A Novel Immunodeficiency Due to a Mutation in the Γ1-COP Subunit of the COPI Coatomer

A Novel Immunodeficiency Due to a Mutation in the γ1-COP Subunit of the COPI Coatomer

The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters

Citation Bainter, Wayne. 2018. A Novel Immunodeficiency Due to a Mutation in the γ1-COP Subunit of the COPI Coatomer. Master's thesis, Harvard Medical School.

Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:42076707

Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA

A novel immunodeficiency due to a mutation in the γ1-COP subunit of the COPI coatomer

Wayne Bainter Jr.

A Thesis Submitted to the Faculty of

The Harvard Medical School

in Partial Fulfillment of the Requirements

for the Degree of Master of Medical Sciences in Immunology

Harvard University

Boston, Massachusetts.

May, 2018

Thesis Advisor: Dr. Raif S. Geha Wayne Bainter Jr.

A novel immunodeficiency due to a mutation in the γ1-COP subunit of the COPI coatomer

Abstract

COPI-mediated retrograde trafficking is responsible for the retrieval of endoplasmic reticulum (ER) resident chaperones that escape to the cis-Golgi. ER resident chaperones with a

C-terminal KDEL motif bind to the KDELR and are transported from the Golgi to the ER via

COPI. Failure of this retrieval results in the accumulation of unfolded nascent proteins in the ER causing ER stress. T and B cells are particularly prone to ER stress during infection as they are stimulated to produce large quantities of cytokines and antibodies, respectively. We describe an

Omani family with increased susceptibility to viral infections and pneumonia due to encapsulated bacteria associated with CD4+ T cell lymphopenia and hypogammaglobulinemia.

Whole exome sequencing identified a bi-allelic missense mutation (K652E) in the γ1-COP subunit of the heptameric COPI coatomer. Patient fibroblasts had impaired retrograde trafficking from the cis-Golgi to ER and diminished co-localization of COPI with the KDEL receptor

(KDLER). Copg1K652E mice had severely reduced serum IgG levels and impaired T-cell dependent and T cell-independent antibody responses. Mutant B cells displayed increased ER stress and reduced immunoglobulin secretion, which could be rescued by the chemical chaperone

TUDCA. Chronically stimulated Copg1K652E T cells demonstrated impaired survival and cytokine secretion. This study identifies the first human disease caused by a mutation in COPG1, revealing a previously unknown role of intracellular protein trafficking and ER stress in adaptive immunity.

Table of Contents

Chapter 1: Background ...... 1

Chapter 2: Data and Methods ...... 8

Materials and Methods ...... 9

Results ...... 16

Chapter 3: Discussion and Perspectives ...... 28

Bibliography ...... 32

iii

Figure Legends

Figure 1. COPG1K652E mutation identified in siblings from a consanguineous family with

CID characterized by progressive CD4+ lymphopenia.

A) Family pedigree. B) Sanger sequencing of the K652E mutation. C) Linear map of protein and ribbon diagrams of COPG1K652E. D) -COP Western blot of fibroblasts: quantitation of 1-

COP/actin and 1-COP/2-COP ratios in patients relative to controls (n= 2 controls, n= 3 patients). E) 1-COP/-COP co-IP quantitation of 1-COP/-COP ratio in patients relative to controls. Columns and bars represent mean and SEM (n=1 per group).

Figure 2. The COPG1K652E mutation impairs retrograde protein trafficking and association with the KDELR.

A) Schematic of VSVG-ts045-KDELR chimeric protein, and its retrograde protein trafficking experimental model. B) Quantitative analysis of VSVG-ts045-KDELR co-localization with

Giantin in human fibroblasts (left) and MEFs (right) (n=1 per group). C) Pull down of -COP from WT and COPG1K652E mutant containing COPI complex with KDELR, Wbp1 and

ARFGAP1 GST fusion proteins (n= 1 per group). D) Quantitative analysis of fluorescence lifetime imaging (FLIM) between mutant COPG1K652E and KDELR or ARFGAP1 (n= 1 per group). Columns and bars represent mean and SEM. ***, P ≤ 0.001.

Figure 3. COPG1K652E results in increased ER stress and impaired ER expansion in stimulated B cells.

A) Bip mRNA and protein expression (total cell lysate) in B cells before and after 3 days of stimulation with LPS/IL-4. B) BiP levels in the supernatant of LPS/IL-4 stimulated B cells. C)

Relative mRNA expression of ER stress response genes in B cells before and after 3 days of stimulation with LPS/IL-4. D) Top: Representative histograms of ER mass (ER-Tracker Green) in B cells before and after stimulation with LPS/IL-4. Bottom: Fold change of ER-Tracker MFI relative to WT (n= 3 per group). Columns and bars represent mean and SEM. *, P ≤ 0.05, **, P

≤ 0.01, ***, P ≤ 0.001.

Figure 4. Mutant γ1-COP causes impaired B cell function.

A, B) In vitro total IgG and IgG1 secretion (A) and relative mRNA expression of germline and mature IgG1 transcripts (B) by B cells after 3 days of LPS/IL-4 stimulation (n= 3 per group). C)

Serum immunoglobulin levels (IgG, IgA, and IgM) in 8-12 weeks old mutant mice and WT controls (n= 10 per group). D) Antibody response 14 days after immunization with the T- independent antigen, TNP-Ficoll, and the T-dependent antigens TNP-KLH and NP-KLH in 8-12 weeks old mutant mice and WT controls (n= 8 per group). E) Percentages of antigen specific memory B cell (NP+IgD-) and plasma cells (CD138+) among splenic B220+ cells 6 days after

NP-KLH immunization in 8-12 weeks old mutant mice and WT controls (n= 6 per group). F, G)

Immunohistochemical staining of popliteal lymph node germinal centers for PNA+ and B220+ cells (left) and germinal center size (right) (n= 11 per group) (F) and percentages of germinal center (B220+ FAS+ GL7+) B cells and (CD4+ CXCR5+ PD1+) T follicular helper cells (G) 9 days after TNP-KLH immunization of 8-12 weeks old mutant mice and WT controls (n= 7 per group). Columns and bars represent mean and SEM. *, P ≤ 0.05, **, P ≤ 0.01, ***, P ≤ 0.001.

Figure 5. COPG1K652E leads to impaired T cell survival and function following repeated stimulation.

A) Experimental schema of repeated in vitro stimulation of T cells with CD3/CD28 Dynabeads.

B) Viable T cell counts after repeated CD3/CD28 stimulation using trypan blue staining (n= 3 per group). C) CD4+ and CD8+ T cells proliferation after stimulation using CellTrace Violet dye dilution (representative histograms, n= 3 per group). D) IL-4 and IFN secretion and relative mRNA expression after stimulation (n= 6 per group). E) Relative mRNA expression of ER stress response genes before and after stimulation (n= 4 per group). F) Representative histograms of

ER mass (ER-Tracker Green) before and after stimulation (left) and quantitative analysis of ER mass in T cells before and after stimulation (right) (n= 4 per group). Columns and bars represent mean and SEM. *, P ≤ 0.05, **, P ≤ 0.01.

Figure 6. The ER stress inhibitor, TUDCA, rescues IgG secretion and ER expansion in B cells.

A, B) In vitro IgG secretion (A) and quantitative analysis of ER mass (B) in B cells from mutant mice and WT controls stimulated with LPS/IL-4 for 3 days with or without the addition of 0.1 mM TUDCA for the last 24 hours of stimulation (n= 3 per group). Columns and bars represent mean and SEM. *, P ≤ 0.05, **, P ≤ 0.01.

Table 1. Immunologic profile of patients.

