US 2007008.7394A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2007/0087394A1 Siena et al. (43) Pub. Date: Apr. 19, 2007

(54) EPIDERMAL GROWTH FACTOR Related U.S. Application Data RECEPTOR GENE COPY NUMBER (60) Provisional application No. 60/667.827, filed on Apr. (76) Inventors: Salvatore Siena, Milan (IT); Mauro 1, 2005. Moroni, Milano (IT); Alberto Bardelli, Torino (IT) Publication Classification Correspondence Address: (51) Int. Cl. FINNEGAN, HENDERSON, FARABOW, GOIN 33/574 (2006.01) GARRETT & DUNNER (52) U.S. Cl...... 435/723 LLP 901 NEW YORK AVENUE, NW (57) ABSTRACT WASHINGTON, DC 20001-4413 (US) Methods of predicting whether al anti-epidermal growth factor receptor (“EGFr)-specific binding agent treatment (21) Appl. No.: 11/396,311 will be efficacious in treating cancer, and methods of treating patients with anti-EGFr-specific binding agents, are pro (22) Filed: Mar. 30, 2006 vided. Patent Application Publication Apr. 19, 2007 Sheet 1 of 2 US 2007/0087394 A1

Patent Application Publication Apr. 19, 2007 Sheet 2 of 2 US 2007/0087394 A1

an

OCZ9WS 087WS 97MS OWO 6CH 9 OH OTO US 2007/0O87394 A1 Apr. 19, 2007

EPIDERMAL GROWTH FACTOR RECEPTOR 2865, 1997). Both epidermal growth factor (EGF) and trans GENE COPY NUMBER forming growth factor-alpha (TGF-C.) have been demon strated to bind to EGFr and to lead to cellular proliferation 0001) This application claims the benefit of U.S. Provi and tumor growth. In many cases, increased surface EGFr sional Application 60/667.827, filed Apr. 1, 2005. U.S. expression was accompanied by production of TGFC. or Provisional Application 60/667.827 is incorporated by ref EGF by tumor cells, suggesting the involvement of an erence herein in its entirety for any purpose. autocrine growth control in the progression of those tumors (see, e.g., Baselga et al. Pharmacol. Ther. 64: 127-154, 1994: FIELD Mendelsohn et al., Biologic Therapy of Cancer pp. 607-623, 0002 The present application relates to methods of pre Philadelphia: J.B. Lippincott Co., 1995; Modjtahedi et al., dicting whether an anti-epidermal growth factor receptor Intl. J. of Oncology 4:277-296, 1994; Salomon et al., Crit. (“EGFr)-specific binding agent treatment will be effica Rev. Oncol. Hematol. 19: 183-232, 1995). cious in treating cancer, and methods of treating patients 0005 Thus, certain groups have proposed that antibodies with anti-EGFr-specific binding agents. Methods of deter against EGF, TGF-C., and EGFr may be useful in the therapy mining the efficacy of treatments are provided. of tumors expressing or overexpressing EGF-r (see, e.g., Mendelsohn Cancer Cells 7:359 (1989), Mendelsohn Can BACKGROUND cer Biology 1:339-344 (1990), Modjtahedi and Dean Int'l J. Oncology 4:277-296 (1994), Tosi et al. Int'l J. Cancer 0003 Certain applications of monoclonal antibodies in 62:643-650 (1995)). Indeed, it has been demonstrated that cancer therapy rely on the ability of the antibody to specifi anti-EGFr antibodies blocking EGF and TGF-C. binding to cally deliver to the cancerous tissues cytotoxic effector the receptor appear to inhibit tumor cell proliferation. At the functions such as immune-enhancing isotypes, toxins or same time, however, anti-EGFr antibodies have not drugs. An alternative approach is to utilize monoclonal appeared to inhibit EGF and TGF-C. independent cell growth antibodies to directly affect the survival of tumor cells by (Modjtahedi and Dean Int'l J. Oncology 4:277-296 (1994)). depriving them of essential extracellular proliferation sig 0006 Monoclonal antibodies specific to the human nals, such as those mediated by growth factors through their EGFr capable of neutralizing EGF and TGFC. binding to cell receptors. One of the attractive targets in this approach tumor cells and of inhibiting ligand-mediated cell prolifera is the epidermal growth factor receptor (EGFr), which binds tion in vitro, have been generated from mice and rats (see, EGF and transforming growth factor C. (TGFC) (see, e.g., e.g., Baselga et al., Pharmacol. Ther. 64: 127-154,1994: Ullrich et al., Cell 61:203-212, 1990; Baselga et al., Phar Mendelsohn et al., in Biologic Therapy of Cancer 607-623, macol. Ther. 64: 127-154, 1994; Mendelsohn et al., in Bio Philadelphia: J.B. Lippincott Co., 1995; Fan et al., Curr. logic Therapy of Cancer 607-623, Philadelphia: J.B. Lip Opin. Oncol. 10: 67-73, 1998; Modjtahedi et al., Intl. J. pincott Co., 1995: Fan et al., Curr. Opin. Oncol. 10: 67-73, Oncology 4: 277-296, 1994). Some of those antibodies, such 1998). Binding of EGF or TGFC. to EGFr, a 170 kDa as the mouse 108, 225 (see, e.g., Aboud-Pirak et al., J. Natl. transmembrane cell Surface glycoprotein, triggers a cascade Cancer Inst. 80: 1605-1611, 1988) and 528 (see, e.g., Baselga of cellular biochemical events, including EGFr autophos et al., Pharmacol. Ther. 64: 127-154, 1994; Mendelsohn et phorylation and internalization, which culminates in cell al., in Biologic Therapy of Cancer 607-623, Philadelphia: proliferation (see, e.g., Ullrich et al., Cell 61:203-212, J.B. Lippincott Co., 1995) or the rat ICR16, ICR62 and 1990). ICR64 (see, e.g., Modjtajedi et al., Intl. J. Oncology 4: 0004 Several observations implicate EGFr in supporting 277-296, 1994; Modjtahedi et al., Br. J. Cancer 67:247-253, development and progression of human Solid tumors. EGFr 1993: Modjtahedi et al., Br. J. Cancer 67: 254-261, 1993) has been demonstrated to be overexpressed on many types monoclonal antibodies, were evaluated extensively for their of human solid tumors (see, e.g., Mendelsohn Cancer Cells ability to affect tumor growth in Xenograft mouse models. 7:359 (1989), Mendelsohn Cancer Biology 1:339-344 Most of the anti-EGFr monoclonal antibodies were effica (1990), Modjtahedi and Dean Int'l J. Oncology 4:277-296 cious in preventing tumor formation in athymic mice when (1994)). For example, EGFr overexpression has been administered with the human tumor cells (Baselga et al. observed in certain lung, breast, colon, gastric, brain, blad Pharmacol. Ther. 64: 127-154,1994; Modjtahedi et al., Br. J. der, head and neck, ovarian, and prostate carcinomas (see, Cancer 67: 254-261, 1993). When injected into mice bearing e.g., Modjtahedi and Dean Int'l J. Oncology4:277-296 established human tumor Xenografts, the mouse monoclonal (1994)). Certain groups have reported that an increase in antibodies 225 and 528 caused partial tumor regression and receptor levels is associated with a poor clinical prognosis required the co-administration of chemotherapeutic agents, (see, e.g., Baselga et al. Pharmacol. Ther. 64: 127-154, 1994: Such as doxorubicin or cisplatin, for eradication of the Mendelsohn et al., Biologic Therapy of Cancer pp. 607-623, tumors (Baselga et al. Pharmacol. Ther. 64: 127-154, 1994: Philadelphia: J.B. Lippincott Co., 1995; Modjtahedi et al., Mendelsohn et al., in Biologic Therapy of Cancer 607-623, Intl. J. of Oncology 4:277-296, 1994: Gullick, Br. Medical Philadelphia: J.B. Lippincott Co., 1995: Fan et al., Cancer Bulletin, 47:87–98, 1991; Salomon et al., Crit. Rev. Oncol. Res. 53: 4637-4642, 1993: Baselga et al., J. Natl. Cancer Hematol. 19: 183-232, 1995). Other studies, however, Sug Inst. 85: 1327-1333, 1993). A chimeric version of the 225 gest that prognosis cannot be directly correlated to EGFr monoclonal antibody (C225), in which the mouse antibody overexpression (see, e.g., Rusch et al. Clin. Cancer Res. variable regions are linked to human constant regions, 3:515-522, 1997; Pfeiffer et al., Br. J. Cancer 74:86-91, exhibited an improved in vivo anti-tumor activity but only at 1996; Fontanini et al., Clin. Cancer Res. 4:241-249, 1998: high doses (see, e.g., Goldstein et al., Clinical Cancer Res. Greatens et al., Am. J. Respir. Crit. Care. Med. 157:1093 1: 1311-1318, 1995; Prewett et al., J. Immunother. Emphasis 1097,1998; D'Amico et al., J. Thorac. Cardiovasc. Surg. Tumor Immunol. 19:419–427, 1996). The rat ICR16, ICR62, 117:736-743, 1999; Pastorino et al., J. Clin. Oncol. 15:2858 and ICR64 antibodies caused regression of established US 2007/0O87394 A1 Apr. 19, 2007 tumors but not their complete eradication (Modjtahedi et al., 0010. In certain embodiments, a method of treating a Br. J. Cancer 67: 254-261,1993). These results established Subject having an EGFr-related cancer is provided, compris EGFr as a promising target for antibody therapy against ing: (a) determining the EGFr gene copy number in a sample EGFr-expressing Solid tumors and led to human clinical from the subject; (b) determining whether there is an trials with the C225 monoclonal antibody in multiple human increased EGFr gene copy number in the sample; and (c) if Solid cancers (see, e.g., Baselga et al. Pharmacol. Ther. 64: there is an increased EGFr gene copy number in the sample, 127-154, 1994; Mendelsohn et al., Biologic Therapy of administering to the Subject a pharmaceutically effective Cancer pp. 607-623, Philadelphia: J.B. Lippincott Co., amount of an EGFr-specific binding agent. 1995; Modjtahedi et al., Intl. J. of Oncology 4:277-296, 0011. In certain embodiments, a method of determining 1994). the efficacy of a treatment in a patient is provided, compris 0007 Certain advances in the biological arts made it ing: (a) determining the EGFr gene copy number in a first possible to produce a fully human anti-EGFr antibody. sample obtained from a patient to obtain a first EGFr gene Using mice transgenic for human immunoglobulin genes copy number level; (b) administering the treatment to the (XenomouseTM technology, Abgenix, Inc.), human antibod patient; (c) determining the EGFr gene copy number in a ies specific for human EGFr were developed (see, e.g., second sample from the patient at a time following admin Mendez, Nature Genetics, 15: 146-156, 1997: Jakobovits, istration of the treatment, thereby generating a second EGFr Advanced Drug Delivery Reviews, 31(1-2): 33-42, 1998: gene copy number level; and (d) comparing the first and Jakobovits, Expert Opinion on Investigational Drugs, 7(4): second EGFr gene copy number levels, wherein a decrease 607-614, 1998; Yang et al., Crit. Rev. Oncol. Hematol. in the EGFr gene copy number in the second EGFr gene 38(1):17-23, 2001; WO98/24893; WO98/50433). One such copy number level relative to the first EGFr gene copy antibody, panitumumab, a human IgG2 monoclonal anti number level indicates that the treatment is effective in the body with an affinity of 5x10' M for human EGFr has patient. been shown to block binding of EGF to the EGFr to block receptor signaling, and to inhibit tumor cell activation and BRIEF DESCRIPTION OF THE FIGURES proliferation in vitro (see, e.g., WO98/50433: U.S. Pat. No. 6,235,883). Studies in athymic mice have demonstrated that 0012 FIGS. 1A-1D are images from dual-color FISH panitumumab also has in vivo activity, not only preventing assay analyses as seen by fluorescent microscope, according the formation of human epidermoid carcinoma A431 to work described in Example 3. In all four figures, EGFr Xenografts in athymic mice, but also eradicating already genes appear red and CEP7 sequences appear green. FIG. established large A431 tumor Xenografts (see, e.g., Yang et 1A shows the staining pattern of normal colorectal mucosal al., Crit. Rev. Oncol. Hematol. 38(1):17-23, 2001: Yang et cells. FIG. 1B shows the staining pattern of tumor cells from al., Cancer Res. 59(6):1236-43, 1999). Panitumumab has patient 7. FIG. 1C shows the staining pattern of tumor cells been considered for the treatment of renal carcinoma, col from patient 4. FIG. 1D shows the staining pattern of tumor orectal adenocarcinoma, prostate cancer, and non Small cell cells from patient 1. Squamous lung carcinoma, among other cancers (see, e.g., 0013 FIG. 2A is a Western blot showing the level of U.S. Patent Publication No. 2004/0033543), and clinical expression of EGFr in different colorectal carcinoma cell trials are underway with that antibody. lines, according to work described in Example 4. FIG. 2B is 0008. In certain cell types, the binding of growth factors, an image from a dual-color FISH assay analysis of DiFi Such as EGFr, prevents apoptosis by stimulation of phos colorectal carcinoma cells as seen by fluorescent micro phatidylinositol 3-kinase (“PI3K) and B-Raf. PI3K activa scope, according to work described in Example 4. EGFr tion triggers a molecular cascade leading to the downregu genes appear red and CEP7 sequences appear green. lation of the central pathways controlling programmed cell death (Yao, R., Science 267:2003-2006, 1995). Members of DETAILED DESCRIPTION OF CERTAIN the Raf family also have been identified as regulators of PREFERRED EMBODIMENTS programmed cell death in mammals (Hunter, Cell 80:225 0014 All references cited herein, including patents, 236, 1995). In Raf knockouts, mice lacking B-Raf showed patent applications, papers, textbooks, and the like, and the disturbances in cell survival, while mice lacking Raf-1 or references cited therein, to the extent that they are not A-Raf did not show such disturbances (see, e.g., Pritchard, already, are hereby incorporated herein by reference in their Curr. Biol. 6:614-617, 1996; Wojnowski, Nat. Genet. entirety. The section headings used herein are for organiza 16:293-297, 1997), indicating that B-Raf may possess spe tional purposes only and are not to be construed as limiting cific functions in cell death regulation. Both PI3K and B-Raf the subject matter described. are of interest in cell proliferation disorders, particularly CaCC. 0.015 Definitions SUMMARY 0016. Unless otherwise defined, scientific and technical 0009. In certain embodiments, a method of predicting terms used in connection with the present invention shall whether an EGFr-specific binding agent treatment will be have the meanings that are commonly understood by those efficacious in treating an EGFr-related cancer in a Subject is of ordinary skill in the art. Further, unless otherwise required provided, comprising determining the EGFr gene copy by context, singular terms shall include pluralities and plural number in a sample from the Subject, wherein the presence terms shall include the singular. of an increased EGFr gene copy number in the sample 0017 Generally, nomenclatures utilized in connection predicts that an EGFr-specific binding agent treatment will with, and techniques of cell and tissue culture, molecular be efficacious in treating an EGFr-related cancer in the biology, and protein and oligo- or polynucleotide chemistry Subject. and hybridization described herein are those well known and US 2007/0O87394 A1 Apr. 19, 2007

