SESSION C. IDENTIFICATION AND CHARACTERIZATION TECHNIQUES
* A preliminary study on the genetic characteristics of inter-specific hybrids of Camellia am- plexicaulis. Xinkai L., Naisheng Z., Guimei F., Danfeng Y. & Jiyin G...... 130 * A Showing of new Generation Camellia Hybrids.Jiyin G., Xinkai L, Naisheng Z., Danfeng Y. 141 * Genus Camellia: a review of extant taxonomic systems using the latest morphological and molecular data. Orel G. & Curry A.S...... 151 * Current research advances in molecular characterization of ornamental camellias. Jiyuan L., Yingkun S. & Hengfu Y...... 161 * The computer and the camellia: what computer can do for conservation, knowledge and research of camellias. Motta G., Miceli G...... 168 * Crowdsourcing information system for camellia cultivar identification. Ventura A., Campos G. & Zagalo H...... 174 * Differentiation of camellia specimens with morphological similarities using morphobotanic descriptors and SSR. Vela P., Couselo J.L., Salinero C. & Paz C...... 181 * Could be considered some Camellia collections as Botanical Gardens?. Aboal J. & Salinero C...... 191 * Presence of Camellia species and cultivars in the Botanical Gardens worldwide. Aboal J. 198 * In vitro culture techniques applied to the propagation ofCamellia reticulataLindley. San José M.C., & Corredoira E...... 202 *Flower Development and Gibberellic Acid Application on Flowering of Camellia rosthoniana `Tianshanfen´. Xu L., Chen F.Z., Du K.B., Ji X.M., Xie Y.F., Tong J., Shi C.M., & Zhang J.B...... 209
2014 International Camellia Society Congress Pontevedra (Spain) 11- 15 March WƌĞůŝŵŝŶĂƌLJ^ƚƵĚLJŽŶ'ĞŶĞƟĐŚĂƌĂĐƚĞƌŝƐƟĐƐŽĨ/ŶƚĞƌͲƐƉĞĐŝĮĐ,LJďƌŝĚƐŽĨ Camellia amplexicaulis
The Department of Plant Resources Research and Development, Palm Landscape
ďƐƚƌĂĐƚ͗ ͘ĂŵƉůĞdžŝĐĂƵůŝƐ and other camellias were done in ͘ĂŵƉůĞdžŝĐĂƵůŝƐ were ͘ ĂŵƉůĞdžŝĐĂƵůŝƐ , ͘ĂŵƉůĞdžŝĐĂƵůŝƐ ͘ ĂŵƉůĞdžŝĐĂƵůŝƐ did. Their resistances to hot and cold climate were greatly raised, comparing with their cross-parents. Also ˈ paper. <ĞLJǁŽƌĚƐ͗ ĂŵĞůůŝĂĂŵƉůĞdžŝĐĂƵůŝƐ
/ŶƚƌŽĚƵĐƟŽŶ 130 ĂŵĞůůŝĂĂŵƉůĞdžŝĐĂƵůŝƐ ͘ĂŵƉůĞdžŝĐĂƵůŝƐ upright, growth vigorous and big trees can be grown, but it is not cold-hardy (below ). Blooming season: autumn to next spring or year-round With the development of camellias around the world, the species is started to be ͘ĂŵƉůĞdžŝĐĂƵůŝƐ was ͘ĂŵƉůĞdžŝĐĂƵůŝƐ et al et al between ͘ũĂƉŽŶŝĐĂ ͘ĂŵƉůĞdžŝĐĂƵůŝƐ (Liu et al
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ Anyway, ͘ĂŵƉůĞdžŝĐĂƵůŝƐ also is an important breeding material in the Genus Camellia ͘ĂŵƉůĞdžŝĐĂƵůŝƐ in the Camellia World. Based on above, we have used ͘ĂŵƉůĞdžŝĐĂƵůŝƐ as a parent and crossed with other people. DĂƚĞƌŝĂůƐĂŶĚŵĞƚŚŽĚƐ ĂƐŝĐƐŝƚƵĂƟŽŶ ͘ĂŵƉůĞdžŝĐĂƵůŝƐ was selected as a main cross-parent mature capsules which they have been pollinated were collected in the autumn and the selected for the study in the Camellia Breeding Base. ƌŽƐƐͲĐŽŵďŝŶĂƟŽŶƐ ͘ĂŵƉůĞdžŝĐĂƵůŝƐ 131 dĂďůĞϭ͘ ͘ĂŵƉůĞdžŝĐĂƵůŝƐ
Female parent and Male-parent and its its photograph photograph hybrid seedlings hybrid plants bloomed sel ĞĐƚĞĚ BH1 ͘ĂŵƉůĞdžŝĐĂƵůŝ BH1-1 ͘ũĂƉŽŶŝĐĂ ) ͘ĂŵƉůĞdžŝĐĂƵůŝ ͘ũĂƉŽŶŝĐĂ ) ͘ĂŵƉůĞdžŝĐĂƵůŝ 11 ͘ũĂƉŽŶŝĐĂ ) ͘ĂŵƉůĞdžŝĐĂƵůŝ of ͘ũĂƉŽŶŝĐĂ )
͘ĂŵƉůĞdžŝĐĂƵůŝ between ͘ƐĂůƵĞŶĞŶƐŝƐ and ͘ũĂƉŽŶŝĐĂ )
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ ͘ĂnjĂůĞĂ ͘ĂŵƉůĞdžŝĐĂƵůŝƐ BH7 ͘ĐŚĞŬŝĂŶŐŽůĞŽƐĂ ͘ĂŵƉůĞdžŝĐĂƵůŝƐ BH7-1
͘ĂŵƉůĞdžŝĐĂƵůŝƐ ͘ ũĂƉŽŶŝĐĂ ) ͘ĂŵƉůĞdžŝĐĂƵůŝƐ ͘ ũĂƉŽŶŝĐĂ ) Total:
KďƐĞƌǀĂƟŽŶ͕ŵĞĂƐƵƌĞĂŶĚƐƚĂƟƐƟĐƐ plant were observed, measured and photographed during blooming period of the 132 when growing stopped in winter. hybrids were evaluated. ZĞƐƵůƚƐĂŶĚŝƐĐƵƐƐŝŽŶ &ůŽǁĞƌƐŚŽǁŝŶŐŽĨƚŚĞŚLJďƌŝĚƐ
dĂďůĞϮ͘ ͘ĂŵƉůĞdžŝĐĂƵůŝƐ
EƵŵďĞƌŽĨĐƌŽƐƐͲ EƵŵďĞƌ &ůŽǁĞƌƉŚŽƚŽŐƌĂƉŚŽĨƚŚĞŚLJďƌŝĚƐ ĐŽŵďŝŶĂƟŽŶ ŽĨ Side Face ŚLJďƌŝĚƐ
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ ,ϭ BH1-1
,Ϯ
,ϯ
133
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ ,ϰ
,ϱ
,ϲ
134
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ ,ϳ BH7-1
,ϴ
135
,ϵ
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ ͘ĂŵƉůĞdžŝĐĂƵůŝƐ &ůŽǁĞƌĐŚĂƌĂĐƚĞƌŝƐƟĐƐŽĨƚŚĞŚLJďƌŝĚƐ
dĂďůĞϯ
ƌŽƐƐͲƉĂƌĞŶƚƐ &ůŽǁĞƌ ŽůŽƌ &Žƌŵ ^ŝnjĞ;ĐŵͿ WĞƚĂů WĞĚŝĐĞů ůŽŽŵŝŶŐ ĂŶĚĐƌŽƐƐͲ ďƵĚ ƋƵĂŶƟƚLJ ůĞŶŐƚŚ ƉĞƌŝŽĚ ĐŽŵďŝŶĂƟŽŶ ĚĞŶƐŝƚLJ ;ĐŵͿ C. Single Autumn to amplexicaulis next spring
KƚŚĞƌ Red Sing- Winter to camellias next spring le–semi-
double
,ϭ Rose- Summer to next spring double
,Ϯ Deep- Semi- Autumn to next spring 136 double
,ϯ Light Semi- Autumn to next spring double ,ϰ Light Single Spring ,ϱ Deep- Rose Autumn to next spring double to double
,ϲ Single Summer to with next spring purple tone
,ϳ Light Single Autumn to next spring ,ϴ Single to Autumn to or red semi- next spring
double
,ϵ Single Autumn to next spring
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ ͘ ĂŵƉůĞdžŝĞĐĂƵůŝƐ ͘ĂŵƉůĞdžŝĐĂƵůŝƐ ͖ũĂƉŽŶŝĐĂ ͘ĂŵƉůĞdžŝĐĂƵůŝƐ all of the hybrids are larger than ͘ĂŵƉůĞdžŝĐĂƵůŝƐ and tend to another cross-parent too. their another cross-parent. In pedicel length, it very obvious that the hybrids become longer which tends to ͘ĂŵƉůĞdžŝĐĂƵůŝƐ . In blooming period, most of the hybrids tend to ͘ĂŵƉůĞdžŝĐĂƵůŝƐ . and only a few of the hybrids tends to their another cross-parent. ͘ ĂŵƉůĞdžŝĐĂƵůŝƐ ͘ĂŵƉůĞdžŝĐĂƵůŝƐ >ĞĂĨĐŚĂƌĂĐƚĞƌŝƐƟĐƐŽĨƚŚĞŚLJďƌŝĚƐ ͘ĂŵƉůĞdžŝĐĂƵůŝƐ , even
dĂďůĞϰ͘
ƌŽƐƐͲƉĂƌĞŶƚƐĂŶĚ >ĞĂĨĐŽůŽƌ >ĞĂĨůĞŶŐƚŚ >ĞĂĨǁŝĚƚŚ >ĞŶŐƚŚͬ >ĞĂĨ WĞƟŽůĞ 137 ĐƌŽƐƐͲĐŽŵďŝŶĂƟŽŶ ǁŝĚƚŚ ƚŚŝĐŬŶĞƐƐ ůĞŶŐƚŚ ;ĐŵͿ ;ĐŵͿ ;ĐŵͿ ;ŵŵͿ ;ĐŵͿ C. amplexicaulis Green KƚŚĞƌ camellias ,ϭ Green ,Ϯ Green ,ϯ Green 1.1 ,ϰ Green ,ϱ Green ,ϲ ,ϳ Light-green ,ϴ Light-green 1.1 ,ϵ Green
green, which is inclined to ͘ĂŵƉůĞdžŝĐĂƵůŝƐ , the leaf length and width of the hybrids are ͘ĂŵƉůĞdžŝĐĂƵůŝƐ and smaller to their other cross-parents, however, ͘ĂŵƉůĞdžŝĐĂƵůŝƐ
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ ͘ĂŵƉůĞdžŝĐĂƵůŝƐ leaves of the Hybrids are of ornamental value in gardening. WůĂŶƚĐŚĂƌĂĐƚĞƌŝƐƟĐƐŽĨƚŚĞŚLJďƌŝĚƐ higher than ͘ĂŵƉůĞdžŝĐĂƵůŝƐ , but greatly than what in their other cross-parents. The new ͘ĂŵƉůĞdžŝĐĂƵůŝƐ growing. Owing to ͘ĂŵƉůĞdžŝĐĂƵůŝƐ trees for gardening.