Acknowledgements

I would like to thank my advisor and mentor Dr. Raif Geha for his wisdom, sharing his knowledge of immunology and medicine, and most importantly for his kindness. I would also like to thank Dr. Janet Chou for her day-to-day support in science as well as life. Deep thanks are due to Dr. Craig Platt for his foundational work on this project as well as his guidance as I began to work on this project. Many thanks are due to Dr. Victor Hsu and Jimmy Park for their contributing work on COPI trafficking and FLIM. This work would not have been possible without the hands-on support from Dr. Sarah Cohen, Jennifer Jones, Dr. Abdallah Beano, and

Kelsey Stafstrom. Finally, I would like to thank the MMSc in Immunology program at Harvard

Medical School, particularly the following members: Dr. Shiv Pillai, Dr. Michael Carroll, Dr.

Diane Lam, and Ms. Selina Sarmiento.

“This work was conducted with support from Students in the Master of Medical Sciences in

Immunology program of Harvard Medical School. The content is solely the responsibility of the authors and does not necessarily represent the official views of Harvard University and its affiliated academic health care centers.”

vii

Chapter 1: Background

Primary Immunodeficiencies (PIDs) are a group of rare monogenic diseases in which a component of the immune system is absent or has impaired function. This usually leads to increased susceptibility to infection which can be life threatening. Due to the fact that the majority of PIDs are autosomal recessive, they are most common in areas with high rates of consanguinity. Unfortunately, most of these areas lack the essential tools for genetic and molecular diagnosis. The implementation of affordable and rapid next-generation sequencing technology has allowed for genetic diagnosis of many patients world-wide. To date there are 354 genes associated with inborn errors of immunity1. Identifying the functional and genetic basis of these diseases has allowed the field of Immunology to discover the involvement of many genes and proteins previously thought to be unrelated to host immunity. We have identified a novel

PID due to a mutation in the γ1-COP subunit of the COPI coatomer which manifests as combined immunodeficiency (CID). This finding is the first to identify a direct link between protein trafficking and host immunity.

Protein trafficking is an essential cellular function that manages the export of newly synthesized proteins from the endoplasmic reticulum (ER) to the Golgi apparatus where they are packaged and sorted for their final destination. Before proteins leave the ER, they must be folded into secondary and tertiary structures. Several ER-resident chaperones, predominantly immunoglobulin heavy chain binding protein (BiP/GRP-78), calreticulin, calnexin and protein disulfide-isomerase (PDI) assist in protein folding and the prevention of protein aggregation of nascent proteins in the ER2. BiP functions by binding to short alternating aromatic and hydrophobic amino acid sequences which are predominantly found in nascent non-

glycoproteins3. BiP remains bound to nascent proteins until they fold, form disulfide bonds and/or tertiary structures with other subunits at which point BiP is released3. Calreticulin and calnexin are both calcium-binding lectins with specificities for monoglucosylated glycoproteins.

They both play dual roles in the ER by regulating Ca2+ homeostasis and acting as chaperones by preventing protein aggregation. PDI functions as an ER chaperone by catalyzing the formation of di-sulfide bonds during the formation of secondary and tertiary structures. Once folded, mature proteins are then transported from the ER to the Golgi via COPII vesicles where they are ultimately sorted and packaged for export4. During transport of secretory proteins from ER to

Golgi, ER chaperones and ER-resident proteins may escape to the Golgi where they bind proteins that may still be unfolded and bring them back to the ER for a second round of maturation2. The traffic back to the ER of escaped ER chaperones and ER-resident proteins is mediated by COPI dependent vesicular retrograde trafficking.

Retrograde trafficking from the cis-Golgi to the ER is mediated by COPI-coated vesicles which bind cargo and sort them into vesicles bound for the ER. COPI or coatomer, is a heptameric protein complex composed of two subcomplexes; the F complex (β, γ, δ, and ζ subunits) which is homologous to AP clathrin adaptor subunits, and the B complex (α, β’, and ε subunits)5 (Figure I.). Vesicle formation begins with the activation of cytosolic Arf1, a small

GTPase, by guanine nucleotide exchange factors (GEFs), specifically GBF16. The exchange of

GDP to GTP on ARF1 leads to a conformational change which causes Arf1 to become inserted into the membrane. Once bound, Arf1 recruits COPI proteins to the Golgi membrane by direct interaction with β, γ, and δ-COP7. In addition to binding the KDELR, along with its KDEL motif-containing cargo, COPI also binds directly to cargo proteins that contain a di-lysine or di- arginine motif at their C-terminus, and cargo proteins that associate with members of the

p23/p24 family of transmembrane proteins. Binding to Arf1 and to Golgi proteins causes rapid polymerization of COPI proteins and ultimately vesicle formation. COPI-coated vesicles that bud from the Golgi, traffic to the ER where they dock through the tethering complex, then fuse with the

ER membrane through SNAREs. The higher pH of the ER causes the COPI complex to dissociate from cargo and adapter proteins8. The COPI complex is then released from the fused vesicle membrane by the action of Arf1 GTPase- Figure I. The heptameric COPI complex and interacting proteins on the Golgi membrane. activating proteins (ARFGAPs), allowing the free COPI complex to be recruited by the Golgi for a subsequent round of vesicle formation.

Cargo destined for return from the Golgi to the ER is able to associate with COPI either through direct interactions with a COPI subunit or by way of a cargo receptor. Direct association between COPI and cargo is mediated through the recognition of di-lysine or di-arginine motifs on cargo proteins by COPI, primarily ER-resident proteins. Other ER proteins, including ER chaperones such as BiP, calreticulin, and PDI, contain the KDEL retrieval sequence in their carboxyl-terminus that allows them to bind to the KDEL-receptor (KDELR). The KDELR associates with COPI via a di-lysine containing motif in its cytoplasmic tail9. This ensures the return of escaped KDEL containing ER proteins from the Golgi to the ER where they can fulfill their duties as chaperones4. When the secretory capacity of a cell is stressed to produce and secrete a large amount of protein, the machinery within the ER, Golgi, as well as trafficking become overloaded. This increases the concentration of unfolded proteins within the ER and leads to “ER stress”9.

In order to alleviate ER stress, the unfolded protein response (UPR) has mechanisms to increase the folding capacity of the ER, downregulate the protein load in the ER, and expand the size of the ER10. The elevated levels of unfolded proteins in the ER causes BiP to dissociate from one of the three ER stress sensors it normally binds to: inostitol requiring kinase-1 (IRE1), PKR-like ER related kinase (PERK), or activated transcription factor 6 (ATF6). Each arm of the UPR offers Figure II. The three arms of the unfolded protein response. mechanisms to alleviate ER stress and effectively manage the protein-folding capacity of the ER11 (Figure II).

The IRE1 arm of the UPR has been widely viewed as the most essential arm of the

UPR. As BiP dissociates from it, IRE1 dimerizes and trans-autophosphorylates which activates its endoribonuclease domain. Once activated, the endoribonuclease domain specifically splices a

26 nucleotide intronic sequence from inactive Xbp1 mRNA which creates a stable active form commonly known as spliced XBP1 (sXBP1)12. As a transcription factor, sXBP1 then migrates to the nucleus where it upregulates the expression of many genes involved in the secretory pathway, membrane biogenesis, ER chaperones, protein synthesis, and increasing protein degradation via ER associated degradation (ERAD)13. sXBP1 has been shown to be essential for the differentiation and function of antibody secreting plasma cells14.

While the IRE1 pathway leads to molecular changes that promote the ER to manage the increased protein load, the PERK arm of the UPR aims to reduce ER stress by other means.

