Drug Metab. Pharmacokinet. 22 (2): SNP29 (136)SNP33 (140) (2007).
SNP Communication Three Novel Single Nucleotide Polymorphisms (SNPs) of CYP2S1 Gene in Japanese Individuals
Yoshiyuki HANZAWA1,2, TakamitsuS ASAKI1,2, Masahiro HIRATSUKA1,2, Masaaki ISHIKAWA2 and Michinao MIZUGAKI1,* 1Department of Clinical Pharmaceutics, Tohoku Pharmaceutical University, Sendai, Japan 2Department of Clinical Pharmacotherapeutics, Tohoku Pharmaceutical University, Sendai, Japan
Full text of this paper is available at http://www.jstage.jst.go.jp/browse/dmpk
Summary: We analyzed all nine exons and exonintron junctions of the CYP2S1 gene in 200 Japanese individuals and identied the following three novel single nucleotide polymorphisms (SNPs): 4612GÀA (Glu147Glu) in exon 3, 5478CÀT (Leu230Leu) and 5479TÀG (Leu230Arg, CYP2S1*5A)inexon5.The allele frequencies were 0.013 for 4612GÀA, 0.058 for 5478CÀT, and 0.003 for 5479TÀG. In addition, a known SNP 1324CÀG (Pro74Pro) was detected at a frequency of 0.300.
Key words: CYP2S1; genetic polymorphism; SNP
were detected in human skin, where CYP2S1 was shown Introduction to be induced by ultraviolet radiation, coal tar, and The cytochrome P450s (CYPs) constitute a large and alltrans retinoic acid.3,4) In the same study, CYP2S1 complex gene superfamily. Currently, 57 active CYP wasobservedtometabolizealltrans retinoic acid, genes and 58 pseudogenes are known to present in the indicating that CYP2S1 may be involved in the biotran human genome. Most of the CYP genes have the highest sformation of endogenous substrates important for cell expression in the liver, which plays a dominant role in proliferation and dierentiation.5) the clearance of foreign compounds. CYP enzymes also The human CYP2S1 gene has recently been shown metabolize many endogenous compounds important to be polymorphic; two amino acidchanging allelic for the maintenance of cellular homeostasis, such as variants CYP2S1*2 (10347CÀT; 13255AÀG) and steroids, retinoids, bile acids, fatty acids, and eicosa CYP2S1*3 (13106CÀT; 13255AÀG) have been noids. detected in Caucasians.6) CYP2S1 has been genetically Recently, a novel CYP gene, CYP2S1, has been analyzed in Caucasians but not in Japanese individuals. identied. The CYP2S1 gene is localized in the CYP2 In the present study, nine exons and exonintron gene cluster on chromosome 19q.13.2. Several studies junctionsoftheCYP2S1 gene from 200 Japanese that investigated the tissue distribution of human individuals were screened for genetic polymorphisms by CYP2S1 mRNA demonstrated that it has low expres using denaturing HPLC (DHPLC). We identied three sion levels in the liver but is detectable in extrahepatic novel single nucleotide polymorphisms of the CYP2S1 tissues such as those of the respiratory and digestive gene, including a nonsynonymous polymorphism, in systems.13) Furthermore, CYP2S1 mRNA and protein Japanese individuals. Materials and Methods As of December 1, 2006, these SNPs were not found in dbSNP in the National Center for Biotechnology Information (http:WWwww. Venous blood was obtained from 200 unrelated ncbi.nlm.nih.govWSNP W), GeneSNPs at the Utah Genome Center healthy Japanese