Overwintering and Early Season Amplification of Eastern Equine

University of South Florida Scholar Commons

Graduate Theses and Dissertations Graduate School

3-31-2014 Overwintering and Early Season Amplification of Eastern Equine Encephalitis Virus in the Southeastern United States Andrea Bingham University of South Florida, [email protected]

Follow this and additional works at: https://scholarcommons.usf.edu/etd Part of the Ecology and Evolutionary Biology Commons, and the Public Health Commons

Scholar Commons Citation Bingham, Andrea, "Overwintering and Early Season Amplification of Eastern Equine Encephalitis Virus in the Southeastern United States" (2014). Graduate Theses and Dissertations. https://scholarcommons.usf.edu/etd/4984

This Dissertation is brought to you for free and open access by the Graduate School at Scholar Commons. It has been accepted for inclusion in Graduate Theses and Dissertations by an authorized administrator of Scholar Commons. For more information, please contact [email protected].

Overwintering and Early Season Amplification of Eastern Equine Encephalitis Virus

in the Southeastern United States

Andrea M. Bingham

A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Global Health College of Public Health University of South Florida

Major Professor: Thomas Unnasch, Ph.D. Robert Novak, Ph.D. Azliyati Azizan, Ph.D. Henry Mushinsky, Ph.D.

Date of Approval: March 31, 2014

Keywords: Arbovirus, Winter Transmission, Ecology, Reservoir Hosts

DEDICATION

I would also like to thank my parents for their positive support and for always being there for when I needed reassurance. They helped me achieve everything that I currently have and have provided me with a foundation for everything to come. Without their encouragement, I would never have gotten this far. I would also like to thank everyone who has helped me get through the dissertation process emotionally, especially Collin, Kelley, Amanda, Jenn, and

Amruta. Thank you guys so much for all the distractions, support, and for putting up with all of my craziness. You are the best friends anyone could ask for. I would also like to thank my major professor and committee for all of the help they have given me throughout this entire process.

TABLE OF CONTENTS

LIST OF TABLES ...... iii

LIST OF FIGURES ...... iv

ABSTRACT ...... v

INTRODUCTION ...... 1 References ...... 10

CHAPTER ONE: Detection of Eastern Equine Encephalomyelitis Virus RNA in North American Snakes ...... 20 Note to Reader ...... 20 Abstract ...... 20 Introduction ...... 21 Materials and Methods ...... 22 Results ...... 25 Discussion ...... 27 Tables and Figures ...... 31 References ...... 35

CHAPTER TWO: Field Investigations of Winter Transmission of Eastern Equine Encephalitis virus in Florida ...... 39 Abstract ...... 39 Introduction ...... 39 Materials and Methods ...... 42 Study Sites ...... 42 Mosquito Collection...... 42 Detection of Virus in Mosquito Pools ...... 43 Blood Meal Analysis...... 44 Avian Surveys ...... 46 Data Analysis ...... 46 Results ...... 47 Mosquito Collections ...... 47 Blood Meal Analysis - Winter Months ...... 48 Host Utilization by Culex erraticus ...... 50 Host Utilization - Summer and Winter Comparison...... 51 Discussion ...... 52 Tables and Figures ...... 57 References ...... 65

CONCLUSION ...... 73 References ...... 77

APPENDIX ...... 80

LIST OF TABLES

Table 1.1 Proportion of Luminex-positive snakes that were positive by qRT-PCR for eastern equine encephalitis virus from Tuskegee National Forest, Alabama, USA ...... 31

Table 2.1 Proportion of blood meals taken from different host classes during the winter months ...... 57

Table 2.2 Blood meals from mammalian hosts during the winter months ...... 58

Table 2.3 Number of blood meals from avian hosts during the winter months ...... 59

Table 2.4 Average monthly water bird abundance and proportion of Cx. erraticus blood meals during the winter months ...... 60

iii

LIST OF FIGURES

Figure 1.1 Exposure to (Antibody +) and infection with (PCR +) eastern equine encephalomyelitis virus in cottonmouth snakes ( Agkistrodon piscivorus ) from Tuskegee National Forest, Alabama, USA. Data on seropositivity rates were taken from previously published sources ...... 32

Figure 1.2 Body size (snout-vent length) of male and female cottonmouth snakes (Agkistrodon piscivorus ) exposed to (A) and infected with (B) eastern equine encephalomyelitis virus from Tuskegee National Forest, Alabama, USA. Error bars show standard deviation ...... 33

Figure 1.3 Sex ratio of eastern equine encephalomyelitis virus (EEEV) quantitative reverse transcription polymerase chain reaction (qRT-PCR)-positive (A) and EEEV qRT-PCR-negative (B) cottonmouth snakes ( Agkistrodon piscivorus ) from Tuskegee National Forest, Alabama, USA...... 34

Figure 2.1 Total relative abundance of mosquitoes (n=12,260) collected from Lettuce Lake Park (panel A), John B. Sargeant Park (panel B), and Eureka Springs Park (panel C) in Hillsborough County, FL during two winter collection periods (2012-2013) ...... 61

Figure 2.2 Winter abundance of mosquitoes from 3 wetland parks in Hillsborough County, FL; January - March 2012 (panel A) and December, 2012 – March, 2013 (panel B). Asterisks indicate dates of EEEV-positive mosquito pools ...... 62

Figure 2.3 Forage ratios for water birds as hosts for Cx. erraticus from Lettuce Lake Park (panel A) and John B. Sargeant Park (panel B) during two winter collection periods (2012-2013). In each panel, the horizontal axis crosses at one, so that species with forage ratios above 1 are indicated as positively preferred and those less than 1 are negatively preferred. Asterisks indicate host species whose forage ratios were statistically different from 1.0 ...... 63

Figure 2.4 Distribution of hosts fed upon by Cx. erraticus collected from Lettuce Lake Park, summer 2011. Numbers over bars indicate total number of blood meals identified for each host class ...... 64

ABSTRACT

Eastern equine encephalitis virus (EEEV) is a highly pathogenic arbovirus that causes severe disease, with a mortality rate of approximately 30-35% in humans and 80-90% in horses.

Studies dating back to the 1930’s have identified many of the epidemiological and ecological aspects of the virus. However, there are several aspects of EEEV’s transmission cycle that remain unclear. In the northeastern states, transmission is seasonal, peaking in the late summer months, while in Florida there is year-round transmission of EEEV. Recent phylogenetic studies have also suggested that Florida may serve as a reservoir for EEEV; the virus may periodically be introduced from Florida to the northeastern US where it locally amplifies, overwinters, and can remain stable for several years. How EEEV is able to migrate from Florida and how it persists during the winter in North America is not yet known, however several theories exist and are examined further by this research. The first part of this study investigates the hypothesis that snakes may serve as overwintering reservoir hosts for EEEV. Rates of exposure and infection of wild snakes were examined by testing serum samples from wild snakes at a focus of EEEV in

Alabama. Two species of vipers, the cottonmouth and the copperhead, were found to be positive for EEEV RNA. The second part of the study attempts to identify the hosts and vectors of enzootic winter transmission of EEEV in Florida, with a focus on avian host preference. EEEV was detected in two mosquito species, Culiseta melanura and Anopheles quadrimaculatus , and were both from the month of February. In addition, the results also suggest that EEEV vectors preferentially feed upon wading birds during the winter months.

INTRODUCTION

Eastern equine encephalitis virus (EEEV) is one of the most pathogenic arboviruses, with a high mortality rate of approximately 30-35% in humans and 80-90% in horses.1 EEEV is a member of the genus Alphavirus and family Togaviridae , and possesses a positive sense RNA genome of approximately 11.7 kb. 1 The disease was first described in horses in 1831 in

Massachusetts when 75 horses died of encephalitic symptoms; 2 however, the virus wasn’t isolated from horses until 1933 3 and the first human case wasn’t identified until 1938. 4

The distribution of EEEV ranges throughout North, Central, and South America as well as the Caribbean. 5 Although the virus is found throughout the Americas, both hemagglutination inhibition assays and phylogenetic studies have indicated that the North and South American isolates are separate antigenic variants. 6, 7 Isolates from North America have been shown to consist of one lineage (I), while South American isolates belong to one of three lineages (II, III, and IV).7, 8 The North American variant is also considered to be more pathogenic, and differs from the South American variant in terms of ecology, and mosquito and vertebrate hosts. 9 In the

United States, cases occur more frequently in the Atlantic and Gulf Coast states, with approximately six human cases and 200 horse cases per year. The first documented case in

Florida occurred in 1952. 10 Since then, Florida has had more human and horse cases than any other state, with an average of 1 to 2 human and 70 horse cases per year (FDOH unpublished data). Other states with increased human cases include Massachusetts, Georgia, and New Jersey, although each of these states has less than half the cases of Florida. Florida is also unique in that

EEEV transmission occurs year-round.10 In the northeastern states, transmission is seasonal, peaking in the late summer months. 1

EEEV can cause either a systemic or encephalitic infection. Symptoms of the systemic illness include chills, fever, malaise, arthralgia, and myalgia. 11, 12 Symptoms usually resolve when there is no central nervous system (CNS) involvement. When there is CNS involvement, the same symptoms manifest as well as the encephalitic ones: headache, restlessness, drowsiness, anorexia, vomiting, diarrhea, cyanosis, convulsions, and coma. 11, 12 In infants, the onset of encephalitis is abrupt, while in children and adults it manifests after several days of systemic infection. 11 Death usually occurs within 2-10 days for 30-50% of infected individuals.

Approximately two thirds of the individuals who recover from infection suffer from chronic neurological sequelae 1, 13 and many of those who survive the initial infection may die within a few years. 14 The highest rates of mortality occur in children and the elderly 11, 12, 13, 15 , with age playing a role in the development of more severe sequelae. 13

A similar sequence of infection has also been seen in animals. Mouse models have indicated that there is a self-limiting replication phase in peripheral tissue followed by a fatal

CNS phase. 16 This spread to the CNS has been shown to occur as early as 24-48 hours after infection. 16, 17 However, the incubation period in horses and humans is often considered to be 3-

10 days. After initial replication in the skeletal muscle of the bite site, the virus can spread to other skeletal muscles and lymphatic tissues. Mouse models have indicated that osteoblasts are readily infected and are involved with early virus amplification. 16 The replication within osteoblasts is especially important since they are specialized fibroblasts responsible for bone formation and infection of these cells results in a higher titer of viremia. These cells are more prominent in the young and their numbers decrease with age, which may explain why there is a

2 higher incidence of neuroinvasion, encephalitis, and death in the young and why older animals may be refractory to encephalitis after being infected. 16 The target cells for EEEV replication are those of the nervous system, mainly neurons, and damage to these cells is severe and potentially irreversible. EEEV has been shown to be directly cytopathic for neurons. 16 The outcome of infection is determined by whether the neurons survive infection and survival is determined by the virulence of the virus and the age of the host at the time of infection. 18 This is because immature, developing neurons are more supportive of viral replication 16 and mature neurons may resist virus induced apoptosis (cell death) by expressing cellular inhibitors of apoptosis. 19 The mechanism by which EEEV enters the CNS is not entirely clear; however, once the virus is able to enter the CNS, it can spread from cell to cell or through the cerebral spinal fluid. 20

Although there are few human cases ever year, EEEV has a strong social and economical impact. Mild infections with EEEV have been shown to cost over $21,000 per case, while children who suffer from severe sequelae can incur lifetime costs upwards of $3 million. 21 The economic impact of these epidemics to the equine industry are also severe, with costs associated with treatment of EEEV totaling over $1 million per year. 22 There is no effective treatment for

EEEV infections and all therapies are considered to be supportive. There is a vaccine for horses; however, annual boosters are needed in order to maintain neutralizing antibodies 23 and horses residing in highly endemic areas require multiple boosters every year. 24 These vaccines are usually available as multivalent vaccines, in combination with other viruses affecting horses or tetanus toxoid. 24

EEEV has been shown to infect horses, humans, birds and other animals 1, 25 and is maintained in an enzootic cycle between ornithophilic mosquitoes and avian reservoir hosts.1, 26

Passerine birds are considered to be the major reservoir hosts for EEEV in North America, with

3 enzootic transmission between avian hosts mediated by ornithophilic Culiseta melanura mosquitoes, particularly in freshwater swamp foci. 1, 26, 27 The virus was first isolated from birds and from Culiseta melanura mosquitoes in 1951. 28, 29 Other mosquito species including Aedes vexans , Aedes sollicitans , and Coquillettidia perturbans , which feed upon mammals and birds, have been implicated in transmitting EEEV from birds to horses and humans 30, 31, 32 Shifts in feeding patterns of bridge vectors from feeding on avian to mammalian hosts during the transmission season may help to facilitate transmission to horses and humans. 33, 34, 35 Mosquito feeding preference has been shown to vary temporally, 36 and may be due to mosquito abundance, 37 host availability or behavior, host reproductive phenology, 34 and winter severity. 35

Many of the mosquitoes that can transmit EEEV also have crepuscular or nocturnal activity, 38, 39 and their feeding preferences may reflect the available hosts during this time period.

The ability of a mosquito to serve as a disease vector depends on a variety of factors. One of the important factors is that the mosquito species known or suspected to transmit EEEV are feeding on potentially infected hosts. The catholic feeding preference of many of the bridge vectors allows for many animals to potentially be exposed to the virus. However, many of these animals may be dead end hosts and not have enough circulating viremia to infect mosquitoes.

Several serosurveys have been conducted in order to identify which species are frequently exposed to EEEV in nature. EEEV has been shown to infect horses, humans, birds and other animals.25 Many species of birds have been identified as exposed to EEEV in nature, and more than 50 species of birds have been naturally or experimentally infected with EEEV. 25, 40, 41 Non- native birds have also been shown to be quite vulnerable to EEEV. 42, 43, 44 Conversely, many mammals have also been exposed to EEEV in the past;45, 46, 47, 48, 49, 50 however, few isolates of virus have come from these mammals and many are considered to be dead end hosts. In

4 particular, white tailed deer have been exposed to EEEV in the wild 45, 51 and several cases of clinical disease have also been reported. 47, 52 Interestingly, small mammals are considered to be the reservoir hosts for the South American variant of eastern equine encephalitis virus with Culex

(Melanoconion ) species serving as the primary vectors. 1, 53 The majority of human serosurveys have focused on the South American variant of EEEV, with seroprevalence ranging from 3-

66%.54, 55, 56 Studies in enzootic locations in the northeast found a seroprevalence rate around

2%. 57, 58 In addition, antibodies to EEEV have also been found in several species of reptiles and amphibians. 59, 60, 61

Another important factor in the transmission of EEEV is how efficient the mosquito is at spreading the virus. Vector competency refers to the genetic factors of the mosquito that affect how competent the mosquito is as a vector. 62, 63 Upon feeding on an infected host, the virus travels to the mosquito’s midgut, replicates and exits to the hemocoel, where the virus can then disseminate to infect secondary organs. 62 The virus will again replicate in the salivary glands and can be transmitted to another host during the next blood meal. Each step represents a potential barrier to infection within the mosquito. Vectorial capacity takes vector competency into account as well as the behavioral and environmental characteristics of the mosquito in determining its importance as a vector. 62, 64 One important intrinsic factor is how long it takes the pathogen to disseminate to the salivary glands, known as the extrinsic incubation period. 65 Cs. melanura is considered to be highly competent for EEEV, with virus disseminating to the salivary glands in as little as 2-3 days. 66, 67 Other species of mosquitoes require a 1-2 week incubation period before being able to transmit the virus. 68, 69, 70 There are several species of mosquitoes that are known or suspected bridge vectors of EEEV. 68

Most studies of EEEV have concentrated upon foci in the northern parts of the US. In the northeastern states, transmission is seasonal, peaking in the late summer months. 1 Cs. melanura is also highly prevalent in enzootic sites in the northeast. 71, 72, 73 This differs from the southeast, where several studies have found virus circulating during patterns of high Culex erraticus and low Cs. melanura populations. 74 In addition, it has been hypothesized that locations that have undergone drastic habitat changes, such as deforestation, lead to the gradual replacement of Cs. melanura by Cx. erraticus .75 Many of the bridge vectors may also differ between the two regions. In addition, domestic chickens are used in the southeast as avian sentinels but were not found to be useful for detecting EEEV activity in the northeast. 76 Chickens are chosen as sentinels because they are susceptible to infection and are capable of developing detectable levels of antibodies, the infection is not life-threatening, and significant viremia does not develop. Thus they are non-infectious to handlers, mosquitoes, and other chickens. 77, 78 In

Florida, the chicken sentinel program has been in place since 1978, 79 however, only 14 counties have maintained sentinel flocks from 1978 to the present and active surveillance is non-existent in most Florida counties. 80 In addition, not all of the counties that are involved with the chicken sentinel program leave their chickens out year-round, so sentinel transmission rates may be under exaggerated.