commonly used in the art. Standard techniques are used for indicates the location of the mutation in terms of the amino recombinant DNA, oligonucleotide synthesis, and tissue acid number of the polypeptide, “X” indicates the amino culture and transformation (e.g., electroporation, lipofec acid found at that position in the wild-type amino acid tion). Enzymatic reactions and purification techniques are sequence, and “Y” indicates the mutant amino acid at that performed according to the manufacturer's specifications or position. For example, the notation “G13D with reference as commonly accomplished in the art or as described herein. to the Ras polypeptide indicates that there is a glycine at The foregoing techniques and procedures are generally amino acid number 13 of the wild-type Ras sequence, and performed according to conventional methods well known that glycine is replaced with a aspartic acid in the mutant Ras in the art and as described in various general and more Sequence. specific references that are cited and discussed throughout the present specification. See e.g., Sambrook et al. Molecu 0025 The term “naturally-occurring as used herein as lar Cloning: A Laboratory Manual (2d ed., Cold Spring applied to an object refers to the fact that an object can be Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989)), found in nature. For example, a polypeptide or polynucle which is incorporated herein by reference. The nomencla otide sequence that is present in an organism (including tures utilized in connection with, and the laboratory proce viruses) that can be isolated from a source in nature and dures and techniques of analytical chemistry, synthetic which has not been intentionally modified by man in the organic chemistry, and medicinal and pharmaceutical chem laboratory or otherwise is naturally-occurring. istry described herein are those well known and commonly 0026. The term “operably linked as used herein refers to used in the art. Standard techniques are used for chemical the positioning of components such that they are in a syntheses, chemical analyses, pharmaceutical preparation, relationship permitting them to function in their intended formulation, and delivery, and treatment of patients. manner. A control sequence “operably linked to a coding 0018. In this application, the use of “or” means “and/or sequence is ligated in Such a way that expression of the unless stated otherwise. Furthermore, the use of the term coding sequence is achieved under conditions compatible “including, as well as other forms, such as “includes and with the control sequences. “included, is not limiting. Also, terms such as “element” or 0027. The term “control sequence” as used herein refers “component' encompass both elements and components to polynucleotide sequences which are necessary to effect comprising one unit and elements and components that the expression and processing of coding sequences to which comprise more than one subunit unless specifically stated they are ligated. The nature of such control sequences differs otherwise. depending upon the host organism; in prokaryotes, such 0019. As utilized in accordance with the present disclo control sequences generally include promoter, ribosomal Sure, the following terms, unless otherwise indicated, shall binding site, and transcription termination sequences; in be understood to have the following meanings: eukaryotes, generally, Such control sequences include pro 0020. The terms "isolated polynucleotide' and "isolated moters and transcription termination sequences. The term nucleic acid are used interchangeably, and as used herein “control sequences” is intended to include, at a minimum, all shall mean a polynucleotide of genomic, cDNA, or synthetic components whose presence is essential for expression and origin or some combination thereof, which by virtue of its processing, and can also include additional components origin (1) is not associated with all or a portion of a whose presence is advantageous, for example, leader polynucleotide in which the "isolated polynucleotide' is sequences and fusion partner sequences. found in nature, (2) is operably linked to a polynucleotide 0028. The term “polynucleotide' as referred to herein which it is not linked to in nature, or (3) does not occur in means a polymeric form of nucleotides of at least 10 bases nature as part of a larger sequence. in length, either ribonucleotides or deoxynucleotides or a 0021. The terms “isolated protein’ and “isolated modified form of either type of nucleotide. The term polypeptide' are used interchangeably, and as referred to includes single and double stranded forms of DNA. herein mean a protein of CDNA, recombinant RNA, or 0029. The term "oligonucleotide' referred to herein synthetic origin, or some combination thereof, which by includes naturally occurring and modified nucleotides linked virtue of its origin, or source of derivation, (1) is not together by naturally occurring, and non-naturally occurring associated with proteins found in nature, (2) is free of other oligonucleotide linkages. Oligonucleotides are a polynucle proteins from the same source, e.g. free of murine proteins, otide Subset generally comprising a length of 200 bases or (3) is expressed by a cell from a different species, or (4) does fewer. Preferably oligonucleotides are 10 to 60 bases in not occur in nature. length and most preferably 12, 13, 14, 15, 16, 17, 18, 19, or 0022. The terms “polypeptide' and “protein’ are used 20 to 40 bases in length. Oligonucleotides are usually single interchangeably and are used herein as a generic term to Stranded, e.g. for probes, although oligonucleotides may be refer to native protein, fragments, peptides, or analogs of a double Stranded, e.g. for use in the construction of a gene polypeptide sequence. Hence, native protein, fragments, and mutant. Oligonucleotides of the invention can be either analogs are species of the polypeptide genus. sense or antisense oligonucleotides. 0023 The term “EGFr polypeptide encompasses native 0030 The term “naturally occurring nucleotides’ protein, as well as fragments, analogs, and mutants of a referred to herein includes deoxyribonucleotides and ribo native protein. Thus, native EGFr protein, as well as frag nucleotides. The term “modified nucleotides’ referred to ments, analogs and mutants of native EGFr protein are herein includes nucleotides with modified or substituted species of the EGFr polypeptide genus. Sugar groups and the like. The term "oligonucleotide link 0024. The terminology Xi Y” in the context of a muta ages' referred to herein includes oligonucleotide linkages tion in a polypeptide sequence is art-recognized, where 'i' Such as phosphorothioate, phosphorodithioate, phospho US 2007/0O87394 A1 Apr. 19, 2007 roselenoate, phosphorodiselenoate, phosphoroanilothioate, that the complementary sequence is homologous to all or a phoshoraniladate, phosphoroamidate, and the like. See e.g., portion of a reference polynucleotide sequence. For illus LaPlanche et al. Nucl. Acids Res. 14:9081 (1986); Stec et al. tration, the nucleotide sequence “TATAC corresponds to a J. Am. Chem. Soc. 106:6077 (1984); Stein et al. Nucl. Acids reference nucleotide sequence “TATAC and is complemen Res. 16:3209 (1988); Zon et al. Anti-Cancer Drug Design tary to a reference nucleotide sequence “GTATA’. 6:539 (1991); Zonet al. Oligonucleotides and Analogues. A 0033. The following terms are used to describe the Practical Approach, pp. 87-108 (F. Eckstein, Ed., Oxford sequence relationships between two or more polynucleotide University Press, Oxford England (1991)); Stec et al. U.S. or amino acid sequences: “reference sequence”, “compari Pat. No. 5,151,510; Uhlmann and Peyman Chemical son window', 'sequence identity”, “percentage of sequence Reviews 90:543 (1990), the disclosures of which are hereby identity”, and “substantial identity”. A “reference sequence' incorporated by reference. An oligonucleotide can include a is a defined sequence used as a basis for a sequence label for detection, if desired. comparison; a reference sequence may be a Subset of a larger 0031. The “copy number of a nucleic acid refers to the sequence, for example, as a segment of a full-length cDNA number of discrete instances of that nucleic acid in a given or gene sequence given in a sequence listing or may com sample. An “EGFr gene copy number in a sample refers to prise a complete cDNA or gene sequence. Generally, a the number of discrete copies of an EGFr gene in that reference sequence is at least 18 nucleotides or 6 amino sample. An "increased EGFr gene copy number in a sample acids in length, frequently at least 24 nucleotides or 8 amino means that the number of discrete copies of the EGFr gene acids in length, and often at least 48 nucleotides or 16 amino in a sample is increased from a reference. In certain Such acids in length. Since two polynucleotides or amino acid embodiments, the reference is another sample. In certain sequences may each (1) comprise a sequence (i.e., a portion Such embodiments, the reference is another sample taken of the complete polynucleotide or amino acid sequence) that from the same individual. In certain such embodiments, the is similar between the two molecules, and (2) may further reference is another sample taken from a different indi comprise a sequence that is divergent between the two vidual. In certain such embodiments, the reference is the polynucleotides or amino acid sequences, sequence com EGFr gene copy number characteristic of a particular popu parisons between two (or more) molecules are typically lation. performed by comparing sequences of the two molecules 0032) The term “selectively hybridize” referred to herein over a “comparison window” to identify and compare local means to detectably and specifically bind. Polynucleotides, regions of sequence similarity. A "comparison window', as oligonucleotides, and fragments thereof selectively hybrid used herein, refers to a conceptual segment of at least 18 ize to nucleic acid strands under hybridization and wash contiguous nucleotide positions or 6 amino acids wherein a conditions that minimize appreciable amounts of detectable polynucleotide sequence or amino acid sequence may be binding to nonspecific nucleic acids. High Stringency con compared to a reference sequence of at least 18 contiguous ditions can be used to achieve selective hybridization con nucleotides or 6 amino acid sequences and wherein the ditions as known in the art and discussed herein. Generally, portion of the polynucleotide sequence in the comparison the nucleic acid sequence homology between polynucle window may comprise additions, deletions, Substitutions, otides, oligonucleotides, and fragments and a nucleic acid and the like (i.e., gaps) of 20 percent or less as compared to sequence of interest will be at least 80%, and more typically the reference sequence (which does not comprise additions with preferably increasing homologies of at least 85%, 90%, or deletions) for optimal alignment of the two sequences. 95%, 96%, 97%, 98%, 99%, and 100%. Two amino acid Optimal alignment of sequences for aligning a comparison sequences are homologous if there is a partial or complete window may be conducted by the local homology algorithm identity between their sequences. For example, 85% homol of Smith and Waterman Adv. Appl. Math. 2:482 (1981), by ogy means that 85% of the amino acids are identical when the homology alignment algorithm of Needleman and Wun the two sequences are aligned for maximum matching. Gaps sch J. Mol. Biol. 48:443 (1970), by the search for similarity (in either of the two sequences being matched) are allowed method of Pearson and Lipman Proc. Natl. Acad. Sci. in maximizing matching; gap lengths of 5 or less are (U.S.A.) 85:2444 (1988), by computerized implementations preferred with 2 or less being more preferred. Alternatively of these algorithms (GAP, BESTFIT. FASTA, and TFASTA and preferably, two protein sequences (or polypeptide in the Wisconsin Genetics Software Package Release 7.0, sequences derived from them of at least 30 amino acids in (Genetics Computer Group, 575 Science Dr. Madison, length) are homologous, as this term is used herein, if they Wis.), Geneworks, or MacVector software packages), or by have an alignment score of more than 5 (in Standard devia inspection, and the best alignment (i.e., resulting in the tion units) using the program ALIGN with the mutation data highest percentage of homology over the comparison win matrix and a gap penalty of 6 or greater. See Dayhoff, M.O., dow) generated by the various methods is selected. in Atlas of Protein Sequence and Structure, pp. 101-110 0034. The term “sequence identity” means that two poly (Volume 5, National Biomedical Research Foundation nucleotide or amino acid sequences are identical (i.e., on a (1972)) and Supplement 2 to that volume, pp. 1-10. The two nucleotide-by-nucleotide or residue-by-residue basis) over sequences or parts thereof are more preferably homologous the comparison window. The term "percentage of sequence if their amino acids are greater than or equal to 50% identical identity” is calculated by comparing two optimally. aligned when optimally aligned using the ALIGN program. The term sequences over the window of comparison, determining the "corresponds to is used herein to mean that a polynucle number of positions at which the identical nucleic acid base otide sequence is homologous (i.e., is identical, not strictly (e.g., A. T. C. G.U., or I) or residue occurs in both sequences evolutionarily related) to all or a portion of a reference to yield the number of matched positions, dividing the polynucleotide sequence, or that a polypeptide sequence is number of matched positions by the total number of posi identical to a reference polypeptide sequence. In contradis tions in the comparison window (i.e., the window size), and tinction, the term "complementary to” is used herein to mean multiplying the result by 100 to yield the percentage of US 2007/0O87394 A1 Apr. 19, 2007 sequence identity. The terms “substantial identity” as used as being encompassed by the present invention, providing herein denotes a characteristic of a polynucleotide or amino that the variations in the amino acid sequence maintain at acid sequence, wherein the polynucleotide or amino acid least 75%, more preferably at least 80%, 90%. 95%, and comprises a sequence that has at least 85 percent sequence most preferably 99%. Conservative amino acid substitutions identity, preferably at least 90 to 95 percent sequence are those that take place within a family of amino acids that identity, more usually at least 96, 97, 98, or 99 percent are related in their side chains. Genetically encoded amino sequence identity as compared to a reference sequence over acids are generally divided into families: (1) acidic amino a comparison window of at least 18 nucleotide (6 amino acids (e.g., aspartate and glutamate); (2) basic amino acids acid) positions, frequently over a window of at least 24-48 (e.g., lysine, arginine, and histidine); (3) non-polar amino nucleotide (8-16 amino acid) positions, wherein the percent acids (e.g., alanine, Valine, leucine, isoleucine, proline, age of sequence identity is calculated by comparing the phenylalanine, methionine, and tryptophan); and (4) reference. Sequence to the sequence which may include dele uncharged polar amino acids (e.g., glycine, asparagine, tions or additions which total 20 percent or less of the glutamine, cysteine, serine, threonine, and tyrosine). Other reference sequence over the comparison window. The ref families of amino acids include, but are not limited to: Serine erence sequence may be a Subset of a larger sequence. and threonine are an aliphatic-hydroxy family; asparagine 0035. As used herein, the twenty conventional amino and glutamine are an amide-containing family; alanine, acids and their abbreviations follow conventional usage. See valine, leucine and isoleucine are an aliphatic family; phe Immunology A Synthesis (2" Edition, E. S. Golub and D. nylalanine, tryptophan, and tyrosine are an aromatic family, R. Gren, Eds. Sinauer Associates, Sunderland, Mass. and cysteine and methionine as a Sulfur-containing side (1991)), which is incorporated herein by reference. The term chain family. For example, it is reasonable to expect that an “amino acid' or "amino acid residue,” as used herein, refers isolated replacement of a leucine with an isoleucine or to naturally occurring L amino acids or to D amino acids. valine, an aspartate with a glutamate, a threonine with a The commonly used one- and three-letter abbreviations for serine, or a similar replacement of an amino acid with a amino acids are used herein (Bruce Alberts et al., Molecular structurally related amino acid will not have a major effect Biology of the Cell, Garland Publishing, Inc., New York (4th on the binding or properties of the resulting molecule, ed. 2002)). Stereoisomers (e.g., D-amino acids) of the especially if the replacement does not involve an amino acid twenty conventional amino acids, unnatural amino acids within a framework site. Exemplary conservative amino Such as C.-.C.-disubstituted amino acids, N-alkyl amino acid substitution groups include, but are not limited to: acids, lactic acid, and other unconventional amino acids may valine-leucine-isoleucine, phenylalanine-tyrosine, lysine also be suitable components for polypeptides of the present arginine, alanine-valine, glutamic acid-aspartic acid, cys invention. Examples of unconventional amino acids include: teine-methionine, and asparagine-glutamine. 4-hydroxyproline, Y-carboxyglutamate, e-N.N.N-trimethyll 0038 Preferred amino acid substitutions are those which: ysine, e-N-acetylysine, O-phosphoserine, N-acetylserine, (1) reduce Susceptibility to proteolysis, (2) reduce Suscep N-formylmethionine, 3-methylhistidine, 5-hydroxylysine, tibility to oxidation, (3) alter binding affinity for forming O-N-methylarginine, and other similar amino acids and protein complexes, (4) alter binding affinities, and (5) confer imino acids (e.g., 4-hydroxyproline). In the polypeptide or modify other physicochemical or functional properties of notation used herein, the lefthand direction is the amino Such analogs. Analogs can include various muteins of a terminal direction and the righthand direction is the carboxy sequence other than the naturally-occurring peptide terminal direction, in accordance with standard usage and sequence. For example, single or multiple amino acid Sub convention. stitutions (preferably conservative amino acid Substitutions) may be made in the naturally-occurring sequence (prefer 0036) Similarly, unless specified otherwise, the lefthand ably in the portion of the polypeptide outside the domain(s) end of single-stranded polynucleotide sequences is the 5' forming intermolecular contacts. A conservative amino acid end; the lefthand direction of double-stranded polynucle Substitution should not substantially change the structural otide sequences is referred to as the 5' direction. The characteristics of the parent sequence (e.g., a replacement direction of 5' to 3' addition of nascent RNA transcripts is amino acid should not tend to break a helix that occurs in the referred to as the transcription direction. Sequence regions parent sequence, or disrupt other types of secondary struc on the DNA strand having the same sequence as the RNA ture that characterizes the parent sequence). Examples of and which are 5' to the 5' end of the RNA transcript are art-recognized polypeptide secondary and tertiary structures referred to as "upstream sequences'. Sequence regions on are described in Proteins, Structures and Molecular Prin the DNA strand having the same sequence as the RNA and ciples (Creighton, Ed., W. H. Freeman and Company, New which are 3' to the 3' end of the RNA transcript are referred York (1984)); Introduction to Protein Structure (C. Branden to as "downstream sequences'. and J. Tooze, eds., Garland Publishing; New York, N.Y. 0037 As applied to polypeptides, the term “substantial (1991)); and Thornton et at. Nature 354:105 (1991), which identity” means that two peptide sequences, when optimally are each incorporated herein by reference. aligned, such as by the programs GAP or BESTFIT using 0039 The term “analog as used herein refers to polypep default gap weights, share at least 80 percent sequence tides which are comprised of a segment of at least 25 amino identity, preferably at least 90 percent sequence identity, acids that has substantial identity to a portion of an amino more preferably at least 95, 96, 97, or 98 percent sequence acid sequence of a naturally occurring polypeptide and identity, and most preferably at least 99 percent sequence which has at least one of the activities of the naturally identity. Preferably, residue positions which are not identical occurring polypeptide. Typically, polypeptide analogs com differ by conservative amino acid substitutions. As discussed prise a conservative amino acid Substitution (or addition or herein, minor variations in the amino acid sequences of deletion) with respect to the naturally-occurring sequence. antibodies or immunoglobulin molecules are contemplated Analogs typically are at least 20 amino acids long, prefer US 2007/0O87394 A1 Apr. 19, 2007

ably at least 50 amino acids long or longer, and can often be embodiments, an EGFr-specific binding agent is an antigen as long as a full-length naturally-occurring polypeptide. binding region of an antibody specific for an EGFr polypep 0040 Peptide analogs are commonly used in the phar tide. maceutical industry as non-peptide drugs with properties 0044) The term “specifically binds” refers to the ability of analogous to those of the template peptide. Those types of a specific binding agent to bind to a target with greater non-peptide compound are termed "peptide mimetics' or affinity than it binds to a non-target. In certain embodiments, "peptidomimetics’. Fauchere, J. Adv. Drug Res. 15:29 specific binding refers to binding for a target with an affinity (1986); Veber and Freidinger TINS p. 392 (1985); and Evans that is at least 10, 50, 100, 250, 500, or 1000 times greater et al. J. Med. Chem. 30:1229 (1987), which are incorporated than the affinity for a non-target. In certain embodiments, herein by reference. Such compounds are often developed affinity is determined by an affinity ELISA assay. In certain with the aid of computerized molecular modeling. Peptide embodiments, affinity is determined by a Blacore assay. In mimetics that are structurally similar to therapeutically certain embodiments, affinity is determined by a kinetic useful peptides may be used to produce an equivalent method. In certain embodiments, affinity is determined by an therapeutic or prophylactic effect. Generally, peptidomimet equilibrium/solution method. In certain embodiments, an ics are structurally similar to a paradigm polypeptide (i.e., a antibody is said to specifically bind an antigen when the polypeptide that has a biochemical property or pharmaco dissociation constant between the antibody and one or more logical activity). Such as human antibody, but have one or of its recognized epitopes is s 1 uM, preferably s 100 nM more peptide linkages optionally replaced by a linkage and most preferably s 10 nM. selected from the group consisting of —CHNH-, CHS , —CH2—CH2—, —CH=CH-(cis and trans), 0045 “Native antibodies and immunoglobulins' are usu —COCH2—, —CH(OH)CH , and —CHSO , by ally heterotetrameric glycoproteins of about 150,000 dal methods well known in the art. Systematic substitution of tons, composed of two identical light (L) chains and two one or more amino acids of a consensus sequence with a identical heavy (H) chains. Each light chain is linked to a D-amino acid of the same type (e.g., D-lysine in place of heavy chain by one covalent disuilfide bond, while the L-lysine) may be used to generate more stable peptides. In number of disulfide linkages varies between the heavy addition, constrained peptides comprising a consensus chains of different immunoglobulin isotypes. Each heavy sequence or a Substantially identical consensus sequence and light chain also has regularly spaced intrachain disulfide variation may be generated by methods known in the art bridges. Each heavy chain has at one end a variable domain (Rizo and Gierasch Ann. Rev. Biochem. 61:387 (1992), (VH) followed by a number of constant domains. Each light incorporated herein by reference); for example, by adding chain has a variable domain at one end (VL) and a constant internal cysteine residues capable of forming intramolecular domain at its other end; the constant domain of the light disulfide bridges which cyclize the peptide. chain is aligned with the first constant domain of the heavy chain, and the light chain variable domain is aligned with the 0041) Preferred amino- and carboxy-termini of fragments variable domain of the heavy chain. Particular amino acid or analogs occur near boundaries of functional domains. residues are believed to form an interface between the light Structural and functional domains can be identified by and heavy-chain variable domains (Chothia et al J. Mol. comparison of the nucleotide and/or amino acid sequence Biol. 186:651 (1985; Novotny and Haber, Proc. Natl. Acad. data to public or proprietary sequence databases. Preferably, Sci. U.S.A. 82:4592 (1985); Chothia et al., Nature 342:877 computerized comparison methods are used to identify 883 (1989)). sequence motifs or predicted protein conformation domains that occur in other proteins of known structure and/or 0046) The term “antibody” refers to both an intact anti function. Methods to identify protein sequences that fold body and to an antigen binding fragment thereof which into a known three-dimensional structure are known (see competes with the intact antibody for specific binding. Bowie et al. Science 253:164 (1991)). Those of skill in the “Antigen binding fragment thereof refers to a portion or art can recognize sequence motifs and structural conforma fragment of an intact antibody molecule, wherein the frag tions that may be used to define structural and functional ment retains the antigen-binding function. Binding frag domains in accordance with the invention. ments are produced by recombinant DNA techniques, or by enzymatic or chemical cleavage of intact antibodies such as 0042. The term “specific binding agent” refers to a natu by cleavage with papain. Binding fragments include Fab, ral or non-natural molecule that specifically binds to a target. Fab, F(ab'). Fv, single-chain antibodies (“scFv'). Fd and Examples of specific binding agents include, but are not Fd fragments. Methods for producing the various fragments limited to, proteins, peptides, nucleic acids, carbohydrates, from monoclonal antibodies are well known to those skilled lipids, and Small molecule compounds. In certain embodi in the art (see, e.g., Pluckthun, 1992. Immunol. Rev. ments, a specific binding agent is an antibody. In certain 130:151-188). An antibody other than a “bispecific' or embodiments, a specific binding agent is an antigen binding “bifunctional antibody is understood to have each of its region of an antibody. binding sites be identical. An antibody substantially inhibits adhesion of a receptor to a counterreceptor when an excess 0043. The term “EGFr-specific binding agent” refers to a of antibody reduces the quantity of receptor bound to specific binding agent that specifically binds any portion of counterreceptor by at least about 20%, 40%, 60%, or 80%, an EGFr polypeptide. In certain embodiments, an EGFr and more usually greater than about 85%, 90%. 95%, 96%, specific binding agent is an antibody that specifically binds 97%, 98%, or 99% (as measured in an in vitro competitive an EGFr polypeptide. In certain embodiments, an EGFr binding assay). specific binding agent is a human antibody that specifically binds an EGFr polypeptide. In certain embodiments, an 0047. An "isolated antibody is one which has been EGFr-specific binding agent is panitumumab. In certain identified and separated and/or recovered from a component US 2007/0O87394 A1 Apr. 19, 2007

