RESEARCH ARTICLE 4011

Development 136, 4011-4020 (2009) doi:10.1242/dev.041160

Conditional knockdown of Nanog induces apoptotic cell death in mouse migrating primordial germ cells Shinpei Yamaguchi1, Kazuki Kurimoto2, Yukihiro Yabuta2, Hiroyuki Sasaki3, Norio Nakatsuji4,5, Mitinori Saitou2,* and Takashi Tada1,6,†,‡

The pluripotency factor Nanog is expressed in peri-implantation embryos and primordial germ cells (PGCs). Nanog-deficient mouse embryos die soon after implantation. To explore the function of Nanog in germ cells, Nanog RNA was conditionally knocked down in vivo by shRNA. Nanog shRNA transgenic (NRi-Tg) mice were generated through the formation of germline chimeras with NRi-Tg embryonic stem cells. In E12.5 Cre-induced ER-Cre/NRi-Tg and TNAP-Cre/NRi-Tg double-transgenic embryos, the number of alkaline phosphatase-positive and SSEA1-positive PGCs decreased significantly. In the E9.5 and E10.5 migrating Nanog-knockdown PGCs, TUNEL-positive apoptotic cell death became prominent in vivo and in vitro, despite Oct4 expression. Single-cell microarray analysis of E10.5 Nanog-knockdown PGCs revealed significant up- and downregulation of a substantial number of genes, including Tial1, Id1 and Suz12. These data suggest that Nanog plays a key role in the proliferation and survival of migrating PGCs as a safeguard of the PGC-specific molecular network.

KEY WORDS: Nanog, Knockdown, Primordial germ cell, Apoptosis, Mouse

INTRODUCTION whereas p53 (Trp53) and Tcf3 are implicated in repressing Nanog Core regulators, including Oct4 (Pou5f1 – Mouse Genome transcription (Wu et al., 2006; Pan and Thomson, 2007). It has been Informatics), Sox2 and Nanog, play key roles in the shown that dimer formation by self-association of Nanog through transcriptional network that maintains the pluripotent state of its C-terminal domain is functionally important (Mullin et al., 2008; human and mouse embryonic stem cells (ESCs). The Wang et al., 2008), and Nanog-Oct4 protein complexes are homeodomain transcription factor Nanog is expressed in the associated with several repressive protein complexes, including the nuclei of ESCs in vitro and of morulae, in the inner cell mass NuRD, Sin3A and Pm1 complexes in mouse ESCs (Liang et al., (ICM) cells of blastocysts, in the epiblast of E6.5 and E7.5 2008). Thus, it has been hypothesized that certain key regulators embryos (Chambers et al., 2003; Mitsui et al., 2003; Hatano et al., control Nanog transcription through several independent pathways. 2005), and in the primordial germ cells (PGCs) of E8.5-13.5 However, the molecular mechanism of transcriptional regulation of embryos (Hart et al., 2004; Yamaguchi et al., 2005) in vivo. Nanog in germ cells is not fully understood. Nanog plays an essential role in the maintenance of the PGCs are first observed in E7.25 embryos at the base of the pluripotency of the epiblast shortly after implantation (Mitsui et allantois and in the caudal end of the primitive streak as a group al., 2003). Overexpression of Nanog promotes the clonal of 20-25 alkaline phosphatase (ALP)-positive cells. On expansion of mouse ESCs (Chambers et al., 2003) and of ES- subsequent days, PGCs proliferate and migrate into the hindgut somatic hybrid cells (Silva et al., 2006) and enhances the stable of developing embryos and finally reach, and enter, the genital propagation of human and monkey ESCs (Darr et al., 2006; ridge of E11.5 embryos. After a few further mitotic divisions in Yasuda et al., 2006). the genital ridge, the developmental pathways of male and female Nanog is cis-regulated via Octamer and Sox elements in its germ cells diverge. Thus, the developmental stages of mitotic promoter region by a synergistic action induced by the binding of germ cells are roughly classified into germ cell specification, Oct4 and Sox2 (Kuroda et al., 2005; Rodda et al., 2005). migration in developing embryos, and sexual divergence of germ Furthermore, Sall4 and FoxD3 activate Nanog transcription, cell behavior in gonads. In germ cell specification prior to the initiation of high-level Nanog expression, Dppa3 (Stella), Fragilis (Ifitm3) and Prdm1 (Blimp1) are key players in the 1Stem Cell Engineering, Institute for Frontier Medical Sciences, Kyoto University, 53 Kawahara-cho, Shogoin, Sakyo-ku, Kyoto 606-8507, Japan. 2Laboratory for mechanism involved in the acquisition of germ cell competence Mammalian Germ Cell Biology, RIKEN Center for Developmental Biology, 2-2-3 (Hayashi et al., 2007). In post-mitotic spermatogenesis and 3 Minatojima-Minamimachi, Chuo-ku, Kobe 650-0047, Japan. Department of oogenesis, when dramatic morphological changes occur, a large Integrated Genetics, National Institute of Genetics, Research Organization of Information and Systems, 1111 Yata, Mishima-shi, Shizuoka 411-8540, Japan. number of differentiation-specific molecules are involved, and 4Development and Differentiation, Institute for Frontier Medical Sciences, Kyoto loss-of-function mutagenesis through conditionally targeted 5 University, 53 Kawahara-cho, Shogoin, Sakyo-ku, Kyoto 606-8507, Japan. Institute disruption by knockout or knockin of these genes often results in for Integrated Cell-Material Sciences (iCeMS), Kyoto University, Kyoto 606-8501, Japan. 6JST, CREST, 4-1-8 Hon-cho, Kawaguchi, Saitama 332-0012, Japan. impaired fertility (O’Bryan and de Kretser, 2006; Roy and Matzuk, 2006). However, in migrating PGCs, only a few genes *Present address: Department of Anatomy and Cell Biology, Graduate School of have been identified as key regulators, including Nanos3 and Medicine, Kyoto University, Yoshida-Konoe-cho, Sakyo-ku, Kyoto 606-8501, Japan †Present address: Laboratory of Stem Cell Engineering, Stem Cell Research Center, Dnd1 (Tsuda et al., 2003; Youngren et al., 2005). Nanog protein, Institute for Frontier Medical Sciences, Kyoto University, 53 Kawahara-cho, Shogoin, which is first detected in male and female PGCs of E7.75-8.0 Sakyo-ku, Kyoto 606-8507, Japan embryos, is expressed throughout the migration stages and is ‡Author for correspondence ([email protected]) subsequently downregulated in the gonads in male and female