volunteers and patients admitted to (http:WWwww.genome.utah.eduWgenesnpsW) or the Human CYP Allele TohokuUniversity Hospital. Written informed consent Nomenclature Committee database (http:WWwww.imm.ki.seW CYPallelesW). The CYP2S1 haplotype with 5479TÀG (Leu230Arg) was obtained from all the blood donors, and the study was assigned as CYP2S1*5A by the Human CYP Allele Nomenclature was approved by the Local Ethics Committee of Committee (http:WWwww.imm.ki.seWCYPallelesW). TohokuUniversity Hospital and TohokuPharmaceuti
Received; December 19, 2006, Accepted; February 13, 2007 *To whom correspondence should be addressed: Michinao MIZUGAKI, Department of Clinical Pharmaceutics, Tohoku Pharmaceutical University, 441, Komatsushima, Aobaku, Sendai 9818558, Japan. Tel. {81227270211, Fax. {817270149, Email: mizugakitohoku pharm.ac.jp
SNP29 (136) Novel SNPs in CYP2S1 Gene SNP30 (137)
Table 1. Amplication and DHPLC conditions for CYP2S1 SNP analysis of genomic DNA
Size Forward primer Reverse primer Annealing PCR DHPLC Exon (bp) (5? to 3?) (5? to 3?) Temp. (9C) cycles Temp. (9C)
1 247 gccgcgcggagcgcctggga ccaggacgtccccagagccc Slowdowna 70.055.0 63 65.8, 68.5 2 376 cttggatcgaagaggtcacagc ttgggatttcaggcactagcc 60.0 35 64.3
3 303 caacagagcgagattccgtctc agttttccctttcactcggctg 65.0 35 62.9
4 367 ctctctccctgcgctgtcc gagaagggcagctagttctcatgg 60.0 35 62.6
5 257 tcccatgagaactagctgcc caccatgcccattcagagag 60.0 30 64.7
6 336 taacttgtgtttccgaccccag ctcagcctcccaaagtgctg 65.0 35 59.2
7 436 acaagatgtgtggtctttgggc agaaaaagtcagggagacactgacag 60.0 35 63.0
8 485 tctctcacctcagcctcccac tcagtattcctcacacccaggc 60.0 35 60.5
9 342 tgaggaatactgactcagccctctc acactctggagacattaaccctgtcc 60.0 35 62.4 aSlowdown protocol: The annealing temperature was decreased after cycle 3 by 1.09C every 3 cycles, beginning at 709C and decreased to a ``slowdown'' annealing temperature of 559C, followed by 15 additional cycles with an annealing temperature of 609C. The PCR was used at a ramp rate of 2.59CWs and reached annealing temperature at 1.59CWs.
812) cal University. DNA was isolated from K2 EDTA USA). Amplied PCR samples (5 mL) were separat anticoagulated peripheral blood by using QIAamp ed on a heated C18 reversephase column (DNAsep})by DNA Mini Kits (Qiagen, Hilden, Germany) according using 0.1 M triethylammonium acetate (TEAA) in water to the manufacturer's instructions. and 0.1 M TEAA in 25z acetonitrile at a ow rate of Table 1 lists the primer pairs used to amplify nine 0.9 mLWmin. The software provided with the instru exons and exonintron junctions of the CYP2S1 gene. ment selected the temperature for the heteroduplex These primers were designed based on the genomic separation of a heterozygous CYP2S1 fragment. sequence reported in GenBank (NGä000008.7). The Table 1 summarizes the DHPLC running conditions for amplicons for exon 1 were generated using AmpliTaq each amplicon. The linear acetonitrile gradient was Gold PCR Master Mix (Applied Biosystems, Foster adjusted to the retention time of the DNA peak at City, CA, USA). PCR reactions were performed using 45 minutes. Homozygous nucleotide exchanges can an iCycler (BioRad, Hercules, CA, USA). Moreover, occasionally