City University of New York (CUNY) CUNY Academic Works

Dissertations and Theses City College of New York

2012

The Molecular and Genetic Characterization of l(3)hem2 and l(3)hem1, Putative Novel Alleles of the Neurogenic , neuralized

Maria A. Otazo CUNY City College

How does access to this work benefit ou?y Let us know!

More information about this work at: https://academicworks.cuny.edu/cc_etds_theses/156 Discover additional works at: https://academicworks.cuny.edu

This work is made publicly available by the City University of New York (CUNY). Contact: [email protected]

The Molecular and Genetic Characterization of l(3)hem2 and l(3)hem1, Putative Novel Alleles of the Neurogenic Gene, neuralized

by

María A. Otazo

A master’s thesis submitted to the Graduate Faculty in Liberal Studies in partial fulfillment of the requirements for the degree of Master of Arts, The City College of New York

2011

1

This manuscript has been read and accepted for the Graduate Faculty in Biology in satisfaction of the requirement for the degree of Master of Arts.

Shubha Govind, Ph.D. 27 April 2011 ______Thesis Advisor Date

Approved

Mark Pezzano, Ph.D.

Shireen Saleque, Ph.D.

Supervisory Committee

THE CITY COLLEGE OF NEW YORK

2 Abstract The Molecular and Genetic Characterization of l(3)hem2 and l(3)hem1, Putative Novel Alleles of the Neurogenic Gene, neuralized

by

María A. Otazo

Advisor: Shubha Govind

The Notch (N) pathway is evolutionarily conserved throughout vertebrates and most invertebrates and has been implicated in numerous human diseases including cancers. The N pathway component, Neuralized (Neur), is responsible for N ligand ubiquitination and recycling, resulting in proper N pathway activation. Although N and

Neur are implicated in neural development, N’s role in hematopoiesis has been studied extensively, but Neur currently has not been linked to hematopoiesis. We have mapped a

P element insertion to the neur locus in the previously uncharacterized mutant, l(3)hem2, and confirmed that it is a novel embryonic lethal allele of neur. Using imprecise excisions, we generated l(3)hem2 excision stocks that also do not complement l(3)hem2 and neur. We have also shown that the hematopoietic mutant, l(3)hem1, is an allele of neur. Although Neur is detected in l(3)hem1 mutants and predicted primary protein structure is unaffected, our preliminary data point to regulation of transcription or a post-transcriptional step affecting neur transcript abundance. Characterization of the mutant phenotype suggests a role for l(3)hem1 in hematopoietic cell division and differentiation. Our results provide insight into a novel role for neurogenic Neur in hematopoiesis. They also characterize l(3)hem1, a widely-utilized hematopoietic mutant model. Since N has been implicated in many types of cancer, this report underscores the importance of the broad and diverse roles played by the N pathway.

3 Acknowledgments

I am thankful to Juyung Yang for performing plasmid rescue experiments and sequencing, and to Eric Spana for sequencing of l(3)hem1 and 402D9 and for professional feedback. I especially thank Sharon Leung. Although I have never met, her complementation data, deficiency crosses and imprecise excision lines have been instrumental to this project.

I am thankful to Dr. Govind and Chiyedza Small, who completed endless complementation tests, all in the name of neur.

I am thankful to Eric Lai for the gift of Neur antibody, to Bloomington Stock

Center for providing fly stocks, and to Arno Muller for the stock Tp(Fa11 e).

I am thankful to all members of the Govind lab who have contributed to this project, whether by performing actual experiments or by providing feedback. Indira

Paddibhatla, Marta Kalamarz and Gwenaelle Gueguen provided thoughtful feedback, animated discussions, cookies and chocolate. I am especially thankful to Indira

Paddibhatla, who has been an invaluable resource for all types of microscopy (especially confocal) and imaging in general, as well as a Photoshop expert. I am thankful to Roma

Rajwani for assistance of every kind whenever I have needed it, for laboratory scheduling support and for all lab party planning.

I am thankful to Marta Kalamarz and her 10 solutions to any problem, personal or antibody-related.

I am thankful to Gwenaelle Gueguen for critical input, endless lunches together, and many discussions about delicious meats.

4 I am thankful to my family for their support. They have recognized and respected the personal and professional importance of this work and of my education.

I am thankful to my committee members, Dr. Mark Pezzano and Dr. Shireen

Saleque. They provided invaluable feedback and support, and both maintained a sense of humor during my thesis defense. In addition, both have been my professors in the past and have taught me a lot.

Warmest thanks go to Chiyedza Small, who has helped me in many ways. She taught me how to keep fly stocks, dissect lymph glands, prepare embryonic cuticles, use the confocal microscope, among many other skills. Her infinite patience and support have been much appreciated throughout the learning process, and she continues to teach me even now.

My strongest gratitude is reserved for Dr. Shubha Govind. She single-handedly aroused my interest in Genetics as an undergraduate, and continues to inspire me and to sometimes drive me crazy (with love, of course) for the world of l(3)hem1.

5 Table of Contents

Abstract 3

Acknowledgments 4

Table of Contents 6

List of Figures 7

Introduction 8

Significance 14

Results 15

Discussion 26

Experimental Procedures 33

References 37

Figure Legends 42

Figures 47

6 List of Figures

Figure 1 l(3)hem2 is characterized by a P{LacW} element insertion within the neur locus 47

Figure 2 The creation of l(3)hem2 excisions 48

Figure 3 Complementation analysis for l(3)hem2, neurA101, l(3)hem2 excisions and l(3)hem1. 49

Figure 4 Deficiency mapping shows that l(3)hem1 falls within the neur locus 50

Figure 5 A deletion/duplication carrying the neuralized locus rescues l(3)hem1 lethality 51

Figure 6 neurA101, l(3)hem2, l(3)hem2 excision lines and l(3)hem1 show similar neurogenic embryonic phenotypes 52

Figure 7 l(3)hem1 lymph glands are morphologically abnormal 53

Figure 8 l(3)hem2/l(3)hem1 trans-heterozygote lymph glands are morphologically abnormal and resemble a weak, l(3)hem1-like phenotype. 54

Figure 9 l(3)hem2 excision mutants 0420D20Hop and 0402D92535 lymph glands are morphologically abnormal and resemble a weak, l(3)hem1-like phenotype 55

Figure 10 l(3)hem1 mutants show dysregulation of neur transcript expression 56

List of Tables

Table 1 A summary of l(3)hem1 polymorphisms at the neur Locus 57

7 Introduction

The Notch (N) pathway is evolutionarily conserved in metazoans, and is important for many cell-cell communication events in development and in cell lineage specification (Weinstein, Roberts and Lemke, 1991; Artavanis-Tsanokas et al, 1999). In mammals, N is required in development for early vascularization and development of both the central and peripheral nervous systems (Krebs et al, 2001; Weinstein, Roberts and Lemke, 1991). Mammals have four different N receptors (Notch1-4) and 6 possible

N ligands (Jagged 1-2, Delta1, 3 and 4). In humans, Notch3 loss of function causes

CADASIL, a severe vascular degeneration disease characterized by ischemic strokes and cognitive decline (Tang et al, 2009). Notch1, the most well studied mammalian form of

N, is expressed in the spinal cord, brain and sensory organs throughout early murine development (days 9-16; Weinstein, Roberts and Lemke, 1991). Overall, N plays an integral role in post-implantation development, evidenced by Notch1 knock out mice that do not survive past 11.5 days in utero (Swiatek et al, 1994).

In addition to its role in vascularization and nervous system development, N plays several roles in mammalian hematopoiesis. The Notch1 receptor suffers recurrent breakpoint in a subset of human patients with T cell acute lymphoblastic lymphoma

(Ellisen et al, 1991), which places a portion of Notch1 gene under the transcriptional control of the T cell receptor  (TCR) gene. The translocations of Notch1 lead to dysregulated Notch1 expression of a truncated, constitutively active form. In addition to having a small body size, Notch1 knock-out mice have an abnormally small thymus with few thymocytes, and these mice and are unable to specify mature T cells (Radke et al,

1999). A constitutively active retroviral form of Notch1 resulted in a block in B cell

8 development, suggesting that N specifies the T cell lineage over the B cell lineage (Pui et al, 1999). The effect of Notch on hematopoietic stem cells (HSCs) is currently of great interest. In one report, bone marrow transplants from virally transduced mice with overactive Notch1 into RAG-/- recipients affected the recipient HSC pools. Specifically,

HSC proliferative potential increases while HSC differentiation decreases in vivo, resulting in larger HSC pools. In addition, self-renewal capabilities increase, as shown by secondary implantation experiments (Steir et al, 2002). Notch therefore regulates HSC pool size, self-renewal and differentiation of HSCs. This latter result was confirmed by the discovery that Notch1 is critical for HSC maintenance in an immature state, and inhibition of Notch1 signaling leads to differentiation of cells that lack self-renewal capabilities (Duncan et al, 2005).