Similar to IRE1, PERK is activated by the release of BiP followed by dimerization and trans- autophosphorylation which activates its kinase domain15. pPERK then recruits and phosphorylates eIF2 which inhibits global protein translation thereby reducing the protein load going into the ER. One of the few mRNAs that is excluded from eIF2 inhibition is ATF4, a transcription factor that drives the expression of CHOP. Under chronic ER stress, CHOP drives the expression of the pro-apoptotic factors Bim, GADD34, and DR5, while simultaneously downregulating the expression of the anti-apoptotic factor BCL-2 which ultimately leads to apoptosis of the cell16. IRE1 also contributes to means of apoptosis during chronic ER stress by activating the ASK1/JNK pathway, which activates caspases 3 and 8 and ultimately apoptosis17.

The third arm of the UPR is mediated by ATF6, which when released from BiP translocates to the Golgi and is activated upon cleavage by the proteases S1P and S2P18. This cleavage then releases the cytosolic domain, which is then free to translocate to the nucleus and induce the transcription of foldases and Xbp112.

During the course of an infection cells of the immune system are driven to produce great amounts of antibodies and cytokines in order to clear the pathogen. T and B cells are particularly prone to ER stress during the immune response. Upon activation and differentiation into plasma cells, B cells will secrete thousands of antibodies per second19. As the lymphocyte is stimulated to produce copious amounts of these molecules the ER becomes increasingly stressed due to the influx of unfolded proteins. Activation of the UPR promotes a more efficient environment for protein folding and export. Particularly expansion of the ER, increasing the concentration of chaperones, and elevating the degree of trafficking to and from the ER20. Normally the UPR is sufficient to support the demand of T and B cells during the course of an infection. However, if

some aspect of this pathway is disrupted or malfunctioning then the cell becomes chronically stressed and can lead to impaired protein secretion and ultimately apoptosis16. T cells are particularly prone to UPR driven apoptosis during ER stress, while B cells appear to suppress apoptosis during times of ER stress. B cells, being professional secretory cells, suppress the

PERK arm of the UPR thereby preventing their susceptibility to apoptosis21. This biological safety mechanism allows for B cells to continue to function as their ER protein load increases.

Contrary to B cells, T cells activate the PERK pathway during times of ER stress and due to their expression of Bim, are especially susceptible to apoptosis. Interestingly, CD4+ T cells are more prone to CHOP induced apoptosis than CD8+ T cells due to their reduced expression of the anti- apoptotic factor BCL222. Before T cells become chronically stressed, the PERK arm of the UPR reduces protein translation via eIF2 and CHOP in an attempt to decrease the amount of proteins going into the ER. One of the proteins suppressed by CHOP is the IL4-R, which is particularly important for B cell class switching to IgG1 and IgE, as well as the allergic Th2 response in

CD4+ T cells23. It has been previously shown that IL4-R is specifically downregulated on anti- viral CD8+ T cells in order to improve their anti-viral capacity during chronic viral infection24.

We hypothesize that a mutation in γ1-COP identified in a family with CID results in impaired retrograde trafficking and ultimately an impaired ER stress response. Mutations in other subunits of coatomer have been previously reported. Variants in the  subunit have been associated with what is known as COPA syndrome. This has been characterized by autoimmune disease (auto-antibodies, arthritis, and interstitial lung disease) driven by Th17 skewing which is known to be promoted by ER stress25. There have also been reports of mutations in δ-COP which present with a craniofacial syndrome26. However, immune deficiency has not been noted in either COPA syndrome or in patients with mutations in δ-COP. The degree to which the

mutations in the -COP and δ-COP subunits in these patients impair COPI trafficking has yet to be determined and may not be severe enough to impair the immune response. Here we show that a mutation in the γ1-COP subunit of COPI leads to impaired retrograde trafficking, elevated ER stress, and ultimately an impaired immune response. This work identifies a mutation in γ1-COP as a novel cause of primary immunodeficiency and illustrates how ER stress could play a role in the genesis of PID.

Chapter 2: Data and Methods

A family of 5 Omani siblings was referred to the International Constortium of Primary

Primary Immunodeficiencies (ICID) based at Boston Children’s Hospital. The patients were born to consanguineous parents and presented with recurrent pneumonias, CMV and EBV viremia, hepatitis, and failure to thrive. Upon an immunological work-up, the first child of the family at the age of 4 years showed hypogammaglobulinemia and T cell lymphopenia, with profound lymphopenia in the CD4+ T cell subset. IVIG treatment was administered to all subsequent siblings soon after birth. While IgG production was diminished, B cell numbers were normal.

Our group at Boston Children’s Hospital accepted to study this case with the hopes to identify the genetic and functional mechanism of the disease in order to formulate the best possible treatment for these children.

Materials and Methods

WES

Ten micrograms of genomic DNA were isolated from peripheral blood samples using the Gentra

Puregene blood kit (QIAGEN), as per kit protocol. WES of two patients and the mother was performed with an Illumina HiSeq-2000. The paired-end Illumina libraries were captured in solution according to the Agilent Technologies SureSelect protocol with 101-bp read length. The sequence data were mapped to the human reference genome (hg-19, NCBI37) using the

Burrows–Wheeler Alignment method at default settings. Variants were identified with the

Genome Analysis Toolkit, SAMtools, and Picard Tools (http://broadinstitute.github.io/picard/).

Variants with a read coverage <2 times or Phred-scaled, single-nucleotide polymorphism quality

<20 were discarded.

Sanger

Sanger sequencing was used to validate the missense mutation in the COPG1 gene identified by

WES in the affected patients. Amplification and sequencing primers were made to amplify this sequence in the COPG1 gene (Fp: 5′- CATATCTATCCATCTAAGGTAGG -3′, Rp: 5′-

CACCTCTTTCCTATTGACCAAG -3′, SFp: 5′- CTGTGGATTTCAGAGCAGTTG -3′, SRP:

5′- TTCTGTCATCAAGTTGGGCTC -3′).

Immunoblotting

Cultured skin fibroblasts or B cells were homogenized in PBS that contains 30mM Tris-HCl pH

7.5, 120mM NaCl, 2mM KCl, 1% Triton X-100 and 2mM EDTA supplemented with a protease inhibitor (Roche). Proteins were separated by electrophoresis on 4-15% precast polyacrylamide

gels (Bio-Rad) and were transferred to 0.45μm nitrocellulose membrane (Bio-Rad). Membranes were blocked in a 1x solution Tris-Buffered Saline/Tween 20 (TBST) with 5% nonfat dry milk for one hour at room temperature and then incubated overnight at 4°C with the specified primary antibody. Primary antibodies were used as follows: γ-COP (Santa Cruz, sc-30092), -COP

(Abcam, 2899), -Actin (Cell Signaling, 3700), BiP (Cell Signaling, 3177). Antigen-antibody complexes were visualized with peroxidase-conjugated secondary antibodies (GE Healthcare) and ECL Western blotting substrate (Pierce). Densitometry of immunoblots was done using the

ImageJ analyzer software (1.48v).

VSVG-KDELR Colocalization with Giantin

Courtesy of Dr. Victor Hsu:

Patient and healthy control fibroblasts were transfected with VSVG-ts045-KDELR to measure retrograde transport. In order to accumulate a synchronized pool of VSVG at the ER, cells were incubated at 40°C for 2 h. Decreasing the temperature to 32°C allowed for the transport of the

VSVG-ts-KDELR chimeric protein from the ER to the cis-Golgi. Transport was quantified by measuring (Metamorph) the colocalization of the cargo, VSVG-ts045-KDELR, with the cis-

Golgi marker, Giantin, over time27.