138
&ŝŐ͘ϭ . Growth comparisons of the hybrids with their cross-parents
ZĞƐŝƐƚĂŶĐĞŽĨƚŚĞŚLJďƌŝĚƐ It has been shown that ͘ĂŵƉůĞdžŝĐĂƵůŝƐ is not cold hardy but can grow well in hot ͘ũĂƉŽŶŝĐĂ or ͘ĐŚĞŬŝĂŶŐŽĞŽƐĂ see that the resistances of the hybrids to extreme temperatures have greatly increased in southern China and eastern China. This shows that owing to cold resistant genes ͘ĂŵƉůĞdžŝĐĂƵůŝƐ from ͘ĂŵƉůĞdžŝĐĂƵůŝƐ , the hybrids have inherited the advantages which ͘ĂŵƉůĞdžŝĐĂƵůŝƐ has obviously raised and it could be expected that the hybrids will be widely used for gardening in subtropical and tropical areas.
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ dĂďůĞϱ͘ Resistant comparisons of the hybrids with their parents on leaf and plant under extreme temperature in southern and eastern China
ZĞŐŝŽŶ džƚƌĞŵĞ C. amplexicaulis KƚŚĞƌĐƌŽƐƐͲƉĂƌĞŶƚƐ ,LJďƌŝĚ ƚĞŵƉĞƌĂƚƵƌĞ ;ćͿ ^ŽƵƚŚĞƌŶŚŝŶĂ ŝŶƐƵŵŵĞƌ Some leaves burnt ĂƐƚĞƌŶŚŝŶĂŝŶ ǁŝŶƚĞƌ growing
or fall o Die and dry
ŽŶĐůƵƐŝŽŶ Through the crosses between ͘ĂŵƉůĞdžŝĐĂƵůŝƐ ͘ĂŵƉůĞdžŝĐĂƵůŝƐ 139 density, color, pedicel length and blooming period all mainly tended to ͘ĂŵƉůĞdžŝĐĂƵůŝƐ ͘ĂŵƉůĞdžŝĐĂƵůŝƐ length tended to other cross-parents. Plant growth of the hybrids was very strong and were greatly raised, comparing with their cross-parents. It could be expected that not also a reference could be provided for the breeding to use ͘ĂŵƉůĞdžŝĐĂƵůŝƐ cross-parent further. ĐŬŶŽǁůĞĚŐŵĞŶƚƐ
ZĞĨĞƌĞŶĐĞƐ Camellia ĂŵĞůůŝĂĂŵƉůĞdžŝĐĂƵůŝƐ ĂŵĞůůŝĂĂŵƉůĞdžŝĐĂƵůŝƐ et al
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ Camellia ĂŵĞůůŝĂĂŵƉůĞdžŝĐĂƵůŝƐ (Pitard) Coh. St. (Theaceae): Molecular Camellia ĂŵƉůĞdžŝĐĂƵůŝƐ
140
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ ^ŚŽǁŝŶŐŽĨEĞǁ'ĞŶĞƌĂƟŽŶĂŵĞůůŝĂ,LJďƌŝĚƐ
Palm Landscape Architecture Co. Ltd., China. E-mail:
/ŶƚƌŽĚƵĐĐŝŽŶ In order to create new camellia hybrids that they can bloom year-round, we have done a lot of crosses between Camellia azalea -
ϭ͘ĐŚŝĞǀĞŵĞŶƚƐŚĂǀĞďĞĞŶŐŽƩĞŶďLJŽƵƌĐĂŵĞůůŝĂďƌĞĞĚŝŶŐƚĞĂŵƐŝŶĐĞ 2006 141
- Bloomed F 1 - F
This is our camellia breeding team
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ Many big hybrid plants propagated Ϯ͘DŽƐƚŽĨƚŚĞŚLJďƌŝĚƐǁĞŐŽƚĂƌĞƌĞĂůůLJƚƌƵĞ
142 - - The leaves of the hybrids are ent from their cross-parents dense ϯ͘KǀĞƌϭϱϬŚLJďƌŝĚƐƚŚĂƚďůŽŽŵLJĞĂƌͲƌŽƵŶĚǁĞƌĞŐŽƩĞŶ͘dŚĞŝƌŽŵŵŽŶ ĐŚĂƌĂĐƚĞƌŝƐƟĐƐĂƌĞĂƐƚŚĞĨŽůůŽǁŝŶŐ͗ - The hybrids all can fully bloom from summer to autumn and then can last to bloom through the wither to next spring. Camellia azalea ĂŵĞůůŝĂĂnjĂůĞĂ͘ - The plants of the hybrids all are vigorous in growing, under full sun-light (shade is not needed). - They have stronger resistances to both hot weather and cold weather ͘ Usually, they ć ć, even under -11 ć in win- ter. ^ŽŵĞŽĨƚŚĞŚLJďƌŝĚƐĂƌĞƐŚŽǁŶĂƐďĞůŽǁ͗
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ A)
Deep red
Red 143
White
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ Edged white Blotched white
White spots on petals Edged very narrow white
B) Flower sizes are diverse in these hybrids. Flowers with Large, medium, small and
144
Very large in size Large in size Medium in size
Medium in size Medium in size Medium in size
Small in size Small in size Miniature in size
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ C) nearly involved in the hybrids.
Single form
Semi-double form
Anemone form 145
Peony form
Rose-double form Fully double form
D)
Four hybrids that bloom year-round with fragrance during their blooming
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ E) Most of the hybrids bloom densely.
146
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ ϰ͘KŶĞŚƵŶĚƌĞĚƚǁĞŶƚLJĮǀĞŚLJďƌŝĚƐŽĨ Camellia amplexicaulis ǁĞƌĞŽďͲ ƚĂŝŶĞĚĂŶĚŽĨƚŚĞŵ͕ϭϴŚLJďƌŝĚƐŚĂǀĞďůŽŽŵĞĚ͘dŚĞŝƌŽŵŵŽŶĐŚĂƌĂĐƚĞƌŝƐͲ ƟĐƐĂƌĞĂƐƚŚĞĨŽůůŽǁƐ͗ - Flowers are very dense. ć. - Blooming period of the hybrids is late-autumn to next spring. ͘ĂŵƉůĞdžŝĐĂƵůŝƐ are shown as below:
A) Flowers
147
Long petals, large, rose double form Medium in size and semi-double
Purple-red, large, peony form
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ B) Plants: Growing is upright and vigorous and leaves are very large. See the photos bellow:
148
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ 149
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ ϱ͘ KƚŚĞƌ ĐĂŵĞůůŝĂ ŚLJďƌŝĚƐ ĂŶĚ ďĞĂƵƟĨƵů ĐƵůƟǀĂƌƐ ƐĞůĞĐƚĞĚ ĨƌŽŵ ĐŚĂŶĐĞ ƐĞĞĚůŝŶŐƐŽƌŵƵƚĂƟŽŶƐ͘tĞŐŽƚŵŽƌĞƚŚĂŶϴϬŽŶĞƐ͘^ĞĞƚŚĞĨŽůůŽǁŝŶŐ͗
The two hybrids are very fragrant
hardy 150
Red with white, medium, fully double, vigorous in growth
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ 'ĞŶƵƐ Camellia ͗ƌĞǀŝĞǁŽĨĞdžƚĂŶƚƚĂdžŽŶŽŵŝĐƐLJƐƚĞŵƐƵƐŝŶŐƚŚĞůĂƚĞƐƚ ŵŽƌƉŚŽůŽŐŝĐĂůĂŶĚŵŽůĞĐƵůĂƌĚĂƚĂ
Orel G.*, Curry A.S. e-mail: [email protected]
ďƐƚƌĂĐƚ͘ Camellia species, where the descriptors exhibit extreme paucity of morphological data, are also discussed. Camellia is discussed. <ĞLJǁŽƌĚƐ :
/ŶƚƌŽĚƵĐƟŽŶ 151 the taxonomy of genus Camellia , taxonomic system divided Camellia Camellia Camellia number of Camellia the species morphological characters. It should be noted that, in some instances, the Camellia Only the basic morphology is described and many of the secondary details are not incorporated. studies based on morphological data further complicates the endeavour to create a Camellia . There can be no doubt that the molecular
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ studies are of great help in resolving some of the problems in Camellia phylogeny. re have to be considered. Camellia DĂƚĞƌŝĂůƐĂŶĚDĞƚŚŽĚƐ Camellia Camellia species and also of the nine newly discovered Camellia ŝŶƐŝƚƵ Camellia species used are presented in dĂďůĞƐϭ͘ and 2. 152 dĂďůĞϭ͘ Camellia
C. dongnaiensis * Vi C. luteocerata C. inusitata C. oconoriana C. sp. 698** C. sp. OCa** C. sp. KďΎΎ C. sp. OCc** C. sp. CT5** ͘ŝŵƉƌĞƐƐŝŶĞƌǀŝƐ ͘ƌƵďƌŝŇŽƌĂ ͘ǀŝĚĂůŝŝ ͘ŐŝůďĞƌƟŝ ͘ƉĞƚĞůŽƟŝ
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ ͘ƉĞƚĞůŽƟŝ ͘ƉĞƚĞůŽƟŝ ͘ůŝŵŽŶŝĂ ͘ŇĂǀĂ ͘ƌŽƐŵĂŶŶŝŝ ͘ŽůĞŝĨĞƌĂ ͘ĂƵƌĞĂ ͘ŶŝƟĚŝƐƐŝŵĂ ͘ŶŝƟĚŝƐƐŝŵĂ var. ŵŝĐƌŽĐĂƌƉĂ P.R. China Taxonomic status uncertain ͘ŶŝƟĚŝƐƐŝŵĂ var. ŶŝƟĚŝƐƐŝŵĂ ͘ůƵƚĞŽŇŽƌĂ ͘ƚƵŶŚŝŶŐĞŶƐŝƐ ͘ƉŝŶŐŐƵŽĞŶƐŝƐ ͘ƉŝŶŐŐƵŽĞŶƐŝƐ ͘ƐĂůŝĐŝĨŽůŝĂ ͘ƉŝƚĂƌĚŝŝǀĂƌ͘ĂůďĂ ͘ƐƉ͘ (Halong Bay) ͘ƐƉ͘ ͘ƐƉ ͘ĞĚŝƚŚĂĞ ͘ŐƌŝũƐŝŝ 153 ͘ŽďƚƵƐŝĨŽůŝĂ ͘LJƵŶŶĂŶĞŶƐŝƐ ͘ĐƌĂƐƐŝƐƐŝŵĂ ͘ƌĞƟĐƵůĂƚĂ ͘ƌƵďƌŝŵƵƌŝĐĂƚĂ P.R. China Taxonomic status uncertain ͘ŚĞŶƌLJĂŶĂ ͘ĐŽƌĚŝĨŽůŝĂ ͘ŽĚŽƌĂƚĂ ͘ƌŚLJƟĚŽĐĂƌƉĂ ͘ũŝŵƉŝŶĞŶƐŝƐ P.R. China Taxonomic status uncertain ͘ũĂƉŽŶŝĐĂ ͘ŵĂŝƌĞŝ * Bold print denotes newly discovered Camellia species
Camellia dĂďůĞϮ .