Like mammals, N in D. melanogaster is also involved in neural development and hematopoiesis. In embryonic stages, N acts as a neurogenic gene needed for proper development of sensory organs. Specifically, N promotes epidermal versus neuroblast cell fate decisions in the early embryo (Lehmann et al, 1983; Campos-Ortega and Jan,

1991) via lateral inhibition (reviewed in Bigas, Robert-Moreno and Espinoza, 2010).

Lateral inhibition is a process by which, from an equivalent group of cells, one cell expresses high levels of N ligands. This activates the N pathway in surrounding cells, promoting the epidermal cell fate decision while inhibiting the neuroblast cell fate decision in surrounding cells. D. melanogaster has only one N receptor which interacts with the ligands Serrate (Ser) or Delta (Dl). The extracellular domains of N and ligands interact, catalyzing three cleavage events in the N intracellular domain. Freed from the membrane, the intracellular domain (NICD) translocates to the nucleus where it acts as a

9 transcription factor and activates downstream effector molecules (Artavanis-Tsakonas,

1999; Lai et al, 2001; Pavlopaolos et al, 2001).

N plays a role in the specification and differentiation of blood cells in Drosophila

(Duvic et al, 2002, Lebestky et al, 2003). Drosophila has three blood cell lineages: crystal cells release phenoloxidases after immune challenge; plasmatocytes phagocytose pathogens in a macrophage-like manner; and lamellocytes produce a melanization enzyme and encapsulate parasitoid wasp eggs. The latter differentiate in response to parasitoid infection (Crozatier and Meister, 2007). N is necessary for the differentiation of crystal cell and lamellocyte lineages (Duvic et al, 2002; Crozatier and Meister, 2007).

The gene neuralized (neur) encodes a E3 ligase (Lai et al, 2001) that ubiquitinates N ligands Ser and Dl, a necessary step in N pathway activation. Like N,

Neur is conserved in flies, nematodes, mice and humans (Ruan et al, 2001). neur encodes a peripheral membrane protein that contains two Neuralized homology repeat domains

(NHR1 and NHR2) and a carboxy terminal RING domain that serves a E3 ubiquitin ligase function (Yeh et al, 2001; Lai et al, 2001). Both isoforms of Neur, isoforms 1A and

1C, contain the same NHR and RING domains, differing only in their first exons. The N terminus of isoform 1A is longer and contains a glutamine/histidine-rich region and a lysine-arginine rich region that serve to localize the protein to the plasma membrane.

Isoform 1C has a unique region of 8 amino acids. It has been shown that isoform 1A is plasma membrane bound and isoform 1C is cytoplasmic and sequestered in vesicles

(Commisso and Boulianne, 2007). Whereas the RING domain is necessary and sufficient for monoubiquitination of Dl and Ser (Yeh et al, 2001), the NHR1 domain is responsible for protein-protein interactions with Dl and Ser. Through the NHR1, Neur is localized to

10 the intracellular side of the plasma membrane where it ubiquitinates Dl and Ser, activating them (Commisso and Boulianne, 2007). Monoubiquitination serves as a signal for endocytosis. The interaction between N and its ligand causes endocytosis of the ligand in the signal-sending cell. Endocytosis coupled with the continued interaction between N and its ligand mechanically pulls on the N receptor, exposing a site of cleavage. Once unmasked, metalloproteases access this S2 cleavage site, triggering the first step in N signaling (Tien et al, 2009). The continuous endocytosis of N ligands and replenishment, or ligand recycling, on the plasma membrane of the signal-sending cell is necessary for proper N signaling events (Lai et al, 2005). It has been shown that Delta ubiquitination via Neur regulates Notch pathway activity in stage 5 embryos (Bardin and

Schweisguth, 2006). However, although N has been linked to hematopoiesis in mammalian and Drosophila systems, Neur has not.

Humans and mice have five encoding Neuralized-like proteins (neurl1a, neurl1b, and neurl2-4; Mouse Genome Database version MGI_4.41; UniProt Consortium

2002-2011) that are located on different . All Neurl proteins have two

NHR domains and one RING finger domain (Mouse Genome Database). Neurl1a is the most well characterized of the Neurl proteins. Like N, Neurl has been implicated in several cancer phenotypes in humans. Neur1lA is deleted or downregulated in patients with malignant astrocytomas (Nakamura et al, 1998). It was recently proposed that

Neurl1A is a tumor suppressor candidate gene in human medullary blastoma (Teider et al, 2010). In mice, neurl1a mutants survive until adult stages, although reports of pleiotropic effects show that Neurl1A regulates processes as diverse as olfactory discrimination, hypersensitivity to ethanol (Ruan et al, 2001), spermatogenesis and

11 maturation of mammary glands in adults (Vollrath et al, 2001). Due to multiple paralogs of genes in mammalian genomes, functional redundancy may limit the understanding of the precise functions of individual Neurl proteins. In D. melanogaster,

Neur is necessary for proper epidermal specification and development of the peripheral nervous system (Boulianne et al, 2001). Like N mutants, neur mutants display a lethal embryonic phenotype involving neural hyperplasia where neuroblasts differentiate at the expense of epidermis (Comisso and Boulianne, 2007).

Drosophila is used as a model for hematopoiesis because of high conservation between Drosophila and mammalian systems and because of the simplicity of the

Drosophila hematopoietic system. D. melanogaster has three larval hematopoietic compartments, one of which is called the lymph gland. The lymph gland of D. melanogaster is a specialized hematopoeitic organ that has been studied intensively for conserved insect and vertebrate hematopoiesis and immune responses. The anterior-most lobes of the third instar lymph gland have three zones. The medullary zone (MZ) houses quiescent, immature progenitor cells. The cortical zone (CZ) contains mature, differentiated cells, and is thought to be the exit site from the gland. The posterior signaling center (PSC) controls hemocyte homeostasis and contains progenitors that resemble stem cells (Krzemien et al, 2010). Although D. melanogaster blood cells resemble mammalian cells from myeloid lineage and lack known lymphoid lineage cells, basic signaling pathways and developmental cues that govern cell differentiation or cell fate adoption are conserved. This leads to the idea that specification, differentiation, survival and maintenance of HSCs and mature hemocytes may follow the same developmental “map” in Drosophila and in mammalian systems.

12 The simplicity of the Drosophila hematopoietic system compared to mammalian systems facilitates hematopoietic studies. Drosophila has fewer hematopoietic compartments in comparison to mammals. Drosophila has only three blood cell lineages, whereas mammals have seven mature myeloid lineages and three lymphoid lineages. In addition, gene orthologs commonly have less functional redundancy and gene copy numbers in Drosophila than in mammals. Functional redundancy, coupled with multiple functions in development, hinder studies of N when it is necessary to “tease out” specific contributions of the individual receptors.

The mutant lethal (3) hematopoiesis missing 1 (l(3)hem1) is currently a model for defective hematopoiesis, having a reduced hemocyte number and defective cellular division in larval proliferating tissues (Gateff, 1994; Leung and Govind, 2003; Charroux and Royet, 2009; Kurucz et al, 2003). A developmental delay and morphological abnormalities have also been reported in l(3)hem1 mutants (Charroux and Royet, 2009).

Genetic, molecular and phenotypic analyses of l(3)hem1 and the previously uncharacterized mutant, l(3)hem2, suggest that these mutants are caused by aberrations within the neur locus. In this report, we have identified and characterized several new alleles of the gene neur: l(3)hem2, l(3)hem2 imprecise excisions and l(3)hem1. Our data show that neur plays a role in proper cellular division and in the maintenance of immature cellular identities within the lymph gland. Largely known as a neurogenic gene, neur has not previously been implicated in hematopoiesis. Given the importance of

N and Neur in Drosophila and mammalian models, the neur mutants l(3)hem2 and l(3)hem1 provide further insight into the many roles of the N pathway.

13 Significance

Hematopoiesis is a dynamically regulated process that is continuously changing to meet the demands of the organism, whether it is an immune challenge or injury. To understand hematopoietic malignancies and how they form, it is important to understand the proteins and molecular factors that act as cellular clues for normal hematopoiesis.

The Notch pathway is highly complex and involved in vertebrate and Drosophila hematopoiesis. The pathway is activated by ligands that are localized to a subset of

“signal-sending cells,” and its outcome in vivo is context dependent. In some cell types, however, the N pathway can be active independently of ligands. Neur is involved in ligand activation and presentation in signal-sending cells. In Drosophila, Neur modulates the activity of both ligands Delta and Serrate through monoubiquitin modification, therefore regulating N pathway activation. The mutants l(3)hem1 and l(3)hem2 are linked in this report to hematopoietic function. We have suggested that these mutants are allelic to each other and to neur. A first study of Neur in the larval hematopoietic system is likely to reveal how N signaling controls normal hematopoietic development. Due to the correlation of aberrant N signaling with cancer in mammalian systems (Zweidler-McKay and Pear, 2004), a full understanding of Neur function in relation to N is likely provide more insight into cancer development.