Generation of COPG1K652E mice sgRNA design was facilitated though the CRISPR Design tool (crispr.mit.edu) to minimize off- target effects. A guide was selected that was predicted to generate a double stranded break 4 nucleotides from the intended c.1954A>G p.K652E mutation. A 160 bp repair template was

designed that included the c.1954A>G mutation as well as synonymous c.1944C>T change in the protospacer adjacent motif to prevent repair template-targeting by the CAS9 nuclease.

Zygotes were microinjected as previously described with CAS9 mRNA (System Biosciences), a single-stranded repair template oligo (PAGE Ultramer from Integrated DNA Technologies), and the sgRNA28. For sgRNA synthesis, the T7 promoter sequence was added to sgRNA template/forward primer and the IVT template generated by PCR amplification. The T7-sgRNA

PCR product was purified and used as the template for IVT using MEGAshortscript T7 kit (Life

Technologies). The sgRNA was purified using the MEGAclear kit (Life Technologies). Aliquots from an IVT reaction were separated on agarose gel to assess reaction quality.

GST Pull-down

Courtesy of Dr. Victor Hsu:

GST fusions were expressed in bacteria (BL21 cell) with ITPG induction. After lysis in buffer

(20 mM Tris, pH 8.0, 100 mM NaCl, 1 mM EDTA, 1% Triton X-100, 1 mg ml−1 of lysozyme and protease inhibitor), GST peptide was incubated with glutathione Sepharose beads (GE

Healthcare). GST fusions on beads were then incubated with purified coatomer (2.5 nM) at 4 °C for 1 h in incubation buffer (25 mM HEPES, pH 7.2, 50 mM KCl, 2.5 mM magnesium acetate and 0.5% NP-40). For competition experiments with peptides, GST fusions on beads were co- incubated with coatomer and peptide at 4°C for 1 h in incubation buffer. Beads were then rinsed twice with incubation buffer and then analyzed by SDS–PAGE followed by immunoblotting or

Coomassie staining. Quantification was performed by analyzing the level of coatomer and normalizing for the level of cargo on beads27.

FLIM

Courtesy of Dr. Victor Hsu:

Interactions between WT or mutant COPI with ARFGAP1 and KDELR were monitored using time-correlated single-photon counting fluorescence lifetime image microscopy analysis

(TCSPC–FLIM) as previously described by Park et al. 201527. In brief, ARFGAP1 and KDELR were detected through the Myc tag appended at the C terminus using an anti-Myc antibody. This antibody was then detected with a secondary antibody conjugated to Alexa Fluor 594 (acceptor fluorophore). Coatomer was detected with the anti-coatomer antibody. This antibody was then detected with a secondary antibody conjugated to Alexa Fluor 488 (donor fluorophore). The baseline lifetimes of the donor fluorophore were calculated by single-exponential decay fitting of fluorescence emission in the absence of the acceptor fluorophore. For samples that involved staining for both donor and acceptor, lifetimes were fitted to a bi-exponential decay with lifetime of one component fixed to the donor-only lifetime. Three variables for FLIM were determined:

(1) lifetime for the interacting fraction, τ1, (2) lifetime for the non-interacting fraction, τ2, and

(3) the percentage of interacting molecules, a1 (%)27.

Cell stimulations

Cells were stimulated with the described amount of the following cytokines and/or agonists: LPS

(InvivoGen), rmIL-4 (Miltenyi), CD3/CD28 Dynabeads (ThermoFisher) in RPMI supplemented with 10% fetal bovine serum, 50,000 IU penicillin, 50,000 μg streptomycin, 10 μM HEPES, and

2 mM Glutamine. Splenic B and T cells were isolated using the CD43 (Ly48) or Pan T cell microbeads (Miltenti), respectively. B cells were then seeded at 500,000 cells/mL in 5 mL culture tubes and were then stimulated at 37°C for 72 h with LPS (10 µg/mL), and rmIL-4 (50

ng/mL). Supernatants and cells were collected and stored at −80°C for future analysis or stained for FACS. T cells were seeded at 1,000,000 cells/mL in 5 mL culture tubes and were then stimulated at 37°C for 5 days with CD3/CD28 Dynabeads (bead-to-cell ratio of 1:1). The beads were magnetically removed on day 5 and were rested for 24 hours at 37°C. On day 6 the T cells were re-stimulated for 24-72 hours with CD3/CD28 Dynabeads (bead-to-cell ratio of 1:1).

Supernatants and cells were collected and stored at −80°C for future analysis or stained for

FACS.

Gene Expression Analysis

Before and after stimulation, mRNA was extracted from B and T cells using RNeasy Mini kit

(QIAGEN) and was reverse-transcribed with the iScript cDNA synthesis kit (Bio-Rad

Laboratories). The expression of the ER stress proteins: Xbp1, sXbp1, Chop, BiP, and IgG1 germline and mature transcripts were measured using quantitative PCR (qPCR) in Power SYBR

Green Master Mix (Thermo Fisher Scientific). The expression of these genes was analyzed using the 2-ΔΔCT method in comparison to the housekeeping gene Hprt. The following primers were used: Xbp1- (Fp: 5′- TCCGCAGCACTCAGACTATG -3′, Rp: 5′-

ACTTGTCCAGAATGCCCAAA -3′), sXbp1- (Fp: 5′- CTGAGTCCGCAGCAGGTG -3′, Rp:

5′- ACTTGTCCAGAATGCCCAAA -3′), Chop- (Fp: 5′- CTGCCTTTCACCTTGGAGAC -3′,

Rp: 5′- CGTTTCCTGGGGATGAGATA -3′), Bip- (Fp: 5′-

CATGGTTCTCACTAAAATGAAAGG -3′, Rp: 5′- GCTGGTACAGTAACAACTG -3′),

Germline IgG1 - (Fp: 5′- CTCTGGCCCTGCTTATTGTTG -3′, Rp: 5′

GGCCCTTCCAGATCTTTGAG -3′), Mature IgG1 - (Fp: 5′- CTCTGGCCCTGCTTATTGTTG

-3′, Rp: 5′ GGATCCAGAGTTCCAGGTCAC -3′), Hprt - (Fp: 5′-

TTGCTGGTGAAAAGGACCTC -3′, Rp: 5′ GCGCTGATCTTAGGCTTTGT -3′). The expression of Il4 (Mm00445259_m1) and Ifng (Mm01168134_m) relative to Hprt

(Mm03024075_m1) were measured using quantitative PCR (qPCR) in a TaqMan Gene

Expression assay (Applied Biosystems).

ELISA

Supernatants from stimulated B cells were analyzed for BiP secretion using the Grp78/BiP

ELISA kit (Enzo), IgG and IgG1 secretion (Southern Biotech). Serum samples from mice were analyzed for basal levels of IgG, IgA, and IgM (Southern Biotech). T cells were analyzed for IL-

4 and IFN-γ secretion (Biolegend). Serum samples from mice which were immunized with either

TNP-KLH, NP-KLH, or TNP-Ficoll were analyzed for either TNP or NP specific antibodies.

Serum samples were added to plates coated with either 10 µg/mL of TNP(25)-BSA or NP(8)-

BSA (BioSearch Technology).

FACS

Standard flow cytometric methods were used for the staining of cell-surface and intra-cellular proteins. Anti-mouse mAbs to the following molecules with the appropriate isotype-matched controls were used for staining: Zombie Aqua Fixable Viability Dye (Biolegend: 77143),

B220/CD45R (ThermoFisher: 47-0452-82), CD138 (Biolegend: 142525), ER-Tracker Green

(ThermoFisher: E34251), CD4 (Biolegend: 100428), CD8 (eBioscience: 17-0081-81), Annexin

(eBioscience: 46-8008-69), GL7 (eBioscience: 53-5902-80), FAS/CD95 (eBioscience: 12-0951-

83), PD1/CD279 (eBioscience: 11-9985-82), CXCR5/CD185 (eBioscience: 13-7185-82),

Streptavidin (eBioscience: 12-4317-87), F4/80 (Biolegend: 123108), Ly6G/GR-1 (Biolegend:

108406), NP (Biosearch: N-5070-1), IgD (Biolegend: 405712), and CD79a (Biolegend: 133105).