be detected due to a slight shift in the the method relied on a combination of the slowdown elution time as compared with that of the reference. The method and the addition of betaine (SigmaAldrich, addition of an approximately equal amount of wildtype St.Louis, MO) for this region with high GC content DNA to the samples (1:1) at the denaturation step (À70z).7) The PCR condition comprised denaturation enabled the reliable detection of homozygous altera at 959C for 5 minutes, followed by 48 cycles of tionsinexon2.Thiswasperformedforallsamplesin denaturation at 959C for 30 seconds, annealing for 30 order to identify homozygous sequence variations. seconds, extension at 729C for 40 seconds, and nally, Therefore, all samples were analyzed as follows. First, 15 additional cycles at an annealing temperature of equal amounts of four samples were mixed to identify 609C. The amplicons for each exon from 2 to 9 were the heterozygotes, and then, each sample was mixed generated using the AmpliTaq Gold PCR Master Mix. with wildtype DNA to detect the homozygous variants. The PCR conditions comprised denaturation at 959C The resultant chromatograms were compared with those for 10 minutes, followed by 30 or 35 cycles of of the wildtype DNA. denaturation at 959C for 30 seconds, annealing for 30 Both strands of samples in which variants were seconds, extension at 729C for 30 seconds, and a nal detected by DHPLC were analyzed using a CEQ8000} extension at 729C for 7 minutes. The annealing temper automated DNA sequencer (BeckmanCoulter Inc., atures and PCR cycles for the screening of CYP2S1 Fullerton, CA, USA). Further, we sequenced all variants are summarized in Table 1. Heteroduplexes samples having chromatographic ndings that diered were generated by performing thermal cycling as from that of the wildtype to establish links between follows: 959C for 1 minute, followed by a reduction in mutations and specic proles. We sequenced the PCR temperature from 959Cby45incrementsof1.59Cper products by uorescent dideoxy termination using a minute. DTCS DNA Sequencing Kit (BeckmanCoulter Inc.) The PCR products were analyzed using the DHPLC according to the manufacturer's instructions. system (WAVE}; Transgenomic Inc., Omaha, NE, SNP31 (138) Yoshiyuki HANZAWA, et al.
Table 2. The location of SNPs and frequencies of the CYP2S1 gene in 200 DNA samples of Japanese individuals
Amino acid SNP ID The number of Observed Frequency (z) Frequency (z)predicted Location Variant change dbSNP (NCBI) each genotype (95z CI) by HardyWeinberg law
Exon 2 1324CÀG Pro74Pro rs338599 CWC: 99 49.5 (42.656.4) 49.0 CWG: 82 41.0 (34.247.8) 42.0 GWG: 19 9.5 (5.413.6) 9.0
Exon 3 4612GÀA Glu147Glu GWG: 195 97.5 (95.399.7) 97.5 GWA: 5 2.5 (0.34.7) 2.5 AWA: 0 0.0 (0.0) 0.0
Exon 5 5478CÀT Leu230Leu CWC: 177 88.5 (84.192.5) 88.8 CWT: 23 11.5 (7.115.9) 10.8 TWT: 0 0.0 (0.0) 0.3
Exon 5 5479TÀG Leu230Arg TWT: 199 99.5 (98.5100) 99.5 TWG: 1 0.5 (01.5) 0.5 GWG: 0 0.0 (0.0) 0.0
Fig. 1. The nucleotide sequences of the CYP2S1 gene in exon 5. Although sequences are shown for antisense strands, both strands were sequenced. Arrows indicate the positions of the variant nucleotide.