14 Results l(3)hem2 P element maps to the gene neur

According to FlyBase, the gene l(3)hem has two alleles: l(3)hem1 and l(3)hem2, the latter being created using P-element insertional mutagenesis (Gateff, 1994; Gateff and

Schmidt, 1991; Umea Stock Center; FlyBase, version FB2011_04). l(3)hem1 is induced with EMS, while l(3)hem2 carries a P element transposon. Although Dr. Elizabeth Gateff is credited for creating l(3)hem2, she is not the creator (personal communication). This mutant, therefore, has an unknown origin. The P{lacW} element in l(3)hem2 is inserted into an unknown locus. As it is more straightforward to map the location of a P element in the genome compared to mapping an EMS-induced lesion that might affect a few bases, we decided to use the l(3)hem2 mutation as an “entry” to the molecular genetic analysis of l(3)hem1. We sought not only to define the insertion point of the P element, but also to characterize the mutation l(3)hem2.

Plasmid rescue is a technique by which genomic DNA flanking a P element can be isolated and sequenced, therefore allowing for the determination of the exact genomic insertion position (Hicks et al, 1997; Stanford, Cone and Cordes, 2001). The P{lacW} element in genomic DNA of l(3)hem2 heterozygote adults was sequenced, along with flanking genomic DNA. A BLAST analysis of the isolated genomic region identified the neurogenic gene, neur, with a 97% identity. The P element insertion point is 3’ to genomic position 4,859,473 (Figure 1; FlyBase 2011_04), mapping to an intronic region directly upstream of the 5’ UTR of the alternatively-spliced first exon of neur isoforms A and B. A separate sequencing analysis confirmed the presence and location of the P element (data not shown). The genomic organization in reference to the insertion is

15 shown in Figure 1A. The nucleotide sequence of this region, including exon 1A, is shown in Figure 1B. It is interesting to note that the P element insertion point is directly after the TATAAA consensus sequence (Figure 1B, underlined), a well-established promoter motif for Drosophila genes (Ohler et al, 2002; Ohler, 2006). It is possible that the P element insertion distances this promoter motif from the transcription start site (TSS) to an extent that transcription of the neur locus in l(3)hem2 mutants is affected. This region appears to be a transposition “hotspot” as many other transposon-induced neur alleles map to this genomic region immediately upstream of the 5’ UTR of neur A (FlyBase

2011_04 and data not shown). Therefore, disruption of a noncoding region via the P element insertion in l(3)hem2 appears to be sufficient to affect the locus and organismal viability.

l(3)hem2 does not complement known neur allele or excision lines

To confirm that the mutant l(3)hem2 phenotype was caused by the P element insertion and not by an extragenic mutation, we generated a number of excision lines from l(3)hem2 mutants. Excisions are achieved by removing most or all of a P element insertion via transposase mobilization (Voelker et al, 1984). Whereas a precise excision cleanly removes the P element only and reverses the mutant phenotype to wildtype, an imprecise excision generally deletes a small amount of genomic DNA flanking the insertion site and can worsen the mutant phenotype (Voelker et al, 1984). Through precise excision of the P{w+} element in l(3)hem2, we generated complete revertants that were viable in trans to l(3)hem2. This showed that l(3)hem2 lethality is indeed due to the

P element insertion in the neur locus (Figure 2A). We first created several imprecise

16 excision lines, including 0402D92535, 0402D20Hop, 0501D122535 and 0509D122535

(Figure 2B). The excision 0402D9 strain has the same mutant as

0402D92535 but in trans to a different balancer chromosome. These excisions failed to complement l(3)hem2 (Figure 3B).

To test if l(3)hem2 is an allele of neur, complementation tests were done using neurA101, a known hypomorphic allele of neur (Price et al, 1993; Yeh et al, 2000; Lai et al, 2005; Figure 3A). Notably, l(3)hem2 did not complement neurA101, indicating that neurA101 and l(3)hem2 may be allelic. l(3)hem2 also failed to complement other established neur alleles, neur1 and neur11 (data not shown). This result suggests that all l(3)hem2 excision lines, l(3)hem2 and neurA101 are allelic.

Complementation suggests that l(3)hem2, l(3)hem2 imprecise excision mutants and l(3)hem1 are allelic

The early lethality of l(3)hem2 mutants limits our studies of hematopoiesis at larval stages; we therefore examined the other putative allele of l(3)hem, l(3)hem1.

Although these mutants are listed as alleles (FlyBase 2011_04), their relationship has yet to be shown experimentally. To determine whether l(3)hem1 and l(3)hem2 are allelic, we performed a series of complementation tests (Figure 3A). Complementation data suggest that l(3)hem1 and l(3)hem2 are allelic, having a 0% viability in trans-heterozygotes.

Furthermore, l(3)hem1 does not complement l(3)hem2 excisions (Figure 3A,B). While l(3)hem1 failed to complement 0402D9 (Figure 3A), 0402D92535, and other l(3)hem2 imprecise excision lines (Figure 3B), unexpectedly, it did complement neurA101 and other bona fide neur alleles (Figure 3A and data not shown). These results suggest that the

17 l(3)hem1 mutation maps to the vicinity of the l(3)hem2 P element insertion and that its relationship to the neur locus may be complex.

Complementation using deficiency lines supports l(3)hem1’s assignment to the neur locus

Using known DrosDel deficiency stocks within the neur region (Ryder et al,

2007), we performed complementation tests to further examine if l(3)hem1 might map in the vicinity of the l(3)hem2 insertion within the neur locus (Figure 4). We expected that l(3)hem2 would fully complement deletions 9225 and 9338 (Ryder et al, 2007; http://flybase.org/reports/FBab0036537.html and http://flybase.org/reports/FBab0036532.html, respectively) because the deletion breakpoints map upstream of the P element insertion (Figure 4A, dotted line). Notably, deletion 9225 (Ryder et al, 2007), which has a deletion of neur exon 1C and intron 1, only partially complemented neurA101 (86.76%) and l(3)hem1 (65.45%; Figure 4B), indicating that the putative l(3)hem1 mutation may lie within this region of the neur locus (Figure

4A). Also of interest, the allele 0402D92535 only partially complements deficiency 9203

(http://flybase.org/reports/FBab0036567.html) although l(3)hem2 complements with greater than 100% viability. This could be indicative of a sizable deletion upstream, and including, the l(3)hem2 insertion point.

We also did complementation with known alleles of the gene hyrax (hyx), whose coding region overlaps that of neur (Mosimann, Hausmann and Basler, 2006; Figure

4B,C). hyx alleles, known as hyxEP9 and hyxEP10, or neurEP9 and neurEP10, predictably did not complement any deletions fully with the exception of 9225, which fully complemented hyx1. hyx1 has a premature stop codon which falls outside of the deleted region in 9225, allowing for complementation. These data conclusively showed that

18 l(3)hem2, l(3)hem2 excisions and l(3)hem1 result from aberrations within the gene neur, not hyx. Because l(3)hem1 survives until the late third instar larval stage, we propose that l(3)hem1 is a weak allele of l(3)hem2.

l(3)hem1 viability is rescued by a duplication containing neur

Our next step was to attempt to rescue the l(3)hem1 phenotype using a duplication and deficiency stock, Tp(3;1)Dp(Fa11); Df(Fa11e)/TM3 Sb Ser e. This stock results from an interchromosomal transposition, resulting in a deficiency of chromosomal regions 84DE-87D on the third chromosome and a duplication of the same region on the first chromosome (Muller, Samanta and Weischaus, 1999). neur falls within the duplicated and deleted region, having a cytological location of 85C2-3 (FlyBase

2011_04). Notably, male offspring that have the deficiency Df(Fa11 e) in trans to l(3)hem1 but lack the duplication Dp(Fa11) are not viable (Figure 5, grey shading), confirming the presence of a deletion at the neur locus. Females containing both the duplication and deletion in trans to l(3)hem1 are completely viable (157%, n = 535;

Figure 5). This complete rescue of l(3)hem1 viability suggests that lesions in l(3)hem1 map within the 84-86C3 region.

l(3)hem2, l(3)hem2 imprecise excision mutants and l(3)hem1 embryos show neural hyperplasia

Because of neur’s role in sensory organ development, it is known that homozygous recessive mutations in neur are lethal due to hyperplasia of the nervous system in embryos (Yeh et al, 2000; Boulianne et al, 2001). neurA101 homozygous

19 mutants have the aforementioned cuticle phenotype in homozygous embryos (Price et al,

1993; Yeh et al, 2000; Lai et al, 2005; Figure 6A, B). We examined l(3)hem2 homozygous recessive embryos for viability and developmental neural abnormalities.