Accepted 29 September 2009 mitotic arrest and meiotic germ cells, respectively (Yamaguchi et DEVELOPMENT 4012 RESEARCH ARTICLE Development 136 (23) al., 2005). The predominance of Nanog expression suggests that the proliferation and survival of migrating PGCs as a safeguard of it plays an important role in early germ cell development. the PGC-specific molecular network in mice. Nanog KD-mediated Recently, a role for Nanog in gonadal germ cells has been apoptotic cell death may be triggered by the disruption of this suggested by the contribution of Nanog-null germ cells of E11.5, orchestrated molecular network. but not of E12.5, chimeric embryos (Chambers et al., 2007). However, it remains unclear whether the lack of Nanog-null cells MATERIALS AND METHODS in the gonads of E12.5 chimeric embryos indicates Nanog Constructions function in gonadal PGCs. It also remains unclear whether these Nanog target sequences were designed using pSico-Oligomaker 1.5 results reflect the role of wild-type ES and embryonic cells in (http://web.mit.edu/jacks-lab/protocols/pSico.html). A random sequence was designed as a negative control. The following target sequences were germ cell development. Therefore, it is necessary to investigate cloned into HpaI/XhoI-digested pSico vector (Ventura et al., 2004): the molecular function of Nanog in germ cells by other shNanog, 5Ј-GTTAAGACCTGGTTTCAAA-3Ј; negative control, 5Ј- approaches. GCCTTCACTCGATGCAATG-3Ј. Post-transcriptional gene silencing through RNA interference The silent mutant form of Nanog was constructed with pCAG-Nanog (RNAi), which is mediated by degradation of RNA complimentary to (Hatano et al., 2004) by introduction of the mutation into the shRNA target ~20-nt small interfering RNAs (siRNAs) after incorporation into an region through PCR-mediated nucleotide replacement. pCAG-Mut-Nanog RNA-induced silencing complex, is widely used to investigate the was co-transfected with pPgk-Neo into NRi ES cells using Lipofectamine molecular function of a target gene in cells cultured in vitro 2000 (Invitrogen). G418 (250 g/ml)-resistant colonies were cloned and (Filipowicz, 2005). Cre/loxP-regulated conditional RNAi of CD8 and expanded. p53 mediated by lentiviral vectors has been successfully demonstrated Lentiviral infections by mating with tissue-specific Cre-expressing transgenic mice in vivo The supernatant, which was collected 48 hours after co-transfection of the (Ventura et al., 2004). The crucial roles of sprouty2 (Spry2) and CREB SIN vector and each packaging vector into HEK 293T cells, was centrifuged (cAMP-responsive element binding protein; Creb1) have been at 6000 g for 16-24 hours (Miyoshi et al., 1998). The pellet was dissolved in revealed by in vivo lentiviral short hairpin RNA (shRNA)-mediated Dulbecco’s modified Eagle’s medium (DMEM) (Sigma) and stored at knockdown (KD) in mice (Shaw et al., 2007; Cheng et al., 2008). –80°C. Lentiviral infectivity was estimated by counting GFP-positive cells Although it is desirable to avoid genetic manipulation of the after infection of the titrated supernatants into the 293T cells. Following ϫ 5 endogenous gene when analyzing the biological role of genes overnight culture of ESCs at 1 10 cells per well of a 12-well culture plate (BD Falcon), the cells were infected with the supernatant at MOI15 and expressed in mouse germ cells, in vivo lentivirus-mediated conditional cultured overnight. After washing out the virus several times with PBS, the KD of a germ cell-specific gene has yet to be reported. ESCs were plated on an inactivated mouse embryonic fibroblast (MEF) Here, we made Nanog shRNA transgenic mice (NRi-Tg) for feeder layer. GFP-positive cells were cloned and expanded. Expression of Cre/loxP-mediated conditional KD. These mice were crossed with shRNA was induced in vitro by treatment with adenovirus expressing Cre estrogen receptor (ER; Esr1)-Cre or tissue non-specific alkaline recombinase (AdCre; AxCANCre) (Kanegae et al., 1995). phosphatase (TNAP; Alpl)-Cre transgenic mice. Cre expression is induced by the administration of tamoxifen (TM) to pregnant mice Culture of ESCs and MEFs Mouse R1 ESCs were maintained in DMEM F-12 HAM (Sigma) with E7.5 ER-Cre/NRi-Tg embryos and upregulated in E9.0 TNAP- supplemented with 15% fetal bovine serum (FBS; BioWest), 0.1 mM 2- Cre/NRi-Tg embryos. In both cases, a reduction in the number of mercaptoethanol and 400 units/ml recombinant LIF (Chemicon) (ES PGCs in E12.5 male and female embryos was apparent. Oct4- medium) on MEF feeder cells inactivated with mitomycin C. independent cell apoptosis was evident by TUNEL staining of E10.5 migrating PGCs. Similar to PGCs in vivo, cell death shortly after Mice Nanog KD was detected in PGCs cultured in vitro. A decrease in the TNAP-Cre and ER-Cre mouse lines were maintained by mating them with C57BL/6J mice. The PCR primer sets for genotyping are summarized in number of germ cells occurred transiently during germ cell Table 1. C57BL/6J blastocysts, into which the NRi-shRNA-infected ESCs development of some adult TNAP-Cre/NRi-Tg males. Single-cell were microinjected, were transferred into the uteruses of pseudo-pregnant microarray analysis of E10.5 Nanog KD PGCs demonstrated ICR females. Chimeras were mated with C57BL/6J females, and germline marked changes at the transcription level in over 700 genes, transmission to the next generation was checked by coat color and GFP including several key factors, such as Tial1 (Tiar), Id1 and Suz12. fluorescence. Mice homogenous for the NRi-Tg were detected by genomic These data demonstrate that Nanog is functionally associated with PCR with a specific primer set (Table 1). For Cre induction in embryos, 3.0

Table 1. Primers and probes for genomic PCR, qPCR and northern blot analyses Primer set Forward primer (5Ј to 3Ј) Reverse primer (5Ј to 3Ј) TNAP-Cre GGCTCTCCTCAAGCGTATTCAAC CAAACGGACAGAAGCATTTTCCAG ER-Cre CTCTAGAGCCTCTGCTAACC CCTGGCGATCCCTGAACATGTCC pSico excision CAAACACAGTGCACACCACGC CGCACAGACTTGTGGGAGAAG Inverse PCR 1st GCCAAGTGGGCAGTTTACCG GGCTGCTCGCCTGTGTTGCC Inverse PCR 2nd AATGGGCGGGGGTCGTTGGG CCAGCGGACCTTCCTTCCCGC NRi-Wt allele CGTAATGAGATCTGACGTCC GGGAGTCTACACAGCAAAC NRi-Tg allele Same as Wt allele GGCTGCTCGCCTGTGTTGCC Nanog CTTTCACCTATTAAGGTGCTTGC TGGCATCGGTTCATCATGGTAC Id1 CAACAGAGCCTCACCCTCTC AGAAATCCGAGAAGCACGAA Tial1 GGCATGCAAGGAAATGTCTC TTGGCTTTAGTTGGCCTCTC Suz12 AAGGCTAGCATTGTTTGCAC TTGTACCATTCAAATGCTTTATCA Gapdh ATGAATACGGCTACAGCAACAGG CTCTTGCTCAGTGTCCTTGCTG shNanog probe GTTAAGACCTGGTTTCAAA