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ dĂďůĞϮ͘ Camellia species
dĂdžŽŶ &ůŽǁĞƌĐŽůŽƵƌ DŽƌƉŚŽůŽŐLJ͕ŶŽƚĞƐ C. dongnaiensis C. luteocerata intensely yellow C. inusitata light yellow C. sp . 0720
C. sp. 698 petals in spiral arrangement C. sp. dϱ pale yellow C. sp. KĂ C. sp. Kď C. sp. KĐ light yellow
154
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ ZĞƐƵůƚƐ
155
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ 156
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ 157
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ 158
ŝƐĐƵƐƐŝŽŶ The present taxonomic arrangement of genus Camellia is provisional and Camellia is
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ closeness of already described Camellia &ŝŐƐ͘ϭ͘ and 2. demonstrate and interpret the existence of a number Camellia Camellia species (Orel discovered yellow Camellia sect. Chrysantha ( ƐĞŶƐƵ sustained. &ŝŐ͘ϭ͘Ϳ and the data presented in &ŝŐ͘Ϯ͘ profoundly Camellia species. The new data also Camellia in general terms. The inclusion in the system Camellia the widening of the terms of taxonomic reference, re genus Camellia . To achieve this, the establishment of new Camellia Camellia taxa 159 Camellia Recently obtained morphological and molecular data recommends the necessity Camellia species. Good examples of this are ͘ŶŝƟĚŝƐƐŝŵĂ , ͘ƚƵŶŐŚŝŶĞŶƐŝƐ ;&ŝŐƵƌĞϭ͘Ϳ and ͘LJƵŶŶĂŶĞŶƐŝƐ and ͘ŚĞŶƌLJĂŶĂ ;&ŝŐƵƌĞƐ͘ϰ͘Θϱ͘Ϳ . Further, the recent morphological and molecular data ( &ŝŐƵƌĞƐϭ͘ĂŶĚ ϯ͘Ϳ ͘ ƉĞƚĞůŽƟŝ , ͘ ŶŝƟĚŝƐƐŝŵĂ and ͘ ŶŝƟĚŝƐƐŝŵĂ var. ŵŝĐƌŽĐĂƌƉĂ . Camellia species are well demonstrated in &ŝŐƵƌĞϯ ͘ƉĞƚĞůŽƟŝ and ͘ƉŝŶŐŐƵŽĞŶƐŝƐ Camellia species. Camellia species and taxonomic treatment of sect. Heterogena Sealy.
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ Camellia species, with ͘ ŚĞŶƌLJĂŶĂ Coh. Stuart Camellia species, with the type species, ͘ŚĞŶƌLJĂŶĂ , being subsumed into ͘LJƵŶŶĂŶĞŶƐŝƐ var. yunnanensis.
>ŝƚĞƌĂƚƵƌĞĐŝƚĞĚ Camellia Science and Technology Press, P.R. China. in Botanical Garden Press, St. Louis. ĂŵĞůůŝĂ ĚŽŶŐŶĂŝĞŶƐŝƐ 160 Camellia species from South-East Asia. Collected Papers, Camellia . Camellia Sect. ^ƚĞƌĞŽĐĂƌƉƵƐ (Theaceae) from Vietnam. - ĂŵĞůůŝĂ ĐĂƫĞŶĞŶƐŝƐ : a new species of Camellia (sect. Archaecamellia: ĂŵĞůůŝĂŝŶƵƐŝƚĂƚĂ (Theaceae), a new species ŝĚŽƵƉŝĂ ) from Vietnam. ĂŵĞůůŝĂĐŚĞƌƌLJĂŶĂ (Theaceae), a new species from China. Annales Botanici ĂŵĞůůŝĂŽĐŽŶŽƌŝĂŶĂ ( dŚĞĂĐĞĂĞ ) a new Camellia samples of dry tea. WůĂŶƚDŽůĞĐƵůĂƌŝŽůŽŐLJZĞƉŽƌƚĞƌ /ƐŽůĂƟŽŶŽĨƚŽƚĂůŐĞŶŽŵŝĐE . WůĂŶƚŵŽůĞĐƵůĂƌďŝŽůŽŐLJͲĂ >ĂďŽƌĂƚŽƌLJDĂŶƵĂů . London: Springer.
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ
ƵƌƌĞŶƚZĞƐĞĂƌĐŚĚǀĂŶĐĞƐŝŶDŽůĞĐƵůĂƌŚĂƌĂĐƚĞƌŝnjĂƟŽŶŽĨKƌŶĂŵĞŶƚĂů ĂŵĞůůŝĂƐ
ďƐƚƌĂĐƚ͘ - - al MADS-box genes in ĂŵĞůůŝĂũĂƉŽŶŝĐĂ - - 161 <ĞLJǁŽƌĚƐ͗
/ŶƚƌŽĚƵĐƟŽŶ Camellia - - number, arrangement, and shape of petals, and degree of petaloid stamens (Figure 1) - ping petals (less than eight) in a single row, and a more or less columnar stamen cluster outer rows of large petals, while the stamens have become almost totally petaloidy and and irregular petals becoming smaller to the center and petaloid stamens and separat- -
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ &ŝŐƵƌĞϭ͘ - 162
ƌĂďŝĚŽƉƐŝƐ and ŶƟƌƌŚŝŶƵŵ - has been successfully demonstrated to a wide range of angiosperm and gymnosperm - - Indeed, studies in several ornamental species suggest C class genes play central roles in dŚĂůŝĐƚƌƵŵƚŚĂůŝĐƚƌŽŝĚĞƐ ' ortho- log ( dŚƚ'ϭ - 'ĞŶĞĐůŽŶŝŶŐĂŶĚĞdžƉƌĞƐƐŝŽŶĂŶĂůLJƐŝƐ͗ ͘ũĂƉŽŶŝ - ĐĂ , we designed degenerate primers based on sequence similarity of MADS conserved Wϭ family -
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ - together (Figure 1 A). It showed ũW>ϭ and ŝW>Ϯ clade of MADS family. ũW>Ϯ and Wϭ ũW>ϭ and &h> Wϭͬ&h> family members from monocot and closely related eudicot species to construct a phylogenic tree, and showed ũW>Ϯ and ũW>ϭ Wϭ and &h> - ly (Figure 1 B).
163
&ƵŶĐƟŽŶĂůĂŶĂůLJƐŝƐŽĨũW>ϭͬϮŝŶ A. thaliana: WϭͲůŝŬĞ and &h>Ͳ like ũW>ϭͬϮ they have, we generated transgenic A. thaliana plants in which ũW>ϭ and ũW>Ϯ were ũW>ϭͬϮ were - - ectopic expression levels of target genes were evident.