Similar to neur loss of function alleles (Figure 6B), l(3)hem2 homozygotes die as embryos and display neural hyperplasia in embryonic stages, as compared to heterozygous siblings (Figure 6A, C). An examination of cuticle phenotypes of the l(3)hem2 excision mutants and l(3)hem1 revealed neural hyperplasia (Figure 6D-G), similar to l(3)hem2 and neurA101 (Figure 6B,C).

l(3)hem1 mutants, l(3)hem1/l(3)hem2 transheterozygotes and l(3)hem2 imprecise excision mutants have morphological lymph gland and cell defects

We examined l(3)hem1 mutants because of their longer lifespan, in comparison to l(3)hem2, to study larval hematopoiesis. Unlike l(3)hem2, l(3)hem1 mutants survive until the third instar larval stage of development. Homozygous l(3)hem1 mutant larval optic neuroblasts fail to divide properly, resulting in large, polyploid nuclei (Gateff, 1994). l(3)hem1 mutants have a reduction in prohemocytes in the lymph gland and in mature hemocytes both in the lymph gland and in circulation (Gateff, 1978). Consistent with these observations, we found that the mean number of cells per lymph gland in heterozygote sibling controls is 2,218  289 (n=3), compared to the mean number in l(3)hem1 mutants, which is 126  21 (n=3) for 5 day old animals. In circulation, the hemocyte concentration is 3,957  1224 hemocytes per microliter for heterozygote controls and 148  68 for homozygous mutants at 5 days of age.

20 Similar to optic neuroblasts, we observed polyploid cells in lymph glands of homozygous l(3)hem1 third instar larvae (Figure 7C-F, arrows). Compared to heterozygous siblings (Figure 7A-B), the morphology of l(3)hem1 homozygous lymph glands is distinct. l(3)hem1 mutant lymph glands possess a severely reduced number of cells. Mutant nuclei are generally larger (Figure 7C,E F, arrowheads) than control nuclei, possibly due to an aberrant cell division defect. Notably, the l(3)hem1 lymph gland appears to be dispersing into the surrounding hemolymph. This is in stark contrast to the heterozygous control gland, which is intact with tightly packed cells (Figure

7A,B). Lymph gland dispersal usually begins after puparium formation when the extracellular matrix is ruptured by escaping hemocytes (Grigorian, Mandal and

Hartenstein, 2011).

To understand the identity of l(3)hem1 mutant, polyploid cells, we used antibodies against integrin , a protein found in mature lamellocytes at high levels (Irving et al,

2005). We observed some mutant cells in l(3)hem1 mutant glands with high levels of integrin  (Figure 7D-F). These integrin -positive cells were morphologically unlike wildtype lamellocytes. Additional experiments revealed that some cells within l(3)hem1 mutant lymph glands also express markers for plasmatocyte (P1) and crystal cell (ProPO) lineages (Small, 2011). l(3)hem1 mutant lymph gland cells, therefore, are abnormally large and exhibit an aberrant developmental program.

Trans-heterozygote lymph glands morphologically resemble l(3)hem1 mutant lymph glands. (Figure 8, 7). l(3)hem2/l(3)hem1 larval lymph glands have a weaker l(3)hem1 phenotype that includes lethality in larval stages, large, polyploid cells and

21 reduced gland cell numbers (Figure 8B) as compared to heterozygote siblings (Figure

8A).

It was discovered that although most l(3)hem2 excision homozygous embryos are not viable, excision lines 0402D92535 and 0420D20Hop animals survive the third larval instar stage with a developmental delay (Figure 2B). We examined lymph glands from surviving homozygous larval mutants 0420D20Hop and 0402D92535 for hematopoietic defects. Similar to l(3)hem1 and l(3)hem2 / l(3)hem1 transheterozygotes, 0402D92535 and

0402D20Hop glands are morphologically abnormal (Figure 9). Mutant glands have low hemocyte numbers within lymph glands, large and polyploid cells and a tendency towards dispersal compared to controls. Therefore, mutants l(3)hem2 and l(3)hem1 can be phenotypically linked to one another through l(3)hem2 excision mutant lymph gland phenotypes.

Expression of Neur RNA and protein in l(3)hem1

Because l(3)hem1 mutant embryos resemble neurA101 mutants in the neural hyperplasia phenotype (Figure 6B,D), we suspected that l(3)hem1 was a hypomorphic allele. In order to investigate expression of neur in l(3)hem1 mutants, we first examined expression of neur transcripts for isoforms A (neurA) and C (neurC). Using primers specific for exons 1A, 1C or a control rp49, reverse transcriptase-PCR was performed on

RNA extracted from wildtype y w, l(3)hem1 / + and l(3)hem1 / l(3)hem1 embryos (Figure

10A). Electrophoresis of amplified PCR products in 1% agarose gel show that the control 449-bp rp49 transcripts are present (lanes 9-11, arrow head right) in all three genotypic classes. neurA transcripts are present in all three genotypic classes, as

22 evidenced by bands of 230 bp (lanes 2-4, arrow head left). The expected 114 bp band representing neurC could not be detected (lanes 5-7). Electrophoresis in 10% polyacrylamide gel (Figure 10B) showed that neurC was, in fact, present in when at least one wildtype copy of neur was present (lanes 3,4 and 6). In l(3)hem1 homozygous mutants, however, neurC transcript levels were undetectable.

To measure the rate of expression of neurA and neurC in l(3)hem1 homozygous mutants, the average quantities of cDNA were measured and compared for each transcript in each genotypic class (Figure 10C). This preliminary result shows that l(3)hem1 heterozygotes have very low levels of neurC, but that l(3)hem1 homozygotes have elevated levels of both neurA and neurC.

Using fluorescently-labeled secondary antibodies, we examined the binding of polyclonal anti-Neur antibodies to probe Neur protein levels in lymph gland cells (Figure

7). Neur protein appears to be expressed at slightly higher levels in l(3)hem1 mutant lymph gland cells than in control cells. These data are preliminary and would need to be further explored.

l(3)hem1 mutants have several polymorphisms within the neur locus

To examine if molecular lesions in the coding region of the neur locus are responsible for the mutant phenotypes, we sequenced the neur locus of l(3)hem1 mutants using DNA from homozygous mutant embryos. l(3)hem1 differed from heterozygous siblings at 9 positions within the neur locus, which were found in exons, introns and the

3’ UTR (Table 1). Although several polymorphisms occurred in exonic, coding DNA regions, these mutations were all silent. Of interest were the polymorphisms within

23 noncoding DNA regions (Figure 1, circles; Table 1). Using the UCSC Genome Browser

(Kent et al, 2002; Fujita et al, 2010), we examined the polymorphic sites in 12 related

Drosophila species. The first UTR mutation (position 4,846,441) is highly conserved

(100%) in all species, indicating a potential regulatory region. The second polymorphic site (position 4,846,304) is the site of a base insertion. The insertion occurs within a highly conserved UTR region (Kent et al, 2002; Fujita et al, 2010), and so again, this insertion could destabilize regulatory sequences within the UTR or the regulatory machinery that would normally interact with the UTR consensus sequences. The last polymorphic site (position 4,846,283) occurs within a genomic region unique to D. melanogaster. Interestingly, this unique region encodes an upstream polyadenylation signal (PAS; sequence AATAAA), which is one of four PASs within the neur 3’ UTR.

Polyadenylation signals are highly conserved throughout mammals (Tian et al, 2005).

Interruption of one PAS could affect neur mRNAs by influencing alternative splicing or transcript stability. To understand if post-transcriptional control mechanisms contribute to alternate protein stability in l(3)hem1 mutants, we examined the 3’ UTR for predicted microRNA (miRNA) binding. miRNAs are roughly 22 nucleotide RNA sequences that bind to the 3’ UTRs of target mRNAs, and have been computationally shown in

Drosophila and vertebrate species to regulate mRNA cleavage or translational repression

(Lai, 2002; Lai, 2003a; Lai et al, 2003b). Using a website dedicated to the prediction of miRNA sites (Betel et al, 2008; www.microrna.org), we found that the polymorphic site

4846441 is one away from, but not within, two known miRNAs (dmel-miR-

263b and dmel-miR-1011) sequences in the neur 3’ UTR.

24 The nomenclature of novel alleles of neur

We propose that the mutants l(3)hem2, l(3)hem1 and all l(3)hem2 imprecise excision mutants (Figure 2B) are alleles of the gene neur. Therefore, the former should be known as neurl(3)hem2 and neurl(3)hem1. The l(3)hem2 excision mutant 0402D92535 will be neurl(3)hem PL1, mutant 0420D20Hop shall be neurl(3)hem PL2, and the remaining 12 l(3)hem2 mutants will be known, in order of Figure 2B, as neurl(3)hem EL1 through neurl(3)hem EL12.

25 Discussion l(3)hem1 is a hypomorph of neur although its relationship to neur alleles is complex

The embryonic lethality of l(3)hem2 mutants largely impedes our knowledge about hematopoiesis in these mutants, as embryos do not possess all hematopoietic lineages or functional lymph glands. The link that we established between l(3)hem1 and l(3)hem2 as alleles of neur, therefore, is integral to our understanding of the role of Neur in larval hematopoiesis.