shNC probe GCCTTCACTCGATGCAATG DEVELOPMENT Safeguard of PGC survival by Nanog RESEARCH ARTICLE 4013 mg TM/40 g body weight was intra-peritoneally injected into pregnant NRi- needles. PGCs were identified by their morphological characteristics and Tg mice 7.5 or 9.5 days after mating them with ER-Cre males. Experiments transferred into lysis buffer by mouth pipette. PGCs were genotyped with with mice were performed according to the institutional guidelines of Kyoto the remaining genital ridges. The amplified cDNA library of each PGC was University, Japan. classified by qPCR-based expression analyses of Nanog, Oct4 and Dppa3 (Kurimoto et al., 2007). cDNAs were labeled by in vitro transcription Blastocyst culture (Affymetrix). The cRNAs were hybridized with the GeneChip Mouse Blastocysts collected from super-ovulated NRi-Tg mice mated with ER-Cre Genome 430 2.0 Array (Affymetrix). Data were analyzed using Microsoft males were treated with acidic Tyrode’s solution (Sigma) to remove the zona Excel and Multiple Experimental Viewer (MeV) software. pellucida. Blastocysts attached to the bottom of a gelatin-coated 1-cm well qPCR was performed using the ABI Prism 7700 (Applied Biosystems) were cultured with ES medium for an initial 24 hours and then in the and Power SYBR Green PCR Master Mix according to the manufacturer’s presence of 1 M 4-hydroxytamoxifen (4OH-TM; Sigma) for 6 days. Each instructions (Applied Biosystems), with gene-specific primer sets (Table 1). expanded blastocyst that was morphologically analyzed was genotyped by genomic PCR with specific primer sets (Table 1). Microarray data have been deposited in ArrayExpress (accession number E-MEXP-2411). PGC culture For collection of PGCs, the dorsal mesentery of E10.5 embryos obtained by RESULTS intercrossing NRi-Tg and ER-Cre transgenic mice was dissociated with Generation of Nanog-knockdown ESCs and 0.05% trypsin and 1 mM EDTA for 1 minute at 37°C (Matsui et al., 1992; Kawase et al., 1994). The cells were cultured in PGC medium [DMEM F- transgenic mice 12 HAM with 15% FBS, 0.1 mM 2-mercaptoethanol, 400 units/ml LIF, 25 A temporally and spatially controlled in vivo Nanog KD system was ng/ml recombinant human bFGF, and 10 M forskolin (Sigma)] on Sl4- constructed with a lentiviral vector for conditional Cre/loxP- m220 feeder cells inactivated with mitomycin C. One-quarter of the cell regulated RNAi (Ventura et al., 2004). Before Cre recombinase suspension was seeded in each well of a gelatin-coated 1-cm well or a expression, the GFP reporter driven by the CMV promoter is widely collagen-coated cell-culture chamber slide (BD Falcon) containing feeder expressed and Nanog shRNA is repressed, whereas after Cre- cells. After 12 hours culture, the PGCs started multiplying in PGC medium mediated recombination, GFP is flipped out and Nanog shRNA containing 5 M 4OH-TM and were harvested at 0, 12, 36 and 60 hours. expression is then driven by the U6 promoter (Fig. 1A). PGCs fixed with 4% paraformaldehyde (PFA) in PBS for 15 minutes at The most effective shRNA was introduced by viral infection of room temperature were used for further analyses. R1 ESCs for establishment of Nanog KD ESCs (NRi-ESCs). Inverse PCR and sequencing Transcription of the shRNA after infection with adenovirus Cre The integration site of the lentivirus in the NRi-shRNA-ESCs was detected (AdCre) was confirmed by northern blot analysis in NRi-ESCs (Fig. by inverse PCR as previously described (Li et al., 1999) with minor 1B). Western blot analyses showed efficient reduction of Nanog modifications. ApaI-ApaI genomic DNA fragments of NRi-shRNA-ESCs expression to a relative value of 0.14 [compared with AdCre(–) NRi- were self-circularized. Flanking genomic DNA was PCR amplified and ESCs] 96 hours after AdCre infection (Fig. 1C). Cre-dependent cloned into the pGEM-T Easy vector (Promega). DNA sequences determined with a CEQ2000XL DNA sequencer (Beckman Coulter) were Nanog repression was verified by GFP expression and aligned using the NCBI BLAST and EBI Ensembl databases. immunostaining of Nanog 48 hours after AdCre infection (Fig. 1D). Downregulation of Nanog was detected within the first 24 hours Northern and western blotting (data not shown). Differentiation of ESCs was detected 96 hours Total RNA (10 g) isolated from ESCs or embryos using TRIzol after AdCre infection with NRi shRNA, indicating that cell (Invitrogen) was separated through 15% polyacrylamide/7M urea gels and differentiation was induced 72 hours after Nanog KD (Fig. 1E). electroblotted to Hybond XL (Amersham). The membrane was hybridized with a 32P 5Ј-end-labeled oligonucleotide probe at 42°C overnight. The Clonal expansion of ESCs was disturbed by transcription of NRi membranes were washed twice in 2ϫSSC/0.1% SDS at 65°C for 30 minutes shRNA (see Fig. S1A,B in the supplementary material). and twice in 0.1ϫSSC/0.1% SDS at 65°C for 15 minutes. shRNA silences a target gene with a completely homologous Whole lysate (20 g/lane) of ESCs was separated by 12% SDS-PAGE and sequence through a post-transcriptional cleavage mechanism. It has transferred onto a nitrocellulose membrane (Millipore). The membrane was been noted that siRNA often triggers off-target effects, which could probed with anti-Nanog (1:1500 dilution) and anti-histone H3 (1:3000) be caused by unintended RNAi-specific toxic events or cleavage of antibodies at 4°C overnight. The membrane was incubated with a HRP-linked an unintended RNA target (Ui-Tei et al., 2008). Cre-dependent anti-mouse or rabbit IgG secondary antibody (1/3000, Amersham) for 1 hour. expression of the non-specific negative control shRNA resulted in a Signals were visualized using the ECL Western Blotting Detection Kit (Amersham). normal ESC phenotype (Fig. 1C-E). Disappearance of Cre- dependent NRi shRNA-mediated repression of Nanog and Immunohistochemistry promotion of differentiation by co-transfection with the silent- Immunohistochemistry analyses of ESCs, PGCs and cryosections (10 m) mutation form of Nanog (Mut-Nanog) again showed that the NRi were performed as described previously (Yamaguchi et al., 2005). The shRNA was highly specific to Nanog (see Fig. S1B-D in the antibodies used were: anti-Nanog (1:1000; Cosmo Bio), anti-Oct4 (1:100; supplementary material). Inverse PCR and DNA sequence analyses Santa Cruz), anti-SSEA1 (MC480, 1:1000; DSHB), anti-phospho-histone H3 (1:2000; Upstate) and TRA98 (1:500; Cosmo Bio; this antibody detects demonstrated that the NRi lentiviral vector was integrated between a mouse testicular germ cell-specific antigen). For counting E12.5 PGCs, Cdh2 and Dsc3, near to the proximal region of chromosome 18 (see ~10-15 transverse sections taken at regular intervals throughout the entire Fig. S2A in the supplementary material). No known gene was gonad were analyzed. For the TUNEL assay, the In Situ Cell Death disrupted by the lentiviral integration. Therefore, the NRi shRNA- Detection Kit (Roche) was used according to the manufacturer’s infected ESCs were used for further in vivo experiments. instructions. ALP signals in genital ridges and cultured PGCs were detected Nanog shRNA transgenic mice were made by mating a male using the ALP staining mixture (Ginsburg et al., 1990). germline chimera carrying NRi shRNA-infected ESCs with Single-cell microarray and quantitative (q) PCR C57BL/6 females. NRi-Tg founder mice were detected by E10.5 genital ridges (TM administered at E7.5) were incubated in 0.5 mM expression of GFP (see Fig. S2B in the supplementary material). By EDTA in PBS for 20 minutes at 37°C and then transferred to 2% BSA in crossing mice heterozygous for NRi-Tg, homozygous NRi-Tg mice

PBS. PGCs were released from the genital ridges by piercing with fine glass were generated and stably maintained as a transgenic line. DEVELOPMENT 4014 RESEARCH ARTICLE Development 136 (23)

Decrease in PGCs in E12.5 ER-Cre/NRi-Tg embryos To examine the effect of Nanog KD on early PGC development, NRi-Tg females were mated with ER-Cre males, and then TM (3 mg/40 g body weight) was intra-peritoneally administered to pregnant mice at 7.5 days post-coitum (dpc) for Cre-dependent transcription of Nanog shRNA. Normal development, without any retardation, was observed in the gross external morphology of the E12.5 single ER-Cre and NRi-Tg embryos, and even in the ER- Cre/NRi-Tg double-transgenic embryos (Fig. 2A), in which transcription of Nanog shRNA was detected (see Fig. S2C in the supplementary material). A striking decrease in the number of ALP+ PGCs was evident by the sparsity of red-stained cells in the gonads of E12.5 ER-Cre/NRi- Tg double-transgenic embryos, in contrast to the high number of red-stained cells in the gonads of single-transgenic NRi-Tg embryos collected from the same littermates (Fig. 2A). Cre activity (excision as assessed by genomic PCR) was nearly 100% in the liver and ~75% in the gonads, although in PGCs it was difficult to determine the Cre activity precisely. To calculate the number of PGCs, cells positive for SSEA1 (stage-specific embryonic antigen 1; Fut4 – Mouse Genome Informatics) were counted in transverse sections of E12.5 gonads. In single-transgenic gonads, 43 SSEA1+ PGCs were detected on average per section, versus only 14 in the double-transgenic gonads (Fig. 2B). Nanog KD resulted in a ~70% reduction in PGCs in male and female ER-Cre/NRi-Tg embryos. The majority of SSEA1+ Fig. 1. Effect of Nanog shRNA on the differentiation of mouse PGCs were negative for Nanog (Fig. 2E). Similarly, in E11.5 ER- + ESCs and blastocysts. (A)Lentiviral vector for conditional Cre/loxP- Cre/NRi-Tg embryos, the number of ALP gonadal PGCs was regulated RNAi of Nanog. (B)Transcription of NRi-shRNA in ESC markedly reduced (see Fig. S3A-C in the supplementary material). derivatives 96 hours after adenovirus Cre (AdCre) infection as assessed Next, to determine whether Nanog KD induces detrimental effects by northern blotting. (C)The efficiency of NRi-shRNA in ESC derivatives on early gonadal PGCs, TM was administered at 9.5 dpc to pregnant 96 hours after AdCre infection as assessed by western blotting. Histone NRi-Tg mice that had been mated with ER-Cre Tg males. H3 was used as a loading control. (D)Suppression of Nanog by NRi- Interestingly, no decrease in ER-Cre/NRi-Tg PGCs was observed at shRNA 48 hours after AdCre infection. (E)Induction of ESC E12.5 by ALP staining (Fig. 2C,D), irrespective of the repression of differentiation by NRi-shRNA 96 hours after AdCre infection. Nanog in SSEA1+ PGCs (Fig. 2E). These data indicate that Nanog (F)Outgrowth of the inner cell mass cells of blastocysts cultured for 7 days with 4-hydroxytamoxifen. NC, non-specific shRNA as a negative mainly plays a role in migrating PGCs, but not in gonadal PGCs. control. Decrease in PGCs in TNAP-Cre/NRi-Tg embryos To verify the function of Nanog in migrating PGCs, NRi-Tg mice were mated with the PGC-specific Cre recombinase transgenic mouse Effect of Nanog knockdown on somatic cells line TNAP-Cre, which was generated by knockin of Cre into the To further examine possible off-target effects in vivo, we analyzed TNAP (Alpl) locus. Cre excision was first detected in early PGCs at peri-implantation development of ER-Cre/NRi-Tg double- E9.0, and Cre activity in PGCs was detected in ~50% of E13.5 PGCs transgenic embryos generated by mating females homozygous for (Lomeli et al., 2000). E12.5 TNAP-Cre/NRi-Tg, NRi-Tg, TNAP-Cre NRi-Tg with males heterozygous for ER-Cre driven by the CAG and wild-type embryos developed normally (Fig. 2F). When E12.5 promoter [C57BL/6.Cg-Tg(cre-Esr1)5Amc/J]. In the ER-Cre TNAP-Cre/NRi-Tg double- and single-transgenic embryos were transgenic embryos and mice, Cre activity is induced by the compared, the intensity of staining of ALP+ cells was drastically synthetic estrogen-like agonist tamoxifen (TM), but not by reduced in the TNAP-Cre/NRi-Tg gonads (Fig. 2F). To estimate the endogenous estrogens (Hayashi and McMahon, 2002). Zona number of PGCs, SSEA1+ cells were counted in each transverse pellucida-free blastocysts were cultured in the presence of TM for 7 section of the E12.5 gonads. The number of PGCs in the TNAP- days. Each blastocyst that expanded on the bottom of a culture well Cre/NRi-Tg gonads was half that in the control gonads (Fig. 2G). was genotyped by genomic PCR. The ICM cells were poorly Immunohistochemical analysis demonstrated that SSEA1+ PGCs developed in the ER-Cre/NRi-Tg double-transgenic embryos, were frequently Nanog– in the TNAP-Cre/NRi-Tg gonads, whereas similar to previous findings in Nanog-knockout embryos (Mitsui et the majority of SSEA1+ PGCs were Nanog+ in the controls (Fig. al., 2003), whereas ICM cells were well developed in the NRi-Tg 2H), indicating that Nanog KD resulted in a reduction in PGCs, as single-transgenic embryos (Fig. 1F). Furthermore, the normal seen in ER-Cre/NR1-Tg transgenic mice. development of E12.5 ER-Cre/NRi-Tg double-transgenic embryos, in which Nanog shRNA was transcribed in all tissues of the body Decrease in proliferation and increase in cell (Fig. 2A,C), indicates that no off-target effects were apparent, death in PGCs in vivo although one cannot necessarily assume that Nanog knockout and To examine the sequential expression of PGC markers, cell KD result in the same molecular consequences and embryonic proliferation and apoptosis during migration, immunohistochemical

phenotypes. analyses and TUNEL assays were performed in E9.5 and E10.5 ER- DEVELOPMENT Safeguard of PGC survival by Nanog RESEARCH ARTICLE 4015

Fig. 2. Reduction in the number of PGCs in E12.5 ER-Cre/NRi-Tg and TNAP-Cre/NRi-Tg embryos. (A)Reduction in the number of alkaline phosphatase (ALP)-positive PGCs in E12.5 ER-Cre/NRi-Tg genital ridges. Tamoxifen was injected into pregnant mice at 7.5 dpc (TM7.5). (B)The number of SSEA1+ PGCs in E12.5 ER-Cre/NRi-Tg and single-transgenic embryos from TM7.5. (C)There was no reduction in ALP+ PGCs in E12.5 ER- Cre/NRi-Tg genital ridges. TM was injected into pregnant mice at 9.5 dpc (TM9.5). (D)There was no difference in the number of SSEA1+ PGCs in E12.5 ER-Cre/NRi-Tg and single-transgenic embryos from TM9.5. (E)Expression of Nanog in SSEA1+ PGCs of E12.5 ER-Cre/NRi-Tg embryos. Transverse sections of E12.5 genital ridges were immunostained. The circles delineate genital ridges. No GFP signal was detected in the cryosections. (F)Reduction in ALP+ PGCs in E12.5 TNAP-Cre/NRi-Tg genital ridges. (G)The number of SSEA1+ PGCs in E12.5 TNAP-Cre/NRi-Tg and single-transgenic embryos. (H) Expression of Nanog in SSEA1+ PGCs of E12.5 TNAP-Cre/NRi-Tg embryos. The circles delineate genital ridges. No GFP signal was detected in the cryosections. *P<0.01, **P<0.05. Error bars, s.e.m.

Cre/NRi-Tg double-transgenic embryos and their littermates. At mediated recombination within the first day after TM injection at E9.5 and E10.5, the gross morphology of the ER-Cre/NRi-Tg E7.5, Nanog–/Oct4+/SSEA1+/TUNEL– PGCs had appeared by the double-transgenic embryos was normal. No sex-specific differences second day. Within the next 24 hours, apoptosis occurred in PGCs were detected. marked as Nanog–/SSEA1+/TUNEL+ (Fig. 4A,B). Oct4 expression At E9.5 (2 days after TM administration), Nanog–/SSEA1+ was observed in all Nanog–/SSEA1+ PGCs, but not TUNEL+ PGCs migrating PGCs were detected in the ER-Cre/NRi-Tg double- (data not shown). Following TM injection at E9.5, Nanog KD did transgenic, but not NRi-Tg, embryos (Fig. 3A). The number of not occur sufficiently in E10.5 migrating PGCs, while induced Nanog+/SSEA1+ PGCs was significantly reduced (to ~70%; Fig. markedly with no significant reduction in the number of E12.5 3B). At E10.5 (3 days after TM administration), Nanog–/SSEA+ gonadal PGCs (Fig. 5A-C), suggesting that Nanog function is PGCs were more abundant in the ER-Cre/NRi-Tg embryos as dispensable for the survival of gonadal PGCs (Fig. 2C-E). The compared with the control embryos (Fig. 3C). Nanog+/SSEA1+ effects on PGC development of Nanog KD induced by TM injection PGCs were markedly decreased (to ~40%; Fig. 3D). An important at E7.5 and E9.5 are summarized in Fig. 5D. finding was that the number of TUNEL+ PGCs noticeably increased in the ER-Cre/NRi-Tg embryos. TUNEL+/SSEA1+ PGCs were first Decrease in proliferation and increase in cell detected in E9.5 PGCs (Fig. 4A,B), and at E10.5 their abundance death in PGCs in vitro was about three times that in the control PGCs (Fig. 4C,D). The To examine whether the reduction in PGCs was caused by the death number of PGCs positive for the mitotic marker phosphorylated- or differentiation of PGCs, dissociated gonads of E10.5 embryos histone H3 was significantly lower in ER-Cre/NRi-Tg than in were cultured on inactivated Sl4-m220 cells expressing the control embryos (Fig. 4E). Notably, the majority of SSEA1+/Oct4+ membrane-associated form of steel factor (kit ligand) with culture PGCs were positive for Nanog in the control embryos, whereas medium containing leukemia inhibitory factor (LIF), basic fibroblast almost half were negative for Nanog in the ER-Cre/NRi-Tg embryos growth factor (bFGF) and forskolin (Koshimizu et al., 1996). The (Fig. 4F). Thus, the majority of E7.5 TM-treated Nanog–/TUNEL+ proliferation of PGCs was clearly repressed in the ER-Cre/NRi-Tg apoptotic PGCs stopped migrating before entry into the genital double-transgenic PGCs as compared with control PGCs after 12 ridges. hours of culture in the presence of TM (Fig. 6A). Although a gradual Cre-mediated recombination is detectable in embryos within 24 decrease in the number of ALP+ PGCs was observed even in the hours of TM administration to pregnant mice (Hayashi and control embryos from 12 to 60 hours after TM administration, ER-

McMahon, 2002). Taking this into consideration, following Cre- Cre/NRi-Tg PGCs were significantly less abundant than control DEVELOPMENT 4016 RESEARCH ARTICLE Development 136 (23)

Fig. 3. Expression of Nanog in migrating PGCs in E9.5 and E10.5 ER-Cre/NRi-Tg embryos. (A)Expression of Nanog in SSEA1+ PGCs of E9.5 ER-Cre/NRi-Tg mouse embryos. (B)The proportion of Nanog+ PGCs in SSEA1+ PGCs in E9.5 ER-Cre/NRi-Tg embryos. (C)Expression of Nanog in SSEA1+ PGCs of E10.5 ER-Cre/NRi-Tg embryos. (D)The proportion of Nanog+ PGCs in SSEA1+ PGCs in E10.5 ER-Cre/NRi-Tg embryos. The arrowheads indicate SSEA1+ PGCs. The circles indicate SSEA1+/Nanog– PGCs. *P<0.01, **P<0.05. Error bars, s.e.m. Fig. 4. Apoptosis and proliferation of Nanog-negative migrating PGCs in E9.5 and E10.5 ER-Cre/NRi-Tg embryos after E7.5 tamoxifen administration. (A)TUNEL assay in E9.5 ER-Cre/NRi-Tg + + PGCs. Notably, immunocytochemical analyses revealed that Nanog mouse embryos. The arrowheads indicate SSEA1 /TUNEL PGCs. (B)The proportion of TUNEL+ cells in SSEA1+ PGCs in E9.5 ER-Cre/NRi-Tg expression was repressed in the ER-Cre/NRi-Tg, but not in the NRi- embryos. (C)TUNEL assay in E10.5 ER-Cre/NRi-Tg embryos. The Tg. PGCs 12 and 36 hours after TM administration (Fig. 6B). From + + + + arrowheads indicate SSEA1 /TUNEL PGCs. (D)The proportion of TUNEL 12 to 36 hours after TM administration, TUNEL cells were cells in SSEA1+ PGCs in E10.5 ER-Cre/NRi-Tg embryos. (E)The proportion prominent in the ER-Cre/NRi-Tg embryos but not in the control of phosphorylated histone H3+ cells in SSEA1+ PGCs of E10.5 ER-Cre/NRi- embryos (Fig. 6C). The number of SSEA1+/TUNEL+ PGCs in the Tg embryos. (F)Expression of Oct4 in Nanog– PGCs of E10.5 ER-Cre/NRi- ER-Cre/NRi-Tg embryos was about twice that in the NRi-Tg control Tg embryos. Arrowheads indicate Oct4+/SSEA1+ PGCs. Circles indicate embryos (Fig. 6D). Nanog–/Oct4+ PGCs were often detected in the Nanog– PGCs. *P<0.01, **P<0.05. Error bars, s.e.m. ER-Cre/NRi-Tg culture, but not in the control, 12 and 36 hours after TM administration (see Fig. S4A in the supplementary material). The number of PGCs positive for the mitotic marker phosphorylated histone H3 was significantly reduced in ER-Cre/NRi-Tg PGCs (see transgenic embryos than in the control embryos, although both the Fig. S4B,C in the supplementary material). Cre-mediated testes and ovaries varied in size (see Fig. S5A,B in the recombination was efficiently induced in more than 50% and nearly supplementary material). 100% of MEFs 12 and 24 hours after culture in the presence of TM, In two out of six testes examined from 6-week-old TNAP- respectively (see Fig. S4D in the supplementary material). Cre/NRi-Tg adults, spermatogonia, marked as TRA98+ germ cells, Differentiation of ESCs was induced 72 hours after Nanog were dissociated from the tubule wall and scattered in the empty repression (Fig. 1E), suggesting that apoptotic cell death prior to cell tubules (see Fig. S5C in the supplementary material). These features differentiation was induced within 24 hours of Nanog repression in are observed in germ cells undergoing mitotic division in pre- PGCs. pubescent newborn mice, demonstrating that developmental retardation of the seminiferous tubule in some regions of adult testes Effect of Nanog knockdown on adult gonads may be caused by the loss of Nanog– germ cells during the peri- After injection of TM at 3 mg/40 g body weight to 7.5 dpc pregnant gonadal stage. Consistently, the number of TRA98+ germ cells in females, embryos developed normally until E13.5 but died in the TNAP-Cre/NRi-Tg newborn (P1) testes was reduced (see Fig. second semester of pregnancy, although most embryos were viable S5D,E in the supplementary material). and developed normally until E13.5. Thus, the testes or ovaries of No significant difference in the number of oocytes was detected 6-week-old TNAP-Cre ϫ NRi-Tg F1 mice were analyzed in 6-week-old TNAP-Cre/NRi-Tg versus control mice by morphologically and immunohistochemically. The testes, but not the immunostaining of cryosections with anti-Oct4 antibody (data not

ovaries, tended to be smaller in the TNAP-Cre/NRi-Tg double- shown). DEVELOPMENT Safeguard of PGC survival by Nanog RESEARCH ARTICLE 4017