of its natural environment. Contaminant components of its Sequences of Proteins of Immunological Interest, 5" Ed. natural environment are materials which would interfere Public Health Service, National Institutes of Health, with diagnostic or therapeutic uses for the antibody, and may Bethesda, Md. (1991)) and/or those residues from a “hyper include enzymes, hormones, and other proteinaceous or variable loop' (e.g. residues 26-32 (L1), 50-52 (L2) and nonproteinaceous solutes. In preferred embodiments, the 91-96 (L3) in the light chain variable domain and 26-32 antibody will be purified (1) to greater than 95% by weight ((H1), 53-55 (H2) and 96-1 01 (H3) in the heavy chain of antibody as determined by the Lowry method, and variable domain: Chothia and Lesk.J. Mol. Biol 196:901-917 terminal or internal amino acid sequencing by use of a (1987)). “Framework Region” or “FR residues are those spinning cup sequenator, or (2) to homogeneity by SDS variable domain residues other than the hypervariable region PAGE under reducing or nonreducing conditions using residues as herein defined. Coomassie blue or, preferably, silver stain. An isolated 0051. The term “complementarity determining regions' antibody includes the antibody in situ within recombinant or “CDRs, when used herein, refers to parts of immuno cells since at least one component of the antibody's natural logical receptors that make contact with a specific ligand and environment will not be present. Ordinarily, however, iso determine its specificity. The CDRs of immunological recep lated antibody will be prepared by at least one purification tors are the most variable part of the receptor protein, giving step. receptors their diversity, and are carried on six loops at the 0048. The term “variable” refers to the fact that certain distal end of the receptor's variable domains, three loops portions of the variable domains differ extensively in coming from each of the two variable domains of the sequence among antibodies and are used in the binding and receptor. specificity of each particular antibody for its particular antigen. However, the variability is not evenly distributed 0052 “Antibody-dependent cell-mediated cytotoxicity' throughout the variable domains of antibodies. It is concen and "ADCC refer to a cell-mediated reaction in which trated in three segments called complementarity-determin non-specific cytotoxic cells that express Fc receptors (FcRs) ing regions (CDRs) or hypervariable regions both in the (e.g. Natural Killer (NK) cells, neutrophils, and macroph light-chain and heavy-chain variable domains. The more ages) recognize bound antibody on a target cell and Subse highly conserved portions of variable domains are called the quently cause lysis of the target cell. The primary cells for framework (FR). The variable domains of native heavy and mediating ADCC, NK cells, express FcyRIII only, whereas light chains each comprise four FR regions, largely adopting monocytes express FcyRI, FcyRII and FcyRIII. Fc expres a B-sheet configuration, connected by three CDRs, which sion on hematopoietic cells is Summarized in Table 3 on form loops connecting, and in some cases forming part of page 464 of Ravetch and Kinet, Annu. Rev. Immunol 9:457 the B-sheet structure. The CDRs in each chain are held 92 (1991). To assess ADCC activity of a molecule of together in close proximity by the FR regions and, with the interest, an in vitro ADCC assay, such as that described in CDRs from the other chain, contribute to the formation of U.S. Pat. No. 5,500,362, or 5,821,337 may be performed. the antigen-binding site of antibodies (see Kabat etal. Useful effector cells for such assays include peripheral blood (1991)). The constant domains are not involved directly in mononuclear cells (PBMC) and Natural Killer (NK) cells. binding an antibody to an antigen, but exhibit various Alternatively, or additionally, ADCC activity of the mol effector functions, such as participation of the antibody in ecule of interest may be assessed in Vivo, e.g., in an animal antibody-dependent cellular toxicity. model such as that disclosed in Clynes et al., PNAS (USA) 95:652-656 (1988). 0049. “Fv' is the minimum antibody fragment which 0053. The term “epitope' includes any protein determi contains a complete antigen-recognition and binding site. In nant capable of specific binding to an immunoglobulin a two-chain Fv species, this region consists of a dimer of one heavy- and one light-chain variable domain in tight, non and/or T-cell receptor. Epitopic determinants usually consist covalent association. In a single-chain FV species, one of chemically active Surface groupings of molecules such as heavy- and one light-chain variable domain can be amino acids or Sugar side chains and usually have specific covalently linked by a flexible peptide linker such that the three dimensional structural characteristics, as well as spe light and heavy chains can associate in a “dimeric' structure cific charge characteristics. analogous to that in a two-chain Fv species. It is in this 0054 The term "agent” is used herein to denote a chemi configuration that the three CDRs of each variable domain cal compound, a mixture of chemical compounds, a biologi interact to define an antigen-binding site on the Surface of cal macromolecule, or an extract made from biological the VH-VL dimer. Collectively, the six CDRs confer anti materials. gen-binding specificity on the antibody. However, even a 0.055 As used herein, the terms “label” or “labeled” single variable domain (or half of an Fv comprising only refers to incorporation of a detectable marker, e.g., by three CDRS specific for an antigen) has the ability to incorporation of a radiolabeled amino acid or attachment to recognize and bind antigen, although at a lower affinity than a polypeptide of biotinyl moieties that can be detected by the entire binding site. marked avidin (e.g., Streptavidin containing a fluorescent 0050. The term “hypervariable region” when used herein marker or enzymatic activity that can be detected by optical refers to the amino acid residues of an antibody which are or calorimetric methods). In certain situations, the label or responsible for antigen-binding. The hyperVariable region marker can also be therapeutic. Various methods of labeling generally comprises amino acid residues from a "comple polypeptides and glycoproteins are known in the art and may mentarity determining region' or “CDR (e.g. residues be used. Examples of labels for polypeptides include, but are 24-34 (L1), 50-62 (L2), and 89-97 (L3) in the light chain not limited to, the following: radioisotopes or radionuclides variable domain and 31-55 (H1), 50-65 (H2) and 95-102 (e.g., H, C, N, SS, YTc, In, 125I, III), fluorescent (H3) in the heavy chain variable domain; Kabat et al., labels (e.g., FITC, rhodamine, lanthanide phosphors), enzy US 2007/0O87394 A1 Apr. 19, 2007

matic labels (e.g., horseradish peroxidase, B-galactosidase, of treatment include those already with the condition or luciferase, alkaline phosphatase), chemiluminescent groups, disorder as well as those prone to have the condition or biotinyl groups, and predetermined polypeptide epitopes disorder or those in which the condition or disorder is to be recognized by a secondary reporter (e.g., leucine Zipper pair prevented. sequences, binding sites for secondary antibodies, metal binding domains, epitope tags). In some embodiments, 0063 A statement that a treatment is “efficacious means labels are attached by spacer arms of various lengths to that the treatment is useful for treating the disease or reduce potential steric hindrance. condition for which the treatment is administered. 0056. The term “pharmaceutical agent or drug as used 0064. A “disorder is any condition that would benefit herein refers to a chemical compound or composition from one or more treatments. This includes chronic and capable of inducing a desired therapeutic effect when prop acute disorders or disease including those pathological con erly administered to a patient. Other chemistry terms herein ditions which predispose the mammal to the disorder in are used according to conventional usage in the art, as question. Non-limiting examples of disorders to be treated exemplified by The McGraw-Hill Dictionary of Chemical herein include benign and malignant tumors, leukemias, and Terms (Parker, S., Ed., McGraw-Hill, San Francisco (1985)), lymphoid malignancies, in particular breast, rectal, ovarian, incorporated herein by reference). stomach, endometrial, salivary gland, lung, kidney, colon, thyroid, pancreatic, prostate or bladder cancer. A preferred 0057 The term “anti-cancer agent' is used herein to refer disorder to be treated in accordance with the present inven to agents that have the functional property of inhibiting a tion is a malignant tumor, such as colorectal cancer, cervical development or progression of a neoplasm in a human, cancer (e.g., cervical intraepithelial squamous and glandular particularly a malignant (cancerous) lesion, such as a car neoplasia), lung cancer, renal cell carcinoma (RCC), esbph cinoma, sarcoma, lymphoma, or leukemia. Inhibition of ageal tumors, epithelial malignant tumors, and carcinoma metastasis is frequently a property of anti-cancer agents. derived cell lines. 0.058 As used herein, “substantially pure” means an 0065. A “disease or condition related to an EGFr object species is the predominant species present (i.e., on a polypeptide' includes at least one disease or condition molar basis it is more abundant than any other individual selected from: a disease or condition caused by an EGFr species in the composition), and preferably a Substantially polypeptide; a disease or condition exacerbated by an EGFr purified fraction is a composition wherein the object species polypeptide; a disease or condition contributed to by an comprises at least about 50 percent (on a molar basis) of all EGFr polypeptide; and a disease or condition that is asso macromolecular species present. Generally, a Substantially ciated with the presence of an EGFr polypeptide. In certain pure composition will comprise more than about 80 percent embodiments, the disease or condition related to an EGFr of all macromolecular species present in the composition, polypeptide may exist in the absence of the EGFr polypep more preferably more than about 85%, 90%, 95%, 96%, tide. In certain embodiments, an increase or decrease in the 97%, 98%, or 99%. Most preferably, the object species is amount of EGFr polypeptide causes a disease or condition purified to essential homogeneity (contaminant species can related to an EGFr polypeptide. In certain embodiments, a not be detected in the composition by conventional detection disease or condition related to an EGFr polypeptide may be methods) wherein the composition consists essentially of a exacerbated by an increase or decrease in the amount of single macromolecular species. EGFr polypeptide. In certain embodiments, a disease or 0059) The terms “patient” and “subject” include human condition related to an EGFr polypeptide is a cancer. An and animal Subjects. “EGFr-related cancer includes at least one cancer selected from: a cancer which is caused by an EGFr polypeptide, a 0060. The terms “mammal’ and “animal’ for purposes of cancer which is exacerbated by an EGFr polypeptide, a treatment refer to any animal classified as a mammal, cancer which is contributed to by an EGFr polypeptide, and including humans, domestic and farm animals, and Zoo, a cancer which is associated with an EGFr polypeptide. sports, or pet animals, such as dogs, horses, cats, cows, etc. Exemplary EGFr-related cancers include, but are not limited Preferably, the mammal is human. to, colorectal cancer, lung cancer (including, but not limited 0061 The term “disease state' refers to a physiological to, non Small cell lung carcinoma), breast cancer, kidney state of a cell or of a whole mammal in which an interrup cancer, colon cancer, gastric cancer, brain cancer, bladder tion, cessation, or disorder of cellular or body functions, cancer, head and neck cancers, ovarian cancer, and prostate systems, or organs has occurred. CaCC. 0062) The terms “treat” or “treatment” refer to. both 0066. In “combined therapy’ or “combination therapy.” therapeutic treatment and prophylactic or preventative mea patients are treated with an EGFr-specific binding agent in sures, wherein the object is to prevent or slow down (lessen) combination with a chemotherapeutic or anti-cancer agent an undesired physiological change or disorder. Such as the and/or radiation therapy. In certain embodiments, an EGFr development or spread of cancer. For purposes of this related cancer is treated under protocol by the addition of a invention, beneficial or desired clinical results include, but specific binding agent to an EGFr polypeptide to standard are not limited to, alleviation of symptoms, diminishment of first and second line therapy. In certain embodiments, pro extent of disease, stabilized (i.e., not worsening) state of tocol designs will address effectiveness as assessed by disease, delay or slowing of disease progression, ameliora reduction in tumor mass as well as the ability to reduce usual tion or palliation of the disease state, and remission (whether doses of standard chemotherapy. In certain embodiments, partial or total), whether detectable or undetectable. “Treat these dosage reductions will allow additional and/or pro ment can also mean prolonging Survival as compared to longed therapy by reducing dose-related toxicity of the expected Survival if not receiving treatment. Those in need chemotherapeutic agent. US 2007/0O87394 A1 Apr. 19, 2007

0067 “Monotherapy” refers to the treatment of a disorder “Southern Hybridization' in Molecular Cloning: A Labora by administering an EGFr-specific binding agent to patients tory Manual, 3d ed., Cold Spring Harbor Lab. Press: Cold without an accompanying chemotherapeutic or anti-cancer Spring Harbor (2001)). In certain such embodiments, agent or radiation therapy. nucleic acids from the sample are separated by electrophore sis. In certain embodiments, the separated nucleic acids are Certain Exemplary Embodiments transferred to a solid Support. Exemplary Solid Supports 0068 Certain Exemplary Methods of Determining EGFr include, but are not limited to, nitrocellulose; nylon; glass; Gene Copy Number quartz; diazotized membranes, including, but not limited to, 0069. In various embodiments, the EGFr gene copy num paper or nylon; silicones; polyformaldehyde; cellulose; cel ber of a sample can be determined in a variety of ways lulose acetate; plastics including, but not limited to, poly known in the art. Exemplary methods include, but are not ethylene, polypropylene, and polystyrene; paper, ceramics; limited to, hybridization-based assays, amplification-based metals; metalloids; semiconductive materials; and Sub assays, and by detection of gene transcription and protein stances that form gels, including, but not limited to, gelatins, expression. lipopolysaccharides, silicates, agarose, and polyacryla mides. In certain Such embodiments, the separated nucleic 0070. In certain embodiments, a hybridization-based acids on the Solid Support are exposed to one or more probes assay is used to determine the EGFr gene copy number in a that specifically bind to the EGFr gene. In certain embodi sample. In certain embodiments, the hybridization-based ments, one or more probes that specifically bind to the EGFr assay is fluorescent in situ hybridization (“FISH) (see, e.g., gene are labeled. In certain embodiments, separated nucleic Angerer, Meth. Enzymol. 152: 649 (1987); Pinkel et al., acids on the Solid Support are also exposed to one or more Proc. Natl. Acad. Sci. U.S.A. 85:9138-42 (1988)). In certain probes that specifically bind to at least one reference nucle Such embodiments, the sample is fixed. In certain Such otide sequence. In certain embodiments, one or more probes embodiments, the sample is treated to increase the accessi that specifically bind to at least one reference nucleotide bility of one or more target nucleic acids. In certain Such sequence are labeled. In certain embodiments, one or more embodiments, the sample is exposed to one or more probes probes that specifically bind to the EGFr gene are labeled that specifically bind to the EGFr gene. In certain embodi with a different label than the label of one or more probes ments, one or more probes that specifically bind to the EGFr that specifically bind to at least one reference nucleotide gene are labeled. In certain embodiments, the sample is also sequence. In certain embodiments, at least one reference exposed to one or more probes that specifically bind to at nucleotide sequence is located on chromosome 7. In certain least one reference nucleotide sequence. In certain embodi embodiments, two copies of at least one reference nucleotide ments, one or more probes that specifically bind to at least sequence are present in each cell in the sample. In certain one reference nucleotide sequence are labeled. In certain embodiments, at least one reference nucleotide sequence is embodiments, one or more probes that specifically bind to a centromeric sequence. In certain embodiments, labeled the EGFr gene are labeled with a different label than the probes are detected. In certain embodiments, the EGFr gene label of one or more probes that specifically bind to at least copy number is compared to the copy number of at least one one reference nucleotide sequence. In certain embodiments, reference nucleotide sequence. In certain embodiments, an at least one reference nucleotide sequence is located on increased copy number of the EGFr gene in the test sample chromosome 7. In certain embodiments, two copies of at relative to the copy number of the at least one reference least one reference nucleotide sequence are present in each nucleotide sequence predicts that an EGFr-specific binding cell in the sample. In certain embodiments, at least one agent treatment will be efficacious in treating an EGFr reference nucleotide sequence is a centromeric sequence. In related cancer in the Subject. certain embodiments, labeled probes are detected by fluo 0073. In certain embodiments, the hybridization-based rescent microscopy. In certain embodiments, the EGFr gene assay is a sandwich assay (see, e.g., Hames and Higgins, copy number is compared to the copy number of at least one Nucleic Acid Hybridization, A Practical Approach, IRL reference nucleotide sequence. In certain embodiments, an Press (1985); Gallet al., Proc. Natl. Acad. Sci. U.S.A. 63: increased copy number of the EGFr gene in the test sample 378-383 (1969); and John et al., Nature 223: 582-587 relative to the copy number of the at least one reference (1969)). In certain embodiments, a nucleic acid that specifi nucleotide sequence predicts that an EGFr-specific binding cally binds to the EGFr gene is immobilized to a solid agent treatment will be efficacious in treating an EGFr Support. Exemplary solid Supports include, but are not related cancer in the Subject. limited to, nitrocellulose: nylon; glass; quartz; diazotized 0071. In certain embodiments, the number of nuclei membranes, including, but not limited to, paper or nylon; present in a sample is determined. In certain embodiments, silicones; polyformaldehyde; cellulose; cellulose acetate; the number of nuclei present in a sample is determined by plastics including, but not limited to, polyethylene, polypro fluorescence microscopy. In certain embodiments, the EGFr pylene, and polystyrene; paper; ceramics; metals; metal gene copy number is compared to the number of nuclei in loids; semiconductive materials; and Substances that form the sample. In certain embodiments, the ratio of the EGFr gels, including, but not limited to, gelatins, lipopolysaccha gene copy number to the number of nuclei is expected to be rides, silicates, agarose, and polyacrylamides. Exemplary 2 in a normal sample. In certain embodiments, a ratio of types of immobilization include, but are not limited to, EGFr gene copy number to number of nuclei greater than covalent bonding or linking via one or more functional two predicts that an EGFr-specific binding agent treatment groups, including, but not limited to, carboxylic acids, will be efficacious in treating an EGFr-related cancer in the aldehydes, amino groups, cyano groups, ethylenic groups, Subject. hydroxyl groups, and mercapto groups. 0072. In certain embodiments, a hybridization-based 0074. In certain embodiments, an immobilized nucleic assay is a Southern blot (see, e.g., Sambrook and Russell, acid that specifically binds to the EGFr gene is exposed to US 2007/0O87394 A1 Apr. 19, 2007