Neurogenic embryonic cuticle phenotypes (Figure 6), abnormal lymph gland phenotypes (Figures 7, 8 and 9), and genetic complementation for viability to adulthood

(Figure 3) in l(3)hem1, l(3)hem2 and l(3)hem2 excision mutants argue for similar processes being affected in these animals. However, there are inconsistencies in the relationship between l(3)hem1 and l(3)hem2 to neur. Although l(3)hem2 did not complement established neur alleles, l(3)hem1 did complement the hypomorphic allele, neurA101 (Figure 3) with over 100% viability. This observation would suggest that l(3)hem1 and neurA101 are not allelic. Other interpretations are also possible. Intragenic complementation, observed extensively in D. melanogaster (and C. elegans), stems from complex interactions between alleles of the same gene in trans-heterozygous animals

(Hawley and Gilliand, 2006). One form of intragenic complementation involves mutations that affect different functions of the protein. In C. elegans, the gene lin-3 plays several roles in development, including vulval induction and male spicule development.

One mutation in lin-3, e1417, disrupts vulval induction and does not disrupt male spicule development, whereas another mutation, n1058, minimally disrupts vulval induction and disrupts male spicule development. Because neither mutation completely removes LIN-3

26 function, it is hypothesized that the residual LIN-3 function can compensate for disrupted developmental processes in trans-heterozygotes (Yook, 2005). It is similarly possible that in neurA101/neurhem1 transheterozygotes, the residual Neur function in the l(3)hem1 background compensates for loss of Neur protein function in the neurA101 background.

The latter allele, completely lethal at embryonic stages, presumably affects the neur locus more strongly. Even though l(3)hem1 produces neurogenic defects in few embryos, it is primarily a larval lethal mutation, with neural and hematopoietic cell division defects.

Antibody stainings of Neur protein and quantitative PCR results are consistent with the idea that Neur transcripts and protein may be present in high quantities in l(3)hem1 mutants (Figure 7, 10). If l(3)hem1 Neur is abundant and neurA101 Neur is not fully functional, the significant dose of Neur from l(3)hem1 could be compensating for decreased neurA101 function.

An alternative, although unlikely scenario is that, in addition to containing a mutant neur locus, l(3)hem1 has a second mutation within the neighboring region. A complete l(3)hem1 rescue using the duplication/deletion of 84DE-87D in conjunction with the failure to complement l(3)hem2 and l(3)hem2 excisions derived from it strongly argue against this possibility.

The l(3)hem1 and l(3)hem2 excision mutations are a novel class of neur alleles

The fact that l(3)hem2 excision homozygotes 0402D92535 and 0420D20Hop survive until larval stages is interesting, as these represent additional novel larval/pupal lethal alleles of neur. In addition, the hematopoietic abnormalities they share with l(3)hem1 mutants, including reduced cell number, large polyploid nuclei and the tendency

27 towards dispersal (Figures 7, 9) suggests that these phenotypes are not only not specific to l(3)hem1, but are very likely derived due to aberrations in neur expression or function.

An interesting result is that the disruption of an intronic region via a P-element insertion in l(3)hem2 was sufficient to affect viability. Another group inserted P elements into noncoding neur regions (Rollman et al, 2008) and found a spectrum of pleiotropic effects in adult flies. Effects included a reduced olfactory sensitivity response, increased aggression over reduced food supply and reduced startle response behavior, which correlated with differential isoform splicing and concomitant morphological neural changes. Although the authors did not address this is the work, it is interesting that the presence of a P element in noncoding regions could have profound behavioral and neurological effects on adult flies. Unlike l(3)hem2 mutants, who are homozygous embryonic lethal, the homozygous mutants in Rollman et al. (2008) survive until adulthood with neurological abnormalities. The P element insertion points of these alleles, neurBG02391, neurBG02542 and neurBG02587 are approximately 70, 40 and 25 bp upstream of of the l(3)hem1 insertion point, respectively (Rollman et al, 2008; Figure

4B). Therefore, the spectrum of phenotypes in neur mutants varies dramatically according to insertions within a mere 70 bp. Together with mutants from l(3)hem1 and l(3)hem2 excisions 0420D20Hop and 0402D92535, who survive through larval stages and die in the early pupal stage, there appears to be an allelic series for neur. The strongest, embryonic lethal alleles include l(3)hem2, all of the l(3)hem2 imprecise excisions and l(3)hem1. We have also isolated alleles of moderate strength whose mutants sometimes die during larval stages, but more often in pupal stages. These alleles include l(3)hem1,

0420D20Hop and 0402D92535. The alleles from Rollman et al (2008) constitute the

28 weakest alleles, whose homozygous mutants are viable with phenotypic defects. The isolation of an allelic series with alleles of varying strengths is necessary for the complete understanding of the neur locus.

The site of P element insertion for l(3)hem2 and l(3)hem2 excisions and neur alleles from Rollman et al (2008) is in the first intron of neur. This said intron is a

“hotspot” for P element insertions, and most known neur P element-induced hypomorphs have insertions within roughly the same region (FlyBase 2011_04). Although no specific pattern for P element insertional preference has emerged, it is significant that insertions within noncoding regions produce null or hypomorphic alleles. This would argue for regulatory regions within noncoding neur regions that have yet to be fully explored and defined. Our l(3)hem2 mutants represent yet another testament to the informative nature of P element insertional mutagenesis as a way to deduce gene function. Further molecular-genetic characterization of the mutations must include characterization of the l(3)hem2 deletion alleles that do not complement the l(3)hem1 mutation.

l(3)hem1 mutants may have altered Neur protein stability or regulation

The l(3)hem2 and l(3)hem1 cuticle phenotypes are very similar to that of homozygous hypomorph neurA101 (Figure 6), suggesting that Neur protein has at least partially lost its function in both backgrounds. This interpretation will be verified in ongoing rescue experiments using BAC clones of 100 kB (Venken et al, 2009) surrounding the neur genomic region, which will be engineered into vectors and transfected into flies. Additional studies are needed to characterize transcripts and protein levels in l(3)hem2 mutants.

29 In l(3)hem1 mutants, our preliminary real time PCR data of whole larvae reveal high levels of both Neur A and C transcripts. Antibody stainings of l(3)hem1 lymph glands show high Neur protein levels compared to glands from sibling heterozygotes.

What could be the source of this overabundant protein? Sequence analysis (Table 1,

Figure 1A) showed that all polymorphisms occurring within coding DNA regions are silent, maintaining the correct predicted amino acid sequence. Genomic sequence analysis, on the other hand, predicts potential changes in transcript levels via changes in transcript stability and/or transcription rate. The 3’ UTRs of both the Neur A and C transcripts are derived from the common exon and this sequence is highly conserved in all 12 Drosophila species (Kent et al, 2002). We found that a polymorphism at position

4,846,441 is near to the dme-miR-1011 seed sequence, although its effect on miRNA binding is not known. Enhanced neur transcript stability in l(3)hem1 mutants would explain high levels of both A and C isoforms and consequent high Neur protein levels in mutants. (Figures 7, 10C).

We also identified two polymorphisms within the l(3)hem1 second intron that may be responsible for aberrant high transcript levels in mutant animals, although neither fell within predicted cis-regulatory modules (REDfly, Gallo et al, 2006). Computational methods predict a promoter within this second intron, upstream of the cis-regulatory regions (Ohler et al, 2002). If this region controls the expression of the wild type locus, then abrerrations in the l(3)hem1 mutant might explain the expression and phenotypic defects in the mutant animals Regardless of the mechanism, our combined data point to changes not in the coding capacity of the gene, but instead in the proportion of transcript isoforms from the neur locus. Loss of mutant larvae at embryonic, larval and pupal

30 stages, with pleiotropic effects of the mutation in different larval organs, suggests that the effects of the mutant proteins are complex and may be difficult to distinguish and separate. One possibility is that aberrant subcellular localization of different isoforms inhibits normal Notch signaling. This interpretation is supported by the observation that additional copies of neurA transcripts in mutants via the UAS-GAL4 system failed to alleviate the effects of the mutation (Small, 2011), although introduction of the entire locus via the deletion/duplication rescued lethality (Figure 5). Further analyses of neur transcripts in l(3)hem1 and l(3)hem2 excision backgrounds will test this interpretation.

neur regulates hematopoietic division and differentiation

Our findings overall were surprising because, although neur plays an essential, well-established role in neurogenesis, it has not yet been implicated in hematopoiesis.

Because Neur and N are conserved in humans and other mammals, it is helpful to know that neur has a previously unknown role in hematopoiesis. Neur is a known modulator of the N pathway via monoubiquitination of ligands Dl and Ser, and it would be interesting to see if there is an effect on N or N ligands in l(3)hem2 and l(3)hem1 mutants. We suspect that Neur expression is upregulated in l(3)hem1 mutants, but how does the upregulation affect N protein and N ligands, if at all? We have shown that N is expressed within cells in all zones of the lymph gland using antibody stainings (Small, 2011). One expectation for the effect of upregulated Neur is that the N pathway would be highly active in lymph gland cells. As mentioned before, N levels are usually high in immature cells and downregulated as the cells adopt mature cell fates in murine hematopoietic systems (Duncan et al, 2005). Although we have yet to explore N protein levels in

31 l(3)hem2 and l(3)hem1 mutants, underactive or aberrant N pathway activation could explain why cells expressing mature hemocyte lineage markers have not correctly adopted the terminal cell fate, like integrin -positive cells (Figure 7, data not shown).