Recent phylogenetic studies have also suggested that Florida may serve as a reservoir for

EEEV; the virus may periodically be introduced from Florida to the northeastern US, where it locally amplifies, overwinters, and can remain stable for several years. 81, 82, 83 It is possible that a combination of local overwintering and re-introductions from southern foci allow the virus to initiate the transmission cycle every year in the northeast. In many locations, early spring transmission of virus is seen among birds before the peak transmission season occurs. 27, 84 How

6 the virus is able to overwinter and re-enter the avian population remains undetermined. One possibility is that the virus is re-introduced by migrating birds from locations such as Latin

America or South America. This is unlikely due to the antigenic and pathogenic differences found between the North American and South American variants. 85 In addition, few virus isolates from migrating birds from these locations have been found. 86 A second possibility is the recrudescence hypothesis, where the virus is able to reside in birds during the winter months in a latent form and transforms each spring into a replicating form in response to stressors such as migration or hormonal changes in the bird. 26, 27 This was recently tested in gray catbirds and also shown not to be the case. 87 Another hypothesis that has been examined is whether or not the virus is overwintering in the mosquito. Studies conducted in the southeastern US, however, have been unable to identify any virus in collections of overwintering adult mosquitoes. 88 Those species in the northeast that overwinter as adults have also been tested for virus and found to be negative. 89 In the northeast, many of the vector species of EEEV overwinter in the egg or larval stage. 90 Cs. melanura overwinters in the larval stage in the northeast; however, there is no evidence of vertical transmission of EEEV in this species or others. 91, 92, 93, 94

There remain two other alternative hypotheses that should be investigated further. One is that perhaps there is another reservoir host involved with the overwintering and early season amplification of EEEV. Studies in the 1950’s and 1960’s focused on the potential of ectotherms to serve as potential overwintering hosts for the virus, a hypothesis that has recently been re- investigated. Studies conducted in Alabama indicated that several mosquito species known to feed on ectothermic hosts had pools that were positive for EEEV viral RNA. 74, 95, 96 The majority of Culex peccator and Uranotaenia sapphirina blood meals came from snakes and frogs. Snakes have also been shown to be exposed to EEEV in the wild. 48, 59, 60, 61 Past studies have indicated

7 that several snake species are susceptible to infection with long lasting, high titers of viremia that is temperature dependent. 13, 97, 98, 99 One study found that viremia lasted from 3-105 days depending on temperature and that post-hibernation, snakes were still viremic for a few months. 98 Most of the research looking at arboviruses and reptiles has focused on another alphavirus, western equine encephalitis virus (WEEV). WEEV is genetically related to EEEV and is thought to have been the result of a recombination event between EEEV-like and Sindbis- like viruses. 100, 101 Previous studies have shown garter snakes to be competent hosts for WEEV, with long lasting levels of high viremia. 102, 103, 104, 105 These studies demonstrated the ability of

Culex tarsalis to transmit WEEV to naïve snakes 104 as well as the vertical transmission of the virus from infected mothers to offspring.102 WEEV viremia has been shown to last 70 days post hibernation in garter snakes when infected before hibernation.103 WEEV has also been isolated from snakes in the wild during a time of no mosquito activity. 102

Another possibility for the re-introduction of virus may be from migrating birds taking the virus back with them after overwintering in the southeast. Most of the studies examining reservoir competence have focused on passerine birds. 27, 41, 48, 84 Studies in the northeast have indicated that permanent resident and summer resident birds have antibodies to EEEV more often than transient and winter resident birds 27, 84, 106 and there is some evidence toward migrating birds playing a role in transportation of EEEV. 107 This makes sense due to the majority of cases occurring during the summer months. Many of these studies conclude that since such a high percentage of permanent residents have antibodies, that migratory birds play a minimal role in the introduction of EEEV. However, these studies focused on passerine birds and many don’t take into account the location of the wintering grounds for these bird species.

Recent studies have indicated that wading birds (Ciconiiformes) are preferred hosts of potential bridge vectors of EEEV in the southeast. 36, 108, 109, 110 Few studies have looked at the exposure of wading birds to EEEV in comparison to the numbers of studies that have focused on passerine birds; however, one seroprevalence study conducted in Louisiana found that over 80% of yellow-crowned night herons were seropositive for EEEV, 106 higher than any of the

Passeriform birds, and virus was isolated from one of the nestlings. 111 Additional studies have implicated a wide variety of wading bird species as potential enzootic hosts for EEEV as well. 40,

45, 112, 113, 114 In 1962, Herman reported 8 species of Ciconiiformes (common egret, snowy egret, black-crowned night heron, green heron, little blue heron, Louisiana heron, yellow-crowned night heron, and white ibis) as either being naturally or experimentally infected with EEEV. 40

Experimentally infected wading and water birds have been shown to have high enough viremia to infect mosquitoes. 41, 115, 116

This research attempts to further describe potential pathways for the overwintering and early season amplification of EEEV and build upon previous research in this field. There are several parts of the EEEV transmission cycle that are missing or not completely described. Two hypotheses, local overwintering in snakes and re-introductions of virus by migrating birds, are examined herein. The first part of this study attempts to identify circulating viremia in snake serum collected from wild snakes in Alabama. It is important to know if snakes have active viral infections, in addition to exposure to the virus, if they are going to serve as potential overwintering hosts for the virus. The second part of this study attempts to identify the hosts and vectors of enzootic winter transmission of EEEV in Florida, with a focus on avian host preference. If the virus is migrating from Florida to other locations after the winter months, it is important to know what species are being fed upon during this time period.

References

1. Scott TW, Weaver SC, 1989. Eastern equine encephalomyelitis virus: epidemiology and evolution of mosquito transmission. Adv Virus Res 37: 277-328.

2. Hanson RP, 1957. An epizootic of equine encephalomyelitis that occurred in Massachusetts in 1831. Am J Trop Med Hyg 6: 858-862.

3. Giltner LT, Shahan MS, 1933. The 1933 outbreak of infectious equine encephalomyelitis in the eastern states. North Am Vet 14: 25-27.

4. Fothergill LD, Dingle, J.H., and Farber, S., 1938. Human encephalitis caused by a virus of the eastern variety of equine encephalitis. New England Journal of Medicine 219: 411.

5. Monath TP, 1979. Arthropod-borne encephalitides in the Americas. Bull World Health Organ 57: 513-533.

6. Casals J, 1964. Antigenic variants of eastern equine encephalitis virus. J Exp Med 119: 547-565.

7. Brault AC, Powers AM, Chavez CL, Lopez RN, Cachon MF, Gutierrez LF, Kang W, Tesh RB, Shope RE, Weaver SC, 1999. Genetic and antigenic diversity among eastern equine encephalitis viruses from North, Central, and South America. Am J Trop Med Hyg 61: 579-586.

8. Arrigo NC, Adams AP, Weaver SC, 2010. Evolutionary patterns of eastern equine encephalitis virus in North versus South America suggest ecological differences and taxonomic revision. J Virol 84: 1014-1025.

9. Weaver SC, Powers AM, Brault AC, Barrett ADT, 1999. Molecular epidemiological studies of veterinary arboviral encephalitides. Vet J 157: 123-138.

10. Bigler WJ, Lassing EB, Buff EE, Prather EC, Beck EC, Hoff GL, 1976. Endemic eastern equine encephalomyelitis in Florida: a twenty-year analysis, 1955-1974. Am J Trop Med Hyg 25: 884-890.

11. Calisher CH, 1994. Medically important arboviruses of the United States and Canada. Clin Microbiol Rev 7: 89-116.

12. Deresiewicz RL, Thaler SJ, Hsu L, Zamani AA, 1997. Clinical and neuroradiographic manifestations of eastern equine encephalitis. N Engl J Med 336: 1867-1874.

13. Feemster RF, Wheeler RE, Daniels JB, Rose HD, Schaeffer M, Kissling RE, Hayes RO, Alexander ER, Murray WA, 1958. Field and laboratory studies on equine encephalitis. N Engl J Med 259: 107-113.

14. Ayres JC, Feemster RF, 1949. The sequelae of eastern equine encephalomyelitis. N Engl J Med 240: 960-962.

15. McGowan JE, Jr., Bryan JA, Gregg MB, 1973. Surveillance of arboviral encephalitis in the United States, 1955-1971. Am J Epidemiol 97: 199-207.

16. Vogel P, Kell WM, Fritz DL, Parker MD, Schoepp RJ, 2005. Early events in the pathogenesis of eastern equine encephalitis virus in mice. Am J Pathol 166: 159-171.

17. Paessler S, Aguilar P, Anishchenko M, Wang HQ, Aronson J, Campbell G, Cararra AS, Weaver SC, 2004. The hamster as an animal model for eastern equine encephalitis--and its use in studies of virus entrance into the brain. J Infect Dis 189: 2072-2076.

18. Griffin D, Levine B, Tyor W, Ubol S, Despres P, 1997. The role of antibody in recovery from alphavirus encephalitis. Immunol Rev 159: 155-161.

19. Griffin DE, Levine B, Tyor WR, Tucker PC, Hardwick JM, 1994. Age-dependent susceptibility to fatal encephalitis: alphavirus infection of neurons. Arch Virol Suppl 9: 31-39.

20. Griffin DE, 2007. Alphaviruses. Knipe DM, P.M. Howley, ed. Fields Virology. Philadelphia, PA: Lippincott Williams & Wilkins, 1023-1068.

21. Villari P, Spielman A, Komar N, McDowell M, Timperi RJ, 1995. The economic burden imposed by a residual case of eastern encephalitis. Am J Trop Med Hyg 52: 8-13.

22. Wilson JH, Rubin HL, Lane TJ, Gibbs EPJ, 1986. A survey of eastern equine encephalomyelitis in Florida horses: Prevalence, economic impact, and management practice. Preventative Veterinary Medicine 4: 261-267.

23. Minke JM, Audonnet JC, Fischer L, 2004. Equine viral vaccines: the past, present and future. Vet Res 35: 425-443.

24. Sellon DC, Long MT, 2007. Equine Infectious Diseases. St. Louis, MO: Saunders Elsevier.

25. Kissling RE, 1958. Host relationship of the arthropod-borne encephalitides. Ann N Y Acad Sci 70: 320-327.

26. Morris CD, 1988. Eastern equine encephalomyelitis. Monath TP, ed. The arboviruses: epidemiology and ecology. Boca Raton, FL: CRC Press, 1-20.

27. Crans WJ, Caccamise DF, McNelly JR, 1994. Eastern equine encephalomyelitis virus in relation to the avian community of a coastal cedar swamp. J Med Entomol 31: 711-728.

28. Kissling RE, Rubin H, Chamberlain RW, Eidson ME, 1951. Recovery of virus of eastern equine encephalomyelitis from blood of a purple grackle. Proc Soc Exp Biol Med 77: 398-399.

29. Chamberlain RW, Rubin H, Kissling RE, Eidson ME, 1951. Recovery of virus of eastern equine encephalomyelitis from a mosquito, Culiseta melanura (Coquillett). Proc Soc Exp Biol Med 77: 396-397.

30. Chamberlain RW, 1958. Vector relationships of the arthropod-borne encepalitides in North America. Ann N Y Acad Sci 70: 312-319.

31. Crans WJ, McNelly J, Schulze TL, Main A, 1986. Isolation of eastern equine encephalitis virus from Aedes sollicitans during an epizootic in southern New Jersey. J Am Mosq Control Assoc 2: 68-72.

32. Crans WJ, Schulze TL, 1986. Evidence incriminating Coquillettidia perturbans (Diptera: Culicidae) as an epizootic vector of eastern equine encephailitis. I. Isolation of EEE virus from C. perturbans during an epizootic among horses in New Jersey. Bull Soc Vector Ecol 11: 178-184.

33. Edman JD, Taylor DJ, 1968. Culex nigripalpus : seasonal shift in the bird-mammal feeding ratio in a mosquito vector of human encephalitis. Science 161: 67-68.

34. Burkett-Cadena ND, McClure CJ, Ligon RA, Graham SP, Guyer C, Hill GE, Ditchkoff SS, Eubanks MD, Hassan HK, Unnasch TR, 2011. Host reproductive phenology drives seasonal patterns of host use in mosquitoes. PLoS One 6: e17681.

35. Burkett-Cadena ND, Hassan HK, Eubanks MD, Cupp EW, Unnasch TR, 2012. Winter severity predicts the timing of host shifts in the mosquito Culex erraticus . Biol Lett 8: 567-569.

36. Oliveira A, Katholi CR, Burkett-Cadena N, Hassan HK, Kristensen S, Unnasch TR, 2011. Temporal analysis of feeding patterns of Culex erraticus in central Alabama. Vector Borne Zoonotic Dis 11: 413-421.

37. Thiemann TC, Wheeler SS, Barker CM, Reisen WK, 2011. Mosquito Host Selection Varies Seasonally with Host Availability and Mosquito Density. PLoS Negl Trop Dis 5: e1452.

38. Gray KM, Burkett-Cadena ND, Eubanks MD, Unnasch TR, 2011. Crepuscular flight activity of Culex erraticus (Diptera: Culicidae). J Med Entomol 48: 167-172.

39. Turell MJ, Dohm DJ, Sardelis MR, Oguinn ML, Andreadis TG, Blow JA, 2005. An update on the potential of North American mosquitoes (Diptera: Culicidae) to transmit West Nile Virus. J Med Entomol 42: 57-62.

40. Herman CM, 1962. The role of birds in the epizootiology of eastern equine encephalitis The Auk 79: 99-103.

41. Kissling RE, Chamberlain RW, Sikes RK, Eidson ME, 1954. Studies on the North American arthropod-borne encephalitides. III. Eastern equine encephalitis in wild birds. Am J Hyg 60: 251-265.

42. Komar N, Dohm DJ, Turell MJ, Spielman A, 1999. Eastern equine encephalitis virus in birds: relative competence of European starlings ( Sturnus vulgaris ). Am J Trop Med Hyg 60: 387-391.

43. Tully TN, Jr., Shane SM, Poston RP, England JJ, Vice CC, Cho DY, Panigrahy B, 1992. Eastern equine encephalitis in a flock of emus ( Dromaius novaehollandiae ). Avian Dis 36: 808-812. 44. Satriano SF, Luginbuhl RE, Wallis RC, Jungherr EL, Williamson LA, 1958. Investigation of eastern equine encephalomyelitis. IV. Susceptibility and transmission studies with virus of pheasant origin. Am J Hyg 67: 21-34.

45. Bigler WJ, Lassing E, Buff E, Lewis AL, Hoff GL, 1975. Arbovirus surveillance in Florida: wild vertebrate studies 1965-1974. J Wildl Dis 11: 348-356.

46. Mutebi JP, Swope BN, Saxton-Shaw KD, Graham AC, Turmel JP, Berl E, 2012. Eastern equine encephalitis in moose (Alces americanus) in northeastern Vermont. J Wildl Dis 48: 1109-1112.

47. Tate CM, Howerth EW, Stallknecht DE, Allison AB, Fischer JR, Mead DG, 2005. Eastern equine encephalitis in a free-ranging white-tailed deer (Odocoileus virginianus). J Wildl Dis 41: 241-245.

48. Dalrymple JM, Young OP, Eldridge BF, Russell PK, 1972. Ecology of arboviruses in a Maryland freshwater swamp. 3. Vertebrate hosts. Am J Epidemiol 96: 129-140.

49. Elvinger F, Liggett AD, Tang KN, Harrison LR, Cole JR, Jr., Baldwin CA, Nessmith WB, 1994. Eastern equine encephalomyelitis virus infection in swine. J Am Vet Med Assoc 205: 1014-1016.

50. Farrar MD, Miller DL, Baldwin CA, Stiver SL, Hall CL, 2005. Eastern equine encephalitis in dogs. J Vet Diagn Invest 17: 614-617.

51. Mutebi JP, Lubelczyk C, Eisen R, Panella N, Macmillan K, Godsey M, Swope B, Young G, Smith RP, Kantar L, Robinson S, Sears S, 2011. Using wild white-tailed deer to detect eastern equine encephalitis virus activity in Maine. Vector Borne Zoonotic Dis 11: 1403- 1409.

52. Schmitt SM, Cooley TM, Fitzgerald SD, Bolin SR, Lim A, Schaefer SM, Kiupel M, Maes RK, Hogle SA, O'Brien DJ, 2007. An outbreak of eastern equine encephalitis virus in free-ranging white-tailed deer in Michigan. J Wildl Dis 43: 635-644.

53. Monath TP, Sabattini MS, Pauli R, Daffner JF, Mitchell CJ, Bowen GS, Cropp CB, 1985. Arbovirus investigations in Argentina, 1977–1980: IV. Serologic surveys and sentinel equine program. Am J Trop Med Hyg 34: 966-975.

54. Aguilar PV, Robich RM, Turell MJ, O'Guinn ML, Klein TA, Huaman A, Guevara C, Rios Z, Tesh RB, Watts DM, Olson J, Weaver SC, 2007. Endemic eastern equine encephalitis in the Amazon region of Peru. Am J Trop Med Hyg 76: 293-298.

55. Causey OR, Theiler M, 1958. Virus antibody survey on sera of residents of the Amazon Valley in Brazil. Am J Trop Med Hyg 7: 36-41.

56. Sabattini MS, Aviles, T.P., and T.P. Monath, 1998. Historical, epidemiological, and ecological aspects of arboviruses in Argentina: Togaviridae, alphavirus. An overview of arbovirology in Brazil and neighboring countries. Instituto Evandro Chagas, Belem, Brazil.

57. Goldfield M, Welsh JN, Taylor BF, 1968. The 1959 outbreak of Eastern encephalitis in New Jersey. 5. The inapparent infection:disease ratio. Am J Epidemiol 87: 32-33.

58. Moncayo AC, 1998. Retrospective analysis of epidemic eastern equine encephalomyelitis transmission in Massachusetts. Electronic Doctoral Dissertations for UMass Amherst.

59. Graham SP, Hassan HK, Chapman T, White G, Guyer C, Unnasch TR, 2012. Serosurveillance of eastern equine encephalitis virus in amphibians and reptiles from Alabama, USA. Am J Trop Med Hyg 86: 540-544.

60. Karstad L, 1961. Reptiles as possible reservoir hosts for Eastern Encephalitis virus. Trans. 26th N. Am. Wildlife Conf.: 186-202.

61. Craighead JE, Shelokov A, Peralta PH, 1962. The lizard: a possible host for eastern equine encephalitis virus in Panama. Am J Epidemiol 76: 82-87.

62. Beerntsen BT, James AA, Christensen BM, 2000. Genetics of mosquito vector competence. Microbiol Mol Biol Rev 64: 115-137.

63. Hardy JL, Houk EJ, Kramer LD, Reeves WC, 1983. Intrinsic factors affecting vector competence of mosquitoes for arboviruses. Annu Rev Entomol 28: 229-262.

64. Woodring JL, Higgs S, Beaty BJ, 1996. Natural cycles of vector-borne pathogens. Niwot, CO: University Press of Colorado.

65. Hardy JL, 1988. Susceptibility and resistance of vector mosquitoes. Boca Raton, FL: CRC Press.

66. Scott TW, Burrage TG, 1984. Rapid infection of salivary glands in Culiseta melanura with eastern equine encephalitis virus: an electron microscopic study. Am J Trop Med Hyg 33: 961-964.