nucleic acids from a sample. In certain embodiments, one or (1998)). In certain embodiments, the EGFr gene copy num more EGFr genes hybridize to the immobilized nucleic acid ber in two or more samples from one or more subjects is that specifically binds to the EGFr gene. In certain embodi determined using microarray technology. In certain Such ments, a wash step removes unhybridized and/or mishybrid embodiments, two or more samples are taken from a single ized sample nucleic acids from the immobilized nucleic Subject. In certain Such embodiments, one of the two or more acid. In certain embodiments, the EGFr gene.immobilized samples is from an EGFr-related tumor and another of the nucleic acid complex is exposed to an EGFr gene-specific two or more samples is from nontumorigenic normal tissue. probe. In certain embodiments, the probe is labeled. In certain embodiments, the label is detected quantitatively. In 0081. In certain embodiments, a sample is not treated certain embodiments, the EGFr gene copy number in a prior to determination of the EGFr gene copy number. In sample is compared to the copy number of at least one certain embodiments, a sample is treated prior to the deter reference sequence in that sample. In certain embodiments, mination.of the EGFr gene copy number. In certain embodi the EGFr gene. copy number in a tumorigenic sample is ments, the EGFr gene copy number in a sample is deter compared to the EGFr gene copy number in a normal mined both prior to and after treatment of the sample. sample. In certain embodiments, the EGFr gene copy num 0082 In certain embodiments, microarrays comprising ber in a malignant sample is compared to the EGFr gene one or more molecules that specifically bind to an EGFr copy number in a normal sample. gene are provided. In certain embodiments, microarrays comprising one or more nucleic acids complementary to an 0075. In certain embodiments, the EGFr gene copy num EGFr gene are provided. In certain such embodiments, ber of a sample is determined by an amplification-based nucleic acids are extracted from one or more samples from assay. Exemplary amplification-based assays include, but one or more subjects and the extracted nucleic acids are are not limited to, quantitative PCR (see, e.g., Poropat et al., exposed to one or more nucleic acids complementary to an Clinical Chem. 44:724-730, 1998), ligase chain reaction EGFr gene in the microarray to form an EGFr gene hybrid (see, e.g., Wu et al., Genomics 4: 560 (1989); Landegren et ization complex. In certain such embodiments, the amount al., Science 241: 1077 (1988); and Barringer et al., Gene 89: of EGFr gene hybridization complex in a microarray is 117 (1990)), transcription amplification (see, e.g., Kwoh et quantitated. In certain Such embodiments, the quantitation is al., Proc. Natl. Acad. Sci. U.S.A. 86: 1173 (1989)); com by binding of a labeled molecule to an EGFr gene hybrid petitive PCR (see, e.g., Honda et al., J. Exp. Botany 53: ization complex and quantitatively detecting the label. In 1515-20 (2002)); and self-sustained sequence replication certain such embodiments, the EGFr gene is labeled and (see, e.g., Guatelli et al., Proc. Nat. Acad. Sci. U.S.A. 87: quantitatively detected after formation of the EGFr gene 1874 (1990)). hybridization complex. 0076. In certain embodiments, the EGFr gene copy num 0083. In certain embodiments, a candidate treatment for ber of a sample is determined by quantitating the amount of an EGFr-related cancer is screened using microarray tech EGFr gene transcript in the sample, using any of the nology. In certain such embodiments, the EGFr gene copy methods described above. number is determined in a first sample obtained from a 0077. In certain embodiments, the EGFr gene copy num patient prior to the administration of the treatment to the ber of a sample is determined by quantitation of EGFr patient, and the EGFr gene copy number is determined in a polypeptide expression, using methods known in the art. second sample obtained from the patient at a time following Exemplary polypeptide quantitation methods include, but the administration of the treatment. In certain such embodi are not limited to, light absorption analysis, including, but ments, the EGFr gene copy numbers of the first sample and not limited to, measuring the absorbance at 280 nm, incu of the second sample are compared, wherein a decrease in bation of sample extracts with labeled anti-EGFr antibodies the EGFr gene copy number in the second sample relative to followed by quantitation of the specifically bound anti-EGFr the EGFr gene copy number of the first sample indicates that antibodies; and chromatography, including, but not limited the treatment is effective in the patient. to, electrophoresis followed by densitometry or Western 0084. In certain embodiments, the presence or absence of analysis, and column chromatography coupled to a detection one or more EGFr polypeptides in one or more samples is device. assessed using microarray technology. In certain Such 0078. In certain embodiments, an array-based system is embodiments, mRNA is first extracted from a cell or tissue used to determine the EGFr copy number of a sample. sample and is subsequently converted to cDNA, which is Exemplary array-based systems include, but are not limited hybridized to the microarray. In certain such embodiments, to, array-based systems involving hybridization-based the presence or absence of cDNA that is specifically bound assays, amplification-based assays, quantitation of gene to the microarray is indicative of the presence or absence of transcription, and quantitation of protein expression. Certain the EGFr polypeptide. In certain such embodiments, the exemplary array. methodologies are described below. expression level of the one or more EGFr polypeptides is assessed by quantitating the amount of cDNA that is spe 0079 Certain Exemplary Arrays cifically bound to the microarray. In certain such embodi 0080. In certain embodiments, the EGFr gene copy num ments, the cell or tissue is treated prior to the assessment, ber in a sample from one or more subjects is determined and the ability of the treatment to affect expression of the using microarray technology, as is known in the art (see, one or more EGFr polypeptides is also assessed. e.g., Pollack et al., Nature Genetics 23: 41-46 (1999); 0085. In certain embodiments, microarrays comprising Pastinen, Genome Res. 7: 606-614 (1997); Jackson, Nature one or more EGFr polypeptides are provided (see, e.g., Biotechnology 14: 1685 (1996); Chee, Science 274: 610 McBeath et al., Science, 289:1760-1763, 2000). In certain (1995); and Pinkel et al., Nature Genetics 20:207-211 embodiments, candidate specific binding agents to one or US 2007/0O87394 A1 Apr. 19, 2007 more EGFr polypeptides are screened using an EGFr plary binding assays include, but are not limited to, a polypeptide microarray. In certain embodiments, microar radioimmunoassay (RIA), an enzyme-linked immunosor rays comprising one or more specific binding agents to an bent assay (ELISA), and the Scatchard analysis of Munson EGFr polypeptide are provided. In certain embodiments, the et al., Anal. Biochem. 107: 220 (1980). quantity of an EGFr polypeptide in one or more samples is assessed. 0093. In certain embodiments, after hybridoma cells are identified that produce antibodies of the desired specificity, 0.086 Certain Exemplary Specific Binding Agents and affinity, and/or activity, the cells may be subcloned by Antibodies limiting dilution procedures and grown by standard methods 0087. In certain embodiments, an EGFr-specific binding (Goding, Monoclonal Antibodies: Principles and Practice, agent is. provided. In certain such embodiments, the EGFr pp. 59-103, Academic Press, 1996). Exemplary culture specific binding agent is an antibody or an antigen-binding media for this purpose include, but are not limited to, fragment thereof. DMEM and RPMI-1640 medium. In certain embodiments, hybridoma cells may be grown in vivo as ascites tumors in 0088. In certain embodiments, monoclonal antibodies an animal. may be made using the hybridoma method first described by Kohler et al., Nature 256: 495 (1975). In certain embodi 0094. In certain embodiments, monoclonal antibodies ments, monoclonal antibodies may be made by recombinant secreted by the subclones are suitably separated from the culture medium, ascites fluid, or serum by conventional DNA methods (U.S. Pat. No. 4,816,567). immunoglobulin purification procedures Such as, for 0089. In certain embodiments of the hybridoma method, example, protein A-Sepharose, hydroxylapatite chromatog a mouse or other appropriate host animal, including, but not raphy, gel electrophoresis, dialysis, or affinity chromatogra limited to, a hamster or macaque monkey, is immunized to phy. elicitlymphocytes that produce or are capable of producing antibodies that will specifically bind to the protein used for 0095. In certain embodiments, a nucleic acid encoding immunization. In certain embodiments, lymphocytes may be the monoclonal antibodies is readily isolated and sequenced immunized in vitro. In certain embodiments, lymphocytes or using conventional procedures (e.g., by using oligonucle lymphocytes enriched for B cells are fused with myeloma otide probes that are capable of binding specifically to genes cells by an electrocell fusion process or by using a suitable encoding the heavy and light chains of the monoclonal fusing agent, such as polyethylene glycol, to form a hybri antibodies). In certain such embodiments, the hybridoma doma cell (Goding, Monoclonal Antibodies. Principles and cells serve as a preferred source of such nucleic acid. In Practice, pp. 59-103, Academic Press, 1996). certain embodiments, isolated polynucleotide may be placed into expression vectors. In certain Such embodiments, the 0090. In certain embodiments, hybridoma cells are expression vectors are transfected into host cells to obtain seeded and grown in a suitable culture medium that prefer the synthesis of monoclonal antibodies in the recombinant ably contains one or more Substances that inhibit the growth host cells. Exemplary host cells include, but are not limited or Survival of the unfused, parental myeloma cells. In certain to, E. coli cells, simian COS cells, Chinese hamster ovary embodiments, if the parental myeloma cells lack the enzyme (CHO) cells, or myeloma cells that do not otherwise produce hypoxanthine guanine phosphoribosyl transferase (HGPRT immunoglobulin protein. In certain embodiments, the or HPRT), the culture medium for the hybridomas typically nucleic acid may be modified, for example, by covalently will include hypoxanthine, aminopterin, and thymidine joining to the immunoglobulin coding sequence all or part of (HAT medium), which substances prevent the growth of the coding sequence for a non-immunoglobulin polypeptide, HGPRT-deficient cells. creating a “chimeric' or “hybrid antibody. 0091. In certain embodiments, myeloma cells are 0096. In certain embodiments, non-immunoglobulin selected that fuse efficiently, support stable high-level pro polypeptides are Substituted for the constant domains of an duction of antibody by the selected antibody-producing antibody. In certain embodiments, non-immunoglobulin cells, and are sensitive to a medium such as HAT medium. polypeptides are substituted for the variable domains of one Exemplary myeloma cell lines include, but are not limited antigen-combining sites of an antibody to create a chimeric to, murine myeloma lines, such as those derived from bivalent antibody comprising one antigen-combining site MOP-21 and MC.-11 mouse tumors available from the Salk having specificity for a target antigen and another antigen Institute Cell Distribution Center, San Diego, Calif. USA, combining site having specificity for a different antigen. and SP-2 or X63-Ag8-653 cells available from the American Type Culture Collection, Rockville, Md. USA. In certain 0097. In certain embodiments, chimeric or hybrid anti embodiments, human myeloma and/or mouse-human het bodies can be prepared in vitro using known methods in eromyeloma cell lines are used for the production of human synthetic protein chemistry, including, but not limited to, monoclonal antibodies (Kozbor, J. Immunol. 133: 3001 those involving crosslinking agents. In certain such embodi (1984); Brodeur et al., Monoclonal Antibody Production ments, immunotoxins can be constructed using a disulfide Techniques and Applications, pp. 51-63, Marcel Dekker, exchange reaction or by forming a thioether bond. Exem Inc., New York, 1987). plary reagents for this purpose include, but are not limited to, iminothiolate and methyl-4-mercaptobutyrimidate. 0092. In certain embodiments, culture medium in which hybridoma cells are growing is assayed for production of 0098. In certain embodiments, human antibodies to a monoclonal antibodies directed against the antigen. In cer target antigen are provided. In certain embodiments, hybri tain embodiments, the binding specificity of monoclonal doma technology is extended to create human antibodies antibodies produced by hybridoma cells is determined by using heteromyelomas (mouse X human hybrid myelomas) immunoprecipitation or by an in vitro binding assay. Exem as fusion partners (see, e.g., Kozbor, J. Immunol. 133: 3001 US 2007/0O87394 A1 Apr. 19, 2007

(1984); Brodeur, et al., Monoclonal Antibody Production expressing the antigen. In certain embodiments, single B Techniques and Applications, pp. 51-63, Marcel Dekker, cells secreting antibodies of interest are identified by a Inc., New York, 1987). In certain embodiments, human specific hemolytic plaque assay. In certain Such embodi antibody-secreting cells can be immortalized by infection ments, cells targeted for lysis are sheep red blood cells with the Epstein-Barr virus (EBV) (James and Bell, J. (SRBCs) coated with the antigen. In certain such embodi Immunol. Methods 100: 5-40 1987). In certain embodi ments, the formation of a plaque indicates specific antigen ments, the immortalization of human B cells can beachieved mediated lysis of the target cells, and thus the presence of a by introducing a defined combination of transforming genes B cell culture secreting the immunoglobulin of interest and (Hahn et al., Nature 400: 464-468 (1999). complement. In certain Such embodiments, the single anti 0099. In certain embodiments, transgenic animals (e.g. gen-specific plasma cell in the center of the plaque can be mice) that are capable, upon immunization, of producing a isolated and used for isolation of mRNA. repertoire of human antibodies in the absence of endogenous 0102) In certain embodiments, the nucleic acid encoding immunoglobulin production are used to make human anti the variable region of the antibody secreted can be cloned bodies (see, e.g., Jakobovits et al., Nature 362: 255-258 using reverse-transcriptase PCR. In certain embodiments, 1993; Lonberg and Huszar, Int. Rev. Immunol. 13: 65-93 the cloned nucleic acid is further inserted into a suitable 1995); Fishwild et al., Nat. Biotechnol. 14:845-851 1996): expression vector, Such as a vector cassette Such as a Mendez et al., Nat. Genet. 15: 146-156 (1997: Green, J. pcDNA, or a pcDNA vector containing the constant domains Immunol. Methods 231: 11-231999; Tomizuka et al., Proc. of immunoglobulin heavy and light chain. In certain Natl. Acad. Sci. USA 97: 722-727 2000: reviewed in Little embodiments, the generated vector is transfected into host et al., Immunol. Today 21: 364-370 2000). It has been cells, (i.e., CHO cells), and cultured in conventional nutrient described that the homozygous deletion of the antibody media modified as appropriate for inducing promoters, heavy chain joining region (J) gene in chimeric and germ selecting transformants, or amplifying the genes encoding line mutant mice results in complete inhibition of endog the desired sequences. enous antibody production (Jakobovits et al., Proc. Natl. Acad. Sci. USA 90: 2551-2555 1993). Transfer of the 0103) In certain embodiments, phage display technology human germ-line immunoglobulin gene array in Such germ is used to produce human antibodies and antibody fragments in vitro, from immunoglobulin variable (V) domain gene line mutant mice results in the production of human anti repertoires from unimmunized donors (see, e.g., McCafferty bodies upon antigen challenge (Jakobovits et al., Nature et al., Nature 348: 552-553 (1990); reviewed in Kipriyanov 362; 255-258 (1993)). and Little, Mol. Biotechnol. 12: 173-201 1999: Hoogen 0100 Mendez et al. (Nature Genetics 15: 146-156 boom and Chames, Immunol. Today21: 371-378 2000). In 1997) have generated a line of transgenic mice designated certain such embodiments, antibody V domain genes are “Xenomouse RII' that, when challenged with an antigen, cloned in-frame into either a major or minor coat protein generates high affinity fully human antibodies. This was gene of a filamentous bacteriophage, such as M13 or fa, and achieved by germ-line integration of megabase human displayed as functional antibody fragments on the Surface of heavy chain and light chain loci into mice with deletion into the phage particle. In certain embodiments, the filamentous endogenous JH segment. The XenoMouseR II harbors 1,020 particle contains a single-stranded DNA copy of the phage kb of human heavy chain locus containing approximately 66 genome, and selections based on the functional properties of V genes, complete D and J regions and three different the antibody also result in selection of the gene encoding the constant regions (u, 8 and Y), and also harbors 800 kb of antibody exhibiting those properties. Phage display can be human K locus containing 32 VK genes, JK segments and CK performed in a variety of formats, including, but not limited genes. In certain embodiments, the antibodies produced in to, those identified in the following documents: Johnson and those mice closely resemble those seen in humans in all Chiswell, Current Opinion in Structural Biology 3: 564-571 respects, including gene rearrangement, assembly, and rep (1993); Winter et al., Annu. Rev. Immunol. 12: 433-455 ertoire. In certain embodiments, the human antibodies are 1994); Dall’Acqua and Carter, Curr. Opin. Struct Biol. 8: preferentially expressed over endogenous antibodies due to 443-450 1998; and Hoogenboom and Chames, Immunol. a deletion in the endogenous J segment that prevents gene Today21: 371-378 2000). Sources of V-gene segments for rearrangement in the murine locus. phage display include, but are not limited to, a small random 0101. In certain embodiments, a transgenic animal com combinatorial library of V genes derived from the spleens of prising human immunoglobulin genes (e.g., the Xenom immunized mice (Clackson et al., (Nature 352: 624–628 ouseR II (Abgenix, Inc.)) may be immunized with an 1991) and a repertoire of V genes from unimmunized antigen of particular interest, such as an EGFr polypeptide. human donors (Marks et al., J. Mol. Biol. 222: 581-597 In certain embodiments, Sera from those immunized animals (1991), or Griffiths et al., EMBO.J. 12: 725-734 (1993)). is screened for antibody reactivity against the initial antigen. 0104. In certain embodiments, in a natural immune In certain embodiments, lymphocytes are isolated from response, antibody genes accumulate mutations at a high lymph nodes or spleen cells and may further be enriched for rate (somatic hypermutation). In certain embodiments, some B cells by selecting for CD138-negative and CD19+cells. In of the changes introduced confer higher affinity. In certain certain embodiments, those B cell cultures (BCCs) are fused embodiments, B cells displaying high-affinity Surface immu to myeloma cells to generate hybridomas as detailed above. noglobulin are preferentially replicated and differentiated In certain embodiments, those B cell cultures are screened during Subsequent antigen challenge. In certain embodi further for reactivity against the initial antigen. Such screen ments, that natural process can be mimicked by employing ing includes, but is not limited to, ELISA, a competition the technique known as “chain shuffling” (Marks et al., assay with known antibodies that bind the antigen of inter Bio/Technol. 10: 779-783 (1992). In certain such embodi est, and in vitro binding to transiently transfected CHO cells ments, the affinity of “primary human antibodies obtained US 2007/0O87394 A1 Apr. 19, 2007 by phage display can be improved by sequentially replacing 0108. In certain embodiments, EGFr-specific binding the heavy and light chain V region genes with repertoires of agent pharmaceutical compositions can be administered in naturally occurring variants (repertoires) of V domain genes combination therapy, i.e., combined with other agents. In obtained from unimmunized donors, allowing the produc certain embodiments, the combination therapy comprises an tion of antibodies and antibody fragments with affinities in EGFr-specific binding agent, in combination with at least the nM range. In certain embodiments, a very large phage one anti-angiogenic agent. Exemplary agents include, but antibody repertoire is constructed (also known as “the are not limited to, in vitro synthetically prepared chemical mother-of-all libraries'), as described by Waterhouse et al., compositions, antibodies, antigen binding regions, radionu Nucl. Acids Res. 21: 2265-2266 (1993). In certain such clides, and combinations and conjugates thereof. In certain embodiments, a high affinity human antibody is directly embodiments, an agent may act as an agonist, antagonist, isolated from a large phage library (see, e.g., Griffiths et al., allosteric modulator, or toxin. In certain embodiments, an EMBO.J. 13: 3245-3260 (1994)). In certain embodiments, agent may act to inhibit or stimulate its target (e.g., receptor gene shuffling can be used to derive human antibodies from or enzyme activation or inhibition), and thereby promote rodent antibodies, where the human antibody has similar cell death or arrest cell growth. affinities and specificities to the starting rodent antibody. In certain such embodiments, the heavy or light chain V 0.109 Exemplary chemotherapy treatments include, but domain gene of rodent antibodies obtained by phage display are not limited to, anti-cancer agents including, but not technique is replaced with a repertoire of human V domain limited to, alkylating agents including, but not limited to: genes, creating rodent-human chimeras (also referred to as nitrogen mustards, including, but not limited to, mechlore "epitope imprinting”). In certain embodiments, selection of thamine, cyclophosphamide, ifosfamide, melphalan and variable regions by the antigen results in isolation of human chlorambucil; nitrosoureas, including, but not limited to, variable regions capable of restoring a functional antigen carmustine BCNU, lomustine, CCNU, and semustine, binding site, i.e. the epitope governs (imprints) the choice of methyl-CCNU; TemodalTM, temozolamide; ethylenimines/ partner. In certain embodiments, when the process is methylmelamine, including, but not limited to, thriethylen repeated in order to replace the remaining rodent V domain, emelamine (TEM), triethylene, thiophosphoramide, a human antibody is obtained which has no framework or thiotepa, hexamethylmelamine (HMM), and altretamine; CDR residues of rodent origin (see, e.g., PCT patent appli alkyl Sulfonates, including, but not limited to, buSulfan; triazines, including, but not limited to, dacarbazine (DTIC); cation WO 93/06213). antimetabolites, including, but not limited to, folic acid 01.05 Certain Exemplary Treatments analogs such as methotrexate and trimetrexate; pyrimidine 0106. In certain embodiments, anti-EGFr-specific bind analogs, including, but not limited to, 5-fluorouracil (5FU), ing agents may have therapeutic use by inclusion in an EGFr fluorodeoxyuridine, gemcitabine, cytosine arabinoside specific binding agent treatment. In this application, when (AraC, cytarabine), 5-azacytidine, and 2,2'-difluorodeoxy discussing the use of EGFr-specific binding agents to treat cytidine; purine analogs, including, but not limited to, diseases or conditions, such use may include use of the 6-mercaptopurine, 6-thioguanine, azathioprine, 2'-deoxyco EGFr-specific binding agents themselves; compositions formycin (pentostatin), erythrohydroxynonyladenine comprising EGFr-specific binding agents; and/or combina (EHNA), fludarabine phosphate, cladribine, and 2-chloro tion therapies comprising EGFr-specific binding agents and deoxyadenosine (2-CdA); natural products, including, but not limited to, antimitotic drugs such as paclitaxel; Vinca one or more additional active ingredients. When EGFr alkaloids, including, but not limited to, vinblastine (VLB), specific binding agents are used to “treat a disease or Vincristine, and vinorelbine; taxotere; estramustine and condition, such treatment may or may not include preven estramustine phosphate: ppipodophylotoxins, including, but tion of the disease or condition. In certain embodiments, not limited to, etoposide and teniposide; antibiotics, includ EGFr-specific binding agents can block the interaction of the ing, but not limited to, actinomycin D, daunomycin, rubi EGF receptor with its ligand, EGF. In certain embodiments, domycin, doxorubicin, mitoxantrone, idarubicin, bleomy EGFr-specific binding agents can activate the EGF receptor. cins, plicamycin, mithramycin, mitomycin C, and In certain embodiments, EGFr-specific binding agents can actinomycin; enzymes, including, but not limited to, L-as constitutively activate the EGF receptor. In certain embodi paraginase; biological response modifiers, including, but not ments, EGFr-specific binding agents can block the activa limited to, interferon-alpha, IL-2, G-CSF, and GM-CSF: tion of the EGF receptor. In certain embodiments, EGFr doxycyckine, irinotecan hydrochloride; miscellaneous specific binding agents can constitutively block the agents, including, but not limited to, platinum coordination activation of the EGF receptor. complexes such as cisplatin and carboplatin; anthracenedi 0107. In certain embodiments, an EGFr-specific binding ones, including, but not limited to, mitoxantrone; Substituted agent is administered alone. In certain embodiments, an urea, including, but not limited to, hydroxyurea; methylhy EGFr-specific binding agent is administered prior to the drazine derivatives, including, but not limited to, N-meth administration of at least one other therapeutic agent. In ylhydrazine (MIH) and procarbazine; adrenocortical Sup certain embodiments, an EGFr-specific binding agent is pressants, including, but not limited to, mitotane (op-DDD) administered concurrent with the administration of at least and aminoglutethimide; hormones and antagonists, includ one other therapeutic agent. In certain embodiments, an ing, but not limited to, adrenocorticosteroid antagonists Such EGFr-specific binding agent is administered Subsequent to as prednisone and equivalents, dexamethasone and amino the administration of at least one other therapeutic agent. glutethimide; Gemzar M. gemcitabine; progestin, including, Exemplary therapeutic agents, include, but are not limited but not limited to, hydroxyprogesterone caproate, medroX to, at least one other cancer therapy agent. Exemplary cancer yprogesterone acetate and megestrol acetate; estrogen, therapy agents include, but are not limited to, radiation including, but not limited to, diethylstilbestrol and ethinyl therapy and chemotherapy. estradiol equivalents; antiestrogen, including, but not lim US 2007/0O87394 A1 Apr. 19, 2007 14 ited to, tamoxifen; androgens, including, but not limited to, of hepatocyte growth factor (HGF, also known as Scatter testosterone propionate and fluoxymesterone/equivalents; Factor), and antibodies or antigen binding regions that antiandrogens, including, but not limited to, flutamide, specifically bind its receptor “c-met.” gonadotropin-releasing hormone analogs and leuprolide; 0112 Exemplary anti-angiogenic agents include, but are oxaliplatin, Eloxatin R, capecitabine, XelodaR), pemetrexed, not limited to, Campath, IL-8, B-FGF, Tek antagonists Alimta R, letrozole, Femara R, anastrozole, Arimidex(R), and (Ceretti et al., U.S. Patent Application Publication No. non-steroidal antiandrogens, including, but not limited to, 2003/0162712; U.S. Pat. No. 6,413,932); anti-TWEAK flutamide. agents (e.g., specifically binding antibodies or antigen bind 0110 Exemplary cancer therapies, which may be admin ing regions, or Soluble TWEAK receptor antagonists; see, istered with an EGFr-specific binding agent, include, but are e.g., Wiley, U.S. Pat. No. 6,727.225); ADAM disintegrin not limited to, targeted therapies. Examples of targeted domain to antagonize the binding of integrin to its ligands therapies include, but are not limited to, use of therapeutic (Fanslow et al., U.S. Patent Application Publication No. antibodies. Exemplary therapeutic antibodies, include, but 2002/0042368); specifically binding anti-eph receptor and/ are not limited to, mouse, mouse-human chimeric, CDR or anti-ephrin antibodies or antigen binding regions (U.S. grafted, humanized, and human antibodies, and synthetic Patent Nos. 5,981,245; 5,728,813; 5,969,110; 6,596,852; antibodies, including, but not limited to, those selected by 6.232.447; 6,057,124; and patent family members thereof); screening antibody libraries. Exemplary antibodies include, anti-PDGF-BB antagonists (e.g., specifically binding anti but are not limited to, those which bind to cell surface bodies or antigen binding regions) as well as antibodies or proteins Her2. CDC20. CDC33, and mucin-like glycopro antigen binding regions specifically binding to PDGF-BB tein, and optionally induce a cytostatic and/or cytotoxic ligands, and PDGFR kinase inhibitory agents (e.g., antibod effect on tumor cells displaying these proteins. Exemplary ies or antigen binding regions that specifically bind thereto). antibodies also include, but are not limited to, HERCEP 0113 Exemplary anti-angiogenic/anti-tumor agents TINTM, trastuzumab, which may be used to treat breast include, but are not limited to, SF-7784 (Pfizer, USA); cancer and other forms of cancer; RITUXANTM, rituximab, cilengitide (Merck KgaA, Germany, EPO 770622); pegap ZEVALINTM, ibritumomab tiuxetan, and LYMPHOCIDETM, tanib octasodium (Gilead Sciences, USA); Alphastatin (Bio epratuZumab, which may be used to treat non-Hodgkin’s Acta, UK); M-PGA (Celgene, USA, U.S. Pat. No. 5,712, lymphoma and other forms of cancer: GLEEVECTM, ima 291); ilomastat (Arriva, USA, U.S. Pat. No. 5,892,112); tinib mesylate, which may be used to treat chronic myeloid emaxanib (Pfizer, USA.U.S. Pat. No. 5,792,783): vatalanib leukemia and gastrointestinal stromal tumors; and (Novartis, Switzerland): 2-methoxyestradiol (EntreMed, BEXXARTM, iodine 131 to situmomab, which may be used USA); TLC ELL-12 (Elan, Ireland); anecortave acetate for treatment of non-Hodgkin’s lymphoma. Certain exem (Alcon, USA); alpha-D148 Mab (Amgen, USA); CEP-7055 plary antibodies also include ERBITUXTM: IMC-C225; (Cephalon, USA); anti-Vn Mab (Crucell, Netherlands); IressaTM; gefitinib; TARCEVATM, ertinolib: KDR (kinase DAC:antiangiogenic (ConjuChem, Canada); Angiocidin domain receptor) inhibitors; anti VEGF antibodies and (In Kine Pharmaceutical, USA); KM-2550 (Kyowa Hakko, antagonists (e.g., AvastinTM and VEGAF-TRAP); anti Japan): SU-0879 (Pfizer, USA); CGP-79787 (Novartis, VEGF receptor antibodies and antigen binding regions; Switzerland, EP 970070): ARGENT technology (Ariad, anti-Ang-1 and Ang-2 antibodies and antigen binding USA); YIGSR-Strealth (Johnson & Johnson, USA); fibrino regions; antibodies to Tie-2 and other Ang-1 and Ang-2 gen-E fragment (BioActa, UK); angiogenesis inhibitor (Tri receptors; Tie-2 ligands; antibodies against Tie-2 kinase gen, UK); TBC-1635 (Encysive Pharmaceuticals, USA); inhibitors; and Campath(R), alemtuzumab. In certain embodi SC-236 (Pfizer, USA); ABT-567 (Abbott, USA); Metastatin ments, cancer therapy agents are other polypeptides which (EntreMed, USA); angiogenesis inhibitor (Tripep, Sweden); selectively induce apoptosis in tumor cells, including, but maspin (Sosei, Japan); 2-methoxyestradiol (Oncology Sci not limited to, TNF-related polypeptides such as TRAIL. ences Corporation, USA); ER-68203-00 (IVAX, USA); 0111. In certain embodiments, cancer therapy agents are Benefin (Lane Labs, USA); TZ-93 (Tsumura, Japan); TAN-1 anti-angiogenic agents which decrease angiogenesis. Cer 120 (Takeda, Japan); FR-11 1142 (Fujisawa, Japan, JP tain such agents include, but are not limited to, 02233610); platelet factor 4 (RepliOen, USA, EP 407122); ERBITUXTM, IMC-C225; KDR (kinase domain receptor) vascular endothelial growth factor antagonist (Borean, Den inhibitory agents (e.g., antibodies and antigen binding mark); temsirolimus (CCI-779) (University of South Caro regions that specifically bind to the kinase domain receptor); lina, USA); bevacizumab (plNN) (Genentech, USA); angio anti-VEGF agents (e.g., antibodies or antigen binding genesis inhibitors (SUGEN, USA); XL 784 (Exelixis, USA); regions that specifically bind VEGF, or soluble VEGF XL 647 (Exelixis, USA); Mab, alpha5beta3 integrin, Vitaxin receptors or a ligand binding region thereof) Such as AVAS and second generation Vitaxin (Applied Molecular Evolu TINTM or VEGF-TRAPTM; anti-VEGF receptor agents (e.g., tion, USA and MedImmune USA); Retinostat(R) gene antibodies or antigen binding regions that specifically bind therapy (Oxford BioMedica, UK); enzastaurin hydrochlo thereto); EGFR inhibitory agents such as IRESSATM, gefi ride (USAN) (Lilly, USA); CEP 7055 (Cephalon, USA and tinib, TARCEVATM, erlotinib, anti-Ang1 and anti-Ang2 Sanofi-Synthelabo, France); BC 1 (Genoa Institute of Can agents (e.g., antibodies or antigen binding regions specifi cer Research, Italy); angiogenesis inhibitor (Alchemia, Aus cally binding thereto or to their receptors, e.g., Tie2/Tek): tralia); VEGF antagonist (Regeneron, USA); rBPI21 and and anti-Tie-2 kinase inhibitory agents (e.g., antibodies or BPI-derived antiangiogenic (XOMA, USA); PI 88 (Progen, antigen binding regions that specifically bind thereto). In Australia); cilengitide (pNN) (Merck Kga A, Germany; certain embodiments, the pharmaceutical compositions may Munich Technical University, Germany; Scripps Clinic and also include one or more agents (e.g., antibodies, antigen Research Foundation, USA); cetuximab (INN) (Aventis, binding regions, or soluble receptors) that specifically bind France); AVE 8062 (Ajinomoto, Japan); AS 1404 (Cancer and inhibit the activity of growth factors, such as antagonists Research Laboratory, New Zealand); SG 292 (Telios, USA); US 2007/0O87394 A1 Apr. 19, 2007