Aberrant N signaling appears to interfere with adoption of mature cell fates.

We have shown that l(3)hem1 mutants have cell division defects that result in large, polypoid cells that sometimes have several centrosomes within dividing cells

(Leung and Govind, 2003; Small, 2011). Neur therefore plays an important role in proper cell division within the lymph gland and within circulating hemocytes, and problematic divisions resulting in mitotic arrest is a likely explanation for low hemocyte numbers. This proposed role for Neur protein is supported by independent RNAi and clonal analysis of Neur (Small, 2011).

Concluding remarks and future directions

Using sequence and complementation analysis, lymph gland morphology and cuticle phenotypes, we have shown that l(3)hem2 and l(3)hem2 excisions are alleles of neur. We propose that l(3)hem1 and the larval/pupal class of l(3)hem2 excisions are a new and important class of neur alleles, reported here for the first time. Our studies with these mutations support clear and novel functions for Neuralized proteins in larval hematopoietic division and differentiation in the Drosophila lymph gland. Neuralized is a key determinant of asymmetric cell division of Drosophila neural stem cells (Bhat,

Gaziova and Katipalla, 2011) and further analysis of the precise contributions of this protein in the division of hematopoietic progenitors is bound to be informative.

32 Experimental Procedures

Sequencing

Plasmid rescue experiments, sequencing and BLAST were performed using adult w/w;

+/+; l(3)hem2 / TM6 Tb Hu by Juyung Yang. l(3)hem1 and l(3)hem2 homozygote were selected for the neurogenic phenotype, washed and frozen in liquid nitrogen. Sequencing for l(3)hem1 and 402D9 and polymorphism analysis was performed by Dr. Eric Spana.

Sequence analysis involved evaluating chromatograms using 4Peaks software and Vector

NTI.

Cuticle Preparations

Adult flies were given apple juice plates and allowed to mate for 24 hours. They were removed and embryos were incubated for 40 hours at room temperature. Embryos of homozygous mutants and heterozygote controls were selected from the juice plates.

Using 50% bleach, embryos were rinsed for 1.5 minutes in order to remove the chorion.

Embryos were rinsed with double distilled water and mounted using Hoyer’s solution.

Complementation

The following fly stocks were used: w; +/+; l(3)hem1 /TM6 Tb Sb (Bloomington), w;

+/+;l(3)hem2 / TM6 Tb Hu (Bloomington), w; +/+; 0402D9/TM6 Sb, and w;+/+;neurA101

P{LacW}/TM6 Tb Hu (Bloomington). Each cross was done using virgin females with males of the appropriate genotype. Offspring were sorted by genotype and counted.

33 For deficiency crosses, stocks 9203, 9225, 9077 and 9338 were obtained from the

DrosDel Project collection (Ryder et al, 2007) via the Bloomington Stock Center. Virgin females of each of the following genotypes were collected and crossed to males of each deficiency stock: w/w; +/+; l(3)hem1 / TM6 Tb Sb, w/w; +/+; 402D9 / TM3 Sb, w/w;

+/+; TM6 Tb Hu, w/w; +/+; l(3)hem2 / TM6 Tb Hu and w/w; +/+; neurA101 / TM6 Tb Hu.

Offspring were collected and genotyped.

To calculate percent viability, the following formula was used: [number experimental class / (total number of single balancer classes / 2)] x 100.

Generation of imprecise excisions

Virgin flies of the genotype y w/y w; +/+; l(3)hem2 P{lacW}/ TM6 Tb Hu were crossed to males of the genotype y w/Y; +/+; Sb 2-3 / TM6. Male offspring that were dysgenic and of the genotype y w/Y; l(3)hem2 P{lacW}/ TM6 Tb Hu were collected and crossed to double balancer virgin females, w/w; TM3 Sb / TM6 Tb. Males were collected that had white eyes (and had lost the w+ marker of the P element). These males, w/Y; l(3)hem2 P{excised}/TM3 were crossed to virgin females who were w/w; +/+; l(3)hem2

/TM6 Sb Tb and stocks were created. Also see Figure 2A.

Antibody Staining

Parents were crossed using adult, virgin females. Egg lays were performed for 3 days, at which parents were removed and vials were transferred to 24C for 3 days.

Larval lymph glands were dissected from third instar animals and mounted onto slides.

4% paraformaldehyde was used to fix the glands for 5 minutes and washed off with 1X

34 PBS. Invitrogen Rhodamine Phalloidin was used at a 1:200 dilution in 1X PBS for 30 minutes, covered. Slides were washed twice with PBS, and Hoechst 33258 was applied at a 1:500 dilution in PBS for 5 minutes. Slides were washed once with PBS. 40 L of

50% glycerol containing N-propyl gallate was added to slides for 5 minutes, and afterwards they were mounted. Slides were imaged using a Zeiss LSM5 confocal microscope or a compound Zeiss Axioscope fluorescence microscopy within 24 hours.

Images were processed using Adobe Photoshop CS2.

For immunohistochemistry, larvae were dissected and lymph glands were mounted and fixed with 4% PFA as above. Glands were washed and permeabilized in

1% Triton X-BSA solution overnight at 4 C. Samples were washed 10 times with 1%

Triton X-1xPBS solution (PBST). Primary antibody, anti-Neuralized (a gift from Eric

Lai) raised in rabbit, was added to slides at a dilution of 1: 500 in 1% BSA solution for 4 hours. Samples were washed with PBST 10 times. Invitrogen Alexa Fluor 546 goat anti- rabbit secondary antibody was added at a dilution of 1:500 in 1% BSA for 3 hours at room temperature. Samples were washed 5 times with 1% Triton X-PBS solution, and

Hoechst 33258 was added at 1:500 in PBS for 5 minutes. Samples were washed with

PBS, anti-fade was added (50% glycerol containing N-propyl gallate), and slides were mounted. Glands were imaged and processed as above.

Quantitative PCR

Embryos with the genotypes w/w; +/+; l(3)hem1 /TM6 Sb, y w; +/+; +/+ and w/w; +/+; l(3)hem1 / l(3)hem1 were collected and total RNA was then isolated using Trizol reagent.

35

RNA was resuspended in 100 µl of distilled H2O (treated with diethyl pyrocarbonate) and was quantitated by spectrophotometer. Fifty larvae yielded between ~1 µg of total RNA.

cDNA synthesis was carried out by using an M-MLV reverse transcriptase (NEB) according to the supplier's instructions. Reaction mixtures were incubated at 42°C for 1 h. Reaction mixtures were then placed at 95°C for 5 min to inactivate the reverse transcriptase. Ten microliter of this reverse transcription mix was used in each subsequent

50-µl PCR. Nucleotide sequences for sense and antisense primers, were as follows:

NeurA-Forward, NeurA-Reverse, NeurC-Forward, NeurC-Reverse

(5’CATGGAGTCCAACGAGCTGCTCA3’,

5’CCCTGCAGAAGCTCTCAAAGCGA3’, 5’GCAATGGGTCAGTCGGCTGG3’,

5’AATTCGGATGTTGTCGCATGTA 3’). The PCR amplification cycles were: 3 mins at

94°C, 1min at 94°C, 1 min at 60°C, 1 min at 72°C, and 8 mins at 72°C for 35 cycles.

Electrophoresis of DNA sequences was performed on 1% agarose gel and on 10% polyacrylamide gel.

36 References

Aguirre A, Rubio ME, Gallo V (2010). "Notch and EGFR pathway interaction regulatesneural stem cell number and self-renewal". Nature 467 (7313): 323–327

Artavanis-Tsakonas, S., Rand, M. D., Lake, R. (1999). "Notch Signaling: Cell Fate Control and Signal Integration in Development (Review)". Science , 284, 770–776.

Asha, H., Nagy, I., Kovacs, G., Stetson, D., Ando, I. and Dearolf, C.R. (2003). Analysisof ras-induced overproliferation in Drosophila hemocytes. Genetics, 163, 203.

Bardin, A.J. and Schweisguth, F. (2006). Bearded family members inhibit Neuralizedmediated endocytosis and signaling activity of Delta in Drosophila. Developmental Cell, 10, 245-55.

Betel, D., Wilson M, Gabow A, Marks DS, Sander C., 215.The microRNA.org resource: targets and expression. Nucleic Acids Res. 2008 Jan; 36(Database Issue): D149-53.

Bhat, K.M, Gaziova, I. and Katipalla, S. (2011). Neuralized mediates asymmetric division of neural precursors by two distinct and sequential events: Promoting asymmetric localization of Numb and enhancing activation of Notch-signaling. Developmental Biology, 351, 186-198.

