Importance of Retinoic Acid and Retinoid Receptors In

IMPORTANCE OF RETINOIC ACID AND RETINOID RECEPTORS IN

ZEBRAFISH (Danio rerio) OVARIAN FUNCTION

A Thesis

Presented to

The Faculty of Graduate Studies

The University of Guelph

CHRISTINA SIMPSON

In partial fulfilment of requirements

for the degree of

Master of Science

September, 2008

395 Wellington Street 395, rue Wellington Ottawa ON K1A0N4 Ottawa ON K1A0N4 Canada Canada

Your file Votre reference ISBN: 978-0-494-47830-1 Our file Notre reference ISBN: 978-0-494-47830-1

NOTICE: AVIS: The author has granted a non L'auteur a accorde une licence non exclusive exclusive license allowing Library permettant a la Bibliotheque et Archives and Archives Canada to reproduce, Canada de reproduire, publier, archiver, publish, archive, preserve, conserve, sauvegarder, conserver, transmettre au public communicate to the public by par telecommunication ou par Plntemet, prefer, telecommunication or on the Internet, distribuer et vendre des theses partout dans loan, distribute and sell theses le monde, a des fins commerciales ou autres, worldwide, for commercial or non sur support microforme, papier, electronique commercial purposes, in microform, et/ou autres formats. paper, electronic and/or any other formats.

The author retains copyright L'auteur conserve la propriete du droit d'auteur ownership and moral rights in et des droits moraux qui protege cette these. this thesis. Neither the thesis Ni la these ni des extraits substantiels de nor substantial extracts from it celle-ci ne doivent etre imprimes ou autrement may be printed or otherwise reproduits sans son autorisation. reproduced without the author's permission.

In compliance with the Canadian Conformement a la loi canadienne Privacy Act some supporting sur la protection de la vie privee, forms may have been removed quelques formulaires secondaires from this thesis. ont ete enleves de cette these.

While these forms may be included Bien que ces formulaires in the document page count, aient inclus dans la pagination, their removal does not represent il n'y aura aucun contenu manquant. any loss of content from the thesis. Canada ABSTRACT

Christina Simpson Advisor: University of Guelph, 2008 Dr. Glen Van Der Kraak

Recent studies have suggested that retinoic acid (RA) plays an essential role in reproduction in zebrafish. My studies involved the use of Real-Time PCR to characterize the mRNA expression encoding five isoforms of retinoid x receptors and one form of retinoic acid receptor in the zebrafish ovary. Studies showed that these receptors were uniformly expressed at different stages of follicular development and that two steroid hormones (17a, 20fl-dihydroxy-4-pregnen-3-one and 1713-estradiol) had only minor effects on mRNA expression encoding the retinoid receptors. Other studies showed that all-trans retinoic acid but not 9-cis retinoic acid significantly decreased 17B-estradiol levels in ovarian tissues by inhibiting the activity and mRNA expression encoding the cytochrome P450 aromatase enzyme. These studies demonstrate that mRNA encoding retinoid receptors are present within the ovary and suggest an essential role for RA in adult zebrafish reproduction. ACKNOWLEDGEMENTS

I have learned a great deal from those who have worked with me over the last few years and I gratefully acknowledge my debt to them. This work would not have been possible without the support and encouragement from my advisor Dr. Glen Van Der

Kraak, whose enthusiasm, knowledge and expertise often provided me with a sense of direction throughout the completion of my thesis. I would like to express the deepest appreciation to my committee, Dr. Patricia Wright and Dr. Todd Gillis, whose comments and revisions provided insight into my research. I have also to thank my lab mates

Jacquie, Andrea, Sharon and Meghan for their interest and countless hours of assistance by consistently offering advice and stimulating suggestions for improvement. Finally, I wish to express my warm and sincere gratitude to family and friends who have been extremely patient and have provided me with encouragement, advice, love and support over the last few years.

i TABLE OF CONTENTS

Acknowledgments i

List of tables , iii

List of figures iii

Chapter 1: General Introduction ,.. 1

Literature review 1 Thesis objectives and outline 10

Chapter 2: Characterization and expression of retinoid receptor isoforms in zebrafish (Danio rerio) ovarian development 18

Abstract 18 Introduction 19 Materials and Methods 21 Results. 29 Discussion 31

Chapter 3: The effects of retinoic acid on steroidogenesis in the zebrafish (Danio rerio) 51

Abstract ....51 Introduction 52 Materials and Methods 54 Results 63 Discussion 65

Chapter 4: General Discussion 90

Literature Cited 97

Appendix I 107 Appendix II 108

ii LIST OF TABLES

Chapter 2

Table 1. Primer sequences, PCR product size and accession numbers for retinoid receptors and housekeeping genes 27

Table 2. Retinoid receptors identified in zebrafish with corresponding mammalian orthologs 49

Chapter 3

Table 1. Primer sequences, PCR product size and accession numbers for steroidogenic enzymes, retinoid receptors and housekeeping genes 61

LIST OF FIGURES

Chapter 1

Figure 1. Production of retinoid and metabolites 12

Figure 2. Synthesis of retinoids in target tissues 14

Figure 3. Steroidogenic pathway in teleost ovary 16

Chapter 2

Figure 1. Representative amplification plot and dissociation curve of retinoid receptor rxraa 32

Figure 2. Mean mRNA expression encoding housekeeping genes in zebrafish ovarian follicle stages 34

Figure 3. Characterization of the mRNA expression encoding six retinoid receptors in ovarian follicle stages represented by non-normalized input values and normalized input values to adjusted elongation factor alpha-1 36

Figure 4. Mean mRNA expression encoding housekeeping genes in zebrafish whole ovary 39

Figure 5. Effects of 24 hour in vivo exposure to 500 ng/ml 1715-estradiol or 500 ng/ml 17a,20B-dihydroxy-4-pregnen-3-one on the mRNA expression encoding six retinoid receptors 41

iii Figure 6. Differences in mRNA expression encoding five retinoid receptors in zebrafish ovarian follicle stages following 24 hour exposure to 100 ng/ml 17a,20fl-dihydroxy-4- pregnen-3-one 43

Chapter3

Figure 1. Effects of the combination of aT-RA and 9-cis-RA incubated with gonadotropin on 17B-estradiol and testosterone production in vitellogenic follicles ....67

Figure 2. Effects of aT-RA or 9-cis-RA incubated with gonadotropin on 1713-estradiol and testosterone production in vitellogenic follicles 69

Figure 3. Effects of aT-RA and/or 9-cis-RA incubated with gonadotropin on 1713- estradiol and testosterone production in whole ovary tissue 71

Figure 4. Effects of aT-RA on testosterone-stimulated 176-estradiol production in vitellogenic follicles 73

Figure 5. 1713-estradiol and testosterone levels in ovarian tissue following exposure to various concentrations of aT-RA '.. 75

Figure 6. Relative mRNA expression encoding steroid enzymes in the whole ovary following exposure to various concentrations of aT-RA 77

Figure 7. Effects of aT-RA on the number of eggs spawned in female zebrafish 78

Figure 8. 176-estradiol and testosterone levels in ovarian tissue following exposure to various concentrations of aT-RA 81

Figure 9. Relative mRNA expression encoding steroid enzymes in whole ovary following exposure to various concentrations of aT-RA 83

Figure 10. Basal and testosterone stimulated 1713-estradiol production by ovarian tissue following exposure to aT-RA 85

Appendix I

Figure 1. Characterization of non-normalized mRNA expression of six retinoid receptors in zebrafish ovarian follicles 107

Appendix II

Figure 1. Effects of the combination of aT-RA and 9-cis-RA on testosterone-stimulated 178-estradiol production in zebrafish vitellogenic follicles 108

iv Figure 2. Effects of 9-cis-RA on testosterone-stimulated 1713-estradiol production in zebrafish vitellogenic follicles 109

Figure 3. Relative mRNA expression of three retinoid receptors in zebrafish whole ovary exposed to aT-RA for 96 hours in vivo : 110

Figure 4. 17B-estradiol and testosterone levels in ovarian tissue of zebrafish following exposure aT-RA and/or 9-cis RA for 96 hours in vivo 113

Figure 5. Relative mRNA expression of CYP191A in zebrafish whole ovary exposed to aT-RA and/or 9-cis-RA for 96 hours in vivo 114

Figure 6. Relative mRNA expression of rarga and rxrga in zebrafish whole ovary exposed to aT-RA and/or 9-cis-RA for 96 hours in vivo 115

Figure 7. Effects of aT-RA and/or 9-cis-RA on the number of eggs spawned in female zebrafish 116

v CHAPTER 1: GENERAL INTRODUCTION

It is well established that retinoids and their derivatives are essential in many biological processes in teleosts including cellular growth and differentiation (Holder and

Hill 1991, Kopinke et al. 2006, Hernandez et al. 2007, Wingert et al. 2007), vision

(Nawroki et al. 1985, Hyatt et al. 1992, Schonthaler et al. 2007) and immune function

(Cuesta et al. 2002, 2004, Hung et al. 2007). Recent studies have shown that a deficiency or an excess of retinoids can inhibit the spawning of eggs in zebrafish (Danio rerio), suggesting a role for retinoids in teleost reproduction (Alsop et al. 2008). My thesis uses the zebrafish (Danio rerio) as a model species to further investigate the importance of the retinoid system in teleost ovarian physiology. My objectives were to explore the expression patterns and potential hormonal regulation of retinoic acid receptors (rars) and retinoid x receptors (rxrs) in zebrafish ovarian follicles at different stages of development.

The effects of retinoids on ovarian function were investigated by examining the action of the biologically active retinoids, all-trans retinoic acid (aT-RA) and 9-cis-retinoic acid (9- cis-RA) on steroid hormone synthesis, steroid enzyme gene expression and egg production.

The purpose of this chapter is to provide insight into retinoid synthesis and metabolism, and to explore what is known regarding retinoid receptors and their subsequent signalling. The effect of retinoids on reproduction in mammals and other vertebrates is also discussed. This chapter provides information on the synthesis of sex steroids in fish and their role in oocyte growth and development. The thesis objectives are also outlined.

1 Retinoid synthesis and metabolism

Retinoids are derivatives of vitamin A and are defined by the presence of both a cyclic and polar end group as well as a polyene side chain and includes both natural and synthetic compounds. They are obtained from the diet as retinol, retinal, retinyl esters or provitamins (mainly 6-carotene) (Napoli 1996). Retinoids are either stored, most commonly in the liver, as retinyl esters or are further metabolized into retinal and retinol derivatives in the intestine and transported to various tissues including the kidney, spleen, gonads, lung and heart (Figure 1 and Figure 2, Blomhoff et al. 1992, Napoli 1996). For storage in the liver, the conversion of retinol to retinyl esters involves the enzymes acyl

CoA: retinol acyltranferase (ARAT) and lecitin: retinol acyl transferase (LRAT) (Guillou

1989, Blomhoff et al. 1992). It has been suggested that retinol is mainly catalyzed to retinyl esters by the enzyme LRAT, whereas ARAT is utilized when excess amounts of retinol are absorbed (Blomhoff and Blomhoff 2006).

The best characterized pathway of retinoid synthesis (Figure 2) involves the hydrolysis of B-carotene and retinyl esters to retinol (Guillou 1989). Retinol is transported through the bloodstream bound to its specific plasma carrier protein, retinol binding protein (RBP) and internalized into specific tissues via the intracellular cellular retinol binding protein (CRBP) (Kurlandsky 1995). In zebrafish two isoforms of CRBPs exist. These are CRBP(l) and CRBP(II), which are both expressed in the developing embryo as well as in adult tissue (liver, ovary, intestine, brain and testis) and are thought to be structurally similar to mammalian CRBPs (Cameron et al. 2002, Liu et al. 2005).

Alcohol dehydrogenase (ADH) reversibly converts retinol to retinal, which is then irreversibly oxidated to all-trans retinoic acid (aT-RA) by the enzymes retinal

2 dehydrogenase I and II (raldhl, raldh2) (Napoli 1999). RA exists in two biologically active forms in fish, aT-RA and 9-cis retinoic acid (9-cis RA). Several methods of biosynthesis for 9-cis RA have been proposed, including enzymatic and non-enzymatic routes from aT-RA, however a precise mechanism has not been established (Chambon

1996, Napoli 1999). It has also been suggested that the aT-RA derivatives 11-cis retinoic acid (11-cis RA) and 13-cis retinoic acid (13-cis RA) function as a biologically active retinoids and may act as ligands for transcription factors (discussed below), but no clear evidence has been reported to date (Blaner 2001, Blomhoff and Blomhoff 2006).

The metabolism of RA (Figure 1) is important for the control and maintenance of

RA levels within tissues and occurs through two separate P450 cytochrome enzymes;

CYP26A1 and CYP26B1 (Nelson 1999, Yamada et al. 2000). These enzymes catabolize aT-RA to its polar metabolites for excretion which include 4-hydroxy retinoic acid (4-

OH-RA), 4-oxo retinoic acid (4-oxo-RA) and 18-hydroxy retinoic acid (18-OH-RA)

(Napoli 1999, Gu et al. 2005). However it is thought the CYP26 enzymes only degrade aT-RA and do not recognize 9-cis RA (Sonneveld et al. 1996). Recently the expression patterns of a novel CYP26 gene (CYP26dl) has been characterized in zebrafish early development and is also thought to be involved in aT-RA metabolism (Gu et al. 2005, Gu etal.2006).

Retinoid signalling

Two major families of nuclear retinoid receptors exist in vertebrates; retinoic acid receptors (rars) and retinoid x receptors (rxrs), each with numerous isoforms. Rars are activated by the binding of aT-RA and 9-cis RA, whereas rxrs are activated solely by the binding of 9-cis RA (Figure 2, Giguere 1994, Beckett and Petkovich 1999). Rxr

3 receptors belong to a large steroid/thyroid superfamily (Nagaya and Jameson 1993, Jones et al. 1995, Zheng et al. 1999) and are able to form either homodimers with rxrs or heterodimers with nuclear receptors of the same family including vitamin D receptors

(VDRs), thyroid hormone receptors (THRs), peroxisome proliferator activated receptors

(PPARs; Ibabe et al. 2002, Mimeault et al. 2006, Dupont et al. 2008) and constitutive androstone receptors (CARs; Jones et al. 1995, Min et al. 2002) as well as rars.

Alternatively, rars are only able to form heterodimers with rxrs. These dimers bind to retinoic acid response elements (RAREs) located in the promoter region of various genes and activate or repress their transcription (Clagett-Dame and DeLuca 2002).

To date, ten retinoid receptors have been identified in zebrafish. These include six rxrs (rxraa and rxrab, rxrba and rxrbb, rxrga and rxrgb) as well as four rars (raraa and rarab, rarga and rargb) (Hale et al. 2006, Talafuss et al. 2006, Waxman and Yelon 2007).

Gene expression of the retinoid receptors has been investigated in developing zebrafish, and all receptors are expressed during embryogenesis (Talafuss et al. 2006, Waxman and

Yelon 2007). Alternatively only the receptors rxrab, rxrba, rxrbb, rxrga, raraa and rarga have been identified in adult zebrafish (Alsop et al. 2008) however the roles of the specific retinoid receptors are poorly understood.

Orthologs of the retinoid receptors, which are homologous genes in other species, have been identified in mammals. Similar orthologs to rxrab, rxrba and rxrga are present in both mice and humans, and include RXRa (Mangelsdorf et al. 1990, Leid et al. 1992),

RXRB (Yu et al. 1991, Nagata et al. 1994) and RXRy (Leid et al. 1992, Boehm et al.

1997) respectively. Orthologs of rxraa, rxrbb and rxrgb, which are thought to have arisen following the teleost gene duplication event (Howarth et al. 2008) do not appear to be

4 expressed in mammals. Rar othologs also exist for raraa and rarga in mammals including

RARa and RAR in humans (Mangelsdorf et al. 1990, Hale et al. 2006) and RARa and

RARy in mice (Dolle et al. 1989, Mohan et al. 2003) but do not exist for the duplicated genes rarab and rargb. Mammals also express an additional rar isoform, RAR6 (Dolle et al. 1989) however no such homologous gene has been identified in the zebrafish. Despite the multiplicity of retinoid receptors across species surprisingly little is known regarding their function.

Retinoids and Reproduction

Several studies have examined the role of retinoids in mammalian reproduction

(Galdieri and Nistico 1994, Zheng et al. 1999, Livera et al. 2002, 2004, Brown et al.

2003). Recently studies have emerged suggesting RA, specifically aT-RA, is responsible for germ cell fate and subsequent sex determination in mice. In females, aT-RA acts on somatic cells and stimulates meiosis in germ cells in the ovary (Bowles et al. 2006,

Koubova et al. 2006, Bowles and Koopman 2007). In males, CYP26B1 metabolizes RA in germ cells and acts as the meiosis-inhibiting factor (Bowles et al. 2006). This allows for germ cells to re-enter the mitotic cycle following birth ensuring a continuous supply of sperm throughout life.

The effects of RA on steroidogenesis have been investigated in mammals and the majority of these studies demonstrate an overall inhibition of steroid hormone and gonadotropin levels. However, there does not appear to be a conserved pattern in terms of effects on the gene expression of steroidogenic enzymes. Fetal rat testes exposed to aT-RA and 9-cis RA in vitro have reduced luteinizing hormone (LH)-stimulated testosterone secretion at 14.5,15.5 and 16.5 days post conception (Livera et al. 2001,

5 Livera et al. 2004). In males, retinoids also inhibited gonadotropin action and adenylate cyclase activity in rat Sertoli cells cultured in vitro (Galdieri and Nistico 1994). Further studies during testes development revealed that RA increases the mRNA expression of certain enzymes in the steroid biosynthetic pathway including the steroid acute regulatory protein (StAR) and P450 17

Leydig cells, mRNA expression of 3J3-HSD was also down-regulated, but P450cl7 mRNA levels increased in a time and dose dependent manner (Lefebvre et al. 1994).

Studies in female mammals have provided evidence that the synthesis and metabolism of RA in the ovary is regulated. Production of RBPs and CRBPs in theca and granulosa cells has been observed in the bovine (Brown et al. 2003), porcine

(Schweigert and Siegling 2001) and human ovaries (Lee et al. 2008) suggesting the transport and metabolism of retinoids may be regulated within the ovarian follicle. At-

RA increased androgen biosynthesis and induced mRNA expression of P450scc, P450cl7 and StAR in human thecal cells following 16-24 hours of exposure (Wickenheisser et al.

2005).

Several studies have investigated the effects of RA in non-mammalian species.

Retinoic acid decreased LH-stimulated E2 production by ovarian follicles of the chicken in vitro (Pawlowska et al. 2008). Retinol, retinal and retinyl esters are deposited into the eggs offish prior to spawning for use in embryonic development following fertilization

(Irie and Seki 2001, Lubzens et al. 2003). Retinyl esters originating from the yolk are

6 also used to maintain retinoid homeostasis during embryogenesis (Isken et al. 2007).

Retinal is the main stored form of retinoids in fish eggs and binds vitellogenin in the oocytes of rainbow trout (Sammar et al. 2005). In adult zebrafish a long term (114-130 days) deficiency in retinoids decreases retinal in eggs by 78 % in comparison to controls

(Alsop et al. 2008). Interestingly, in goldfish hepatocytes, RA inhibited vitellogenin production (Wells and Van Der Kraak, unpublished data) which may have contributed to a decrease in oocyte development. It has also been suggested that the transport proteins of retinoids, RBPs, originate in the theca and granulosa cell layers of the fish oocyte

(Lubzens 2003, Sammar et al. 2005). Transcripts for RA metabolizing and synthesizing enzymes (CYP26A and raldh2) are also present within the gonads of male and female zebrafish and change with diet retinoid levels (Alsop et al. 2008) suggesting a larger role for retinoids and their derivatives in the fish ovary. A retinoid deficiency can significantly decrease the number of eggs spawned in female zebrafish by 73 %, whereas an excess of retinoids also decreases spawned eggs by 93 % (Alsop et al. 2008). There were no effects on fertilization rates. Although research has investigated potential aspects of retinoids in the reproduction of non-mammalian vertebrates, there is a lack of information regarding the mechanisms behind their effects.