Endostatin (Boston Children’s Hospital, USA); 2-methox endothelial growth factor receptor 1) (Merck & Co, USA); yestradiol (Boston Childrens Hospital, USA); ZD 6474 Tie-2 ligands (Regeneron, USA); and thrombospondin 1 (AstraZeneca, UK); ZD 6126 (Angiogene Pharmaceuticals, inhibitor (Allegheny Health, Education and Research Foun UK); PPI 2458 (Praecis, USA); AZD 9935 (AstraZeneca, dation, USA). UK); AZD 2171 (AstraZeneca, UK); vatalanib (plNN) 0114 Certain cancer therapy agents include, but are not (Novartis, Switzerland and Schering AG, Germany); tissue limited to: thalidomide and thalidomide analogues (N-(2,6- factor pathway inhibitors (EntraMed, USA); pegaptanib dioxo-3-piperidyl)phthalimide); tecogalan Sodium (sulfated (Pinn) (Gilead Sciences, USA); xanthorrhizol (Yonsei Uni polysaccharide peptidoglycan); TAN 1120 (8-acetyl-7,8,9, versity, South Korea); vaccine, gene-based, VEGF-2 10-tetrahydro-6,8,11-trihydroxy-1-methoxy-10-octahy (Scripps Clinic and Research Foundation, USA); SPV5.2 dro-5-hydroxy-2-(2-hydroxypropyl)-4,10-dimethylpyrano (Supratek, Canada); SDX 103 (University of California at 3,4-d- 1.3,6-dioxazocin-8-yloxy-5,12 San Diego, USA); PX 478 (Pro1X, USA); Metastatin naphthacenedione); Suradista (7.7-carbonylbisimino(1- (EntreMed, USA); troponin I (Harvard University, USA); methyl-1H-pyrrole-4,2-diyl)carbonylimino(1-methyl-1H SU 6668 (SUGEN, USA); OXI 4503 (OXiGENE, USA); pyrrole-4,2-diyl)carbonyliminobis-1,3-naphthalenedisul o-guanidines (Dimensional Pharmaceuticals, USA); motu fonic acid tetrasodium salt); SU 302: SU 301: SU 1498 poramine C (British Columbia University, Canada); CDP ((E)-2-cyano-3-4-hydroxy-3,5-bis(1-methylethyl)phenyl 791 (Celltech Group, UK); atiprimod (plNN) (GlaxoSmith N-(3-phenylpropyl)-2-pro penamide); SU 1433 (4-(6,7-dim Kline, UK); E 7820 (Eisai, Japan): CYC 381 (Harvard ethyl-2-quinoxalinyl)-1,2-benzenediol); ST 1514; SR University, USA); AE 941 (Aeterna, Canada); FGF2 cancer 25989; soluble Tie-2; SERM derivatives: Pharmos: semax vaccine (EntreMed, USA); urokinase plasminogen activator anib (pNN)(3-(3,5-dimethyl-1H-pyrrol-2-yl)methylene inhibitor (Dendreon, USA); oglufanide (pNN) (Melmotte, 1,3-dihydro-2H-indol-2-one); S 836; RG 8803: RESTIN: R USA); HIF-1alfa inhibitors (Xenova, UK); CEP 5214 440 (3-(1-methyl-1H-indol-3-yl)-4-(1-methyl-6-nitro-1H (Cephalon, USA); BAY RES 2622 (Bayer, Germany); indol-3-yl)-1H-pyrrole-2,5-dione); R 123942 (1-6-(1,2,4- Angiocidin (In Kine, USA); A6 (Angstrom, USA); KR thiadiazol-5-yl)-3-pyridazinyl-N-3-(trifluoromethyl)phe 31372 (Korean Research Institute of Chemical Technology, nyl-4-piperidinamine); prolyl hydroxylase inhibitor; South Korea); GW 2286 (GlaxoSmithKline, UK); EHT progression elevated genes; prinomastat (INN) ((S)-2.2- 01.01 (Exon Hit, France); CP 868596 (Pfizer, USA); CP dimethyl-4-p-(4-pyridyloxy)phenylsulphonyl-3-thio 564959 (OSI, USA); CP 547632 (Pfizer, USA): 786034 morpholinecarbohydroxamic acid); NV 1030; NM 3 (8-hy (GlaxoSmithKline, UK); KRN 633 (Kirin Brewery, Japan): droxy-6-methoxy-alpha-methyl-1-oxo-1H-2-benzopyran-3- drug delivery system, intraocular, 2-methoxyestradiol acetic acid); NF 681; NF 050; MIG. METH 2: METH 1: (EntreMed, USA); anginex (Maastricht University, Nether manassantin B (alpha -1-4-5-4-2-(3,4-dimethoxyphe lands, and Minnesota University, USA); ABT 510 (Abbott, nyl)-2-hydroxy-1-methylethoxy-3-methoxyphenyltetrahy USA); AAL 993 (Novartis, Switzerland); VEGI (Pro dro-3,4-dimethyl-2-furanyl-2-methoxyphenoxyethyl-1,3- teomTech, USA); tumor necrosis factor-alpha inhibitors benzodioxole-5-methanol); KDR monoclonal antibody; (National Institute on Aging, USA); SU 11248 (Pfizer, USA alpha5beta3 integrin monoclonal antibody; LY 290293 and SUGEN USA); ABT 518 (Abbott, USA); YH16 (Yantai (2-amino-4-(3-pyridinyl)-4H -naphtho1.2-bipyran-3-car Rongchang, China); S-3APG (Boston Childrens Hospital, bonitrile); KP 0201448; KM 2550; integrin-specific pep USA and EntreMed, USA); Mab, KDR (ImClone Systems, tides; INGN 401; GYKI 66475: GYKI 66462; greenstatin USA); Mab, alpha5 beta1 (Protein Design, USA); KDR (101-354-plasminogen (human)); gene therapy for rheuma kinase inhibitor (Celltech Group, UK, and Johnson & toid arthritis, prostate cancer, ovarian cancer, glioma, Johnson, USA); GFB 116 (South Florida University, USA endostatin, colorectal cancer, ATF BTPI, antiangiogenesis and Yale University, USA); CS 706 (Sankyo, Japan); com genes, angiogenesis inhibitor, or angiogenesis; gelatinase bretastatin A4 prodrug (Arizona State University, USA); inhibitor, FR 111142 (4,5-dihydroxy-2-hexenoic acid chondroitinase AC (IBEX, Canada); BAY RES 2690 (Bayer, 5-methoxy-4-2-methyl-3-(3-methyl-2-butenyl)oxiranyl Germany); AGM 1470 (Harvard University, USA. Takeda, 1-oxaspiro2.5oct-6-yl ester); forfenimex (pNN) (S)-al Japan, and TAP, USA); AG 13925 (Agouron, USA); pha-amino-3-hydroxy-4-(hydroxymethyl)benzeneacetic Tetrathiomolybdate (University of Michigan, USA); GCS acid); fibronectin antagonist (1-acetyl-L-prolyl-L-histidyl 100 (Wayne State University, USA); CV 247 (Ivy Medical, L-seryl-L-cysteinyl-L-aspartamide); fibroblast growth fac UK); CKD 732 (Chong Kun Dang, South Korea); Mab, tor receptor inhibitor; fibroblast growth factor antagonist; vascular endothelium growth factor (Xenova, UK); irsogla FCE 27164 (7.7-carbonylbisimino(1-methyl-1H-pyrrole dine (INN) (Nippon Shinyaku, Japan); RG 13577 (Aventis, 4.2-diyl)carbonylimino(1-methyl-1H- pyrrole-4,2-diyl)car France); WX 360 (Wilex, Germany); squalamine (pNN) bonyliminobis-1,3,5-naphthalenetrisulfonic acid hexaso (Genaera, USA); RPI 4610 (Sirna, USA); galacto fucan dium salt); FCE 26752 (8,8-carbonylbisimino(1-methyl Sulphate (Marinova, Australia); heparanase inhibitors 1H-pyrrole-4,2-diyl)carbonylimino(1-methyl-1H -pyrrole (InSight, Israel); KL 3106 (Kolon, South Korea); Honokiol 4.2-diyl)carbonyliminobis-1,3,6-naphthalenetrisulfonic (Emory University, USA); ZK CDK (Shering AG, Ger acid); endothelial monocyte activating polypeptide II; many); ZK Angio (Schering AG, Germany); ZK 229561 VEGFR antisense oligonucleotide; anti-angiogenic and (Novartis, Switzerland, and Schering AG, Germany); XMP trophic factors: ANCHOR angiostatic agent; endostatin: 300 (XOMA, USA); VGA 1102 (Taisho, Japan); VEGF Del-1 angiogenic protein; CT 3577; contortrostatin: CM receptor modulators (Pharmacopeia, USA); VE-cadherin-2 101; chondroitinase AC: CDP 845; CanStatin; BST 2002: antagonists (ImClone Systems, USA); Vasostatin (National BST 2001; BLS 0597; BIBF 1000; ARRESTIN: apomigren Institutes of Health, USA); vaccine, Flk-1 (ImClone Sys (1304-1388-type XV collagen (human gene COL15A1 tems, USA); TZ 93 (Tsumura, Japan); TumStatin (Beth alpha1-chain precursor)); angioinhibin; aaATIII: A 36: Israel Hospital, USA); truncated soluble FLT 1 (vascular 9alpha-fluoromedroxyprogesterone acetate ((6-alpha)-17

US 2007/0O87394 A1 Apr. 19, 2007

otics; a Pro-HGF; NK2; a c-Met peptide inhibitor; an matory bowel disease-like disease. When testing the efficacy antagonist of Grb2 Src homology 2; a Gab1 modulator; of a human monoclonal antibody in a cynomolgus monkey dominant-negative Src, a Von-Hippel-Landau inhibitor, human disease model, in certain embodiments, it is useful to including, but not limited to, wortmannin; P13 kinase inhibi determine whether the EGFr-specific binding agent binds to tors, other anti-receptor therapies, a COX-2 inhibitor, Cele EGFr in humans and cynomolgus monkeys at a comparable brexTM, celecoxib, ViOXXTM, rofecoxib; a vascular endothe level. lial growth factor (VEGF), a VEGF modulator, a fibroblast growth factor (FGF), an FGF modulator, an epidermal 0.121. In certain embodiments, an EGFr-specific binding growth factor (EGF); an EGF modulator; a keratinocyte agent may be part of a conjugate molecule comprising all or growth factor (KGF), a KGF-related molecule, a KGF part of the EGFr-specific binding agent and a cytotoxic modulator; and a matrix metalloproteinase (MMP) modula agent. The term “cytotoxic agent” refers to a Substance that tOr. inhibits or prevents the function of cells and/or causes the death or destruction of cells. The term includes, but is not 0116. In certain embodiments, an EGFr-specific binding limited to, radioactive isotopes (e.g., I'', I'', Y” and agent is used with particular therapeutic agents to treat Re"), chemotherapeutic agents, and toxins such as enzy various cancers. In certain embodiments, in view of the matically active toxins of bacterial, fungal, plant or animal condition and the desired level of treatment, two, three, or origin, or fragments thereof. Exemplary cytotoxic agents more agents may be administered. Where the compounds are include, but are hot limited to, Adriamycin, Doxorubicin, used with one or more other components, the compound and 5-Fluorouracil, Cytosine arabinoside (“Ara-C), Cyclophos the one or more other components may be administered phamide. Thiotepa, Taxotere (docetaxel), BuSulfan, together, separately, or sequentially (e.g., in a pharmaceuti Cytoxin, Taxol. Methotrexate, Cisplatin, Melphalan, Vin cal format). In certain embodiments, such agents may be blastine, Bleomycin, Etoposide, Ifosfamide, Mitomycin C, provided together by inclusion in the same formulation. In Mitoxantrone, Vincreistine, Vinorelbine, Carboplatin, Teni certain embodiments. Such agents and an EGFr-specific poside, Daunomycin, Carminomycin, Aminopterin, Dacti binding agent may be provided together by inclusion in the nomycin, Mitomycins, Esperamicins, Melphalan and other same formulation. In certain embodiments, such agents may related nitrogen mustards. beformulated separately and provided together by inclusion in a treatment kit. In certain embodiments, such agents and 0122) In certain embodiments, an EGFr-specific binding an EGFr-specific binding agent may be formulated sepa agent may be part of a conjugate molecule comprising all or rately and provided together by inclusion in a treatment kit. part of the EGFr-specific binding agent and a prodrug. In In certain embodiments, such agents may be provided sepa certain embodiments, the term “prodrug” refers to a precur rately. sor or derivative form of a pharmaceutically active sub stance. In certain embodiments, a prodrug is less cytotoxic 0117. In certain embodiments, when administered by to cells compared to the parent drug and is capable of being gene therapy, the genes encoding protein agents and/or an enzymatically activated or converted into the more active EGFr-specific binding agent may be included in the same cytotoxic parent form. Exemplary prodrugs include, but are vector. In certain embodiments, the genes encoding protein not limited to, phosphate-containing prodrugs, thiophos agents and/or an EGFr-specific binding agent may be under phate-containing prodrugs, sulfate-containing prodrugs, the control of the same promoter region. In certain embodi peptide-containing prod rugs, D-amino acid-modified prod ments, the genes encoding protein agents and/or an EGFr rugs, glycosylated prodrugs, beta-lactam-containing pro specific binding agent may be in separate vectors. drugs, optionally substituted phenoxyacetamide-containing 0118. In certain embodiments, an EGFr-specific binding prodrugs and optionally substituted phenylacetamide-con agent may be used to treat non-human animals, such as pets taining prodrugs, 5-fluorocytosine and other 5-fluorouridine (dogs, cats, birds, primates, etc.), and domestic farm animals prodrugs which can be converted into a more active cyto (horses cattle, sheep, pigs, birds, etc.). In certain Such toxic free drug. Examples of cytotoxic drugs that can be instances, an appropriate dose may be determined according derivatized into a prodrug form include, but are not limited to the animal’s body weight. For example, in certain to, those cytotoxic agents described above. See, e.g., U.S. embodiments, a dose of 0.2-1 mg/kg may be used. In certain Pat. No. 6,702,705. embodiments, the dose may be determined according to the 0123. In certain embodiments, antibody conjugates func animal’s Surface area, an exemplary dose ranging from 0.1 tion by having the antibody portion of the molecule target to 20 mg/in, or from 5 to 12 mg/m. For small animals, such the cytotoxic portion or prodrug portion of the molecule to as dogs or cats, in certain embodiments, a suitable dose is 0.4 a specific population of cells in the patient. In the case of mg/kg. In certain embodiments, EGFr-specific binding EGFr-specific binding agents, such conjugate molecules agents are administered by injection or other Suitable route one or more times per week until the animals condition is may be used, for example, in certain embodiments, to improved, or it may be administered indefinitely. destroy abnormally proliferating cells, such as cancer cells. 0.124. In certain embodiments, methods of treating a 0119) It is understood that the response by individual patient comprising administering a therapeutically effective patients to the aforementioned medications or combination amount of an EGFr-specific binding agent are provided. In therapies may vary, and an appropriate efficacious combi certain embodiments, methods of treating a patient compris nation of drugs for each patient may be determined by his or ing administering a therapeutically effective amount of an her physician. antibody conjugate are provided. In certain embodiments, an 0120) The cynomolgus monkey provides a useful model antibody is used in conjunction with a therapeutically effec for certain diseases. Exemplary diseases include, but are not tive amount of at least one additional therapeutic agent, as limited to, transplantation rejection syndrome and inflam discussed above. US 2007/0O87394 A1 Apr. 19, 2007