chromatographic proles that were distinct from that of Results and Discussion the wildtype in exons 2, 3, and 5. We tested the specic We found the following three novel SNPs: ity of DHPLC in detecting the variant allele in these exons by comparing the results with those of direct 1) SNP: 061023Hiratsuka10; GENE NAME: sequencing. Four SNPs including three novel and one CYP2S1; known SNP (rs338599) were detected (Table 2). The ACCESSION NUMBER: NGä000008; LENGTH: 25 electrophoretograms of the novel nonsynonymous SNP bases; are shown in Fig. 1. The SNP in exon 5 was 5479TÀG 5?AGAAGGCGAGGAGWACTGATCCAGGCG3?. and resulted in an amino acid change of Leu230Arg. 2) SNP: 061023Hiratsuka11; GENE NAME: Among the 200 individuals, one was heterozygous for CYP2S1; the 5479TÀG SNP, suggesting that the allele frequency ACCESSION NUMBER: NGä000008; LENGTH: 25 was 0.003 in the Japanese population. The other novel bases; SNPs 4612GÀA and 5478CÀT were detected at 5?TTCCTGCGGCCCCWTTGCCAGGCCCCC3?. frequencies of 0.013 and 0.058, respectively. The se 3) SNP: 061023Hiratsuka12; GENE NAME: quences for each sample were obtained from at least two CYP2S1; dierent PCR amplications. ACCESSION NUMBER: NGä000008; LENGTH: 25 The novel SNP 5479TÀG is located in exon 5 of the bases; CYP2S1 gene and results in an amino acid substitution. 5?TCCTGCGGCCCCTWGGCCAGGCCCCCA3?. Homology modeling of the human CYP2 family DHPLC analysis of the CYP2S1 gene in the 200 DNA enzymes based on the CYP2C5 crystal structure lead to samples obtained from Japanese individuals revealed speculation that Leu230 is located at the start of the Novel SNPs in CYP2S1 Gene SNP32 (139)
Ghelix.13,14) In the CYP2 family, this region is not a P450 CYP2S1: individuality in regulation by therapeutic putative active site.15,16) However, the Pro227 substitu agents forpsoriasis and otherskin diseases. Lancet., tion of CYP2C19 (CYP2C19*10) in the same region has 361: 13361343 (2003). been clearly identied as being responsible for the 4) Guengerich, F. P., Wu, Z. L. and Bartleson, C. J.: decreased catalytic activity toward Smephenytoin.17) Function of human cytochrome P450s: characterization Pro220 was also one of several critical amino acids that of the orphans. Biochem. Biophys. Res. Commun., 338: 465469 (2005). appearto determinethe extent of the specicity of 5) Saarikoski, S. T., Rivera, S. P., Hankinson, O. and CYP2C19 for Smephenytoin as compared to that of HusgafvelPursiainen, K.: CYP2S1: A short review. 18) CYP2C9. Therefore, the start of the Ghelix and FG Toxicol. Appl. Pharmacol., 207: 6269 (2005). loop of the CYP2 family, including CYP2S1, might be 6) Saarikoski, S. T., Suitiala, T., Holmila, R., Impivaara, associated with enzyme activity. O., Jarvisalo, J., Hirvonen, A. and HusgafvelPursiai Numerous genetic polymorphisms have been identi nen, K.: Identication of genetic polymorphisms of edinmostCYP genes. In particular, genetic polymor CYP2S1 in a Finnish Caucasian population. Mutat. phisms of the CYP2 family are believed to be responsi Res., 554: 26777 (2004). ble for large individual variations. Saarikoski et al.have 7) Bachmann, H. S., Siert, W. and Frey, U. H.: Success detected two variant alleles CYP2S1*2 and CYP2S1*3 ful amplication of extremely GCrich promoter regions using a novel `slowdown PCR' technique. Phar in the CYP2S1 gene in the Caucasian population.6) macogenetics, 13: 759766 (2003). In the present study we identied the novel variant allele 8) Hiratsuka, M., Nozawa, H., Konno, Y., Saito, T., * CYP2S1 5A in the Japanese population. CYP2S1 could Konno, S. and Mizugaki, M.: Human CYP4B1 gene in be involved in the metabolism of alltrans retinoic acid, the Japanese population analyzed by denaturing HPLC. which is used to treat skin diseases. CYP2S1 expression