Control of ovarian follicle development

Zebrafish are asynchronous spawners, containing up to four stages of ovarian follicles at any given time, and are thus ideal organisms for the study of follicular development. The follicles of zebrafish are also relatively large allowing for separation and sorting of the various stages for investigation.

7 The structure of the oocyte in zebrafish is similar to other teleosts. Zebrafish

follicles contain two layers of cells; the outermost layer consisting of fibroblasts and thecal cells and the inner layer composed of granulosa cells which are separated from the

oocyte by the vitelline envelope (Ge 2005). The development of the oocyte is primarily

controlled by the pituitary and subsequent release of gonadotropins such as LH and follicle stimulating hormone (FSH) which are mediated by growth factors, inhibins, activins and steroids hormones (Danforth 1996, Nagahama and Yamashita 2008). During development, oogenia propagate and give rise to follicles which undergo growth through various stages within the ovary as outlined by Selman et al. (1993) and include primary follicles (stage I: 7-140 um; oocyte in nest, includes pre-follicle and surrounding connective tissue), pre-vitellogenic follicles (stage II: 0.14-0.34 mm; oocyte transparent, germinal vesicle (GV) visible and irregular in shape) and vitellogenic follicles (stage III:

0.34-0.69 mm; follicle opaque, GV completely obscured).

Vitellogenic follicles become mature follicles (stage IV: 0.69-0.73 mm; follicle opaque until after GV breakdown) following a surge of gonadotropin from the pituitary which stimulates the ovarian follicles to be responsive to the maturation inducing steroid

(MIS) (Ge 2005). In zebrafish the MIS responsible is 17a-20B-dihydroxy-4-pregnen-3- one (17a20fiP) which is converted from 17a-hydroxyprogesterone by the enzyme 20/3- hydroxysteroid dehydrogenase (20/3-HSD) located in the granulosa layers of the follicle

(Kazeto et al. 2005). Other major changes in steroid biosynthesis at the time of oocyte maturation involve a shift from E2 to 17a20fiP production by late vitellogenic follicles to initiate final maturation (Patino et al. 2001, Ge and Pang 2002, Nagahama and Yamashita

2008).

8 Production and regulation of sex steroid hormones

The steroidogenic pathway in zebrafish (Figure 3) is similar to that of mammals.

The ovary is the major site of steroidogenesis in the zebrafish and the subsequent

synthesis of estrogens, androgens and progestins. Estrogens have many dynamic and

important roles in teleost development, reproduction and behaviour which are mediated

through nuclear receptors in target tissues. Androgens are involved in the regulation of

secondary sexual characteristics and male reproduction, whereas in females, androgens

are converted to estrogens which are essential for oocyte growth and development.

Progestins such as 17a20J3P are involved in zebrafish oocyte maturation (Lister and Van

Der Kraak 2008).

Steroid hormones are derived from cholesterol and are involved in many

important physiological functions in fish. Teleost synthesis of sex steroid hormones

occurs through the elaborate but well characterized steroidogenic pathway located within

the gonads (Figure 3). The rate limiting step in steroidogenesis involves the mobilization

of cholesterol from cellular stores to the outer mitochondrial membrane and its

subsequent transfer to the inner mitochondrial membrane by the steroid acute regulatory

protein (StAR) (Stocco and Clark 1996, Bauer et al. 2000). The cholesterol side-chain

cleavage enzyme (P450scc) converts cholesterol to pregnenolone by hydroxylation and is

the first step in the synthesis of all steroids (Hu et al. 2001). During sex hormone

synthesis, the androgen androstenedione is synthesized from pregnenolone through a

series of enzymatic reactions which produces the intermediate steroids progesterone, 17a

hydroxyprogesterone, 17a-hydroxyprenenolone and dehydroepiandrosterone which are all synthesized by either 3B-hydroxysteroid dehydrogenase (36-HSD) or P450 17a-

9 hydroxylase/17,20-lyase (P450cl7) enzymes. These steroid intermediates are believed

to be inactive and are further metabolized for excretion (Young et al. 2005).

Androstenedione is then converted to testosterone (T) by the enzyme 1715-hydroxysteroid

dehydrogenase type 3 (17B-HSD) and subsequently to 1713-estradiol (E2), estrone and the male androgen 11-ketotestosterone (11-KT) by the enzymes P450 aromatase A

(P450aromA, CYP191 A) in females or P450 1 lB-hydroxylase (P4501 IB) and 1113- hydroxysteroid dehydrogenase in males (Young et al. 2005).

Given the small size of the zebrafish it is not possible to measure sex steroids in the plasma. In order to investigate steroid hormone status researchers commonly use several approaches. This includes measurement of whole body or ovarian steroid levels or in vitro incubation of ovarian follicles to examine the effects of gonadotropin or steroid precursors in the biosynthetic capacity of the ovarian follicle (Lister and Van Der

Kraak 2008). Additionally, expression of the steroid enzymes is quantified by technology such as Real-Time PCR (Ings and Van Der Kraak 2006)

Thesis objective and outline

The objectives of this research were to investigate the importance and potential regulation of the mRNA expression of the rxr and rar receptors throughout ovarian development and to determine the role of RA in ovarian function in the zebrafish.

Previous research by Alsop et al. (2008) has established a fundamental role for RA in the zebrafish by demonstrating that a deficiency or an excess of RA negatively affects reproduction.

Based on this previous knowledge, a primary objective was to confirm and characterize the presence and mRNA expression coding of the selected rar and rxr

10 isoforms in the zebrafish primary, pre-vitellogenic and vitellogenic ovarian folliQle stages using Real-Time PCR. I hypothesized that retinoid receptors would be present in normal follicle development and that their expression would change between follicle stages.

A secondary objective was to investigate potential regulators of retinoid receptors during ovarian development. The steroid hormones E2 and 17a20BP were selected as suitable candidates due to their extensive roles in oocyte growth, development and maturation in the zebrafish. I hypothesized that hormones involved in various stages of ovarian follicle development would influence the mRNA expression coding for retinoid receptor isoforms.

The third objective was to determine if exposure to aT-RA and 9-cis RA affected various aspects of ovarian function in the zebrafish by eliciting changes in steroid hormone production such as E2 and T, mRNA expression coding for enzymes involved in steroid hormone synthesis, as well as egg production by evaluating the number of eggs spawned by breeding females. I hypothesized that RA would alter the production of E2 and T by affecting genes involved in steroid biosynthesis such as CYP191 A, 36-HSD,

StARandCYP17.

The following two data chapters have been written in manuscript format for submission in consideration for publication in Comparative Biochemistry and Physiology

(Chapter 2) and General and Comparative Endocrinology (Chapter 3). For this reason

Chapter 2 and Chapter 3 were written without formal hypotheses and predictions. The objectives of each study have been clearly stated. The hypotheses and predictions presented in the introduction will be revisited in the general discussion.

11 Figure 1: Production of retinoid precursors and metabolites for excretion and storage.

Retinoids are obtained through the diet most commonly in the form of carotenoids (13- carotene) and retinyl esters (retinyl palmitate). These are either metabolized by the enzymes LRAT (lecithin: retinol acyl transferase) and/or ARAT (acyl CoA: retinol acyltransferase) to retinol then converted to retinyl esters and stored in the liver or released into the bloodstream. Retinol is subsequently converted through a series of enzymatic reactions involving several binding proteins to the biologically active all-trans retinoic acid (aT-RA) and 9-cis retinoic acid (9-cis-RA). The known metabolites of aT-

RA are generated by the enzyme CYP26 for excretion (4-OH-RA; 4-hydroxy retinoic acid, 4-oxo-RA; 4-oxo retinoic acid, 18-OH-RA; 18 hydroxy retinoic acid).

12 LIVER r ^

X^VVNA- *OfKHI,CH, Carotenoids (B-carotene) LRAT LRAT o retinol ^> <=$ ARAT ARAT *CM^CH,1,CH, Retinal ester (retinyl palmitate) b v J Retinal ester (retinyl palmitate)

LRAT ARAT EXCRETION V c ^s, ™ ^Js^XXc OH C> aT-RA « 4-OH-RA retinol

~~gr-^vA, 4-oxo-RA CHO~~

~~13-cisRA f^Y^v-^v^^^v^^\c~~

9-cis RA 18-OH-RA O" OH 13 Figure 2: Retinol (Rol) is carried into the bloodstream by retinol binding proteins (RBPs) produced in the liver. Retinol is then taken up by target tissues and binds to cellular retinol binding proteins (CRBPs). Alcohol dehydrogenase (ADH) or short-chain dehydrogenase/reductase (SDR) reversibly converts retinol to retinal (Ral), which is then irreversibly converted to RA by retinal dehydrogenase 2 (Raldh2) and bound by cellular retinoic acid binding proteins (CRABPs). RA is converted into two biologically active forms; all-trans retinoic acid (aT-RA) and 9-cis-retinoic acid (9-cis-RA) and these bind to two classes of nuclear receptors including the retinoic acid receptors (rars) and the retinoid X receptors (rxrs). Rars are activated by binding of aT-RA and 9-cis-RA while rxrs are activated solely by 9-cis RA. The rxrs are able to form heterodimers with rars, rxrs and other nuclear receptors of the same family including constitutive androstone receptors (CARs), vitamin D receptors (VDRs) and peroxisome proliferator activated receptors (PPARs) indicated by an X. These heterodimers bind to retinoid response elements (RAREs) to regulate gene transcription (Adapted from Alsop et al. 2005).

~~14 TARGET TISSUE~~

15 Figure 3: Schematic representation of steroidogenesis in teleost ovary. In brief, cholesterol is transferred from the outer mitochondrial membrane to the inner mitochondrial membrane by the steroid acute regulatory protein (StAR; insert).

~~Following a series of enzymatic reactions in which several intermediate metabolites are produced, the main female steroid hormones 176-estradiol and estrone are generated.~~

The maturation inducing steroid 17a- 20J3-dihydroxy-4-pregnen-3-one (17a206P) is also produced from 17a-hydroxyprogesterone. (LH: luteinizing hormone, FSH: follicular stimulating hormone, G: Gs protein, ATP: adenosine triphosphate, cAMP: cyclic AMP,

PKA: protein kinase A, P450sec: P450 side chain cleavage, 3J3-HSD: 38- hydroxysteroid dehydrogenase, P450cl7: P450 17a-hydroxylase/17,20-lyase, 17B-HSD1: 1713- hydroxysteroid dehydrogenase type 1,178-HSD3: 176-hydroxysteroid dehydrogenase type 3,2013-HSD: 2013-hydroxysteroid dehydrogenase, P450arom: P450 aromataseA).

~~16 LH or FSH from pituitary~~

~~J-~-*~" T Free cholesterol~~

~~nntpr mfimhrane intermembrane StAR space~~

~~i , inner membrane~~

~~mitochondrion~~

~~P450scc~~

~~V 3IJ-HSD~~

~~Pregnenolone Progesterone~~

~~CH3~~

~~P450c17 P450C17 H CO -OH 20U-HSD V 36-HSD V =>~~

~~17a ,20IS-Dihydroxy-4-pregnen- 17a -Hydroxyprogesterone 3-one 17a -Hydroxypregnenolone~~

~~P450C17 P450C17 GRANULOSA CELL~~

~~V 3R-HSD V~~

~~Dehydroepiandrosterone Androstenedione~~

~~17R-HSD V V r=>~~

~~Testosterone Androstenediol THECA CELL GRANULOSA CELL P450arom P450arom~~

~~17S-Estradiol Estrone 17 CHAPTER 2: CHARACTERIZATION AND EXPRESSION OF RETINOID RECEPTOR ISOFORMS IN ZEBRAFISH (DANIO RERIO) OVARIAN DEVELOPMENT.~~

~~ABSTRACT~~

The present studies were conducted to confirm and characterize the presence and mRNA expression coding for ten retinoid receptors in the adult zebrafish ovary and to determine whether these receptors are regulated by steroid hormones. Using Real-Time

PCR it has been shown that the mRNA coding for only six retinoid receptors (rxraa, rxrab, rxrba, rxrbb, rxrga and rarga) is expressed in the ovary of zebrafish. Female zebrafish were exposed to either the maturation inducing steroid 17a, 20B-dihydroxy-4- pregnen-3-one (17a20BP), 1713-estradiol (E2) or left untreated for 24 hours and whole ovary pieces and isolated ovarian follicles were analyzed for the expression of the six retinoid receptors. The mRNA coding for retinoid receptors was uniformly expressed between primary (7-140 um), pre-vitellogenic (0.14-0.35 mm) and vitellogenic (0.35-

0.69mm) ovarian follicles in untreated female zebrafish with the exception of the retinoid receptor mRNA encoding rxrbb which showed a significant reduction in vitellogenic follicles. E2 had little effect in the whole ovary apart from an up-regulation of the mRNA encoding the receptor rxraa. In contrast, 17a2013P generally reduced RA receptor mRNA expression in the whole ovary and caused a significant decrease in the expression of the mRNA encoding rxrba and rarga. This study has demonstrated the presence of retinoid receptors in zebrafish ovarian follicles and identifyied potential hormonal regulation of three retinoid receptors within the zebrafish ovary.

~~18 INTRODUCTION~~

Retinoids are hormone derivatives of vitamin A that affect a wide range of physiological processes. Although retinoids are well known for their role in vision, they are also essential for the health and survival of vertebrates affecting growth, differentiation, reproduction and morphogenesis (Blomhoff and Blomhoff 2006,

~~Wickenheisser et al. 2005, Moreno et al. 2008).~~

Two major families of retinoid receptors exist in most vertebrates; retinoic acid receptors (rars) and retinoid X receptors (rxrs), each with numerous isoforms. To date ten retinoid receptors have been identified in the zebrafish (Danio rerio) genome and this includes the duplicate genes of each rxr or rar (Hale et al. 2006, Talafuss et al. 2006,

Waxman and Yelon 2007). Rars are activated by binding of the biologically active retinoids all-trans retinoic acid (aT-RA) and 9-cis retinoic acid (9-cis-RA) whereas rxrs are activated solely by the binding of 9-cis-RA (Giguere 1994, Beckett and Petkovich

~~1999). Rxrs and rars are members of a large steroid/thyroid hormone superfamily~~

(Nagaya and Jameson 1993, Jones et al. 1995, Zheng et al. 1999). Rxrs form homodimers with other rxrs or heterodimers with other nuclear receptors of the same family including rars, thyroid hormone receptors, vitamin D receptors, peroxisome proliferator activated receptors and constitutive androstane receptors (Jones et al. 1995,

Min et al. 2002), whereas rars only form heterodimers with rxrs. These dimers then bind to retinoic acid response elements (RAREs) and activate or repress the transcription of genes (Giguere 1994, Clagett-Dame and DeLuca 2002). RAREs have been identified in the promoter region of several genes including the RARB gene in mammals, the RA metabolizing enzyme CYP26, hepatocyte nuclear factors (HNFla, HNF4a) and

~~19 aromatase cytochrome P450 enzyme B (CYP19A2) in the zebrafish (De The et al. 1990,~~

~~Loudig et al. 2000, Qian et al. 2000, Kazeto et al. 2001) suggesting that a variety of~~

~~functions are mediated by rxr and rars.~~

~~Three rxrs and three rars have been characterized in mammals and include RXRa,~~

~~RXRB and RXRy (Nagata et al. 1993, Seleiro et al. 1994, Boehm et al. 1997) and RARa,~~

RARB and RARy (Dolle et al. 1989, Mohan et al. 2003). In zebrafish, similar retinoid receptors have been identified each having a duplicate gene arid are thought to have arisen following the teleost genome duplication event. To date an ortholog of the mammalian gene RARB has not yet been identified and therefore ten isoforms are present in zebrafish and include rxraa and rxrab, rxrba and rxrbb, rxrga, and rxrgb as well as raraa and rarab,rarga and rargb (Hale et al. 2006, Talafuss et al. 2006, Waxman and Yelon

~~2007). The expression patterns of all the retinoid receptors have been characterized in zebrafish throughout embryogenesis (Hale et al. 2006, Tallafuss et al. 2006, Waxman and~~

Yelon 2007). Only rxrab, rxrba, rxrbb, rxrga, raraa and rarga have been studied in adult zebrafish where they exhibit varying expression in several tissues (Alsop et al. 2008). To date there is no information regarding the expression of the newly identified zebrafish receptors (rxraa, rxrgb, rarab, rarbg; Waxman and Yelon 2007) in adults.

The objectives of this study were to characterize the presence and expression patterns of the ten retinoid receptors in zebrafish ovarian follicles during the different stages of development and secondly, to determine if these receptors are regulated by steroid hormones prominent in ovarian follicle development. The mRNA expression encoding the rxr genes (rxraa, rxrab, rxrba, rxrbb, rxrga and rxrgb) and the rar genes

~~20 (raraa, rarab, rarga and rargb) were evaluated using Real-Time PCR (Polymerase Chain~~

~~Reaction) in primary, pre-vitellogenic and vitellogenic ovarian follicles.~~

~~The growth and maturation of ovarian follicles in the zebrafish is dependent on~~

~~the proper timing of sex steroid secretion. 1713-estradiol (E2) is produced during oocyte~~

~~growth and plays a pivotal role in vitellogenesis, whereas the maturation inducing steroid~~

~~17a, 20B-dihydroxy-4-pregnen-3-one (17a20BP) is secreted immediately before ovulation~~

~~and is a potent inducer of oocyte maturation. The transition from oocyte growth to~~

~~oocyte maturation involves a shift in the production of E2 to 17a20BP in the zebrafish~~

~~ovary (Ge and Pang 2002, Nagahama and Yamashita 2008). Therefore I exposed~~

~~sexually mature female zebrafish to 17a20BP and E2 for 24 hours to determine if these~~

~~hormones were potential regulators of retinoid receptor gene expression. Retinoid~~

~~receptor gene expression was subsequently investigated within the zebrafish whole ovary~~

~~and in ovarian follicle stages.~~

~~MATERIALS AND METHODS~~

~~Experimental Animals~~

~~Adult zebrafish (40-100 mg) were purchased from DAP International (Etobicoke,~~

~~ON) and held at the Hagen Aqualab (University of Guelph, Guelph, ON) in A-HAB units~~

(Aquatic Eco-Systems, Apopka FL) with re-circulating well water at 28 °C. Fish were held under a 12 hr light and 12 hr dark photoperiod and fed twice daily to satiation with a commercial salmon fry formulation (Martin Mills, Elmira, ON) or frozen bloodworms

~~(Oregon Desert Brine Shrimp Co., Lakeview, OR).~~

~~Experimental design~~

~~21 Sexually mature female zebrafish were transferred to 4 L glass beakers containing~~

3.5 L of Hagen Aqualab well-water. Each treatment included multiple beakers which were randomly placed in a water bath held at 28 °C. Water was changed daily and fish were fed twice a day to satiety with frozen bloodworms. Following the exposure period, fish were anaesthetized between 9 am and 1 pm by overdose with MS-222 and sacrificed by spinal transection.