0125. As discussed above, in certain embodiments, alcohols (such as mannitol or Sorbitol); Suspending agents; EGFr-specific binding agents may be administered concur Surfactants or wetting agents (such as pluronics, PEG, rently with one or more other drugs that are administered to Sorbitan esters, polysorbates Such as polysorbate 20, the same patient, each drug being administered according to polysorbate 80, triton, tromethamine, lecithin, cholesterol, a regimen Suitable for that medicament. Such treatment tyloxapal); Stability enhancing agents (such as Sucrose or encompasses pre-treatment, simultaneous treatment, Sorbitol); tonicity enhancing agents (such as alkali metal sequential treatment, and alternating regimens. Additional halides, preferably sodium or potassium chloride, mannitol examples of Such drugs include, but are not limited to, sorbitol); delivery vehicles; diluents; excipients and/or phar antivirals, antibiotics, analgesics, corticosteroids, antago maceutical adjuvants. (Remington's Pharmaceutical Sci nists of inflammatory cytokines, DMARDs, nonsteroidal ences, 18, Edition, A. R. Gennaro, ed., Mack Publishing anti-inflammatories, chemotherapeutics, and stimulators of Company (1990). angiogenesis. 0.131. In certain embodiments, an EGFr-specific binding 0126. In certain embodiments, various medical disorders agent and/or an additional therapeutic molecule is linked to are treated with EGFr-specific binding agents in combina a half-life extending vehicle known in the art. Such vehicles tion with a stimulator of apoptosis. For example, in certain include, but are not limited to, the Fc domain, polyethylene embodiments, EGFr-specific binding agents may be admin glycol, and dextran. Such vehicles are described, e.g., in istered in a composition that also contains a compound that U.S. Pat. No. 6,660,843 and published PCT Application No. stimulates apoptosis of one or more cells. In certain embodi WO 99/25044. ments, the EGFr-specific binding agent and stimulators of apoptosis may be administered as separate compositions, 0.132. In certain embodiments, the optimal pharmaceuti cal composition will be determined by one skilled in the art and these may be administered by the same or different depending upon, for example, the intended route of admin rOuteS. istration, delivery format and desired dosage. See, for 0127. In certain embodiments, pharmaceutical composi example, Remington's Pharmaceutical Sciences, Supra. In tions are provided comprising a therapeutically effective certain embodiments, such compositions may influence the amount of an EGFr-specific binding agent and a pharma physical state, stability, rate of in vivo release and rate of in ceutically acceptable diluent, carrier, solubilizer, emulsifier, vivo clearance of the EGFr-specific binding agents. preservative and/or adjuvant. 0133. In certain embodiments, the primary vehicle or 0128. In certain embodiments, pharmaceutical composi carrier in a pharmaceutical composition may be either tions are provided comprising a therapeutically effective aqueous or non-aqueous in nature. For example, in certain amount of an EGFr-specific binding agent and a therapeu embodiments, a suitable vehicle or carrier may be water for tically effective amount of at least one additional therapeutic injection, physiological saline solution or artificial cere agent, and a pharmaceutically acceptable diluent, carrier, brospinal fluid, possibly supplemented with other materials solubilizer, emulsifier, preservative and/or adjuvant. common in compositions for parenteral administration. In certain embodiments, neutral buffered saline or saline mixed 0129. In certain embodiments, acceptable formulation with serum albumin are further exemplary vehicles. In materials preferably are nontoxic to recipients at the dosages certain embodiments, pharmaceutical compositions com and concentrations employed. prise Tris buffer of about pH 7.0-8.5, or acetate buffer of 0130. In certain embodiments, the pharmaceutical com about pH 4.0–5.5, which may further include sorbitol or a position may contain formulation materials for modifying, suitable substitute therefor. In certain embodiments, a phar maintaining or preserving, for example, the pH, osmolarity, maceutical composition is an aqueous or liquid formulation Viscosity, clarity, color, isotonicity, odor, Sterility, stability, comprising an acetate buffer of about pH 4.0–5.5, a polyol rate of dissolution or release, adsorption or penetration of the (polyalcohol), and optionally, a surfactant, wherein the com composition. In certain embodiments, Suitable formulation position does not comprise a salt, e.g., Sodium chloride, and materials include, but are not limited to, amino acids (such wherein the composition is isotonic for the patient. Exem as glycine, glutamine, asparagine, arginine or lysine); anti plary polyols include, but are not limited to. Sucrose, glu microbials; antioxidants (such as ascorbic acid, sodium cose, Sorbitol, and mannitol. An exemplary Surfactant sulfite or sodium hydrogen-sulfite); buffers (such as borate, includes, but is not limited to, polysorbate. In certain bicarbonate, Tris-HCI, citrates, phosphates or other organic embodiments, a pharmaceutical composition is an aqueous acids); bulking agents (such as mannitol or glycine); chelat or liquid formulation comprising an acetate buffer of about ing agents (such as ethylenediamine tetraacetic acid pH 5.0, sorbitol, and a polysorbate, wherein the composition (EDTA)); complexing agents (such as caffeine, polyvi does not comprise a salt, e.g., Sodium chloride, and wherein nylpyrrolidone, beta-cyclodextrin or hydroxypropyl-beta the composition is isotonic for the patient. Certain exem cyclodextrin); fillers; monosaccharides; disaccharides; and plary compositions are found, for example, in U.S. Pat. No. other carbohydrates (such as glucose, mannose or dextrins): 6,171,586. Additional pharmaceutical carriers include, but proteins (such as serum albumin, gelatin or immunoglobu are not limited to, oils, including petroleum oil, animal oil, lins); coloring, flavoring and diluting agents; emulsifying vegetable oil, peanut oil, soybean oil, mineral oil, Sesame agents; hydrophilic polymers (such as polyvinylpyrroli oil, and the like. In certain embodiments, aqueous dextrose done); low molecular weight polypeptides; salt-forming and glycerol Solutions can also be employed as liquid counterions (such as Sodium); preservatives (such as ben carriers, particularly for injectable solutions. In certain Zalkonium chloride, benzoic acid, Salicylic acid, thimerosal, embodiments, a composition comprising an antibody, with phenethyl alcohol, methylparaben, propylparaben, chlo or without at least one additional therapeutic agent, may be rhexidine, Sorbic acid or hydrogen peroxide); Solvents (such prepared for storage by mixing the selected composition as glycerin, propylene glycol or polyethylene glycol); Sugar having the desired degree of purity with optional formula US 2007/0O87394 A1 Apr. 19, 2007 tion agents (Remington's Pharmaceutical Sciences, Supra) least one additional therapeutic agent, may be formulated as in the form of a lyophilized cake or an aqueous solution. a dry powder for inhalation. In certain embodiments, an Further, in certain embodiments, a composition comprising inhalation Solution comprising an EGFr-specific binding an antibody, with or without at least one additional thera agent, with or without at least one additional therapeutic peutic agent, may be formulated as a lyophilizate using agent, may be formulated with a propellant for aerosol appropriate excipient Solutions (e.g., Sucrose) as diluents. delivery. In certain embodiments, solutions may be nebu 0134. In certain embodiments, an EGFr-specific binding lized. Pulmonary administration is further described in PCT agent is administered in the form of a physiologically Publication No. WO94/20069, which describes pulmonary acceptable composition comprising purified recombinant delivery of chemically modified proteins. protein in conjunction with physiologically acceptable car 0.139. In certain embodiments, it is contemplated that riers, excipients or diluents. In certain embodiments, such formulations may be administered orally. In certain embodi carriers are nontoxic to recipients at the dosages and con ments, an EGFr-specific binding agent, with or without at centrations employed. In certain embodiments, preparing least one additional therapeutic agent, that is administered in Such compositions may involve combining the EGFr-spe this fashion may be formulated with or without those cific binding agent with buffers, antioxidants such as ascor carriers customarily used in the compounding of Solid bic acid, low molecular weight polypeptides (such as those dosage forms such as tablets and capsules. In certain having fewer than 10 amino acids), proteins, amino acids, embodiments, a capsule may be designed to release the carbohydrates Such as glucose. Sucrose or dextrins, chelating active portion of the formulation at the point in the gas agents such as EDTA, glutathione and/or other stabilizers, trointestinal tract when bioavailability is maximized and and excipients. In certain embodiments, appropriate dosages pre-systemic degradation is minimized. In certain embodi are determined in Standard dosing trials, and may vary ments, at least one additional agent can be included to according to the chosen route of administration. In certain facilitate absorption of the EGFr-specific binding agent embodiments, in accordance with appropriate industry stan and/or any additional therapeutic agents. In certain embodi dards, preservatives may also be added, which include, but ments, diluents, flavorings, low melting point waxes, Veg are not limited to, benzyl alcohol. In certain embodiments, etable oils, lubricants, Suspending agents, tablet disintegrat the amount and frequency of administration may be deter ing agents, and/or binders may also be employed. mined based on Such factors as the nature and severity of the 0140. In certain embodiments, a pharmaceutical compo disease being treated, the desired response, the age and sition may involve an effective quantity of an EGFr-specific condition of the patient, and so forth. binding agent, with or without at least one additional thera 0135) In certain embodiments, pharmaceutical composi peutic agent, in a mixture with non-toxic excipients which tions can be selected for parenteral delivery. The preparation are suitable for the manufacture of tablets. In certain of certain Such pharmaceutically acceptable compositions is embodiments, by dissolving the tablets in sterile water, or within the skill of the art. another appropriate vehicle, solutions may be prepared in 0136. In certain embodiments, the formulation compo unit-dose form. Suitable excipients include, but are not nents are present in concentrations that are acceptable to the limited to, inert diluents, such as calcium carbonate, sodium site of administration. In certain embodiments, buffers are carbonate orbicarbonate, lactose, or calcium phosphate; and used to maintain the composition at physiological pH or at binding agents. Such as Starch, gelatin, and acacia, and a slightly lower pH, typically within a pH range of from lubricating agents such as magnesium Stearate, Stearic acid, about 5 to about 8. and talc. 0137 In certain embodiments, when parenteral adminis 0.141. Additional pharmaceutical compositions will be tration is contemplated, a therapeutic composition may be in evident to those skilled in the art, including formulations the form of a pyrogen-free, parenterally acceptable aqueous involving an EGFr-specific binding agent, with or without at least one additional therapeutic agent, in Sustained- or con Solution comprising the desired antibody, with or without trolled-delivery formulations. In certain exemplary Sus additional therapeutic agents, in a pharmaceutically accept tained- or controlled-delivery formulations include, but are able vehicle. In certain embodiments, a vehicle for not limited to, liposome carriers, bio-erodible micropar parenteral injection is sterile distilled water in which the ticles, porous beads, and depot injections. Certain exemplary antibody, with or without at least one additional therapeutic techniques for preparing certain formulations are known to agent, is formulated as a sterile, isotonic Solution, properly those skilled in the art. See for example, PCT publication no. preserved. In certain embodiments, the preparation can WO93/15722, which-describes the controlled release of involve the formulation of the desired molecule with an porous polymeric microparticles for the delivery of phar agent, such as injectable microspheres, bio-erodible par maceutical compositions. In certain embodiments, Sus ticles, polymeric compounds (such as polylactic acid or tained-release preparations may include semipermeable polyglycolic acid), beads, or liposomes, that may provide for polymer matrices in the form of shaped articles, e.g. films, the controlled or sustained release of the product which may or microcapsules. Sustained release matrices include, but are then be delivered via a depot injection. In certain embodi not limited to, polyesters, hydrogels, polylactides (U.S. Pat. ments, hyaluronic acid may also be used, and may have the No. 3,773.919 and EP 058.481), copolymers of L-glutamic effect of promoting Sustained duration in the circulation. In acid and gamma ethyl-L-glutamate (Sidman et al., Biopoly certain embodiments, implantable drug delivery devices mers, 22:547-556 (1983)), poly (2-hydroxyethyl-methacry may be used to introduce the desired molecule. late) (Langer etal., J. Biomed. Mater: Res., 15:167-277 0138. In certain embodiments, a pharmaceutical compo (1981) and Langer, Chem. Tech., 12:98-105 (1982)), ethyl sition may be formulated for inhalation. In certain embodi ene vinyl acetate (Langer et al., Supra), and poly-D(-)-3- ments, an EGFr-specific binding agent, with or without at hydroxybutyric acid (EP 133,988). In certain embodiments, US 2007/0O87394 A1 Apr. 19, 2007 20

Sustained release compositions may also include liposomes, contain the same amount of the desired molecule) over time, which can be prepared, in certain embodiments, by any of or as a continuous infusion via an implantation device or several methods known in the art. See e.g., Eppstein et al., catheter. Certain methods of further refining the appropriate Proc. Natl. Acad. Sci. USA, 82:3688-3692 (1985); EP 036, dosage are within the skill in the art. In certain embodiments, 676; EP 088,046 and EP 143,949. appropriate dosages may be ascertained through use of 0142. In certain embodiments, the pharmaceutical com appropriate dose-response data. position to be used for in vivo administration is sterile. In 0.147. In certain embodiments, the route of administration certain embodiments, the pharmaceutical composition to be of the pharmaceutical composition is in accord with known used for in vivo administration is made sterile by filtration methods, e.g. orally, through injection by intravenous, intra through sterile filtration membranes. In certain embodi peritoneal, intracerebral (intra-parenchymal), intracere ments, where the composition is lyophilized, Sterilization broVentricular, intramuscular, intra-ocular, intraarterial, using sterile filtration membranes may be conducted either intraportal, or intralesional routes; by Sustained release sys prior to or following lyophilization and reconstitution. In tems or by implantation devices. In certain embodiments, certain embodiments, the composition for parenteral admin the compositions may be administered by bolus injection or istration may be stored in lyophilized form or in a solution. continuously by infusion, or by implantation device. In certain embodiments, parenteral compositions generally 0.148. As discussed above, in various embodiments, any are placed into a container having a sterile access port, for efficacious route of administration may be used to admin example, an intravenous solution bag or vial having a ister an EGFr-specific binding agent. If injected, in certain stopper pierceable by a hypodermic injection needle. embodiments, an EGFr-specific binding agent may be 0143. In certain embodiments, after the pharmaceutical administered, for example, via intra-articular, intravenous, composition has been formulated, it may be stored in sterile intramuscular, intralesional, intraperitoneal, intracranial, vials as a solution, Suspension, gel, emulsion, Solid, or as a intranasal, inhalation or Subcutaneous routes by bolus injec dehydrated or lyophilized powder. In certain embodiments, tion or by continuous infusion. Exemplary methods of Such formulations may be stored either in a ready-to-use administration include, but are not limited to, Sustained form or in a form (e.g., a lyophilized form) that is recon release from implants, aerosol inhalation, eyedrops, oral stituted prior to administration. preparations, including pills, syrups, lozenges, and chewing 0144. In certain embodiments, kits for producing a gum, and topical preparations such as lotions, gels, sprays, single-dose administration unit are provided. In certain ointments, and other Suitable techniques. embodiments, the kits may each contain both a first con 0149. In certain embodiments, administration by inhala tainer having a dried protein and a second container having tion is beneficial when treating diseases associated with an aqueous formulation. In certain embodiments, kits con pulmonary disorders. In certain embodiments, an EGFr taining single and/or multi-chambered pre-filled Syringes specific binding agent may be administered by implanting (e.g., liquid Syringes and lyosyringes) are included. cultured cells that express an EGFr-specific binding agent. In certain embodiments, the patient's own cells are induced 0145. In certain embodiments, the effective amount of a to produce by transfection in vivo or ex vivo with one or pharmaceutical composition comprising an EGFr-specific more vectors that encode an EGFr-specific binding agent. In binding agent, with or without at least one additional thera certain embodiments, this vector can be introduced into the peutic agent, to be employed therapeutically will depend, for patient’s cells, for example, by injecting naked DNA or example, upon the therapeutic context and objectives. One liposome-encapsulated DNA that encodes an EGFr-specific skilled in the art will appreciate that the appropriate dosage binding agent, or by other methods of transfection. When an levels for treatment, according to certain embodiments, will EGFr-specific binding agent is administered in combination thus vary depending, in part, upon the molecule delivered, with one or more other biologically active compounds, in the indication for which the EGFr-specific binding agent, certain embodiments, these may be administered by the with or without at least one additional therapeutic agent, is same or by different routes, and may be administered being used, the route of administration, and the size (body together, separately, or sequentially. weight, body Surface or organ size) and/or condition (the age and general health) of the patient. In certain embodiments, 0150. In certain embodiments, the composition may be the clinician may titer the dosage and modify the route of administered locally via implantation of a membrane, administration to obtain the optimal therapeutic effect. In sponge or another appropriate material onto which the certain embodiments, a typical dosage may range from desired molecule has been absorbed or encapsulated. In about 0.1 ug/kg to up to about 100 mg/kg or more, depend certain embodiments, where an implantation device is used, ing on the factors mentioned above. In certain embodiments, the device may be implanted into any Suitable tissue or the dosage may range from 0.1 g/kg up to about 100 mg/kg: organ, and delivery of the desired molecule may be via or 1 g/kg up to about 100 mg/kg, or 5 g/kg up to about 100 diffusion, timed-release bolus, or continuous administration. mg/kg. 0151. In certain embodiments, it may be desirable to use 0146 In certain embodiments, the frequency of dosing a pharmaceutical composition comprising an EGFr-specific will take into account the pharmacokinetic parameters of the binding agent, with or without at least one additional thera EGFr-specific binding agent and/or any additional therapeu peutic agent, in an ex vivo manner. In such embodiments, tic agents in the formulation used. In certain embodiments, cells, tissues and/or organs that have been removed from the a clinician will administer the composition until a dosage is patient are exposed to a pharmaceutical composition com reached that achieves the desired effect. In certain embodi prising an antibody, with or without at least one additional ments, the composition may therefore be administered as a therapeutic agent, after which the cells, tissues and/or organs single dose, or as two or more doses (which may or may not are Subsequently implanted back into the patient. US 2007/0O87394 A1 Apr. 19, 2007