Bigas, A., Robert-Moreno, A. and Espinosa, L. (2010) The Notch pathway in the developing hematopoietic system. International Journal of Developmental Biology, 54, 1175-1188.

Blake, J.A., Bult, C.J., Kadin, J.A., Richardson, J.E., Eppig, J.T. and the Mouse GenomeDatabase Group. (2011). The Mouse Genome Database (MGD): premier model organism resource for mammalian genomics and genetics. Nucleic Acids Research, 39(suppl 1), D842-D848.

Bolós V, Grego-Bessa J, de la Pompa JL (2007). "Notch signaling in developmentand cancer". Endocrine Review, 28, 339–63.

Boulianne, G.L., de la Concha, A., Campos-Ortega, J.A., Jan, L.Y. and Jan, Y.N. (2001).The Drosophila neurogenic gene neuralized encodes a novel protein and is expressed in precursors of larval and adult neurons. The EMBO Journal,10, 2975-2983.

Brand, A.H. and Perrimon, N. (1993). Targeted gene expression as a means of alteringcell fates and generating dominant phenotypes. Development, 118, 401-415.

Campos-Ortega, J.A. and Jan, Y.N. (1991). Genetic and molecular bases of neurogenesis in Drosophila melanogaster. Annual Review in Neuroscience, 14, 399-420.

37 Charroux, B. and Royet, J. (2009). Elimination of plasmatocytes by targeted apoptosis reveals their role in multiple aspects of the Drosophila immune response. PNAS, 106, 9797-9802.

Comisso, C. and Boulianne, G.L. (2007). The NHR1 domain of Neuralized binds Delta and mediates Delta trafficking and Notch signaling. Molecular Biology of the Cell, 18, 1- 13.

Crotatier, M. and Meister, M. (2007). Drosophila hematopoiesis. Cellular Microbiology, 9, 1117-1126.

Duvic, B., Hoffman, J.A., Meister, M. and Royet, J. (2002). Notch signaling controls lineage specification during Drosophila larval hematopoiesis. Current Biology, 12, 1923- 1927.

Gallo, S. M., Li, L., Hu, Z. and Halfon, M. S. (2006). REDfly: a regulatory element database for Drosophila. Bioinformatics, Vol. 22 no. 3 2006, pages 381-383.

Gateff, E. (1994). Tumor-suppressor genes, hematopoietic malignancies and other dematopoietic disorders of Drosophila melanogaster. Annals of the New York Academy of Sciences, 712, 260-279.

Gateff, E. and Schmidt, E.R. (1991). Lethal (3)hematopoiesis missing (l(3)hem): a gene responsible for blood cell and optic neuroblast cytokinesis and polytenization in a variety of cells. European Drosophila Research Conference, 12: 281.

Grigorian, M., Mandal, L. and Hartenstein, V. Hematopoiesis at the onset of metamorphosis: terminal differentiation and dissociation of the Drosophila lymph gland. Developmental Genes and Evolution. 2011 Apr 21. [Epub ahead of print].

Gruber, A.R., Lorenz, R., Bernhart, S.H., Neuböck, R., and Hofacker, I.L. (2008) The Vienna RNA Websuite. Nucleic Acids Research.

Hawley, R. S. and Gilliland, W.D. (2006). Sometimes the result is not the answer: the truth and the lies that come from using the complementation test. Genetics, 74, 1-15.

Hicks, G.G., Shi, E., Li, X.M., Li, C.H., Pawlak, M. and Ruley, H.E. (1997). Functional genomics in mice by tagged sequence mutagenesis. Nature Genetics, 16, 338-344.

Irving, P., J.-M. Ubeda, D. Doucet, L. Troxler, M. Lagueux, D. Zachary, J. A. Hoffmann, C. Hetru, M. Meister. 2005. New insights into Drosophila larval haemocyte functions through genome-wide analysis. Cell. Microbiology, 7, 335-350.

Kent WJ, Sugnet CW, Furey TS, Roskin KM, Pringle TH, Zahler AM, Haussler D. The browser at UCSC. Genome Res. 2002 Jun;12(6):996-1006.

38 Krzemien, J., Oyallon, J., Crozatier, M. and Vincent, A. (2010) Hematopoietic progenitors and hemocyte lineages in the Drosophila lymph gland. Developmental Biology, 346, 310-319.

Lai, E. and Rubin, G. (2001). Neuralized functions cell-autonomously to regulate a subset of notch-dependent processes during adult drosophila development. Developmental Biology, 231, 217-233.

Lai, E.C., Deblandre, G.A., Kinter, C. and Rubin, G.M. (2001) Drosophila neuralized is a ubiquitin ligase that promotes the internalization and degredation of Delta. Developmental Cell, 1, 783-794.

Lai, E.C. (2002). MicroRNAs are complementary to 3’ UTR motifs that mediate negative post-transcriptional regulation. Nature Genetics, 30, 363-364.

Lai, E.C. (2003a). MicroRNAs: runts of the genome assert themselves. Current Biology, 13, R925-R936.

Lai, E.C., Tomancak, P., Williams, R.W. and Rubin, G.M. (2003b). Computational identification of Drosophila microRNA genes. Genome Biology, 4:R42, 1-20.

Lai, E.C., Roegiers, F., Qin, X., Jan, Y.N. and Rubin, G.M. (2005). The ubiquitin ligase Drosophila Mind bomb promotes Notch signaling by regulating the localization and activity of Serrate and Delta. Development, 132, 2319-2332.

Laky, K. and Fowlkes, B.J. (2008). Notch signaling in CD4 and CD8 T cell development. Current Opinions in Immunology, 20, 197-202.

Lebestky, T., Jung, S.H. and Banerjee, U. (2003) A serrate-expressing signaling center controls Drosophila hematopoiesis. Genes and Development, 17, 348-353.

Lehmann, R., Jimenez, F., Dietrich, U. and Campos-Ortega, J.A. (1983). On the phenotype and development of mutants of early neurogenesis in Drosophila melanogaster. Roux’s Archive of developmental Biology, 192, 62-74.

Leung, S.S. and Govind, S. (2003) The l(3)hem1 mutation blocks proliferation and development of hematopoietic precursors in the Drosophila larva. Annual Drosophila Research Conference, 44:933C.

Magrane, M. and the UniProt consortium. (2011). UniProt Knowledgebase: a hub of integrated protein data. Database, bar009.

Muller, H.A.J., Samanta, R. and Wieschaus, E. (1999). Wingless signaling in the Drosophila embryo: zygotic requirements and the role of the frizzled genes. Development, 126, 577-586.

39 Ohler, U., Liao, G.C., Niemann, H. and Rubin, G.M. (2002). Computational analysis of core promoters in the Drosophila genome. Genome Biology, 3, 0087.1-0087.12.

Ohler, U. (2006) Identification of core promoter modules in Drosophila and their application in improved promoter prediction. Nucleic Acids Res, 34,5943-5950.

Pavlopaolos, E., Pitsouli, C., Klueg, K.M., Muskavitch, M.A., Moschonas, N.K. and Delidakis, C. (2001). Neuralized encodes a peripheral membrane protein involved in delta signaling and endocytosis. Developmental Cell, 1, 807-816.

Price, B.D., Chang, Z., Smith, R., Bockheim, S. and Laughon, A. (1993) The Drosophila neuralized gene encodes a C3HC4 zinc finger. The EMBO Journal, 12, 2411- 2418.

Ryder, E., M. Ashburner, R. Bautista-Llacer, J. Drummond, J. Webster et al. (2007). The DrosDel deletion collection: a Drosophila genomewide chromosomal deficiency resource. Genetics, 177, 615–629.

Rizki, T.M. and Rizki, R.M. (1984). The cellular defense system of Drosophila melanogaster. Insect Ultrastructure, Vol. 2, R.C. King and H. Akai, eds. New York: Plenum publishing, pp. 579-604.

Rollmann, S.M., Zwarts, L., Edwards, A.C., Yamamoto, A., Callaerts, P., Norga, K., Mackay, T.F.C. and Anholt, R.R.H. (2008). Pleiotropic effects of Drosophila neuralized on complex behaviors and brain structure. Genetics, 179, 1327-1336.

Ruan, Y., Tecott, L., Jiang, M.M., Jan, L.Y. and Jan, Y.N. (2001). Ethanol hypersensitivity and olfactory discrimination defect in mice lacking a homolog of Drosophila neuralized. PNAS, 98, 9907-9912.

Small, C. (2011) PhD thesis, Functions of Notch and Neuralized in Drosophila hematopoiesis. City University of York.

Stanford, W.L, Cohn, J.B. and Cordes, S.P. (2001). Gene-trap mutagenesis: past, present and beyond. Nature Reviews: Genetics, 2, 756-768.

Tian, B., Hu, J., Zhang, H. and Lutz, C.S. (2005) A large-scale analysis of mRNA polyadenylation of human and mouse genes. Nucleic Acids Res. 33:201–212.