Experiment 1 evaluated the presence and tissue distribution of the ten retinoid receptors in the zebrafish. Untreated female and male zebrafish were sacrificed and the whole ovary, muscle, liver, testis and intestine were removed for RNA extraction and the evaluation of the mRNA expression coding for the rxrs and rars using Real-Time PCR

The second experiment evaluated the mRNA expression encoding rars and rxrs in zebrafish primary (stage I, 7-140 urn), pre-vitellogenic (stage II, 0.14-0.35 mm) and vitellogenic (stage III, 0.35-0.69 mm) follicles. Untreated breeding female zebrafish

(n=13) were sampled from beakers following a 48 hour holding period and the ovaries were removed and immediately placed in 900 ul of RNALater® (Ambion, Austin, TX) and stored at 4 "C. Ovaries were placed in sterilized diethylpyrocarbonate (DEPC)- treated water and separated into three stages; primary, pre-vitellogenic and vitellogenic (n

~~= 70-100 follicles/stage/fish) based on morphological characteristics as outlined in~~

~~Selman et al. (1993). Once separated, follicles were snap frozen at -80 °C until RNA extraction.~~

Experiment 3 investigated whether the mRNA expression encoding retinoid receptors in the zebrafish whole ovary was regulated by the steroid hormones 17a206P and E2. Non-spawning sexually mature female fish were added to six beakers containing

~~22 Hagen Aqualab well-water (n=3 fish per beaker) and allowed to acclimate for 48 hours.~~

~~The steroid hormones 17~~

~~(final concentration of ETOH was 0.05%). Following a 24-hour exposure period fish were sacrificed and whole ovaries were removed and immediately snap frozen in liquid nitrogen and stored at -80 "C.~~

~~A fourth experiment evaluated the effects of 100 ng/L 17~~

~~17a20BP treated groups (n=3) received 35 ul of stock solution to achieve a final concentration of 100 ng/ml whereas the controls received 35 ul ETOH. Following the~~

24-hour exposure period fish were sacrificed and whole ovaries were removed and immediately placed in RNALater®. Follicles were later separated into primary, pre- vitellogenic and vitellogenic stages in sterilized diethyl pyrocarbonate (DEPC) treated

~~H2O and snap frozen at -80°C until RNA extraction.~~

~~23 RNA extraction~~

~~To evaluate the mRNA expression encoding rxrs and rars in the zebrafish, total~~

~~RNA was extracted from whole ovary pieces (< 50 mg) and primary, pre-vitellogenic and~~

~~vitellogenic ovarian follicles (n=70-100/stage) using a guanidine thiocynate phenol~~

~~chloroform extraction method from Chomczynski and Sacchi (1987). Tissues were~~

~~homogenized in a denaturing solution (DEPC H2O, 0.7 M sodium citrate, 10% N-~~

~~lauroylsarcosine, guanidine thiocyanate, 2-mercaptoethanol) using a polytron~~

~~homogenizer. Sodium acetate (2 M, pH = 4.0) followed by water saturated phenol and~~

~~chloroform:isoamyl alcohol were added, mixed by inversion and centrifuged at 4 °C at 10~~

~~000 g for 20 minutes. The upper aqueous phase was removed and the samples were re-~~

~~extracted with water saturated phenol and chloroform:isoamyl alcohol, mixed by~~

~~inversion, incubated at 4 °C and centrifuged at 10 000 g for 20 minutes. The upper~~

~~aqueous phase was precipitated overnight with 100% ethanol and sodium acetate (3 M) to~~

~~ensure all RNA was in solution. To reconstitute, samples were centrifuged at 4 °C at 15~~

~~000 g, washed with 70 % ETOH followed by a second wash with 100 % ETOH and~~

~~reconstituted in 15 to 20 ul sterilized DEPC H2O. The mRNA protein content and RNA~~

~~content in each sample was quantified using spectrophotometry by measuring the~~

~~absorbance of 50x diluted samples in 10 mM Tris-HCl (pH 8.0). The purity of the RNA~~

~~samples was determined by calculating the ratio of absorbance of nucleic acids at 260 nm~~

~~and the absorbance of proteins at 280 nm.~~

~~Reverse Transcription~~

~~For subsequent DNA synthesis, total RNA samples (2 ug) were first DNase treated with lOx reaction buffer (200 uM Tris HC1, 20 mM MgCl2; Sigma, St. Louis,~~

24 MO) and Amp-Dl (10 mM Tris-HCl, 10 mM CaCl2, 10 mM MgCl2, Sigma), and brought to a final volume of 10 ul with DEPC H2O and incubated at room temperature for 15 minutes. Stop mix (50 mM EDTA, Sigma) was added and the samples were heated at 70

~~°C for 10 minutes and immediately placed on ice. Samples were reverse transcribed using a reverse transcriptase (RT) cocktail which included; 5x RT buffer (50 mM Tris-~~

~~HCl, 75 mM KC1, 3 mM MgC12, Invitrogen, Carlsbad, CA), Rnasin (40 IU, Invitrogen,~~

~~Carlsbad, CA), dNTPs (0.5 mM, Roche Molecular Biochemicals, Laval, PQ), DTT (10 mM, Invitrogen, Carlsbad, CA), M-MLV reverse transcriptase (200 U, Invitrogen,~~

~~Carlsbad, CA) and random primers (0.1 ng, Roche Molecular Biochemicals, Laval, PQ).~~

Separate samples were identically treated without the addition of M-MLV reverse transcriptase to verify the absence of genomic DNA. Samples were incubated for 1 hour at 37 °C followed by 5 minutes of cycling at 95 °C to inactivate the enzyme. First strand cDNA was diluted 5x with autoclaved water and stored at -20 °C for Real-Time PCR amplification.

~~Real-Time PCR~~

~~Primers appropriate for Real-Time PCR use were designed to span exon-exon boundaries in the mRNA sequence to prevent the amplification of genomic DNA, using~~

Primer Express software v. 2.0 (Applied Biosystems; Forster City, CA). Forward and reverse primers were designed for ten RA oligonucleotide retinoid receptors as well as the housekeeping genes P-actin and elongation factor alpha-1 (EF) based on published mRNA sequences (Table 1).

~~Each Real-Time PCR reaction well contained 5 ul diluted first strand cDNA, forward and reverse primers (0.05 uM), and SYBR green PCR Master Mix® (SYBR~~

~~25 green dye, dNTPs, Passive Reference I, AmpliTaq® Gold DNA polymerase, Applied~~

~~Biosystems, Foster City, CA). Using the ABI Prism 7000 sequence detection system~~

(Applied Biosystems, Foster City, CA), samples were incubated at 95 °C for 10 minutes, followed by 40 cycles of 15 seconds at 95 °C and 1 minute at 60 °C. PCR reactions were run in duplicate and the cycle threshold values were averaged for data analysis.

~~A standard curve was generated for each primer pair by serial dilution of 2 ug of~~

RT product in 50 ng/ml yeast RNA (Sigma, St. Louis, MO) to determine the efficiency of the primer amplification. The standard curve was produced for each gene by graphing the negative log of the dilution factor against the relative cycle threshold (Ct) value, generating a linear equation. To be considered suitable for analysis each primer pair was required to have a linear standard curve with an r2 value above 0.98, have consistency among replicate Ct values, and primer amplification efficiency between 85% and 110% based on the equation E% = 10A(-1/slope)-1)* 100. If gene primer pairs did not meet these criteria, they were excluded from the experiment. The slope of the line and the y- intercept were used in the analysis of gene expression. Each retinoid receptor gene was analyzed in several zebrafish tissues including zebrafish ovary, muscle, liver, gonad and intestine.

~~Nucleotide sequences for the PCR products generated in the ovary for the genes of interest were sequenced by capillary electrophoresis (ABI3730 DNA Analyzer,~~

Genomics Facility, Advanced Analysis Centre, University of Guelph). Sequences were compared to published zebrafish nucleotide sequences (NCBI BLAST) using multiple sequence alignments (ClustalW, European Bioinformatics Institute) to ensure amplification of the correct product.

26 Table 1: Forward (F) and reverse (R) nucleotide primer pairs for retinoid receptors and housekeeping genes in the zebrafish (Danio rerio), their product size (base pairs, bp) and associated accession numbers from GenBank.

Gene Primer Sequence Size Accession (bp) number F-ACAGGGAAAAGATGACACAGATCA P-actin 72 AF025305 R-CAGCCTGGATGGCAACGTA F-GATCACTGGTACTTCTCAGGCTGA EF 111 NMJ31263 R-GGTGAAAGCCAGGAGGGC F-GGCTCTCCCTTCTCCGTCAT rxraa 101 EF028132 R-GTGCGAGTTCAACTGAGGGC F-CCGAACTGGCAGTAGAACCAA rxrab 86 U29894 R-TGTTACAGGGTCGTTCGGAGA F-TACTGCCGCTACCAGAAGTGC rxrba 86 U29942 R-CGCTCCTCCTGAACGGATC F-CCCCCTTTGGCTTA AAGTCTG rxrbb 100 U29941 R-GCCATAATGCTTCCCCGAA F-TTGAATGGGCGAAGAGGATC rxrga 86 U29940 R-AGACCGATCCTCAGGGAAACA F- AGTGCCTGATCGACAAGCG rxrgb 103 EF028133 R- GCCTCTCTTCCTGAACCGC F- GCGGATCCAACCACTCTATTG raraa 101 L03398 R- GCAGGGCTTGTAGATGCGAG F- TTCGCTTTCGCCAACCAG rarba 101 L03399 R- TCTAGATCCTGCCGATCTCCAC F-ATGTCCAAGGAAGCTGTGCG rarga 100 S74156 R-TCCAGTTCCCCACTCAGCTC F- GTGAGGGCTGCAAGGGTTT rargb 101 EF028131 R- GTTGCGCGTCACTTTGTTGAT

~~27 Standardization of gene expression~~

~~Traditional standardization procedures involve the comparison of Real-Time PCR~~

~~raw arbitrary input values to an internalized control such as an unchanging housekeeping~~

~~gene. Analysis of the housekeeping genes from in vivo experiments revealed significant~~

~~differences between the mRNA expression encoding fi-actin and EF in untreated ovarian~~

~~follicle stages (experiment 2) as well as in ovarian follicles exposed to 17a20BP when~~

~~compared to controls (experiment 4). The mRNA expression encoding 6-actin was also~~

~~significantly different in the whole ovary exposed to E2 whereas the expression of EF~~

~~remained unchanged (experiment 3). Therefore, the Real-Time PCR input values for~~

~~experiment 2 and experiment 4 were normalized against adjusted EF using a formula~~

~~derived from Billiau et al. (2001) and Essex-Fraser et al. (2005). The conversion~~

~~involves the average input amount of each treatment group to be equalized to the~~

~~controls. This involves the conversion of each sample to a value that corresponds with a~~

~~new average for the specified treatment group using the following formula:~~

~~Individual value within a treatment/(mean value of a treatment group/mean value of control group)~~

~~The input values of experiment 3 were normalized to EF using traditional normalization~~

~~methods.~~

~~Data Analysis~~

~~All experiments were examined for homogeneity of variance and statistical~~

~~analysis involved the analysis of variance (ANOVA) followed by Tukeys post hoc tests~~

~~when significance was found, to compare the average normalized input values between~~

~~28 ovarian follicle stages, or hormone treatments in comparison to untreated control~~

~~zebrafish. Significance was denoted by a p<0;05.~~

~~RESULTS~~

~~Tissue distribution~~

~~Experiment 1 established mRNA expression encoding for six retinoid receptors~~

~~(rxraa, rxrab, rxrba, rxrbb, rxrga and rarga) in zebrafish tissue. Figure 1 shows a~~

~~representative Real-Time PCR amplification plot for rxraa. The mRNA encoding this~~

~~isoform was successfully amplified (Figure la) and evaluation of the dissociation curve~~

~~(Figure lb) demonstrated the amplification of a single product. Nucleotide sequencing~~

~~and nucleotide alignment of the Real Time PCR purified product with published~~

~~sequences confirmed the proper amplification of the mRNA coding for rxraa as well as~~

the selected rxrs and rars within the zebrafish ovary. These receptors (rxraa, rxrab, rxrba, rxrbb, rxrga and rarga) were selected for further investigation in the zebrafish ovary based on successful primer design and cDNA amplification within the zebrafish. In contrast, the receptors raraa, rarab and rargb in zebrafish ovary, muscle, liver, gonad or intestine did not fulfill the predetermined criteria to be designated suitable for analysis and were subsequently excluded from further study. The retinoid primer pairs did not have a standard curve with an r above 0.98 and lacked consistency among sample replicates. Primer efficiency was also consistently below 80%. The primers for the isoform rxrgb did not amplify a product or produce a Ct value in any of the tissues analyzed and it was therefore concluded that mRNA encoding rxrgb was not expressed in the adult zebrafish (data not shown).

~~29 MRNA expression encoding retinoid receptors in zebrafish ovarian follicles~~

~~The second experiment evaluated the mRNA expression encoding all six receptor~~

~~isoforms in separated primary, pre-vitellogenic and vitellogenic ovarian follicles. The~~

~~mRNA expression coding for ft-actin and EF were both significantly lower in stage II and~~

~~III ovarian follicles compared to stage I follicles from untreated fish (p<0.05; Figure 2).~~

~~Due to the changes in expression of the housekeeping genes between stages, it was~~

~~appropriate to evaluate the mRNA expression encoding the retinoid receptor expression~~

~~based on both normalized and non-normalized input values. Analysis of Real-Time PCR~~

~~non-normalized input values and normalized adjusted input values showed the same~~

~~results in mRNA expression coding for retinoid receptors (Figure 3). The mRNA~~

~~encoding for the receptors rxraa, rxrab, rxrba, rxrga and rarga was uniformly expressed~~

~~between follicle stages, whereas the mRNA expression encoding rxrbb showed a~~

~~significant decrease from stage I to stage III in untreated zebrafish as evaluated by both~~

~~approaches (p<0.05).~~

~~Regulation of retinoid receptors in zebrafish ovary~~

Experiment 3 evaluated the mRNA expression encoding the retinoid receptors in the zebrafish whole ovary following exposure to E2 and 17a2013P. All input values were normalized to EF using standard normalization procedures as its expression did not change in the zebrafish ovary following exposure to E2 or 17a20BP (Figure 4). Exposure to 17a20BP for 24 hours led to a significant decrease in the mRNA expression encoding the receptor isoforms rxrba and rarga in the zebrafish whole ovary (p<0.05). The mRNA coding for rxraa was significantly up-regulated following exposure to E2 (p=0.045) but not 17a20BP. The mRNA expression encoding the receptor rxrab was significantly lower

~~30 in ovarian tissue treated with 17a20BP in comparison to tissue treated with E2 (p<0.05,~~

~~Figure 5).~~

Experiment 4 evaluated the expression of mRNA encoding only five of the retinoid receptors (rxraa, rxrba, rxrbb, rxrga and rarga) for changes between ovarian follicle stages. Exposure to 17a20BP in experiment 4 significantly reduced the expression of mRNA coding for EF in stage II and stage III ovarian follicles compared to stage I follicles (p<0.05, data not shown) and retinoid receptor input values were normalized to adjusted EF. No changes were observed in the expression of mRNA coding for any receptors within ovarian follicle stages exposed to 17

~~DISCUSSION~~

Traditional standardization methods for Real-Time PCR involve the comparison of raw arbitrary input values (non-normalized) to an internal control, typically 6-actin or EF in zebrafish. This standardization process accounts for variability in the amount of starting material as well as enzymatic and PCR efficiencies. The assumption made in these studies is that the expression of the housekeeping gene does not change with experimental treatment. The results from this study showed a significant decrease in the expression of fi-actin and EF in the various stages of zebrafish ovarian follicles either left untreated or exposed to 100 ng/L 17a20J5P. This questions the appropriateness of the normalization approach. These changes have been reported previously in developing zebrafish follicles (Ings and Van Der Kraak 2006) and have recently brought the effectiveness of these housekeeping genes under scrutiny. Due to the differences in the expression of mRNA encoding the housekeeping genes, this study has utilized a similar method as Ings and Van Der Kraak (2006) to account for these changes between follicle

~~31 Figure 1: Representative Real-Time PCR amplification plot for rxraa demonstrating the amplification of 2 ug cDNA from zebrafish whole ovary at 4x (a), 8x (b), 32x (c) and 128x~~

~~(d) serial dilution. Plot illustrates the three phases of amplification (exponential, linear and plateau) and the cycle threshold (Ct) in which input values were obtained for quantification~~

(A) and the subsequent dissociation curve demonstrating the dissociation (melting, temperature of amplicon) of only one PCR product at a given temperature from the same dilutions of zebrafish ovarian cDNA. This curve also demonstrates that there is no contamination within the PCR reaction (B)

~~32 Delta Rn vs Cycle~~

~~1.0e+001~~

~~1.0e+000~~

~~1 Qe-001 & i 1 .De-002~~

~~1.0e-003~~

~~1.0e-004 1 3 5 7 9 11 13 15 17 19 21 23 25 27 29 31 33 35 37 39 Cycle Number~~

~~Dissociation Curve B 0.10 I 1~~

~~0.08 1~~

~~0.06 is liii~~

~~0.04~~

~~Q M_ III 0.02 ^P=S §^^S-21s~~

~~0.00~~

~~-0.02 60 65 70 75 80 85 90 96 Temperature (C)~~

33 Figure 2: Mean expression of mRNA encoding 6-actin and elongation factor alpha-1 (EF) in arbitrary units ± SE (n=10) from primary (stage I), pre-vitellogenic (stage II) and vitellogenic (stage III) ovarian follicle stages in untreated zebrafish as determined by

~~Real-Time PCR. Different letters denote statistical differences detected by Tukeys post hoc test (p<0.05).~~

34 c& actin mean mR NA expression (arbitrary units) n 2.0 4.0 6.0 n 3.0 5.0 1.0- stage I T a stage Istage! Q 35 111 a: < o c E ID (0 c E a> (1) CO CO X o •= U •ti t- (ar i -i CO 0.01 0.07 0.08 0.02 0.03 0.04-1 0.05 0.06 0 - stage I a T b Figure 3: Characterization of the mRNA expression encoding six retinoid receptor genes

(rxraa, rxrab, rxrba, rxrbb, rxrga and rarga) from exeperiment 2 in primary (stage I), pre- vitellogenic (stage II) and vitellogenic (stage III) zebrafish ovarian follicles (70-100 follicles/stage/fish). Gene expression is represented as fold changes in normalized input values ± SE (n=10) to adjusted elongation factor alpha-1 and the same changes are represented in non-normalized input values ± SE (n=10) to compare responses in normalized and non-normalized values. Normalization involves an adjustment of the input values for elongation factor alpha-1 to compensate for the significant changes in expression of mRNA encoding the housekeeping gene across follicle stages. Different letters denote statistical difference by detection with Tukeys post hoc test (p<0.05).