0152. In certain embodiments, an EGFr-specific binding panitumumab. In certain embodiments, the EGFr-specific agent and any additional therapeutic agents can be delivered binding agent treatment comprises an EGFr-specific binding by implanting certain cells that have been genetically engi agent and at least one chemotherapeutic agent. In certain neered, using methods such as those described herein, to embodiments, the EGFr-related cancer is a solid tumor. In express and secrete the polypeptides. In certain embodi certain embodiments, the Solid tumor comprises at least one ments, such cells may be animal or human cells, and may be cancer selected from colorectal cancer, lung cancer, breast autologous, heterologous, or Xenogeneic. In certain embodi cancer, -ovarian cancer, prostate cancer, kidney cancer, and ments, the cells may be immortalized. In certain embodi head and neck cancer. ments, in order to decrease the chance of an immunological 0.156. In certain embodiments, determining the EGFr response, the cells may be encapsulated to avoid infiltration gene copy number in the sample comprises determining the of Surrounding tissues. In certain embodiments, the encap EGFr gene copy number in a test sample from a tumor in the Sulation materials are typically biocompatible, semi-perme Subject, determining the copy number of at least one refer able polymeric enclosures or membranes that allow the ence nucleotide sequence in the test sample, and comparing release of the protein product(s) but prevent the destruction the EGFr gene copy number in the test sample to the copy of the cells by the patient’s immune system or by other number of at least one reference nucleotide sequence in the detrimental factors from the Surrounding tissues. test sample. In certain embodiments, an increased copy 0153. Certain Exemplary Methods number of the EGFr gene in the test sample relative to the copy number of the at least one reference nucleotide 0154) In certain embodiments, a method of predicting sequence predicts that an EGFr-specific binding agent treat whether an EGFr-specific binding agent treatment will be ment will be efficacious in treating an EGFr-related cancer efficacious in treating an EGFr-related cancer in a Subject is in the Subject. In certain embodiments, the at least one provided. In certain embodiments, the method comprises reference nucleotide sequence is located on the same chro determining the EGFr gene copy number in a sample from mosome as an EGFr gene. In certain embodiments, the at the Subject. In certain embodiments, the presence of an least one reference nucleotide sequence is located on another increased EGFr gene copy number in the sample predicts chromosome from the chromosome where EGFr is located. that an EGFr-specific binding agent treatment will be effi In certain embodiments, the copy number of the at least one cacious in treating an EGFr-related cancer in the Subject. In reference nucleotide sequence is two copies per cell. In certain embodiments, the EGFr-specific binding agent treat certain embodiments, the at least one reference nucleotide ment comprises an anti-EGFr antibody. In certain embodi sequence is a centromeric sequence. In certain embodi ments, the anti-EGFr antibody is a human anti-EGFr anti ments, the ratio of the EGFr gene copy number to the copy body. In certain embodiments, the anti-EGFr antibody is number of the at least one reference nucleotide sequence in panitumumab. In certain embodiments, the EGFr-specific a normal sample is 1. In certain embodiments, determining binding agent treatment comprises an EGFr-specific binding the EGFr gene copy number and the at least one reference agent and at least one chemotherapeutic agent. In certain nucleotide sequence copy number comprises fluorescent in embodiments, the EGFr-related cancer is a solid tumor. In situ hybridization analysis. In certain embodiments, deter certain embodiments, the Solid tumor comprises at least one mining the EGFr gene copy number and the at least one cancer selected from colorectal cancer, lung cancer, breast reference nucleotide sequence copy number comprises cancer, ovarian cancer, prostate cancer, kidney cancer, and quantitative PCR. In certain embodiments, determining the head and neck cancer. EGFr gene copy number and the at least one reference 0155 In certain embodiments, determining the EGFr nucleotide sequence copy number comprises Southern blot gene copy number in the sample comprises comparing the analysis. In certain embodiments, determining the EGFr EGFr gene copy number in the sample to the EGFr gene gene copy number and the at least one reference nucleotide copy number in a normal reference sample. In certain sequence copy number comprises another gene copy number embodiments, the normal reference sample is from the same determination methodology described herein. In certain Subject as the sample. In certain embodiments, the normal embodiments, the EGFr-related cancer is a solid tumor. In reference sample is not from the same Subject as the sample. certain embodiments, the Solid tumor comprises at least one In certain embodiments, the normal reference sample is from cancer selected from colorectal cancer, lung cancer, breast the same tissue as the sample. In certain Such embodiments, cancer, ovarian cancer, prostate cancer, kidney cancer, and the normal reference sample is from nontumorigenic tissue head and neck cancer. In certain embodiments, the EGFr and the sample is from tumorigenic tissue. In certain Such specific binding agent treatment comprises an anti-EGFr embodiments, the normal reference sample is from non antibody. In certain embodiments, the anti-EGFr antibody is malignant tissue and the sample is from malignant tissue. In a human anti-EGFr antibody. In certain embodiments, the certain embodiments, determining the EGFr gene copy anti-EGFr antibody is panitumumab. In certain embodi number comprises fluorescent in situ hybridization analysis. ments, the EGFr-specific binding agent treatment comprises In certain embodiments, determining the EGFr gene copy an EGFr-specific binding agent and at least one chemothera number comprises quantitative PCR. In certain embodi peutic agent. ments, determining the EGFr gene copy number comprises 0157. In certain embodiments, determining the EGFr Southern blot analysis. In certain embodiments, determining gene copy number comprises: determining the EGFr gene the EGFr gene copy number comprises another gene copy copy number in a test sample from the Subject; determining number determination methodology described herein. In the number of nuclei in the test sample; and comparing the certain embodiments, the EGFr-specific binding agent treat EGFr gene copy number to the number of nuclei. In certain ment comprises an anti-EGFr antibody. In certain embodi such embodiments, a ratio between the EGFr gene copy ments, the anti-EGFr antibody is a human anti-EGFr anti number and the number of nuclei of greater than two body. In certain embodiments, the anti-EGFr antibody is predicts that an EGFr-specific binding agent treatment will US 2007/0O87394 A1 Apr. 19, 2007 22 be efficacious in treating an EGFr-related cancer in the comprises at least one cancer selected from colorectal can subject. In certain embodiments, the ratio of the EGFr gene cer, lung cancer, breast cancer, ovarian cancer, prostate copy number to the number of nuclei in a normal sample is cancer, kidney cancer, and head and neck cancer. 2. In certain embodiments, an increased EGFr gene copy 0.160 In certain embodiments, a method of determining number in a sample is indicated by a ratio of the EGFr gene the efficacy of a treatment in a patient is provided, compris copy number to the number of nuclei of greater than 2. In ing: (a) determining the EGFr gene copy number in a first certain embodiments, the EGFr-specific binding agent treat sample obtained from a patient to obtain a first EGFr gene ment comprises an anti-EGFr antibody. In certain embodi copy number level; (b) administering the treatment to the ments, the anti-EGFr antibody is a human anti-EGFr anti patient; (c) determining the EGFr gene copy number in a body. In certain embodiments, the anti-EGFr antibody is second sample from the patient at a time following admin panitumumab. In certain embodiments, the EGFr-specific istration of the treatment, thereby generating a second EGFr binding agent treatment comprises an EGFr-specific binding gene copy number level; and (d) comparing the first and agent and at least one chemotherapeutic agent. In certain second EGFr gene copy number levels, wherein a decrease embodiments, the EGFr-related cancer is a solid tumor. In in the EGFr gene copy number in the second EGFr gene certain embodiments, the Solid tumor comprises at least one copy number level relative to the first EGFr gene copy cancer selected from colorectal cancer, lung cancer, breast number level indicates that the treatment is effective in the cancer, ovarian cancer, prostate cancer, kidney cancer, and patient. In certain embodiments, determining the EGFr gene head and neck cancer. copy number comprises fluorescent in situ hybridization 0158. In certain embodiments, determining the EGFr analysis. In certain embodiments, determining the EGFr gene copy number and the number of nuclei comprises gene copy number comprises quantitative PCR. In certain fluorescent in situ hybridization analysis. In certain embodi embodiments, determining the EGFr gene copy number ments, determining the EGFr gene copy number and the comprises Southern blot analysis. In certain embodiments, number of nuclei comprises quantitative PCR. In certain determining the EGFr gene copy number comprises another embodiments, determining the EGFr gene copy number and gene copy number determination methodology described the number of nuclei comprises Southern blot analysis. In herein. In certain embodiments, the treatment comprises an certain embodiments, determining the EGFr gene copy EGFr-specific binding agent. In certain embodiments, the number and the number of nuclei comprises another gene EGFr-specific binding agent is an anti-EGFr antibody. In copy number determination methodology described herein. certain embodiments, the anti-EGFr antibody is a human In certain embodiments, the EGFr-related cancer is a solid anti-EGFr antibody. In certain embodiments, the anti-EGFr tumor. In certain embodiments, the Solid tumor comprises at antibody is panitumumab. In certain embodiments, the treat least one cancer selected from colorectal cancer, lung cancer, ment comprises an EGFr-specific binding agent and at least breast cancer, ovarian cancer, prostate cancer, kidney cancer, one chemotherapeutic agent. In certain embodiments, the and head and neck cancer. In certain embodiments, the treatment is for an EGFr-related cancer. In certain embodi EGFr-specific binding agent treatment comprises an anti ments, the EGFr-related cancer is a solid tumor. In certain EGFr antibody. In certain embodiments, the anti-EGFr anti embodiments, the Solid tumor comprises at least one cancer body treatment comprises a human anti-EGFr antibody. In selected from colorectal cancer, lung cancer, breast cancer, certain embodiments, the anti-EGFr antibody is panitu ovarian cancer, prostate cancer, kidney cancer, and head and mumab. In certain embodiments, the EGFr-specific binding neck cancer. agent treatment comprises an EGFr-specific binding agent and at least one chemotherapeutic agent. 0.161 The following examples, including the experi 0159. In certain embodiments, a method of treating a ments conducted and results achieved are provided for Subject having an EGFr-related cancer is provided, compris illustrative purposes only and are not to be construed as ing: determining the EGFr gene copy number in a sample limiting upon the present invention. from the Subject, determining whether there is an increased EXAMPLES EGFr gene copy number in the sample; and if there is an increased EGFr gene copy number in the sample, adminis Example 1 tering to the Subject a pharmaceutically effective amount of an EGFr-specific binding agent. In certain embodiments, the Isolation of CRC Tumor Samples and Correlation EGFr-specific binding agent is an anti-EGFr antibody. In with Panitumumab Treatment certain embodiments, the anti-EGFr antibody is a human anti-EGFr antibody. In certain embodiments, the anti-EGFr 0162 Ten patients were selected from patients enrolled at antibody is panitumumab. In certain embodiments, the Ospedale Niguarda CaGranda for a panitumumab (human EGFr-specific binding agent treatment comprises an EGFr IgG2 monoclonal antibody to EGFr; Amgen Inc.) clinical specific binding agent and at least one chemotherapeutic trial for the treatment of EGFr-expressing colorectal cancer agent. In certain embodiments, determining the EGFr gene (“CRC). Treatment protocols were approved by the Insti copy number comprises fluorescent in situ hybridization tutional Ethics Committee. Patients gave written informed analysis. In certain embodiments, determining the EGFr consent for receiving panitumumab, as well as for analysis gene copy number comprises quantitative PCR. In certain of tumor-expressed EGFr and molecules involved in EGFr embodiments, determining the EGFr gene copy number activation. All ten patients were resistant to prior chemo comprises Southern blot analysis. In certain embodiments, therapy regimens. Those prior chemotherapy regimens are determining the EGFr gene copy number comprises another shown in Table 1 below. Patient tumor samples were gene copy number determination methodology described assessed for EGFr expression using the EGFRPharmDX kit herein. In certain embodiments, the EGFr-related cancer is (DAKO Corp.) according to the manufacturers instructions. a solid tumor. In certain embodiments, the solid tumor All patients selected for the study had EGFr-expressing US 2007/0O87394 A1 Apr. 19, 2007

metastatic CRC, ascertained by the presence of EGFr stain extracted with 0.2M NaOH/1 mM EDTA. Samples were ing in at least 1% of malignant cells. Patients were treated subsequently neutralized with 100 mM Tris-TE. After intravenously with panitumumab at a dose of 6 mg/kg every extraction and neutralization, DNA from each sample was two weeks until disease progression was observed. purified using a PCR Purification Kit (Qiagen) following the 0163 Tumor response to panitumumab treatment was manufacturers instructions. evaluated by Computed Tomography Imaging ("CT Scan’) 0.165 Exon-specific PCR primers and sequencing prim employing Response Evaluation Criteria in Solid Tumors ers were designed using the program Primer3 (Rozen S. (RECIST) criteria by institutional as well as independent Skaletsky H (2000) Primer3 on the WWW for general users radiologists according to clinical protocols. RECIST pro and for biologist programmers. In: Krawetz, S., Misener, S. vides guidelines for identifying improvement, stable dis (eds) Bioinformatics Methods and Protocols: Methods in ease, or progressive disease based on tumor size (see Ther Molecular Biology. Humana Press, Totowa, N.J., pp. 365 asse et al., February 2000, “New Guidelines to Evaluate the 386). The designed primers were synthesized by Invitro Response to Treatment in Solid Tumors. J. Natl. Cancer genTM (Carlsbad, Calif.). The forward PCR primer for EGFr Inst. 92(3): 205-216). The results-of the RECIST analysis of exon 18 was GCTGAGGTGACCCTTGTCTC (SEQ ID patients treated with panitumumab are shown in Table 1. NO: 1), the reverse PCR primer for EGFr exon 18 was ACAGCTTGCAAGGACTCTGG (SEQID NO: 2), and the TABLE 1. sequencing primer for EGFr exon 18 was TGGAGCCTCT TACACCCAGT (SEQID NO:3). The forward PCR primer Relevant Clinical Characteristics of Patients Treated with Panitumumab for EGFr exon 19 was CCCAGTGTCCCTCACCTTC (SEQ Du ID NO: 4), the reverse PCR primer for EGFr exon 19 was Number and ration CCACACAGCAAAGCAGAAAC (SEQID NO: 5), and the Type of Prior Tumor of Re sequencing primer for EGFr exon 19 was GCTGGTAA Chemotherapy Response to sponse CATCCACCCAGA (SEQ ID NO: 6). The forward PCR Patient Sex Age Regimens Panitumumab (weeks) primer for EGFr exon 21 was TGATCTGTCCCTCACAG 1 - 30624793 M 59 3: FOLFOX*, Partial 33 CAG (SEQ ID NO: 7), the reverse PCR primer for EGFr Capecitabine, Response exon 21 was TCAGGAAAATGCTGGCTGAC (SEQ ID FOLFIRIt NO: 8), and the sequencing primer for EGFr exon 21 was 2 - 23 SO661 F 62 2: FOLFOX, Partial 24 FOLFIR Response TTCAGGGCATGAACTACTTGG (SEQ ID NO: 9). The 3 - 3064O71S M 57 2: FOLFIRI, Partial 16 forward PCR primer for PI3K exon 9 was FOLFOX Response GGGAAAAATATGACAAAGAAAGC (SEQ ID NO: 10), 4 - 3O398321 F 78 3: FOLFOX, Partial 12+ Capecitabine, Response the reverse PCR primer for PI3K exon 9 was CTGAGAT FOLFIR CAGCCAAATTCAGTT (SEQ ID NO: 11), and the 5 - 1 OO15851 F 52 4: FOLFOX, Stable Disease 32 sequencing primer for PI3K exon 9 was TAGCTAGAGA rinotecan, CAATGAATTAAGGGAAA (SEQ ID NO: 12). The for Capecitabine, ward PCR primer for PI3K exon 20 was CTCAATGAT FOLFIR 6 - 30656334 M 71 2: FOLFOX, Stable Disease 16+ GCTTGGCTCTG (SEQ ID NO: 13), the reverse PCR FOLFIR primer for PI3K exon 20 was TGGAATCCAGAGT 7 - 30667900 M 56 1: Oxaliplatin- Progressive (no GAGCTTTC (SEQ ID NO: 14), and the sequencing primer rinotecan-5- Disease re for PI3K exon 20 was TTGATGACATTGCATACATTCG FUFA sponse) 8 - 3O384032 F 67 2: FOLFOX, Progressive (no (SEQ ID NO: 15). The forward PCR primer for Ras exon 2 FOLFIRI Disease re was GGTGGAGTATTTGATAGTGTATTAAC (SEQ ID sponse) NO: 16), the reverse PCR primer for Ras exon 2 was 9 - 30692441 M 54 2: FOLFOX, Progressive (no AGAATGGTCCTGCACCAGTAA (SEQ ID NO: 17), and FOLFIRI Disease re sponse) the sequencing primer for Ras exon 2 was TCATTATTTT 10 - 30685324 F 65 3: 5-FU/FA, Progressive (no TATTATAAGGCCTGCTG (SEQ ID NO: 18). The forward FOLFOX, Disease re PCR primer for B-Raf exon 15 was TGCTTGCTCTGAT FOLFIRI sponse) AGGAAAATG (SEQ ID NO: 19), the reverse PCR primer for B-Raf exon 15 was AGCATCTCAGGGCCAAAAAT *FOLFOX is a combination of 5-fluorouracil, leucovorin, and oxaliplatin FOLFIRI is a combination of 5-fluorouracil, leucovorin, and irinotecan (SEQID NO: 20), and the sequencing primer for B-Rafexon 15 was TGTTTTCCTTTACTTACTACACCTCA (SEQ ID Thus, six of the ten patients responded positively to the NO: 21). panitumumab treatment, showing either stable disease or a 0166 EGFr exons 18, 19, and 21, PI3K exons 9 and 20, partial response. Ras exon 2, and B-Raf exon 15 were amplified by PCR from the purified tumor genomic DNA using the PCR primers Example 2 described above. PCR was performed in a total volume of 20 LL using a touchdown PCR program. The amplification Mutational Analysis of EGFr. PI3K, Ras, and Raf program was as follows: 94° C. for 2 minutes; three cycles in CRC Tumor Samples of 94° C. for 30 seconds, 64° C. for 30 seconds, 70° C. for 30 seconds; three cycles of 94° C. for 30 seconds, 58° C. for 0164 Prior to initiation of panitumumab treatment dis 30 seconds, 70° C. for 30 seconds; 35 cycles of 94° C. for cussed in Example 1, CRC tumor samples from each patient 30 seconds, 57° C. for 30 seconds, and 70° C. for 30 were embedded in paraffin. A 10 micron section was pre seconds; and one cycle of 70° C. for 5 minutes. After the pared from each patient sample. Regions of the section reaction was complete, the amplicons were purified using displaying tumor tissue were marked and the tissue was the AMPure PCR purification system (Agencourt Bio US 2007/0O87394 A1 Apr. 19, 2007 24