For intracellular staining experiments, cells were permeabilized and fixed using the BD

Phosflow Lyse/Fix Buffer and Phosflow Perm Buffer III (BD biosciences) and subsequently stained with IL-4 (Biolegend: 504131), and IFNγ (ThermoFisher: 48-7311-80). All flow cytometry data was collected with an LSR Fortessa (BD Biosciences) cell analyzer and analyzed with FlowJo software (Tree Star).

Immunizations

Specific antibody responses to immunization were studied by immunizing 8-12-week-old

COPG1K652E and WT (C57BL/6) mice i.p. with 10 µg TNP-KLH (Biosearch Technologies), or

25 µg TNP-ficoll (Biosearch Technologies), or 100 µg NP-KLH (Biosearch Technologies) emulsified in Alhydrogel (Invivogen). Blood was collected from mice via retro-orbital bleed at the time of immunization and 14 days after the initial immunization. NP-specific B cell studies were performed on 8-12-week-old COPG1K652E and WT (C57BL/6) which were injected via the hock with 80 μg of NP-KLH in Alhydrogel. Mice were then sacrificed on day 8 and popliteal lymph nodes were harvested and stained for FACS as previously described by Todd et al. 2009.

Histology

8-12-week-old COPG1K652E and WT (C57BL/6) mice were injected in hocks with 80 µg NP-

KLH (Biosearch Technologies) emulsified in Alhydrogel (Invivogen). Mice were sacrificed on day 7 and popliteal lymph nodes were harvested. LN morphology and expression of specific markers was assayed by both routine H&E staining and immunohistochemistry for peanut agglutinin (PNA) and B220 using 2 µm thick formalin fixed paraffin embedded LN sections.

Results

The five affected siblings involved in this study were born to first cousin parents and presented with recurrent pneumonias due to H. influenzae and S. pneumoniae (Fig. 1A). In addition, they all suffered from CMV and EBV viremia, hepatitis, and failure to thrive at a young age. The eldest sibling, Patient 1, had hypogammaglobulinemia on presentation at age 4 yrs which was treated with supplemental IVIG. In a proactive effort, the referring physician treated all subsequent siblings with IVIG shortly after birth. All other siblings developed similar symptoms and infections as Patient 1 including severe CD4+ T cell lymphopenia. The youngest sibling had normal numbers of CD4+ T cells at birth, then developed CMV viremia and CD4+ T cell lymphopenia at the age of 9 months. Despite a clear defect in humoral immunity B cell numbers were normal in all patients, and switched memory B cells were low in only 1 of 3 patients investigated (Table 1).

Table 1. Immunologic profile of patients.

In order to identify the genetic cause of this disease, whole exome sequencing was performed on two of the affected siblings and their mother. 6 non-synonymous mutations were identified which were homozygous in all patients and heterozygous in the mother, but absent from any public or in-house SNP databases. Autozygosity mapping was then used to narrow the candidate genes to one genetic loci. This revealed a shared region of homozygosity in three of the patients located on chromosome 3 (126611300-134019500). One candidate variant was identified within this region, COPG1 (c.A1954G:p.K652E), which encodes the γ1-COP subunit of the COPI coatomer. Sanger sequencing of each family member revealed homozygous

COPG1K562E mutations in the 5 affected siblings and heterozygous mutations in both parents

(Fig. 1B).

The K652 residue is located within the appendage domain of γ1-COP and is highly conserved. Crystal structure of γ1-COP reveals that the K652 residue acts as a bridge between the N- and C- termini of the appendage domain. Structural modeling predicted that mutating this residue to E652 disrupts two potential bonds: a salt bridge with the carboxyl side chain of D762 and a potential hydrogen bond with the main chain carbonyl oxygen of E757 (Fig. 1C). This would ultimately alter the orientation of the two sub-domains and we predict this would lead to impaired function of the COPI coatomer.

We next investigated the effect of the K652E mutation on γ1-COP protein expression and function. Immunoblotting with an antibody to γ-COP (which detects both isoforms of γ-COP: γ1-

COP and γ2-COP) revealed comparable expression of γ1-COP in fibroblasts from patients and controls (Fig. 1D). The ability of the K652E mutant to integrate in the COPI complex was studied by comparing the ability of WT and mutant γ1-COP to co-precipitate with the β-COP subunit. Co-precipitation of γ1-COP with β-COP was comparable in patients to controls (Fig.

10 20 30 40 50 GGG G G G G AAGG T C GC GG T C T T G G GCC CC T C T T CAA GT CC T C GCC T G AGCC C GT GG

60 70 80 90 100 110 C CCTT CA C C GAG T CA GA GAC GG AGT AT GT CA T C C GC T GCA C CA A A CA CA C C T T CA C CA A C C 1E). This indicates that the mutant γ1-COP can integrate into the COPI complex.

A. B. Control Parent Patient

G C A C C A A A C A C G C A C C A A A C A C G C A C C G A A C A C G C A C C A A A C A C G C A C C G A A C A C G C A C C G A A C A C Affected

Carrier

Deceased

D. ControlsPatients 120 130 140 150 160 12123 170 CA CA T GGT T T T T CA G GT GA GC A A G GT G G GC T GA G GC C C T GC T GGG GC A T GC GC C C A G GG γ1-COP C. γ2-COP

1 Clathrin/Coatomer Adaptor Appendage C-Terminal 873 β-Actin 25 538 612 759 761

K652E

γ1-COP Appendage Domain

E. 5% of input IP β-COP IP IgG CtlPt 2 Ctl Pt 2 CtlPt 2

γ1-COP γ2-COP

β-COP

Figure 1. COPG1K652E mutation identified in siblings from a consanguineous family with

CID characterized by progressive CD4+ lymphopenia.

COPI’s main function of retrograde protein trafficking from the cis-Golgi to the ER was

then tested. Patient fibroblasts were transfected with chimeric VSVG-ts-KDELR, a temperature

sensitive form of vesicular stomatitis virus G protein in which the lumenal portion is fused to the

N-terminus of the KDELR (essential for COPI binding). At 32 OC the VSVG-ts-KDELR

chimeric protein traffics from the ER to Golgi and then back to the ER in a cyclic fashion.

Changing the temperature from 32OC to 40OC causes the lumenal VSVG domain to misfold and

prevents additional anterograde transport from the ER so that retrograde transport from the Golgi

to the ER can be measured (Fig. 2A). Colocalization of VSVG-ts-KDELR with the cis-Golgi marker, Giantin, was measured for one hour after temperature shift. After one hour, the colocalization in control fibroblasts declined to approximately 10 %, compared to 20 % in patient fibroblasts (Fig. 2B). The significant difference in colocalization of VSVG-ts-KDELR and Giantin suggested a defect in COPI-mediated retrograde protein trafficking of the KDELR due to the K652E variant.

Further studies were essential to understand the mechanism linking impaired protein trafficking and immune dysregulation. Unfortunately, the family did not consent to many research studies which indicated the need for a mouse model of this disease. CRIPSR/Cas9 was used to generate a homozygous Copg1K652E mutant mouse. The mice develop normally and have normal T and B cell development in the thymus and bone marrow, and normal numbers of splenic CD3+, CD4+, CD8+ and B220+ B cells, MZ B cells, peritoneal B1 cells and NK cells

(data not shown). The distribution of naïve (CD44loCD62Lhi) and memory (CD44hiCD62Llow) subsets among CD4+ and CD8+ T cells was normal in the mutant. MEFs derived from these mice revealed a similar defect in retrograde trafficking of VSVG-ts-KDELR as the patient fibroblasts

(Figure 2B). The interaction of the COPI complex with the KDELR was studied using COPI isolated from the livers of the WT and mutant mice. We examined the ability of proteins known to interact with COPI to bind mutant and WT COPI. To this purpose we examined the ability of

GST fusion proteins that contained KDELR, Wbp1, which binds to -COP, and ARFGAP1, which binds to δ-COP, to pull down COPI complex by western blotting for -COP. GST-

KDELR pulled down -COP from WT but not mutant COPI indicating that the K652E mutation impaired KDELR binding to COPI (Fig. 2C). GST-Wbp1 and ARFGAP1 interacted normally with mutant COPI as evidenced by their normal ability to pull down comparable amounts of -

COP after incubation with mutant or WT COPI (Fig. 2C). The selectively impaired ability of mutant COPI to associate with the KDELR was confirmed in cells using fluorescence lifetime imaging microscopy (FLIM) where mutant COPI had significantly less KDELR colocalization, but comparable colocalization with ARFGAP1 compared to WT COPI (Fig. 2D). These results suggest that the K652E mutant selectively disrupts COPI binding to the KDELR and thereby impairs the return of KDEL motif containing ER chaperones to the ER which could cause ER stress and impair T and B cell function during an infection.

Lumen A. H2N C. KDELR WT COPIMut COPI CO2H Cytosol

VSVG-ts-KDELR VSVG-ts- Input GST KDELR Wbp1 ARFGAP1 KDELR Wbp1 ARFGAP1 Cytosol ER/Golgi βCOP Lumen 32oC 40oC

Golgi GST-peptides VSVG- KDELR

VSVG- KDELR E.R

B. D. Human Fibroblasts MEFs

Control WT

Patient Mutant *** *** ***

Figure 2. The COPG1K652E mutation impairs retrograde protein trafficking and association with the KDELR.

We specifically investigated the status of the KDEL motif-containing ER chaperone,

GRP78/BiP in mutant B cells. BiP mRNA levels in LPS/IL-4 stimulated B cells were increased in mutant B cells compared to WT B cells, but the protein levels of BiP were comparable (Fig.

3A). This suggests that a greater amount of BiP was being lost/degraded in mutant cells.

Analysis of the supernatants revealed that BiP was not secreted at significantly higher levels by mutant B cells (Fig. 3B). Current experiments are being performed to measure BiP levels in the insoluble versus soluble fractions to determine the concentration of BiP in the cytosol and in the

Golg/ER, as well as to measure BiP levels in ER and Golgi fractions. Impaired return of BiP to the ER would increase the concentration of unfolded proteins which would cause ER stress and activate the unfolded protein response (UPR). The activation of the three arms of the UPR was investigated in mutant B cells after LPS/IL-4 stimulation. The relative mRNA expression of

Xbp1, sXbp1 were both significantly increased, while Chop expression was down regulated in both WT and mutant (Fig. 3C). Another response of the UPR is to drastically increase the size of the ER in order to maintain sufficient space for protein folding. Mutant B cells had impaired expansion of their ER, both at baseline and after stimulation (Fig. 3D). Impaired ER expansion in addition to reduced return of KDELR-containing chaperones due to mutant γ1-COP could be causing a functional defect in mutant B cells.

Figure 3- COPG1results in impaired binding of COPI to KDELR, mislocalized BiP, and ER collapse

A. Bip B.

Genotype: WTKI WTKI LPS/IL-4: -- ++

BiP

Β-actin **

WT COPG1K652E C. Xbp1 sXbp1 Chop **

D. Unstimulated LPS/IL-4 *** *** WT WT

COPG1K652E COPG1K652E

Figure 3. COPG1K652E results in increased ER stress and impaired ER expansion in stimulated B cells.

B cell proliferation and differentiation into plasmablasts after LPS/IL-4 stimulation was normal in mutant B cells (data not shown), while immunoglobulin secretion was significantly impaired, both IgG and IgG1, after 3 days of stimulation (Fig. 4A). The germline and mature transcript of IgG1 were all found in comparable levels to WT (Fig. 4B). This confirms that this defect in immunoglobulin production is due to a defect in secretion rather than switching and/or mRNA expression. Copg1K652E mutant mice had decreased basal serum IgG, yet normal IgA and

IgM levels which are synthesized in much lower quantities than IgG (Fig. 4C). Upon immunization with either T-independent (TNP-Ficoll) or T-dependent antigens (TNP-KLH or

NP-KLH), mutant mice had an impaired specific-antibody response (Fig. 4D). Copg1K652E mutant mice also had impaired antigen specific B cell and plasma cell percentages compared to

WT after NP-KLH immunization (Fig. 4E). Further investigation revealed that mutant mice had impaired germinal center (GC) formation, associated with reduced GC B cells, but normal T follicular helper cell percentages after T-dependent immunization (Figs. 4F and G). The impaired humoral response that is seen in the mutant mice can be attributed to the impaired ability of B cells to properly differentiate into GC B cells and form germinal centers, thus reducing the amount of antigen-specific B cells and immunoglobulins in response to immunization.

A. B. C. * * ***

D. E. TNP-Ficoll TNP-KLH NP-KLH ** * ** * *

F. G. * * WT COPG1K652E

PNA

B220

Figure 4: Mutant γ1-COP causes impaired B cell function.

All of the affected patients had viremia due to CMV and/or EBV, the clearance of which is mediated by effector T cells. In order to replicate a chronic in vivo stimulation as seen by viral infection, we stimulated mutant T cells in vitro for two cycles with anti-CD3/CD28 beads for 5 days followed by a 24-hour rest in between cycles (Fig. 5A). The numbers of viable and dividing

CD4+ cells, but not CD8+ T cells, were reduced in Copg1K652E mutant T cells after repeated stimulation (Fig. 5B, C). There was an apparent defect in IL-4 secretion, while IFNγ, IL-2, and

IL-17A secretion was comparable to WT (Fig. 5D and data not shown). The numbers of viable

CD4+IL4+ cells and CD4+INFγ+ cells on day 6 were both reduced by ~30% when compared to the profile of WT T cells (data not shown). This finding indicates that impaired IL-4 production in the Copg1K652E mutant T cells is not due to selective Th2 cell death. In order to determine if this defect is due to a secretion defect similar to what was seen in mutant B cells, we measured the Il4 and Ifng mRNA expression in stimulated T cells. Interestingly, Il4, but not Ifng mRNA expression was significantly decreased in mutant T cells, which indicates that this defect is occurring at the transcriptional level as opposed to a secretion defect (Fig. 5E). We found mutant

T cells to have reduced ER mass and significantly higher Chop mRNA expression compared to

WT (Fig. 5F and G). This increase in CHOP in mutant T cells could be causing the decrease in

CD4+ T cell viability as CD4+ T cells have less Bim expression compared to CD8+ T cells, thus making them more susceptible to CHOP induced apoptosis23. Furthermore, increased CHOP expression may underlie the decreased expression of IL-4 in mutant T cells because CHOP is a transcriptional repressor and has been shown to downregulate Il4ra expression and thereby Il4 expression23.

Figure 5- COPG1leads to impaired T cell survival and function A. B. Day:1 – 5 5 - 6 7 - 9 α-CD3 + α-CD28 Rest in media

C. Sample Name Subset Name Count Sample Name Subset Name Count 100 + 100 + 100 CD4 100170913_TC_CTV_WT_1_Day 6.fcs CD4+CD8 873 170913_TC_CTV_WT_1_Day 6.fcs CD8+ 12409 170913_TC_CTV_COPG_1+3_Day 6.fcs CD4+ 275 170913_TC_CTV_COPG_1+3_Day 6.fcs CD8+ 15608 80 80 WT e e d d o o M

M 60

60 o K652E n.s. o

T COPG1

T 60 60

d d e e z ** i z l i l a

a 40 m

40 r m r o o N N

% of % Max of 20 2020 20

0 0 3 3 4 5 3 3 4 5 -10 0 10 10 10 -10 0 0 10 3 10 4 10 5 0 3 4 5 10 10 10 10 10 10CellTrace Violet10 10 CellTrace Violet CTV Stimulation: - + - + CD4+ CD8+ D. E. Xbp1 sXbp1 ** n.s.

Chop F. Unstimulated Stimulated *

WT WT

COPG1K652E COPG1K652E

Figure 5: COPG1K652E leads to impaired T cell survival and function following repeated stimulation.

The overall mechanism of the disease, defective COPI mediated KDELR dependent retrograde trafficking leading to ER stress and impaired function in both T and B cells, led us to explore therapeutic options that could recover the lost immune function. Tauroursodeoxycholic acid (TUDCA), a hydrophobic bile acid that is currently FDA approved for treating biliary cirrhosis as well as some cholestatic liver diseases, has been shown to act as an ER stress inhibitor. As a chemical chaperone, TUDCA binds to unfolded proteins and prevents nascent protein aggregation and thereby reduces ER stress29. We attempted to ameliorate the increased

ER stress levels found in our mutant mice by treating B cells in vitro with TUDCA. Treatment

with TUDCA ameliorated the mutant’s ability to secrete IgG, secreting levels comparable to those of the WT (Fig. 6A). Furthermore, TUDCA completely rescued the ability of mutant B cells to expand their ER (Fig. 6B). This finding identifies a potential therapeutic treatment to recover lost B cell function due to elevated ER stress not only in our mutant mice, but also the patients suffering from this combined immunodeficiency. Figure 7- The chemical chaperone, TUDCA, ameliorates mutant T and B cell function

ns **

Figure 6: The ER stress inhibitor, TUDCA, rescues IgG secretion and ER expansion in B cells.

We have identified a novel cause of primary immunodeficiency caused by a mutation in the γ1-COP subunit of the COPI coatomer in a family with CID. Functional investigation demonstrated that the K652E mutation in γ1-COP resulted in delayed retrograde protein

trafficking and abolished COPI association with the KDELR which ultimately may be causing the mislocalization of KDEL-containing ER chaperones, inducing ER stress in activated B and T cells. Immunized Copg1K652E mice had an impaired ability to generate germinal centers as well as antigen specific immunoglobulins. Likewise, mutant B cells stimulated in vitro with LPS/IL-4 revealed impaired immunoglobulin secretion and reduced ER mass. Upon repeated in vitro stimulation, T cells isolated from Copg1K652E mice displayed reduced CD4+ T cell viability and proliferation as well as a transcriptional block in IL-4 production and secretion. Further investigation into the UPR revealed reduced ER mass and increased mRNA expression of Chop which could be the cause of reduced CD4+ T cell viability. In an attempt to find a therapy for this disorder, we found that the chemical chaperone, TUDCA, was sufficient to recover the defects identified in B cells in vitro. These results in Copg1K652E mutant mice display defects very similar to those that are seen in the patients affected by this disease, and we have identified a potential therapeutic to recover their lost immune function. We plan to continue to investigate the effects of TUDCA in the mutant mice in vivo and bring this finding to the patient’s clinical care, ultimately giving them a better chance to persevere through their disease.

Chapter 3: Discussion and Perspectives

The field of primary immunodeficiencies offers the opportunity to identify not only novel causes of disease, but also novel functions of proteins and mechanisms previously not known to be associated with host immunity. Over the past decade the advent of affordable and accessible next-generation sequencing has propelled the momentum of identifying novel genetic causes of

PID. Through global collaborations, the patient base of PIDs has drastically expanded and has offered hope of diagnosis to many suffering patients, while also advancing the field of PID and

Immunology as a whole. As technology continues to advance and the knowledge of the investigators grows, so does the phenotypic spectrum of new born errors of immunity1. The line of PID classification continues to expand and cross between phenotypes and pathways, making the investigation more complicated but also more rewarding. In conjunction with the developing knowledge of Immunology, the current surge in genetic manipulation by CRISPR/Cas9 offers a great hope for patients with PID. An affordable, faster, and most importantly, safer, technology will most likely be used to correct the genetic defect in these patients. I believe that the field of

PIDs will continue to unlock novel mechanisms of disease while identifying disease specific therapies which will offer these patients the least invasive, yet most effective treatment possible.

This project opened up many windows into the potential mechanism of PID to myself and other members of the lab. We strove to dig as far as possible into the molecular biology, biochemistry, and medicine to find the most thorough understanding of the disease. While this complex disorder offered many mysteries, it was up to us to learn new pathways, systems, and techniques which caused there to be a few short comings in this study. In particular, the lack of many in vivo studies is an area where we plan to do more work. We wished to understand the

molecular and immunological dysfunctions prior to leaping into large and costly in vivo studies. I also feel that there are other aspects of the mechanism that we have yet to uncover.

Due to a lack of time, there are still many experiments that I wish to perform to further dissect this mechanism of disease. For example, we are currently trying to replicate the patient’s chronic viral infections by performing an in vivo LCMV cl.13 infection in the Copg1K652E mutant mice. We suspect that the mutants will have an impaired ability to clear the virus at the chronic stage of infection and will develop CD4+ T cell lymphopenia and hypogammaglobulinemia similar to the affected patients. Siggs et al. found impaired viral clearance in a KDELR1 mutant mouse model, which suggests a similar model of disease30. Supplementing these infections, we will treat a subset with TUDCA and determine if its effects on recovering immune function can be replicated in vivo as they did in vitro. This experiment would give us more confidence that

TUDCA therapy could potentially ameliorate our patient’s immune dysregulation.

In addition, I would like to prove that BiP and other KDEL-containing ER chaperones are mislocalized to the cis-Golgi. We would investigate this phenomenon in two ways: one being confocal microscopy, the other being subcellular fractionation followed by immunoblotting.

Confocal microscopy could provide us with the evidence that BiP is predominately associated with the cis-Golgi by measuring the association between fluorescently labeled BiP with a cis-

Golgi marker. In order to have a more quantifiable cellular localization, we would perform subcellular fractionation using digitonin to separate the ER fraction from the total cell lysate.

Numata et al. identified a mechanism of disease quite similar to our proposed mechanism. They showed that a missense mutation in the gene PLP1 caused the mutant protein to misfold and

accumulate in the ER which led to mislocalization of ER chaperones. In an attempt to further explain the mechanism, they showed that blocking COPI-mediated retrograde trafficking with brefeldin A also led to mislocalization of ER chaperones in the cis-Golgi and elevated levels of

ER stress31. We could take this study a step further and isolate the Golgi and probe it for BiP protein expression in order to have complete confidence that the BiP is accumulating in the cis-

Golgi instead of returning to the ER.

Another interesting finding that goes unexplained is the impaired ability of mutant B and

T cells to expand their ER mass upon activation. While COPI has a role in the formation of lipid droplets, it is unknown whether this defect is caused by a lack of lipid synthesis/manipulation by

COPI or if COPI is responsible for returning fragments of Golgi membrane to the ER in addition to returning ER chaperones32. This additional function of COPI would suggest an otherwise unknown method of ER expansion driven by COPI-mediated retrograde trafficking.

