile acids and travels from the intestine to the liver to down-regulate hepatic bile acid synthesis (28). A related hormone from the same family,
FGF21 (29, 30) was also chosen for sequencing based upon unpublished data from our studies with the Diet1-deficient mouse model, suggesting that FGF21 can respond to elevated bile acid levels. Another intestinal hormone, glucagon-like peptide-1, GLP-1 is a peptide hormone produced by the cleavage of glucagon (GCG) in the intestinal enteroendocrine cells, which stimulates the secretion of insulin, and is also known be responsive to elevated bile acid levels
(31-34).
The receptors that respond to FGF19 are fibroblast growth receptor 4 (FGFR4, (9)) and
β klotho (KLB, (35)), although we only chose FGFR4 for sequencing. In addition to the cell- surface receptor FGFR4, we also decided to sequence the bile acid cell-surface receptor g protein-coupled bile acid receptor 1, TGR5 (official gene symbol GPBAR1). As its name indicates, the ligands for TGR5 are bile acids (36), and one of its downstream targets is GLP-1
(32-34).
126 The last couple of genes chosen for resequencing in this group interact with the bile acid responsive hormone FGF19 and the gastric hormone ghrelin. Our laboratory has demonstrated in Vergnes et al. that Diet1 pomotes the secretion of FGF19 (37), which makes DIET1 a potential determinant of bile acid levels in humans. The final gene, membrane bound O-acyltransferase,
GOAT (official symbol MBOAT4) is expressed in the enteroendocrine cells and modifies the hormone ghrelin by covalently linking it to a medium-chain fatty acid (38, 39). A GOAT knockout mouse model was recently reported to have increased plasma bile acid levels, possibly due to aberrant expression of ASBT in the duodenum (40). While the mechanism by which ghrelin and GOAT promote the proximal-distal intestinal division is unknown, genetic variation in GOAT may play a role in plasma bile acid levels.
Nuclear receptor transcription factors
The next set of genes we targeted for sequencing is nuclear receptor transcription factors with roles in bile acid metabolism and related processes. The farnesoid X receptor FXR (official gene symbol NR1H4) is a central transcription factor in bile acid metabolism (reviewed in (41)).
When activated by its ligands, bile acids, FXR upregulates transcription of many genes involved not only in bile acid metabolism (41), but in other metabolic pathways as well (42, 43). In addition to FXR, the pregnane X receptor PXR (official gene symbol NR1I2) (44), and constitutive androstane receptor (official gene symbol NR1I3) (45) can also be activated by bile acids, and play important roles in the response to non-animal sterols (44, 45). The liver receptor homolog-1 (LRH1, encoded by NR5A2) is necessary for optimal expression of the bile acid synthetic gene CYP7A1 (46-48). When FXR is activated in the liver, it induces the transcription of transcriptional repressor small heterodimer partner (SHP, encoded by NR0B2) (46-48). SHP
127 then disrupts LRH1-mediated transcription of CYP7A1, thereby down-regulating bile acid synthesis (46-48). FXR is also expressed in the enterocyte and when active, induces the expression of FGF19 (28, 49). The vitamin D receptor (VDR), PXR, and the retinoic acid receptors α or β (RARA and RARB) can also activate transcription of FGF15/19 (50-52). Most of these transcription factors, with the exception of LRH-1 function as heterodimers with retinoid acid receptors α or β (RXRA or RXRB). As these genes represent major metabolic control points, we expect that any rare deleterious mutations would have serious consequences, whereas subtle variation in the regulation of these genes might contribute to variations in bile acid levels in the Mexican study sample.
Lipid transporters
The final set of genes we selected for resequencing are several lipid transporters that may influence bile acid metabolism. Both cholesterol and phospholipids are essential components of bile, and thus variations in the bile salt-to-lipid ratio in bile could influence the absorption of lipids in the intestine. Perturbations in the absorption of cholesterol by enterocytes or hepatocytes may also impact the rate of bile acid synthesis. To test the contribution of genetic variation in cholesterol and phospholipid transporters on bile acid levels, we sequenced the ATP- binding cassette transporters A1, G5, G8, and B4 (encoded by ABCA1, ABCG5, ABCG8, and
ABCB4, respectively) and Niemann-Pick C1-Like 1 (NPC1L1). ABCA1 and NPC1L1 are important for importing cholesterol into cells, including hepatocytes (53, 54); NPC1L1 is also important for the uptake of cholesterol in enterocytes (54-57). ABCG5 and G8 function together as a heterodimer to export sterols (55-57). They are expressed in the liver where they secrete free cholesterol into bile, as well as the intestine, where they export dietary plant sterols and
128 cholesterol from enterocytes into the intestinal lumen (56-58). ABCB4 functions in the liver to transport phospholipids from the hepatocyte into the bile canaliculi (59, 60).