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ 164
&ŝŐƵƌĞϮ͘ Ectopic expression of ũW>ϭ and ũW>Ϯ in ƌĂďŝĚŽƉƐŝƐ ũW>ϭ ũW>Ϯ overexpression with greater number of stamens and carpels. D-F, Overexpression of ũW>ϭ ũW>ϭ overexpression with greater number of stamens and carpels is shown (F). G-I, Overexpression of ũW>Ϯ
ũW>ϭ - ũW>ϭ had increased ũW>Ϯ ũW>ϭ which displayed
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ ũW>Ϯ transgenic plants, a high frequency of 'ĞŶĞĞdžƉƌĞƐƐŝŽŶĂŶĂůLJƐŝƐŝŶĚŽƵďůĞŇŽǁĞƌƐŽĨ C. japonica ǀĂƌŝĞƟĞƐ͗ ͘ũĂƉŽŶŝĐĂ is a fa- - - - ũW>ϭͬϮ ũW>ϭͬϮ ũW>ϭͬϮ - - ũW>ϭͬϮ
165
&ŝŐƵƌĞϯ͘ Increased expression levels of ũW>ϭͬϮ ͘ũĂƉŽŶŝĐĂ͘ A, Over- view of wild ͘ũĂƉŽŶŝĐĂ - pression of ũW>ϭͬϮ
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ we isolated the ũW>ϭ and ũW>Ϯ from ͘ũĂƉŽŶŝĐĂ which belong to euAP1 and ũW>ϭ and ũW>Ϯ Overexpression of ũW>ϭͬϮ displayed similar phenotypes in Arabidopsis including early only in overexpression plants of ũW>Ϯ the petal number was increased. Moreover, we also discovered the expression levels of both ũW>ϭ and ũW>Ϯ were generally induced Wϭͬ&h> ĐŬŶŽǁůĞĚŐĞŵĞŶƚƐ of experimental design and analysis of data. - ZĞĨĞƌĞŶĐĞƐ ƌĂďŝĚŽƉƐŝƐ͘ The 166 - - - - nology Publishing House, Hangzhou W d - >ϭ W d>ϯ - Uniformity and Stability Camellia excluding ͘ƐŝŶĞŶƐŝƐ . www.upov.int. W d>ϭ W d>Ϯ - - W d>ϭ
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ ƌĂďŝĚŽƉƐŝƐ W d>ϭ . The Plant W d>ϭͬ&Zh/d&h>> W d>ϭͬ&Zh/d&h>>ͲůŝŬĞ - Limited Sydney, Australia - the ƌĂďŝĚŽƉƐŝƐ ĂŵĞůůŝĂĐŚĂŶŐŝŝ
167
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ dŚĞĐŽŵƉƵƚĞƌĂŶĚƚŚĞĐĂŵĞůůŝĂ͗ǁŚĂƚĐŽŵƉƵƚĞƌĐĂŶĚŽĨŽƌĐŽŶƐĞƌǀĂƟŽŶ͕ ŬŶŽǁůĞĚŐĞĂŶĚƌĞƐĞĂƌĐŚŽĨĐĂŵĞůůŝĂƐ
Giovanni Miceli,
e-mail:
ďƐƚƌĂĐƚ - - and a club or society must be there, if it wants to survive in the era of Internet. 168 <ĞLJǁŽƌĚƐ͗ Web, Register, Camellia.
/ŶƚƌŽĚƵĐƟŽŶ - - It should be stressed that the Camellia Register contains names, as the term “register” suggests, and cannot be considered an Encyclopedia or a guide for camellia -
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ The WCR can be accessed from the ICS website - lia.org .
169
&ŝŐƵƌĞϭ The home page of the Web Camellia Register (WCR)
- a. - - b. c. - ported by a smart phone d. while even IEEE opens all papers.
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ ŽŶǀĞƌŐŝŶŐƚĞĐŚŶŽůŽŐŝĞƐ a. b. c. d. Sensors (e.g. RFID tags on trees) that dialogue through internet with servers and the table here below.
dĂďůĞϭ
>ŝŵŝƚƐ dĞĐŚŶŽůŽŐŝĞƐ Smartphone Computer maps Web Services Field Sensor X XXX X /ƚŝƐĂƉŽůŝƟĐĂůĚĞĐŝƐŝŽŶ 170
ŶĞŶŚĂŶĐĞĚĂŵĞůůŝĂZĞŐŝƐƚĞƌ a. b. c. d. e. The user will get all of this within the WCR (“one stop shopping”) i.e. without needing to exit from the computer session.
&ŝŐƵƌĞϮ dŚĞĂĚĚͲŽŶƐƚŽƚŚĞĐƵƌƌĞŶƚtZƉĂŐĞ;ŽŶƚŚĞůĞŌͿ͗WŝĐƚƵƌĞƐ͕ƌĂǁŝŶŐƐ͕sŝŐŶĞƩĞ
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ ƉŽƚĞŶƟĂů'ĂƌĚĞŶZĞŐŝƐƚĞƌ The ICS website already provides an entry point to the gardens of excellence. website and web register e.g.: a. f. g. h. in the garden
171
&ŝŐƵƌĞϯ
ŵŽďŝůĞŐƵŝĚĞĨŽƌǀŝƐŝƚŽƌƐ Mobile phone is a powerful guide to visitors of gardens. Visitors, by using their smart phone, can: a. b. c. d. e. ƉŽƚĞŶƟĂůƐƵƉƉŽƌƚĨŽƌŐĂƌĚĞŶĞƌƐĂŶĚŐĂƌĚĞŶƐ a.
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ b. c. Integrate RFID / sensor data in plant record (it could store the history of each
&ŝŐƵƌĞϰ
EĂǀŝŐĂƟŽŶŇŽǁŽŶƚŚĞƐŵĂƌƚƉŚŽŶĞĨŽƌĂŐĂƌĚĞŶǀŝƐŝƚŽƌ
172
&ŝŐƵƌĞϱ
ŽŶĐůƵƐŝŽŶƐ a.
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ b. Overall map of historic camellias : where they are, what they are c. d. wants to survive in the era of Internet. ZĞĨĞƌĞŶĐĞƐ 1. 7. - - 11. Salinero Corral C., Vela Fernandez P., and Vaquez Mansilla P., “La camellia en la colleccion de la 173 - 17. - ĂŵĞůůŝĂƌĞƟĐƵůĂƚĂ Alonso, G., Casati, F., Kuno, H., & Machiraju, V. (2004). Web services (pp. 123-149). Springer Berlin Heidelberg. Atzori, L., Iera, A., & Morabito, G. (2010). The internet of things: A survey. Computer net- works , 54 (15), 2787-2805. Verschaffelt, A. A., & McIlhenny, E. A. (1945). New Iconography of the camellias. Berlese L.B. Monographie du genre Camellia et traité complet sur sa culture, sa descrip- Motta, G., Sacco, D., Belloni, A., & You, L. (2013, July). A system for green personal integrated mobility: A research in progress. In Service Operations and Logistics, and In- formatics (SOLI), 2013 IEEE International Conference on (pp. 1-6). IEEE.
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ ƌŽǁĚƐŽƵƌĐŝŶŐŝŶĨŽƌŵĂƟŽŶƐLJƐƚĞŵĨŽƌĐĂŵĞůůŝĂĐƵůƟǀĂƌŝĚĞŶƟĮĐĂƟŽŶ
Ventura A. 1, Campos G. 1 E-mail: [email protected]
ďƐƚƌĂĐƚ͘ entries on this system originate in ĐƵůƟǀĂƌŝĚĞŶƟĮĐĂƟŽŶƌĞƋƵĞƐƚƐ online, it gradually collects responses to the requests. Simultaneously, based on their quiz performance, the system applies metrics to establish the ƌĞƉƵƚĂƟŽŶ of the respondents and respondent. <ĞLJǁŽƌĚƐ͗
/ŶƚƌŽĚƵĐƟŽŶ can also add economic value, because there is growing interest in plants with historical 174 'ĂƌĚĞŶƐ ŽĨ džĐĞůůĞŶĐĞ /ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂZĞŐŝƐƚĞƌ as t he tĞďĂŵĞůůŝĂZĞŐŝƐƚĞƌ
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ 1) gradually. ĐƌŽǁĚƐŽƵƌĐŝŶŐ . ƌŽǁĚƐŽƵƌĐŝŶŐ The term ĐƌŽǁĚƐŽƵƌĐŝŶŐ online tŝŬŝƉĞĚŝĂ , the online encyclopedia whose content can be created, reviewed and improved by anyone. The otherwise be extremely hard or even impossible to accomplish. n is the Treezilla KƉĞŶdƌĞĞDĂƉ environment. 175 ^LJƐƚĞŵƐƚƌƵĐƚƵƌĞĂŶĚďĂƐŝĐŽƉĞƌĂƟŽŶ elements: The ƐƉĞĐŝŵĞŶ ĚĂƚĂďĂƐĞ is fed primarily by ŝĚĞŶƟĮĐĂƟŽŶ ƌĞƋƵĞƐƚƐ users. The community will be challenged to try and answer those requests through ĐƵůƟǀĂƌŝĚĞŶƟĮĐĂƟŽŶƋƵŝnjnjĞƐ ĐƵůƟǀĂƌƌĞŐŝƐƚĞƌ
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ &ŝŐƵƌĞϭ͘ ƌĞƉƵƚĂƟŽŶ ) of respondents (see 176 explanatory.
&ŝŐƵƌĞϮ͘
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ The system database may be empty to begin with, as it will be gradually fed -
177
&ŝŐƵƌĞϯ͘ Basic system use case diagram.
^ƉĞĐŝŵĞŶĚĂƚĂďĂƐĞ
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ
178
&ŝŐƵƌĞϰ͘
are considered, in accordance with the guidelines recently issued by the /ŶƚĞƌŶĂƟŽŶĂů hŶŝŽŶĨŽƌƚŚĞWƌŽƚĞĐƟŽŶŽĨEĞǁsĂƌŝĞƟĞƐŽĨWůĂŶƚƐ Although the database is designed to allow storage of very complete and detailed point, so as not to discourage submission.