I would like to further investigate this relationship between ER stress and immune dysregulation. There are many unidentified PIDs which present with phenotypes of hypogammaglobulinemia and CD4+ T cell lymphopenia similar to what is seen in the patients presented here. This sparked the hypothesis that there are probably a group of PIDs caused by a defective unfolded protein response and an impaired ability to control ER stress. In addition to these “ER-opathies” there are also more disorders associated with protein trafficking and immunity. Watkin et al. identified COPA syndrome as being the cause of autoimmune lung disease and arthritis in five families which was associate with impaired protein trafficking and elevated levels of ER stress25. A direct correlation between the defect in trafficking and the

severity of disease could be potentially observed when comparing the phenotypes of the COPA and COPG patients. I feel that the work in this dissertation and the above proposed experiments will further the association of CID with protein trafficking and ER defects, potentially opening yet another spectrum of PIDs.

Bibliography

1. Picard, C. et al. International Union of Immunological Societies: 2017 Primary

Immunodeficiency Diseases Committee Report on Inborn Errors of Immunity. J. Clin.

Immunol. 38, 96–128 (2018).

2. Zhang, J. X., Braakman, I., Matlack, K. E. & Helenius, A. Quality control in the

secretory pathway: the role of calreticulin, calnexin and BiP in the retention of

glycoproteins with C-terminal truncations.Mol. Biol. Cell 8, 1943–54 (1997).

3. Blond-Elguindi, S. et al. Affinity panning of a library of peptides displayed on

bacteriophages reveals the binding specificity of BiP. Cell 75, 717–28 (1993).

4. Munro, S. & Pelham, H. R. A C-terminal signal prevents secretion of luminal ER

proteins. Cell 48, 899–907 (1987).

5. Futatsumori, M., Kasai, K., Takatsu, H., Shin, H. W. & Nakayama, K. Identification and

characterization of novel isoforms of COP I subunits. J. Biochem. 128, 793–801 (2000).

6. Yu, X., Breitman, M. & Goldberg, J. A structure-based mechanism for Arf1-dependent

recruitment of coatomer to membranes. Cell 148, 530–42 (2012).

7. Watson, P. J., Frigerio, G., Collins, B. M., Duden, R. & Owen, D. J. Gamma-COP

appendage domain - structure and function.Traffic 5, 79–88 (2004).

8. Beck, R., Rawet, M., Ravet, M., Wieland, F. T. & Cassel, D. The COPI system:

molecular mechanisms and function. FEBS Lett. 583, 2701–9 (2009).

9. Capitani, M. & Sallese, M. The KDEL receptor: new functions for an old protein. FEBS

Lett. 583, 3863–71 (2009).

10. Todd, D. J., Lee, A.-H. H. & Glimcher, L. H. The endoplasmic reticulum stress response

in immunity and autoimmunity.Nat. Rev. Immunol. 8, 663–74 (2008).

11. Wang, M. & Kaufman, R. J. Protein misfolding in the endoplasmic reticulum as a conduit

to human disease. Nature 529, 326–35 (2016).

12. Yoshida, H., Matsui, T., Yamamoto, A., Okada, T. & Mori, K. XBP1 mRNA is induced

by ATF6 and spliced by IRE1 in response to ER stress to produce a highly active

transcription factor. Cell 107, 881–91 (2001).

13. Acosta-Alvear, D. et al. XBP1 controls diverse cell type- and condition-specific

transcriptional regulatory networks. Mol. Cell 27, 53–66 (2007).

14. Todd, D. J. et al. XBP1 governs late events in plasma cell differentiation and is not

required for antigen-specific memory B cell development. J. Exp. Med. 206, 2151–9

(2009).

15. Walter, P. & Ron, D. The unfolded protein response: from stress pathway to homeostatic

regulation. Science 334, 1081–6 (2011).

16. Szegezdi, E., Logue, S. E., Gorman, A. M. & Samali, A. Mediators of endoplasmic

reticulum stress-induced apoptosis. EMBO Rep. 7, 880–5 (2006).

17. Urano, F. et al. Coupling of stress in the ER to activation of JNK protein kinases by

transmembrane protein kinase IRE1. Science 287, 664–6 (2000).

18. Haze, K., Yoshida, H., Yanagi, H., Yura, T. & Mori, K. Mammalian transcription factor

ATF6 is synthesized as a transmembrane protein and activated by proteolysis in response

to endoplasmic reticulum stress. Mol. Biol. Cell 10, 3787–99 (1999).

19. Anken, E. van et al. Sequential waves of functionally related proteins are expressed when

B cells prepare for antibody secretion. Immunity 18, 243–53 (2003).

20. Shaffer, A. L. et al. XBP1, downstream of Blimp-1, expands the secretory apparatus and

other organelles, and increases protein synthesis in plasma cell

differentiation. Immunity 21, 81–93 (2004).

21. Gass, J. N., Jiang, H.-Y. Y., Wek, R. C. & Brewer, J. W. The unfolded protein response

of B-lymphocytes: PERK-independent development of antibody-secreting cells. Mol.

Immunol. 45, 1035–43 (2008).

22. Pino, S. C. et al. CHOP mediates endoplasmic reticulum stress-induced apoptosis in

Gimap5-deficient T cells. PLoS ONE 4, e5468 (2009).

23. Arensdorf, A. M. & Rutkowski, D. T. Endoplasmic reticulum stress impairs IL-4/IL-13

signaling through C/EBPβ-mediated transcriptional suppression. J. Cell. Sci. 126, 4026–

36 (2013).

24. Wijesundara, D. K., Tscharke, D. C., Jackson, R. J. & Ranasinghe, C. Reduced

interleukin-4 receptor α expression on CD8+ T cells correlates with higher quality anti-

viral immunity. PLoS ONE 8, e55788 (2013).

25. Watkin, L. B. et al. COPA mutations impair ER-Golgi transport and cause hereditary

autoimmune-mediated lung disease and arthritis. Nat. Genet. 47, 654–60 (2015).

26. Izumi, K. et al. ARCN1 Mutations Cause a Recognizable Craniofacial Syndrome Due to

COPI-Mediated Transport Defects. Am. J. Hum. Genet. 99, 451–9 (2016).

27. Park, S.-Y. Y., Yang, J.-S. S., Schmider, A. B., Soberman, R. J. & Hsu, V. W.

Coordinated regulation of bidirectional COPI transport at the Golgi by CDC42. Nature

521, 529–32 (2015).

28. Yang, H., Wang, H. & Jaenisch, R. Generating genetically modified mice using

CRISPR/Cas-mediated genome engineering. Nat Protoc 9,1956–68 (2014).

29. Almeida, S. F. F. de et al. Chemical chaperones reduce endoplasmic reticulum stress and

prevent mutant HFE aggregate formation. J. Biol. Chem. 282, 27905–12 (2007).

30. Siggs, O. M. et al. Mutation of the ER retention receptor KDELR1 leads to cell-intrinsic

lymphopenia and a failure to control chronic viral infection. Proc. Natl. Acad. Sci.

U.S.A. 112, E5706–14 (2015).

31. Numata, Y. et al. Depletion of molecular chaperones from the endoplasmic reticulum and

fragmentation of the Golgi apparatus associated with pathogenesis in Pelizaeus-

Merzbacher disease. J. Biol. Chem. 288, 7451–66 (2013).

32. Beller, M. et al. COPI complex is a regulator of lipid homeostasis. PLoS Biol. 6, e292

(2008).