129 REFERENCES FOR APPENDIX
1. Noshiro, M., Nishimoto, M., Morohashi, K., and Okuda, K. 1989. Molecular cloning of
cDNA for cholesterol 7 alpha-hydroxylase from rat liver microsomes. Nucleotide
sequence and expression. FEBS Lett 257:97-100.
2. Jelinek, D.F., Andersson, S., Slaughter, C.A., and Russell, D.W. 1990. Cloning and
regulation of cholesterol 7 alpha-hydroxylase, the rate-limiting enzyme in bile acid
biosynthesis. J Biol Chem 265:8190-8197.
3. Noshiro, M., and Okuda, K. 1990. Molecular cloning and sequence analysis of cDNA
encoding human cholesterol 7 alpha-hydroxylase. FEBS Lett 268:137-140.
4. Cali, J.J., and Russell, D.W. 1991. Characterization of human sterol 27-hydroxylase. A
mitochondrial cytochrome P-450 that catalyzes multiple oxidation reaction in bile acid
biosynthesis. J Biol Chem 266:7774-7778.
5. Eggertsen, G., Olin, M., Andersson, U., Ishida, H., Kubota, S., Hellman, U., Okuda, K.I.,
and Bjorkhem, I. 1996. Molecular cloning and expression of rabbit sterol 12alpha-
hydroxylase. J Biol Chem 271:32269-32275.
6. Gafvels, M., Olin, M., Chowdhary, B.P., Raudsepp, T., Andersson, U., Persson, B.,
Jansson, M., Bjorkhem, I., and Eggertsen, G. 1999. Structure and chromosomal
assignment of the sterol 12alpha-hydroxylase gene (CYP8B1) in human and mouse:
eukaryotic cytochrome P-450 gene devoid of introns. Genomics 56:184-196.
7. Radominska, A., Comer, K.A., Zimniak, P., Falany, J., Iscan, M., and Falany, C.N. 1990.
Human liver steroid sulphotransferase sulphates bile acids. Biochem J 272:597-604.
130 8. Furster, C., and Wikvall, K. 1999. Identification of CYP3A4 as the major enzyme
responsible for 25-hydroxylation of 5beta-cholestane-3alpha,7alpha,12alpha-triol in
human liver microsomes. Biochim Biophys Acta 1437:46-52.
9. Xie, M.H., Holcomb, I., Deuel, B., Dowd, P., Huang, A., Vagts, A., Foster, J., Liang, J.,
Brush, J., Gu, Q., et al. 1999. FGF-19, a novel fibroblast growth factor with unique
specificity for FGFR4. Cytokine 11:729-735.
10. Steinberg, S.J., Mihalik, S.J., Kim, D.G., Cuebas, D.A., and Watkins, P.A. 2000. The
human liver-specific homolog of very long-chain acyl-CoA synthetase is cholate:CoA
ligase. J Biol Chem 275:15605-15608.
11. Mihalik, S.J., Steinberg, S.J., Pei, Z., Park, J., Kim, D.G., Heinzer, A.K., Dacremont, G.,
Wanders, R.J., Cuebas, D.A., Smith, K.D., et al. 2002. Participation of two members of
the very long-chain acyl-CoA synthetase family in bile acid synthesis and recycling. J
Biol Chem 277:24771-24779.
12. Falany, C.N., Johnson, M.R., Barnes, S., and Diasio, R.B. 1994. Glycine and taurine
conjugation of bile acids by a single enzyme. Molecular cloning and expression of human
liver bile acid CoA:amino acid N-acyltransferase. J Biol Chem 269:19375-19379.
13. Falany, C.N., Fortinberry, H., Leiter, E.H., and Barnes, S. 1997. Cloning, expression, and
chromosomal localization of mouse liver bile acid CoA:amino acid N-acyltransferase. J
Lipid Res 38:1139-1148.
14. Hunt, M.C., Solaas, K., Kase, B.F., and Alexson, S.E. 2002. Characterization of an acyl-
coA thioesterase that functions as a major regulator of peroxisomal lipid metabolism. J
Biol Chem 277:1128-1138.
131 15. Durgan, D.J., Smith, J.K., Hotze, M.A., Egbejimi, O., Cuthbert, K.D., Zaha, V.G., Dyck,
J.R., Abel, E.D., and Young, M.E. 2006. Distinct transcriptional regulation of long-chain
acyl-CoA synthetase isoforms and cytosolic thioesterase 1 in the rodent heart by fatty
acids and insulin. Am J Physiol Heart Circ Physiol 290:H2480-2497.