Fig. 5. Effects of E9.5 tamoxifen administration on ER-Cre/NRi-Tg PGCs. (A) The efficiency of Cre-mediated recombination in the genital ridges of E10.5 and E12.5 ER-Cre/NRi-Tg mouse embryos after E7.5 and E9.5 tamoxifen administration. Pre, pre- recombination; Post, post- recombination. (B) Nanog expression in SSEA1+ PGCs of E10.5 ER- Cre/NRi-Tg embryos after TM9.5. The arrowhead indicates a Nanog– PGC. (C) The proportion of Nanog+ cells in SSEA1+ PGCs in E10.5 ER- Cre/NRi-Tg embryos. *P<0.01. Error bars, s.e.m. (D)Induction of Nanog knockdown and apoptosis by TM7.5 and TM9.5. Fig. 6. Effects of Nanog knockdown on PGC development in culture in vitro. (A)The relative number of ER-Cre/NRi-Tg double- transgenic to single-transgenic PGCs after 12, 36 and 60 hours of Changes in gene expression profile upon Nanog culture with TM. PGCs were detected by ALP staining. (B)Repression of knockdown in each PGC Nanog 12 hours after TM treatment. (C)TUNEL staining of PGCs after 36 hours of culture with TM. Arrowheads indicate TUNEL+ PGCs. To explore the molecular mechanism involved in apoptotic cell + + death by Nanog KD, the global gene expression profile of each (D)The proportion of TUNEL cells in SSEA1 PGCs after 36 hours of culture with TM. *P<0.01. Error bars, s.e.m. E10.5 PGC was analyzed by a single-cell microarray assay (Kurimoto et al., 2007). A PGC-specific cDNA library was identified by RT-PCR of Oct4 and Dppa3 (Fig. 7A). The libraries were classified into Nanog low [Nanog (L)] and Nanog high Some genes downstream of Nanog (Kim et al., 2008) were up- [Nanog (H)] by qPCR. Hybridization with the amplified cDNAs or downregulated in Nanog (L) PGCs (see Fig. S6B in the to the Affymetrix GeneChip Mouse Genome 430 2.0 Array supplementary material). The significant decrease in Id1 (Affymetrix) demonstrated that 759 out of 45,101 probes were transcription was verified by qPCR with a single-cell cDNA significantly different between Nanog (L) and (H) in their relative library (see Fig. S7A in the supplementary material). Although the expression level (P<0.05; greater than 2-fold change) (Fig. 7B). mechanism of transcriptional regulation of Id1, which bypasses No change was detected in the Oct4 expression level between the BMP/phosphorylated Smad pathway (Dudley et al., 2007), is Nanog (L) and (H), in agreement with immunostaining (Fig. 4F). unclear, Id1 might be directly downstream of Nanog in PGCs, Furthermore, Sox2, Dppa3, Sll4, Kit, Dnd1, Zfp42 (Rex1), Prdm1, as shown by the binding of Nanog to Id1 in ESCs (Kim et al., Utf1 and Klf5 were highly transcribed even in Nanog (L) PGCs, 2008). similar to in control PGCs. The expression of a few genes in the development and lineage-annotated sequences in the gene DISCUSSION ontology list (Affymetrix) had changed in the Nanog (L) PGCs Nanog is expressed not only in the pluripotential cells of peri- (see Fig. S6A in the supplementary material). These data suggest implantation embryos, but also in the migrating and early gonadal that Nanog KD leads PGCs to apoptotic cell death and not to PGCs of post-implantation embryos (Yamaguchi et al., 2005). A key differentiation. Notably, the expression level of some genes was function of Nanog at the peri-implantation stage is to maintain the significantly up- or downregulated (Fig. 7C; see Table S1 in the pluripotency of early embryonic cells, as revealed in Nanog- supplementary material). For example, those encoding the RNA- deficient embryos produced by genetic disruption of Nanog (Mitsui binding protein Tial1 (Beck et al., 1998), helix-loop-helix (HLH) et al., 2003). Here, to investigate the function and mechanism of family protein Id1 (Norton et al., 1998) and Polycomb repressive Nanog in PGCs, we constructed the NRi-Tg transgenic line, in complex 2 (PRC2) subunit Suz12 (Lee et al., 2006), were which Nanog activity is controlled in vivo through inducible markedly repressed in Nanog (L) PGCs. Disruption of the PGC- transcription of Nanog-specific shRNA with a pSico lentiviral vector specific molecular network, at least that due to downregulation of (Ventura et al., 2004). In combination with two independent Cre- these key genes, might trigger prompt mitotic arrest and cell death expressing transgenic lines, ER-Cre and TNAP-Cre, Cre expression

(Fig. 7D). beginning at ~E8.5-9.0 resulted in a significant reduction in the DEVELOPMENT 4018 RESEARCH ARTICLE Development 136 (23)

migrating PGCs, (2) a deficiency in Nanog triggers apoptosis but not cell differentiation in PGCs, and (3) Nanog is involved in safeguarding the PGC molecular network. The use of an inducible KD system without genetic alteration of the endogenous gene is a powerful tool for analyzing the molecular function of a possibly heteroinsufficient germ cell-specific gene. This is the first report of a successful conditional KD of a germ cell- specific gene in vivo. A conditional KD system is quicker to build than a conventional conditional knockout system, although possible off-target effects have to be carefully examined in order to avoid an overestimation of gene function resulting from non-specific gene silencing. In migrating germ cells, only a few genes have been identified as key regulators. Following germ cell specification, Nanog, Kit, Tial1, Nanos3 and Dnd1 are known to be highly transcribed in migrating PGCs (Beck et al., 1998; Tsuda et al., 2003; Youngren et al., 2005; Yamaguchi et al., 2005). Kit plays a crucial role in the survival of migrating PGCs (Loveland and Schlatt, 1997). Tial1-deficient mice are sterile owing to the loss of PGCs at ~E11.5 (Beck et al., 1998). Knockout of Nanos3 results in the complete loss of PGCs in both sexes in E12.5 embryos (Tsuda et al., 2003). A similar phenomenon was detected after germ cell-specific knockout of Oct4. Oct4- deficient PGCs undergo apoptosis, and a marked reduction in PGCs is detected in E10.5-12.5 embryos (Kehler et al., 2004). Importantly, a common consequence of the loss of gene expression is apoptotic cell death, not cell differentiation. Single-cell microarray analysis demonstrated that abnormal transcription of various types of core regulators, including the RNA-binding protein Tial1, differentiation inhibitor Id1, and PRC2 subunit Suz12, occurred within 24 hours of Nanog downregulation in E10.5 PGCs. Notably, the absence of any significant change in the expression level of genes downstream of Id1 and Suz12 suggests that the prompt cell death response might be induced by abrupt disruption of the PGC molecular network prior to the disordered expression of peripheral genes. Thus, we speculate that the apoptotic cell death of PGCs is triggered by ‘disharmony’ in the gene regulation network. The molecular mechanism involved in Fig. 7. Single-cell microarray analysis of E10.5 ER-Cre/NRi-Tg monitoring ‘harmony’ in the PGC molecular network is unclear. It PGCs. (A)Scheme of the single-cell microarray analysis. (B)Comparison is also unknown whether the apoptosis of Nanog (L) PGCs depends of global gene expression profiles, shown as a heat map. Genes that show a greater than 2-fold change in Nanog (L) versus Nanog (H) PGCs on the Bax pathway, as reported in Steel (Kitl)-deficient (Runyan et are represented. (C)Changes in the expression of selected genes al., 2006) and Nanos3-deficient (Suzuki et al., 2008) PGCs. between Nanog (L) and Nanog (H) PGCs. The ontology of the genes is Apoptotic cell death triggered by a deficiency in any core gene, summarized in Table S1 in the supplementary material. (D)A model of including Nanog, might play an important role in preventing the the molecular network involved in PGC survival and apoptosis induced transmission of abnormal genetic information to the next generation. by Nanog knockdown. An interesting point is that Oct4 and Nanog exhibit similar dual physiological roles, which are essential for maintaining pluripotency in early embryonic cells and for supporting survival in migrating PGCs. It is still unclear why a deficiency in Nanog and Oct4 induces gonadal PGCs of E12.5 male and female embryos. a distinctive phenotype in early embryonic cells and PGCs. A Immunohistochemical analyses of the migrating PGCs of E9.5 and possible explanation is that the molecular network supporting the E10.5 TM-administered ER-Cre/NRi-Tg embryos demonstrated properties of pluripotent embryonic cells differs from that of that Nanog–/Oct4+ PGCs were first detected at E9.5, and then unipotent PGCs (Kato et al., 1999). In pluripotent embryonic cells, Nanog–/TUNEL+ PGCs appeared at E10.5. The immediate differentiation-associated genes may be ready to be transcribed induction of cell apoptosis following Nanog repression in PGCs quickly following the downregulation of pluripotent guardian genes cultured in vitro suggests that cell death, but not cell differentiation, including Nanog and Oct4, whereas in unipotent PGCs, which are is the key reason for the decrease in PGC numbers. The adult TNAP- specialized toward generating germ cells through tight epigenetic Cre/NRi-Tg males and females were fertile. Notably, some male regulation of gene activation and silencing, a defect in the PGC- TNAP-Cre/NRi-Tg adult mice showed partially retarded specific molecular network triggered by a lack of Nanog or Oct4 development of the seminiferous tubule. A single-cell microarray may cause apoptosis without the alternative option of trans-lineage analysis revealed that changes in gene expression, including differentiation. We found no evidence that Nanog– PGCs downregulation of Tail1, Id1 and Suz12, were associated with differentiated into another type of somatic cell instead of undergoing apoptotic cell death of Nanog KD PGCs. Our data provide apoptosis, although apoptosis and differentiation are induced in the