67. Scott TW, Hildreth SW, Beaty BJ, 1984. The distribution and development of eastern equine encephalitis virus in its enzootic mosquito vector, Culiseta melanura. Am J Trop Med Hyg 33: 300-310.

68. Chamberlain RW, Sikes RK, Nelson DB, Sudia WD, 1954. Studies on the North American arthropod-borne encephalitides. VI. Quantitative determinations of virus- vector relationships. Am J Hyg 60: 278-285.

69. Chamberlain RW, Corristan EC, Sikes RK, 1954. Studies on the North American arthropod-borne encephalitides: V. The extrinsic incubation of eastern and western equine encephalitis in mosquitoes. Am J Hyg 60: 269-277.

70. Vaidyanathan R, Edman JD, Cooper LA, Scott TW, 1997. Vector competence of mosquitoes (Diptera:Culicidae) from Massachusetts for a sympatric isolate of eastern equine encephalomyelitis virus. J Med Entomol 34: 346-352.

71. Komar N, Spielman A, 1994. Emergence of eastern encephalitis in Massachusetts. Ann N Y Acad Sci 740: 157-168.

72. Armstrong PM, Andreadis TG, 2010. Eastern equine encephalitis virus in mosquitoes and their role as bridge vectors. Emerg Infect Dis 16: 1869-1874.

73. Howard JJ, Morris CD, Emord DE, Grayson MA, 1988. Epizootiology of eastern equine encephalitis virus in upstate New York, USA. VII. Virus surveillance 1978-85, description of 1983 outbreak, and series conclusions. J Med Entomol 25: 501-514.

74. Cupp EW, Klingler K, Hassan HK, Viguers LM, Unnasch TR, 2003. Transmission of eastern equine encephalomyelitis virus in central Alabama. Am J Trop Med Hyg 68: 495- 500.

75. Cupp EW, Tennessen KJ, Oldland WK, Hassan HK, Hill GE, Katholi CR, Unnasch TR, 2004. Mosquito and arbovirus activity during 1997-2002 in a wetland in northeastern Mississippi. J Med Entomol 41: 495-501.

76. Crans WJ, 1986. Failure of chickens to act as sentinels during an epizootic of eastern equine encephalitis in southern New Jersey, USA. J Med Entomol 23: 626-629.

77. Langevin SA, Bunning M, Davis B, Komar N, 2001. Experimental infection of chickens as candidate sentinels for West Nile virus. Emerg Infect Dis 7: 726-729.

78. Komar N, 2001. West Nile virus surveillance using sentinel birds. Ann N Y Acad Sci 951: 58-73.

79. Nelson DB, Kappus KD, Janowski HT, Buff E, Wellings FM, Schneider NJ, 1983. St. Louis encephalitis--Florida 1977. Patterns of a widespread outbreak. Am J Trop Med Hyg 32: 412-416.

80. Connelley CR, Carlson DB, 2009. Florida Mosquito Control: The state of the mission as defined by mosquito controllers, regulators, and environmental managers. Florida Coordinating Council on Mosquito Control. Vero Beach, FL: University of Florida, Institute of Food and Agricultural Sciences, Florida Medical Entomology Laboratory.

81. Armstrong PM, Andreadis TG, Anderson JF, Stull JW, Mores CN, 2008. Tracking eastern equine encephalitis virus perpetuation in the northeastern United States by phylogenetic analysis. Am J Trop Med Hyg 79: 291-296.

82. White GS, Pickett BE, Lefkowitz EJ, Johnson AG, Ottendorfer C, Stark LM, Unnasch TR, 2011. Phylogenetic analysis of eastern equine encephalitis virus isolates from Florida. Am J Trop Med Hyg 84: 709-717.

83. Young DS, Kramer LD, Maffei JG, Dusek RJ, Backenson PB, Mores CN, Bernard KA, Ebel GD, 2008. Molecular epidemiology of eastern equine encephalitis virus, New York. Emerg Infect Dis 14: 454-460.

84. Emord DE, Morris CD, 1984. Epizootiology of eastern equine encephalomyelitis virus in upstate New York, USA. VI. Antibody prevalence in wild birds during an interepizootic period. J Med Entomol 21: 395-404.

85. Calisher CH, Maness KSC, Lord RD, Coleman PH, 1971. Identification of two South American strains of eastern equine encephalomyelitis virus from migrant birds captured on the Mississippi delta. Am J Epidemiol 94: 172-178.

86. Kissling RE, Stamm DD, Chamberlain RW, Sudia WD, 1957. Birds as winter hosts for eastern and western equine encephalomyeltitis viruses. Am J Epidemiol 66: 42-47.

87. Owen JC, Moore FR, Williams AJ, Stark L, Miller EA, Morley VJ, Krohn AR, Garvin MC, 2011. Test of recrudescence hypothesis for overwintering of eastern equine encephalomyelitis virus in gray catbirds. J Med Entomol 48: 896-903.

88. Burkett-Cadena ND, White GS, Eubanks MD, Unnasch TR, 2011. Winter biology of wetland mosquitoes at a focus of eastern equine encephalomyelitis virus transmission in Alabama, USA. J Med Entomol 48: 967-973.

89. Wallis RC, Taylor RM, McCollum RW, Riordan JT, 1958. Study of hibernating mosquitoes in eastern equine encephalomyelitis endemic areas in Connecticut. Mosq News 18: 1-5.

90. Crans WJ, 2004. A classification system for mosquito life cycles: life cycle types for mosquitoes of the northeastern United States. J Vector Ecol 29: 1-10.

91. Watts DM, Clark GG, Crabbs CL, Rossi CA, Olin TR, Bailey CL, 1987. Ecological evidence against vertical transmission of eastern equine encephalitis virus by mosquitoes (Diptera: Culicidae) on the Delmarva Peninsula, USA. J Med Entomol 24: 91-98.

92. Morris CD, Srihongse S, 1978. An evaluation of the hypothesis of transovarial transmission of eastern equine encephalomyelitis virus by Culiseta melanura. Am J Trop Med Hyg 27: 1246-1250.

93. Clark GG, Crans WJ, Crabbs CL, 1985. Absence of eastern equine encephalitis (EEE) virus in immature Coquillettidia perturbans associated with equine cases of EEE. J Am Mosq Control Assoc 1: 540-542.

94. Andreadis TG, Shepard JJ, Thomas MC, 2012. Field Observations on the overwintering ecology of Culiseta melanura in the northeastern USA. J Am Mosq Control Assoc 28: 286-291.

95. Burkett-Cadena ND, Graham SP, Hassan HK, Guyer C, Eubanks MD, Katholi CR, Unnasch TR, 2008. Blood feeding patterns of potential arbovirus vectors of the genus Culex targeting ectothermic hosts. Am J Trop Med Hyg 79: 809-815.

96. Cupp EW, Zhang D, Yue X, Cupp MS, Guyer C, Sprenger TR, Unnasch TR, 2004. Identification of reptilian and amphibian blood meals from mosquitoes in an eastern equine encephalomyelitis virus focus in central Alabama. Am J Trop Med Hyg 71: 272- 276.

97. White G, Ottendorfer C, Graham S, Unnasch TR, 2011. Competency of reptiles and amphibians for eastern equine encephalitis virus. Am J Trop Med Hyg 85: 421-425.

98. Hayes RO, Daniels JB, Maxfield HK, Wheeler RE, 1964. Field and laboratory studies on eastern encephalitis in warm- and cold-blooded vertebrates. Am J Trop Med Hyg 13: 595-606.

99. Hayes RO, 1961. Studies on eastern encephalitis in Massachusetts during 1960. Proc N J Mosq Exterm Assoc 48: 59-62.

100. Hahn CS, Lustig S, Strauss EG, Strauss JH, 1988. Western equine encephalitis virus is a recombinant virus. Proceedings of the National Academy of Sciences 85: 5997-6001.

101. Weaver SC, Kang W, Shirako Y, Rumenapf T, Strauss EG, Strauss JH, 1997. Recombinational history and molecular evolution of western equine encephalomyelitis complex alphaviruses. J Virol 71: 613-623.

102. Gebhardt LP, Stanton GJ, Hill DW, Collett GC, 1964. Natural overwintering hosts of the virus of western equine encephalitis. N Engl J Med 271: 172-177.

103. Thomas LA, Eklund CM, 1962. Overwintering of western equine encephalomyelitis virus in garter snakes experimentally infected by Culex tarsalis . Proc Soc Exp Biol Med 109: 421-424.

104. Gebhardt LP, Stanton GJ, De St Jeor S, 1966. Transmission of WEE virus to snakes by infected Culex tarsalis mosquitoes. Proc Soc Exp Biol Med 123: 233-235.

105. Thomas LA, Eklund CM, Rush WA, 1958. Susceptibility of garter snakes ( Thamnophis spp.) to western equine encephalomyelitis virus. Proc Soc Exp Biol Med 99: 698-700.

106. Kissling RE, Chamberlain RW, Nelson DB, Stamm DD, 1955. Studies on the North American arthropod-borne encephalitides. VIII. Equine encephalitis studies in Louisiana. Am J Hyg 62: 233-254.

107. Lord RD, Calisher CH, 1970. Further evidence of southward transport of arboviruses by migratory birds. Am J Epidemiol 92: 73-78.

108. Hassan HK, Cupp EW, Hill GE, Katholi CR, Klingler K, Unnasch TR, 2003. Avian host preference by vectors of eastern equine encephalomyelitis virus. Am J Trop Med Hyg 69: 641-647.

109. Estep LK, McClure CJ, Burkett-Cadena ND, Hassan HK, Hicks TL, Unnasch TR, Hill GE, 2011. A multi-year study of mosquito feeding patterns on avian hosts in a southeastern focus of eastern equine encephalitis virus. Am J Trop Med Hyg 84: 718- 726.

110. Edman JD, 1979. Host-feeding patterns of Florida mosquitoes (Diptera: Culicidae) VI. Culex (Melanoconion). J Med Entomol 15: 521-525.

111. Stamm DD, 1958. Studies on the ecology of equine encephalomyelitis. Am J Public Health Nations Health 48: 328-335.

112. Spalding MG, McLean RG, Burgess JH, Kirk LJ, 1994. Arboviruses in water birds (Ciconiiformes, Pelecaniformes) from Florida. J Wildl Dis 30: 216-221.

113. Favorite FG, 1960. Some evidence of local origin of EEE virus in Florida. Mosq News 20: 87-92.

114. Gottdenker NL, Howerth EW, Mead DG, 2003. Natural infection of a great egret (Casmerodius albus ) with eastern equine encephalitis virus. J Wildl Dis 39: 702-706.

115. Aguirre AA, McLean RG, Cook RS, 1992. Experimental inoculation of three arboviruses in black-bellied whistling ducks ( Dendrocygna autumnalis ). J Wildl Dis 28: 521-525.

116. McLean RG, Crans WJ, Caccamise DF, McNelly J, Kirk LJ, Mitchell CJ, Calisher CH, 1995. Experimental infection of wading birds with eastern equine encephalitis virus. J Wildl Dis 31: 502-508.

CHAPTER ONE

Detection of Eastern Equine Encephalomyelitis Virus RNA in North American Snakes

Note to Reader

This chapter has been previously published (Bingham, AB, et al., 2012. Detection of

Eastern Equine Encephalomyelitis Virus RNA in North American Snakes. Am J Trop Med Hyg

87(6): 1140-1144.) and is utilized with permission from the publisher.

Abstract

The role of non-avian vertebrates in the ecology of eastern equine encephalomyelitis virus (EEEV) is unresolved, but mounting evidence supports a potential role for snakes in the

EEEV transmission cycle, especially as overwintering hosts. To determine rates of exposure and infection, we examined serum samples from wild snakes at a focus of EEEV in Alabama for viral RNA using quantitative reverse transcription polymerase chain reaction. Two species of vipers, the copperhead ( Agkistrodon contortrix ) and the cottonmouth ( Agkistrodon piscivorus ), were found to be positive for EEEV RNA using this assay. Prevalence of EEEV RNA was higher in seropositive snakes than seronegative snakes. Positivity for the quantitative reverse transcription polymerase chain reaction in cottonmouths peaked in April and September. Body size and sex ratios were not significantly different between infected and uninfected snakes. These results support the hypothesis that snakes are involved in the ecology of EEEV in North

America, possibly as overwintering hosts for the virus.

Introduction

Eastern equine encephalomyelitis virus (EEEV; family Togaviridae , genus Alphavirus ) is an extremely pathogenic arbovirus endemic to New England south to Florida, extending west as far as Michigan. 1 This virus circulates year-round in Florida, but outside of Florida its transmission is seasonal. Recent studies have suggested that the virus is periodically introduced from Florida to the northeastern United States, where it establishes itself in defined foci and is capable of maintaining itself for several seasons. 2, 3, 4, 5, 6 How EEEV overwinters in these foci remains unresolved. However, recent studies have implicated ectothermic animals, snakes in particular, as potential overwintering reservoir hosts for EEEV. For example, studies on the ecology of EEEV conducted in the Tuskegee National Forest in Alabama documented the presence of EEEV in pools of Culex peccator , Culex territans , and Uranotaenia sapphirina mosquitoes, with some of the EEEV positive pools in these species detected early in the transmission season. 7, 8, 9 These mosquito species feed primarily upon ectothermic hosts, with Cx. territans primarily feeding upon amphibians and Cx. peccator and Ur. sapphirina primarily feeding upon reptiles. 7, 8

Laboratory studies have also supported the hypothesis that ectotherms might play a role in the overwintering of EEEV. 10, 11, 12 Recently, it was reported that snakes experimentally infected with EEEV developed circulating levels of viremia that were sufficient to infect mosquitoes and maintained these potentially infectious viral titers for 7–10 days. 13 This period was longer than the period that infectious titers persist in passerine birds, the accepted enzootic hosts for EEEV. Furthermore, viremic snakes, when induced to go into a hibernation-like state known as brumation, maintained a circulating viremia upon exiting brumation.13

Snakes also appear to be commonly exposed to EEEV. A recent serosurvey of ectothermic species from a focus of EEEV transmission in Tuskegee National Forest in Alabama showed that more than 35% of the cottonmouths ( Agkistrodon piscivorus ), the ectothermic species most frequently fed upon by mosquitoes in Tuskegee National Forest, 7 contained antibodies to EEEV. 14 However, these data must be interpreted with caution because the presence of antibodies recognizing EEEV in these animals might merely reflect exposure to the virus, but not the development of a patent infection.

Snakes and other ectothermic animals mount relatively inefficient antibody responses to pathogens, 15, 16, 17 suggesting that antibodies produced by these animals against EEEV might not be efficient in clearing the infection with the virus. In support of this hypothesis, plasma from cottonmouths experimentally infected with EEEV, while containing antibodies to EEEV that were detectable by the luminex assay, were found to lack detectible antiviral activity in plaque reduction neutralization assays. 14 These findings suggested the hypothesis that snakes exposed to

EEEV in the wild might maintain a low level of circulating virus. To test this hypothesis, plasma samples collected from snakes at Tuskegee National Forest were tested for the presence of EEEV by using quantitative reverse transcription polymerase chain reaction (qRT-PCR).

Materials and Methods

Collection of plasma from snakes at the Tuskegee National Forest has been described in detail in a previous publication. 14 In brief, samples were collected from an EEEV-endemic area in Tuskegee National Forest, located in east-central Alabama. Samples were collected during

April–September 2007–2009 during surveys of the herpetofauna present at the site, as described. 14 Procedures used for collection of blood samples were approved by the Institutional

Review Board for Animal Use and Care of Auburn University. Blood samples (1 mL) were

22 collected from the caudal sinus with a 26-gauge heparinized syringe. At the time of blood draw, body size and sex of each snake were recorded. Animals were marked to prevent re-sampling and released at the point of capture. Blood samples were transferred to 1.5-mL microcentrifuge tubes, placed on wet ice, and transported to the laboratory. Samples were centrifuged briefly and the plasma was decanted from the cell pellet. The luminex assay (recognizing antibodies to

EEEV) was then used to determine snake exposure to EEEV only, as described. 14 Samples determined to be antibody positive by luminex were then tested by qRT-PCR for EEEV RNA.

In addition, samples from 66 randomly selected seronegative snakes (11 per month, April-

September) were tested by qRT-PCR for EEEV RNA.

Total RNA was prepared from 140 µL of plasma by using the QIAamp Viral RNA Mini

Kit (QIAGEN, Valencia, CA) according to the manufacturer’s protocol. The process was automated with the Qiacube system (QIAGEN), and isolated RNA (60 µL) was stored at –80°C.

Each batch of 12 samples processed in the Qiacube consisted of 11 serum samples and one sham extraction as a negative control.

The qRT-PCR was performed using the iScript one step RT-PCR kit for probes (Bio-Rad,

Hercules, CA) according to the manufacturer’s protocol. Primers and reaction conditions used to detect EEEV RNA were those recommended by Lambert and others, 18 with the exception that reactions were performed in a final volume of 25 µL and used 5 µL of the RNA template. These primers produced an amplicon spanning positions 9298–9456 in the EEEV genome sequence

(GenBank accession no. X67111). 19 Samples (and associated sham extractions) were run in a 96- well plate format, with each plate containing two qRT-PCR negative control wells. Amplicons were detected by using a 5’ 6-FAM, 3’ BHQ1a-Q probe spanning positions 9411–9431 in the

EEEV genome. Samples producing a signal at a cycle threshold (C t) value ≤ 37 were considered putatively positive.