16. Momose, A., Fujita, M., Ohtomo, T., Umemoto, N., Tanonaka, K., Toyoda, H.,
Morikawa, M., and Yamada, J. 2011. Regulated expression of acyl-CoA thioesterases in
the differentiation of cultured rat brown adipocytes. Biochem Biophys Res Commun
404:74-78.
17. Watanabe, M., Houten, S.M., Mataki, C., Christoffolete, M.A., Kim, B.W., Sato, H.,
Messaddeq, N., Harney, J.W., Ezaki, O., Kodama, T., et al. 2006. Bile acids induce
energy expenditure by promoting intracellular thyroid hormone activation. Nature
439:484-489.
18. Liaset, B., Hao, Q., Jorgensen, H., Hallenborg, P., Du, Z.Y., Ma, T., Marschall, H.U.,
Kruhoffer, M., Li, R., Li, Q., et al. 2011. Nutritional regulation of bile acid metabolism is
associated with improved pathological characteristics of the metabolic syndrome. J Biol
Chem 286:28382-28395.
19. Wong, M.H., Oelkers, P., Craddock, A.L., and Dawson, P.A. 1994. Expression cloning
and characterization of the hamster ileal sodium-dependent bile acid transporter. J Biol
Chem 269:1340-1347.
20. Shneider, B.L., Dawson, P.A., Christie, D.M., Hardikar, W., Wong, M.H., and Suchy,
F.J. 1995. Cloning and molecular characterization of the ontogeny of a rat ileal sodium-
dependent bile acid transporter. J Clin Invest 95:745-754.
132 21. Sacchettini, J.C., Hauft, S.M., Van Camp, S.L., Cistola, D.P., and Gordon, J.I. 1990.
Developmental and structural studies of an intracellular lipid binding protein expressed in
the ileal epithelium. J Biol Chem 265:19199-19207.
22. Oelkers, P., and Dawson, P.A. 1995. Cloning and chromosomal localization of the human
ileal lipid-binding protein. Biochim Biophys Acta 1257:199-202.
23. Ballatori, N., Christian, W.V., Lee, J.Y., Dawson, P.A., Soroka, C.J., Boyer, J.L.,
Madejczyk, M.S., and Li, N. 2005. OSTalpha-OSTbeta: a major basolateral bile acid and
steroid transporter in human intestinal, renal, and biliary epithelia. Hepatology 42:1270-
1279.
24. Dawson, P.A., Hubbert, M., Haywood, J., Craddock, A.L., Zerangue, N., Christian,
W.V., and Ballatori, N. 2005. The heteromeric organic solute transporter alpha-beta,
Ostalpha-Ostbeta, is an ileal basolateral bile acid transporter. J Biol Chem 280:6960-
6968.
25. Hagenbuch, B., Stieger, B., Foguet, M., Lubbert, H., and Meier, P.J. 1991. Functional
expression cloning and characterization of the hepatocyte Na+/bile acid cotransport
system. Proc Natl Acad Sci U S A 88:10629-10633.
26. Gerloff, T., Stieger, B., Hagenbuch, B., Madon, J., Landmann, L., Roth, J., Hofmann,
A.F., and Meier, P.J. 1998. The sister of P-glycoprotein represents the canalicular bile
salt export pump of mammalian liver. J Biol Chem 273:10046-10050.
27. Green, R.M., Hoda, F., and Ward, K.L. 2000. Molecular cloning and characterization of
the murine bile salt export pump. Gene 241:117-123.
28. Inagaki, T., Choi, M., Moschetta, A., Peng, L., Cummins, C.L., McDonald, J.G., Luo, G.,
Jones, S.A., Goodwin, B., Richardson, J.A., et al. 2005. Fibroblast growth factor 15
133 functions as an enterohepatic signal to regulate bile acid homeostasis. Cell Metab 2:217-
225.
29. Nishimura, T., Nakatake, Y., Konishi, M., and Itoh, N. 2000. Identification of a novel
FGF, FGF-21, preferentially expressed in the liver. Biochim Biophys Acta 1492:203-206.
30. Kharitonenkov, A., Shiyanova, T.L., Koester, A., Ford, A.M., Micanovic, R., Galbreath,
E.J., Sandusky, G.E., Hammond, L.J., Moyers, J.S., Owens, R.A., et al. 2005. FGF-21 as
a novel metabolic regulator. J Clin Invest 115:1627-1635.
31. Solcia, E., Fiocca, R., Capella, C., Usellini, L., Sessa, F., Rindi, G., Schwartz, T.W., and
Yanaihara, N. 1985. Glucagon- and PP-related peptides of intestinal L cells and
pancreatic/gastric A or PP cells. Possible interrelationships of peptides and cells during
evolution, fetal development and tumor growth. Peptides 6 Suppl 3:223-229.