Tien, A.C., Rajan, A. and Bellen, H. (2009). A Notch updated. Journal of Cell Biology,184, 621-629.

Tweedie, S., Ashburner, M., Falls, K., Leyland, P., McQuilton, P., Marygold, S., Millburn, G., Osumi-Sutherland, D., Schroeder, A., Seal, R., Zhang, H. and The FlyBase Consortium. (2009) FlyBase: enhancing Drosophila annotations. Nucleic Acids Research, 37, D555-D559; doi:10.1093/nar/gkn788

40

Umea Stock Center, (2001.7.30). l(3)hem2 allele. Personal communication to FlyBase from Kevin Cook.

Vaessin, H., Brand, M., Jan, L.Y. and Jan, Y.N. (1994). daughterless is essential for neuronal precursor differentiation but not for initiation of neuronal precursor formation in Drosophila embryo. Development, 120, 935-945.

Venken, KJT, Carlson JW, Schulze KL, Pan H, He Y, Spokony R, Wan KH, Koriabine M, de Jong PJ, White KP, Bellen HJ, Hoskins RA (2009) Versatile P[acman] BAC Libraries for transgenesis studies in Drosophila melanogaster. Nature Methods, 6,431- 434.

Voelker, R.A., Greenleaf, A.L., Gyurkovics, H., Wisely, G.B., Huang, S.M. and Searles, L.L. (1984). Frequent imprecise excision among reversions of a P element-caused lethal mutation in Drosophila. Genetics, 107, 279-294.

Vollrath, B., Pudney, J., Asa, S., Leder, P. and K. Fitzgerald. (2001). Isolation of a murine homologue of the Drosophila neuralized gene, a gene required for axonemal integrity in spermatozoa and terminal maturation of the mammary gland. Molecular and Cell Biology, 21, 7481-7494.

Yeh, E., Zhou, L., Rudzik, N., Boulianne, G.L. Neuralized functions cell autonomously to regulate Drosophila sense organ development. The EMBO Journal, 19, 4827-4837.

Yook, K. Complementation (October 06, 2005). WormBook, ed. The C. elegans Research Community, WormBook, doi/10.1895/wormbook 1.24.1, http://www.wormbook.org.

41 Figure Legends

Figure 1 l(3)hem2 is characterized by a P{lacW} element insertion within the neur locus.

The gene neur possesses four exons that are alternatively spliced during post- transcriptional processing. All known transcripts have common exons 2 and 3, differing only in the first exon. Isoforms A and B have the first exon 1A whereas isoforms C and D have the first exon 1C. (A) The neur locus and the relative position of the P{lacW} element in l(3)hem2 mutants. White circles mark relative positions of l(3)hem1 polymorphisms. (B) Exon 1A on the nucleotide level maps to noncoding DNA directly upstream of the 5’ untranslated region of exon 1A (red arrow). Sections of the exon are as follows: noncoding DNA (unshaded), 5’ UTR (purple shading), coding DNA (blue shading), start codon (yellow shading), sequenced DNA from plasmid rescue experiments

(red text) and predicted promoter motif (bolded text; Ohler et al, 2002; Ohler, 2006).

Figure 2 The creation of l(3)hem2 excisions.

(A) Schematic for how excisions were created, and the two types of excisions that resulted: precise and imprecise. (B) List of l(3)hem2 imprecise excisions lines that were created using the protocol described in panel A. Lethal phase is the point in the life cycle that lethality is observed. E = embryonic, early P= early pupae.

42 Figure 3 Complementation analysis for l(3)hem2, neurA101, l(3)hem2 excisions and l(3)hem1.

Percent viability to adulthood is shown. (A) Complementation between neurA101 and l(3)hem2, an l(3)hem2 excision line 0402D9 and l(3)hem1 reveals non-complementation, with the exception of neurA101 and l(3)hem1. (B) Complementation failed between l(3)hem2 excision lines, l(3)hem1 and l(3)hem2.

Figure 4 Deficiency mapping shows that l(3)hem1 falls within the neur locus.

(A) The neur genomic scaffold is shown (blue) in relation to known deficiency stocks within the region (black bars). The exact insertion point of the l(3)hem2 P element is indicated. (B) Detailed schematic of the neur locus is shown. Coding DNA is shown in blue in relation to the l(3)hem2 P element, the gene hyx, and two P element insertions within the shared neur and hyx region, neurEP9 and neurEP10. (C) Results from complementation tests performed between deficiency stocks and l(3)hem2, l(3)hem1,

0402D92535 , neurA101 and neur/hyx alleles 1, 2, EP9 and EP10.

Figure 5 A deletion/duplication carrying the neuralized locus rescues l(3)hem1 lethality.

Mutants of the genotype Tp(3;1)Dp(Fa11); Df(Fa11e)/TM3 Sb Ser e have a deletion of the genomic region 84-86C3 in chromosome 3 and a duplication of the same area on chromosome 1. Parental genotypes are shown at top, and expected F1 genotypes are boxed. Numbers indicate the actual number of offspring present for each class, and gray shading indicates the absence of the F1 class. Percent viability calculation is shown below.

43

Figure 6 neurA101, l(3)hem2, l(3)hem2 excision lines and l(3)hem1 show similar neurogenic embryonic phenotypes

Control homozygous embryos (A) have normal denticle belt and mouth hook formations.

Experimental homozygous mutant embryos (B-G) had neurogenic phenotypes consisting of cuticle holes (arrowheads) and abnormal development. Mutant embryos are from homozygous mutants for neurA101 (B), l(3)hem2 (C), l(3)hem1 (D), 0402D20Hop (E),

0402D92535 (F) and 0509D5D2535. Magnification is 40x. Anterior ends are to the left.

Figure 7 l(3)hem1 lymph glands are morphologically abnormal.

Control heterozygous sibling lymph glands from third instar larvae (A) and (B) have normal hemocyte numbers and sizes. (A) Negative control without primary Neur antibody, (B) control with primary Neur antibody. l(3)hem1 mutant glands (C)-(F) show a range of phenotypes. These glands have few hemocytes that are large and polyploid

(arrowhead) with dispersed basement membranes. Glands are stained with anti-Neur antibodies and DAPI. Images are single confocal image slices at magnification 40x.

Figure 8 l(3)hem2/l(3)hem1 trans-heterozygote lymph glands are morphologically abnormal and resemble a weak, l(3)hem1-like phenotype.

Compared to heterozygous l(3)hem1 control siblings (A), trans-heterozygote lymph glands have few hemocytes and large, polyploid nuclei. Lymph glands are stained with F- actin. Images are single confocal image slices at magnification 40x

44 Figure 9 l(3)hem2 excision mutants 0420D20Hop and 0402D92535 have morphologically abnormal and resembles a weak, l(3)hem1-like phenotype.

Heterozygous controls (A), l(3)hem1/+, (C) 0420D20Hop/+ and (E) 0402D92535/+ have large, intact lymph glands as compared to mutants (B) l(3)hem1/l(3)hem1, (D)

0420D20Hop/0420D20Hop and (F) 0402D92535/0402D92535. Mutant lymph glands also have large, polyploid cells and dispersed basement membranes. Images are single confocal slices at 40x magnification, stained with F-actin.

Figure 10 l(3)hem1 mutants show dysregulation of neur transcript expression.

(A) Electrophoresis results from RT-PCR. PCR products are from neurA-specific primers for lanes 2-4, from neurC-specific primers for lanes 5-7 and from control primers rp49 for lanes 9-11. PCR products are obtained from larval genotype yw (lanes

2,5,9), l(3)hem1 / + (lanes 3,6,10) and l(3)hem1 / l(3)hem1 (lanes 4,8,11). Lane 1 is a marker. Arrow on left indicates 500 bp mark, marker on right indicates 449 bp.

Expected size of neurA PCR products is 230 bp, neurC is 114 bp. (B) A polyacrylamide gel electrophoresis result for quantitative PCR using neurC specific primers. Lanes 1-2 are markers. PCR products are from the following genotypes: (lane 3) y w , (lane 4) l(3)hem1 / +, (lane 5) l(3)hem1 / l(3)hem1 , (lane 6) lwr / +, which has a wildtype neur locus. Arrow indicates 114 bp. (C) Preliminary results from realtime PCR showing PCR products obtained using neurA and neurC-specific primers in genotypes y w, l(3)hem1 / + and l(3)hem1 / l(3)hem1.

45 Table legends

Table 1 A summary of l(3)hem1 polymorphisms at the neur locus.

The position, genomic region of interest and type of mutation are shown. Of the polymorphisms shown, four occur within exonic regions and are silent mutations. Five of the polymorphisms occur within noncoding DNA regions.

46 Figure 1

47 Figure 2

48 Figure 3

49 Figure 4

50 Figure 5

51 Figure 6

52 Figure 7

53 Figure 8

54 Figure 9

55

Figure 10

56 Table 1

57