Science Corp.). The purified amplicons were sequenced 0.169 A fluorescent microscope (Zeiss Axioskop, Ger using the BigDyeR Terminator v.3.1 Cycle Sequencing Kit many) equipped with the Chromowin workstation (Ampli (Applied BioSystems) according to the manufacturers medical, Italy) was used for the FISH Visualization. The instructions and analyzed with a 3730 ABI capillary elec EGFr gene was observed as a red signal with a tetramethyl trophoresis system. Each exon sequence from the tumor rhodamine isothiocyanate (TRITC) filter. The CEP7 DNA of a particular patient was compared to the wild-type sequence was observed as a green signal with a fluorescein exon sequence from normal DNA of that same patient to isothiocyanate (FITC) filter. The cell nuclei were observed identify the presence of any mutations. The results of that as a blue signal with a DAPI filter. Representative images of each specimen were taken with a Hamamatsu C5895 chilled analysis are shown in Table 2. CCD camera (Upstate Technical Equipment Co., New York) in monochromatic layers that were Subsequently merged by TABLE 2 Casti Imaging FISH Multicolor software (Amplimedical). Mutational Analysis of Certain EGFr. PI3K, and Ras Exons in Cultured retinal pigment epithelial cells and normal colorec CRC Patient Samples tal mucosal cells adjacent to the tumor cells in each patient sample were used as normal cell controls. A431 human EGFr EGFr EGFr PI3K PI3K B-Raf epidermoid carcinoma cells were used as controls for (XOil (XOil (XOil (XOil (XOl Ras (XOl increased EGFr gene copy number. The specimen from Patient 18 19 21 9 2O exon 2 15 patient 5 was available only as a 10 micron section and - 30624793 WT WT WT WT WT WT WT despite multiple attempts, FISH analysis was not conclusive - 2350661 WT WT WT WT WT G13D WT due to excessive tissue thickness. - 30640715 WT WT WT WT WT G12D WT - 3039832 WT WT WT WT WT WT WT 0170 Two independent observers scored at least 200 - 10015851 WT WT WT WT WT G13D WT non-overlapping interphase nuclei from each sample using - 30656334 WT WT WT WT WT G12V WT - 30667900 WT WT WT WT WT WT WT predefined scoring guidelines. The observers were blinded - 30384032 WT WT WT WT WT G13D WT to both.the clinical characteristics of the patients and the - 30692441 WT WT WT WT WT WT WT scoring and assessment of the other observer. Within each 1 - 30685324 WT WT WT WT H1047R WT E599V nucleus, the number of copies of the EGFr gene and the CEP7 sequence were assessed independently. The ratio of the EGFr gene copy number to the number of nuclei 0167 The results in Tables 1 and 2 show that mutations (EGFrinuclei) and the EGFr gene copy number to the CEP7 in the EGFr catalytic domain (exons 18, 19, and 21), and sequence number (EGFr:CEP7) were recorded. The results mutations in Ras exon 1, PI3K exons 9 and 20, and muta are shown in Table 3. tions in B-Raf exon 15 were not correlated with efficacy of panitumumab treatment in the ten tested CRC patients. TABLE 3 Example 3 Results of FISH Analysis of EGFr Gene Copy Number Response to EGFr EGFr Analysis of EGFR Copy Number and Localization Patient panitumumab gene:CEP7 gene:nuclei in CRC Tumor Samples 1 - 30624793 partial response 2.50 4.8O 2 - 2350661 partial response 2.13 6.8O 0168 The number of copies of an EGFr gene in patient 3 - 3064071S partial response 3.27 8.2O tumor samples was determined in two ways: by fluorescent 4 - 3O39832 partial response 1.19 3.38 in situ hybridization (“FISH) and by quantitative PCR. The 5 - 1 OO15851 stable disease na na FISH analysis was performed using the Her1 FISH detection 6 - 30656334 stable disease 1.04 1.88 7 - 30667900 progressive disease O.91 1.70 kit (Dakocytomation, Denmark) according to the manufac 8 - 3O384032 progressive disease 1.02 2.00 turer's instructions. The kit permitted the differential fluo 9 - 30692441 progressive disease 1.03 2.00 rescent labeling of each EGFr gene, each chromosome 7 10 - 30685324 progressive disease 1.18 2.10 alpha-centromeric sequence (“CEP7), and each nucleus present in the sample. Patient samples were placed in a pretreatment solution (provided in kit) for 30 minutes at 96° 0171 An EGFr gene is normally located on chromosome C. and Subsequently digested with pepsin Solution (provided 7, and thus the expected ratio of EGFr gene number:CEP7 in kit) for 30 minutes at room temperature. Dual-color, sequence number was 1. The expected ratio of EGFr gene dual-target FISH assays were performed using the LSI number: nuclei was 2, given that normally two copies of EGFR Spectrum Orange probe (Vysis, Downers Grove, Ill.) chromosome 7 would be present in the nucleus. An and the CEP7 Spectrum Green probe (Vysis, Downers increased EGFr gene copy number can result from both Grove, Ill.). Tissue sections were covered with 10 pl. probe chromosome 7 polysomy and from EGFr gene amplifica solution (provided in kit) and incubated at 75° C. for 5 tion. Normal disomy is thus indicated by an EGFr minutes to co-denature the EGFr and CEP7 probes. The gene:CEP7 ratio of 1 and an EGFr gene:nuclei ratio of 2. sections were allowed to hybridize overnight with the dena Balanced polysomy is indicated by an EGFr gene:CEP7 tured probes at 37°C. The co-denaturation and hybridization ratio of 1 and an EGFr gene: nuclei ratio greater than 2. steps were performed sequentially in a microprocessor Normal disomy with amplification of an EGFr gene is controlled system (Hybridizer, Dakocytomation, Denmark). indicated by an EGFr gene:CEP7 ratio of greater than 1 and After hybridization, the sections were washed twice at 65° an EGFr gene:nuclei ratio greater than 2. Increased EGFr C. for 10 minutes per wash using the wash buffer provided gene copy number was arbitrarily defined as a value 23 in in the kit, and dried at room temperature for 15 minutes. The tissue sections were covered with 46-diamidino-2-phenylin the ratio of EGFr gene number:nucleus. dole (DAPI II, Vysis) for chromatin counterstaining and 0172 FIG. 1 shows certain dual-color FISH assay examined by fluorescent microscopy. images, in which EGFr genes appear in red, and CEP7 US 2007/0O87394 A1 Apr. 19, 2007

sequences appear in green. FIG. 1A shows the staining mented with 10% FCS and antibiotics. An exemplary FISH pattern of normal colorectal mucosal cells, in which bal fluorescence stained image for DiFi cells is shown in FIG. anced disomy is observed. FIG. 1B shows the staining 2B. The values obtained from the FISH analyses are shown pattern of tumor cells from patient 7, also displaying bal in Table 4. anced disomy. FIG. 1C shows the staining pattern of tumor cells from patient 4, displaying balanced polysomy. FIG. 1D TABLE 4 shows the staining pattern of tumor cells from patient 1, displaying disomy with EGFr gene amplification. Copy Number of EGFr Gene in CRC Cell Lines 0173 The EGFr gene copy number is also determined for Cell Line EGFr gene:CEP7 EGFr gene:Nucleus each patient using quantitative PCR. Real-time PCR is DF >2O >2O performed using an ABI PRISM(R) 7900HT apparatus and SW48 1.10 3.19 the SYBR(R) Green (Molecular Probes, Inc.) detection sys SW48O O.94 3.08 tem (Applied Biosystems), following the manufacturers SW62O 1.OS 3.00 instructions. The forward primer GAATTCGGATGCA HT-29 0.97 2.52 GAGCTTC (SEQ ID NO: 22) and the reverse primer LoVo O.98 2.41 GACATGCTGCGGTGTTTTC (SEQ ID NO. 23) are used HCT-116 O.93 1.79 to amplify a small (100-200 bp) non-repetitive region of an DLD-1 O.93 1.68 EGFr gene. Line-1, a repetitive element for which copy numbers per diploid genome are similar among all human cells, is also amplified from each patient sample to permit As shown in Table 4. DiFi cells have a very high EGFr gene normalization of the EGFr gene results. The forward and copy number. reverse primers for the Line-1 repetitive element are AAAGCCGCTCAACTACATGG (SEQ ID NO: 24) and 0.175 EGFr gene expression was examined in each of the TGCTTTGAATGCGTCCCAGAG (SEQ ID NO: 25), cell lines by Western blot analysis of cellular EGFr protein respectively. The amplification conditions are as follows: (see FIG. 2A). Protein extracts were subjected to electro one cycle of 10 minutes at 95°C. followed by 45 cycles of phoresis via SDS-PAGE and transferred to polyvinylidene 15 seconds at 95°C. and 1 minute at 60°C. Threshold cycle difluoride membranes by high-intensity wet blotting. Filters numbers are obtained using the ABI PRISM(R) 7900HT were probed with the indicated antibodies, and specific Sequence Detection System software. Amplification reac binding was detected using an enhanced chemiluminescence tions are performed in triplicate and threshold cycle numbers system (Amersham). As expected from the FISH data, are averaged. Copy number, changes are calculated by using above, DiFi cells had a very high level of EGFr protein. With the formula s?"NN". In that formula, Dt is the the exception of SW620, the other cell lines showed variable average threshold cycle number observed for the EGFr gene levels of EGFr protein. SW260 cells did not contain EGFr sequence in a patient sample, Dline is the average threshold protein, despite a high EGFr gene copy number. cycle number observed for the Line-1 sequence in a patient 0176) The effect of panitumumab on proliferation of each sample, Nt is the threshold cycle number observed for the of the CRC tumor cell lines is measured using a bromode EGFr gene sequence in DNA from retinal pigment epithelial oxyuridine (“BrdU) incorporation assay. Cells are grown in cells (“RPE) cells, and Nline is the threshold cycle number DMEM supplemented with 2% FBS in 96-well black plates observed for the Line-1 sequence in DNA from RPE cells. (Culture PlateTM 96F (Packard Bioscience)). The plated cells Example 4 are incubated for 5 days with varying concentrations between 0.01-100 nM panitumumab (Amgen Inc.). Cell proliferation is measured by a chemiluminscent ELISA Cell Proliferation Inhibition Assay method assaying BrdU incorporation (Roche). The cell 0174 The effect of panitumumab on cell lines with a seeding density per well for each cell line is as follows: DiFi. normal number of EGFr gene copies or with an increased 4000; LoVo: 4000: DLD: 500; HCT116:1000; HT29; 1000; number of EGFr gene copies are studied. First, the copy SW480: 1000; SW387: 4000; SW48: 500; and SW620: 500. number of EGFr in experimental CRC cell lines was deter The BrdU assay is performed in three separate triplicate mined. Eight different CRC cell lines were studied: DiFi experiments according to the manufacturers instructions (Jose Baselga, Vall d’Hebron University, Barcelona, Spain), and is terminated 20 hours after addition of the labeling DLD-1, HCT-116, HT-29, LoVo, SW48, SW480, and Solution. The percentage of cell proliferation at each pani SW620 (all from ATCC). The EGFr copy number of each tumumab concentration is calculated using the following CRC cell line was determined using the FISH methodology formula: (test sample-blank sample)/(control sample as described above in Example 3. Each cell line (with the blank sample)x100), where the control sample is cells grown exception of the DiFi cells) was grown in DMEM supple in medium lacking panitumumab, and the blank sample mented with 10% fetal calf serum, penicillin, and strepto consists of cells grown in 0.02% Triton X in DMEM (i.e., no mycin. DiFi cells were grown in F-12 medium supple growth).

SEQUENCE LISTING

<160> NUMBER OF SEQ ID NOS: 25

<210> SEQ ID NO 1 &2 11s LENGTH 20 US 2007/0O87394 A1 Apr. 19, 2007 26

-continued

&212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: oligonucleotide primer <400 SEQUENCE: 1 gctgaggtga cccittgtc.tc 20

<210> SEQ ID NO 2 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OOTHER INFORMATION: oligonucleotide primer <400 SEQUENCE: 2 acagottgca agg actctgg 20

<210> SEQ ID NO 3 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OOTHER INFORMATION: oligonucleotide primer <400 SEQUENCE: 3 tggagc citct tacacccagt 20

<210> SEQ ID NO 4 &2 11s LENGTH 19 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: oligonucleotide primer <400 SEQUENCE: 4 cccagtgtcc citcaccittc 19

<210 SEQ ID NO 5 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: oligonucleotide primer <400 SEQUENCE: 5 ccacacagoa aag cagaaac 20

<210> SEQ ID NO 6 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: oligonucleotide primer <400 SEQUENCE: 6 gctggtaa.ca tocacccaga 20

<210 SEQ ID NO 7 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: oligonucleotide primer US 2007/0O87394 A1 Apr. 19, 2007 27

-continued

<400 SEQUENCE: 7 tgatctgtcc citcacagoag 20

<210 SEQ ID NO 8 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: oligonucleotide primer <400 SEQUENCE: 8 to aggaaaat gctggctgac 20

<210 SEQ ID NO 9 <211& LENGTH 21 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: oligonucleotide primer <400 SEQUENCE: 9 ttcagggcat galactacttg g 21

<210> SEQ ID NO 10 &2 11s LENGTH 23 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: oligonucleotide primer <400 SEQUENCE: 10 gggaaaaata togacaaagaa agc 23

<210> SEQ ID NO 11 <211& LENGTH 22 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: oligonucleotide primer <400 SEQUENCE: 11 citgagatcag ccaaattcag tt 22

<210> SEQ ID NO 12 &2 11s LENGTH 27 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: oligonucleotide primer <400 SEQUENCE: 12 tagctagaga caatgaatta agggaaa 27

<210> SEQ ID NO 13 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: oligonucleotide primer <400 SEQUENCE: 13 citcaatgatg cittggctctg 20 US 2007/0O87394 A1 Apr. 19, 2007 28

-continued

<210> SEQ ID NO 14 <211& LENGTH 21 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: oligonucleotide primer <400 SEQUENCE: 14 tggaatccag agtgagctitt c 21

<210 SEQ ID NO 15 <211& LENGTH 22 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: oligonucleotide primer <400 SEQUENCE: 15 ttgatgacat to catacatt cq 22

<210> SEQ ID NO 16 &2 11s LENGTH 26 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: oligonucleotide primer <400 SEQUENCE: 16 ggtggagtat ttgatagtgt attaac 26

<210 SEQ ID NO 17 <211& LENGTH 21 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: oligonucleotide primer <400 SEQUENCE: 17 agaatggtoc tocaccagta a 21

<210> SEQ ID NO 18 &2 11s LENGTH 27 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: oligonucleotide primer <400 SEQUENCE: 18 toattattitt tattataagg cct gotg 27

<210 SEQ ID NO 19 <211& LENGTH 22 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: oligonucleotide primer <400 SEQUENCE: 19 tgcttgctict gataggaaaa to 22

<210> SEQ ID NO 20 &2 11s LENGTH 2.0 US 2007/0O87394 A1 Apr. 19, 2007 29

-continued

&212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: oligonucleotide primer

<400 SEQUENCE: 20 agcatctoag ggccaaaaat 20

<210> SEQ ID NO 21 &2 11s LENGTH 26 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: oligonucleotide primer

<400 SEQUENCE: 21 tgtttitccitt tactitactac accitca 26

<210> SEQ ID NO 22 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: oligonucleotide primer

<400 SEQUENCE: 22 gaattcggat gcagagctitc 20

<210> SEQ ID NO 23 &2 11s LENGTH 19 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: oligonucleotide primer

<400 SEQUENCE: 23 gacatgctgc ggtgtttitc 19

<210> SEQ ID NO 24 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: oligonucleotide primer

<400 SEQUENCE: 24 aaag.ccgcto aactacatgg 20

<210> SEQ ID NO 25 <211& LENGTH 21 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: oligonucleotide primer

<400 SEQUENCE: 25 tgctittgaat gcgtoccaga g 21 US 2007/0O87394 A1 Apr. 19, 2007 30

We claim: 17. The method of claim 12, wherein determining the 1. A method of predicting whether an EGFr-specific EGFr gene copy number and the at least one reference binding agent treatment will be efficacious in treating an nucleotide sequence copy number comprises Southern blot EGFr-related cancer in a Subject, comprising determining analysis. the EGFr gene copy number in a sample from the Subject, 18. The method of claim 12, wherein the EGFr-related wherein the presence of an increased EGFr gene copy cancer is a solid tumor. number in the sample predicts that an EGFr-specific binding 19. The method of claim 18, wherein the solid tumor is at agent treatment will be efficacious in treating an EGFr least one cancer selected from colorectal cancer, lung cancer, related cancer in the Subject. breast cancer, ovarian cancer, bladder cancer, prostate can 2. The method of claim 1, wherein the EGFr-specific cer, kidney cancer, and head and neck cancer. binding agent treatment comprises an anti-EGFr antibody. 20. The method of claim 12, wherein the EGFr-specific 3. The method of claim 2, wherein the anti-EGFr antibody binding agent treatment comprises an anti-EGFr antibody. is a human anti-EGFr antibody. 21. The method of claim 20, wherein the anti-EGFr 4. The method of claim 3, wherein the human anti-EGFr antibody is a human anti-EGFr antibody. antibody is panitumumab. 22. The method of claim 21, wherein the human anti EGFr antibody is panitumumab. 5. The method of claim 1, wherein the EGFr-specific 23. The method of claim 12, wherein the EGFr-specific binding agent treatment comprises an EGFr-specific binding binding agent treatment comprises an EGFr-specific binding agent and at least one chemotherapeutic agent. agent and at least one chemotherapeutic agent. 6. The method of claim 1, wherein the EGFr-related 24. The method of claim 1, wherein determining the EGFr cancer is a Solid tumor. gene copy number comprises: 7. The method of claim 6, wherein the solid tumor is at least one cancer selected from colorectal cancer, lung cancer, (a) determining the EGFr gene copy number in a test breast cancer, ovarian cancer, prostate cancer, kidney cancer, sample from the Subject; and head and neck cancer. (b) determining the number of nuclei in the test sample: 8. The method of claim 1, wherein determining the EGFr and gene copy number in the sample comprises comparing the EGFr gene copy number in the sample to the EGFr gene (c) comparing the EGFr gene copy number to the number copy number in a normal reference sample. of nuclei, wherein a ratio greater than two predicts that 9. The method of claim 8, wherein determining the EGFr an EGFr-specific binding agent treatment will be effi gene copy number comprises fluorescent in situ hybridiza cacious in treating an EGFr-related cancer in the Sub tion analysis. ject. 25. The method of claim 24, wherein determining the 10. The method of claim 8, wherein determining the EGFr EGFr gene copy number and the number of nuclei comprises gene copy number comprises quantitative PCR analysis. fluorescent in situ hybridization analysis. 11. The method of claim 8, wherein determining the EGFr 26. The method of claim 24, wherein the EGFr-related gene copy number comprises Southern blot analysis. cancer is a solid tumor. 12. The method of claim 1, wherein determining the EGFr 27. The method of claim 26, wherein the solid tumor is at gene copy number comprises: least one cancer selected from colorectal cancer, lung cancer, (a) determining the EGFr gene copy number in a test breast cancer, ovarian cancer, bladder cancer, prostate can sample from a tumor in the Subject; cer, kidney cancer, and head and neck cancer. 28. The method of claim 24, wherein the EGFr-specific (b) determining the copy number of at least one reference binding agent treatment comprises an anti-EGFr antibody. nucleotide sequence in the test sample; and 29. The method of claim 28, wherein the anti-EGFr (c) comparing the EGFr gene copy number to the at least antibody is a human anti-EGFr antibody. one reference nucleotide sequence copy number, 30. The method of claim 29, wherein the human anti wherein an increased copy number of the EGFr gene in EGFr antibody is panitumumab. the test sample relative to the copy number of the at 31. The method of claim 24, wherein the EGFr-specific least one reference nucleotide sequence predicts that an binding agent treatment comprises an EGFr-specific binding EGFr-specific binding agent treatment will be effica agent and at least one chemotherapeutic agent. cious in treating an EGFr-related cancer in the Subject. 32. A method of treating a subject having an EGFr-related 13. The method of claim 12, wherein the at least one cancer comprising: reference nucleotide sequence copy number is two copies (a) determining the EGFr gene copy number in a sample per cell. from the subject; 14. The method of claim 12, wherein the at least one reference nucleotide sequence is a centromeric sequence. (b) determining whether there is an increased EGFr gene 15. The method of claim 12, wherein determining the copy number in the sample; and EGFr gene copy number and the at least one reference (c) if there is an increased EGFr gene copy number in the nucleotide sequence copy number comprises fluorescent in sample, administering to the Subject a pharmaceutically situ hybridization analysis. effective amount of an EGFr-specific binding agent. 16. The method of claim 12, wherein determining the 33. The method of claim 32, wherein the EGFr-specific EGFr gene copy number and the at least one reference binding agent is an anti-EGFr antibody. nucleotide sequence copy number comprises quantitative 34. The method of claim 33, wherein the anti-EGFr PCR analysis. antibody is a human anti-EGFr antibody. US 2007/0O87394 A1 Apr. 19, 2007

35. The method of claim 34, wherein the human anti (c) determining the EGFr gene copy number in a second EGFr antibody is panitumumab. sample from the patient at a time following adminis 36. The method of claim 32, wherein the EGFr-specific tration of the treatment, thereby generating a second binding agent is administered with at least one chemothera EGFr gene copy number level; and peutic agent. 37. A method of determining the efficacy of a treatment in (d) comparing the first and second EGFr gene copy a patient, comprising: number levels, wherein a decrease in the EGFr gene copy number in the second EGFr gene copy number (a) determining the EGFr gene copy number in a first level relative to the first EGFr gene copy number level sample obtained from a patient to obtain a first EGFr indicates that the treatment is effective in the patient. gene copy number level; (b) administering the treatment to the patient;