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ 179 &ŝŐƵƌĞϱ͘ ^ƚĂŶĚĂƌĚƐƉĞĐŝŵĞŶƐ moderator user (or group of moderator users) with permission to do so can give that specimen the status of ƐƚĂŶĚĂƌĚƐƉĞĐŝŵĞŶ - - - - - date to standard specimen). ZĞƉƵƚĂƟŽŶĂŶĚĐƵůƟǀĂƌƉƌŽďĂďŝůŝƚLJŵĞƚƌŝĐƐ The ƌĞƉƵƚĂƟŽŶ - very simply as the percentage of right answers. It is fair to assume that a user with higher out ĐƵůƟǀĂƌƉƌŽďĂďŝůŝƚLJ -
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ aged to avoid reliance on standard specimens. &ƵƚƵƌĞǁŽƌŬ The system is currently being implemented according to the design and require- referring to standard specimens) are being analysed. The following step will be a small- Botanic gardens, GOEs) preferably equipped with computer-aided specimen manage- ment, to try and import a core of reliable data, including as many standard specimens as possible (especially of Portuguese origin). Simultaneously, to ignite the process, we plan as completely as possible with the help of volunteer Botany students, and publicise the ZĞĨĞƌĞŶĐĞƐ Robson, B. (2008) “On the naming of 19 th Century camellias”. International Camellia Journal, No. 40, pp. 44-49. Scheme for the Recognition of International Camellia Gardens of Excellence (n.d.), Int. Camellia Society. Retrieved October 28, 2012, from http://www.internationalcamellia.org/ International Camellia Register. (n.d.), Int. Camellia Society. Retrieved February 13, 2014, from http://www.internationalcamellia.org/international-camellia-register Web Camellia Register. (n.d.). Retrieved February 13, 2014, from http://camellia.unipv.it/ camelliadb2/ Couselo, J. L., Vela, P., Salinero, C. and Sainz, M. J. (2010) “Characterization and dif- ferentiation of old Camellia japonica cultivars using single sequence repeat (SSRs) as genetic markers”. International Camellia Journal, No. 42, pp. 117-122. 180 - mellias in Hawaii”. International Camellia Journal, No. 42, pp. 46-49. Crowder, F. S. (2011) “A personal search for pre-1900 camellia cultivars and their preser- vation”. International Camellia Journal, No. 43, pp. 45-46. from http://crowdsourcing.typepad.com/cs/2006/06/crowdsourcing_a.html Treezilla - the monster map of trees. (n.d.). Retrieved February 13, 2014, from http:// treezilla.org/ OpenTreeMap Cloud - Tree map for engaging communities and managing urban ecosys- tems. (n.d.). Retrieved February 13, 2014, from https://www.opentreemap.org/ Guidelines for the conduct of tests for distinctness, uniformity and stability - Camellia L. - TG/275/1 (October 20, 2011). Retrieved February 13, 2014, from http://www.upov.int/ edocs/tgdocs/en/tg275.pdf Li, J., Ni, S., Li, X, Zhang, X. and Gao, J. (2008) “Developing the International Test Guide- line of Distinctness, Uniformity and Stability for Ornamental Camellia Varieties”. Interna- tional Camellia Journal, No. 40, pp. 112-118.
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ ŝīĞƌĞŶƟĂƟŽŶŽĨĐĂŵĞůůŝĂƐƉĞĐŝŵĞŶƐǁŝƚŚŵŽƌƉŚŽůŽŐŝĐĂůƐŝŵŝůĂƌŝƟĞƐ ƵƐŝŶŐŵŽƌƉŚŽďŽƚĂŶŝĐĚĞƐĐƌŝƉƚŽƌƐĂŶĚ^^Z
Estación Fitopatolóxica de Areeiro, Deputación de Pontevedra, Subida á Pontevedra, Spain. E-mail: [email protected]
ďƐƚƌĂĐƚ͘ - ĂŵĞůůŝĂũĂƉŽŶŝĐĂ - ͘ũĂƉŽŶŝĐĂ - <ĞLJǁŽƌĚƐ͗ ĂŵĞůůŝĂũĂƉŽŶŝĐĂ , Pompone, microsatellites
181 /ŶƚƌŽĚƵĐƟŽŶ The genus Camellia - th century, there is not - ĂŵĞůůŝĂũĂƉŽŶŝĐĂ - In historic gardens and in the Galician pazos there are several camellia plants,
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ &ŝŐƵƌĞϭ͘ ´Pompone´ 182
&ŝŐƵƌĞϮ͘ Flowers of a ĂŵĞůůŝĂũĂƉŽŶŝĐĂ - Camellia japoni- ĐĂ Some Camellia
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ - Camellia , most molecular studies have been fo- cused on ͘ƐŝŶĞŶƐŝƐ , the tea plant, because this is the camellia species with the highest economical value. - - nant, polymorphic, highly reproducible, independent form the environment and provide Camellia sinensis have been - - ĂŵĞůůŝĂũĂƉŽŶŝĐĂ Camellia species such as ͘ũĂƉŽŶŝĐĂ subsp. ƌƵƐƟĐĂŶĂ , ͘ũĂƉŽŶŝĐĂ and ͘ƐĂƐĂŶƋƵĂ ͘ƚĂůŝĞŶƐŝƐ , ͘ƚĂĐŚĂŶŐĞŶƐŝƐ and ͘ŐLJŵŶŽŐLJŶĂ ĂŵĞůůŝĂũĂƉŽŶŝĐĂ based on morphological characters. - 183 ĂŵĞůůŝĂũĂƉŽŶŝĐĂ - DĂƚĞƌŝĂůĂŶĚŵĞƚŚŽĚƐ ĂŵĞůůŝĂũĂƉŽŶŝĐĂ dĂďůĞϭ͘
Plant code Garden Pazo de Lourizán Pontevedra
Pazo de Oca A Estrada
Vigo Pazo de Santa Cruz de Rivadulla Vedra ͘ũĂƉŽŶŝĐĂ applied were:
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ Plant Leaf: length and width, blade shape, apex, margin and base form. Flower - - presence or absence of style and division. - - - dĂďůĞϮ͘ ĂŵĞůůŝĂũĂƉŽŶŝĐĂ and ͘ƐŝŶĞŶƐŝƐ , showing the repeat
Micro Repeat Primer sequences Tm Cycle Size satellites (oC) expected (pb) F:GGGAAGGTGCATAAAATACT 1 min 184 R:TGCGACCTAAGATTACTAAA
F:CGCTCGACGTAATGCCACACT 1 min R:CGAGCCTTCCTTTTCCCATTC
F:CCTATTGCCTACGACCATTTC 1 min R:GCTGAGCTTGGAGATTTTGTT
F:AGGGAGCATTATGAGTCGTCT 1 min R:CATCGTCCTAATCCACTTCAC
F:AAGGGTGATGCAAAAGTGAGA 1 min R: TTCTTTGGGTTGTGTTCCAA
F:AAACTTCAACAACCAGCTCTGGTA 1 min GAR:AATTATAGGATGCAAACAGGCAT-
F:GCATCATTCCACCACTCACC CamsinM11 1 min R:GTCATCAAACCAGTGGCTCA
F:GAAAGTGCGAAACCAAAC (AG)11 1 min R:CTGCGAACCCTCTTGACC
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ - ZĞƐƵůƚƐĂŶĚĚŝƐĐƵƐƐŝŽŶ The morphobotanic descriptors of the plant (growth habit, foliage) and blooming - 185 - of the stamens in a reddish colour, whereas the rest were white or yellowish white. This deformed in all plants, except in PQL-1, with a rudimentary style, thus it was regarded as - - specimen each. - -
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ dĂďůĞϯ͘ Results of the leaf descriptors used for the ĂŵĞůůŝĂũĂƉŽŶŝĐĂ
ǁŝĚƚŚ ĨŽƌŵ ;ĐŵͿ WůĂŶƚ ůŽŶŐ;ĐŵͿ ĐŽĚĞ ďůĂĚĞ ĂƉĞdž ďĂƐĞ ŵĂƌŐŝŶ ƐŚĂƉĞ pointed/acumi- 7.5-8.5 3.0-3.7 acute nate - 7.5-10.7 4.0-5.4 acuminate acute serrate cal 8.0-9.5 4.2-4.9 acuminate acute dentate 8.8-9.8 4.5-5.2 acuminate acute dentate 7.3-8.7 3.5-4.5 acuminate acute dentate 7.1-9.0 3.0-4.5 acuminate acute dentate 7.8-8.5 4.2-4.9 acuminate acute dentate acuminate/point- 6.2-8.2 3.0-4.0 acute dentate ed 7.5-8.5 3.6-4.4 acuminate acute dentate 6.6-8 3.3-4.2 pointed acute dentate 7.3-8.9 3.9-4.6 acuminate acute dentate ellip- pointed/acumi- 10.9 7.0-5.5 acute dentate nated ovated 7.2-9.1 3.6-4.7 acuminate acute dentate 8.0 3.9-4.0 pointed acute dentate 186 7.2-10.0 3.9-5.3 acuminate acute 6.5-9.8 3.0-4.8 acuminate acute dentate 9.0-10.0 4.0-5.2 pointed acute dentate 10.0-11.0 5.3-6.3 acuminate acute dentate 7.4-9.2 3.8-5.0 pointed acute dentate 7.5-9.4 3.6-4.8 pointed acute dentate 8.5-10.0 3.4-5.4 pointed acute dentate 7.0-9.3 3.6-4.8 pointed acute dentate 7.0-9.8 3.8-5.0 pointed acute dentate 8.6 4.1-5.1 pointed acute dentate ellip- pointed/acumi- 7.9-8.9 4.6-5.5 acute dentate nate ovated - pointed/acumi- 7.3-8.8 3.1-3.9 cal/lan- acute nate ceolate 8.0-9.0 4.3-4.7 acuminate acute lanceo- pointed/acumi- 7.3-9.0 3.0-3.8 acute late nate pointed/acumi- 6.9-9.0 3.5-4.6 acute dentate nate lanceo- 7.9-9.5 3.3-3.9 late/el- acuminate acute
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ dĂďůĞϰ͘ Camellia japoni- ĐĂ ŝĂŵĞƚĞƌ ĞƉƚŚ ŽůŽƌ WůĂŶƚĐŽĚĞ &Žƌŵ ;ĐŵͿ ;ĐŵͿ ĐŽůŽƌ ĚŝƐƚƌŝďƵƟŽŶŝŶƉĞƚĂůƐ homogeneous / 8.5-10.0 4.0 typical anemone base 8.5-10.0 4.0 white homogeneous homogeneous / 7.8-9.5 4.1-5.0 full peony base 7.5-9.5 4.0-5.0 7.2-8.5 homogeneous atypical anemone 4.3-5.2 7.0-8.2 emarginated homogeneous / spot- full peony 7.7-9.5 4.5-5 ted atypical anemone/ 7.0-8.5 4.2-5.1 open peony 7.2-8.5 homogeneous 6.5-7.5 4.2-5.1 atypical anemone/ 6,5-7.4 homogeneous 4.3-4.9 open peony 8.5-10.5 4.5-5.0 white homogeneous 7.0-8.5 4.3-5.2 white homogeneous atypical anemone/ 6.2-7.5 4.5-4.7 open peony 7.2-8.8 homogeneous / 4.5-5.2 187 6.5-8.3 4.5-5.1 6.5 4.3-4.8 homogeneous atypical anemone 6.1-7.6 emarginated 4.5-5.0 6.0-8.3 white homogeneous 4.1-5.2 atypical anemone/ 7.0-8.8 4.7-5.4 open peony atypical anemone 6.8-8.6 4.6-5.3 atypical anemone/ 7.9-9.6 4.9-5.5 open peony 7.8-9.3 4.8-5.4 homogeneous atypical anemone 7.5-10 4.5-5.2 homogeneous atypical anemone/ homogeneous / 7.2-9.3 4.2-5.0 open peony atypical anemone 7.0-8.5 4.1-5.2 atypical anemone 8.5-10.5 4.2-5.1 white homogeneous 6.8-10.0 4.3-4.9 atypical anemone 5.5-8.5 4.2-5.0 homogeneous 7.5-8.0 4.2-5.1 atypical anemone 8.5-9.0 4.1-5.0 homogeneous 7.9-9.6 4.3-5.2 white homogeneous atypical anemone 8.0-9.5 4.1-4.9 homogeneous atypical anemone 6.5-8.0 4.5-5.2 atypical anemone 7.5-8.2 4.1-5.0 atypical anemone 7.4-8.0 4.2-5.3
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ atypical anemone 6.5-8.5 4.3-5.4 atypical anemone 8.2-9.0 4.1-5.3 atypical anemone 6.0-9.0 4.0-5.5 atypical anemone 7.1-8.7 4.2-5 white homogeneous atypical anemone/ 5.5-6.9 3.8-4.2 white 8.1-8.4 4.5-5.1 emarginated white full peony 6.8-8.4 4.5-4.8 9.1-9.9 4.1-4.9 white atypical anemone emarginated white / 8.6-10.3 4.6-4.8 atypical anemone/ 7.4-8 4.4-4.9 homogeneous open peony atypical anemone 8.4-10.2 4.6-4.9 white atypical anemone/ 8.1-8.9 4.7-5.3 open peony base dĂďůĞϱ͘ ĂŵĞůůŝĂũĂƉŽŶŝĐĂ WĞƚĂůŽŝĚƐ ^ƚĂŵŵĞŶƐ ^ƚLJůĞ WůĂŶƚ ĐŽĚĞ ĂƌƌĂŶŐĞͲ ĐŽůŽƌ ĂƌƌĂŶŐĞͲ ĐŽůŽƌŽĨ ĂŵŽƵŶƚ ŵĞŶƚ ĐŽůŽƌ ĚŝƐƚƌŝďƵƟŽŶ ĂŵŽƵŶƚ ŵĞŶƚ ĮůĂŵĞŶƚƐ ƉƌĞƐĞŶĐĞ 45-120 homogeneous/ 2-3 rudimen- disordered dispersed yellow tary 84-127 white homogeneous 8-10 74-138 homogeneous/ 22-49 white disordered dispersed yellow deformed 59-116 white/ 3-68 188 82-194 homogeneous/ 12-46 disordered white dispersed white deformed 41-86 disordered white 8-53 dispersed reddish deformed 130-140 disordered white 5-10 dispersed white deformed 70-90 disordered white 30-50 dispersed white deformed 95-132 white homogeneous 13-14 65-92 white/ 19-31 disordered dispersed white deformed 88-231 homogeneous/ 0-40 white 52-146 white/ 0-56 58-151 homogeneous 80 white-yel- disordered dispersed deformed low 77-129 white emarginated 4-18 42-113 white homogeneous 3-95 66-140 white/ 16-53 disordered dispersed white deformed 80-140 white/ 0-6 disordered pointed dispersed white deformed 74-116 disordered white homogeneous 4-35 dispersed white deformed 90-130 disordered homogeneous 0-8 dispersed white deformed 88-162 homogeneous/ 0-21 disordered white dispersed white deformed 80-220 white/ 3-6 white-yel- disordered pointed dispersed low deformed white-yel- 60-70 disordered white homogeneous 60-70 dispersed low deformed
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ 40-57 white/ homogeneous/ 0-10 disordered dispersed yellow deformed 41-55 homogeneous/ 0-9 white 94-150 white/ - 0-35 ted white-yel- disordered dispersed deformed low 95-140 white homogeneous 0-50 white homogeneous 15-100 60-134 disordered dispersed white deformed homogeneous/ 10-95 white 100-165 white/ 0-15 white-yel- disordered pointed dispersed low deformed 95-165 white/ 0-15 disordered pointed dispersed white deformed 90-140 white/ 1-5 disordered pointed dispersed white deformed 120-150 white/ 0-3 disordered pointed dispersed white deformed 70-155 white/ 0-5 disordered pointed dispersed white deformed 140-195 white/ 0-18 disordered pointed dispersed white deformed white-yel- 79-176 disordered white homogeneous 52-161 dispersed low deformed 66-104 white homogeneous 12-18
50-89 disordered white 16-29 dispersed white deformed
54-62 22-33 125-199 white homogeneous 102-119 white-yel- disordered split deformed 189 127-162 white 17-84 low 86-106 disordered 13-31 dispersed white deformed 76-112 disordered white 37-106 dispersed white deformed 73-125 homogeneous/ 13-32 disordered dispersed white deformed dĂďůĞϲ͘ specimens of ĂŵĞůůŝĂũĂƉŽŶŝĐĂ .
'ϭ 'Ϯ 'ϯ 'ϰ 'ϱ 'ϲ 'ϳ 'ϴ PQL-1
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ dĂďůĞϳ͘ ĂŵĞůůŝĂũĂƉŽŶŝĐĂ specimens
'ϭ 'Ϯ 'ϯ 'ϰ 'ϱ 'ϲ 'ϳ 'ϴ 'ϵ 'ϭϬ 'ϭϭ PQL- ZĞĨĞƌĞŶĐĞƐ ĂŵĞůůŝĂũĂƉŽŶŝĐĂ seeds by ƉŽĚĞŵƵƐƐƉĞĐŝŽƐƵƐ - Camellia ZŽƐĂŚLJďƌŝĚĂ - microsatellites in tea ( Camellia sinensis 190 microsatellite loci from Camellia sinensis Camellia sinensis - of old ĂŵĞůůŝĂũĂƉŽŶŝĐĂ - Australia. ĂŵĞůůŝĂũĂƉŽŶŝĐĂ - derived microsatellites from tea plant ( Camellia sinensis
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ ŽƵůĚďĞĐŽŶƐŝĚĞƌĞĚƐŽŵĞ Camellia ĐŽůůĞĐƟŽŶƐĂƐŽƚĂŶŝĐĂů'ĂƌĚĞŶƐ͍
1, Salinero M.C.
1 Pontevedra, Spain. E-mail: [email protected]
ďƐƚƌĂĐƚ͘ In this study, it was examined whether Camellia
/EdZKhd/KE 191 BCGI. In this study, it was examined whether Camellia Botanical Gardens.
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ &ŝŐƵƌĞϭ͘ areas
Dd Z/>ED d,K^ As an example case, it has been examined if the criteria listed by BGCI are met by the Camellia as Botanical Garden. This list can not be considered as a comprehensive summary of 192 The Camellia
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ &ŝŐƵƌĞϮ͘ 193
Z ^h>d^ Garden), Germany (Flora Cologne Botanic Garden) and Australia (Royal Botanic Gardens, Melbourne).
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ 6 GE ICS BCGI 5
4
3
2
1 Number of gardens ofNumber 0 UK Italy USA Spain China South Africa Japan New France Zealand Australia Germany Switzerland
&ŝŐƵƌĞϯ͘ and number of those included as botanic gardens in the BCGI directory corresponding at each country Camellia
ϭ͘ͲƌĞĂƐŽŶĂďůĞĚĞŐƌĞĞŽĨƉĞƌŵĂŶĞŶĐĞ 194
Ϯ͘ͲŶƵŶĚĞƌůLJŝŶŐƐĐŝĞŶƟĮĐďĂƐŝƐĨŽƌƚŚĞĐŽůůĞĐƟŽŶƐ. In the Soutomaior Castle the Camellia ͘ũĂƉŽŶŝĐĂ ͘ƌĞƟĐƵůĂƚĂ ͘ƐĂƐĂŶƋƵĂ džŚLJďƌŝĚ ( ). In the “Finca do Areeiro” there are represented ͘ũĂƉŽŶŝĐĂ ͘ ƌĞƟĐƵůĂƚĂ ͘ƐĂƐĂŶƋƵĂ basis for these, and could be considered as an ĂƌďŽƌĞƚƵŵ dŚĞĂĐĞĂĞ and other related (i.e. WĞŶƚĂƉŚLJůĂĐĂĐĞĂĞ )
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ &ŝŐƵƌĞϰ͘
ϯ͘ͲWƌŽƉĞƌĚŽĐƵŵĞŶƚĂƟŽŶŽĨƚŚĞĐŽůůĞĐƟŽŶƐ͕ŝŶĐůƵĚŝŶŐǁŝůĚŽƌŝŐŝŶ 195 ϰ͘ͲDŽŶŝƚŽƌŝŶŐŽĨƚŚĞƉůĂŶƚƐŝŶƚŚĞĐŽůůĞĐƟŽŶƐ . All the plants are dendrometrically on the season) and cultural control. Also the phenology of each plant is recorded (each
ϱ͘ͲĚĞƋƵĂƚĞůĂďĞůůŝŶŐŽĨƚŚĞƉůĂŶƚƐ͘ All the plants (both Camellia
&ŝŐƵƌĞϱ͘ A Camellia
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ ϲ͘ͲKƉĞŶƚŽƚŚĞƉƵďůŝĐ͘
196
&ŝŐƵƌĞϲ͘ ϳ͘ͲŽŵŵƵŶŝĐĂƟŽŶŽĨŝŶĨŽƌŵĂƟŽŶƚŽŽƚŚĞƌŐĂƌĚĞŶƐ͕ŝŶƐƟƚƵƟŽŶƐĂŶĚƚŚĞƉƵďůŝĐ͘ ϴ͘Ͳ džĐŚĂŶŐĞŽĨƐĞĞĚŽƌŽƚŚĞƌŵĂƚĞƌŝĂůƐǁŝƚŚŽƚŚĞƌďŽƚĂŶŝĐŐĂƌĚĞŶƐ͕ĂƌďŽƌĞƚĂ ŽƌƌĞƐĞĂƌĐŚŝŶƐƟƚƵƟŽŶƐ . There is exchange of plants with other Camellia gardens. The exchange of seeds is usually too reduced for Camellia ŝŶĚĞdžƐĞŵŝŶƵŵ ” each years, as it is ϵ͘ͲhŶĚĞƌƚĂŬŝŶŐŽĨƐĐŝĞŶƟĮĐŽƌƚĞĐŚŶŝĐĂůƌĞƐĞĂƌĐŚŽŶƉůĂŶƚƐŝŶƚŚĞĐŽůůĞĐƟŽŶƐ͘ ϭϬ͘Ͳ DĂŝŶƚĂŶĞŶĐĞ ŽĨ ƌĞƐĞĂƌĐŚ ƉƌŽŐƌĂŵƐ ŝŶ ƉůĂŶƚ ƚĂdžŽŶŽŵLJ ŝŶ ĂƐƐŽĐŝĂƚĞĚ ŚĞƌďĂƌŝĂ͘dŚĞƌĞŝƐŶŽƚĂŶLJƌĞƐĞĂƌĐŚƉƌŽŐƌĂŵƐŝŶƉůĂŶƚƚĂdžŽŶŽŵLJŝŶĂƐƐŽĐŝĂƚĞĚŚĞƌďĂƌŝĂ͘
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ whole of the criteria must be met. Then, we can conclude that it would be possible to include the Camellia member of the BGCI. Camellia to propose the Camellia &/E>Z DZ<^ On our opinion the Camellia are considered also botanic gardens. Moreover, the criteria of the Ibero-Macaronesian 197 be send. Z & Z E ^ Diputación Provincial de Pontevedra, Servicio de Publicaciones, Pontevedra.
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ WƌĞƐĞŶĐĞŽĨ Camellia ƐƉĞĐŝĞƐĂŶĚĐƵůƟǀĂƌƐŝŶŽƚĂŶŝĐĂů'ĂƌĚĞŶƐ ǁŽƌůĚǁŝĚĞ
Compostela, Spain. E-mail:
ďƐƚƌĂĐƚ͘ Camellia Camellia ĂŵĞůůŝĂũĂƉŽŶŝĐĂ ͘džǁŝůůŝĂŵƐŝŝ ͘ ũĂƉŽŶŝĐĂ ͘ ƐĂƐĂŶƋƵĂ ͘ ũĂƉŽŶŝĐĂ ͘ ƐĂƐĂŶƋƵĂ ͘džǁŝůůŝĂŵƐŝŝ are included in some Botanical Gardens. /ŶƚƌŽĚƵĐƟŽŶ 198 Paeonia species Camellia Camellia the ornamental plants diversity. For this reason we compare the BGCI plant database with worldwide botanic gardens.
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ DĂƚĞƌŝĂůĂŶĚDĞƚŚŽĚƐ The “Plant Searh” is an online database permit to locate plant species in “Camellia ZĞƐƵůƚƐ Camellia included in the PlantSearch database. Most of the species and subspecies correspond ͘ũĂƉŽŶŝĐĂ by ͘ƐĂƐĂŶƋƵĂ Camellia ͘ƌĞƟĐƵůĂƚĂ 199 3500 3251 3000 40 2500 30 20 2000 10 0 1500
1000 C. rosiflora C. oleifera C. hiemalis C. sinensis C. cuspidataC. nitidissima C. rusticana 450 C. lutchuensis C. saluenensis 382 500 232 Number of cultivars ofNumber 0
Hybrids C. oleifera C. rosiflora C. rusticanaC. hiemalisC. sinensisC. reticulata C. japonica C. cuspidataC. nitidissima C. sasanqua C. lutchuensisC. saluenensis
&ŝŐƵƌĞϭ͘ one botanical garden. Taxons corresponding to wild plants (or at least not included as gardens ( ͘ũĂƉŽŶŝĐĂ and ͘ƐŝŶĞŶƐŝƐ
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ (͘ŽůĞŝĨĞƌĂ͕͘ƐĂƐĂŶƋƵĂ͕͘ĐƵƐƉŝĚĂƚĞ͕͘ƌĞƟĐƵůĂƚĞ͕͘ĐŚƌLJƐĂŶƚŚĂ͕͘ŐƌŝũƐŝŝ͕͘ĨƌĂƚĞƌŶĂ͕ ͘ůƵƚĐŚƵĞŶƐŝƐ͕͘ĐƌĂƉŶĞůůŝĂŶĂ͕͘ƐĂůƵĞŶĞŶƐŝƐ͕͘ƚƐĂŝŝ͕͘ũĂƉŽŶŝĐĂ subsp. ƌƵƐƟĐĂŶĂ ). ͘ũĂƉŽŶŝĐĂ ͘džǁŝůůŝĂŵƐŝŝ ͘ũĂƉŽŶŝĐĂ ͘ƐĂƐĂŶƋƵĂ ͘ũĂƉŽŶŝĐĂ ͘ƐĂƐĂŶƋƵĂ and ͘džǁŝůůŝĂŵƐŝŝ
4000 6 3500 5 3000 4 2500 3 2 2000 1 1500 0 1000 21-25 26-30 31-35 36-40 41-45 46-50 51-75 75-100 500 100-125 0 1 2 3 4 5 6 7 8 9 Number of taxon/cultivars ofNumber 10
11-15 16-20 21-25 26-30 31-35 36-40 41-45 46-50 51-75 200
Number of BG 75-100 100-125
&ŝŐƵƌĞϮ͘ dĂďůĞϭ͘ corresponds to ͘ũĂƉŽŶŝĐĂ Camellia x williamsii ƵůƟǀĂƌŶĂŵĞ EǑ' ĂŵĞůůŝĂũĂƉŽŶŝĐĂ Camellia x williamsii ĂŵĞůůŝĂũĂƉŽŶŝĐĂ ĂŵĞůůŝĂƐĂƐĂŶƋƵĂ ĂŵĞůůŝĂũĂƉŽŶŝĐĂ ĂŵĞůůŝĂƐĂƐĂŶƋƵĂ 17 Camellia x williamsii 17
The results of the study of the correspondence between both databases showed Web Camellia Register are included in some Botanical Gardens.
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ 1600 ICS BCGI 12% 1400
1200 TOTAL: 12% 13% 1000
800 15% 600 7% 400 Number of cultivars ofNumber 200 1%
0 XJIDA
&ŝŐƵƌĞϯ͘ some Botanical Gardens (BCGI). &ŝŶĂůZĞŵĂƌŬƐ Camellia 201 Camellia gardens as Botanic Gardens could increase this percentage. ZĞĨĞƌĞŶĐĞƐ
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ /ŶǀŝƚƌŽ ĐƵůƚƵƌĞƚĞĐŚŶŝƋƵĞƐĂƉƉůŝĞĚƚŽƚŚĞƉƌŽƉĂŐĂƚŝŽŶŽĨ Camellia reticulata >ŝŶĚůĞLJ
ďƐƚƌĂĐƚ͘ Camellia . ͖ŝŶǀŝƚƌŽ culture of Camellia has been regenerated in ǀŝƚƌŽ <ĞLJǁŽƌĚƐ͗ - genesis.
/ŶƚƌŽĚƵĐƟŽŶ 202 The genus Camellia includes shrubs and trees belonging to the family Theaceae ĂŵĞůůŝĂƚƐƵď - aki name, ĂŵĞůůŝĂũĂƉŽŶŝĐĂ in his species WůĂŶƚĂƌƵŵ͘ The center of origin of the genus C amellia is in South and southwestern China, - Camellia species, viz. ͘ũĂƉŽŶŝĐĂ and ͘ůĂŶĐĞŽůĂƚĂ Camellia were spread from country to country by Camellia plant brought by sea from the East. Those from Portugal to Spain in their acid soil and temperate humid climate. Camellia was introduced to the USA at the beginning of the eighteenth century. From England, orna- mental Camellia was introduced to Australia during the nineteenth century. The economic importance of the genus Camellia is largely due to ͘ ƐŝŶĞŶƐŝƐ , -
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ the wild species, economic value of ͘ũĂƉŽŶŝĐĂ - wide. Other wild species with ornamental values are ͘ƌĞƟĐƵůĂƚĂ͕͘ƐĂƐĂŶƋƵĂ͕ and ͘ ƐĂůƵĞŶƐŝƐ . A few wild species such as ͘ŽůĞŝĨĞƌĂ͕͘ƐĞŵŝƐĞƌƌĂƚĂ͕ and ͘ĐŚĞŬŝĂŶŐŽůŽŵLJ - Camellia leaves contain a number of substances used in the Camellia ŝŶǀŝƚƌŽ /Ŷ ǀŝƚƌŽ /ŶǀŝƚƌŽ established for several thousand plant species, including numerous rare and endangered ŝŶǀŝƚƌŽ Camellia species of economic im- in ǀŝƚƌŽ
͘ƌĞƟĐƵůĂƚĂ (Table 1). This species 203 ͘ ƌĞƟĐƵůĂƚĂ ͘ ƌĞƟĐƵůĂƚĂ th century B.C.
&ŝŐƵƌĞϭ͕͘ ĂŵĞůůŝĂƌĞƟĐƵůĂƚĂ tree showing the typical habit growth. ͕ Flower of ͘ƌĞƟĐƵůĂƚĂ
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ dĂďůĞϭ͘ ĂŵĞůůŝĂƌĞƟĐƵůĂƚĂ͘
džƉůĂŶƚƚLJƉĞ KƌŝŐŝŶ DĞĚŝĂ;ŵŐͬůͿ 'ƌŽǁƚŚƌĞƐƉŽŶƐĞ ZĞĨĞƌĞŶĐĞ
MT nodes min MT nodes In vitro leaf MT In vitro leaf S Mature coty- ledon B Mature and Plata and Vieitez, immature co- MS, GA tyledons Immature zy- Secondary embryos 204 Anatomical study
- DŝĐƌŽƉƌŽƉĂŐĂƟŽŶĨƌŽŵƐŚŽŽƚƟƉƐĂŶĚŶŽĚĂůĞdžƉůĂŶƚƐ ŝŶǀŝƚƌŽ culture methods was suggested as a means Camellia including tea and re- ĂŵĞůůŝĂƌĞƟĐƵůĂƚĂ ŝŶǀŝƚƌŽ - - -
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ
205
&ŝŐƵƌĞϮ͘ ĂŵĞůůŝĂƌĞƟĐƵůĂƚĂ͘ ͕ the culture of axillary shoots of ͘ƌĞƟĐƵůĂƚĂ ͕ ͘ƌĞƟĐƵůĂƚĂ plantlets cultured and rooted ŝŶǀŝƚƌŽ . ͕ leaves segments. ͕ ͘ƌĞƟĐƵůĂƚĂ
DŝĐƌŽƉƌŽƉĂŐĂƟŽŶďLJŶĞŽĨŽƌŵĂƟŽŶŽĨĂĚǀĞŶƟƟŽƵƐďƵĚƐ - ual genes controlling traits such as disease resistance and pest resistance, and will no
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ - - ŐƌŽďĂĐƚĞƌŝƵŵ spp., ŝŶǀŝƚƌŽ ĂŵĞůůŝĂ͘ ͘ƐŝŶĞŶƐŝƐ ͘ƌĞƟĐƵůĂƚĂ - - - root length and in the number of roots formed per shoot. DŝĐƌŽƉƌŽƉĂŐĂƟŽŶďLJƐŽŵĂƟĐĞŵďƌLJŽŐĞŶĞƐŝƐ - tem of Camellia 206 - provement of genotypes for desirable traits and integrate well with the technique of Camellia . How- - from the surface of ͘ƌĞƟĐƵůĂƚĂ - - ͘ƌĞƟĐƵůĂƚĂ - ͘ƌĞƟĐƵůĂƚĂ that embryogenesis occurred mainly on the hypocotyl region of primary embryos. His-
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ - ŽůĚƐƚŽƌĂŐĞ /ŶǀŝƚƌŽ - ent species. However, ŝŶǀŝƚƌŽ techniques require periodic transfers of cultures to fresh medium and the inclusion of plant growth regulators and organics, and inorganics com- ͘ƌĞƟĐƵůĂƚĂ ŽŶĐůƵƐŝŽŶ ĂŵĞůůŝĂƌĞƟĐƵůĂƚĂ͘ The availability ĐŬŶŽǁůĞĚŐĞŵĞŶƚƐ
ZĞĨĞƌĞŶĐĞƐ 207 ĂŵĞůůŝĂũĂƉŽŶŝĐĂ L. and ĂŵĞůůŝĂƌĞƟĐƵůĂƚĂ - /ŶǀŝƚƌŽ Cell. Dev. Camelia. Peón, Pontevedra, Spain ŝŶǀŝƚƌŽ . Aplicación de las tec- Camellia . Tesis Doctoral. Universidad <ĂůŵŝĂ ůĂƟĨŽůŝĂ Camellia - sources. Springer-Verlag, Berlin, Heidelberg WŝƐƚĂĐŝĂ
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ ͘ũĂƉŽŶŝĐĂ L. Plant Cell Rep. ŝŶǀŝƚƌŽ de ĂŵĞůůŝĂƌĞƟĐƵůĂƚĂ - Camellia ƌĞƟĐƵůĂƚĂ . /ŶǀŝƚƌŽ /ŶǀŝƚƌŽ ĂŵĞůůŝĂƌĞƟĐƵůĂƚĂ - /ŶǀŝƚƌŽ ŝŶǀŝƚƌŽ Camellia ƌĞƟĐƵůĂƚĂ /ŶǀŝƚƌŽ ĂŵĞůůŝĂƌĞƟĐƵůĂƚĂ ŝŶǀŝƚƌŽ leaves of adult Camel- ůŝĂƌĞƟĐƵůĂƚĂ Camellia plantlets from leaf explant cultures by of ĂŵĞůůŝĂũĂƉŽŶŝĐĂ 208 Ca- ŵĞůůŝĂũĂƉŽŶŝĐĂ plantlets cultured ŝŶǀŝƚƌŽ Camellia -
- nomically Important Plants. Proc. Costed. Symp. Singapore
/ŶǀŝƚƌŽ ĂŵĞůůŝĂƌĞƟĐƵůĂƚĂ L. Acta Biol. Exp. Sin.
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ &ůŽǁĞƌĞǀĞůŽƉŵĞŶƚĂŶĚ'ŝďďĞƌĞůůŝĐĐŝĚƉƉůŝĐĂƟŽŶŽŶ&ůŽǁĞƌŝŶŐŽĨ Camellia rosthoniana ͚dŝĂŶƐŚĂŶĨĞŶ͛
L Xu 1* 1 1 1 1, C M Shi 1 θHuazhong Agricultural University θ θP.R. China
ďƐƚƌĂĐƚ͗ Camellia rosthoniana development and gibberellic acid (GA th -1 of GA -1 of GA <ĞLJǁŽƌĚƐ͗ Camellia rosthoniana : GA ďďƌĞǀŝĂƟŽŶƐ
/EdZKhd/KE Camellia rosthorniana Hand.-Mazz., which originated from China, is an evergreen 209 ͘ rosthorniana of ͘ƌŽƐƚŚŽƌŶŝĂŶĂ by the use of seedling
has been used in some species, such as WĂĞŽŶŝĂůĂĐƟŇŽƌĂ ,ĞůůĞďŽƌƵƐ on , ͘ƌŽƚŚŽƌŶŝĂŶĂ for spraying the At C. :ĂƉŽŶŝĐĂ
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ ͘ƌŽƐƚŚŽŶŝĂŶĂ except for our previous report on its pollens Dd Z/>^ED d,K^ Plant Material ͘ ƌŽƐƚŚŽŶŝĂŶĂ plantlets ˈ , ć the next year. DĞƚŚŽĚƐ &ůŽǁĞƌĚĞǀĞůŽƉŵĞŶƚ ˈ th th nd rd
^ƚĂƌƟŶŐĚĂƚĞŽĨƚƌĞĂƚŵĞŶƚǁŝƚŚ' ϯ 210
-1 of GA once a for development. p <
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ dĂďůĞϭ͘
&ůŽǁĞƌďƵĚƐŝnjĞ ^ƚĂƌƟŶŐ ͬĐŵ ŚĂƌĂĐƚĞƌŝƐƟĐ dƌĞĂƟŶŐ /ŶŝƟĂůŽƉĞŶ PSB % date ŽĨŇŽǁĞƌďƵĚƐ ƟŵĞƐ date >ĞŶŐƚŚtŝĚƚŚ September Green buds -- th Early March d
Late February d September Green buds nd c Middle d d
Early March d Green buds October turning to red th b buds Late 211 December a Z ^h>d^ &ůŽǁĞƌ/ŶŝƟĂƟŽŶĂŶĚĞǀĞůŽƉŵĞŶƚ &ůŽƌĂůŵŽƌƉŚŽůŽŐLJŽĨ͘ƌŽƐƚŚŽŶŝĂŶĂ͚dŝĂŶƐŚĂŶĨĞŶ͛ &ůŽǁĞƌŝŶŝƟĂƟŽŶĂŶĚĚĞǀĞůŽƉŵĞŶƚ Flower buds of ͘ ƌŽƐƚŚŽŶŝĂŶĂ th th ), with sepal primordium development, petal primordium began to form at inner base of ˈraised stamen primordia began to form at the inner base
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ
212
&ŝŐƵƌĞϭ͘ Camellia rosthorniana δ ε dŚĞŽƉƟŵƵŵƐƚĂƌƟŶŐĚĂƚĞĂŶĚƟŵĞƐŽĨƚƌĞĂƚŵĞŶƚǁŝƚŚ' ϯ
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ th /^h^^/KE^ The ͘ƌŽƐƚŚŽƌŶŝĂŶĂ ͘ƌŽƐƚŚŽƌŶŝĂŶĂ ͘ƌŽƐƚŚŽƌŶŝĂŶĂ͘
. 213 bud stage ˈred bud stage ˈcoloring stage ˈ by use of GA
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ dĂďůĞϮ͘ &ůŽǁĞƌďƵĚ ĂƚĞ &ůŽǁĞƌďƵĚĚŝīĞƌĞŶƟĂƟŽŶƉƌŽĐĞƐƐ ŵŽƌƉŚŽůŽŐLJ Late May - middle and Bract primordium, calyx Green bud stage primordium and petal primordium Green bud stage early August Early and middle August - middle and late from green bud to organs and beginning of sexual cells October red bud Early and middle Red bud stage December th . The possible reason for this was to accept the
nd th will do no harm to 214 and thus -1 of GA
ůĂĐƟŇŽƌĂ
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ Camellia rosthorniana Hand. Camellia rosthorniana on Camellia rosthorniana .
215
ϮϬϭϰ/ŶƚĞƌŶĂƟŽŶĂůĂŵĞůůŝĂ^ŽĐŝĞƚLJŽŶŐƌĞƐƐ WŽŶƚĞǀĞĚƌĂ;^ƉĂŝŶͿϭϭͲϭϱDĂƌĐŚ