conclusive evidence that (1) Nanog is required for the survival of ICM cells of Nanog-deficient blastocysts (Silva et al., 2009). In this DEVELOPMENT Safeguard of PGC survival by Nanog RESEARCH ARTICLE 4019 context, the fate of migrating PGCs may be strictly determined by Chambers, I., Colby, D., Robertson, M., Nichols, J., Lee, S., Tweedie, S. and the fixed transcriptional circuitry regulated by stable epigenetic Smith, A. (2003). Functional expression cloning of nanog, a pluripotency sustaining factor in embryonic stem cells. Cell 113, 643-655. modifications that is inappropriate for trans-differentiation to Chambers, I., Silva, J., Colby, D., Nichols, J., Nijmeijer, B., Robertson, M., somatic cells. Vrana, J., Jones, K., Grotewold, L. and Smith, A. (2007). Nanog safeguards Id1 is downstream of the BMP/phosphorylated Smad pathway pluripotency and mediates germline development. Nature 450, 1230-1234. and functions as a dominant-negative binding factor for HLH genes Cheng, J. C., Kinjo, K., Judelson, D. R., Chang, J., Wu, W. S., Schmid, I., Shankar, D. B., Kasahara, N., Stripecke, R., Bhatia, R. et al. (2008). CREB is (Norton et al., 1998). However, phosphorylated Smad1, 5 and 8 are a critical regulator of normal hematopoiesis and leukemogenesis. Blood 111, not detected in migrating PGCs (Dudley et al., 2007). Thus, Id1 has 1182-1192. to be upregulated by another pathway. Considering that Nanog binds Darr, H., Mayshar, Y. and Benvenisty, N. (2006). Overexpression of NANOG in human ESCs enables feeder-free growth while inducing primitive ectoderm to the upstream sequence of Id1 in ESCs, as determined by ChIP- features. Development 133, 1193-1201. on-chip analysis (Kim et al., 2008), and that Id1 is downregulated in Dudley, B. M., Runyan, C., Takeuchi, Y., Schaible, K. and Molyneaux, K. Nanog (L) PGCs, as revealed by single-cell microarray analysis (see (2007). BMP signaling regulates PGC numbers and motility in organ culture. Fig. S7B in the supplementary material), one may suggest that Mech. Dev. 124, 68-77. Filipowicz, W. (2005). RNAi: the nuts and bolts of the RISC machine. Cell 122, 17- Nanog is involved in the regulation of Id1 in PGCs. 20. Oct4 and Sox2 activate Nanog expression through binding to the Ginsburg, M., Snow, M. H. and McLaren, A. (1990). Primordial germ cells in the Octamer/Sox elements upstream of the transcription start site mouse embryo during gastrulation. Development 110, 521-528. Hart, A. H., Hartley, L., Ibrahim, M. and Robb, L. (2004). Identification, cloning (Kuroda et al., 2005; Rodda et al., 2005), although full and expression analysis of the pluripotency promoting Nanog genes in mouse transcriptional regulation of Nanog is complicated by its association and human. Dev. Dyn. 230, 187-198. with many other regulatory factors. In Oct4-deficient PGCs, it is not Hatano, S. Y., Tada, M., Kimura, H., Yamaguchi, S., Kono, T., Nakano, T., evident whether Nanog and Sox2 are expressed appropriately Suemori, H., Nakatsuji, N. and Tada, T. (2005). Pluripotential competence of cells associated with Nanog activity. Mech. Dev. 122, 67-79. (Kehler et al., 2004). It is possible that apoptosis of the Oct4- Hayashi, K., de Sousa Lopes, S. M. and Surani, M. A. (2007). Germ cell deficient PGCs might be detected as a consequence of the prompt specification in mice. Science 316, 394-396. repression of Nanog, which is downstream of Oct4. Apoptosis of Hayashi, S. and McMahon, A. P. (2002). Efficient recombination in diverse – + tissues by a tamoxifen-inducible form of Cre: a tool for temporally regulated Nanog /Oct4 PGCs in our KD analyses clearly demonstrated that gene activation/inactivation in the mouse. Dev. Biol. 244, 305-318. Oct4 expression is insufficient to prevent apoptosis in Nanog- Hough, S. R., Clements, I., Welch, P. J. and Wiederholt, K. A. (2006). deficient PGCs. Differentiation of mouse embryonic stem cells after RNA interference-mediated Interestingly, Nanog-null ESCs can self-renew indefinitely with silencing of OCT4 and Nanog. Stem Cells 24, 1467-1475. Kanegae, Y., Lee, G., Sato, Y., Tanaka, M., Nakai, M., Sakaki, T., Sugano, S. an undifferentiated status, although they are prone to differentiation, and Saito, I. (1995). Efficient gene activation in mammalian cells by using suggesting that Nanog stabilizes ESCs in culture by resisting or recombinant adenovirus expressing site-specific Cre recombinase. Nucleic Acids reversing alternative gene expression programs (Chambers et al., Res. 23, 3816-3821. Kato, Y., Rideout, W. M., Hilton, K., Barton, S. C., Tsunoda, Y. and Surani, M. 2007). Nanog-null ESCs have the potential to generate chimeric A. (1999). Developmental potential of mouse primordial germ cells. fetuses and adults through multi-lineage differentiation in somatic Development 126, 1823-1832. cells, indicating that Nanog expression is not required for the Kawase, E., Yamamoto, H., Hashimoto, K. and Nakatsuji, N. (1994). Tumor development and maturation of somatic tissues. In germ cells, the necrosis factor-alpha (TNF-alpha) stimulates proliferation of mouse primordial germ cells in culture. Dev. Biol. 161, 91-95. colonization of Nanog-null cells was detected in the PGCs of the Kehler, J., Tolkunova, E., Koschorz, B., Pesce, M., Gentile, L., Boiani, M., genital ridges of E11.5, but not E12.5, chimeric embryos (Chambers Lomeli, H., Nagy, A., McLaughlin, K. J., Scholer, H. R. et al. (2004). Oct4 is et al., 2007). This finding differs from our present observation that required for primordial germ cell survival. EMBO Rep. 5, 1078-1083. Kim, J., Chu, J., Shen, X., Wang, J. and Orkin, S. H. (2008). An extended Nanog-deficient PGCs start dying due to apoptosis within 48 hours transcriptional network for pluripotency of embryonic stem cells. Cell 132, 1049- of Nanog KD during the migrating stages. Survival of the Nanog- 1061. null PGCs in E11.5 chimeras could be a consequence of Koshimizu, U., Taga, T., Watanabe, M., Saito, M., Shirayoshi, Y., Kishimoto, T. and Nakatsuji, N. (1996). Functional requirement of gp130-mediated compensation by other transcriptional circuitries acquired in ESC signaling for growth and survival of mouse primordial germ cells in vitro and culture (Chambers et al., 2007). This would explain the discrepancy derivation of embryonic germ (EG) cells. Development 122, 1235-1242. that Nanog KD in normal ESC lines induces cell differentiation (Fig. Kurimoto, K., Yabuta, Y., Ohinata, Y. and Saitou, M. (2007). Global single-cell 1E) (Hough et al., 2006), whereas selected Nanog-null ESCs cDNA amplification to provide a template for representative high-density oligonucleotide microarray analysis. Nat. Protocol 2, 739-752. maintain a capability for self-renewal and pluripotency. Notably, Kuroda, T., Tada, M., Kubota, H., Kimura, H., Hatano, S. Y., Suemori, H., Nanog is specifically required for the proliferation and survival of Nakatsuji, N. and Tada, T. (2005). Octamer and Sox elements are required for migrating PGCs of wild-type embryos. transcriptional cis regulation of Nanog gene expression. Mol. Cell. Biol. 25, 2475-2485. Acknowledgements Lee, T. I., Jenner, R. G., Boyer, L. A., Guenther, M. G., Levine, S. S., Kumar, R. M., Chevalier, B., Johnstone, S. E., Cole, M. F., Isono, K. et al. (2006). We thank Dr Tyler Jacks for the pSico vector, Dr Hideki Enomoto for the ER-Cre Control of developmental regulators by Polycomb in human embryonic stem transgenic mouse, Dr Masakazu Hattori for the AdCre adenovirus, and Drs cells. Cell 125, 301-313. Yoshio Koyanagi and Jun Aoki for instructions for lentivirus manipulation. This Li, J., Shen, H., Himmel, K. L., Dupuy, A. J., Largaespada, D. A., Nakamura, work was partly funded by grants from the Japan Society for the Promotion of T., Shaughnessy, J. D., Jr, Jenkins, N. A. and Copeland, N. G. (1999). Science, the Ministry of Education, Culture, Sports, Science and Technology Leukaemia disease genes: large-scale cloning and pathway predictions. Nat. and the Core Research for Evolutional Science and Technology (Japan Science Genet. 23, 348-353. and Technology Agency) to T.T. Liang, J., Wan, M., Zhang, Y., Gu, P., Xin, H., Jung, S. Y., Qin, J., Wong, J., Cooney, A. J., Liu, D. and Songyang, Z. (2008). Nanog and Oct4 associate Supplementary material with unique transcriptional repression complexes in embryonic stem cells. Nat. Supplementary material for this article is available at Cell Biol. 10, 731-739. http://dev.biologists.org/cgi/content/full/136/22/4011/DC1 Lomeli, H., Ramos-Mejia, V., Gertsenstein, M., Lobe, C. G. and Nagy, A. (2000). Targeted insertion of Cre recombinase into the TNAP gene: excision in References primordial germ cells. Genesis 26, 116-117. Beck, A. R., Miller, I. J., Anderson, P. and Streuli, M. (1998). RNA-binding Loveland, K. L. and Schlatt, S. (1997). Stem cell factor and c-kit in the protein TIAR is essential for primordial germ cell development. Proc. Natl. Acad. mammalian testis: lessons originating from Mother Nature’s gene knockouts. J.

Sci. USA 95, 2331-2336. Endocrinol. 153, 337-344. DEVELOPMENT 4020 RESEARCH ARTICLE Development 136 (23)

Matsui, Y., Zsebo, K. and Hogan, B. L. (1992). Derivation of pluripotential Silva, J., Nichols, J., Theunissen, T. W., Guo, G., van Oosten, A. L., embryonic stem cells from murine primordial germ cells in culture. Cell 70, 841- Barrandon, O., Wray, J., Yamanaka, S., Chambers, I. and Smith, A. (2009). 847. Nanog is the gateway to the pluripotent ground state. Cell 138, 722-737. Mitsui, K., Tokuzawa, Y., Itoh, H., Segawa, K., Murakami, M., Takahashi, K., Suzuki, H., Tsuda, M., Kiso, M. and Saga, Y. (2008). Nanos3 maintains the germ Maruyama, M., Maeda, M. and Yamanaka, S. (2003). The homeoprotein cell lineage in the mouse by suppressing both Bax-dependent and -independent nanog is required for maintenance of pluripotency in mouse epiblast and ES apoptotic pathways. Dev. Biol. 318, 133-142. cells. Cell 113, 631-642. Tsuda, M., Sasaoka, Y., Kiso, M., Abe, K., Haraguchi, S., Kobayashi, S. and Miyoshi, H., Blomer, U., Takahashi, M., Gage, F. H. and Verma, I. M. (1998). Saga, Y. (2003). Conserved role of nanos proteins in germ cell development. Development of a self-inactivating lentivirus vector. J. Virol. 72, 8150-8157. Science 301, 1239-1241. Mullin, N. P., Yates, A., Rowe, A. J., Nijmeijer, B., Colby, D., Barlow, P. N., Ui-Tei, K., Naito, Y., Zenno, S., Nishi, K., Yamato, K., Takahashi, F., Juni, A. Walkinshaw, M. D. and Chambers, I. (2008). The pluripotency rheostat and Saigo, K. (2008). Functional dissection of siRNA sequence by systematic Nanog functions as a dimer. Biochem. J. 411, 227-231. DNA substitution: modified siRNA with a DNA seed arm is a powerful tool for Norton, J. D., Deed, R. W., Craggs, G. and Sablitzky, F. (1998). Id helix-loop- mammalian gene silencing with significantly reduced off-target effect. Nucleic helix proteins in cell growth and differentiation. Trends Cell Biol. 8, 58-65. Acids Res. 36, 2136-2151. O’Bryan, M. K. and de Kretser, D. (2006). Mouse models for genes involved in Ventura, A., Meissner, A., Dillon, C. P., McManus, M., Sharp, P. A., Van Parijs, impaired spermatogenesis. Int. J. Androl. 29, 76-89; discussion 105-108. L., Jaenisch, R. and Jacks, T. (2004). Cre-lox-regulated conditional RNA Pan, G. and Thomson, J. A. (2007). Nanog and transcriptional networks in interference from transgenes. Proc. Natl. Acad. Sci. USA 101, 10380-10385. embryonic stem cell pluripotency. Cell Res. 17, 42-49. Wang, J., Levasseur, D. N. and Orkin, S. H. (2008). Requirement of Nanog Rodda, D. J., Chew, J. L., Lim, L. H., Loh, Y. H., Wang, B., Ng, H. H. and dimerization for stem cell self-renewal and pluripotency. Proc. Natl. Acad. Sci. Robson, P. (2005). Transcriptional regulation of nanog by OCT4 and SOX2. J. USA 105, 6326-6331. Biol. Chem. 280, 24731-24737. Wu, Q., Chen, X., Zhang, J., Loh, Y. H., Low, T. Y., Zhang, W., Zhang, W., Roy, A. and Matzuk, M. M. (2006). Deconstructing mammalian reproduction: Sze, S. K., Lim, B. and Ng, H. H. (2006). Sall4 interacts with Nanog and co- using knockouts to define fertility pathways. Reproduction 131, 207-219. occupies Nanog genomic sites in embryonic stem cells. J. Biol. Chem. 281, Runyan, C., Schaible, K., Molyneaux, K., Wang, Z., Levin, L. and Wylie, C. 24090-24094. (2006). Steel factor controls midline cell death of primordial germ cells and is Yamaguchi, S., Kimura, H., Tada, M., Nakatsuji, N. and Tada, T. (2005). Nanog essential for their normal proliferation and migration. Development 133, 4861- expression in mouse germ cell development. Gene Expr. Patterns 5, 639-646. 4869. Yasuda, S., Tsuneyoshi, N., Sumi, T., Hasegawa, K., Tada, T., Nakatsuji, N. Shaw, A. T., Meissner, A., Dowdle, J. A., Crowley, D., Magendantz, M., and Suemori, H. (2006). NANOG maintains self-renewal of primate ES cells in Ouyang, C., Parisi, T., Rajagopal, J., Blank, L. J., Bronson, R. T. et al. (2007). the absence of a feeder layer. Genes Cells 11, 1115-1123. Sprouty-2 regulates oncogenic K-ras in lung development and tumorigenesis. Youngren, K. K., Coveney, D., Peng, X., Bhattacharya, C., Schmidt, L. S., Genes Dev. 21, 694-707. Nickerson, M. L., Lamb, B. T., Deng, J. M., Behringer, R. R., Capel, B. et al. Silva, J., Chambers, I., Pollard, S. and Smith, A. (2006). Nanog promotes (2005). The Ter mutation in the dead end gene causes germ cell loss and transfer of pluripotency after cell fusion. Nature 441, 997-1001. testicular germ cell tumours. Nature 435, 360-364. DEVELOPMENT