RNA samples found to be putatively positive in the screening assay were subjected to a confirmatory qRT-PCR assay provided by the Centers for Disease Control and Prevention

(Atlanta, GA) to state Department of Health Laboratories conducting arboviral surveillance activities. 20 The confirmatory assay used two primers (5’-ACCTTGCTGACGACCAGGTC-

3’ and 5’-GTTGTTGGTCGCTCAATCCA-3’), which produced an amplicon spanning positions

9428–9497 in the EEEV genome. The sequence of the probe used in this assay was

5’-CTTGGAAGTGATGCAAATCCAACTCGACA-3’, which spanned positions 9449–9477 in the genome. The probe contained the same fluorescent and quencher molecules as the first qRT-PCR. Putatively positive samples that produced a detectable amplicon in the confirmatory assay (C t < 40) were considered confirmed as positive for EEEV RNA. The biochemical limit of detection of both assays was determined to be ≤ 1 plaque-forming unit when assayed against cultured viral stocks of known titers.

Virus isolation was attempted from all confirmed qRT-PCR–positive samples by inoculating individual T-25 flasks of confluent Vero cell cultures with 1 mL of plasma. Flasks were incubated for two hours at 37°C, with gentle rocking every 15 minutes. After the incubation, 9 mL of maintenance media (1 x Earle’s minimal essential medium, 2% fetal bovine serum, 200 U/mL penicillin, 200 µg/mL streptomycin, and 2.5 µg/mL amphotericin B) were added to each flask. Cells were then monitored daily for a cytopathic effect.

Fisher’s exact test was used to test for the significance of the proportion of qRT-PCR– positive samples in seropositive and seronegative snakes. The Pearson’s chi-square test was used to test differences in sex ratio in EEEV qRT-PCR–positive and EEEV qRT-PCR–negative

24 snakes. Statistical differences in body sizes of infected and uninfected snakes (separated by sex) were determined using a t-test. All analyses were performed by using SAS version 9.1 statistical software (SAS Institute, Cary, NC).

Results

Cottonmouths ( Agkistrodon piscivorus ) were the most common and commonly sampled snakes at our site, representing 41% of the ectotherm biomass, 8 and were previously shown to exhibit high rates of EEEV exposure, with 35.4% of cottonmouth serum samples tested containing antibodies to EEEV. 14 For this reason, initial studies concentrated upon determining if

EEEV RNA could be detected in seropositive and seronegative cottonmouths. Although EEEV

RNA was detected in seropositive and seronegative snakes, cottonmouths with detectable antibodies against EEEV in their serum were significantly more likely to be qRT-PCR positive than seronegative cottonmouths (P < 0.001, by Fisher’s exact test). Of the 66 seronegative cottonmouths tested, only one (1.5%) was qRT-PCR positive, while 12 (22.2%) of the 54 seropositive snakes were positive for EEEV RNA. The Ct values for the snakes ranged from 33.4 to 37 for the screening assay and from 30.9 to 40 for the confirmatory assay. Attempts to culture

EEEV from all the qRT-PCR–positive samples were not successful.

Previous studies had shown that temporal distribution of EEEV exposure in cottonmouths

(as measured by antibody positivity) was relatively constant throughout the transmission season, with some suggestion of an increased prevalence of seropositivity in the spring and fall. 14 A similar biphasic distribution of qRT-PCR positivity in seropositive cottonmouths was seen

(Figure 1.1). In April, 22.2% of the total cottonmouths tested (seropositive and seronegative) were qRT-PCR positive. The proportion of qRT-PCR positive cottonmouths then decreased through the May–July period, reaching a nadir of 3.2% in July, and began to increase again in

August. The single seropositive cottonmouth sample collected in September was found to be qRT-PCR-positive for EEEV (Figure 1.1).

Seropositive serum samples collected from other species of snakes exposed to EEEV at

Tuskegee National Forest were then tested for EEEV RNA by qRT-PCR. Two of the eight snake species tested (the cottonmouth and the copperhead [Agkistrodon contortrix ]) were found to contain qRT-PCR positive animals. Of the three copperheads sampled, one was positive for

EEEV RNA. Serum samples from two other seropositive snake species (Plain-bellied watersnake

[Nerodia erythrogaster ] and black racer [ Coluber constrictor ]) were not positive for EEEV RNA

(Table 1.1).

Because host body size 8 and behavior 21 can have strong effects on selection of ectothermic hosts by mosquitoes, and thus vector-host contact rates (a major driver in pathogen exposure), we investigated potential relationships between EEEV prevalence and snake body size and sex. No difference was observed between mean body size (measured by snout-vent length) of male or female cottonmouths exposed to EEEV and those not exposed to EEEV

(Figure 1.2, Panel A) (females: P = 0.5779, t = 0.5595, degrees of freedom [df] = 61; males: P =

0.2898, t = 1.0718, df = 43). A slightly greater body size (mean snout-vent length) was observed for cottonmouths that were qRT-PCR positive than those that were qRT-PCR negative

(Figure 1.2, Panel B), although the difference was not statistically significant (females: P =

0.6962, t = 0.3923, df = 61; males: P = 0.8798, t = 0.1521, df = 43). Female cottonmouths constituted a greater proportion of the EEEV qRT-PCR–positive snakes than males (Figure 1.3), although this ratio was not significantly different from the sex ratio of qRT-PCR–negative snakes ( χ2 = 0.142, df = 1, P = 0.707).

Discussion

The data presented demonstrate that snakes at Tuskegee National Forest were not only exposed to EEEV (antibody positive), but that a proportion of snakes have detectable infections

(qRT-PCR positive for EEEV RNA). Two snake species (cottonmouth and copperhead), both of the genus Agkistrodon , were found to have detectable levels of EEEV in serum samples collected at our study site in Tuskegee National Forest. Cottonmouths, the greatest source of reptilian biomass at our site, 8 were frequently exposed to and infected with EEEV. Interestingly, cottonmouth snakes are commonly targeted hosts by suspected bridge vectors of EEEV at this site as well. 7, 8

To our knowledge, this is the first report of the detection of virus (as opposed to antibodies) detected in field-collected serum samples from ectothermic vertebrates. Karstad 22 detected neutralizing antibodies to EEEV from wild ectotherms, but could not isolate virus from the samples. Dalrymple 23 and others 11 also detected EEEV antibodies in several ectothermic species, but made no mention of whether virus isolation was attempted for serum samples from these same hosts. However, other snakes have been shown to be competent hosts for western equine encephalomyelitis virus, 24, 25, 26, 27 an Alphavirus related to EEEV, with one study showing viremia in western equine encephalomyelitis virus–infected snakes lasting 70 days post brumation. 25 These studies demonstrated the ability of Culex tarsalis to transmit WEEV to naïve snakes 28 as well as the vertical transmission of the virus from infected mothers to offspring.26

WEEV has also been isolated from snakes in the wild during a time of no mosquito activity. 26

Attempts to culture EEEV were unsuccessful in this study, which might reflect sample degradation because the serum samples had been subjected to multiple freeze–thaw cycles.

Another possibility is that the relatively inefficient adaptive immune response of snakes 16 was

27 insufficient to completely clear the infection, permitting the maintenance of a low-titer circulating viremia.

The data suggest that the proportion of qRT-PCR–positive cottonmouths was highest in the spring. These data are in concordance with those of previous laboratory studies, which demonstrated that garter snakes ( Thamnophis sirtalis ) experimentally infected with EEEV held at low temperatures (18°C) were found to maintain circulating viremias for longer periods than did animals held at higher temperatures (25°C or 30°C). 13 It is possible this might be a consequence of the temperature dependence of the ectothermic adaptive immune system. During cooler months, snakes may not be able to raise body temperatures to levels that would enable them to clear infections because the adaptive immune response of ectotherms is more efficient at higher temperatures. 16, 17, 29, 30, 31

The relationship between host body size and infection is complicated, and positive and negative associations have been found in different host/vector-borne pathogen systems. Body size can be affected by infection, when physiological cost of infection is high. 32 Larger body size can contribute to greater infection through increased exposure because vectors are believed to feed more frequently upon larger hosts. 33 In our own study, we found no significant difference in the body size of exposed and unexposed snakes. However, body size was slightly (but not significantly) larger in qRT-PCR–positive snakes than in qRT-PCR–negative snakes.

For many vertebrate pathogens, males have higher prevalence and intensity of infection because of their larger home ranges, mate attracting/guarding activities, and hormonal influences. 34, 35 In contrast, in this study, we found that compared with the uninfected population, females made up a larger proportion of the population of infected cottonmouths, although the difference was not statistically significant from that of the uninfected population.

The behavior of cottonmouth snakes may also make them a potential reservoir host for

EEEV. In warmer climates, cottonmouths are active from March to October. There is no defined breeding season; breeding can occur year-round. In some locations the breeding season occurs in

April-May and young cottonmouths are born in August-September. 36 Another study conducted at

TNF noted that the breeding season was August-September. 14 The cottonmouth snake has been shown to tolerate lower temperatures better than many other snake species and is usually the last to go into brumation. 37 In more southern locations, cottonmouths may not brumate at all and have been seen basking during the mornings of cooler months. 38 The metabolic costs of this non- feeding period have also been shown to increase with increasing latitude. 39 Some species of female mosquitoes (including Culex species) also overwinter in underground burrows and root holes 40 which are sites that are also used as hibernacula by cottonmouths and other snakes.

Cottonmouth snakes are usually found basking during the day, but are more active at night. 41

Cottonmouths do most of their hunting at night, corresponding with the nocturnal activity of some of its food supply (some species of frogs and reptiles). They remain motionless for long periods of time in order to ambush prey,41 which also encourages mosquito feeding. The mosquito species that are known or suspected vectors of EEEV also have crepuscular or nocturnal activity 42 and therefore have a greater chance of feeding on a cottonmouth snake than more diurnal snakes.

Previous laboratory studies demonstrated that snakes experimentally infected with EEEV can remain viremic through brumation, and that viremia in these animals is affected by the ambient temperature, with infected animals held at lower temperatures having lower viral titers of circulating virus, but maintaining viremia for longer periods than animals held at higher temperatures. 12, 13 One study found that viremia lasted from 3-105 days depending on

29 temperature and that post-brumation, snakes were still viremic for a few months. 11 The demonstration that wild-caught snakes contain EEEV virus in circulating blood and that the proportion of animals with circulating viremia is highest in the spring months provides further support to the hypothesis that snakes play an important role in overwintering and early season enzootic amplification of EEEV.

Tables and Figures

Table 1.1 Proportion of Luminex-positive snakes that were positive by qRT-PCR for eastern equine encephalitis virus from Tuskegee National Forest, Alabama, USA ______Species Common name No. tested % qRT-PCR 95% CI positive ______Coluber constrictor Black racer 4 0 ND* Agkistrodon contortrix Copperhead 3 33.3 0-87 Agkistrodon piscivorus Cottonmouth 54 22.2 13-35 Storeria dekayi Dekay’s Brownsnake 1 0 ND Nerodia sipedon pleuralis Midland Watersnake 1 0 ND Nerodia erythrogaster Plain-bellied Watersnake 7 0 ND Diadophis punctatus Ringneck Snake 1 0 ND Crotalus horridus Timber Rattlesnake 1 0 ND ______*qRT-PCR = quantitative reverse transcription polymerase chain reaction; CI = confidence interval, ND = not determined

Figure 1.2 Body size (snout-vent length) of male and female cottonmouth snakes ( Agkistrodon piscivorus ) exposed to (A) and infected with (B) eastern equine encephalomyelitis virus from Tuskegee National Forest, Alabama, USA. Error bars show standard deviation.

References

1. Bigler WJ, Lassing EB, Buff EE, Prather EC, Beck EC, Hoff GL, 1976. Endemic eastern equine encephalomyelitis in Florida: a twenty-year analysis, 1955-1974. Am J Trop Med Hyg 25: 884-890.

2. Armstrong PM, Andreadis TG, Anderson JF, Stull JW, Mores CN, 2008. Tracking eastern equine encephalitis virus perpetuation in the northeastern United States by phylogenetic analysis. Am J Trop Med Hyg 79: 291-296.

3. Weaver SC, Hagenbaugh A, Bellew LA, Gousset L, Mallampalli V, Holland JJ, Scott TW, 1994. Evolution of alphaviruses in the eastern equine encephalomyelitis complex. J Virol 68: 158-169.

4. Weaver SC, Scott TW, Rico-Hesse R, 1991. Molecular evolution of eastern equine encephalomyelitis virus in North America. Virology 182: 774-784.

5. Young DS, Kramer LD, Maffei JG, Dusek RJ, Backenson PB, Mores CN, Bernard KA, Ebel GD, 2008. Molecular epidemiology of eastern equine encephalitis virus, New York. Emerg Infect Dis 14: 454-460.

6. White GS, Pickett BE, Lefkowitz EJ, Johnson AG, Ottendorfer C, Stark LM, Unnasch TR, 2011. Phylogenetic analysis of eastern equine encephalitis virus isolates from Florida. Am J Trop Med Hyg 84: 709-717.

7. Cupp EW, Zhang D, Yue X, Cupp MS, Guyer C, Sprenger TR, Unnasch TR, 2004. Identification of reptilian and amphibian blood meals from mosquitoes in an eastern equine encephalomyelitis virus focus in central Alabama. Am J Trop Med Hyg 71: 272- 276.

8. Burkett-Cadena ND, Graham SP, Hassan HK, Guyer C, Eubanks MD, Katholi CR, Unnasch TR, 2008. Blood feeding patterns of potential arbovirus vectors of the genus Culex targeting ectothermic hosts. Am J Trop Med Hyg 79: 809-815.

9. Cupp EW, Klingler K, Hassan HK, Viguers LM, Unnasch TR, 2003. Transmission of eastern equine encephalomyelitis virus in central Alabama. Am J Trop Med Hyg 68: 495- 500.

10. Hayes RO, 1961. Studies on eastern encephalitis in Massachusetts during 1960. Proc N J Mosq Exterm Assoc 48: 59-62.

11. Hayes RO, Daniels JB, Maxfield HK, Wheeler RE, 1964. Field and laboratory studies on eastern encephalitis in warm- and cold-blooded vertebrates. Am J Trop Med Hyg 13: 595-606.

12. Feemster RF, Wheeler RE, Daniels JB, Rose HD, Schaeffer M, Kissling RE, Hayes RO, Alexander ER, Murray WA, 1958. Field and laboratory studies on equine encephalitis. N Engl J Med 259: 107-113.

13. White G, Ottendorfer C, Graham S, Unnasch TR, 2011. Competency of reptiles and amphibians for eastern equine encephalitis virus. Am J Trop Med Hyg 85: 421-425.

14. Graham SP, Hassan HK, Chapman T, White G, Guyer C, Unnasch TR, 2012. Serosurveillance of eastern equine encephalitis virus in amphibians and reptiles from Alabama, USA. Am J Trop Med Hyg 86: 540-544.

15. Hsu E, 1998. Mutation, selection, and memory in B lymphocytes of exothermic vertebrates. Immunol Rev 162: 25-36.

16. Zimmerman LM, Vogel LA, Bowden RM, 2010. Understanding the vertebrate immune system: insights from the reptilian perspective. J Exp Biol 213: 661-671.

17. Zapata AG, Varas A, Torroba M, 1992. Seasonal variations in the immune system of lower vertebrates. Immunol Today 13: 142-147.

18. Lambert AJ, Martin DA, Lanciotti RS, 2003. Detection of North American eastern and western equine encephalitis viruses by nucleic acid amplification assays. J Clin Microbiol 41: 379-385.

19. Volchkov VE, Volchkova VA, Netesov SV, 1991. [Complete nucleotide sequence of the Eastern equine encephalomyelitis virus genome]. Mol Gen Mikrobiol Virusol: 8-15.

20. 2011. Real-time RT-PCR Arbovirology Protocol – 2011: Florida Department of Health, Bureau of Laboratories - Tampa.

21. Burkett-Cadena ND, McClure CJ, Ligon RA, Graham SP, Guyer C, Hill GE, Ditchkoff SS, Eubanks MD, Hassan HK, Unnasch TR, 2011. Host reproductive phenology drives seasonal patterns of host use in mosquitoes. PLoS One 6: e17681.

22. Karstad L, 1961. Reptiles as possible reservoir hosts for Eastern Encephalitis virus. Trans. 26th N. Am. Wildlife Conf.: 186-202.

23. Dalrymple JM, Young OP, Eldridge BF, Russell PK, 1972. Ecology of arboviruses in a Maryland freshwater swamp. 3. Vertebrate hosts. Am J Epidemiol 96: 129-140.

24. Gebhardt LP, Hill DW, 1960. Overwintering of Western Equine Encephalitis Virus. Proceedings of the Society for Experimental Biology and Medicine. Society for Experimental Biology and Medicine (New York, N.Y.) 104: 695-698.

25. Thomas LA, Eklund CM, 1962. Overwintering of western equine encephalomyelitis virus in garter snakes experimentally infected by Culex tarsalis . Proc Soc Exp Biol Med 109: 421-424.

26. Gebhardt LP, Stanton GJ, Hill DW, Collett GC, 1964. Natural overwintering hosts of the virus of western equine encephalitis. N Engl J Med 271: 172-177.

27. Thomas LA, Eklund CM, Rush WA, 1958. Susceptibility of garter snakes ( Thamnophis spp.) to western equine encephalomyelitis virus. Proc Soc Exp Biol Med 99: 698-700.

28. Gebhardt LP, Stanton GJ, De St Jeor S, 1966. Transmission of WEE virus to snakes by infected Culex tarsalis mosquitoes. Proc Soc Exp Biol Med 123: 233-235.

29. Allen FW, McDaniel EC, 1937. A study of the relation of temperature to antibody formation in cold-blooded animals. The Journal of Immunology 32: 143-152.

30. Tait NN, 1969. The effect of temperature on the immune response in cold-blooded vertebrates. Physiological Zoology 42: 29-35.

31. Le Morvan C, Troutaud D, Deschaux P, 1998. Differential effects of temperature on specific and nonspecific immune defences in fish. J Exp Biol 201: 165-168.

32. Rätti O, Dufva R, Alatalo RV, 1993. Blood parasites and male fitness in the pied flycatcher. Oecologia 96: 410-414.

33. Daviews CR, Ayres JM, Dye C, Deane LM, 1991. Malaria infection rate of Amazonian primates increases with body weight and group size. Functional Ecology 5: 655-662. 34. Poulin R, 1996. Sexual inequalities in helminth infections: A cost of being a male? The American Naturalist 147: 287-295.