36 Normalized rxrba mRNA expression Normalized rxrab mRNA expression Normalized rxraa mRNA expression (fold change) (fold change) (fold change) 0©000-»-'-»-» o o •~l O o O O O _^k -* -». —k o CD 4^ o -fc. 00 o o ooooooooo o O O O o O O O o O o o o o

~~CO 5T •' • ' ••-... -.. -• 1 & CO •.:"•"' •": sCD 1 co CD~~

~~o ST 9 CO CD CO CD CD~~

~~of 9J CO CO (D •a CD~~

non-normalized rxrba mRNA expression non-normalized rxrab mRNA expression non-normalized rxraa mRNA expression (fold change) (fold change) (fold change) 0.7 5 - 0.2 5 0.5 0 - 0.7 5 1.2 5 - 1.5 0 n o 1.0 0 c3 1.0 0 1.2 5 - ^ c en 00 0 CJI c3 09 0 o

~~(0 age l stag e I~~

~~0) CO CD I I~~

~~0) 0) 0) CO to CO CD CD CO~~

0) 0) CO 0) CO CO CD CD CD fi> fit SI 0) Normalized rarga mRNA expression Normalized rxrga mRNA expression Normalized rxrbb mRNA expression (fold change) (fold change) (fold change) o o o ooooo-»-»--»->-->- o o o KJ *. b) bo b io ' o k> i. b> to o k> jk bi co to CO IO o o o o o o o o o o o oooooooooo o o o

~~tn 01 & CQ sr P CD CD CQ *• .- CD~~

~~01 0) 01 CQ CQ CQ CD CD CD 1 8-~~

~~01 01 01 CQ CQ CQ —1 cr CD CD CD '~~

00 non-normalized rxrbb mRNA expression non-normalized rarga mRNA expression non-normalized rxrga mRNA expression (fold change) o (fold change) Ho o o O o o to o o o o o en o o in o Ol o o M Ol -vl o IO Ol oi o o Ol O o Ol o o Ol o

~~01 CO 01 CD CQ & J» CD CQ CD~~

~~01 01 CQ 0) CQ CD CQ CD CD 8-~~

~~01 01 CQ 01 01 CO CD CQ p CD CD 1 CQ fi) Figure 4: Mean expression of mRNA coding for 0-actin and elongation factor alpha-1~~

~~(EF) in arbitrary units ± SE (n=6-8) following 24 hour in vivo exposure to 17p-estradiol~~

~~(E2) or 17a,20fi-dihydroxy-4-pregnen-3-one (17a206P) in the zebrafish whole ovary as determined by Real-Time PCR. Different letters denote statistical difference detected by~~

~~Tukeys post hoc test (p<0.05).~~

~~39 B-actin mean mRNA expression (arbitrary units)~~

° P r* r* r° N o en o ui o oi o o 3 -H P =O^*

~~m 1 o* N>~~

~~H p O 53~~

~~-1^ o Elongation factor mean mRNA expression (arbitrary units) 0. 1 - p p 0. 4 o c3 en~~

~~o o H P u_ft -~~

~~m p~~

D N) H p O Figure 5: Effects of 24hour in vivo exposure to 500 ng/L of 17|3-estradiol (E2) and 500 ng/L 17a,20B-dihydroxy-4-pregnen-3-one (17a20BP) on the expression of mRNA encoding the retinoid receptors (rxraa, rxrab, rxrba, rxrbb, rxrga and rarga) in zebrafish whole ovary obtained by Real-Time PCR from experiment 3. Values represent normalized fold change from control ± SE (n=6-8) as compared to elongation factor alpha-1. Different letters denote statistical difference detected with Tukeys post hoc test

~~(p<0.05).~~

41 Normalized rxraa mRNA expression Normallzsed rxrga mRNA Normalized rxrba mRNA expression (fold change) expression (fold change) (fold change) o o o o o o o o o o bob CDbbb bob o to .&. O) oo oooooooooo o o o o o

~~P 9 H P~~

~~-\ P~~

~~or P I fi) to~~

Normalized rarga mRNA expression Normalized rxrbb mRNA Normalized rxrab mRNA expression (fold change) expression (fold change) (fold change) ooooo -»•-»-»-» pppop-^^-k-^-* o o o o o oki^Qabio^btD ooooooooo oooooooooo

~~9 -i p §•~~

~~H P p~~

~~fii - -% a fi) L_^ fi> Figure 6: Differences in expression of mRNA encoding retinoid receptors (rxraa, rxrba, rxrbb, rxrga and rarga) in primary (stage I), pre-vitellogenic (stage II) and vitellogenic~~

~~(stage III) zebrafish ovarian follicles following 24 hour in vivo exposure to 100 ng/L~~

~~17a,20B-dihydroxy-4-pregnen-3-one as determined by Real-Time PCR from experiment 4.~~

Values represent normalized fold change from control ± SE (n=9-12), as compared to adjusted elongation factor alpha-1. Normalization involves an adjustment of the input values for elongation factor alpha-1 to compensate for the significant changes in mRNA expression encoding the housekeeping gene across follicle stages. Different letters denote statistical differences detected with Tukeys post hoc test (p<0.05).

~~43 Normalized rxrba mRNA expression Normalized rxraa mRNA expression to Normalized rxrga mRNA expressior (fold change) adjusted B-actin (fold change) (fold change)~~

~~BT •~~

~~ft)~~

J*. 4^ Normalized rxrbb mRNA expression tc Normalized rarga mRNA expression (fold change) (fold change) stages in experiment 2 and 4. This method requires an adjusted internal control which allows for the normalization of the gene of interest and also compensates for loading error and reaction efficiencies. Comparison of the adjusted normalized input values with raw non-normalized input values in this study resulted a similar mRNA expression patterns encoding the retinoid receptors between zebrafish follicle stages. Thus standardization to adjusted EF values is an acceptable method for quantification of mRNA expression in zebrafish ovarian development.

This study has shown that mRNA encoding the retinoid receptors is present within the ovary of zebrafish by establishing expression of rxrs and rars in the whole ovary and within primary, pre-vitellogenic and vitellogenic ovarian follicles by means of

Real-Time PCR. The presence of rxrs and rars in all follicle stages suggests that aT-RA and 9-cis-RA have the potential to affect transcription in the zebrafish ovary and throughout oocyte development. Previous studies have also identified several retinoid receptors in the zebrafish ovary which include rxrba, rxrbb, raraa and rarga (Alsop et al.

2008). Unlike this study, Alsop et al (2008) did not find mRNA encoding the expression of the rxrab and rxrga genes in zebrafish ovaries or testis as determined by reverse transcription (RT)-PCR. This may be due to the lack of sensitivity of traditional RT-PCR methods as compared to Real-Time PCR used in this study. The PCR methods adapted by Alsop et al. (2008) utilized agarose gels for the detection of final cDNA amplification at the end-point of the reaction and are not as precise due to end-point variability and degradation between samples (Applied Biosystems, Roche Molecular Systems, Inc.). By comparison, Real-Time PCR is able to detect amplification during the exponential phase

45 of the reaction which is very specific and precise, ultimately detecting changes as little as two-fold. In this study the mRNA expression encoding rxrab was very low in all follicle stages and mRNA encoding rxrga had low expression in stage II follicles in comparison to other retinoid isoforms but still generated quantifiable results (Appendix 1).

~~In the current study, the mRNA coding for rxraa was up-regulated by exposure to~~

500 ng/L E2 in the whole ovary, however there were no changes in the mRNA expression encoding the other five retinoid receptors. It is possible rxraa may have a role in regulating some aspects of reproduction in the zebrafish ovary that are highly influenced by E2 such as vitellogenesis, and is therefore affected by hormones differently. An equivalent retinoid receptor to the zebrafish rxraa does not exist in mammals and therefore no comparisons on receptor expression can be made. It is known that E2 is a major target in the development and differentiation of the ovary however why it remains unknown why E2 impacts the expression of mRNA encoding the retinoid receptor rxraa.

Exposure to 100 ng/L 17a20BP induced a significant down-regulation in the mRNA expression coding for rxrba and rarga compared to controls, in the zebrafish whole ovary. This was accompanied by a decreasing trend in all other rxr genes except the newly identified rxraa. Alternatively, when examined between follicle stages 100 ng/L 17a2013P had no effect on the mRNA expression coding for any of the receptor isoforms analyzed. These inconsistencies could be due the differences in treatment dosage between experiments (100 ng/L used when comparing gene expression between stages as opposed to 500 ng/L 17a20BP when examined at the level of the whole ovary). mRNA coding for retinoid gene expression was also investigated in female ovarian

~~46 follicles at 500 ng/L 17a2013P however results were extremely variable and therefore not included in analysis (data not shown).~~

The possibility exists that following exposure to such high levels of 17a206P, some of the follicles had undergone oocyte maturation whereas others had not. These differences may have been undetected during follicle separation due to the large emphasis on size. Differences in mRNA expression coding for retinoid receptors may therefore exist in mature follicles compared to follicles in pre-maturation stages. Following binding of gonadotropin to receptors on the oocyte membrane, vitellogenic follicles produce 17a20fiP and subsequently begin to undergo maturation (Nagahama and

Yamashita 2008). Exposure to high concentrations of 17a206P may have induced maturation in several of the immature follicles without alteration of follicle size and contributed to the high variability between groups.

Orthologs of the zebrafish rxrs, which are genes found in other species and traced to common ancestors, have been identified in mammalian species (Table 2). Knowledge of the hormonal control of these orthologs may contribute to the understanding of the role of rxrs in the regulation of gene transcription in the gonads of zebrafish. For example, the mammalian RXRa (rxrga in zebrafish) is expressed in human, mice and bovine gonads (Mangelsdorf et al. 1990, Boehm et al. 1997, Gaemers et al. 1997, Mohan et al.

2003). Studies in bovine ovarian follicles have indirectly demonstrated that retinoids can exert receptor mediated effects through RXRa (Mohan et al. 2003). Injection of E2 in ovariectomized rats also induced RXRa mRNA expression in vaginal basal cells, suggesting a relationship between estrogens and rxr expression (Boehm et al. 1997).

~~Such changes were not seen in the zebrafish ortholog rxrga in the present study and may~~

47 be exclusive to mammals. RXRp, the mammalian ortholog of rxrba, also exists in two receptor isoforms (pi and P2) with expression in both mouse ovaries and testes (Nagata et al. 1994). Multiple subtypes of rxrba exist in the gonads of the zebrafish and are thought to promote differential operation of rxr receptor heterodimerization (Alsop et al.

~~2008) however there were little changes in rxrba expression following exposure to E2 or~~

~~17a20J3P. There is no indication of an ortholog of rxrbb in mammals.~~

The current study has identified only one' rar in the adult zebrafish (rarga) however several rar genes have been established in mammals. Mammalian orthologs of the zebrafish rarga (RARy) and raraa (RARa) genes are present in the rat and bovine ovary (Boehm et al. 1997, Mohan et al. 2003). Unlike RARy, the expression of RARa is thought to change in relation to hormone changes in the mouse ovary. Estrogens increased RARa expression in breast cancer cell lines through the activation of an estrogen responsive element (ERE) found within the RARa promoter region (Rishi et al.

1995) but E2 had no effect on rarga in the zebrafish. The retinoid receptor RARP which is expressed in mammals (Dolle et al 1989, Yu et al. 1991, Mohan et al. 2003) is absent in zebrafish. It is unknown whether the zebrafish genome lacks RARp or if it has simply not been identified. Mice lacking the RARp gene have retarded growth, but are otherwise apparently normal (Hale et al. 2006).

~~To date the role of retinoid receptors within zebrafish gonads remains unclear.~~

This study does provide a starting point for the investigation of potential functions of these receptors it generally demonstrates comparable mRNA expression patterns encoding retinoid receptors within primary, pre-vitellogenic and vitellogenic ovarian follicles.

~~48 Table 2: Zebrafish retinoid receptor genes and the corresponding homologous retinoid receptor identified in mammals.~~

~~Zebrafish gene Mammalian ortholog rxraa n/a rxrab RXRy rxrba RXRG rxrbb n/a rxrga RXRa rxrgb n/a~~

~~raraa RARa rarab n/a rarga RARy rargb n/a n/a RARB~~

49 This study also suggests some hormonal control by 17a20GP and E2. At this time, the absence of an effect on mRNA expression coding for retinoid receptors between ovarian follicle stages following exposure to 100 ng/L 17a2013P remains unexplained but may be due to a premature maturation of follicles caused by this hormone. Future studies involving retinoid receptors are required to determine whether these receptors have a functional role in ovarian follicle development. These studies may utilize gene microarray to establish subsets of genes present in ovarian tissue that may be up- regulated or down-regulated following treatment of zebrafish with an RA antagonist or agonist. The subsequent formation of proteins may also be investigated using two- dimensional gel electrophoresis. Furthermore, potential regulation of retinoid receptors by other hormones involved in ovarian function is possible. Further research is required to investigate possible regulators of retinoid receptors and to explore their role in ovarian development and reproduction.

~~50 CHAPTER 3: THE EFFECTS OF RETINOIC ACID ON STEROIDOGENESIS IN~~

~~THE ZEBRAFISH (DANIO RERIO)~~

~~ABSTRACT~~

~~The present studies evaluated the effects of retinoic acid (RA) on various aspects~~

~~of zebrafish ovarian function including steroid hormone production, gene expression and~~

ovulation. Isolated zebrafish vitellogenic follicles (0.35-0.69 mm) and whole ovary pieces (10 mg) were incubated in vitro with human chorionic gonadotropin (hCG) and all-trans retinoic acid (aT-RA) and/or 9-cis-retinoic acid (9-cis-RA) for 18 hours.

Production of 17fi-estradiol (E2) and testosterone (T) was subsequently measured. These studies demonstrated a significant reduction in hCG-stimulated E2 production by ovarian follicles and whole ovary pieces incubated with aT-RA, but no changes resulted following incubation with 9-cis-RA. In contrast hCG-stimulated T production remained unaffected in all treatments. The effects of aT-RA were further substantiated in vitro by a decrease in T-stimulated E2 production, suggesting a primary effect on the aromatase cytochrome P450 enzyme (CYP191A). To further evaluate the potential effects of aT-

RA on steroidogenesis in the ovary, a series of experiments were performed in which female breeding zebrafish were exposed to aT-RA in the water for 96 hours. Results demonstrated the negative effects of aT-RA on reproduction in the zebrafish by decreasing E2 levels through inhibition of the catalytic activity and the mRNA expression encoding CYP191A. Ovulation was also reduced in the female zebrafish exposed to high concentrations (45 ng/ml) of aT-RA. In conclusion, the present studies suggests RA does affect reproduction in the adult zebrafish and that these effects are specifically mediated by aT-RA through inhibition of the aromatase enzyme. The mechanism by which aT-RA inhibits aromatase remains unknown, however these studies suggest that regulation may

~~51 occur through retinoic acid response elements (RAREs) or a secondary signalling pathway.~~

~~INTRODUCTION~~

~~Retinoids, and their derivatives are fundamental to ovarian physiology in fish.~~

~~Retinol, retinal and retinyl esters are deposited into the eggs prior to spawning for use in embryonic development following fertilization (Irie and Seki 2002, Lubzens et al. 2003,~~

~~Alsop et al. 2008). Retinal is the main stored form of retinoids in fish eggs and has been shown to bind the yolk precursor protein vitellogenin in the oocytes of rainbow trout~~

(Sammar et al. 2005). Other studies have shown that the fish ovary contains enzymes involved in the synthesis (Alsop et al. 2008), transport (Lubzens et al. 2003, Sammar et al. 2005) and metabolism (Alsop et al. 2008) of retinoids. The two major classes of retinoid receptors, retinoid x receptors (rxrs) and retinoic acid receptors (rars), have also been identified in the fish ovary using ligand binding and both reverse transcription (RT)-

PCR and Real-Time PCR (Alsop et al 2001,2008). Other studies by Alsop et al. (2008) have shown that feeding zebrafish a retinoid deficient diet for over 100 days decreased the number of eggs spawned by 73 % and decreased egg retinal stores by 78 %. Excess all-trans retinoic acid (aT-RA) also significantly decreased the number of spawned eggs by 93 % following acute exposure (11 days).

Little is known regarding the mechanism by which retinoids affect reproductive physiology in fish although some insight can be gained from studies in mammals where retinoids have been shown to be essential to reproduction (Galdieri and Nistico 1994,

~~Zheng et al. 1999, Livera et al. 2002,2004, Brown et al. 2003). Some studies have suggested RA, specifically aT-RA, is responsible for germ cell fate and subsequent sex~~

~~52 determination in mice. In females, aT-RA stimulates meiosis in germ cells in the ovary~~

~~through the activation of rar heterodimers (Bowles et al. 2006, Koubova et al. 2006,~~

~~Bowles and Koopman 2007). In males, the metabolizing enzyme of RA, CYP26B1 acts~~

~~as the meiosis-inhibiting factor in germ cells (Bowles et al. 2006).~~

~~Other studies suggest that retinoids may directly affect gonadal steroid hormone~~

~~biosynthesis. Most of these have examined testicular steroids in mammals where aT-RA~~

~~and 9-cis retinoic acid (9-cis-RA) most commonly decrease testosterone (T) production~~

~~and do so in part by modulating the expression of genes involved in steroid biosynthesis~~

~~such as the cytochrome P450 aromatase enzyme (CYP19), 3J3-hydroxysteroid~~

~~dehydrogenase (36-HSD), P450 17a-hydroxylase/17,20-lyase (CYP17) and the steroid~~

~~acute regulatory protein (StAR) (Galdieri and Nistico 1994, Lefevre et al. 1994, Lee et al.~~

1999, Livera et al. 2004). Although there have been fewer studies in female mammals, treatment with retinoids has also been shown to increase the mRNA expression coding for the steroid biosynthetic enzymes including StAR (Wickenheisser et al. 2005).

~~This study examines the effects of RA on various aspects of steroidogenesis in the zebrafish. A series of experiments were conducted to examine the effects of aT-RA and~~

9-cis RA on basal and hCG stimulated steroid production. This included a comparison of the response in both isolated vitellogenic follicles and whole ovaries which included follicles at different stages of development. Additional tests examined the effect of aT-

RA and 9-cis RA on the ability of the ovary to convert T to E2 and thus provide a measure of aromatase activity. In other experiments, zebrafish were exposed to aT-RA via the water and examined for the expression of RA receptors, ovarian steroid levels, genes involved in ovarian steroid biosynthesis and egg production.

~~53 MATERIALS AND METHODS~~

~~Experimental Animals~~

Zebrafish were purchased from DAP International (Etobicoke, ON) and held at the Hagen Aqualab (University of Guelph, Guelph, ON) in A-HAB units (Aquatic Eco systems, Apopka FL) with re-circulating well water at 28°C. Fish were held under a 12 hr light and 12 hr dark photoperiod and fed twice daily to satiation with a combination of commercial salmon fry formulation (Martin Mills, Elmira, ON) and frozen bloodworms

~~(Oregon Desert Brine Shrimp Co., Lakeview, OR).~~

~~Experimental Design~~

~~In vitro incubation of vitellogenic ovarian follicles and whole ovary tissue~~

A series of experiments were performed to investigate the effects of retinoids on the in vitro production of steroid hormones by the zebrafish ovary. Four to six sexually mature female zebrafish were anaesthetized with MS-222, sacrificed by severing the spinal cord and the ovaries were removed and immediately placed in Leibovitz L-15 media (Invitrogen, Carlsbad, CA) to support tissue growth. The media contained 200

U/mL penicillin and 200 U/mL streptomycin sulphate to prevent contamination during the incubation period. Vitellogenic follicles (0.35-0.69 mm) or whole ovary pieces (10 mg) were separated from the ovary with fine tipped forceps and pooled in a petri dish containing L-15 media. Isolated follicles (40 individual follicles) or whole ovary pieces

(10 ± 0.4 mg) were placed into individual wells of a 24-well polystyrene, tissue culture plate (Corning Inc., Corning, NY) containing 900 ul of L-15. Prior to treatment, all media was removed from each well and substituted with 500 ul of fresh L-15 media containing 1 mM 3-isobutyl-l-methylxanthine (IBMX; Sigma, St. Louis, MO) which

~~54 prevents the degradation of endogenous cAMP by inhibiting phosphodiesterases. Test compounds were added and the incubation volume was adjusted to 1 ml with L-15 media.~~

The culture plate was covered and incubated in the dark at 28 °C for 18 hours. Following the incubation period, media was removed and snap frozen at -80 °C for E2 and T analysis by radioimmunoassay (RIA). Each experiment contained three to four replicate wells for each treatment and experiments were repeated three times using ovarian tissue from separate groups of female zebrafish.

The first experiment evaluated the combined effects of 25 ng/ml aT-RA and 25 ng/ml 9-cis-RA (Sigma, St. Louis, MO) on basal and gonadotropin-stimulated steroid hormone production by vitellogenic follicles. Due to the lack of information regarding the effects of RA on ovarian function in fish, the exposure concentrations in this experiment were based on similar in vitro studies in chicken ovarian follicles (Pawlowska et al. 2008). Human chorionic gonadotropin (hCG; Sigma, St. Louis, MO) was diluted in

L-15 media and added to individual treatment wells in 100 ul aliquots to achieve a final concentration of 100 IU/ml. aT-RA and 9-cis-RA (1 mg/ml) were dissolved in dimethyl- sulfoxide (DMSO) and were each added to treatment wells in 2.5 ul aliquots. Control wells received 5 ul of DMSO (<0.001 %).