32. Katsuma, S., Hirasawa, A., and Tsujimoto, G. 2005. Bile acids promote glucagon-like
peptide-1 secretion through TGR5 in a murine enteroendocrine cell line STC-1. Biochem
Biophys Res Commun 329:386-390.
33. Thomas, C., Gioiello, A., Noriega, L., Strehle, A., Oury, J., Rizzo, G., Macchiarulo, A.,
Yamamoto, H., Mataki, C., Pruzanski, M., et al. 2009. TGR5-mediated bile acid sensing
controls glucose homeostasis. Cell Metab 10:167-177.
34. Vallim, T.Q., and Edwards, P.A. 2009. Bile acids have the gall to function as hormones.
Cell Metab 10:162-164.
35. Lin, B.C., Wang, M., Blackmore, C., and Desnoyers, L.R. 2007. Liver-specific activities
of FGF19 require Klotho beta. J Biol Chem 282:27277-27284.
134 36. Kawamata, Y., Fujii, R., Hosoya, M., Harada, M., Yoshida, H., Miwa, M., Fukusumi, S.,
Habata, Y., Itoh, T., Shintani, Y., et al. 2003. A G protein-coupled receptor responsive to
bile acids. J Biol Chem 278:9435-9440.
37. Vergnes, L., Lee, J.M., Chin, R.G., Auwerx, J., and Reue, K. 2013. Diet1 functions in the
FGF15/19 enterohepatic signaling axis to modulate bile acid and lipid levels. Cell Metab
17(6):916-28.
38. Gutierrez, J.A., Solenberg, P.J., Perkins, D.R., Willency, J.A., Knierman, M.D., Jin, Z.,
Witcher, D.R., Luo, S., Onyia, J.E., and Hale, J.E. 2008. Ghrelin octanoylation mediated
by an orphan lipid transferase. Proc Natl Acad Sci U S A 105:6320-6325.
39. Yang, J., Brown, M.S., Liang, G., Grishin, N.V., and Goldstein, J.L. 2008. Identification
of the acyltransferase that octanoylates ghrelin, an appetite-stimulating peptide hormone.
Cell 132:387-396.
40. Kang, K., Schmahl, J., Lee, J.M., Garcia, K., Patil, K., Chen, A., Keene, M., Murphy, A.,
and Sleeman, M.W. 2012. Mouse ghrelin-O-acyltransferase (GOAT) plays a critical role
in bile acid reabsorption. Faseb J 26:259-271.
41. Edwards, P.A., Kast, H.R., and Anisfeld, A.M. 2002. BAREing it all: the adoption of
LXR and FXR and their roles in lipid homeostasis. J Lipid Res 43:2-12.
42. Thomas, C., Pellicciari, R., Pruzanski, M., Auwerx, J., and Schoonjans, K. 2008.
Targeting bile-acid signalling for metabolic diseases. Nat Rev Drug Discov 7:678-693.
43. de Aguiar Vallim, T.Q., Tarling, E.J., and Edwards, P.A. 2013. Pleiotropic Roles of Bile
Acids in Metabolism. Cell Metab 17(5):657-69.
44. Ihunnah, C.A., Jiang, M., and Xie, W. 2011. Nuclear receptor PXR, transcriptional
circuits and metabolic relevance. Biochim Biophys Acta 1812:956-963.
135 45. Saini, S.P., Sonoda, J., Xu, L., Toma, D., Uppal, H., Mu, Y., Ren, S., Moore, D.D.,
Evans, R.M., and Xie, W. 2004. A novel constitutive androstane receptor-mediated and
CYP3A-independent pathway of bile acid detoxification. Mol Pharmacol 65:292-300.
46. Goodwin, B., Jones, S.A., Price, R.R., Watson, M.A., McKee, D.D., Moore, L.B.,
Galardi, C., Wilson, J.G., Lewis, M.C., Roth, M.E., et al. 2000. A regulatory cascade of
the nuclear receptors FXR, SHP-1, and LRH-1 represses bile acid biosynthesis. Mol Cell
6:517-526.
47. Lu, T.T., Makishima, M., Repa, J.J., Schoonjans, K., Kerr, T.A., Auwerx, J., and
Mangelsdorf, D.J. 2000. Molecular basis for feedback regulation of bile acid synthesis by
nuclear receptors. Mol Cell 6:507-515.
48. Kerr, T.A., Saeki, S., Schneider, M., Schaefer, K., Berdy, S., Redder, T., Shan, B.,
Russell, D.W., and Schwarz, M. 2002. Loss of nuclear receptor SHP impairs but does not
eliminate negative feedback regulation of bile acid synthesis. Dev Cell 2:713-720.
49. Kim, I., Ahn, S.H., Inagaki, T., Choi, M., Ito, S., Guo, G.L., Kliewer, S.A., and Gonzalez,
F.J. 2007. Differential regulation of bile acid homeostasis by the farnesoid X receptor in
liver and intestine. J Lipid Res 48:2664-2672.
50. Wistuba, W., Gnewuch, C., Liebisch, G., Schmitz, G., and Langmann, T. 2007.
Lithocholic acid induction of the FGF19 promoter in intestinal cells is mediated by PXR.
World J Gastroenterol 13:4230-4235.
51. Chow, E.C., Maeng, H.J., Liu, S., Khan, A.A., Groothuis, G.M., and Pang, K.S. 2009.
1alpha,25-Dihydroxyvitamin D(3) triggered vitamin D receptor and farnesoid X receptor-
like effects in rat intestine and liver in vivo. Biopharm Drug Dispos 30:457-475.
136 52. Schmidt, D.R., Holmstrom, S.R., Fon Tacer, K., Bookout, A.L., Kliewer, S.A., and
Mangelsdorf, D.J. 2010. Regulation of bile acid synthesis by fat-soluble vitamins A and
D. J Biol Chem 285:14486-14494.
53. Brooks-Wilson, A., Marcil, M., Clee, S.M., Zhang, L.H., Roomp, K., van Dam, M., Yu,
L., Brewer, C., Collins, J.A., Molhuizen, H.O., et al. 1999. Mutations in ABC1 in Tangier
disease and familial high-density lipoprotein deficiency. Nat Genet 22:336-345.
54. Lawn, R.M., Wade, D.P., Garvin, M.R., Wang, X., Schwartz, K., Porter, J.G., Seilhamer,
J.J., Vaughan, A.M., and Oram, J.F. 1999. The Tangier disease gene product ABC1
controls the cellular apolipoprotein-mediated lipid removal pathway. J Clin Invest
104:R25-31.
55. Berge, K.E., Tian, H., Graf, G.A., Yu, L., Grishin, N.V., Schultz, J., Kwiterovich, P.,
Shan, B., Barnes, R., and Hobbs, H.H. 2000. Accumulation of dietary cholesterol in
sitosterolemia caused by mutations in adjacent ABC transporters. Science 290:1771-
1775.
56. Yu, L., Hammer, R.E., Li-Hawkins, J., Von Bergmann, K., Lutjohann, D., Cohen, J.C.,
and Hobbs, H.H. 2002. Disruption of Abcg5 and Abcg8 in mice reveals their crucial role
in biliary cholesterol secretion. Proc Natl Acad Sci U S A 99:16237-16242.
57. Yu, L., Li-Hawkins, J., Hammer, R.E., Berge, K.E., Horton, J.D., Cohen, J.C., and
Hobbs, H.H. 2002. Overexpression of ABCG5 and ABCG8 promotes biliary cholesterol
secretion and reduces fractional absorption of dietary cholesterol. J Clin Invest 110:671-
680.
58. Igel, M., Giesa, U., Lutjohann, D., and von Bergmann, K. 2003. Comparison of the
intestinal uptake of cholesterol, plant sterols, and stanols in mice. J Lipid Res 44:533-538.
137 59. Smit, J.J., Schinkel, A.H., Oude Elferink, R.P., Groen, A.K., Wagenaar, E., van Deemter,
L., Mol, C.A., Ottenhoff, R., van der Lugt, N.M., van Roon, M.A., et al. 1993.
Homozygous disruption of the murine mdr2 P-glycoprotein gene leads to a complete
absence of phospholipid from bile and to liver disease. Cell 75:451-462.
60. Jacquemin, E., De Vree, J.M., Cresteil, D., Sokal, E.M., Sturm, E., Dumont, M., Scheffer,
G.L., Paul, M., Burdelski, M., Bosma, P.J., et al. 2001. The wide spectrum of multidrug
resistance 3 deficiency: from neonatal cholestasis to cirrhosis of adulthood.
Gastroenterology 120:1448-1458.
138
Chapter 5
Conclusion
139 The studies presented in this dissertation describe the initial identification and functional characterization of the novel gene Diet1, and provide new insights into the regulation of bile acid metabolism and the communication between the intestine and liver. The studies also explore genetic variation in human DIET1 and identify a relationship between a common DIET1 polymorphism and cellular secretion of fibroblast growth factor 19 (FGF19), a hormone that is essential in signaling between intestine and liver to modulate bile acid synthesis.
The physiological and cellular role of Diet1
Chapter 2, Diet1 functions in the FGF15/19 enterohepatic signaling axis to modulate bile acid and lipid levels, is the initial report of the identification of the gene and characterization of the null mutation within the Diet1 locus that underlies resistance to hypercholesterolemia and atherosclerosis, and causes elevated bile acid levels in the
C57BL/6ByJ mouse.
The initial characterization of the Diet1 gene established that Diet1 expression is restricted to the small intestine and kidney cortex. The elevated bile acid levels in the
Diet1-deficient mouse are associated with elevated expression of the hepatic enzyme responsible for the rate-limiting step of bile acid synthesis, Cyp7a1. This presented a mystery: how does a gene that is not expressed in the liver influence hepatic bile acid synthesis? A salient clue about the function of Diet1 was the detection of reduced mRNA and protein levels for fibroblast growth factor 15 (FGF15) in the intestine of
Diet1-deficient mice. I demonstrated that the absence of Diet1 is the reason behind the reduced FGF15 mRNA levels in the B6By mice by introducing a Diet1 transgene into the
140 B6By background. Utilizing an in vitro cell-based system I developed, in which both
Diet1 and FGF19 are expressed in a human cell line under the control of heterologous promoters, I showed that Diet1 affects FGF19 production at the post-transcriptional level.
Despite its metabolic effects, little is known about the regulation, intracellular itinerary, or secretion of FGF15/19. Our data indicating that Diet1 is a determinant of
FGF15/19 secretion provides new insights into the FGF15/19 pathway. My immunofluorescent confocal microscopy studies demonstrated that Diet1 appears to inhabit vesicular-like structures that resemble endosomes. FGF15 localization in the cell overlapped with the Diet1-containing vesicles. However, those vesicular-like structures do not contain protein markers for early endosomes, late endosomes, or lysosomes. This suggests that Diet1 and FGF15/19 reside on a distinct type of vesicle. In agreement with the observation that Diet1 and FGF15/19 (at times) share the same cellular compartment,
I also detected Diet1 and FGF15/19 proteins in a complex by co-immunoprecipitation. A key goal for future studies will be to identify additional proteins that interact with Diet1 and FGF15/19 to better define their subcellular compartment, and to define the mechanism by which Diet1 promotes FGF15/19 secretion.
From the perspective of modulating Diet1 in vivo, it will be important to identify the factors that regulate Diet1 transcription and protein levels. Due to the fact that Diet1 was not previously annotated in the genome sequence, Diet1 probes are not currently available on commercial microarrays. Therefore there are no published data regarding
Diet1 expression in a variety of experimental conditions. In preliminary work that is not presented in this dissertation, I observed that DIET1 expression in the Caco2 human intestinal cell line is not enhanced when treated with agonists for the nuclear receptors
141 FXR, LXR, RXR, RAR or VDR. However, future work should be performed to evaluate the effects of these agonists in vivo on Diet1 expression in mouse intestine, as well as the effects of additional potential regulators such as specific species of bile acids and lipids.
An aspect of Diet1 function that we have not addressed is the role of Diet1 in the kidney cortex. The kidney and ileum express many of the same bile acid metabolic genes such as ASBT, FXR and OSTα/β (1, 2), but there is no expression of FGF15/19 in the kidney. This raises the intriguing possibility that Diet11 functions in an FGF15/19- independent role in the kidney.
Genetic variation in DIET1
The study described in Chapter 3, A common genetic variant in DIET1 influences fibroblast growth factor 19 (FGF19) secretion, set out to examine the possibility that rare variation in DIET1 could underlie some cases of type 2 bile acid diarrhea (BAD), a syndromic chronic diarrhea with no known cause. Dr. Julian Walters (Imperial College,
London, UK) previously demonstrated that patients with type 2 BAD had reduced circulating FGF19 levels, and elevated levels of the bile acid synthetic intermediate C4, as compared to controls (3, 4). The reduction in FGF19 levels and increased bile acid synthesis is reminiscent of the Diet1-deficient mouse model, and we hypothesized that rare, deleterious mutations in DIET1 may underlie some cases of type 2 BAD. I sequenced the coding region of DIET1 in 22 type 2 BAD cases and 22 controls from
DNA samples provided by Dr. Walters. I annotated 7 novel DIET1 genetic variants: 5 nonsynonymous variants, 1 synonymous variant, and 1 single-nucleotide deletion leading to a frame-shift and early termination mutation. However, the variants were all present in
142 the heterozygous state and do not explain type 2 BAD status. Although the rare DIET1 variants detected in this particular case/control cohort cannot explain case status, the hypothesis that DIET1 can underlie some cases of type 2 BAD remains valid. In the future, it will be valuable to sequence DIET1 in more individuals with type 2 BAD, and to investigate the genetic variation of DIET1 in other types of bile acid diarrhea disorders.
Our study of DIET1 genetic variation did uncover a relationship between case/control status and the genotype at SNP rs12256835, which specifies a histidine
(major allele) or a glutamine (minor allele) at Diet1 amino acid position 1721. The 1721- histidine and the 1721-glutamine versions of Diet1 differ in their ability to secrete FGF19 in a cell-based assay; the glutamine isoform leads to enhanced secretion of FGF19.
Given that this variant occurs at a frequency of 17% in the European population (1000
Genomes) (5), rs12256835 may be a significant genetic determinant of inter-individual variation in FGF19—and downstream bile acid levels. We are eager to test this hypothesis in a larger study sample in which bile acid levels and FGF19 levels have been determined. Large cohorts documenting these specific phenotypes are not currently available, but given the building evidence that bile acids involved in other aspects of metabolism ranging from glucose homeostasis to energy metabolism perhaps such cohorts will become available in the future.
Genetic determinants of plasma bile acid levels
Chapter 4, Genetic variants associated with human plasma bile acid levels, describes the experimental design and preliminary results from a study to identify genetic determinants of bile acid levels in a human population. In the effort to discover the genes
143 that contribute to common human diseases (including coronary artery disease, type 2 diabetes, obesity, and hypertension), tens of thousands of cases and controls have been genotyped and relevant phenotypes collated (6, 7). Despite this wealth of data and the well-established status of bile acids being a catabolic product of cholesterol, plasma bile acid levels are understudied. Few studies have attempted to identify genetic variations associated with bile acid levels, and have been limited to examining several common variants in two candidate genes, CYP7A1 and SLCO1B1 (8, 9). The purpose of our study is to begin to investigate a broader scope of bile acid metabolic genes for potential roles in determining variation in plasma bile acid levels in the population. As there are not yet studies with a large enough sample size to provide the statistical power necessary for an unbiased approach, we selected 38 candidate genes that we hypothesize might influence bile acid levels, using a synthesis of information from the literature, as well as our own findings regarding the DIET1 gene. The candidate genes were chosen to represent known pathways that are needed for the enterohepatic circulation of bile acids, as well as less well characterized players with some evidence for a connection to bile acids, even if the exact mechanism is unknown. The first step in our study was to perform targeted sequencing for the 38 genes on a subset of the study population, 16 individuals with the lowest and 16 with the highest bile acid levels in 135 people assessed.
For a preliminary analysis of the sequence data, we chose to focus on the rare coding variants. I showed that there is an accumulation of rare nonsynonymous variant alleles in the low bile acid group. Further examination of the rare nonsynonymous variants revealed that DIET1 harbors more variants than expected by chance, and that a significant number of the variants were present only in the low bile acid group. While
144 the correlation between the number of rare DIET1 variants in an individual and their bile acid levels was not statistically significant, our data hint that DIET1 may be an important determinant in total bile acid levels in Mexicans. These preliminary data are encouraging and warrant continued study in a larger study sample.
Bile acids as metabolic signaling molecules
Recent years have seen an increasing recognition that bile acids serve an important role as metabolic signaling molecules, as well as detergents essential for efficient digestion of lipids (10-12). The breakthrough finding for this realization was the discovery that bile acids are the endogenous ligands for the nuclear receptor transcription factor farnesoid X receptor (FXR) (10, 11, 13). FXR has wide-ranging effects on the transcription of genes involved in not only in bile acid metabolism, but also genes that regulate lipid and glucose metabolism (10, 11, 13). Bile acids also serve as ligands for the membrane bound G protein-coupled receptor, TGR5 (12, 14). TGR5 is expressed in numerous tissues including brown adipose tissue, epithelial cells in the bile duct, intestinal enteroendocrine cells, and immune cells indicating that bile acid signaling may occur in those tissues (10, 11). It has been shown that TGR5 activation in the intestinal enteroendocrine cells induces the production of the hormone glucagon-like peptide 1
(GLP-1), which binds to receptors in the liver and improves insulin sensitivity (12, 14).
There is also evidence that TGR5 expression in the brown adipose tissue is important for modulating energy expenditure (10, 11).
Through the action and tissue distribution of FXR and TGR5, bile acids can influence multiple metabolic pathways (Fig. 1). Through its effects on FGF15/19, Diet1
145 may potentially influence a wide range of metabolic processes beyond determining bile acid levels. Using our mouse models we can evaluate the effects of Diet1 levels on glucose metabolism as well as energy homeostasis. The cell culture-based assay we developed to assess Diet1 function in promoting the secretion of FGF19 can be utilized to characterize the functional consequences of genetic variants uncovered by resequencing
DIET1 in human cohorts. Future studies of DIET1 variation in large human studies will elucidate potential relationships between polymorphisms in DIET1, bile acid levels, and possibly other related traits such as plasma glucose and triglyceride levels.