35. Zuk M, McKean KA, 1996. Sex differences in parasite infections: patterns and processes. Int J Parasitol 26: 1009-1023.

36. Blem CR, Blem LB, 1995. The eastern cottonmouth ( Agkistrodon piscivorus ) at the northern edge of Its range. Journal of Herpetology 29: 391-398.

37. Neill WT, 1948. Hibernation of Amphibians and Reptiles in Richmond County, Georgia. Herpetologica 4: 107-114.

38. Allen ER, Swindell D, 1948. Cottonmouth moccasin of Florida. Herpetologica 4: 1-16.

39. Zaidan F, 3rd, 2003. Variation in cottonmouth (Agkistrodon piscivorus leucostoma ) resting metabolic rates. Comp Biochem Physiol A Mol Integr Physiol 134: 511-523.

40. Burkett-Cadena ND, White GS, Eubanks MD, Unnasch TR, 2011. Winter biology of wetland mosquitoes at a focus of eastern equine encephalomyelitis virus transmission in Alabama, USA. J Med Entomol 48: 967-973.

41. Burkett RD, 1966. Natural History of Cottonmouth Moccasin, Agkistrodon piscivorus (Reptilia). University of Kansas Publications, Museum of Natural History 17: 435-491.

42. Scott TW, Weaver SC, 1989. Eastern equine encephalomyelitis virus: epidemiology and evolution of mosquito transmission. Adv Virus Res 37: 277-328.

CHAPTER TWO

Field Investigations of Winter Transmission of Eastern Equine Encephalitis virus in Florida

Abstract

Field studies investigating the dynamics of winter transmission of eastern equine encephalitis virus (EEEV) were conducted in Tampa, Florida to identify EEEV vectors and their associated hosts. EEEV was detected in pools of Culiseta melanura and Anopheles quadrimaculatus in February of 2012 and 2013. During winter months, herons were major hosts for Cs. melanura and Culex erraticus, primary and epizootic vectors of EEEV, respectively. In summer months, Cs. melanura females were not encountered at the same sampling locations, while Cx. erraticus was still abundant, but took fewer blood meals from herons than in winter.

Four bird species (black-crowned night heron, yellow-crowned night heron, anhinga, and great blue heron) were fed upon to a greater extent than their relative abundance predicted. Results suggest that EEEV vectors preferentially feed upon wading birds during the winter months suggesting that these birds may participate in maintaining EEEV during the winter in Florida.

Introduction

Eastern equine encephalitis virus (EEEV) is a highly pathogenic arbovirus that causes severe disease, with a mortality rate of approximately 30-35% in humans and 80-90% in horses.1

Approximately two thirds of the individuals that recover from the infection suffer from chronic neurological sequelae 1, 2 that can incur lifetime costs upwards of $3 million. 3 In the US, cases occur most frequently in the Atlantic and Gulf Coast states, with approximately six human cases

39 and 200 horse cases per year. Florida has had more human and horse cases than any other state, with an average of 1-2 human and 70 horse cases per year, respectively (FDOH unpublished data).

EEEV has been shown to infect horses, humans, birds and other animals.1, 4 The virus is maintained in an enzootic cycle between ornithophilic mosquitoes and avian reservoir hosts.1, 5

Most studies of EEEV have concentrated upon foci in the northern parts of the US. In the northeastern states, transmission is seasonal, peaking in the late summer months. 1 Passerine birds are considered to be the major reservoir hosts for EEEV in the northeastern US, with enzootic transmission between avian hosts mediated by ornithophilic Culiseta melanura mosquitoes, particularly in freshwater swamp foci. 1, 5, 6 Other mosquito species which feed upon mammals and birds, including Aedes vexans , Aedes sollicitans , and Coquillettidia perturbans , have been implicated as bridge vectors, transmitting EEEV from birds to horses and humans.7, 8, 9 In the southeastern US, some evidence suggests that Culex erraticus may play an important role both as an enzootic and bridge vector in habitats where Cs. melanura is less common.10, 11 Shifts in feeding patterns of bridge vectors from feeding on avian to mammalian hosts during the transmission season may help to facilitate transmission to horses and humans. 12, 13, 14, 15

Most of the studies examining reservoir competence have focused on passerine birds. 6, 16,

17, 18 Studies have indicated that permanent resident and summer resident birds have antibodies to

EEEV more often than transient and winter resident birds 6, 17, 19 and there is some evidence suggesting that migrating birds play a role in transportation of EEEV. 20 Many of these studies focused on passerine birds; however, recent studies have indicated that wading birds

(Ciconiiformes) are preferred hosts of potential bridge vectors of EEEV in the southeast. 21, 22, 23,

24 Few studies have looked at the exposure of wading birds to EEEV; however, one

40 seroprevalence study conducted in Louisiana found that over 80% of yellow-crowned night herons ( Nyctanassa violacea ) were seropositive for EEEV, 19 higher than any of the

Passeriformes examined and virus was isolated from one nestling. 25 Several other studies have implicated a wide variety of wading bird species as potential enzootic hosts for EEEV as well. 26,

27, 28, 29, 30 In 1962, Herman reported 8 species of Ciconiiformes (great egret ( Ardea alba ), snowy egret ( Egretta thula ), black-crowned night heron ( Nycticorax nycticorax ), green heron ( Butorides virescens ), little blue heron ( Egretta caerulea ), tricolored heron ( Egretta tricolor ), yellow- crowned night heron, and white ibis ( Eudocimus albus )) as either being naturally or experimentally infected with EEEV. 27 Experimentally infected wading and water birds have been shown to develop high enough viremias to infect mosquitoes. 18, 31, 32 In addition, Ciconiiformes, particularly the night herons, have been implicated to some extent in many other arbovirus transmission cycles including West Nile virus, 33, 34 Saint Louis encephalitis virus, 26 Venezuelan equine encephalitis virus, 35, 36, 37 Western equine encephalitis virus, 25, 38 Japanese encephalitis virus, 39, 40 and Murray Valley encephalitis virus. 41, 42

Florida is unique among US states in that EEEV transmission occurs year-round.43

Furthermore, recent phylogenetic studies have suggested that Florida may serve as a reservoir for

EEEV; the virus may periodically be introduced from Florida to the northeastern US, where it locally amplifies, overwinters, and can remain stable for several years. 44, 45, 46 If the hypothesis that Florida serves as a reservoir for EEEV for the rest of the country is correct, then transmission during the winter months in Florida, when vector densities are low, may represent a particularly vulnerable point in the viral life cycle. The present study was undertaken to investigate winter ecology of EEEV transmission with respect to relative abundance, virus

41 infection, and host use of potential vector mosquito species, focusing on wading birds as potential amplification and dissemination hosts.

Materials and Methods

Study Sites

Field work was conducted at three county parks in Hillsborough County, Florida. Lettuce

Lake Park (28°4'33.875"N, 82°22'35.837"W) is a 240-acre site along the Hillsborough River, with more than half of the park consisting of a hardwood and cypress swamp and the remainder consisting of hardwood hammocks and pine flatwoods. The park is named after a shallow dead- end offshoot of the river which is dominated by water lettuce (Pistia stratiotes ), a floating aquatic plant. The second site, John B. Sargeant Park (28°4'57.793"N, 82°17'10.991W), is a 23- acre site also along the Hillsborough River, dominated by cypress and hardwood swamps. The third site, Eureka Springs Park (28°0'22.928"N, 82°20'41.529"W), is a 31-acre park with a floodplain forest of maple, cypress, and tupelo.

Mosquito Collection

The mosquito population at each site (park) was sampled weekly during winter months using three methods: resting shelters, carbon dioxide-baited light traps and vegetation sweeps.

Resting mosquitoes were collected from wire frame shelters that served as artificial resting sites. 47 Six resting shelters were sampled at each site, spaced approximately 50 meters apart along designated trails. Mosquitoes were aspirated during morning hours (0800-1030h) from the resting stations using a modified Dustbuster ® and a piece of white corrugated plastic cardboard with a 10 cm diameter hole cut in it. 48 Mosquitoes resting in vegetation were also sampled during morning hours (0800-1030h) with vegetation sweeps. Low-growing herbaceous vegetation was swept using a heavy-duty sweep net along two predetermined paths and contents of the net

42 vacuumed. Host-seeking mosquitoes were sampled using two CO 2–baited light traps at each site.

Traps were set shortly before dusk, and retrieved the following morning, at which time resting mosquitoes were collected. Samples were collected weekly at Lettuce Lake Park from January through March 2012 and December through March 2013. Samples were collected weekly from the other two sites from December 2012 through March 2013. Mosquitoes were also collected from artificial resting shelters at Lettuce Lake Park from June through August 2011 for comparison. Field-collected mosquitoes were returned to the laboratory for identification, pool- screening, and blood meal analysis.

Detection of Virus in Mosquito Pools

Mosquitoes were sorted by species, collection date, and collection site into pools of 50 individuals or fewer. A copper BB and 1 ml of BFD (biological field diluent; 90% minimum essential medium with Hanks’ salts, 10% fetal bovine serum, 200 U/ml penicillin, 200 µg/ml streptomycin, 2.5 µg/ml amphotericin B, and 50 µg/ml kanamycin) were added to each pool and mosquitoes were homogenized using a high-speed mechanical homogenizer (TissueLyser;

Qiagen, Valencia, CA). RNA was prepared from 140 µL of the supernatant using the QIAamp

Viral RNA Mini Kit (Qiagen, Valencia, CA) following the manufacturer’s conditions. The

Qiacube platform (Qiagen, Valencia, CA) was used to automate RNA extraction and the isolated

RNA (eluted into 60 µl of nuclease free water) was stored at -80°C. Real time RT-PCR was then conducted using the iScript one step RT-PCR kit for probes (Bio-Rad, Hercules, CA) according to the manufacturer’s protocol. The primers and reaction conditions used to detect EEEV RNA were those recommended by Lambert and others, 49 with the exception that reactions were performed in a final volume of 25 µL, and used 5 µL of the RNA template. Samples producing a signal at a Ct value of 37 or below were considered putatively positive.

RNA samples found to be putatively positive in the initial assay were subjected to the confirmatory qRT-PCR assay provided by the Centers for Disease Control and Prevention to state Department of Health Laboratories conducting arboviral surveillance activities. 50 The confirmatory assay employed two primers (5' ACCTTGCTGACGACCAGGTC 3' and 5'

GTTGTTGGTCGCTCAATCCA 3') that produced an amplicon spanning positions 9428-9497 in the EEEV genome. The 5’ 6-FAM, 3’ BHQ1a-Q probe used in this assay contained the sequence

5' CTTGGAAGTGATGCAAATCCAACTCGACA 3', spanning positions 9449-9477 in the genome. Samples were only considered to be positive if they produced a detectable amplicon in both assays.

Virus isolation was attempted from all confirmed qRT-PCR positive samples by inoculating individual T-25 flasks of confluent Vero cell cultures with 1 mL of filtered mosquito pool supernatant. Flasks were incubated for two hours at 37°C, with gentle rocking every 15 minutes. After the incubation, 9 mL of maintenance media (1× Earle's minimal essential medium, 2% fetal bovine serum, 200 U/mL penicillin, 200 µg/mL streptomycin, 2.5 µg/mL amphotericin B) were added to each flask. Cells were then monitored daily for cytopathic effect

(CPE).

Blood Meal Analysis

Individual blood engorged female mosquitoes were homogenized in 200 µL DNAzol reagent (Molecular Research Center Inc., Cincinnati, OH) using a disposable plastic pestle.

Samples were incubated for ten minutes at room temperature, centrifuged and the supernatant transferred to a new tube. In order to precipitate the DNA, 80 µl of isopropanol was added. The solution was then mixed and incubated for five minutes at room temperature. The sediment was precipitated by centrifugation at 4,000 xg for ten minutes. Following centrifugation, the pellet

44 was washed twice with 1 ml of 75% ethanol and the DNA dissolved with 50 µl of Tris-EDTA buffer (Tris-EDTA, pH 8.0, Boston Bioproducts, Ashland, MA). Isolated DNA was stored at -

80°C until further testing.

The identification of the blood meals from the extracted DNA employed two polymerase chain reaction (PCR)-based assays. The initial nested PCR used a set of universal vertebrate primers targeting cytochrome B. 21 The first PCR reaction used the following primers: 5 ′-

CCCCTCAGAATGATATTTGTCCTCA-3′and 5 ′-CCATCCAACATCTCAGCATGATGAAA-

3′ and followed the reaction conditions outlined by Hassan and co-workers. 21 The sequences of the forward primer for the nested reaction was 5’-TCWRCHTGATGAAACTTCGG-3’where W

= A or T, R = A or G, and H = A, C or T. The non-coding primer used was a mixture of four primers with the following sequences: 5’-ACRAARGCRGTTGCTATTAG-3’, 5’-

ACRAAGGCAGTKGCTATAAG-3’, 5’-ACGAARGCRGTTGCYATGAG-3’, and 5’-

ACGAAGGCMGTKGCTATTAG-3’ where K = G or T, Y = C or T, and M = A or C. Reaction conditions were as previously described. 21

The second PCR assay used to identify blood meals used a universal vertebrate primer set targeting 16S rRNA. Primers used in the PCR were those of Kitano and co-workers 51 and were as follows: 5 ′-GCCTGTTTACCAAAAACATCAC-3′ and 5 ′-

CTCCATAGGGTCTTCTCGTCTT-3′. Reaction conditions were the same as those described previously. 52 Amplicons were purified using the QIAquick PCR purification kit (Qiagen,

Valencia, CA) and were then sent to the Eurofins MWG Operon sequencing facility (Huntsville,

AL) for analysis. Sequences were entered into the NCBI BLAST database for identification, and only those sequences with a match percentage ≥ 95% were accepted as belonging to the identified blood meal source.

Avian Surveys

Wading birds were counted through visual searches of the study areas (mosquito collecting habitats) from elevated boardwalks maintained by The Parks, Recreation and

Conservation Department of Hillsborough County at each of the parks. Wading birds were counted for each occasion that light traps were set (dusk) and again the following morning.

Data Analysis

In order to characterize the relative utilization of wading bird hosts as a blood source, forage ratios were calculated for each water bird species. 53, 54, 55 Forage ratios were calculated by dividing the percentage of blood meals obtained by Cx. erraticus for each host species of interest by the percentage that the species represented in the water bird community. The maximum count for each bird for each sampling day (dusk or dawn) was used for calculating forage ratios. 56, 57, 58

Abundance of some species of wading and water birds are difficult to estimate; 59 however, increasing number of visits has been shown to yield significant increases in cumulative species richness in wetland areas. 60 In addition, combining morning and evening samplings increases the overall detection probability for these species. 61 We calculated 95% confidence intervals for forage ratios using the formula 95% CI = (forage ratio ± 1.96*standard error). The standard error

2 (SE) was calculated using the formula SE = o(1− o)/(up ) , where o = the proportion of blood meals from a given source, u = the total number of blood meals, and p = the proportion of available host community comprised of species of interest. 54 To account for variations in bird abundances over the season, the average monthly relative abundance was used in the calculations. Avian species that were found to be fed upon by mosquitoes, but not detected in the wading bird surveys, were assigned a value of 1 individual present for calculation of avian relative abundance and forage ratios. Forge rations were not calculated for avian species for

46 which no blood meals were detected but which were identified in the point counts. Forage ratios were considered to be statistically significant when their 95% confidence interval excluded one. 54

Results

Mosquito Collections

A total of 12,260 mosquitoes representing 16 species were collected from the three sites over 116 trap nights during the winter months. Culex erraticus was the species with the highest abundance at all three sites, representing 58.0% of mosquitoes at Lettuce Lake Park, 41.9% at

John B. Sargeant Park, and 33.3% at Eureka Springs Park (Figure 2.1). Uranotaenia sapphirina was the second most abundant species at Lettuce Lake Park, representing 12.6% of the mosquitoes collected. The remaining mosquito species at Lettuce Lake Park were collected at low abundance, with each species representing 10% or less of the collected mosquitoes at the site

(Figure 2.1, Panel A). At John B. Sargeant Park, Culex nigripalpus and Anopheles quadrimaculatus were the next most abundant species, representing 21.3% and 19.9%, respectively (Figure 2.1, Panel B). The remaining mosquito species at John B. Sargeant Park were collected at low abundance, with each species representing less than 10% of the collected mosquitoes at the site. At Eureka Springs Park, Culex nigripalpus and Anopheles crucians were the next most abundant species, representing 32.4% and 24.0%, respectively (Figure 2.1, Panel

C). Culiseta melanura was present at low numbers at all three study sites, representing less than

5% of the collections. Other species collected in low numbers at the three sites included Culex territans, Culex peccator , Aedes infirmatus , Anopheles perplexens , Coquillettidia perturbans ,

Culex coronator , Culex peccator , Culex salinarius , Mansonia titillans , Uranotaenia lowii , and

Wyeomyia mitchellii . Each of these species represented less than 2% of the collections from the sites or was not present at all sites.

Overall, mosquito abundances were higher in the second year of the study (December

2012-March 2013 winter season) than in the first year (January-March 2012 season) (Fig. 2, panels A and B). In general, abundance of host-seeking females was greatest in January in both years (Figure 2.2, Panels A and B), with few mosquitoes collected in weeks leading up to the end of the collection season in March. The one exception to this pattern was a peak of An. crucians that was observed in March, 2012 (Figure 2.2, Panel B). Culex erraticus was abundant during both winters, and was the only mosquito species collected during every month of sampling. In

January of 2013, abundance of this mosquito was greater than any point during the entire study, with an average of 313.8 females collected per trap night the second week of January. Culiseta melanura was present, although not particularly abundant, throughout both winters.

Quantitative RT-PCR assays to detect EEEV were conducted on all non-engorged mosquitoes collected during both winter seasons. Of 455 total mosquito pools tested for EEEV, two pools were confirmed positive for EEEV; a pool of Cs. melanura collected at Lettuce Lake

Park in February 2012 and a pool of An. quadrimaculatus collected at John B. Sargeant Park in

February 2013. The overall seasonal minimum infection rate (MIR) was 22.2 for Cs. melanura and 1.54 for An. quadrimaculatus , while the monthly MIRs were 58.82 for Cs. melanura and

7.19 for An. quadrimaculatus . Attempts to culture virus from both isolates were not successful.

Blood Meal Analysis - Winter Months

A total of 724 blood-engorged mosquitoes representing eight species were collected during the two winter sampling periods (Table 2.1). Of these, 701 (96.8%) blood meals were successfully identified to the host species level. The most commonly collected blood-fed species

48 was Cx. erraticus with 500 blood meals identified. The percentages of blood meals identified by host class varied among the mosquito species. Birds were the predominant winter hosts for

Cx. erraticus , Cx. nigripalpus , Cx. peccator , and Cs. melanura . Culiseta melanura had the highest proportion of avian blood meals (88.3%) among the eight mosquito species. For An. crucians , An. perplexens , and An. quadrimaculatus , the majority of blood meals were from mammalian hosts; however, these species also fed to some extent on avian hosts. Amphibians were the main hosts for Cx. territans . Culex territans and Cx. erraticus were the only mosquito species found to feed upon all four host classes. Reptilian blood meals were mainly derived from alligators ( Alligator mississippiensis ) and the green anole ( Anolis carolinensis ) while amphibian hosts included the green tree frog ( Hyla cinerea ), Southern leopard frog ( Lithobates sphenocephelus ), Cuban tree frog ( Osteopilus septentrionalis ) and pine woods tree frog ( Hyla femoralis ).

All eight species of mosquitoes fed upon both avian and mammalian hosts. A total of nine mammalian species were identified as hosts (Table 2.2). White tailed deer ( Odocoileus virginianus ) was a major host among mammals, representing more than half of the mammal- derived blood meals for Cx. erraticus (54.9%), An. crucians (63.2%) and An. quadrimaculatus

(51.7%). Humans ( Homo sapiens ) also represented important hosts, making up 29.1% of Cx. erraticus mammalian-derived blood meals, as well as 6/7 (85.7%) of the mammal-derived blood meals of Cs. melanura .

A total of 35 avian species were identified as hosts for the wintertime mosquito community during this study (Table 2.3). The vast majority of the avian blood meals came from wading birds. Seven of eight mosquito species fed upon wading birds to some extent. The only species not found to feed on wading birds, An. perplexens , had a single bird-derived blood meal

(of seven total) from the Eastern phoebe ( Sayornis phoebe ). Anopheles crucians and An. quadrimaculatus took 13.6% and 14.7% of total blood meals from avian hosts, respectively.

Wading birds were major avian hosts for Cx. erraticus and Cs. melanura , comprising 82.3% and

39.6%, respectively, of the total avian-derived blood meals for these species. Culex erraticus fed on 20 different bird species, 12 of which were water birds. The four most commonly fed upon birds were represented by three species of wading birds (black-crowned night heron, yellow- crowned night heron, and great blue heron ( Ardea herodias )) and one species of water bird

(anhinga ( Anhinga anhinga )). Half (50.2%) of all avian-derived blood meals of Cx. erraticus came from night herons (black-crowned and yellow-crowned). Culiseta melanura fed on 21 bird species (7 species of water birds and 11 species of passerine birds). Just over half (50.9%) of avian-derived blood meals of Cs. melanura were from passerine birds, with the northern cardinal

(Cardinalis cardinalis ) contributing a quarter 24.5% of the total avian meals. By contrast, the northern cardinal represented just two (of 305 total) Cx. erraticus avian blood meals.

Host Utilization by Culex erraticus

For Lettuce Lake Park (Fig. 3, panel A), the forage ratios of Cx. erraticus for anhinga, black-crowned night heron, great blue heron, wood stork ( Mycteria americana ), and yellow- crowned night heron were significantly greater than one, indicating that these species were fed upon more frequently than would be expected based upon their relative abundance. These forage ratios ranged from 2.065 (wood stork) to 7.597 (black-crowned night heron). Green heron, limpkin ( Aramus guarauna ), pied-billed grebe ( Podilymbus podiceps ), and Wilson’s snipe

(Gallinago delicata ) also had forage ratios greater than one, but these were not statistically significant due in part to their large 95% confidence intervals. The Muscovy duck ( Cairina moschata ) and white ibis were the only species with forage ratios significantly less than one, and

50 were therefore underutilized as hosts. At John B. Sargeant Park (Fig. 3, panel B), forage ratios for the anhinga, great blue heron, and green heron were all significantly greater than one. Too few avian blood meals were identified from Eureka Springs Park (five total) to calculate realistic forage ratios. However, all 5 Cx. erraticus avian blood meals from this site were from wading birds, even though few wading birds were recorded at this site. Several species of birds were not present in the blood meals but were present in the avian survey; however this varied by location

(Table 2.4). Conversely, there were also several species of birds that were not present in the avian survey but were present in the blood meals. Both the roseate spoonbill and the snowy egret were present at multiple sites but were not detected in any mosquito blood meals.

Host Utilization - Summer and Winter Comparisons

During the summer months of 2011, 145 blood-engorged Cx. erraticus females were collected from Lettuce Lake Park and the blood-meal source of 138 (95.2%) of these were identified to the species level. Culex erraticus fed upon 7 species of mammals, 13 species of birds, one species of amphibians, and 3 species of reptiles during the summer months (Fig. 4).

Many of these blood meals came from mammals (44.9%), with the vast majority of the total blood meals being from white tailed deer (18.1%) and humans (21.7%). Additional mammalian blood meals included the bobcat ( Lynx rufus ), brown rat ( Rattus norvegicus ), dog ( Canis lupus familiaris ), raccoon ( Procyon lotor ), and wild boar ( Sus scrofa ), each of which made up less than

5% of the total blood meals. Alligators made up a large portion (17.4%) of the blood meals as well. The remaining reptilian blood meals came from brown water snake ( Nerodia taxispilota , n=1) and pond slider turtle ( Trachemys scripta , n=1). A total of 34.7% of Cx. erraticus blood meals came from avian hosts during the summer months, in contrast to the winter months, when avian hosts made up 61.0% meals. Five species of wading birds (black-crowned night heron,

51 great blue heron, limpkin, little blue heron, and yellow-crowned night heron) and two species of water birds (anhinga and pied-billed grebe) were each fed upon less than 10% of the time in the summer months. The only passerine bird species found to be fed upon was northern cardinal

(2.9%). Additional avian species included barred owl ( Strix varia ), chicken ( Gallus gallus domesticus ), great horned owl ( Bubo virginianus ), osprey ( Pandion haliaetus ), and wild turkey

(Meleagris gallopavo ), which were all fed upon in small numbers.

Discussion

This field investigation found that vectors of EEEV were present and often abundant during the winter, that wading birds were important hosts for Cs. melanura and Cx. erraticus during the winter, and that EEEV-infected mosquitoes are actively host-seeking during the winter at wetlands in peninsular Florida. EEEV was detected in mosquitoes in Hillsborough

County, Florida twice during winter months of the study. During the months of December through March in the years 2005-2010, 126 EEEV sentinel chicken seroconversions and 31

EEEV horse cases occurred in Florida (FDOH unpublished data). Winter transmission of EEEV in Hillsborough County has also been documented, with sentinel chicken seroconversions occurring during the study period, as well as one human case reported in March, 2013 (FDOH unpublished data). Although no sentinel chickens seroconverted at the Lettuce Lake Park sampling site during the study period, EEEV activity has been noted in the sentinel chickens maintained at this location in the past (FDOH unpublished data).

Both EEEV positive mosquito pools were from collections made during February, when mosquito abundance was relatively low. Both of the positive mosquito species ( Cs. melanura and An. quadrimaculatus ) have been shown to be competent vectors of EEEV, suggesting that these isolations represented evidence for ongoing winter transmission at the site. 7, 62, 63, 64

Culex erraticus was the most abundant mosquito at these wetland sites during the winter months, a finding that corroborates those of other studies conducted in the southeastern US. 10, 65,

66 While EEEV was not detected in Cx. erraticus pools during this study, this mosquito is a suspected bridge vector for EEEV, and has been shown to be a competent vector for the virus. 7

Isolations of EEEV from Cx. erraticus mosquito pools in Florida have been demonstrated in the past. 67, 68 Several studies have also found EEEV circulating during patterns of high Cx. erraticus and low Cs. melanura abundances.10 Theoretical models used for other arboviruses have indicated that having multiple vector species improves long-term virus persistence and species that are active in the winter could enable virus persistence 69 until another vector becomes active in spring. 70

All eight blood fed mosquito species collected during the winter months fed on mammalian hosts to some extent in this study. The three blood-fed Anopheles species collected in this study, An. crucians , An. quadrimaculatus , and An. perplexens , fed more upon mammals than any other host class. The propensity for feeding on mammalian hosts shown by these species is well established, 65, 71, 72, 73 though this study to our knowledge is the first to identify hosts for An. perplexens in Florida. The main mammalian host for An. quadrimaculatus and An. crucians as well as Cx. erraticus was the white tailed deer. White tailed deer are frequently exposed to EEEV in the wild 29, 74 and several cases of clinical EEE have also been reported in this species. 75, 76 The role that white tailed deer play in the transmission cycle of EEEV, however, remains unclear.

Another mammal commonly fed upon was humans. The relatively high preponderance of human blood meals seen in Cx. erraticus (29.1% of mammalian derived blood meals) and the 6

(10%) seen in Cs. melanura samples highlights the threat that these species may directly pose to

53 humans, as bridge vectors of EEEV. Although Cs. melanura is often considered to be an ornithophilic mosquito, the occasional feeding of Cs. melanura on humans has been documented previously. 71, 77

The most commonly fed upon host class overall were avian hosts. All eight blood fed mosquito species fed on birds during the winter months, even those species that are known to feed predominantly on mammals ( An. crucians and An. quadrimaculatus) or reptiles and amphibians ( Cx. territans and Cx. peccator ). 52, 78 The few avian blood meals for these species were mainly represented by wading or water bird species. Interestingly, An. quadrimaculatus s.l., one of the mosquito species positive for EEEV during this study, fed upon a wide variety of birds, including anhinga, raptors (barred owl and black vulture) and wading birds (wood stork and yellow-crowned night heron).

The enzootic vector of EEEV, Culiseta melanura , also fed predominantly on birds.

Previous studies have found that this ornithophilic species feeds predominantly on passerine birds. 77, 79 In this study, the majority of females fed upon passerine birds (50.9%), but a relatively large percentage also fed on wading birds during the winter months (39.6%). Other studies have shown Cs. melanura feeding on wading birds, but to a smaller extent, representing around 7-15% of blood meals. 22 It has been shown in other studies in Florida, however, that Cs. melanura may feed on Ciconiiformes at greater levels than would be expected from their relative abundance. 79

No blood engorged females of Cs. melanura were collected during the summer months, so no conclusions could be made between host utilization between the two seasons. Nonetheless, our finding that Cs. melanura took a large fraction of total bloodmeals (nearly 40%) from wading birds in the winter is of interest, since this mosquito is considered the primary enzootic vector of

EEEV in North America.

Culex erraticus fed upon all four host classes; however, the majority of females fed upon avian hosts. This catholic feeding pattern of Cx. erraticus has also been shown in other studies. 23,

24, 65, 80 The main avian hosts utilized by Cx. erraticus in this study were wading and water birds, representing 82.3% and 15.1% of avian blood meals, respectively. Other studies in the southeastern US conducted during different times of the year have shown a strong preference of

Cx. erraticus for water/wading birds. 21, 22, 23, 24 A similar preference for herons, especially black- crowned night herons, was recently seen in Colombia as well. 81 In contrast, passerine birds were fed upon to a much smaller extent by Cx. erraticus . In addition, a statistically significant preference by Cx. erraticus for several species of water and wading birds was seen, including the anhinga, black-crowned night heron, great blue heron, green heron, wood stork, and yellow- crowned night heron. Several other wading birds had an increased preference but the preference did not reach statistical significance. This was due to a lack of power resulting from the bird species in question not being observed during the avian surveys or due to low numbers of blood meals identified from these species.

The stalking and nesting behaviors exhibited by many species of wading birds may influence their ability to serve as a potential enzootic hosts for EEEV. Night herons stand still for long periods of time as they forage for food and have decreased anti-mosquito behavior compared to other species including other Ciconiiformes, allowing many mosquitoes to feed upon them. 82, 83, 84, 85, 86 However, in these studies, the authors concluded that anti-mosquito behavior couldn’t explain all the variation in feeding preference by mosquitoes, 82 suggesting an innate preference for these species.

While birds were the most commonly fed upon host class for Cx. erraticus during the winter months, mammals were more commonly fed upon during the summer. Almost 45% of

55 females fed upon mammalian hosts in the summer months, particularly humans (21.7% of total blood meals). Humans only made up 10.2% of the total blood meals in the winter months, indicating an increased risk of exposure for mammalian species to EEEV during the summer.

These results indicate a shift in feeding behavior occurring somewhere between the winter and summer months. Such a biphasic pattern of feeding has also been seen in studies of other mosquito species, and has been hypothesized to play an important role in arboviral transmission and amplification. 12, 13, 14, 15 One reason for this may be an increased abundance of wading birds at our study sites in the winter months due to the in migration of these species, which augment the year round resident populations. 87, 88 However, the four most commonly fed upon avian species during the winter months were still among the most often fed upon avian hosts in the summer, although they were targeted to a lesser extent than in the winter, suggesting that these species remain popular hosts year round, despite the seasonal fluctuations in their numbers.

In summary, the data presented above demonstrates a preference for feeding on water birds and wading birds among many mosquito species, notably Cx. erraticus and Cs. melanura , during the winter months. Given that previous studies have shown these to be competent enzootic hosts for EEEV, it is possible that these species may play a role in maintaining EEEV transmission during the winter months in Florida, and perhaps in disseminating the virus to the northeastern states during their spring migration. Further research will be needed to investigate the role of wading birds in these processes.

Tables and Figures

Table 2.1 Proportion of blood meals taken from different host classes during the winter months

______Percentage feeding on b ______Species ID/Tested a Avian Mammalian Reptile Amphibian ______Anopheles crucians 22/22 13.6 ± 14.3 86.4 ± 14.3 0 0 Anopheles perplexens 7/7 14.3 85.7 0 0 Anopheles quadrimaculatus 34/34 14.7 ± 11.9 85.3 ± 11.9 0 0 Culex erraticus 500/518 61.0 ± 4.3 35.0 ± 4.2 3.2 ± 1.5 0.8 ± 0.8 Culex nigripalpus 40/40 75.0 ± 13.4 20.0 ± 12.4 0 5.0 ± 6.8 Culex peccator 7/8 71.4 28.6 0 0 Culex territans 31/35 9.7 ± 10.4 12.9 ± 11.8 6.4 ± 8.6 71.0 ± 16.0 Culiseta melanura 60/60 88.3 ± 8.1 11.7 ± 8.1 0 0 ______aOnly mosquito species for which the number of blood meals identified was greater than 5 are shown. b95% confidence intervals are provided for species where the number of samples identified was greater than or equal to 20.

Table 2.2 Blood meals from mammalian hosts during the winter months ______

Anopheles Anopheles Anopheles Culex Culex Culex Culex Culiseta Host species crucians perplexens quadrimaculatus erraticus nigripalpus peccator territans melanura (n=19/22) (n=6/7) (n=29/34) (n=175/500) (n=8/40) (n=2/7) (n=4/31) (n=7/60) ______

Cow ( Bos taurus ) 1 0 5 9 1 0 0 0 Dog ( Canis lupus familiaris ) 0 0 0 2 0 0 0 0 Eastern cottontail rabbit ( Sylvilagus floridanus ) 3 3 1 12 2 0 0 0 Human ( Homo sapiens ) 2 3 0 51 3 0 3 6 Marsh rabbit ( Sylvilagus palustris ) 0 0 0 2 0 0 0 0 Raccoon ( Procyon lotor ) 0 0 2 3 2 0 0 0 Virginia opossum ( Didelphis virginiana ) 0 0 1 0 0 0 0 0 White tailed deer ( Odocoileus virginianus ) 12 0 15 96 0 1 1 1 Wild boar ( Sus scrofa ) 1 0 5 0 0 1 0 0 ______The numerator under each mosquito species name indicates the number of blood meals from mammals, while the denominator indicates the total number of blood meals identified (from all host classes) for that mosquito species.

Table 2.3 Number of blood meals from avian hosts during the winter months ______Anopheles Anopheles Anopheles Culex Culex Culex Culex Culiseta Host species crucians perplexens quadrimaculatus erraticus nigripalpus peccator territans melanura (n=3/22) (n=1/7) (n=5/34) (n=305/500) (n=30/40) (n=5/7) (n=3/31) (n=53/60) ______

American bittern ( Botaurus lentiginosus ) 0 0 0 1 0 0 0 1 Anhinga ( Anhinga anhinga ) 0 0 1 41 5 0 0 1 Black-crowned night heron (Nycticorax nycticorax ) 2 0 0 110 1 2 0 12 Eastern phoebe ( Sayornis phoebe ) 0 1 0 0 0 0 0 2 Great blue heron ( Ardea herodias ) 1 0 0 33 4 2 0 1 Great egret ( Ardea alba ) 0 0 0 23 0 0 0 0 Green heron ( Butorides virescens ) 0 0 0 6 0 0 0 2 Limpkin ( Aramus guarauna ) 0 0 0 6 0 0 0 0 Little blue heron ( Egretta caerulea ) 0 0 0 0 3 0 2 0 Muscovy duck ( Cairina moschata ) 0 0 0 2 0 0 0 0 Northern cardinal ( Cardinalis cardinalis ) 0 0 0 2 0 0 1 13 Northern parula ( Parula Americana ) 0 0 0 0 0 0 0 2 Pied-billed grebe ( Podilymbus podiceps ) 0 0 0 2 0 0 0 0 Tennessee warbler ( Vermivora peregrina ) 0 0 0 1 0 0 0 4 Tufted titmouse ( Baeolophus bicolor ) 0 0 0 1 0 0 0 1 Turkey vulture ( Cathartes aura ) 0 0 1 1 10 0 0 1 White ibis ( Eudocimus albus ) 0 0 0 1 1 0 0 0 Wood stork ( Mycteria americana ) 0 0 1 28 2 1 0 2 Yellow-crowned night heron ( Nyctanassa violacea ) 0 0 1 43 1 0 0 3 Other Passeriformes species (n=8) a 0 0 0 2 0 0 0 6 Other avian species (n=8) b 0 0 1 2 3 0 0 2 ______aOnly avian species with more than one mosquito blood meal identified are listed. Passeriformes species not included in the table were Carolina wren (Thryothorus ludovicianus ) and Florida scrub jay ( Aphelocoma coerulescens ), for Cx. erraticus; blue jay (Cyanocitta cristata ), hermit thrush ( Catharus guttatus ), house wren ( Troglodytes aedon ), loggerhead shrike ( Lanius ludovicianus ), pine warbler ( Dendroica pinu ), and white breasted nuthatch ( Sitta carolinensis ) for Cs. melanura . bOther avian species include barred owl ( Strix varia ) for An. quadrimaculatus ; great horned owl ( Bubo virginianus ) and Wilson’s snipe ( Gallinago delicata ) for Cx. erraticus ; black vulture ( Coragyps atratus ), mourning dove ( Zenaida macroura ), and osprey ( Pandion haliaetus ) for Cx. nigripalpus ; chicken (Gallus gallus ) and wild turkey ( Meleagris gallopavo ) for Cs. melanura. The numerator under each mosquito species name indicates the number of blood meals from birds, while the denominator indicates the total number of blood meals identified (from all host classes) for that mosquito species.

Table 2.4 Average monthly water bird abundance and proportion of Cx. erraticus blood meals during the winter months

Average Monthly Relative Blood Meal Proportion

Abundance (SD) a Avian ± CI b Lettuce Lake Park Anhinga 0.030 (0.009) 0.128 ± 0.039 Black-crowned night heron 0.051 (0.036) 0.390 ± 0.057 Double crested cormorant 0.007 (0.006) 0 Duck (Mottled, Muscovy, Whistling) 0.050 (0.032) 0.007 ± 0.010 Great blue heron 0.032 (0.019) 0.082 ± 0.032 Great egret 0.073 (0.021) 0.078 ± 0.031 Green heron 0 0.007 ± 0.010 Limpkin 0.010 (0.004) 0.021 ± 0.017 Little blue heron 0.020 (0.009) 0 Pied-billed grebe 0 0.007 ± 0.010 Roseate spoonbill 0.012 (0.015) 0 Snowy egret 0.004 (0.002) 0 White ibis 0.607 (0.113) 0.004 ± 0.007 Wilson’s snipe 0 0.004 ± 0.007 Wood stork 0.048 (0.041) 0.100 ± 0.035 Yellow-crowned night heron 0.056 (0.025) 0.145 ± 0.041 John B. Sargeant Park American bittern 0 0.056 ± 0.106 Anhinga 0.060 (0.028) 0.288 ± 0.207 Great blue heron 0.029 (0.026) 0.389 ± 0.225 Great egret 0.054 (0.020) 0.056 ± 0.106 Green heron 0.001 (0.002) 0.222 ± 0.192 Limpkin 0.007 (0.010) 0 Little blue heron 0.067 (0.051) 0 Roseate spoonbill 0.001 (0.002) 0 Snowy egret 0.002 (0.002) 0 Tricolored heron 0.009 (0.009) 0 White ibis 0.748 (0.134) 0 Wood stork 0.016 (0.007) 0 Eureka Springs Park Great blue heron 0 0.600 ± 0.429 Great egret 0.599 (0.468) 0 Limpkin 0.028 (0.056) 0 White ibis 0.337 (0.398) 0 Wood stork 0.036 (0.071) 0 Yellow-crowned night heron 0 0.400 ± 0.429 a Relative abundance was calculated from the average monthly abundance by dividing the number of birds of that species by the total number of water birds that month. b95% confidence intervals are provided for blood meal proportions.

Figure 2.4 Distribution of hosts fed upon by Cx. erraticus collected from Lettuce Lake Park, summer 2011. Numbers over bars indicate total number of blood meals identified for each host class.

References

1. Scott TW, Weaver SC, 1989. Eastern equine encephalomyelitis virus: epidemiology and evolution of mosquito transmission. Adv Virus Res 37: 277-328.

2. Feemster RF, Wheeler RE, Daniels JB, Rose HD, Schaeffer M, Kissling RE, Hayes RO, Alexander ER, Murray WA, 1958. Field and laboratory studies on equine encephalitis. N Engl J Med 259: 107-113.

3. Villari P, Spielman A, Komar N, McDowell M, Timperi RJ, 1995. The economic burden imposed by a residual case of eastern encephalitis. Am J Trop Med Hyg 52: 8-13.

4. Kissling RE, 1958. Host relationship of the arthropod-borne encephalitides. Ann N Y Acad Sci 70: 320-327.

5. Morris CD, 1988. Eastern equine encephalomyelitis. Monath TP, ed. The arboviruses: epidemiology and ecology. Boca Raton, FL: CRC Press, 1-20.

6. Crans WJ, Caccamise DF, McNelly JR, 1994. Eastern equine encephalomyelitis virus in relation to the avian community of a coastal cedar swamp. J Med Entomol 31: 711-728.

7. Chamberlain RW, Sikes RK, Nelson DB, Sudia WD, 1954. Studies on the North American arthropod-borne encephalitides. VI. Quantitative determinations of virus- vector relationships. Am J Hyg 60: 278-285.

8. Crans WJ, McNelly J, Schulze TL, Main A, 1986. Isolation of eastern equine encephalitis virus from Aedes sollicitans during an epizootic in southern New Jersey. J Am Mosq Control Assoc 2: 68-72.

9. Crans WJ, Schulze TL, 1986. Evidence incriminating Coquillettidia perturbans (Diptera: Culicidae) as an epizootic vector of eastern equine encephailitis. I. Isolation of EEE virus from C. perturbans during an epizootic among horses in New Jersey. Bull Soc Vector Ecol 11: 178-184.

10. Cupp EW, Klingler K, Hassan HK, Viguers LM, Unnasch TR, 2003. Transmission of eastern equine encephalomyelitis virus in central Alabama. Am J Trop Med Hyg 68: 495- 500.

11. Cupp EW, Tennessen KJ, Oldland WK, Hassan HK, Hill GE, Katholi CR, Unnasch TR, 2004. Mosquito and arbovirus activity during 1997-2002 in a wetland in northeastern Mississippi. J Med Entomol 41: 495-501.

12. Burkett-Cadena ND, McClure CJ, Ligon RA, Graham SP, Guyer C, Hill GE, Ditchkoff SS, Eubanks MD, Hassan HK, Unnasch TR, 2011. Host reproductive phenology drives seasonal patterns of host use in mosquitoes. PLoS One 6: e17681.

13. Kilpatrick AM, Kramer LD, Jones MJ, Marra PP, Daszak P, 2006. West Nile virus epidemics in North America are driven by shifts in mosquito feeding behavior. PLoS Biol 4: e82.

14. Molaei G, Andreadis TG, Armstrong PM, Anderson JF, Vossbrinck CR, 2006. Host feeding patterns of Culex mosquitoes and West Nile virus transmission, northeastern United States. Emerg Infect Dis 12: 468-474.

15. Edman JD, Taylor DJ, 1968. Culex nigripalpus : seasonal shift in the bird-mammal feeding ratio in a mosquito vector of human encephalitis. Science 161: 67-68.

16. Dalrymple JM, Young OP, Eldridge BF, Russell PK, 1972. Ecology of arboviruses in a Maryland freshwater swamp. 3. Vertebrate hosts. Am J Epidemiol 96: 129-140. 17. Emord DE, Morris CD, 1984. Epizootiology of eastern equine encephalomyelitis virus in upstate New York, USA. VI. Antibody prevalence in wild birds during an interepizootic period. J Med Entomol 21: 395-404.

18. Kissling RE, Chamberlain RW, Sikes RK, Eidson ME, 1954. Studies on the North American arthropod-borne encephalitides. III. Eastern equine encephalitis in wild birds. Am J Hyg 60: 251-265.

19. Kissling RE, Chamberlain RW, Nelson DB, Stamm DD, 1955. Studies on the North American arthropod-borne encephalitides. VIII. Equine encephalitis studies in Louisiana. Am J Hyg 62: 233-254.

20. Lord RD, Calisher CH, 1970. Further evidence of southward transport of arboviruses by migratory birds. Am J Epidemiol 92: 73-78.

21. Hassan HK, Cupp EW, Hill GE, Katholi CR, Klingler K, Unnasch TR, 2003. Avian host preference by vectors of eastern equine encephalomyelitis virus. Am J Trop Med Hyg 69: 641-647.

22. Estep LK, McClure CJ, Burkett-Cadena ND, Hassan HK, Hicks TL, Unnasch TR, Hill GE, 2011. A multi-year study of mosquito feeding patterns on avian hosts in a southeastern focus of eastern equine encephalitis virus. Am J Trop Med Hyg 84: 718- 726.

23. Oliveira A, Katholi CR, Burkett-Cadena N, Hassan HK, Kristensen S, Unnasch TR, 2011. Temporal analysis of feeding patterns of Culex erraticus in central Alabama. Vector Borne Zoonotic Dis 11: 413-421.

24. Edman JD, 1979. Host-feeding patterns of Florida mosquitoes (Diptera: Culicidae) VI. Culex (Melanoconion). J Med Entomol 15: 521-525.

25. Stamm DD, 1958. Studies on the ecology of equine encephalomyelitis. Am J Public Health Nations Health 48: 328-335.

26. Spalding MG, McLean RG, Burgess JH, Kirk LJ, 1994. Arboviruses in water birds (Ciconiiformes, Pelecaniformes) from Florida. J Wildl Dis 30: 216-221.

27. Herman CM, 1962. The role of birds in the epizootiology of eastern equine encephalitis The Auk 79: 99-103.

28. Favorite FG, 1960. Some evidence of local origin of EEE virus in Florida. Mosq News 20: 87-92.

29. Bigler WJ, Lassing E, Buff E, Lewis AL, Hoff GL, 1975. Arbovirus surveillance in Florida: wild vertebrate studies 1965-1974. J Wildl Dis 11: 348-356.

30. Gottdenker NL, Howerth EW, Mead DG, 2003. Natural infection of a great egret (Casmerodius albus ) with eastern equine encephalitis virus. J Wildl Dis 39: 702-706.

31. Aguirre AA, McLean RG, Cook RS, 1992. Experimental inoculation of three arboviruses in black-bellied whistling ducks ( Dendrocygna autumnalis ). J Wildl Dis 28: 521-525.

32. McLean RG, Crans WJ, Caccamise DF, McNelly J, Kirk LJ, Mitchell CJ, Calisher CH, 1995. Experimental infection of wading birds with eastern equine encephalitis virus. J Wildl Dis 31: 502-508.

33. Reisen WK, Wheeler S, Armijos MV, Fang Y, Garcia S, Kelley K, Wright S, 2009. Role of communally nesting ardeid birds in the epidemiology of West Nile virus revisited. Vector Borne Zoonotic Dis 9: 275-280.

34. Wheeler SS, Barker CM, Fang Y, Armijos MV, Carroll BD, Husted S, Johnson WO, Reisen WK, 2009. Differential impact of West Nile virus on California birds. Condor 111: 1-20.

35. Powers CD, Dickerman RW, 1975. Primary immunoglobulin response of herons to infection with Venezuelan encephalitis virus. Infect Immun 11: 303-308.

36. Dickerman RW, Bonacorsa CM, Scherer WF, 1976. Viremia in young herons and ibis infected with Venezuelan encephalitis virus. Am J Epidemiol 104: 678-683.

37. Bowen GS, McLean RG, 1977. Experimental infection of birds with epidemic Venezuelan encephalitis virus. Am J Trop Med Hyg 26: 808-814.

38. Reisen WK, Lundstrom JO, Scott TW, Eldridge BF, Chiles RE, Cusack R, Martinez VM, Lothrop HD, Gutierrez D, Wright SE, Boyce K, Hill BR, 2000. Patterns of avian seroprevalence to western equine encephalomyelitis and Saint Louis encephalitis viruses in California, USA. J Med Entomol 37: 507-527.

39. Scherer WF, Smith RPJ, 1960. In vitro studies on the sites of Japanese encephalitis virus multiplication in the heron, an important natural host in Japan. Am J Trop Med Hyg 9: 50-55.

40. Scherer WF, Buescher EL, McClure HE, 1959. Ecologic studies of Japanese encephalitis virus in Japan: V. Avian factors. Am J Trop Med Hyg 8: 689-697.

41. Boyle DB, Dickerman RW, Marshall ID, 1983. Primary viraemia responses of herons to experimental infection with Murray Valley encephalitis, Kunjin and Japanese encephalitis viruses. Aust J Exp Biol Med Sci 61 ( Pt 6): 655-664.

42. Marshall ID, Brown BK, Keith K, Gard GP, Thibos E, 1982. Variation in arbovirus infection rates in species of birds sampled in a serological survey during an encephalitis epidemic in the Murray Valley of South-eastern Australia, February 1974. Aust J Exp Biol Med Sci 60 (Pt 5): 471-478.

43. Bigler WJ, Lassing EB, Buff EE, Prather EC, Beck EC, Hoff GL, 1976. Endemic eastern equine encephalomyelitis in Florida: a twenty-year analysis, 1955-1974. Am J Trop Med Hyg 25: 884-890.

44. Armstrong PM, Andreadis TG, Anderson JF, Stull JW, Mores CN, 2008. Tracking eastern equine encephalitis virus perpetuation in the northeastern United States by phylogenetic analysis. Am J Trop Med Hyg 79: 291-296.

45. White GS, Pickett BE, Lefkowitz EJ, Johnson AG, Ottendorfer C, Stark LM, Unnasch TR, 2011. Phylogenetic analysis of eastern equine encephalitis virus isolates from Florida. Am J Trop Med Hyg 84: 709-717.

46. Young DS, Kramer LD, Maffei JG, Dusek RJ, Backenson PB, Mores CN, Bernard KA, Ebel GD, 2008. Molecular epidemiology of eastern equine encephalitis virus, New York. Emerg Infect Dis 14: 454-460.

47. Burkett-Cadena ND, 2011. A wire-frame shelter for collecting resting mosquitoes. J Am Mosq Control Assoc 27: 152-155.

48. Burkett-Cadena ND, Eubanks MD, Unnasch TR, 2008. Preference of female mosquitoes for natural and artificial resting sites. J Am Mosq Control Assoc 24: 228-235.

49. Lambert AJ, Martin DA, Lanciotti RS, 2003. Detection of North American eastern and western equine encephalitis viruses by nucleic acid amplification assays. J Clin Microbiol 41: 379-385.

50. 2011. Real-time RT-PCR Arbovirology Protocol – 2011: Florida Department of Health, Bureau of Laboratories - Tampa.

51. Kitano T, Umetsu K, Tian W, Osawa M, 2007. Two universal primer sets for species identification among vertebrates. Int J Legal Med 121: 423-427.

52. Burkett-Cadena ND, Graham SP, Hassan HK, Guyer C, Eubanks MD, Katholi CR, Unnasch TR, 2008. Blood feeding patterns of potential arbovirus vectors of the genus Culex targeting ectothermic hosts. Am J Trop Med Hyg 79: 809-815.

53. Kay BH, Boreham PFL, Edman JD, 1979. Application of the "feeding index" concept to studies of mosquito host-feeding patterns. Mosq News 39: 68-72.

54. Manly BF, McDonald L, Thomas D, McDonald TL, Erickson WP, 2002. Resource selection by animals: statistical design and analysis for field studies. Dordrecht, The Netherlands: Kluwer Academic Publishers.

55. Hess AD, Hayes RO, Tempelis CH, 1968. The use of the forage ratio technique in mosquito host preference studies. Mosq News 28: 386-389.

56. Colwell MA, Cooper RJ, 1993. Estimates of coastal shorebird abundance: The important of multiple counts. J Field Ornithol 64: 293-412.

57. Dickson JG, 1978. Comparison of breeding bird census techniques. American Brd 32: 10-13.

58. Dieni JS, Jones SL, 2002. A field test of the area search method for measuring breeding bird populations. Journal of Field Ornithology 73: 253-257.

59. Johnson DH, Gibbs JP, Herzog M, Lor S, Niemuth ND, Ribic CA, Seamans M, Shaffer TL, Shriver WG, Stehman SV, Thompson WL, 2009. A sampling design framework for monitoring secretive marshbirds. Waterbirds 32: 203-215.

60. Tozer D, Abraham K, Nol E, 2006. Improving the accuracy of counts of wetland breeding birds at the point scale. Wetlands 26: 518-527.

61. Nadeau CP, Conway CJ, Smith BS, Lewis TE, 2008. Maximizing detection probability of wetland-dependent birds during point-count surveys in northwestern Florida. The Wilson Journal of Ornithology 120: 513-518.

62. Scott TW, Burrage TG, 1984. Rapid infection of salivary glands in Culiseta melanura with eastern equine encephalitis virus: an electron microscopic study. Am J Trop Med Hyg 33: 961-964.

63. Vaidyanathan R, Edman JD, Cooper LA, Scott TW, 1997. Vector competence of mosquitoes (Diptera:Culicidae) from Massachusetts for a sympatric isolate of eastern equine encephalomyelitis virus. J Med Entomol 34: 346-352.

64. Chamberlain RW, Corristan EC, Sikes RK, 1954. Studies on the North American arthropod-borne encephalitides: V. The extrinsic incubation of eastern and western equine encephalitis in mosquitoes. Am J Hyg 60: 269-277.

65. Cohen SB, Lewoczko K, Huddleston DB, Moody E, Mukherjee S, Dunn JR, Jones TF, Wilson R, Moncayo AC, 2009. Host feeding patterns of potential vectors of eastern equine encephalitis virus at an epizootic focus in Tennessee. Am J Trop Med Hyg 81: 452-456.

66. Burkett-Cadena ND, White GS, Eubanks MD, Unnasch TR, 2011. Winter biology of wetland mosquitoes at a focus of eastern equine encephalomyelitis virus transmission in Alabama, USA. J Med Entomol 48: 967-973.

67. Day JF, Stark LM, 1996. Transmission patterns of St. Louis encephalitis and eastern equine encephalitis viruses in Florida: 1978-1993. J Med Entomol 33: 132-139.

68. Mitchell CJ, Morris CD, Smith GC, Karabatsos N, Vanlandingham D, Cody E, 1996. Arboviruses associated with mosquitoes from nine Florida counties during 1993. J Am Mosq Control Assoc 12: 255-262.

69. Glass K, 2005. Ecological mechanisms that promote arbovirus survival: a mathematical model of Ross River virus transmission. Trans R Soc Trop Med Hyg 99: 252-260.

70. Lord CC, 2010. The effect of multiple vectors on arbovirus transmission. Isr J Ecol Evol 56: 371-392.

71. Apperson CS, Hassan HK, Harrison BA, Savage HM, Aspen SE, Farajollahi A, Crans W, Daniels TJ, Falco RC, Benedict M, Anderson M, McMillen L, Unnasch TR, 2004. Host feeding patterns of established and potential mosquito vectors of West Nile virus in the eastern United States. Vector Borne Zoonotic Dis 4: 71-82.

72. Molaei G, Farajollahi A, Armstrong PM, Oliver J, Howard JJ, Andreadis TG, 2009. Identification of bloodmeals in Anopheles quadrimaculatus and Anopheles punctipennis from eastern equine encephalitis virus foci in northeastern U.S.A. Med Vet Entomol 23: 350-356.

73. Edman JD, 1971. Host-feeding patterns of Florida mosquitoes. I. Aedes , Anopheles , Coquillettidia , Mansonia and Psorophora . J Med Entomol 8: 687-695.

74. Mutebi JP, Lubelczyk C, Eisen R, Panella N, Macmillan K, Godsey M, Swope B, Young G, Smith RP, Kantar L, Robinson S, Sears S, 2011. Using wild white-tailed deer to detect eastern equine encephalitis virus activity in Maine. Vector Borne Zoonotic Dis 11: 1403- 1409.

75. Schmitt SM, Cooley TM, Fitzgerald SD, Bolin SR, Lim A, Schaefer SM, Kiupel M, Maes RK, Hogle SA, O'Brien DJ, 2007. An outbreak of eastern equine encephalitis virus in free-ranging white-tailed deer in Michigan. J Wildl Dis 43: 635-644.

76. Tate CM, Howerth EW, Stallknecht DE, Allison AB, Fischer JR, Mead DG, 2005. Eastern equine encephalitis in a free-ranging white-tailed deer ( Odocoileus virginianus ). J Wildl Dis 41: 241-245.

77. Molaei G, Andreadis TG, Armstrong PM, Thomas MC, Deschamps T, Cuebas-Incle E, Montgomery W, Osborne M, Smole S, Matton P, Andrews W, Best C, Cornine F, 3rd, Bidlack E, Texeira T, 2013. Vector-host interactions and epizootiology of eastern equine encephalitis virus in Massachusetts. Vector Borne Zoonotic Dis.

78. Cupp EW, Zhang D, Yue X, Cupp MS, Guyer C, Sprenger TR, Unnasch TR, 2004. Identification of reptilian and amphibian blood meals from mosquitoes in an eastern equine encephalomyelitis virus focus in central Alabama. Am J Trop Med Hyg 71: 272- 276.

79. Edman JD, Webber LA, Kale HW, 2nd, 1972. Host-feeding patterns of Florida mosquitoes. II. Culiseta . J Med Entomol 9: 429-434.

80. Robertson LC, Prior S, Apperson CS, Irby WS, 1993. Bionomics of Anopheles quadrimaculatus and Culex erraticus (Diptera: Culicidae) in the Falls Lake basin, North Carolina: seasonal changes in abundance and gonotrophic status, and host-feeding patterns. J Med Entomol 30: 689-698.

81. Mendenhall IH, Tello SA, Neira LA, Castillo LF, Ocampo CB, Wesson DM, 2012. Host preference of the arbovirus vector Culex erraticus (Diptera: Culicidae) at Sonso Lake, Cauca Valley Department, Colombia. J Med Entomol 49: 1092-1102.

82. Webber LA, Edman JD, 1972. Anti-mosquito behaviour of ciconiiform birds. Animal Behaviour 20: 228-232.

83. Kale HW, Edman JD, Webber LA, 1972. Effect of behavior and age of individual ciconiiform birds on mosquito feeding success. Mosq News 32: 343-350.

84. Edman JD, Webber LA, Kale HW, 2nd, 1972. Effect of mosquito density on the interrelationship of host behavior and mosquito feeding success. Am J Trop Med Hyg 21: 487-491.

85. Edman JD, Webber LA, Schmid AA, 1974. Effect of host defenses on the feeding pattern of Culex nigripalpus when offered a choice of blood sources. J Parasitol 60: 874-883.

86. Edman JD, Kale HW, 1971. Host Behavior: Its Influence on the Feeding Success of Mosquitoes. Annals of the Entomological Society of America 64: 513-516.

87. Kale HW, Pranty B, Stith BM, Biggs CW, 1992. The atlas of the breeding birds of Florida. Final report. Tallahassee, FL: Florida Game and Fresh Water Fish Commission.

88. Robertson WB, Kushlan JA, 1974. The southern Florida avifauna. Miami Geological Soc Mem 2: 414-452.

CONCLUSION

In order to decrease transmission of eastern equine encephalitis virus (EEEV), it is important to know as much information about the transmission cycle as possible. The transmission cycle of this virus is complicated due to the multiple vectors and hosts, and not all aspects have been completely described. Since Florida is capable of year-round transmission of

EEEV, 1 the southeastern United States may serve as a reservoir for the virus for more northern locations. Recent phylogenetic studies have confirmed this, with Florida isolates clustering with isolated obtained from the northeastern United States. 2, 3, 4 These studies also indicated that the virus is able to locally amplify, overwinter, and can remain stable in these locations for several years. How EEEV is able to migrate from Florida and how it persists during the winter in North

America is not yet known. The first study contained herein has indicated that snakes have detectable levels of circulating EEEV viremia and may play a role as an overwintering host for the virus. The second study found that wading birds in Florida are preferred hosts in the winter for several known or suspected vectors of EEEV, and may play a role in the dispersal of the virus to more northern locales.

These studies, while providing us with more knowledge on the transmission and ecology of EEEV, are mainly an indication of potential areas of further study. Other studies have indicated that snakes are exposed to EEEV 5, 6, 7 and this study was the first to isolate viral RNA from them as well. 8 However, since this research was limited to Alabama, it would be important to test snakes for exposure to and infection with EEEV from other areas as well. If snakes can

73 serve as overwintering hosts for the virus, it would be especially important to repeat this study in the northeast. Being able to isolate and culture the virus from naturally infected snakes is also important as it would further provide strong evidence for the association and would allow for genetic comparisons between EEEV isolates from other hosts. An association between potential vectors of EEEV and snakes has also been shown, 9, 10, 11 but many of these mosquito species are suspected vectors of EEEV and the necessary vector competency studies need to be conducted.

These studies were also conducted in the southeast and should be repeated to see which mosquito species are feeding on snakes in other locations. In addition, the timing of when mosquitoes feed on snakes and when the snakes have high levels of viremia, particularly how viremia levels change post-brumation, also needs to be investigated.

Laboratory studies have also indicated that snakes may serve as reservoir hosts for

EEEV, 12, 13, 14, 15 however, these studies do not indicate whether the snake species used were picked based on past exposure studies or due to their ease of handling or access. This study found that cottonmouth snakes were more often exposed at the study site than other species.

Future studies should focus on the susceptibility of cottonmouths to infection and how temperature affects their levels of viremia. In addition, these studies have only looked at infecting the snake with virus. In order to show that the virus can be transmitted between snake and mosquitoes, it is also important to try to infect mosquitoes from an infected snake and vice versa . Unfortunately, the use of cottonmouth snakes in these studies creates problems in terms of both safety and regulations affecting venomous animals. Studies similar to the one conducted by

Hayes and co-workers, 14 where infected snakes were left outside over the winter and tested for

EEEV the next spring, would also provide a lot of information in terms of the ability of snakes to

74 serve as an overwintering host. However, this type of study would also violate many legal and safety regulations.

For the second study, many of the same problems come up in terms of verifying that wading birds are involved in the potential dispersal and maintenance of EEEV. Laboratory studies have been conducted with several wading bird species in the past, 16, 17, 18, 19 and found that they have high enough viremia to infect mosquitoes, but none of these studies tried to infect mosquitoes from infected wading birds. It is also important to know how long high levels of viremia can last in these birds when considering them as potential dispersers of the virus.

Unfortunately, little laboratory work can be done now due to legal regulations and many species may be endangered, threatened, or species of special concern, so these important studies may not be completed.

Studies have implicated a wide variety of wading bird species as potential hosts for

EEEV. 17, 20, 21, 22, 23 The majority of these studies occurred in the southeastern United States and other studies looking at exposure and infection rates in other locations needs to be conducted.

While virus has been isolated from several species of wild wading birds, 23, 24 it would be beneficial to attempt further isolations from other locations as well. Studies have also indicated that wading birds are preferred hosts of potential bridge vectors of EEEV in the southeast. 25, 26, 27,

28 However, again, it would be important to determine if these same species are being fed upon by vectors of EEEV in the northeast. Many of these wading birds overwinter in Florida and other states in the southeast before returning to their nesting and post-breeding dispersal ranges. 29, 30

One way to help confirm that wading birds are involved with dispersal of the virus would be to tag wading birds, particularly those that have been implicated as preferred hosts such as black- and yellow-crowned night herons, with a GPS logger that tracks their location. You can then go

75 to these locations and see if the arrival of the wading birds contributes to or jumpstarts the enzootic transmission of EEEV. Due to the short period of high viremia for many of these birds, it is also possible that there are locations between the southeast and northeast that may serve as intermediate sites, and the GPS tracker would indicate these locations as well. Knowing where the birds migrate and when can help to determine locations to test mosquitoes for virus and blood meal hosts as well as testing birds for exposure to and infection with EEEV.

Knowing more about the transmission cycle and virus dispersal, maintenance, and overwintering is important when it comes to control of EEEV. Most mosquito control efforts tend to be focused towards the epizootic transmission of arboviruses that peaks in the summer as enzootic transmission is not always detectable and mosquito densities may be lower in earlier months. Mosquito control efforts could be made to coincide with the timing of bird migrations or the timing of snake brumation. Efforts could even be made to correspond with the timing of known winter transmission of EEEV, as seen in the second study that showed isolates of EEEV in February when mosquito densities were low. If transmission was reduced during the early season amplification of the virus, the level of arbovirus transmission could be reduced for the rest of the year.

References

1. Bigler WJ, Lassing EB, Buff EE, Prather EC, Beck EC, Hoff GL, 1976. Endemic eastern equine encephalomyelitis in Florida: a twenty-year analysis, 1955-1974. Am J Trop Med Hyg 25: 884-890.

3. White GS, Pickett BE, Lefkowitz EJ, Johnson AG, Ottendorfer C, Stark LM, Unnasch TR, 2011. Phylogenetic analysis of eastern equine encephalitis virus isolates from Florida. Am J Trop Med Hyg 84: 709-717.

4. Young DS, Kramer LD, Maffei JG, Dusek RJ, Backenson PB, Mores CN, Bernard KA, Ebel GD, 2008. Molecular epidemiology of eastern equine encephalitis virus, New York. Emerg Infect Dis 14: 454-460.

5. Graham SP, Hassan HK, Chapman T, White G, Guyer C, Unnasch TR, 2012. Serosurveillance of eastern equine encephalitis virus in amphibians and reptiles from Alabama, USA. Am J Trop Med Hyg 86: 540-544.

6. Karstad L, 1961. Reptiles as possible reservoir hosts for Eastern Encephalitis virus. Trans. 26th N. Am. Wildlife Conf.: 186-202.

7. Dalrymple JM, Young OP, Eldridge BF, Russell PK, 1972. Ecology of arboviruses in a Maryland freshwater swamp. 3. Vertebrate hosts. Am J Epidemiol 96: 129-140.

8. Bingham AM, Graham SP, Burkett-Cadena ND, White GS, Hassan HK, Unnasch TR, 2012. Detection of eastern equine encephalomyelitis virus RNA in North American snakes. Am J Trop Med Hyg 87: 1140-1144.

9. Cupp EW, Klingler K, Hassan HK, Viguers LM, Unnasch TR, 2003. Transmission of eastern equine encephalomyelitis virus in central Alabama. Am J Trop Med Hyg 68: 495- 500.

10. Cupp EW, Zhang D, Yue X, Cupp MS, Guyer C, Sprenger TR, Unnasch TR, 2004. Identification of reptilian and amphibian blood meals from mosquitoes in an eastern equine encephalomyelitis virus focus in central Alabama. Am J Trop Med Hyg 71: 272- 276.

11. Burkett-Cadena ND, Graham SP, Hassan HK, Guyer C, Eubanks MD, Katholi CR, Unnasch TR, 2008. Blood feeding patterns of potential arbovirus vectors of the genus Culex targeting ectothermic hosts. Am J Trop Med Hyg 79: 809-815.

12. White G, Ottendorfer C, Graham S, Unnasch TR, 2011. Competency of reptiles and amphibians for eastern equine encephalitis virus. Am J Trop Med Hyg 85: 421-425.

13. Feemster RF, Wheeler RE, Daniels JB, Rose HD, Schaeffer M, Kissling RE, Hayes RO, Alexander ER, Murray WA, 1958. Field and laboratory studies on equine encephalitis. N Engl J Med 259: 107-113.

14. Hayes RO, Daniels JB, Maxfield HK, Wheeler RE, 1964. Field and laboratory studies on eastern encephalitis in warm- and cold-blooded vertebrates. Am J Trop Med Hyg 13: 595-606.

15. Hayes RO, 1961. Studies on eastern encephalitis in Massachusetts during 1960. Proc N J Mosq Exterm Assoc 48: 59-62.

16. Kissling RE, Chamberlain RW, Sikes RK, Eidson ME, 1954. Studies on the North American arthropod-borne encephalitides. III. Eastern equine encephalitis in wild birds. Am J Hyg 60: 251-265.

17. Herman CM, 1962. The role of birds in the epizootiology of eastern equine encephalitis The Auk 79: 99-103.

18. Aguirre AA, McLean RG, Cook RS, 1992. Experimental inoculation of three arboviruses in black-bellied whistling ducks ( Dendrocygna autumnalis ). J Wildl Dis 28: 521-525.

19. McLean RG, Crans WJ, Caccamise DF, McNelly J, Kirk LJ, Mitchell CJ, Calisher CH, 1995. Experimental infection of wading birds with eastern equine encephalitis virus. J Wildl Dis 31: 502-508.

20. Spalding MG, McLean RG, Burgess JH, Kirk LJ, 1994. Arboviruses in water birds (Ciconiiformes, Pelecaniformes) from Florida. J Wildl Dis 30: 216-221.

21. Favorite FG, 1960. Some evidence of local origin of EEE virus in Florida. Mosq News 20: 87-92.

22. Bigler WJ, Lassing E, Buff E, Lewis AL, Hoff GL, 1975. Arbovirus surveillance in Florida: wild vertebrate studies 1965-1974. J Wildl Dis 11: 348-356.

23. Gottdenker NL, Howerth EW, Mead DG, 2003. Natural infection of a great egret (Casmerodius albus ) with eastern equine encephalitis virus. J Wildl Dis 39: 702-706.

24. Stamm DD, 1958. Studies on the ecology of equine encephalomyelitis. Am J Public Health Nations Health 48: 328-335.

25. Hassan HK, Cupp EW, Hill GE, Katholi CR, Klingler K, Unnasch TR, 2003. Avian host preference by vectors of eastern equine encephalomyelitis virus. Am J Trop Med Hyg 69: 641-647.

26. Oliveira A, Katholi CR, Burkett-Cadena N, Hassan HK, Kristensen S, Unnasch TR, 2011. Temporal analysis of feeding patterns of Culex erraticus in central Alabama. Vector Borne Zoonotic Dis 11: 413-421.

27. Estep LK, McClure CJ, Burkett-Cadena ND, Hassan HK, Hicks TL, Unnasch TR, Hill GE, 2011. A multi-year study of mosquito feeding patterns on avian hosts in a southeastern focus of eastern equine encephalitis virus. Am J Trop Med Hyg 84: 718- 726.

28. Edman JD, 1979. Host-feeding patterns of Florida mosquitoes (Diptera: Culicidae) VI. Culex (Melanoconion). J Med Entomol 15: 521-525.

29. Kale HW, Pranty B, Stith BM, Biggs CW, 1992. The atlas of the breeding birds of Florida. Final report. Tallahassee, FL: Florida Game and Fresh Water Fish Commission.

30. Robertson WB, Kushlan JA, 1974. The southern Florida avifauna. Miami Geological Soc Mem 2: 414-452.

APPENDIX

Chapter One Permissions

The American Society of Tropical Medicine and Hygiene grants permission to republish the article cited below as part of your Ph.D. dissertation for the University of South Florida. Order License Id: 3302711205731.

Bingham, AB, Graham, SP, Burkett-Cadena, ND, White, GS, Hassan, HK, Unnasch, TR, 2012. Detection of Eastern Equine Encephalomyelitis Virus RNA in North American Snakes. Am J Trop Med Hyg 87(6): 1140-1144.