~~Experiment 2 evaluated the effects of 25 ng/ml of aT-RA or 25 ng/ml of 9-cis-RA on hCG-stimulated steroid hormone production by vitellogenic follicles. aT-RA, 9-cis-~~

~~RA and hCG were added as described in Experiment 1. Control wells received 2.5 ul~~

~~DMSO (<0.001 %).~~

~~55 A third experiment investigated the effects of 25 ng/ml aT-RA and 25 ng/ml 9-cis~~

~~RA alone and in combination on hCG-stimulated E2 and T production by whole ovary~~

~~pieces. Treatments were added as described in Experiments 1 and 2.~~

~~Experiment 4 tested the effects of 25 ng/ml aT-RA, on T-stimulated E2 production~~

~~in vitellogenic follicles. In each case, follicles were incubated with T (Sigma, St. Louis,~~

~~MO) at a final concentration of 50 ng/ml which was an adequate concentration to produce~~

~~consistent and measurable E2 stimulation. aT-RA was added to wells in 2.5 ul aliquots.~~

~~Control wells received 2.5 ul DMSO.~~

~~In vivo effects of RA on zebrafish whole ovary~~

~~A series of experiments were performed in which zebrafish were exposed in vivo~~

~~to aT-RA and effects on ovarian steroid hormone levels, gene expression, and egg~~

~~production were evaluated. Groups of 8-12 female breeding zebrafish and 4-5 sexually~~

~~mature male zebrafish were randomly placed into individual 4 L glass beakers containing~~

~~3.5 L Hagen Aqualab well-water. Each beaker also contained a plastic mesh insert to~~

~~allow for spawned eggs to fall through and be separated from the fish. Each treatment~~

~~included multiple beakers which were randomly placed in a water bath held at 28 °C.~~

Water was changed daily between 10 am and 12 pm and spawned eggs were collected at this time using a pasteur pipette and counted. Fish were acclimated for 48 hours prior to experiments to ensure successful spawning at similar rates in all beakers. Fish were fed to satiety twice daily with salmon fry formulation or frozen bloodworms. At the end of each exposure, fish were overdosed with MS-222 and killed by spinal transection.

~~Experiment 5 consisted of a 5 day pre-exposure period followed by a 96 hour exposure period, whereas experiment 6 consisted solely of a 96 hour exposure period in~~

56 which eggs were not collected. In Experiment 5, fish were treated with 13.5 and 135 ul of a stock aT-RA solution (1 mg/ml; final concentration 4.5 and 45 ng/ml). Exposure concentrations of aT-RA and 9-cis RA we selected based on previous exposures in the zebrafish in which a response was found (Alsop et al. 2008) followed by a series of reduced dosages. In experiment 6 fish were treated with 1.35 ul or 13.5 ul aT-RA from the stock solution (1 mg/ml; final concentration 0.45 and 4.5 ng/ml), Control beakers for all experiments were subsequently supplemented with 135 ul or 13.5 ul DMSO for experiments 5 and 6, respectively. At the end of the exposure period, fish were sacrificed and weighed. Whole ovaries were removed, weighed and immediately snap frozen in liquid nitrogen and stored at -80 °C until RNA and steroid hormone extraction.

~~Experiment 7 evaluated the effects of 4.5 ng/ml aT-RA on the catalytic activity of the aromatase cytochrome P450 enzyme A (P450aromA) in the zebrafish whole ovary.~~

Groups of 4 sexually mature female fish and 2 male fish were added to each of 4 L glass beakers. The aT-RA treated group received 13.5 ul of stock solution (1 mg/ml) whereas the controls received 13.5 ul of DMSO. After 24 hours, fish were sacrificed and the ovaries were removed and immediately placed in L-15 media. The whole ovaries of 8 fish from each treatment group were pooled and 5.0 ± 0.15 mg of ovarian tissue was separated into wells of a 24-well polystyrene tissue culture plate containing 500 ul of L-

~~15. Prior to treatment, all media was removed from the wells and replaced with 250 ul L-~~

~~15 containing 1 mM IBMX. Ovarian tissue was incubated with either L-15 media alone~~

(controls) or L-15 media supplemented with T (final concentration of 50 ng/ml) in a final volume of 500 ul for 18 hours at 28 °C. Following incubation, media was removed from all wells and snap frozen and stored at -80 °C for measurement of E2 by RIA.

~~57 Steroid Extraction~~

~~To extract steroid hormones from whole ovary, tissue was weighed and sonicated~~

~~(Vibracell™, Sonics and Materials Inc., Danbury CT. USA) for 5 seconds in 100 ul of homogenizing buffer containing 0.372 g/L ethylene diamine tetraacetic acid (EDTA;~~

~~Fisher Scientific) in a phosphate buffer (80 mM Na2HP04,20 mM NaHPO4,100mM~~

NaCl, pH 7.4). Steroid hormones were then extracted from the hompgenate following the method of Lister and Van Der Kraak (2008). Briefly, methanol was added at 4x the volume of homogenizing buffer and samples were vortexed. Samples were incubated in the dark at 4 °C for 60 minutes and vortexed at 20 minute intervals during the incubation period. Samples were then centrifuged for 5 minutes at 3000 g at 4 °C and immediately placed on dry ice for 2 minutes. Samples were pulse spun for 10 seconds to allow for any frozen water to attach to the pellet. The upper aqueous methanol supernatant was then decanted into a 7 ml glass collection vial. Each sample was extracted 3 times and the MEOH was evaporated with N2. Extracted steroids were reconstituted in 300 ul 50 mM acetate buffer (2.35 ml glacial acetic acid, 1.23 g sodium acetate trihydrate, in 1 L; pH 4) and stored at -20 °C until purification.

Reconstituted steroid hormones were purified using 100 mg mini-columns containing octadecyl (Amersham, NJ.) To wash columns, methanol (1 ml) was added and forced through the column with positive pressure using a syringe adapter, followed by the addition of 1 ml ultra-pure water. Samples were added to the wet column and allowed to elute through. Columns were then washed with ultra-pure water (1 ml) followed by hexane (1 ml, Fisher Scientific) and all wash collections were discarded. To retrieve samples 1 ml ethyl acetate (1% MEOH) was added to the column and collected

~~58 into .7 ml glass vials. The elute was evaporated with N2 and reconstituted in 200 ul EIA~~

~~buffer (Caymen Chemicals, Ann Arbour, MI) and stored at -20 °C until analysis.~~

~~Radioimmunoassay~~

~~T and E2 levels in the culture media were measured using methods from~~

~~McMaster etal. (1995). Antibodies were obtained from MP Biomedicals (Irvine, CA)~~

~~3 3 and H-T and H-E2 were purchased from Amersham (Baie d'Urfe, PQ).~~

~~Enzyme immunoassay~~

Enzyme immunoassay is a more sensitive method for the measurement of hormones in tissue than the RIA method described above and was used to determine E2 and T levels in zebrafish whole ovaries exposed to RA in vivo. Steroids were analyzed with the Enzyme Immunoassay (EIA) kit (Caymen Chemicals, Ann Arbour, MI) following product guidelines and quantified using spectrophotometry at 410 nm

~~(SpectraMax 190, Molecular Devices Inc, Sunnyvale CA).~~

~~RNA extraction~~

RNA was extracted from whole ovary and ovarian follicles (see Chapter 2). To examine mRNA expression coding for various genes in the zebrafish ovary, total RNA was extracted from whole ovary pieces (< 50 mg) and primary and vitellogenic ovarian follicles using a guanidine thiocynate phenol chloroform extraction method adapted from

~~Chomczynski and Sacchi (1987) and subsequent cDNA synthesis from Ings and Van Der~~

~~Kraak(2006).~~

~~Real Time PCR~~

~~Forward and reverse primers were designed for six rxr/rar receptor isoforms; rxraa, rxrab, rxrba, rxrbb, rxrga and rarga, as well as the steroid enzymes P450 aromatase~~

59 A (P450aromA, CYP191 A), the steroid acute regulatory protein (StAR), P450 17a- hydroxylase/17,20-lyase (CYP17), 36-hydroxysteroid dehydrogenase (3B-HSD) and the housekeeping genes 8-actin and elongation factor alpha-1 (EF) based on published mRNA sequences (Table 1),

Briefly (See Chapter 2) each Real-Time PCR reaction well contained diluted first strand cDNA, forward and reverse primers and SYBR green PCR Master Mix®. Using the ABI Prism 7000 sequence detection system samples were incubated at 95 °C for 10 minutes, followed by 40 cycles of 15 seconds at 95 "C and 1 minute at 60 °C. PCR reactions were run in duplicate and the cycle threshold values were averaged for data analysis.

~~Nucleotide sequences for the PCR products of interest generated in the ovary were sequenced using capillary based sequencing (Advanced Analysis Centre, Genomics~~

~~Facility, University of Guelph, ON) to confirm amplification of the correct product, and compared to published sequences. (BLAST) using multiple sequence alignments~~

~~(ClustalW).~~

60 Table 1. Forward (F) and reverse (R) primer sequences for zebrafish {Danio rerio), amplicon sizes in base pairs (bp) and their associated Genbank accession numbers for all primer pairs used in this study.

Gene Primer Sequence Size (bp) Accession # F- GATCACTGGTACTTCTCAGGCTGA EF 111 NMJ31263 R- GGTGAAAGCCAGGAGGGC F- AGTTCAACTGGCACACGCAG CYP19A1 82 NMJ31154 R- AGCTCTCCATGGCTCTGAGC F- ACCTGTTTTCTGGCTGGGATG StAR 81 NMJ31663 R- GGGTCCATTCTCAGCCCTTAC F- CAGAAAGGGACGCGGGT GYP17 102 AY281362 R- CTCATTCAGAAAGCGTCCTGG F- GCAACTCTGGTTTTCCACACTG 3B-HSD 102 AY279108 R- CAGCAGGAGCCGTGTAGCTT F- GGCTCTCCCTTCTCCGTCAT rxraa 101 EF028132 R- GTGCGAGTTCAACTGAGGGC F- CCGAACTGGCAGTAGAACCAA rxrab 86 U29894 R- TGTTACAGGGTCGTTCGGAGA F- CCCCCTTTGGCTTAAAGTCTG rxrbb 100 U29941 R- GCCATAATGCTTCCCCGAA F- TTGAATGGGCGAAGAGGATC rxrga 86 U29940 R- AGACCGATCCTCAGGGAAACA F- ATGTCCAAGGAAGCTGTGCG rarga 100 S74156 R- TCCAGTTCCCCACTCAGCTC

~~61 Data analysis~~

~~Data were examined using an analysis of variance (ANOVA) to determine if~~

~~significant differences existed between experiments of each in vitro study. For~~

~~gonadotropin-stimulated studies, data from all three experiments were pooled and E2 and~~

~~T levels were expressed as a percentage of hCG-stimulated hormone production.~~

~~Significant differences between T-stimulated in vitro experiments (experiment 4) resulted~~

~~in separate analysis of experiments. Data was expressed as a percentage of T-stimulated~~

~~E2 production. Statistical analysis for all experiments was examined using a one-way~~

~~ANOVA followed by Tukey's post hoc test or a two-tailed T-test for significant~~

~~differences between treatment groups. All experiments were examined for homogeneity of variance, and a non parametric Kruskal Wallace test was performed followed by~~

~~Dunnett's post hoc test in experiments 1,2, 3 and 4 when transformations had no effect on data variance. Significance was denoted by a p<0.05~~

~~Standardization of gene expression~~

Traditional standardization procedures for Real-Time PCR involve the comparison of a raw arbitrary input value (non-normalized) to an invariable internalized control (J3-actin or EF). Analysis of the gene expression for B-actin in all in vivo experiments revealed significant changes between treatments. Alternatively the mRNA expression encoding EF was not affected by treatment in the majority of experiments and therefore EF was used for standardization purposes. In experiment 5, EF did show significant differences in expression between the control and the 4.5 ng/ml aT-RA treatment group and therefore these input amounts were normalized against adjusted EF.

~~Standardization of the genes of interest to adjusted EF was previously shown to be an~~

~~62 appropriate method for quantification of mRNA expression in the zebrafish (See Chapter~~

~~2). The formula used in this adjustment was derived from Billiau et al. (2001) and Essex-~~

~~Fraser et al. (2005).~~

~~Individual value within a treatment/(mean value of a treatment group/mean value of control group)~~

Experiment 6 showed no changes in EF expression with any of the treatments (0, 0.45 and 4.5 ng/ml aT-RA) and values were standardized to EF by traditional methods of calculating the ratio of the gene of interest to EF.

~~RESULTS~~

~~In vitro response to RA~~

E2 and T production by vitellogenic follicles following incubation with hCG were significantly increased compared to basal levels (p<0.01). The combination of aT-RA and 9-cis-RA induced a significant decrease in hCG-stimulated E2 production but had no effect on T production (Figure 1, p<0.05). The combination of aT-RA and 9-cis-RA had no effect on basal T of E2 levels compared to controls. In experiment 2 it was shown that aT-RA induced a significant decrease in hCG-stimulated E2 production (Figure 2, p<0.05) but had no effect on T production in vitellogenic follicles. In contrast, 9-cis-RA had no effect on hCG-stimulated E2 or T production. Similar responses were seen with incubations of whole ovary. In experiment 3 the combination of aT-RA and 9-cis RA, and aT-RA alone significantly decreased hCG-stimulated E2 production but had no effect on T production (p<0.05, Figure 3). 9-cis RA had no effect on either E2 or T production in the whole ovary.

~~63 Addition of T to follicle incubations leads to a marked increase in E2 production~~

by vitellogenic follicles (not shown). In two of the three replicate experiments aT-RA caused a significant decrease in T-stimulated E2 production (p<0.05, Figure 4). By comparison 9-cis RA and the combination of aT-RA and 9-cis RA had no effect on T- stimulated E2 production (appendix II, Figure 1, Figure 2).

~~In vivo response to RA~~

In experiment 5 whole animal exposure to waterborne aT-RA (4.5 or 45 ng/ml) for 96 hours significantly decreased E2 levels in zebrafish whole ovary compared to controls (p<0.05). There was a significant decrease in T levels in fish exposed to aT-RA at 45 ng/ml (p<0.01) but no effect on T in fish exposed to 4.5 ng/ml of aT-RA (Figure 5).

~~Real-Time PCR revealed a significant down-regulation in mRNA expression encoding~~

~~CYP19A1 in the ovary following exposure to 4.5 and 45 ng/ml aT-RA (p<0.01).~~

Expression of mRNA coding for 36-HSD and CYP17 was significantly reduced in response to 4.5 ng/ml aT-RA (p<0.05). There were no effects of aT-RA on the mRNA expression encoding StAR (Figure 6). The rxr isoforms; rxraa, rxrab and rxrbb also did not change with exposure to 45 ng/ml aT-RA and were therefore not analyzed in whole ovary samples from fish exposed to 4.5 ng/ml aT-RA (appendix II, Figure 3). The spawning of eggs was also not affected by either 4.5 or 45 ng/ml aT-RA (Figure 7).

In experiment 6, exposure to 0.45 ng/ml aT-RA for 96 hours had no effect on either E2 or T levels in the zebrafish whole ovary, whereas exposure to 4.5 ng/ml significantly decreased E2 levels but not T levels (Figure 8). The mRNA expression encoding the CYP191A gene was also significantly down-regulated by two-fold following exposure to 4.5 ng/ml aT-RA (p<0.05), but not 0.45 ng/ml aT-RA. No changes

~~64 were shown in the mRNA expression coding for 3B-HSD, but there was a significant down-regulation of mRNA coding for CYP17 with 0.45 ng/ml aT-RA (Figure 9).~~

E2 production in experiment 7 did not change in ovarian tissue exposed to DMSO in vivo following incubation in vitro with DMSO or aT-RA (4.5 ng/ml) for 24 hours. In contrast, the addition of T to culture media induced a significant increase in ovarian E2 production in both 24 hour control and aT-RA in vivo exposure groups (pO.01).

~~Following exposure to aT-RA in vivo, T-stimulated E2 production of ovarian tissue was significantly decreased compared to T-stimulated controls (Figure 10, p<0.05).~~

~~DISCUSSION~~

~~Through a combination of in vivo and in vitro studies, it was shown that aT-RA inhibits~~

E2 production in the zebrafish ovary. This is reflected in a significant reduction of both hCG-stimulated E2 production by ovarian follicles incubated in vitro and ovarian levels of E2 following short term (96 hour) exposure to aT-RA in vivo. In both in vitro and in vivo experiments, T levels did not change with the decrease in E2 following exposure to aT-RA suggesting a specific effect of aT-RA on the aromatase cytochrome P450 enzyme

(CYP19A1) in zebrafish whole ovary and vitellogenic follicles. This was confirmed in studies showing that the reduction in E2 following in vivo exposure to aT-RA was associated with an inhibition of CYP191A expression and catalytic activity when ovarian tissue was incubated with the presence of exogenous T and there was reduced formation ofE2.

In vitro incubation of ovarian tissue is a common approach used to study the influence of endogenous hormones and exogenous chemicals on steroid hormone biosynthesis. Stimulation of E2 and T production with hCG in zebrafish vitellogenic

65 follicles has been previously observed in vitro (Ings and Van Der Kraak 2006). The same approach was used in the current studies to show that aT-RA decreases E2 production, and has shown to be a useful method to investigate the potential regulators of steroid synthesis. Zebrafish are asynchronous spawners, which means they have all stages of ovarian development (primary, pre-vitellogenic, vitellogenic and mature follicles) present in the ovary at any given time. In these experiments we showed a similar response in whole ovary tissue and in isolated vitellogenic follicles suggesting that aT-RA similarly affects various stages of zebrafish ovarian development.

Two major families of retinoid receptors exist in most vertebrates; retinoic acid receptors (rars) which are activated by the binding of aT-RA and 9-cis RA, and retinoid x receptors (rxrs) which are activated solely by the binding'of 9-cis RA (Giguere 1994,

~~Beckett and Petkovich 1999). Rxrs are able to form homodimers or heterodimers with members of the same nuclear receptor family which include rars, vitamin D receptors~~

~~(VDRs), peroxisome proliferators activated receptors (PPARs; Mimeault et al. 2006,~~

~~Dupont et al. 2008) or constitutive androstane receptors (CARs; Jones et al. 1995,~~

Mimeault et al. 2006). Our studies suggest that the inhibitory effect on E2 production is mediated by rars, as 9-cis-RA had no effect on any of the endpoints investigated (data not shown). In mammals, the binding of rar heterodimers to retinoic acid response elements

~~(RAREs) is involved in the transcriptional response of target genes following treatment with RA. In human breast cancer cells, a combination of rxr and rar ligands stimulated~~

~~P450aromA activity and mRNA expression (Mu et al. 2000, Yanase et al. 2001) and exposure to aT-RA also up-regulated the mRNA expression of P450arom in normal mammalian placentas (Zhu et al. 2002).~~

66 Figure 1. Effects of the combination of all-trans retinoic acid (aT-RA; 25 ng/ml) and 9- cis-retinoic acid (9-cis; 25 ng/ml) alone or with hCG (100 IU/ml) on 1713-estradiol (A) and testosterone (B) production in zebrafish vitellogenic follicles. Each treatment contained 4 replicates of 40 randomly chosen follicles pooled from 4-6 female zebrafish.

Values represent mean ± SEM from 3 separate experiments and are expressed as a percentage of hCG-stimulated hormone production. Different letters indicate significant differences detected by a Kruskal Wallace test followed by Dunnett's post hoc test

~~(p<0.05).~~

~~67 A~~

~~itu - o stimulation ) 8 80- "~~

~~X. ^ C D O a a Estradio l ( %~~

~~S 20 T ^ 0 - aT-RA + 9-cis 0 aT-RA + 9-cis hCG + +~~

~~160 b c 140 ,o '••3 : b \~~

~~ul a 120~~

~~4E3 (A 100 T (3 O a s. 80 •^&* c 60 S a 40 st e 4oM T 20 Te s~~

~~aT-RA + 9-cis 0 aT-RA + 9-cis hCG + +~~

~~68 Figure 2. Effects of all-trans retinoic acid (aT-RA; 25 ng/ml) or 9-cis-retinoic acid (9-cis;~~

25 ng/ml) with hCG (100 IU/ml) on 1713-estradiol (A) and testosterone (B) production in zebrafish vitellogenic follicles. Each treatment contained 4 replicates of 40 randomly chosen follicles pooled from 4-6 female zebrafish. Values represent mean ± SEM from 3 separate studies and are expressed as a percentage of hCG-stimulated hormone production. Different letters indicate significant differences detected by a Kruskal

~~Wallace test followed by Dunnett's post hoc test (p<0.05).~~

~~69 o Testosterone (%hCG stimulation) w 17B-estradiol (%hCG stimulation) o O 00 o Isi O _ > o o o o o CO oo o o o O O O o o O~~

~~-_T H P I- -~~

~~• ' • " i vn* + I -' + o - o - -~~

CO + o 8- + o - ' " • • • '»*****. - . • " —1 o*

~~+ §* + —1 o Figure 3. Effects of all-trans retinoic acid (aT-RA; 25 ng/ml), 9-cis-retinoic acid (9-cis;~~

~~25 ng/ml) and the combination of aT-RA and 9-cis (25 ng/ml each) with hCG (100~~

IU/ml) on 1713-estradiol (A) and testosterone (B) production in zebrafish whole ovary tissue pieces (10 mg). Each treatment contained 4 replicates containing tissue pieces pooled from 4-6 female zebrafish. Values represent mean ± SEM from 3 separate studies and are expressed as a percentage of hCG-stimulated hormone production. Different letters indicate significant differences detected by a Kruskal Wallace test followed by

~~Dunnett's post hoc test (p<0.05).~~

~~71 A~~

~~120.00~~

~~1 100.00 3a 3 80.00 I10 0 o £ 60.00 - se >*— 1 40.00 \ trad i 8~~

~~7ft . 20.00 \~~

~~0.00~~

~~hCG~~

~~140.00~~

~~c* 120.00 o~~

~~hCG~~

~~72 Figure 4. Effects of all-trans retinoic acid (aT-RA; 25 ng/ml) on testosterone-stimulated~~

(50 ng/ml) 17B-estradiol production in zebrafish vitellogenic follicles measured by RIA from incubation media culture. Each treatment contained 3 replicates of 40 randomly chosen follicles pooled from 4-6 female zebrafish. Due to significant differences between individual experiments (p<0.05), values are represented as mean ± SEM for each separate experiment and are expressed as a percentage of T-stimulated E2 production.

~~Different letters indicate significant differences detected by a Kruskal Wallace test followed by Dunnett's post hoc test (p<0.05).~~

~~73 Experiment~~

74 Figure 5. 17J3-estradiol and testosterone levels in ovarian tissue in zebrafish following whole animal exposure to 0,4.5 or 45 ng/ml of all-trans retinoic acid (aT-RA) for 96 hours. Values represent mean ± SEM (n=12) from whole ovary pieces. Different letters indicate significant differences within treatments detected by Tukey's post hoc test

~~(p<0.05).~~

~~75 Testosterone (pg/mg ovary) 17B-estradiol (pg/mg ovary) o o -» -» N) N3 eo o en ia in o in b o L to eo -^ en CT> -j oo c o o o o o o o o o o o o o c o o o o o o o o o o o c o~~

~~H P~~

~~- ' •~~

~~2 I = in as~~

-fc. en H a- en -. Figure 6. Relative mRNA expression encoding P450 aromatase A (CYP191 A), steroid acute regulatory protein (StAR), P450 17a-hydroxylase/17,20-lyase (CYP17) and 36- hydroxysteroid dehydrogense (36-HSD) in zebrafish whole ovary exposed to all-trans retinoic acid (aT-RA; 4.5 ng/ml and 45 ng/ml) for 96 hours in vivo (Experiment 5).

Values represent mean ± SEM (n=l 1-12) of the fold change in expression normalized to adjusted EF as compared to controls, determined by Real-Time RT-PCR. Significant differences in mRNA expression encoding EF between aT-RA treatments are represented in insert. Normalization involves the conversion of each sample to a value that corresponds with a new average for the specific treatment group. Different letters indicate significant differences detected by Tukey's post hoc test (p<0.05).

~~77 Normalized mRNA expression to adjusted EF (fold change) p p o 00 O NJ O) CO o o o o o o o o o o o o~~

~~p CO V3 I X to D &~~

~~13 CO~~

~~p oo~~

-3

~~3 D EFgene expression en (arbitrary untits) 3 000007^7*7* ON3J*>b)C»Qk>£ 1 cr OOOOOOOO~~

5 H P ss TJ I 3 CD N <* > Figure 7. The effects of all-trans retinoic acid (aT-RA; 4.5 and 45 ng/ml) on the total cumulative number of eggs spawned by female zebrafish in each exposure treatment for experiment 5. The spawning from each container was standardized to the number of female fish in that treatment container. Data represents the accumulation of the mean number of eggs in each treatment for each day of the exposure period. The experiment included a 5 day pre exposure period (represented by negative numbers) followed by a 4 day exposure period

~~(represented by positive numbers) in which water was changed and supplemented daily with respective treatments.~~

~~79 1200 Pre-exposure Exposure~~

~~~s 1000 a *-•••-; A > «a 600 • -t-1->1 "•>^ ^ rt ^lii rs « j/.. K-' _ 400 a •a •""" ^ * -' s co u bo 200 50~~

~~1 1 > I 1 1 1 ! 1 -5 Day~~

~~Control -a- aT-RA 4.5 ng/ml A aT-RA 45 ng/ml~~

~~80 Figure 8. 1713-estradiol and testosterone levels in ovarian tissue in zebrafish exposed for~~

~~96 hours to either 0,0.45 or 4.5 ng/ml water borne all-trans retinoic acid (aT-RA).~~

~~Values represent mean ± SEM (n=10-13) from whole ovary pieces. Different letters indicate significant difference within treatments detected by Tukey's post hoc test~~

~~(p<0.05).~~

~~81 Testosterone (pg/mg ovary) 17B-estradiol (pg/mg ovary)~~

~~oo-^-»-roiNJCow-l^.fc. p p p p o O N3 J*. O Kl •£- CO O O O obiobiobiolnobi O O O O O oooooooooo~~

~~P P~~

~~i o "a P I~~

61 Figure 9. Relative mRNA expression encoding P450aromatase (CYP191A), P450 17a- hydroxylase/17,20-lyase (CYP17) and 315-hydroxy steroid dehydrogense (313-HSD) in zebrafish whole ovary exposed to all-trans retinoic acid (aT-RA; 0.45 ng/ml and 4.5 ng/ml) for 4 days in vivo (Experiment 6). Values represent mean ± SEM (n=10-13) of the fold change in expression normalized to elongation factor alpha 1 (EF) as compared to controls, determined by Real-Time RT-PCR. Mean hiRNA expression encoding EF for all treatment groups is represented in insert. Different letters indicate significant differences detected by Tukey's post hoc test (p<0.05).

~~83 Normalized mRNA expression to EF (fold change)~~

~~00 -fct~~

~~~>H 8-~~

~~EF mRNA expression (arbitary units) P o o o~~

~~s, 1 Figure 10. Basal and testosterone (T)-stimulated 17B-estradiol (E2) production by ovarian tissue (Experiment 7). Zebrafish were exposed to all-trans retinoic acid (aT-RA;~~

4.5 ng/ml) or DMSO (<0.001%) via the water for 24 hours, followed by incubation of whole ovary pieces (5.0 mg ±0.15) in media alone or with T for 18 hours. Values represent mean E2 production/ml culture media/mg of ovarian tissue ± SEM (n=9).

~~Different letters indicate significant differences detected by a Kruskal Wallace test followed by Dunnett's post hoc test (p<0.05).~~

~~85 • 0 ng/ml Testosterone B 50 ng/ml Testosterone~~

~~a m:m 4.5 aT-RA (ng/ml)~~

~~86 The effect of aT-RA on the control of germ cell fate in male and-female mice is thought to involve signalling through a rar pathway (Bowles and Koopman 2007).~~

Evaluation of the promoter region of the zebrafish CYP191A gene and 1000 base pairs upstream of the promoter with Genomatix Software (Matlnspector; http://www.genomatrix.de/cgi-bin/./eldorado/main.pl) and alignment of published sequences (Chang et al. 1997, Loudig et al. 2000, Tong and Chung 2003, Kazeto et al.

2005) in ClustalW failed to locate a consensus RARE sequence. Alternatively a rxr/ppar heterodimer has been identified in the promoter of CYP191B, an aromatase isoform expressed mainly in the brain of zebrafish (Kazeto et al. 2001, Tong and Chung 2003).

However there is no information to date regarding the effects of aT-RA on the mRNA expression of CYP191B in fish. The promoter region of CYP191A in the zebrafish exhibits consensus sequences for cAMP-responsive elements, an aryl hydrocarbon- responsive element, a steroidogenic factor 1 site (Kazeto et al. 2001), as well as estrogen receptor and androgen receptor half sites (Tong and Chung 2003). It is possible that response elements which recognize rars have not been identified within the CYP191A promoter or that the effects of aT-RA on aromatase may be indirect and could involve some other secondary signalling pathway.

The present studies also suggest that aT-RA may exert effects on other sites within the steroid biosynthetic pathway. A significant reduction in the mRNA expression encoding the steroid enzymes 3B-HSD and CYP 17 was seen following exposure to 4.5 ng/ml aT-RA, but there were no changes in the expression of StAR. These effects are less sensitive than those on aromatase and moreover there was no effect on T levels in vitro or in vivo. This suggests that the observed reductions in other steroid enzymes may

~~87 be less important than the inhibition of aromatase. Other reproductive endpoints~~

~~investigated in this study such as egg production showed no effects with any of the aT-~~

~~RA exposure treatments. This is unlike previous experiments in zebrafish where egg production was significantly inhibited by 93 % in fish exposed to aT-RA (Alsop et al.~~

2008). These differences may be due to changes in the duration and treatment dosages between aT-RA exposure studies. In this study, zebrafish were exposed for 96 hours at low treatment concentrations whereas in earlier studies fish were exposed to a high concentration (90 ng/ml aT-RA) for 11 days (Alsop et al. 2008). It was also observed that in the 45 ng/ml aT-RA treatment group the amount of eggs spawned daily continued to decrease with time and during the last three days of exposure 55 % of the RA groups did not spawn in comparison to 22 % in control groups (data not shown). Thus it is possible egg production would have significantly decreased with high aT-RA treatment following a longer exposure period.

A fundamental question is whether the effects of aT-RA reflect a physiological action in the zebrafish. This is difficult to address as the levels of aT-RA and 9-cis RA in fish are unknown. In zebrafish embryos, levels of aT-RA were measured at 3.3 ng/ml

~~(Costaridis et al. 1996). Previous studies have also measured whole body levels of the~~

RA precursors, retinal and retinol in the zebrafish. Retinal and retinol levels in zebrafish whole body tissue were shown to be 400 and 50 ng/g respectively in both males and females (Alsop et al. 2008). However, the levels of aT-RA and 9-cis RA are much lower than their precursors, and subsequently could not be measured by high pressure liquid chromatography (HPLC) (Alsop, personal communication). In higher vertebrates such as mammals and birds, RA levels are between 4 and 20% of those of retinol (Costaridis et

~~88 al. 1996). This suggests the concentrations of aT-RA used in this study (0.45,4.5 and 45~~

~~ng/ml) occur at physiologically relevant concentrations. The lowest concentration of aT-~~

~~RA that induced a consistent inhibitory effect on E2 levels, and aromatase enzyme~~

~~activity and gene expression in the ovary was 4.5 ng/ml. This indicates a relatively low~~

~~threshold concentration of aT-RA for its effects on zebrafish reproduction.~~

~~It has been demonstrated in zebrafish that whole body aT-RA levels increase~~

~~following starvation (Costaridis et al. 1996). While the cause of this increase is unknown,~~

investigation into energy allocation during periods of limited food availability may help provide insight into that phenomenon. When food is scarce, one could hypothesize that elevated levels of aT-RA would lead to down-regulation of CYP191A activity and expression resulting in an inhibition of E2 production in the ovary and subsequent vitellogenin synthesis in the liver, and decrease egg production. This possibility provides some direction to future studies examining the importance of RA in reproduction and food deprivation.

The present studies demonstrate that the effect of aT-RA on steroidogenesis in the zebrafish occurs through the inhibition of the catalytic activity and mRNA expression encoding the aromatase enzyme. It was also shown that the effects of aT-RA are similar between developmental stages as vitellogenic follicles and whole ovary pieces were similarly affected. The mechanism in which aT-RA inhibits aromatase remains unknown, however these studies suggest that regulation may occur via rar/rxr hetefodimers, or by a secondary signalling pathway. Further investigation into aromatase activity and expression following treatment with known rar and rxr agonists and antagonists would aid in determining the role of RA in the zebrafish ovary.

~~89 GENERAL DISCUSSION~~

The present studies have demonstrated the importance of the retinoid system to ovarian function and development in the zebrafish. This was demonstrated by i) the presence of mRNA encoding retinoid receptors in the zebrafish ovary within primary, pre-vitellogenic and vitellogenic follicle stages and ii) by retinoic acid (RA), specifically all-trans retinoic acid (aT-RA), affects ovarian steroidogenesis. The primary effect of RA occurs on the ovarian mRNA encoding the aromatase cytochrome P450 enzyme

~~(P450arom) through decreased catalytic activity and down-regulation of mRNA.~~

~~Secondary effects may also occur in other steroid enzymes such as down-regulation of~~

~~P450 17a-hydroxylase/17,20-lyase (CYP17) and 313-hydroxysteroid dehydrogenase (3B-~~

~~HSD). Regulation of retinoid receptors by steroid hormones does not appear to be as important, as exposure to 17a20J3P and E2 caused minimal changes in expression of mRNA encoding retinoid receptors.~~

~~Characterization of retinoid receptors in the zebrafish~~

~~The first objective of my research was to use the zebrafish as a model to investigate the significance of rxrs and rars in ovarian development. Recent evidence by~~

Alsop et al. (2008) demonstrated that several retinoid receptors are present within zebrafish tissue, however, the role of these receptors is unknown. Based on these previous findings, I hypothesized that retinoid receptors would be present in developing zebrafish ovarian follicles and that their expression would change between follicle stages.

Of the ten retinoid receptors that have been previously identified during zebrafish embryogenesis, my studies showed that only six (rxraa, rxrab, rxrba, rxrbb, rxrga and rarga) were present in the adult zebrafish ovary. Rxrgb was the only retinoid receptor

~~90 that was not detected in any adult zebrafish tissue examined. Due to the inefficiency of~~

~~the retinoid primers (< 80%) it is unknown whether amplification within the zebrafish~~

~~was simply not successful in the current studies or if expression of mRNA encoding the~~

~~genes for raraa, rarab and rargb is at such low levels within the ovary that it was not~~

~~detected. The mRNA expression encoding rarab and rargb has not yet been quantified in the adult zebrafish however raraa was present in both testis and ovaries in previous~~

studies (Alsop et al. 2008). In studies by Alsop et al. (2008) the mRNA encoding rxrga was found to be weakly expressed or absent in zebrafish gonads and the mRNA coding for the receptor rxrab was consistently undetected. This was not the case in this study, as both subtypes were detected in all stages of oocyte development. This may simply be due to the high sensitivity of Real-Time PCR in detecting low transcript expression in comparison to reverse transcription (RT)-PCR. In these studies, the mRNA encoding rxrab had very low expression in the ovary whereas the mRNA encoding rxrga had relatively moderate expression. This is in contrast to previous studies that showed an absence and weak expression of rxrab and rxrga, respectively (Alsop et al. 2008). These discrepancies should therefore be resolved before further conclusions can be made regarding retinoid receptor function and regulation in the zebrafish gonads. The mRNA encoding retinoid receptors were also found to be uniformly expressed across ovarian follicle stages. The presence of the mRNA encoding six retinoid receptors in the ovary suggests a potential role of RA in zebrafish reproduction however the function of these receptors remains unclear.

~~Investigation of retinoid receptor expression in the zebrafish embryo has found overlapping regions of mRNA expression, alluding to similar receptor function (Waxman~~

91 and Yelon 2006). In the adult zebrafish, there was also very little change between the expression of mRNA patterns encoding the retinoid receptors in the ovary. Future studies could utilize in situ hybridization to further clarify the expression of the receptors within the adult ovarian follicle and aid in determining their role in reproduction. The mRNA encoding the receptor rxrbb was the only receptor to show significant down-regulation in vitellogenic follicles which may indicate a separate function for this receptor isoform in oocyte growth and development.

~~Regulation of retinoid receptors in the zebrafish ovary~~

A secondary objective was to determine how the retinoid signaling pathway is regulated within the zebrafish ovary. Oocyte growth and maturation is dependent on the timed secretion of steroid hormones in the ovary such as E2 and 17a20J3P. Therefore I hypothesized E2 and 17a206P would influence the expression of mRNA encoding the retinoid receptor isoforms in the zebrafish ovary. This hypothesis was not supported by these studies, as E2 and 17a206P had very little effect on the expression of mRNA encoding retinoid receptor in whole ovary tissue and within follicular stages. However exposure to 500 ng/1 17a20fiP did cause a significant decrease in the expression of rxrba and rarga and demonstrated a decreasing trend in the expression of rxrab, rxrbb and rxrga in the whole ovary. This may suggest a potentialfunction for these receptors in oocyte growth and development. Alternatively no changes were observed between ovarian follicle stages following exposure to 100 ng/117a208P. At the present time the cause of the absence of effect of 17a2013P between follicle stages remains unknown. A treatment dosage of 100 ng/ml may not be enough to induce changes in mRNA expression.

~~92 Alternatively, 500 ng/ml may induce maturation in some ovarian follicles and contribute~~

~~to high variability in expression causing difficulties in analysis.~~

~~E2 did not have an effect on the retinoid receptors in the whole ovary except for~~

~~an up-regulation of rxraa. Due to the absence of effect on the other receptor genes E2 was~~

~~not examined between follicle stages. To date, studies that have characterized the~~

~~expression of rxraa in the adult zebrafish do not exist, and mammalian orthologs for rxraa~~

~~have not been identified. Therefore no comparisons can be made regarding the~~

~~expression and subsequent regulation of rxraa. The receptor rxraa may affect areas of ovarian function in the zebrafish that are highly influenced by E2.~~

Although these studies have not determined the role of retinoid receptors in the ovary, they have provided insight into some regulation by steroid hormones. Other hormones (luteinizing hormone, follicle stimulating hormone, insulin growth factors, and epidermal growth factors) involved in zebrafish ovarian function may also have the potential to regulate retinoid receptors and should remain a possibility for future investigations.

~~Effects of retinoic acid on steroidogenesis in the zebrafish~~

The third objective of my research was to determine how RA affects steroid hormone production, enzyme gene expression and ovulation in the zebrafish. I hypothesized that RA would alter the production of E2 and testosterone (T) by affecting genes involved in steroid biosynthesis.

~~Evidence from this study suggests that aT-RA has a primary effect on the enzyme~~

~~P450arom in the zebrafish ovary. This was demonstrated by a reduction in E2 but not T levels, a down-regulation of the mRNA expression of CYP191A and a decrease in the~~

93 catalytic activity of P450arom following exposure to aT-RA. Previous studies have suggested regulation by retinoic acid response elements (RAREs) located within the promoter regions of several genes in the zebrafish, with the ability to modify transcription following the binding of RA dimers. These DNA binding domains contain two zinc fingers with distinct functions that recognize the specific RA dimers and control the transcriptional activities of target genes (Yasmin et al. 2005). Changes in expression have been demonstrated following RARE binding in several genes including hox genes

~~(Nolte et al, 2003), CYP26 responsible for RA catabolism (Loudig et al. 2000), CYP191b in the zebrafish brain (Qian et al. 2000) and the signalling molecule sonic hedgehog~~

~~(Chang et al. 1997). This suggests a role for aT-RA in the regulation of gene transcription by binding to RAREs and may be the source of the observed effects on~~

CYP191A in the zebrafish. To date however no RAREs have been identified within the promoter region of the zebrafish CYP191 A. It is possible response elements which recognize rars have not been identified within the CYP191A promoter or that the effects of aT-RA may not be directly on aromatase, but could involve some other secondary signalling pathway.

The inhibition of aromatase and E2 production following treatment with aT-RA and not 9-cis-RA suggest the effects are mediated by rxr/rar heterodimers. This was also demonstrated in human breast cancer cells, as a combination of rxr and rar ligands stimulated P450arom activity and mRNA expression (Mu et al. 2000, Yanase et al. 2002).

Exposure to RA also caused an up-regulation of the mRNA expression of CYP19 in mammalian placentas (Zhu et al. 2002). In fetal germ cells of the mouse, aT-RA is also thought to regulate meiosis by binding to an rxr/rar heterodimer by induction of the

~~94 stimulated by retinoid acid gene 8 (Stra8) (Koubova et al. 2006, Bowles and Koopman~~

~~2007). Stra8 encodes a protein required for meiotic initiation in the mouse (Bouillet et al.~~

1995). A similar gene to Stra8 may also exist in fish however none have been identified to date. The observed effects on P450arom may also be mediated through a secondary signalling pathway. Studies have suggested the possible regulation of P450arom in mammalian ovaries through several means. In vitro cultures of mouse ovarian follicles with recombinant bovine activin A demonstrated a dose-dependent increase in E2 production by up-regulation of CYP19 (Miro and Hilier 1992, Smitz et al. 1998).

~~Retinoids also inhibited gonadotropin action and adenylate cyclase activity in rat Sertoli cells cultured in vitro suggesting possible effects on LH and FSH (Galdieri and Nistico~~

1994). Alternatively, the binding affinity of 9-cis RA to retinoid receptors in comparison to aT-RA is much lower, suggesting that 9-cis RA may induce effects in the zebrafish but at much higher concentrations than those tested here (Alsop et al. 2005). This may induce effects in zebrafish through rxr heterodimers such as vitamin D receptors (VDRs), thyroid hormone receptors (THRs), peroxisome proliferator activated receptors (PPARs) and constitutive androstone receptors (CARs)

~~Conclusions~~

These studies have characterized the mRNA expression patterns of six retinoid receptors in zebrafish primary, pre-vitellogenic and vitellogenic ovarian follicles. These studies also indicate that the steroid hormone 17a206P influences the expression of the retinoid receptors rxrbb and rarga. E2 induced the expression of the receptor rxraa.

~~Following the completion of these studies, the question regarding the regulation of rxrs and rars is not completely resolved. Many of the retinoid receptors were not affected by~~

~~95 E2 and 17a20J3P, however, the possibility of other potential steroid hormone regulators within the ovary still exists.~~

These studies also demonstrated the effects of RA on several aspects of zebrafish reproduction, particularly steroidogenesis. The means by which aT-RA affects gene expression remains to be investigated but may also provide answers into the regulation of retinoid receptors. To date no RARE consensus sequences have been identified in the zebrafish however this should not limit the possibility of RAREs in regulating gene transcription. Activation of heterodimers may also provide insight regarding the presence of retinoid receptors within zebrafish ovarian follicles. These studies have provided insight into the effects of RA in zebrafish but the role of retinoids in teleost physiology is still not fully understood.

~~96 LITERATURE CITED~~

~~Alberti, M., Kausch, U., Haindl, S., Seifert, M. 2005. Gene expression analysis for exposure to estrogenic substances. Acta Hydrochimica 33: 38-44.~~

Alsop, D., Brown, S. and Van Der Kraak, G. 2001. Development of a retinoic acid receptor-binding assay with rainbow trout tissue: characterization of retinoic acid binding, receptor tissue distribution, and developmental changes. General and Comparative Endocrinology 123: 254-267.

Alsop, D., Van Der Kraak, G., Brown, S.B., Eales, J.G. 2005. The biology and toxicology of retinoids in fish. Biochemistry and Molecular Biology of Fishes 6: Environmental Toxicology, Mommsen, T.P. and Moon, T.W., Eds., Elsevier, Amsterdam 413-430.

~~Alsop, D., Matsumoto, J., Brown, S., Van Der Kraak, G. 2008. Retinoid requirements in the reproduction of zebrafish. General and Comparative Endocrinology 156: 51-62.~~

Bauer, M.P., Bridgham, J.T., Langenau, D.M., Johnson, A.L., Goetz, F.W. 2000. Conservation of steroidogenic acute regulatory (StAR) protein structure and expression in vertebrates. Molecular and Cellular Endocrinology 168: 119-125.

~~Beckett, B.R. and Petkovich, M. 1999. Evolutionary conservation in retinoid signalling and metabolism. American Zoologist 39: 783-795.~~

Billiau, A.D., Sefrioui, H., Overbergh, L., Rutgeerts, O., Goebels, J., Mattieu, C, Waer, M. 2001. Transforming growth factor 6 inhibits lymphokine activated killer cytotoxicity of bone marrow cells. Transplantation 71: 292-299.

~~Blaner, W.S. 2001. Cellular metabolism and actions of 13-cis-retinoic acid. Journal of the American Academy of Dermatology 45: S129-S135.~~

~~Blomhoff, R., Green, M.H., Norum, K.R. 1992. Vitamin A: physiological and biochemical processing. Annual Review of Nutrition 12: 37-57.~~

~~Blomhoff, R. and Blomhoff, H.K. 2006. Overview of retinoid metabolism and function. Journal of Neurobiology 66: 606-630.~~

~~Boehm, N., Chateau, D., Rochette-Egly, C. 1997. Retinoid receptors in rat vaginal and uterine epithelia: changes with ovarian steroids. Molecular and Cellular Endocrinology 132:101-108.~~

Bouillet, P., Qulad-Abdelghani, M., Vicaire, S., Gamier, J.M., Schuhbaur, B., Dolle, P., Chambon, P. 1995. Efficient cloning of cDNAs of retinoic acid-responsive genes in pi 9 embryonal carcinoma cells and characterization of a novel mouse gene, Stral (mouse LERK-2/Eplg2). Developmental Biology 170:420-433.

97 Bowles, J., Knight, D., Smith, C, Wilhelm, D., Richman, J., Mamiya, S., Yashiro, K. Chawengsaksophak, K., Wilson, M.J., Rossant, J., Hamada, H., Koopman, P. 2006. Retinoid signaling determines germ cell fate in mice. Science 312: 596-600.

~~Bowles, J. and Koopman, P. 2007. Retinoic acid, meiosis and germ cell fate in mammals. Development 134: 3401-3411.~~

Brion, E., Tyler, C.R., Palazzi, X., laillet, B., Porcher, J.M., Garric, J. Flammarion, P. 2004. Impacts of 17beta-estradiol, including environmentally releveant concentrations, on reproduction after exposure during embryo-larval, juvenile, and adult life stages in zebrafish (Danio rerio). Aquatic Toxicology 24: 193-217.

Brown, J.A., Eberhardt, D.M., Schrick, F.N., Roberts, M.P., Godkin, J.D. 2003. Expression of retinol-binding protein and cellular retinol-binding protein in the bovine ovary. Molecular Reproduction and Development 64: 261-269.

Cameron, M.C., Denovan-Wright, E.M., Sharma, M.K., Wright, J.M. 2002. Cellular retinol-binding protein type II (CRBPII) in adult zebrafish {Danio rerio), cDNA sequence, tissue-specific expression and gene linkage analysis. European Journal of Biochemistry 269: 4685-4692.

~~Chambon, P. 1996. A decade of molecular biology of retinoic acid receptors. Federation of American Societies for Experimental Biology 10: 940-954.~~

Chang, B-E., Blader, P., Fischer, N., Ingham, P.W., Strahle, U. 1997. Axial (HNF3J3) and retinoic acid receptors are regulators of the zebrafish sonic hedgehog promoter. The EMBO Journal 16: 3955-3964.

~~Chomczynski, P. and Sacchi, N. 1987. Single-step method of RNA isolation by acid guanidine thiocynate-phenol-chloroform extraction. Analytical Biochemistry 162: 156- 159.~~

~~Clagett-Dame, M. and DeLuca, H. 2002. The role of vitamin A in mammalian reproduction and development. Annual Review of Nutrition 22: 3 47-3 81.~~

~~Costaridis, P., Horton, C, Zeitlinger, J., Holder, N., Maden, M. 1996. Endogenous retinoids in the zebrafish embro and adult. Developmental Biology 205:41-51.~~

Cuesta, A., Ortuno, J., Rodriguez, A., Esteban, M.A., Meseguer, J. 2002. Changes in some innate defence parameters of seabream {Sparus aurata L.) induced by retinol acetate. Fish & Shellfish Immunology 13: 279-291.

~~Cuesta, A., Meseguer, J., Esteban, M.A. 2004. Total serum immunoglobin M levels are affected by immunomodulators in seabream {Sparus aurata L.). Veterinary Immunology and Immunopathology 101: 203-210.~~

~~98 Danforth; D.R. 1996. Endocrine and paracrine control of oocyte development. American Journal of Obstetrics and Gynecology 172: 747-752.~~

~~De The, H., del Mar Vivanco-Ruiz, M., Tiollais, P., Stunnenberg, H., Dejean, A. 1990. Identification of a retinoic acid responsive element in the retinoic acid receptor 6 gene. Nature 343: 177-180.~~

Dolle, P., Ruberte, E., Kastner, P., Petkovich, M., Stoner, CM., Gudas, L.J., Chambon, P. 1989. Differential expression of genes encoding a, 6 and y retinoic acid receptors and CRABP in the developing limbs of the mouse. Nature 342: 702-705.

~~Doyle, C.J. and Lim, R.P. 2002. The effect of 1713-estradiol on the gonopodial development and sexual activity of Gambusia holbrooki. Environmental Toxicology and Chemistry 21: 2719-2724.~~

Dupont, J., Chabrolle, C, Rame, C, Tosca, L., Coyral-Castel, S. 2008. Role of peroxisome proliferators-activated receptors, adenosine monophosphate-activated kinase, and adiponectin in the ovary. PPAR Research: In Press ID 176275.

Essex-Fraser, P.A., Steele, S.L., Bernier, N.J., Muray, B.W., Stevens, E.D., Wright, P.A. 2005. Expression of four glutamine synthetase genes in early stages of development of rainbow trout {Orcorhynchus mykiss) in relationship to nitrogen excretion. Journal of Biological Chemistry 280: 20268-20273.

Gaemers, I.C., van Pelt, A.M.M., van der Saag, P.T., Hoogerbrugge, J.W., Themmen, A.P.N., de Rooij, D.G. 1997. Effect of retinoid status on the messenger ribonucleic acid expression of nuclear retinoid receptors a, 13 and y, and retinoid x receptors a, 6 and y in the mouse testis. Endocrinology 138: 1544-1550.

~~Galdieri, M. and Nistico, L. 1994. Retinoids regulate gonadotropin action in cultured rat Sertoli cells. Biology of Reproduction 50: 171-177.~~

~~Ge, W. and Pang, Y. 2002. Gonadotropin and activin enhance maturational competence of oocytes in the zebrafish (Danio rerio). Biology of Reproduction 66: 259-265.~~

Ge, W. and Wang, Y. 2004. Developmental profiles of activin J3A, BB, and follistatin expression in the zebrafish ovary: evidence for their differential roles during sexual maturation and ovulatory cycle. Biology of Reproduction 71: 2056-2064.

Ge, W. 2005. Intrafollicular paracrine communication in the zebrafish ovary: the state of the art of an emerging model for the study of vertebrate folliculogenesis. Molecular and Cellular Endocrinology 237: 1-10.

~~Giguere, V. 1994. Retinoic acid receptors and cellular retinoid binding proteins: complex interplay in retinoid signaling. Endocrine Reviews 15: 61-79.~~

~~99 Gu, X., Xu, F., Wang, X., Gao, X., Zhao, Q. 2005. Molecular cloning and expression of a novel CYP26 gene (cyp26dl) during zebrafish development. Gene Expression Patterns 5:733-739.~~

Gu, X., Xu, F., Song, W., Hu, P., Yang, Y., Gao, X., Zhao, Q. 2006. A novel cytochrome P450, zebrafish cyp26dl, is involved in metabolism of all-trans retinoic acid. Molecular Endocrinology 20: 1661-1672.

Guillou, A., Choubert, G., Storebakken, T., de la Nouet, J., Kaushik, S. 1989. Bioconversion pathway of astaxanthin into retinol in mature rainbow trout (Salmo Gairdneri Rich.). Comparative Biochemistry and Physiology 94B: 481-485.

Hale, L.A., Tallafuss, A., Yan, Y-L., Dudley, L., Eisen, J.S., Postlethwait, J.H. 2006. Characterization of the retinoic acid receptor genes raraa, rarab, and rarg during zebrafish development. Gene Expression Patterns 6: 546-555.

~~Hernandez, R.E. Putzke, A.P., Myers, J.P., Margeretha, L., Moens, C.B. 2007. Cyp26 enzymes generate the retinoic acid response pattern necessary for hindbrain development. Development 134:177-187.~~

~~Holder, N. and Hill, J. 1991. Retinoic acid modifies development of the midbrain-hindbrain border and affects cranial ganglion formation in zebrafish embryos. Development 113:1159-1170.~~

Howarth, D.L., Law, S.H., Barnes, B., Hall, J.M., Hinton, D.E., Moore, L., Maglich, J.M., Moore, J.T., Kullman, S.W. 2008. Paralogous vitamin D receptors in teleosts: transition of nuclear receptor function. Endocrinology 149: 2411 -2422.

~~Hu, M-C, Chiang, E.F-L., Tong, S-K., Lai, W., Hsu, N-C, Wang, L.C-K., Chung, B-c. 2001. Regulation of steroidogenesis in transgenic mice and zebrafish. Molecular and Cellular Endocrinology 171: 9-14.~~

Hung, S-W., Tu, C-Y., Wang, W-S. 2007. In vivo effects of adding singular or combined anti-oxidative vitamins and/or minerals to diets on the immune system of tilapia {Oreochromis hybrids) peripheral blood monocyte-derived, anterior kidney- derived, and spleen-derived macrophages. Veterinary Immunology and Immunopathology 115: 87-99.

~~Hyatt, G.A., Schmitt, E.A., Marsh-Armsrong, N.R., Dowling, J.E. 1992. Retinoic acid- induced duplication of the zebrafish retina. Proceedings of the National Academy of Science 89: 8293-8297.~~

Ibabe, A., Grabenbauer, M., Baumgart, E., Fahimi, H.D., Cajarville, M.P. 2002. Expression of peroxisome proliferator-activated receptors in zebrafish (Danio rerio). Histochemical Cell Biology 118: 231-239.

100 Ings, J.S. and Van Der Kraak, G.J. 2006. Characterization of the mRNA expression of StAR and steroidogenic enzymes in zebrafish ovarian follicles. Molecular Reproduction and Development 73: 943-954.

~~Irie, T., Seki, T. 2002. Retinoid composition and retinal localization in the eggs of teleost fishes. Comparative Biochemistry and Physiology Part B 131: 209-219.~~

~~Isken, A., Holzschuh, J., Lampert, J.M., Fischer, L., Oberhauser, V., Palczewki, K., von Lintlg, J. 2007. The Journal of Biological Chemistry 282: 1144-1151. .~~

Jones, B.B., Ohno, C.K., Allenby, G., Boffa, M.B., Levin, A.A., Grippo, J.F., Petkovich, M. 1995. New retinoid x receptor subtypes in zebra fish (Danio rerio) differentially modulate transcription and do not bind 9-cis retinoic acid. Molecular and Cellular Biology 15: 5226-5234.

Kazeto, Y., Goto-Kazeto, R. and Trant, J.M. 2005. Membrane-bound progestin receptors in channel catfish and zebrafish ovary: changes in gene expression associated with the reproductive cycles and hormonal reagents. General and Comparative Endocrinology 142: 204-211.

~~Kazeto, Y., Ijiri, S., Place, A.R., Zohar, Y., Trant, J.M. 2001. The 5'-flanking regions of CYP19A1 and CYP19A2 in zebrafish. Biochemical and Biophysical Research Communications 288: 503-508.~~

Kopinke, D., Sasine, J., Swift, J., Stephens, W.Z., Piotrowski, T. 2006. Retinoic acid is required for endodermal pouch morphogenesis and not for pharyngeal endoderm specification. Developmental Dynamics 235: 2695-2709.

Korgaard, B., Andreassen, T.K., Rasmussen, T.H. 2002. Effects of an environmental estrogen, 17a-ethinyl-estradiol, on the maternal-fetal trophic relationship in the eelpout Zoarces viviparous (L). Marine Environmental Research 54: 735-739.

Koubova, J., Menke, D.B., Zhou, Q., Capel, B., Griswold, M.D., Page, D.C. 2006. Retinoic acid regulates sex-specific timing of meiotic initiation in mice. Proceedings of the National Academy of Science 103: 2474-2479.

~~Kurlandsky, S.B., Gamble, M.V., Ramakrishnant, R., Blaner, W.S. 1995. Plasma delivery of retinoic acid to tissues in the rat. The Journal of Biological Chemistry 270: 17850-17857.~~

~~Lee, J-W., Imt, J-A., Lee, D-C, Lee, H-R., Shim, J-Y. 2008. Retinol-binding protein in non-obese women with polycystic ovary syndrome. Clinical Endocrinology 68: 786-790.~~

~~Lee, H-K., Yoo, M-S., Choi, H-S., Kwon, H-B and Soh, J. 1999. Retinoic acids up- regulate steroidogenic acute regulatory protein gene. Molecular and Cellular Endocrinology. 148: 1-10.~~

~~101 Leid, M., Kastner, P. and Chambon, P. 1992. Multiplicity generates diversity in the retinoic acid signalling pathways. Trends in Biochemical Sciences 17: 427-433.~~

Lefevre, A., Rogier E., Astraudo, C, Duquenne, C, Finaz, C. 1994. Regulation by retinoids of luteinizing hormone/chrionic gonadotropin receptor, cholesterol side-chain cleavage cytochrome P-450, 3fi-hydroxysteroid dehydrogenase/A^-isomerase and 17a- hydroxylase/C 17.20 lyase cytochrome P-450 messenger ribonucleic acid levels in the K9 mouse leydig cell line. Molecular and Cellular Endocrinology 106: 31-39.

~~Lister, A. and Van Der Kraak, G. 2008. Regulation of prostaglandin synthesis in ovaries of sexually-mature zebrafish (Danio rerio). General and Comparative Endocrinology: In Press.~~

Liu, R-Z., Sun, Q., Thisse, C, Thisse, B., Wright, J.M., Denovan-Wright, E.M. 2005. The cellular retinol-binding protein genes are duplicated and differentially transcribed in the developing adult zebrafish (Danio rerio). Molecular Biology and Evolution 22: 469- 477.

~~Livera, G., Rouiller-Fabre, V., Habert, R. 2001. Retinoid receptors involved in the effects of retinoic acid on rat testis development. Biology of Reproduction 64: 1307- 1314.~~

~~Livera, G., Rouiller-Fabre, V., Pairault, C, Levacher, C, Habert, R. 2002. Regulation and perturbation of testicular functions by vitamin A. Reproduction 124: 173-180.~~

Livera, G., Pairault, C, Lambrot, R., Lelievre-Pegorier, M., Saez, J.M., Habert, R., Rouiller-Fabre, V. 2004. Retinoid-sensitive steps in steroidogenesis in fetal and neonatal rat testes: in vitro and in vivo studies. Biology of Reproduction 70: 1814-1821.

Loudig, O., Babichuk, C, White, J., Abu-Abed, S., Mueller, C, Petkovich, M. 2000. Cytochrome P450RA1(CYP26) promoter: a distinct composite retinoic acid response element underlies the complex regulation of retinoic acid metabolism. Molecular Endocrinology 14:1483-1497.

Lubzens, E., Lissauer, L., Levavi-Sivan, B., Avarre, J.-C, Sarnmar, M. 2003. Carotenoid and retinoid transport to fish oocytes and eggs: what is the role of retinol binding protein? Molecular Aspects of Medicine 24: 441-457.

~~Mangelsdorf, D.J., Ong, E.S., Dyck, J.A., Evans, R.M. 1990. Nuclear receptor that identifies a novel retinoic acid response pathway. Nature 345: 224-229.~~

Mimeault, C, Trudeau, V.L. and Moon, T.W. 2006. Waterborne gemfibrozil challenges the hepatic antioxidant defense system and down-regulates peroxisome proliferator- activated receptor beta (PPARB) mRNA levels in male goldfish (Cassius auratus). Toxicology 228: 140-150.

102 Min, G., Kim, H., Bae, Y., Petz, L., Kemper, J.K. 2002. Inhibitory cross-talk between estrogen receptor (ER) and constitutively activated androstane receptor (CAR). The Journal of Biological Chemistry 277: 34626-34633.

~~Miro, F. and Hillier, S.G. 1992. Relative effects of activin and inhibin on steroid hormone synthesis in primate granulosa cells. Journal of Clinical Endocrinology and Metabolism 75: 1556-1571.~~

Mohan, M., Thirumalapura, N.R, Malayer, J. 2003. Bovine cumulus-granulosa cells contain biologically active retinoid receptors that can respond to retinoic acid. Reproductive Biology and Endocrinology 1: 104-113.

Montserrat, N., Gonzalez, A., Mendez, E., Piferrer, F., Planas, J.V. 2004. Effects of follicle stimulating hormone on estradiol-176 production and P-450 aromatase (CYP19) activity and mRNA expression in brown trout vitellogenic ovarian follicle in vitro. General and Comparative Endocrinology 137: 123-131.

~~Moreno, T.A, Jappelli, R., Belmonte, J.C.I., Kintner, C. 2008. Retinoic acid regulation of the Mesp-Ripply feedback loop during vertebrate segmental patterning. Developmental Biology 315: 317-330.~~

Mu, Y-M., Yanase, T., Nishi, Y., Hirase, N., Goto, K., Takayanagi, R., Nawata, H. 2000. A nuclear receptor system constituted by RAR and RXR induces aromatase activity in MCF-7 human breast cancer cells. Molecular and Cellular Endocrinology 166: 137-145.

~~Nagahama, Y. and Yamashita, M. 2008. Regulation of oocyte maturation in fish. Development and Growth Differentiation 50: S195-S219.~~

Nagata, T., Kanno, Y., Ozato, K., Taketo, M. 1994. The mouse Rxrb gene encoding RXRB: genomic organization and two mRNA isoforms generated by alternative splicing of transcripts initiated from CpG island promoters. Gene 142: 183-189.

~~Nagaya, T. and Jameson, J.L. 1993. Distinct dimerization domains provide antagonist pathways for thyroid hormone receptor action. The Journal of Biological Chemistry 268: 24278-24282.~~

~~Napoli, J.L. 1996. Biochemical pathways of retinoid transport, metabolism, and signal transduction. Clinical Immunology and Immunopathology 80: S52-S62.~~

~~Nawrocki, L., Bremiller, R., Streisinger, G., Kaplan, M. 1985. Larval and adult visual pigments of the zebrafish, Brachydanio rerio. Vision Research 25: 1569-1576.~~

~~Nelson, D.R. 1999. A second CYP26 P450 in humans and zebrafish: CYP26B1. Archives of Biochemistry and Biophysics 371: 345-347.~~

103 Nolte, C, Amores, A., Kovacs, E.N., Postlethwait, J., Featherstone, M. 2003. The role of retinoic acid response element in establishing the anterior neural expression border of Hoxd4 transgenes. Mechanisms of Development 120: 325-335.

Patino, R., Yoshizaki, G., Thomas, P., Kagawa, H. 2001. Gonadotropic control of ovarian follicle maturation: the two-stage concept and its mechanisms. Comparative Biochemistry and Physiology Part B 129: 427-439.

Pawlowska, K., Sechman, A., Suchanek, I., Grzegorzewska, A., Rzasa, J. 2008. Effect of 9-cis retinoic acid (RA) on progesterone and estradiol secretion and RA receptor expression in the chicken ovarian follicles. Folia Biologica 56: 65-72.

~~Phillips, D.J. and de Krester, D.M. 1998. Follistatin a multifunctional regulatory protein. Frontiers in Neuroendocrinology 19: 287-322.~~

~~Qian, A., Cai, Y., Magee, T.R., Wan, Y-J.Y. 2000. Identification of retinoic acid- responsive elements on the HNFla and HNF4a genes. Biochemical and Biophysical Research Communications 276: 837-842.~~

Rishi, A.K., Shao, Z-M., Baumann, R.G., Li, X-S., Sheikh, M.S., Kimura, S., Bashirelahi, N., Fontana, J.A. 1995. Estradiol regulation of the human retinoic acid receptor a gene in human breast carcinoma cells is mediated via an imperfect half-palindromic estrogen response element and Spl motifs. Cancer Research 55: 4999-5006.

Sammar, M., Levi,L., Hurvitz, A., Lubzens, E. 2005. Studies on retinol-binding protein during vitellogenesis in the rainbow trout (Oncorhynchusmykiss). General and Comparative Endocrinology 141: 141-151.

Schonthaler, H.B., Lampert, J.M., Isken, A., Rinner, O., Mader, A., Gesemann, M., Oberhauser, V., Golczak, M., Biehlmaier, O., Palczewski, K., Neuhuass, S.C.F., von Lintig, J. 2007. Evidence for RPE65-independent vision in the cone-dominated zebrafish retina. European Journal of Neuroscience 26:1940-1949.

Schweigert, F. and Siegling, C. 2001. Immunolocalization of retinol-binding protein, cellular retinoic acid-binding protein I and retinoic x receptor 13 in the porcine reproductive tract during the oestrous cycle. Reproduction, Fertility and Development 13:421-426.

Seleiro, E.A.P., Darling, D., Brickell, P.M. 1994. The chicken retinoid-x-receptor-y gene gives rise to two distinct species of mRNA with different patterns of expression. Biochemical Journal 201: 283-288.

~~Selman, K., Wallace, R.A., Sarka, A., Qi, X. 1993. Stages of oocyte development in the zebrafish Brachydanio rerio. Journal of Morphology 218: 203-222.~~

~~104 Smitz, J., Cortvrindt, R., Hu, Y., Vanderstichele, H. 1998. Effects of recombinant activin A on in vitro culture of mouse preantral follicles. Molecular Reproduction and Development 50: 294-304.~~

Sonneveld, E., van den Brink, C.E., van der Leede, B-J.M., Schulkes, R-K.A.M., Petkovich, M., van der Burg, B., van der Saag, P.T. 1996. Human retinoic acid (RA) 4- hydroxylase (C YP26) is highly specific for all-trans-RA and can be induced through RA receptors in human breast and colon carcinoma cells. Cell Growth and Differentiation 9: 629-637.

~~Stocco, D.M. and Clark, B.J. 1996. Regulation of the acute production of steroids in steroidogenic cells. Endocrine Reviews 17: 221-244.~~

~~Stocco, C. 2008. Aromatase expression in the ovary: hormonal and molecular regulation. Steroids 73: 473-487.~~

Tallafuss, A., Hale, L.A., Yan, Y-L., Dudley, L., Eisen, J.S., Postlethwait, J.H. 2006. Characterization of retinoid-x receptor genes rxra, rxrba, rxrbb and rxrg during zebrafish development. Gene Expression Patterns 6: 556-565.

~~Tong, S-K. and Chung, B-C. 2003. Analysis of zebrafish cypl9 promoters. Journal of Steroid Biochemistry and Molecular Biology 86: 381-386.~~

~~Trautmann, E., Guerquin, M.J., Duquenne, C„ Lahaye, J.B., Habert, R., Livera, G. 2008. Retinoic acid prevents germ cell mitotic arrest in mouse fetal testes. Cell Cycle 7: 656- 664,~~

~~Waxmann, J.S. and Yelon, D. 2007. Comparison of the expression patterns of newly identified zebrafish retinoic acid and retinoid x receptors. Developmental Dynamics 236: 587-595.~~

Wickenheisser, J.K., Nelson-DeGrave, V.L., Hendricks, K.L., Legro, R.S., Strauss III, J.F., McAllister, J.M. 2005. Retinoids and retinol differentially regulate steroid biosynthesis in ovarian theca cells isolated from normal cycling women and women with polycystic ovary syndrome. The Journal of Clinical Endocrinology and Metabolism 90: 4858-4865.

Wingert, R.A., Selleck, R., Yu, J., Song, H-D., Chen, Z., Song, A., Zhou, Y., Thisse, B., Thisse, C, McMahon, a.P., Davidson, A.J. 2007. The cdx genes and retinoic acid control the positioning and segmentation of the zebrafish pronephros. PLoS Genetics 3: 1922-1938.

~~Yamada, H., Yamaguchi, T., Oguri, K. 2000. Suppression of the expression of the CYP2B1/2 gene by retinoic acids. Biochemical and Biophysical Research Communications 277: 66-71.~~

105 Yanase, T., Mu, Y-M., Nishi, Y., Goto, K., Nomura, M., Okabe, T., Takayanagi, R., Nawata, H. 2001. Regulation ofaromatase by nuclear receptors. Journal of Steroid Biochemistry and Molecular Biology 79: 187-192.

~~Yasmin, R., Williams, R.M., Xu, M., Noy, N. 2005. Nuclear import of the retinoid x receptor, the vitamin D receptor, and their mutual heterodimer. The Journal of Biological Chemistry 280: 40152-40160.~~

Young, G., Kusakabe, M., Makamura, I. 2005. Gonadal steroidogenesis in teleost fish. Hormones and their receptors in fishreproduction . Malamed, P. and Sherwood, N. World Scientific Publishing Company, New Jersey.

Yu, V.C., Deiser, C, Anderson, B., Holloway, J.M., Devary, O.V., Naar, A.M., Kim, S.Y., Boutin, J-M., Glass, C.K., Rosenfeld, M.G. 1991. RXR6: a coregulator that enhances binding of retinoic acid, thyroid hormone, and vitamin D receptors to their cognate response elements. Cell 67: 1251-1266.

Zheng, W.L., Bucco, R.A., Sierre-Rievera, E., Osteen, K.G., Melner, M.H., Ong., D.E. 1999. Synthesis of retinoid acid by rat ovarian cells that express cellular retinoic acid- binding protein-III. Biology of Reproduction 60:110-114.

Zhu, S.J., Li, Y., Li, H., Wang, Y.L., Xiao, Z.J., Vihko, P., Piao, Y.S. 2002. Retinoic acids promote the action ofaromatase and 1713-hydroxysteroid dehydrogenase type 1 on the biosynthesis of 176-estradiol in placental cells. Journal of Endocrinology 172: 31-43.

Zou, F., Liu, Y., Liu, L., Wu, K., Wei, W., Zhu, Y., Wu, J. 2007. Retinoic acid activates human inducible nitric oxide synthase gene through binding of RARa/RXRa heterodimer to a novel retinoic acid response element in the promoter. Biochemical and Biophysical Research Communication 355: 494-500.

~~106 APPENDIX I - RETINOID RECEPTOR mRNA EXPRESSION IN ZEBRAFISH OVARIAN FOLLICLES~~

~~Srxrba 0.90 -, Srxrbb • rxrga Hrxraa • rxrab • rarga L~~

~~stage I stage II stage III~~

Figure 1: Characterization of the mRNA expression encoding six retinoid receptors (rxrba, rxrbb, rxrga, rxraa, rxrab and rarga) from experiment 2 in primary (stage I), pre-. vitellogenic (stage II) and vitellogenic (stage III) ovarian follicles in untreated zebrafish (70-100 follicles/stage/fish). Values represent non-normalized mean input values in arbitrary units ± SE (n=10) to demonstrate ovarian follicle mRNA expression coding for retinoid receptors relative to one-another.

~~107 APPENDIX II - IN VITRO AND IN VIVO EFFECTS OF RETINOIC ACID IN ZEBRAFISH OVARIAN FUNCTION~~

~~m 0 ng/ml aT-RA + 0 ng/ml 9-cis El 25 ng/ml aT-RA + 25 ng/ml 9-cis ^ 120 c o 4-1 100 T T n3 T Ural! T 80 • sti m adio l k At 60 ro n -es t *"i m 40 stost e £ 20 mi~~

~~Experiment~~

Figure 1. Effects of the combination of all-trans retinoic acid (aT-RA; 25 ng/ml) and 9- cis-retinoic acid (9-cis; 25 ng/ml) on testosterone (T)-stimulated (50 ng/ml) 1713-estradiol (E2) production in zebrafish vitellogenic follicles. Each treatment contained 3 replicates of 40 randomly chosen follicles pooled from 4-6 female zebrafish. Due to significant differences between individual experiments (p<0.05), values are represented as mean ±

~~SEM for each separate study and are expressed as a percentage of T-stimulated E2 production. There were no significant differences between treatment groups (p>0.05).~~

~~108 140 20 • 0 ng/ml I' n 25 ng/ml 9-cis RA 2 100 80~~

~~60-^~~

~~20 J~~

~~Experiment~~

Figure 2. Effects of 9-cis-retinoic acid (9-cis; 25 ng/ml) on testosterone (T)-stimulated (50 ng/ml) 176-estradiol (E2) production in zebrafish vitellogenic follicles. Each treatment contained 3 replicates of 40 randomly chosen follicles pooled from 4-6 female zebrafish. Due to significant differences between individual experiments (p<0.05), values are represented as mean ± SEM for each separate study and are expressed as a percentage of T-stimulated E2 production. There were no significant differences between treatments groups (p>0.05).

~~109 1.40 if- 1.60 I I 0.80~~

~~1.40 if" £ S. o.20 b.oo 0 4.5 1.20 aT-RA (ng/ml) 1.00~~

~~0.80~~

~~0.60~~

~~0.40 !i0.2 0 0.00 rxraa rxrab rxrbb~~

~~I 0 ng/m aT-RA m 45 ng/ml aT-RA~~

~~Figure 3. Relative mRNA expression coding for rxraa, rxrab and rxrbb in zebrafish whole ovary exposed to all-trans retinoic acid (aT-RA; 45 ng/ml) for 96 hours in vivo.~~

Values represent mean ± SEM (n=l 1-13) of the fold change in expression normalized to adjusted EF (insert represent non-adjusted EF mRNA expression in arbitrary units) as compared to controls, determined by Real-Time RT-PCR. Normalization involves the conversion of each sample to a value that corresponds with a new average for the specific treatment group. There were no significant differences between treatment groups

~~(p>0.05).~~

~~110 EXPERIMENT 8~~

~~Experimental Design~~

~~An additional experiment was designed to evaluate the effects of 4.5 ng/ml aT-~~

~~RA, 4.5 ng/ml 9-cis-RA and the combination of 4.5ng/ml aT-RA and 4.5 ng/ml 9-cis-RA~~

~~on ovarian steroid hormone levels, steroidogenic gene expression and ovulation in female~~

~~zebrafish. In Experiment 8 consisted of a 5 day pre-exposure followed by a 96 hour~~

~~exposure period in which eggs were counted and collected daily. Fish were treated with~~

~~13.5 ul of either aT-RA or 9-cis-RA, or the combination of 13.5 ul aT-RA and 9-cis-RA~~

~~from stock solutions (1 mg/ml). Control beakers were supplemented with 27 ul DMSO.~~

~~At the end of the exposure period, fish were sacrificed by spinal transaction and weighed.~~

~~Whole ovaries were removed, weighed and snap frozen at -80 °C and stored until RNA~~

~~and steroid hormone extraction.~~

~~RESULTS~~

~~Exposure to waterbourne 4.5 ng/ml aT-RA and the combination of 4.5 ng/ml aT-~~

RA and 4.5 ng/ml 9-cis-Ra for 96 hours caused a slight decrease in E2 levels in the zebrafish whole ovary compared to controls, but was not significant, whereas 9-cis-RA did not have an effect on E2 levels in the ovary (Figure 4a). In contrast, T levels were not affected by any of the RA treatments in the whole ovary (Figure 4b). Real-Time RT-

PCR revealed a significant down-regulation in mRNA expression of CYP191 Al in the ovary followingexposur e to 4.5 ng/ml aT-RA and the combination of 4.5 ng/ml aT-RA and 4.5 ng/ml 9-cis-RA (p<0.05). There were no effects of 4.5 ng/ml 9-cis-RA on the mRNA expression of CYP191A (Figure 5). The rxr isoforms rxrga and rarga also did not

~~111 change with any of the RA treatments (Figure 6). The spawning of eggs was also not affected by any RA treatments (Figure 7).~~

~~112 6.00~~

~~5.00 £10~~

~~go v 4.00 E -^O.l 3.00 a SSSsil io l •o 2 2.00 +* » ffi? 1.00~~

~~0.00 aT-RA 9-cis aT-RA + 9-cis~~

~~RAtype (4.5ng/ml)~~

~~2.00~~

~~O O) E "5) S 1.00 I I «~~

~~•| 0.50~~

~~0.00 aT-RA 9-cis aT-RA + 9-cis RAtype (4.5ng/mI)~~

Figure 4: 176-estradiol and testosterone levels in ovarian tissue of zebrafish following exposure to all-trans retinoic acid (aT-RA; 4.5 ng/ml), 9-cis retinoic acid (9-cis; 4.5 ng/ml) and the combination of aT-RA and 9-cis RA (4.5 ng/ml each) for 96 hours.

~~Values represent mean ± SEM (n=5-8) from whole ovary pieces. There were no significant differences between treatments (p>0.05).~~

~~113 1.4 E g aT-RA 9^:is 9-cis + 1.2 aT-RA S ° 1.0 T- "O 0.8 ab a. "o 0.6 b o c -o .2 0.4 d) (0 0.2 5 Q. F X 0.0 O ® Z 0 aT-RA 9-cis 9-cis + aT- RA RA type (4.5 ng/ml)~~

Figure 5. Relative mRNA expression coding for CYP191A in zebrafish whole ovary exposed to all-trans retinoic acid (aT-RA; 4.5 ng/ml), 9-cis retinoic acid (9-cis; 4.5 ng/ml) and the combination of aT-RA and 9-cis RA (4.5 ng/ml each) for 96 hours in vivo.

~~Values represent mean ± SEM (n=9-l 1) of the fold change in expression normalized to~~

~~EF (insert) as compared to controls, determined by Real-Time RT-PCR. Different letters indicate significant differences (p<0.05).~~

~~114 U Control • aT-RA D 9-cis 0 aT-RA + 9-cis~~

~~rarga rxrga~~

Figure 6. Relative mRNA expression encoding rarga and rxrga in zebrafish whole ovary exposed to all-trans retinoic acid (aT-RA; 4.5 ng/ml), 9-cis retinoic acid (9-cis; 4.5 ng/ml) and the combination of aT-RA and 9-cis RA (4.5 ng/ml each) for 96 hours in vivo.

~~Values represent mean ± SEM (n=9-l 1) of the fold change in expression normalized to~~

~~EF as compared to controls, determined by Real-Time RT-PCR. There were no significant differences between treatments (p>0.05).~~

~~115 Pre-exposure 400 350 300" 250 • ft 200 w31 150 3 100 a 3 50 o~~

~~-2 -1 1 2 3 Day •S— Control —•— 9cis (4.5 ng/m]) -*- aT-RA + 9cis (4.5 ng/mfl • aT-RA (4.5 ng/ml)~~

Figure 7. The effects of all-trans retinoic acid (aT-RA; 4.5 ng/ml), 9-cis RA (4.5 ng/ml) and the combination of aT-RA and 9-cis RA (4.5 ng/ml each) on the total cumulative number of eggs spawned by female zebrafish in each exposure treatment. The spawning from each container was standardized to the number of female fish in that treatment container. Data represents the accumulation of the mean number of eggs in each treatment for each day of the exposure period. The experiment included a 5 day pre exposure period (represented by negative numbers) followed by a 96 hour day exposure period (represented by positive numbers) in which water was changed and supplemented daily with respective treatments.

~~116~~