Concluding thoughts
The common theme of the studies presented in this dissertation is the relationship between Diet1 and bile acid levels. Since the discovery of cholic acid in the 19th century
(10), much scientific effort has been expended to elucidate the composition, chemical, and physiological properties of bile. Numerous genes encoding proteins that are involved in the synthesis, modification, uptake and transport have been identified and characterized in the past few decades. The work presented in this dissertation contributes to the existing body of knowledge by identifying Diet1, a novel protein that functions in the recently described pathway for communication between the intestine and the liver to regulate bile acid synthesis. In particular, our work implicates Diet1 as a key determinant of FGF15/19 secretion from enterocytes, and as a potential determinant of interindividual variations in bile acid levels in humans. Given that bile acids are increasingly recognized as contributors to a much broader range of physiological processes beyond bile acid
146 metabolism, Diet1 may also contribute to a wider spectrum of metabolic pathways as well.
147
Figure 5.1 Potential pleiotropic influence of Diet1 on common diseases
Schematic diagram of some of the metabolic parameters and diseases that have been associated with bile acids. Diet1 influences FGF15/19, FGF15/19 regulates bile acid synthesis, and bile acids acting as metabolic signals, contribute to other areas of metabolism, and potentially to common diseases.
148 REFERENCES
1. Dawson, P.A., Lan, T., and Rao, A. 2009. Bile acid transporters. J Lipid Res
50:2340-2357.
2. Lee, H., Zhang, Y., Lee, F.Y., Nelson, S.F., Gonzalez, F.J., and Edwards, P.A.
2006. FXR regulates organic solute transporters alpha and beta in the adrenal
gland, kidney, and intestine. J Lipid Res 47:201-214.
3. Pattni, S.S., Brydon, W.G., Dew, T., and Walters, J.R. 2012. Fibroblast Growth
Factor 19 and 7alpha-Hydroxy-4-Cholesten-3-one in the Diagnosis of Patients
With Possible Bile Acid Diarrhea. Clin Transl Gastroenterol 3:e18.
4. Walters, J.R., Tasleem, A.M., Omer, O.S., Brydon, W.G., Dew, T., and le Roux,
C.W. 2009. A new mechanism for bile acid diarrhea: defective feedback
inhibition of bile acid biosynthesis. Clin Gastroenterol Hepatol 7:1189-1194.
5. Abecasis, G.R., Auton, A., Brooks, L.D., DePristo, M.A., Durbin, R.M.,
Handsaker, R.E., Kang, H.M., Marth, G.T., and McVean, G.A. 2012. An
integrated map of genetic variation from 1,092 human genomes. Nature 491:56-
65.
6. Kathiresan, S., Willer, C.J., Peloso, G.M., Demissie, S., Musunuru, K., Schadt,
E.E., Kaplan, L., Bennett, D., Li, Y., Tanaka, T., et al. 2009. Common variants at
30 loci contribute to polygenic dyslipidemia. Nat Genet 41:56-65.
7. Teslovich, T.M., Musunuru, K., Smith, A.V., Edmondson, A.C., Stylianou, I.M.,
Koseki, M., Pirruccello, J.P., Ripatti, S., Chasman, D.I., Willer, C.J., et al. 2010.
Biological, clinical and population relevance of 95 loci for blood lipids. Nature
466:707-713.
149 8. Xiang, X., Backman, J.T., Neuvonen, P.J., and Niemi, M. 2012. Gender, but not
CYP7A1 or SLCO1B1 polymorphism, affects the fasting plasma concentrations
of bile acids in human beings. Basic Clin Pharmacol Toxicol 110:245-252.
9. Xiang, X., Han, Y., Neuvonen, M., Pasanen, M.K., Kalliokoski, A., Backman,
J.T., Laitila, J., Neuvonen, P.J., and Niemi, M. 2009. Effect of SLCO1B1
polymorphism on the plasma concentrations of bile acids and bile acid synthesis
marker in humans. Pharmacogenet Genomics 19:447-457.
10. de Aguiar Vallim, T.Q., Tarling, E.J., and Edwards, P.A. 2013. Pleiotropic Roles
of Bile Acids in Metabolism. Cell Metab 17(5):657-69.
11. Thomas, C., Pellicciari, R., Pruzanski, M., Auwerx, J., and Schoonjans, K. 2008.
Targeting bile-acid signalling for metabolic diseases. Nat Rev Drug Discov 7:678-
693.
12. Vallim, T.Q., and Edwards, P.A. 2009. Bile acids have the gall to function as
hormones. Cell Metab 10:162-164.
13. Edwards, P.A., Kast, H.R., and Anisfeld, A.M. 2002. BAREing it all: the adoption
of LXR and FXR and their roles in lipid homeostasis. J Lipid Res 43:2-12.
14. Thomas, C., Gioiello, A., Noriega, L., Strehle, A., Oury, J., Rizzo, G.,
Macchiarulo, A., Yamamoto, H., Mataki, C., Pruzanski, M., et al. 2009. TGR5-
mediated bile acid sensing controls glucose homeostasis. Cell Metab 10:167-177.
150