Drug. Metab. Pharmacokinet., 19: 114119 (2004). was induced in some individuals treated topically with 9) Ebisawa, A., Hiratsuka, M., Sakuyama, K., Konno, Y., alltrans retinoic acid, whereas others showed no Sasaki, T. and Mizugaki, M.: Two novel single nucleo response.3) At least in part, such variation may be tide polymorphisms (SNPs) of the CYP2D6 gene in caused by sequence variations aecting expression or Japanese individuals. Drug. Metab. Pharmacokinet., 20: activity of CYP2S1. However, Wu et al. recently 294299 (2005). reported that CYP2S1 did not catalyze the oxidation of 10) Hiratsuka, M., Kudo, M., Koseki, N., Ujiie, S., alltrans retinoic acid at measurable rate. Further stu Sugawara,M.,Suzuki,R.,Sasaki,T.,Konno,Y.and Mizugaki, M.: A novel single nucleotide polymorphism dies on this point are being conducted in our laboratory. of the human methylenetetrahydrofolate reductase gene In conclusion, we identied three novel SNPs in the in Japanese individuals. Drug. Metab. Pharmacokinet., CYP2S1 gene, including a nonsynonymous polymor 20: 387390 (2005). phism in Japanese individuals. The nonsynonymous 11) Hiratsuka, M., Nozawa, H., Katsumoto, Y., Moteki, SNP was 5479TÀG in exon 5, and it resulted in an T., Sasaki, T., Konno, Y. and Mizugaki, M.: Genetic amino acid change of Leu230Arg. This SNP has been polymorphisms and haplotype structures of the assigned as CYP2S1*5A. CYP4A22 gene in a Japanese population. Mutat. Res., 599: 98104 (2006). Acknowledgements: This work was supported partly by 12) Sasaki, T., Goto, E., Konno, Y., Hiratsuka, M. and a GrantinAid for Research on Advanced Medical Mizugaki, M.: Three novel single nucleotide polymor Technology from the Ministry of Health, Labor and phisms of the human thiopurine Smethyltransferase gene in Japanese individuals. Drug. Metab. Pharmacoki Welfare of Japan and in part by HighTech Research net., 21: 332336 (2006). Center Program from the Ministry of Education, 13) Lewis, D. F.: Homology modelling of human CYP2 Culture, Sports, Science, and Technology of Japan. family enzymes based on the CYP2C5 crystal structure. References Xenobiotica, 32: 305323 (2002). 14) Johnson, E. F.: The 2002 Bernard B. Brodie Award 1) Rylander, T., Neve, E. P., IngelmanSundberg, M. and lecture: Deciphering substrate recognition by drug Oscarson, M.: Identication and tissue distribution of metabolizing cytochromes P450. Drug Metab. Dispos., the novel human cytochrome P450 2S1 (CYP2S1). 31: 15321540 (2003). Biochem. Biophys. Res. Commun., 281: 529535 (2001). 15) Lewis, D. F.: The CYP2 family: models, mutants and 2) Choudhary, D., Jansson, I., Stoilov, I., Sarfarazi, M. interactions. Xenobiotica, 28: 617661 (1998). and Schenkman, J. B.: Expression patterns of mouse 16) Gotoh, O.: Substrate recognition sites in cytochrome and human CYP orthologs (families 14) during de P450 family 2 (CYP2) proteins inferred from compara velopment and in dierent adult tissues. Arch. Biochem. tive analyses of amino acid and coding nucleotide Biophys., 436: 5061 (2005). sequences. J. Biol. Chem., 267: 8390 (1992). 3) Smith, G., Wolf, C. R., Deeni, Y. Y., Dawe, R. S., 17) Blaisdell, J., Mohrenweiser, H., Jackson, J., Ferguson, Evans,A.T.,Comrie,M.M.Ferguson,J.and S., Coulter, S., Chanas, B., Xi, T., Ghanayem, B. and Ibbotson, S. H.: Cutaneous expression of cytochrome Goldstein, J. A.: Identication and functional charac SNP33 (140) Yoshiyuki HANZAWA, et al.
terization of new potentially defective alleles of human Identication of human CYP2C19 residues that confer CYP2C19. Pharmacogenetics, 12: 703711 (2002). Smephenytoin 4?hydroxylation activity to CYP2C9. 18) Tsao, C. C., Wester, M. R., Ghanayem, B., Coulter, S. Biochemistry, 40: 19371944 (2001). J., Chanas, B., Johnson, E. F. and Goldstein, J. A.: