Mucin-1 Increases Renal TRPV5 Activity in Vitro, and Urinary Level Associates with Calcium Nephrolithiasis in Patients

CLINICAL RESEARCH www.jasn.org

Mucin-1 Increases Renal TRPV5 Activity In Vitro, and Urinary Level Associates with Calcium Nephrolithiasis in Patients

† ‡ Mingzhu Nie,* Manjot S. Bal,* Zhufeng Yang, Jie Liu,* Carolina Rivera,* Andrea Wenzel, ‡ † Bodo B. Beck, Khashayar Sakhaee,§ Denise K. Marciano, and Matthias T.F. Wolf*

*Pediatric Nephrology, †Nephrology, and §Charles and Jane Pak Center for Mineral Metabolism and Clinical Research, University of Texas Southwestern Medical Center, Dallas, Texas; and ‡Institute of Human Genetics, University of Cologne, Cologne, Germany

ABSTRACT Hypercalciuria is a major risk factor for nephrolithiasis. We previously reported that Uromodulin (UMOD) protects against nephrolithiasis by upregulating the renal calcium channel TRPV5. This channel is crucial for calcium reabsorption in the distal convoluted tubule (DCT). Recently, mutations in the gene encoding Mucin-1 (MUC1) were found to cause autosomal dominant tubulointerstitial kidney disease, the same disease caused by UMOD mutations. Because of the similarities between UMOD and MUC1 regarding associated disease phenotype, protein structure, and function as a cellular barrier, we examined whether urinary MUC1 also enhances TRPV5 channel activity and protects against nephrolithiasis. We established a semiquantitative assay for detecting MUC1 in human urine and found that, compared with controls (n=12), patients (n=12) with hypercalciuric nephrolithiasis had significantly decreased levels of urinary MUC1. Immunofluorescence showed MUC1 in the thick ascending limb, DCT, and collecting duct. Applying whole–cell patch-clamp recording of HEK cells, we found that wild-type but not disease mutant MUC1 increased TRPV5 activity by impairing dynamin-2– and caveolin-1–mediated endocytosis of TRPV5. Coim- munoprecipitation confirmed a physical interaction between TRPV5 and MUC1. However, MUC1 did not increase the activity of N-glycan–deficient TRPV5. MUC1 is characterized by variable number tandem repeats (VNTRs) that bind the lectin galectin-3; galectin-3 siRNA but not galectin-1 siRNA prevented MUC1-induced upregulation of TRPV5 activity. Additionally, MUC1 lacking VNTRs did not increase TRPV5 activity. Our results suggest that MUC1 forms a lattice with the N-glycan of TRPV5 via galectin-3, which impairs TRPV5 endocytosis and increases urinary calcium reabsorption.

J Am Soc Nephrol 27: 3447–3458, 2016. doi: 10.1681/ASN.2015101100

Nephrolithiasis is a common disorder with a life- Interestingly, the murine knockout of Uromo- 2 2 time risk of 10%–15%.1 Stone formation is caused dulin (Umod / ), the most abundant protein in by a sequence of events, including urinary super- saturation, crystal nucleation, growth, and finally, adhesion.2 Calcium is the most common constitu- Received October 7, 2015. Accepted February 24, 2016. ent of kidney stones.3 Hypercalciuria is the most M.N. and M.S.B. contributed equally to this work. fi signi cant contributing risk factor for the develop- Published online ahead of print. Publication date available at ment of nephrolithiasis, and it is detected in 35%–50% www.jasn.org. of patients with kidney stones.4 The determination of fi Correspondence: Dr.MatthiasT.F.Wolf,DivisionofPediatric the nal urinary calcium concentration occurs in the Nephrology, University of Texas Southwestern Medical Center, late distal convoluted tubule (DCT) and connecting 5323 Harry Hines Boulevard, Dallas, TX 75390-9063. Email: tubule via transcellular reabsorption by the renal cal- [email protected] – cium channel TRPV5.5 7 Copyright © 2016 by the American Society of Nephrology

J Am Soc Nephrol 27: 3447–3458, 2016 ISSN : 1046-6673/2711-3447 3447 CLINICAL RESEARCH www.jasn.org human urine, has hypercalciuria, renal calcium crystals, and MUC1 detection to a Western blot–based assay. Using a well calcifications.8 A genome–wide association study in humans published, monoclonal anti–MUC1 antibody (VU4H5),33–36 showed a protective effect of a specific UMOD allele against we detected a specific MUC1 band in cell lysate of human em- calcium–containing kidney stones.9 UMOD decreases the risk bryonic kidney 293 (HEK293) cells transfected with 42-TR of nephrolithiasis as a macromolecule with characteristics of MUC1 (Figure 1A). In human kidney lysate, we detected three inhibiting stone formation and by increasing the cell surface different bands at approximately 170, 260, and 300 kD (Figure abundance of the renal calcium channel TRPV5.2,10 Mutations 1A). Immunodepletion experiments identified the 170-kD band in UMOD result in autosomal dominant tubulointerstitial as unspecific, thus indicating that the two larger bands are kidney disease (ADTKD).11,12 MUC1. Their differing sizes are most likely caused by different Recently, Mucin-1 (MUC1) was described as another gene VNTRs in the maternally and paternally inherited MUC1 alleles that results in ADTKD.12,13 There are .20 different human (Figure 1B). Urine from a control subject (N1) and three indi- MUCs, which represent a family of large extracellular glycopro- viduals who were calcium stone formers (P1–P3) revealed teins that are involved in cell-cell and cell-matrix interactions.14–18 higher molecular weight for MUC1 compared with cell or kid- MUCs contribute to the formation of a mucus layer, protecting ney lysate (Figure 1). underlying mucosa in different organs.14,19,20 MUC1 contains an Serial dilutions of one individual’s urine done in triplicate N-terminal subunit consisting of the signal peptide, a variable showed that our Western blot–based assay detected urinary number tandem repeats (VNTR) domain, and a sea urchin sperm MUC1 within the linear dynamic range (Figure 2). To test if protein, enterokinase, and agrin domain.21,22 The MUC1-N sub- urinary MUC1 is decreased in hypercalciuric stone formers, unit is tethered to the cell surface by noncovalent binding to the we analyzed urine from calcium stone formers and control MUC1-C fragment, which contains short extracellular, trans- individuals semiquantitatively regarding MUC1. Clinical membrane, and cytoplasmic domains.21 The hallmark of MUCs characteristics of both groups are shown in Table 1. There is the VNTR domain. In MUC1, each tandem repeat (TR) was less MUC1 in the urine of hypercalciuric stone formers contains 20 amino acids.22 The MUC1 VNTR is heavily O-glycosylated and can range from 20 to 120 TRs, depending on the inherited maternal and paternal alleles. In the kidney, MUC1 is expressed in renal development and upregulated in renal cell carcinoma.23–26 Additionally, MUC1 protects against AKI.27 Oth- erwise, little is known about MUC1 in renal physiology. There are several similarities between UMOD and MUC1. Both proteins are membrane proteins and have protein-protein interacting domains. UMOD is a GPI–anchored membrane protein, whereas MUC1 is a cell membrane–associated protein.16,28 Parts of UMOD and MUC1 are both secreted. Al- though UMOD is cleaved at the C terminus of the protein and becomes the most abundant protein in human urine, MUC1 undergoes autoproteolysis within the sea urchin sperm protein, enterokinase, and agrin domain, and MUC1-N is released.21,29 UMOD and MUC1 both form polymers, thus contributing to a viscous, protective layer at the epithelial surface.16,18,30,31 When mutated, both proteins are retained within cells, contribute to cellular apoptosis, and result in ADTKD.13,32 Because of these similarities between UMOD and MUC1, we examined the hypothesis that urinary MUC1 is decreased in calcium stone formers and that MUC1 may protect against kidney stones by enhancing TRPV5 channel activity. Figure 1. MUC1 is expressed in human kidney and secreted in urine. (A) Compared with HEK293 cell lysate (control; lane 1), we RESULTS identified a clear MUC1 band in cell lysate from HEK293 cells transfected with an MUC1 plasmid containing 42 TRs, yielding a protein size of approximately 200 kD by Western blot. In lysate MUC1 Is Secreted in Human Urine and Decreased in from human kidneys, we detected three different bands at ap- Urine of Calcium Stone Formers proximately 170, 260, and .300 kD. Shown is MUC1 expression To study if urinary MUC1 concentration is decreased in in human urine from a healthy control (N1) and three patients with patients who are hypercalciuric and calcium stone formers, we hypercalciuric nephrolithiasis (P1–P3). (B) Immunodepletion of first tested different MUC1 ELISAs, which turned out to be human kidney lysate with MUC1 or control IgG shows the MUC1 unreliable. We, therefore, changed our approach for urinary antibody specificity (arrows).

3448 Journal of the American Society of Nephrology J Am Soc Nephrol 27: 3447–3458, 2016 www.jasn.org CLINICAL RESEARCH

Table 1. Characteristics of individuals who were hypercalciuric and control individuals studied Control Patients Who Were P Value Patients Hypercalciuric No. 12 12 NS Age, yr 48614 58621 NS Sex, women/men 7/5 7/5 NS No. of stones 0 .12 ,0.01 Urine Ca2+, mg/d 90643 3066122 ,0.001 pH 6.360.4 6.260.5 NS Volume, ml 13686697 21556752 ,0.05 Na+, mEq/d 1596125 164676 NS K+, mEq/d 56631 73636 NS Uric acid, mg/d 4186172 7016442 NS Creatinine, mg/d 12596572 14536775 NS Mg2+,mg/d 83647 130630 ,0.05 2 Cl , mEq/d 102622 148694 NS + NH4 , mEq/d 216934618 NS Citrate, mg/d 5986389 7466334 NS Phosphorus, mg/d 6986357 11116527 NS Oxalate, mg/d 27618 38611 NS Figure 2. Urinary MUC1 concentration can be analyzed semi- 22 SO4 , mmol/d 156823613 NS quantitatively by Western blot. (A) Three separate MUC1 dilution Serum experiments with increasingly less diluted urine from the same BUN, mg/dl 16621566NS control individual resulted in comparable results regarding MUC1 Creatinine, mg/dl 0.960.3 0.960.2 NS band density. (B) A linear function between the urine concen- Calcium, mg/dl 9.460.4 9.660.5 NS tration and the normalized MUC1 band density (diluted MUC1 Phosphorus, mg/dl 3.460.5 3.260.5 NS band/100% MUC1 band density) was found in the three different Uric acid, mg/dl 4.960.8 3.960.2 NS dilution experiments. PTH, pmol/L 70623 44618 NS Ca2+,calcium;Na+, sodium; K+, potassium; Mg2+,magnesium;Cl2,chloride; + 22 compared with that in control individuals (P,0.01), support- NH4 ,ammonium;SO4 , sulfate; PTH, parathyroid hormone. ing the notion that urinary MUC1 may protect against calcium nephrolithiasis (Figure 3). Despite some variability of (Figure 4, D and D9). Three-dimensional projection of a z stack urinary MUC1 molecular weight in controls and stone for- of confocal images revealed that lower levels of MUC1 were mers, there was no significant difference found between the found apically in tubules with basolateral Na+/K+ ATPase ex- two groups. pression, which represent TAL tubules (Figure 4E). Importantly, the expression of MUC1 in the apical membranes of DCT is MUC1 Is Expressed in Different Tubular Segments consistent with a possible role of MUC1 in regulation of Human renal MUC1 expression analyzed in situ and by im- TRPV5 channels, which are expressed at apical membranes in munohistochemistry was previously published about DCT late DCT and the connecting tubule.38 and collecting ducts (CDs), but a detailed assessment of its subcellular localization in vivo is not known.25,37 In patients MUC1 Upregulates TRPV5 Whole–Cell Current Density with ADTKD and MUC1 mutations, MUC1 localizes to apical in a Dose-Dependent Fashion and intracellular regions in the thick ascending limb (TAL), We tested our hypothesis that MUC1 regulates the renal DCT, and CD.13 We were interested in obtaining more detailed calcium channel TRPV5 by analyzing TRPV5 whole-cell information about tubular expression of wild-type (WT) current density in HEK293 cells transfected with control, MUC1 by using immunofluorescence imaging and nephron- WT MUC1, or mutant MUC1 (c.428dupC, a frameshift segment, specific markers (Figure 4). mutation found in patients with ADTKD).13,39 Coexpression Similar to UMOD, we detected MUC1 along apical mem- of TRPV5 and WT MUC1 increased TRPV5 current density by branes (Figure 4, A–C and E). Within the cortex, MUC1 local- approximately 100% compared with control. Mutant MUC1 ized to tubules expressing either Aquaporin 2 or NCC (Figure 4, expression did not change TRPV5 current density compared A–C), confirming their localization to cortical DCT and CD.25 with control (Figure 5A). The effect of MUC1 on TRPV5 MUC1 did not colocalize with the proximal tubule marker Lotus channel current density was dose dependent (Figure 5B). Ad- tetragonolobus lectin, showing that MUC1 is not present in the dition of anti-MUC1 antibody (targeting the VNTR) to the proximal tubule in basal conditions (Figure 4, C and C9). In the culture medium of cells cotransfected with TRPV5 and MUC1 medulla, MUC1 was expressed at high levels in medullary CDs blocked the effect of MUC1 to increase TRPV5 activity (Figure

J Am Soc Nephrol 27: 3447–3458, 2016 Mucin-1 Upregulates TRPV5 3449 CLINICAL RESEARCH www.jasn.org

TRPV5, we coimmunoprecipitated MUC1 (Figure 6B). Conversely, anti-MUC1 antibody was able to coimmunoprecipitate TRPV5 (Figure 6B). These experiments are consistent with a physical interaction between MUC1 and TRPV5.

MUC1 Increases TRPV5 Activity by Impairing Dynamin-2– and Caveolin- 1–Related Channel Endocytosis The identification of MUC1 in urine (Figures 1–3) and the ability of anti-MUC1 antibody added to culture medium to decrease MUC1– stimulated TRVP5 current density (Figure 5C) were consistent with an extracellular role of MUC1 in TRPV5 regulation. There- fore, we tested the hypothesis that MUC1 increases TRPV5 channel activity from the extracellular side. Similar to MUC1 cotransfected cells, TRPV5-expressing cells exposed to MUC1-containing supernatant had an increase in TRPV5 current density (Figure 7A). We attempted an approximation to show that the MUC1 level used in supernatant is close to a physiologically relevant concentration. Applying the same conditions as for the experiment shown in Figure 7A, in a Western blot assay, MUC1-containing supernatant from overexpressing cells yielded a band den- Figure 3. Urinary MUC1 is significantly decreased in calcium stone formers versus sity ranging between the band densities for controls. (A) The 24-hour urine samples from 12 controls and 12 hypercalciuric stone formers were compared semiquantitatively regarding urine MUC1 band density. (B) urinary MUC1 from calcium stone formers The urinary MUC1 band densities of control individuals and patients were analyzed. To and control individuals (Supplemental Figure compare multiple urine samples, even on different SDS gels, we determined an MUC1 3). The urine volume loaded represents the band ratio by dividing the patient’s urinary MUC1 band density by the MUC1 band urine output of approximately 1 second, thus density of a urine sample used repeatedly as standard on every SDS gel. Significantly emphasizing that control human urine lower urine MUC1 band ratios were found in hypercalciuric stone formers (ratio of contains a significant amount of MUC1. MUC1 band density: 0.860.15 for the control group versus 0.3460.07 for stone for- Previously published studies showed that mers; P,0.01). extracellular regulation of TRPV5 involves dynamin– and caveolin (Cav) –related con- – 5C). MUC1 did not alter TRPV5 stability or TRPV5 glycosyla- stitutive endocytosis of TRPV5.10,41 43 Therefore, we tested the tion patterns (Supplemental Figures 1 and 2). role of dynamin-2 in MUC1 regulation of TRPV5. TRPV5 current density was upregulated by MUC1 when cotransfected with WT MUC1 Is Expressed in a Wide Range of Cells and dynamin-2 (Figure 7B). Cells transfected with dominant negative Physically Interacts with TRPV5 dynamin-2, which impairs constitutive endocytosis, showed in- Because MUC1 is thought to be expressed on the apical surface of creased TRPV5 current density, even without MUC1 (Figure 7B). most secretory epithelia, we next examined how widely MUC1 is Stimulation with MUC1 did not result in any further increase of expressed.40 We performed real–time quantitative PCR of TRPV5 activity, suggesting that MUC1 increases TRPV5 by im- MUC1 in different cell lines ranging from fibroblasts to renal pairing dynamin-2–related endocytosis of TRPV5 (Figure 7B). cells in different species (Figure 6A). We detected endogenous This conclusion is further supported by experiments using dyna- MUC1 in most analyzed cell lines from mouse (fibroblasts sore, an inhibitor of dynamin GTPase activity and blocker of and IMCD3), rat (Nrk52e), dog (MDCK2), and humans dynamin-dependent endocytosis44 (Figure 7C). To study the in- (HEK293T and HeLa) in variable degrees. We then studied if volvement of Cav1, which is also involved in TRPV5 endocytosis, 2 2 MUC1 interacts physically with TRPV5. We performed coimmu- we cotransfected Cav1 / or WT fibroblasts with TRPV5 and noprecipitation experiments in HEK cells transfected with Flag- control or MUC1. Upregulation of TRPV5 by MUC1 was abro- 2 2 tagged TRPV5. Using anti-Flag to immunoprecipitate Flag-tagged gated in Cav1 / cells but not in WT cells (Figure 7D). Higher

3450 Journal of the American Society of Nephrology J Am Soc Nephrol 27: 3447–3458, 2016 www.jasn.org CLINICAL RESEARCH

increases TRPV5 activity in a galectin-1– dependent manner.42 We examined the effect of reduced galectin-1 levels using galectin-1 siRNA. We found that knockdown of galectin-1 had no effect on the MUC1- mediated increase in TRPV5 activity, indicating that galectin-1 is not required for MUC1 upregulation of TRPV5 (Figure 8B). Another possible candidate that emerged was galectin-3. Galectin-1 and -3 both com- prise part of large crosslinked complexes that form lattice networks.42,47 Galectin-3 medi- ates the upregulation of TRPV5 cell surface abundance by Klotho.48 Galectin-3 is also known to bind N-glycans.49 Moreover, Galectin-3 binds MUC1 via O-glycans of the VNTR.20,49–51 Therefore, we investigated whether galectin-3 may be a critical media- Figure 4. Muc1 is expressed along different nephron segments in mouse kidney. (A, B, tor of TRPV5 upregulation by MUC1. We B9,C,andC9) Muc1 immunostaining in the renal cortex. A shows the tubules at low found that reduction of galectin-3 by using magnification. Muc1 (green) localizes to (B and B9) tubules with Aquaporin 2 (AQ2; galectin-3 siRNA abrogated the increase in 9 red; a marker of the CDs) and (C and C ) tubules with NCC (red; a marker of DCTs) but TRPV5 current density mediated by MUC1 9 not with L. tetragonolobus lectin (LTL; blue; a marker of proximal tubules). (D, D ,and (Figure 8C). This provides strong evidence E) Within the outer and inner stripes of the outer medulla, Muc1 (green) is highly that galectin-3 is an important mediator of expressed in CDs (arrowheads in E; AQ2 is not shown here). Higher magnification of a three-dimensional (3D) projection of a z stack reveals that low levels of Muc1 also TRPV5 stimulation by MUC1. localize to medullary tubules containing basolateral Na+/K+ ATPase (red), which de- Because galectin-3 is known to bind pict TALs. Scale bars, 100 mminA,D,andD9;10mminB,B9,C,C9, and E. O-glycans of the MUC1 VNTRs, we next studied the importance of the MUC1 VNTR domain for TRPV5 activity. We com- 2 2 current density was expected for TRPV5 in Cav1 / cells, be- pared the effect of MUC1 with no repeats with that of MUC1 cause TRPV5 endocytosis is impaired. We think that the unex- with 42 repeats on the TRPV5 channel activity. TRPV5 current 2 2 pected lower current density in Cav1 / cells may be because density was increased by MUC1 containing 42 TRs but not by of a lower transfection efficiency in these cells. A similar pattern of MUC1 with zero TRs (Figure 8D). This shows that the VNTR 2 2 lower TRPV5 current in Cav1 / cells was seen in other publica- domain is critical for increasing TRPV5 current density by 2 2 tionsaswell.10,42 In Cav1 / cells, overexpression of recombinant MUC1 and indirectly implicates galectin-3 binding to O-glycans Cav1 but not control plasmid restored the upregulation of TRPV5 of the MUC1 VNTR as a possible mechanism by which MUC1 by MUC1, consistent with MUC1 increasing TRPV5 current and galectin-3 regulate TRPV5 activity. density in a Cav1-dependent fashion (Figure 7E).

MUC1 Requires TRPV5 N-Glycan and Galectin-3 for DISCUSSION Channel Upregulation Because MUC1 modifies TRPV5 current density from the We show MUC1 as a novel urinary modifier of the renal extracellular space and because the N-glycan of TRPV5 is required calcium channel TRPV5, thus providing a physiologic function for TRPV5 upregulation by UMOD, we tested if MUC1 requires for MUC1 in the kidney. Using in situ hybridization and im- the N-glycan of TRPV5 for upregulation of current density.10 munohistochemistry, MUC1 expression was previously Analyzing the effect of MUC1 on WT- and N-glycan–deficient shown in the DCT and CD.25,37 Using immunofluorescence TRPV5 (TRPV5N358Q), we found that N-glycan–deficient TRPV5 imaging, our data confirmed apical MUC1 expression in DCT was not stimulated by MUC1 in contrast to WT TRPV5 (Figure 8A). and CD and low levels in TALs (Figure 4E). WT and mutant Galectins are an ancient, ubiquitous family of lectins char- MUC1 were also shown in TALs by other groups.13,27 acterized by an evolutionary conserved, approximately 130- In our experiments, we show that MUC1 increases TRPV5 amino acid-long carbohydrate recognition domain that binds current density from the extracellular space. Upregulation of b-galactosides.45,46 Galectins include 15 members. Galectin-1 is TRPV5 current density by MUC1 is consistent with MUC1 the family prototype, containing one carbohydrate recognition expression in the TAL and DCT and MUC1 secretion into the domain and forming homodimers. Galectin-1 binds to the tubular lumen (Figures 1 and 4, C and E). Other previously TRPV5 N-glycan.42 Indeed, the antiaging hormone Klotho published urinary proteins regulating TRPV5 include tissue

J Am Soc Nephrol 27: 3447–3458, 2016 Mucin-1 Upregulates TRPV5 3451 CLINICAL RESEARCH www.jasn.org

and urine.48 It was previously shown that galectin-3 increases TRPV5 calcium uptake in an N-glycan–dependent fashion.48 Klotho and sialidase treatment also increased TRPV5 calcium uptake, whereas adding galectin-3 to these respective conditions did not have any additional effect, imply- ing that all three proteins activate TRPV5 in a similar fashion.48 We show that MUC1 interacts with TRPV5 and that galectin-3 is required for the upregulation of TRPV5 current by MUC1. Binding of galectin-3 via specific O-glycan modifications of the MUC1 VNTR region has been shown to be significant for progression of cancer and metastasis by causing MUC1 clustering on the cell surface.20,40,51,54–58 The galectin- 3toMUC1interactionisalsorelevantin other organ systems. On the surface of the eye, galectin-3 and MUC1 colocalize, and physical interaction between cell surface–associated MUC1 and galectin-3 occurs in a galactose-dependent fashion.20 Additional proof for significance of the galectin-3 to MUC1 interaction under Figure 5. MUC1 increases TRPV5 whole–cell current density in a dose-dependent physiologic conditions was published for fashion. (A) In HEK293 cells, coexpression with WT MUC1 increased the TRPV5 current MDCK cells.50 density (15656217 pA/pF; P,0.01) compared with control (740664 pA/pF) and Our data are consistent with a role of ADTKD–causing frameshift mutant (+C) MUC1 (8726111 pA/pF; NS; n=5 for each MUC1 in preventing calcium–containing group). (B) Cotransfection of increasing amounts of MUC1 plasmid resulted in in- kidney stones (Figure 3). We propose a creasingly higher TRPV5 current density (840689 pA/pF with 0.6 mg MUC1 versus model, in which galectin-3 interacts with 6 m , 560 79 pA/pF with 0 gMUC1,P 0.05; n=5 for each group). (C) MUC1 antibody the TRPV5 N-glycan and the VNTR of fi signi cantly decreased TRPV5 current density in TRPV5 and MUC1 cotransfected cells MUC1 then binds to galectin-3, thus stabi- (10576122 pA/pF for MUC1 versus 618644 pA/pF for MUC1 and anti-MUC1; lizing the TRPV5 N-glycan to galectin-3 in- P,0.01). Anti-MUC1 alone had no effect on TRPV5 current density (587664 pA/pF for control versus 523666 pA/pF for control and anti-MUC1; NS; n=5 for each group). teraction (Figure 9). Alternatively, MUC1 could directly bind to TRPV5, and galectin-3 is needed for connecting multiple kallikrein, Klotho, and UMOD.10,42,52 Tissue kallikrein MUC1 molecules. In each case, galectin-3 enables lattice for- activates the PLC/PKC signaling pathway by binding to bra- mation of TRPV5 channels and therefore, results in clustering dykinin 2 receptor, and Klotho and UMOD enable lattice for- of TRPV5 channels by impairing TRPV5 endocystosis (Figure mation of TRPV5 and inhibit TRPV5 endocytosis.10,52,53 We 9). This results in increased apical channel cell surface abun- show that the mechanism of MUC1-related upregulation of dance and increased urine calcium reabsorption, thus decreas- TRPV5 is similar but distinct from the molecular mechanisms ing the risk of calcium-containing stones. In contrast to the described for Klotho and UMOD. All three proteins work mechanisms by which Klotho enhances TRPV5 channel ac- from the extracellular space, impair TRPV5 endocytosis, and tivity, no additional sialidase activity was needed for the require the TRPV5 N-glycan for channel upregulation.10,42 MUC1 effect on TRPV5 current density. We cannot rule out For Klotho, a detailed molecular mechanism was deciphered that endogenous neuraminidases, which carry sialidase activ- in which Klotho functions as a specific a-2,6 sialidase, cleaving ity, may be required for the MUC1 effect, because there are specific terminal sialic acids from the channel N-glycan. This four different neuraminidases in humans that were also iden- allows galectin-1 to bind to the underlying disaccharide galac- tified in human urine.59 Larger trials will be needed to confirm tose-N-acetylglucosamine, thus enabling lattice formation the usefulness of urinary MUC1 as a biomarker for increased and impairing channel endocytosis. In contrast, MUC1 re- risk of calcium nephrolithiasis. Our data show that MUC1 is a quires galectin-3 for TRPV5 upregulation (Figure 8C). Con- component of a urinary network of proteins that modify tu- sistent with our data, galectin-3 is expressed in murine DCT bular channels, such as TRPV5.

3452 Journal of the American Society of Nephrology J Am Soc Nephrol 27: 3447–3458, 2016 www.jasn.org CLINICAL RESEARCH

Cell Culture and Transfection HEK293 cells were cultured as described pre- 2 2 viously.41 WT and Cav1 / ﬁbroblasts were cultured as reported earlier.10 Cells were transiently cotransfected with cDNA for WT or N-glycan– deﬁcient (N358Q) GFP-TRPV5 plus cDNA for WT MUC1, mutant MUC1, MUC1 zero TRs, MUC1 42 TRs, WT dynamin-2, dominant negative (K44A) mutant of dynamin-2, or Cav1 as outlined elsewhere.10 When not otherwise men- tioned, we used the MUC1 construct containing six TRs as the WT. If not otherwise documented, 1 mg MUC1 plasmid DNA was used for transfection. Cells were transfected using Lipofectamine 2000 (Life Technologies, Carlsbad, CA) as per the manufacturer’s protocol. In each experiment, the total amount of plasmid DNA for transfection was balanced by empty vector. For galectin-1 and galectin-3 siRNA (Dharmacon, Lafayette, CO), we transfected 40 and 20 nmol siRNA, respectively.

Electrophysiologic Recordings Whole–cell patch-clamp pipettes were pulled from borosilicate glass (Dagan Corporation, Minneapolis, MN) and had resistance between Figure 6. MUC1 is abundantly expressed and binds physically to TRPV5. (A) MUC1 1.5 and 3 MV. Pipette and bath solutions were mRNA is endogenously expressed in multiple cell lines. We identified MUC1 mRNA in a used as described earlier.10 Current densities range of different cell lines from a variety of species using quantitative RT-PCR. En- dogenous MUC1 was strongly detected in MDCK2, IMCD3, and fibroblast (FB) cells, and were obtained by normalizing current ampli- 2 to a lower degree, also detected in HEK293T cells. A very small amount of MUC1 mRNA tude (obtained at 150 mV) to cell capacitance. was found in HeLa and Nrk52e cells. (B) MUC1 binds TRPV5 channel. HEK293 cells were Whole-cell recordings were obtained with a transiently transfected with MUC1 and TRPV5-Flag. The antibody used for immunopre- low-pass filter set at 2 kHz using an eight–pole cipitation is shown above each panel (coimmunoprecipitation [CoIP]). Immunoprecipitated Bessel filter in the clamp amplifier. Data were proteins were identified using Western blotting (WB) and specific antibodies as shown on sampled every 0.1 ms with a Digidata-1440A the left. Cell lysate is shown at the left of each immunoprecipitation experiment. MUC1 is Interface. detected with precipitation of the MUC1-TRPV5 complex using anti-Flag antibody (lane 3), and TRPV5 is detected using anti-MUC1 antibody for precipitation (lane 6). Quantitative Real–Time PCR Cell lysate was obtained from the following cells: CONCISE METHODS fibroblasts (mouse), IMCD3 (mouse), MDCK2 (dog), Nrk52e (rat), HEK293 (human), and HeLa cells (human). Total RNAwas extracted Materials and DNA Constructs using the Quick-RNA MicroPrep Reagent (ZYMO Research, Irvine, MUC1 plasmids containing zero and 42 TRs were obtained from O. J. CA), and 1 mg total RNA was used for cDNA synthesis with random Finn (University of Pittsburgh, Pittsburgh, PA). Mutant MUC1 primers using the iScript Select cDNA Synthesis Kit (Bio-Rad, Hercules, plasmid was provided by B. Beck (University of Cologne, Cologne, CA). Relative transcript expression levels were measured by quantitative Germany). Mutant MUC1 was constructed containing three VNTRs. real–time PCR using iTaq Universal SYBR Green Supermix (Bio-Rad). The cytosine insertion was cloned into the second VNTR, thus SampleswererunontheCFX96Real-TimePCRDetectionSystem(Bio- resulting in formation of the neoprotein, including the third VNTR. Rad). b-Actin was used for inner control. The following primer sequences WT MUC1 containing six TRs and mutant MUC1 containing the were used: for cells from mouse: mMuc1-PF-ATGAGGAGGTTTCGG- insertion of a cytosine were cloned into pCEP4. GFP-tagged TRPV5 CAGGTAA and mMuc1-PR-GGGTGGGGTGACTTGCTCCT (expected contains the coding region of TRPV5 cloned in frame to commercial size =101 bp), mACTB-qPF-TAAAACCCGGCGGCGCA and mACTB- pEGFP-N3 vector.41 The well published mouse anti–MUC1 qPR-CATTCCCACCATCACACCCTGG (expected size =248 bp); for cells (VU4H5) antibody was purchased from Santa Cruz Biotechnology from rat: rMuc1-PF-TCCAAGTCAGCAGCCCATCTC and rMuc1- (Santa Cruz, CA). Anti-Flag antibody was purchased from Sigma- PR-AAGGAGACCCCGACAGACAAC (expected size 141 bp); Aldrich(St.Louis,MO).TheGFP–tagged TRPV5 WT and N358Q rACTB-qPF- CCACCCGCGAGTACAACCTTC and rACTB-qPR- mutant constructs have been described in detail.42 CATCCATGGCGAACTGGTGGC (expected size =72 bp); for cells

J Am Soc Nephrol 27: 3447–3458, 2016 Mucin-1 Upregulates TRPV5 3453 CLINICAL RESEARCH www.jasn.org

from dog: dMuc1-PF-TCCCAGCAGCAACTAC- TACCA and dMuc1-PR-GCATCAGTGG- CACCATTTCGG (expected size =162 bp); dACTB-qPF-TCTTGGGTGTTGGGGAGAAGG and dACTB-qPR- AGGCCAGTACCCATAAT- TCCCC (expected size =142 bp); and for human cell lines: hMUC1-PF-CTGCCAACTTGTAGGGG- CAC and hMUC1-PR- CCGAGAAATTGGTGG GGCCT (expected size =170 bp); hACTB-qPF- GAGCACAGAGCCTCGCCTTT and hACTB- qPR-TCATCCATGGTGAGCTGGCG (expected size =67 bp).

Glycosylation Analyses HEK293 cells were transfected with TRPV5 and control or TRPV5 and MUC1. Cell pellets were harvested, and lysates were treated by Endoglyco- sidase H and N-Glycosidase F (PNGase F) following the manufacturer’s instructions (New England Biolabs, Ipswich, MA). Ten micrograms each protein sample was denatured at 65°C for 10 minutes; 103reaction buffer (10% NP-40 needed to be added for the PNGase F reaction) and 1000 U En- doglycosidase H, PNGase F, or equal volume of water (in the control reaction) were added to the 40-mlreactionandincubatedat37°Cfor1hour. Then, 23 Laemmli sample buffer was added into each reaction. Samples were analyzed by immunoblotting.

Protein Stability Analyses HEK293 cells were transfected with TRPV5 and control or TRPV5 and MUC1. Cells were – Figure 7. MUC1 upregulates TRPV5 from the extracellular space and impairs dynamin-2 harvested at 24, 48, and 72 hours. Cells were – and Cav1 dependent TRPV5 endocytosis. (A) MUC1 increases TRPV5 current density lysed in RIPA buffer; 23 Laemmli sample buffer 6 from the extracellular space. Cells cotransfected with MUC1 (410 80 pA/pF and control was added to each sample. Samples were dena- versus 1186697 pA/pF and MUC1; P,0.0005) as well as TRPV5 transfected cells ex- tured at 65°C for 10 minutes. Equal amounts of posed to MUC1-containing supernatant show increased TRPV5 current density (5266102 pA/pF and control supernatant versus 1072696 pA/pF and MUC1 supernatant; protein samples were analyzed by immunoblot- P,0.005), confirming extracellular upregulation of TRPV5 by MUC1. (B) MUC1 increases ting. TRPV5 activity by impairing dynamin-2–dependent endocytosis of the channel. Whereas cells transfected with WT dynamin-2 showed the expected upregulation of TRPV5 cur- 2 2 rent density with MUC1 (for WT dynamin-2: 462653 pA/pF and control versus 940651 (Cav1 / ) displayed no further increase of pA/pF and MUC1; P,0.0001), cells transfected with dominant negative dynamin-2 dis- TRPV5 activity when cotransfected with MUC1 2 2 played increased TRPV5 current density at baseline, indicating constitutive TRPV5 en- (Cav1 / cells: 490631 pA/pF and control docytosis by dynamin-2. In these cells, no additional increase of TRPV5 activity was versus 541643 pA/pF and MUC1; NS), in- noticed with MUC1 (for dominant negative dynamin-2: 937641 pA/pF and control versus dicating that TRPV5 upregulation by MUC1 1043633 pA/pF and MUC1), indicating that TRPV5 upregulation by MUC1 occurs by occurs by impairing Cav1-dependent endo- impairing dynamin-2–dependent endocytosis. (C) Confirmation of MUC1 upregulation of cytosis. (E) TRPV5 upregulation by MUC1 in 2 2 TRPV5 by impairing dynamin–dependent TRPV5 endocytosis using dynasore. Using the Cav1 / cells is rescued by cotransfection of dynamin GTPase inhibitor dynasore, which blocks dynamin-dependent endocytosis, we Cav1. Forced overexpression of Cav1 but not confirmed the lack of MUC1 effect on TRPV5 current density (no dynasore: 515657 pA/ control plasmid restored the ability of TRPV5 pF and control versus 904647 pA/pF and MUC1; P,0.001; plus dynasore: 887637 pA/ upregulation by MUC1 (no Cav1: 558661 pA/ pF and control versus 959668 pA/pF and MUC1; NS). (D) MUC1 increases TRPV5 activity pF and control versus 598653 pA/pF and by impairing Cav1-dependent endocytosis of the channel. Whereas WT fibroblasts MUC1; NS; with Cav1: 496625 pA/pF and showed the expected upregulation of TRPV5 current density with MUC1 (WT cells: 7016 control versus 935636 pA/pF and MUC1; 37 pA/pF and control versus 11786109 pA/pF and MUC1; P,0.01), Cav1-deficient cells P,0.001; n=5 for each group).

3454 Journal of the American Society of Nephrology J Am Soc Nephrol 27: 3447–3458, 2016 www.jasn.org CLINICAL RESEARCH

Figure 8. MUC1 upregulation of TRPV5 requires the TRPV5 N-glycan and galectin-3. (A) The N-glycan of TRPV5 is required for upregulation by MUC1. WT TRPV5 responded to MUC1 cotransfection (WT TRPV5: 648645 pA/pF and control versus 958614 pA/pF and MUC1; P,0.001), whereas N-glycan–deficient (N358Q) TRPV5 did not react to MUC1 stimulation (N358Q TRPV5: 578690 pA/pF and control versus 728664 pA/pF and MUC1; NS). (B) Galectin-1 is not required for TRPV5 upregulation by MUC1. Knockdown of galectin-1 using siRNA did not impair the response of TRPV5 current density to MUC1 (control siRNA: 270646 pA/pF and control versus 769665 pA/pF and MUC1; P,0.001; galectin-1 siRNA: 393665 pA/pF and control versus 920677 pA/pF and MUC1; P,0.005). Using Western blotting, knockdown of galectin-1 is shown in the upper right panel. Quantification of the galectin-1 knockdown by densitometry shows a reduction of 80%. (C) Knockdown of galectin-3 abrogates upregulation of TRPV5 current density by MUC1 (control siRNA: 341637 pA/pF and control versus 770652 pA/pF and MUC1; P,0.0001; galectin-3 siRNA: 372653 pA/pF and control versus 364672 pA/pF and MUC1; NS). Using Western blotting, knockdown of galectin-3 is shown in the upper right panel. Quantification of the galectin-3 knockdown by densitometry shows a reduction of 70% (D) MUC1 lacking VNTR is not able to upregulate TRPV5 current density (711623 pA/pF and control versus 681668 pA/pF and zero-TR MUC1; NS) in contrast to MUC1 containing 42 TRs (1207649 pA/pF and 42-TR MUC1; P,0.0005; n=5 for each group).

Coimmunoprecipitation, Immunoblotting, and Cells were collected and lysed using a needle syringe. The protein con- Immunodepletion centration in the cell lysate was determined using protein assay (DC HEK293 cells were cotransfected with 42-TR MUC1 and Flag-tagged Protein Assay; Bio-Rad). Samples were adjusted to the same concentra- TRPV5 using Lipofectamine 2000 and incubated for 48 hours at 37°C. tion with buffer. Samples were resolved on a 4%–20% gradient gel and

J Am Soc Nephrol 27: 3447–3458, 2016 Mucin-1 Upregulates TRPV5 3455 CLINICAL RESEARCH www.jasn.org

corrected for total creatinine. Urine was denatured at 65°C for 15 minutes and loaded on an SDS gel with 43 sample buffer. To obtain a comparable number, an individual ratio for each resulting MUC1 band was determined by dividing the MUC1 band density by a standardized sample. The resulting ratios were compared for control and hypercalciuric stone formers. Age, sex, and degree of hypercalciuria were reviewed and are distributed as shown in Table 1.

Immunofluorescence Staining Male WT mice were fed a regular diet and eu- thanized at the age of 3 months. Anesthetized micewereperfusedwithparaformaldehyde,andthe kidneys were harvested and embedded in paraffin. Sections were deparaffinized, and antigen retrieval was performed (Trilogy; Cell Marque). Sections Figure 9. Model of TRPV5 channel upregulation by urinary MUC1. MUC1 is secreted in were blocked with 10% donkey sera in PBS, and the ultrafiltrate along the TAL and the distal nephron. In the DCT and connecting tubule, immunofluorescence was performed with Muc1 urinary MUC1 binds to the N-glycan of TRPV5 (shown in the boxed area). Two different antibody (1:50; Thermo Scientific, Pittsburgh, PA) scenarios are possible. Either galectin-3 binds to the TRPV5 N-glycan, and MUC1 sta- overnight at 4°C. Fluorescence images were ob- bilizes the binding by binding galectin-3 via the O-glycans of the MUC1 VNTR, or MUC1 tained using a Zeiss Axioplan 2 Microscope (Carl may bind directly to TRPV5 N-glycans, and galectin-3 is needed for aggregation of Zeiss GmbH, Jena, Germany) with a Zeiss Axio- multiple MUC1 molecules via the O-glycans of the MUC1 VNTR. In both situations, Cam MRc Camera (Carl Zeiss GmbH) or a Zeiss galectin-3 enables lattice formation of TRPV5 because of MUC1, which impairs TRPV5 LSM510 Confocal Microscope (Carl Zeiss GmbH). endocytosis and increases TRPV5 cell surface abundance (shown in the box). Allanimalexperimentswereperformedincompli- ance with relevant laws and institutional guidelines processed for immunblotting using specific antibodies. For experiments, and approved by the University of Texas Southwestern Medical Center at we used 700 mg cell lysate for coimmunoprecipitation, using 3 mganti- Dallas Institutional Animal Care and Use Committee. Flag or anti-MUC1 antibodies overnight. Species–specificanti–IgG (Santa Cruz Biotechnology) was used as control. Antigen-antibody complex was ACKNOWLEDGMENTS then loaded onto Protein G Beads (GE Healthcare, Waukesha, WI) by slow rotation overnight. The antibody-loaded beads were then washed. Sample WethankDr.O.J.FinnforsharingMucin-1plasmidscontaining0and42 buffer was added, and proteins were denatured at 65°C for 10 minutes. tandem repeats. We are grateful to Beverley Huet for support with sta- Samples were then subjected to SDS-PAGE and immunoblotting. For tisticalanalysis.WearethankfultoPaulettePadalinoandJohnPoindexter immunodepletion, human kidney lysate was incubated with either anti- for support regarding clinical data on patients with stones. We highly IgG or anti-MUC1 for 5 hours. Antigen-antibody complexes were pulled appreciate the scientific input from Drs. M. Baum, V. Patel, and down with Protein G Beads. The same volume of MUC1-depleted super- A. Rodan. natant was then visualized on an SDS gel with immunoblotting. This work was supported, in whole or in part, by National Institutes of Health grants R01DK009478 (to D.K.M.) and K08DK95994-04 (to Urine Collection of Control Patients and Patients Who M.T.F.W.), the March of Dimes Basil O’Connor (to D.K.M.), the Carl Were Hypercalciuric and Had Kidney Stones W. Gottschalk Research Scholar Grant from the American Society of In collaboration with the Charles and Jane Pak Center for Mineral Nephrology (to M.T.F.W.), and the Children’s Clinical Research Advi- Metabolism and Clinical Research, we obtained samples from 24-hour sory Committee, Children’s Health System (Dallas, TX; to M.T.F.W.). urine collections. Urine was collected from 12 patients who were hypercalciuric and had kidney stones and 12 control patients. Patients DISCLOSURES who were hypercalciuric were selected among those without established None. diagnosis of primary hyperparathyroidism, distal renal tubular acidosis, chronicdiarrhealconditions,andrepeatedurinarytractinfections.None ofthepatientsreceivedtreatmentwiththiazidediuretic,thiazideanalogs, REFERENCES alkali treatment, or allopurinol. Informed consent was obtained in – fi adherence to the project speci c institutional review board (STU 1. Sakhaee K, Maalouf NM, Kumar R, Pasch A, Moe OW: Nephrolithiasis- 022014–055; University of Texas Southwestern Medical Center). Be- associated bone disease: Pathogenesis and treatment options. Kidney cause of widely differing urine volume (Table 1), urine specimen was Int 79: 393–403, 2011

3456 Journal of the American Society of Nephrology J Am Soc Nephrol 27: 3447–3458, 2016 www.jasn.org CLINICAL RESEARCH

2. Kumar V, Lieske JC: Protein regulation of intrarenal crystallization. Curr 20. Argüeso P, Guzman-Aranguez A, Mantelli F, Cao Z, Ricciuto J, Panjwani Opin Nephrol Hypertens 15: 374–380, 2006 N: Association of cell surface mucins with galectin-3 contributes to the 3. Moe OW, Pearle MS, Sakhaee K: Pharmacotherapy of urolithiasis: Ev- ocular surface epithelial barrier. JBiolChem284: 23037–23045, 2009 idence from clinical trials. Kidney Int 79: 385–392, 2011 21. Macao B, Johansson DG, Hansson GC, Härd T: Autoproteolysis cou- 4. Frick KK, Bushinsky DA: Molecular mechanisms of primary hyper- pled to protein folding in the SEA domain of the membrane-bound calciuria. JAmSocNephrol14: 1082–1095, 2003 MUC1 mucin. Nat Struct Mol Biol 13: 71–76, 2006 5. Costanzo LS, Windhager EE, Ellison DH: Calcium and sodium transport 22. Hanisch FG, Müller S: MUC1: The polymorphic appearance of a human by the distal convoluted tubule of the rat. 1978. JAmSocNephrol11: mucin. Glycobiology 10: 439–449, 2000 1562–1580, 2000 23. Fanni D, Iacovidou N, Locci A, Gerosa C, Nemolato S, Van Eyken P, 6. Hoenderop JG, van Leeuwen JP, van der Eerden BC, Kersten FF, van der Monga G, Mellou S, Faa G, Fanos V: MUC1 marks collecting tubules, Kemp AW, Mérillat AM, Waarsing JH, Rossier BC, Vallon V, Hummler E, renal vesicles, comma- and S-shaped bodies in human developing Bindels RJ: Renal Ca2+ wasting, hyperabsorption, and reduced bone kidney tubules, renal vesicles, comma- and s-shaped bodies in human thickness in mice lacking TRPV5. J Clin Invest 112: 1906–1914, 2003 kidney. Eur J Histochem 56: e40, 2012 7. Topala CN, Bindels RJ, Hoenderop JG: Regulation of the epithelial 24. Kraus S, Abel PD, Nachtmann C, Linsenmann HJ, Weidner W, Stamp calcium channel TRPV5 by extracellular factors. Curr Opin Nephrol GW, Chaudhary KS, Mitchell SE, Franke FE, Lalani N: MUC1 mucin and Hypertens 16: 319–324, 2007 trefoil factor 1 protein expression in renal cell carcinoma: Correlation 8. Liu Y, Mo L, Goldfarb DS, Evan AP, Liang F, Khan SR, Lieske JC, Wu XR: with prognosis. Hum Pathol 33: 60–67, 2002 Progressive renal papillary calcification and ureteral stone formation in 25. Leroy X, Copin MC, Devisme L, Buisine MP, Aubert JP, Gosselin B, mice deficient for Tamm-Horsfall protein. Am J Physiol Renal Physiol Porchet N: Expression of human mucin genes in normal kidney and 299: F469–F478, 2010 renal cell carcinoma. Histopathology 40: 450–457, 2002 9. Gudbjartsson DF, Holm H, Indridason OS, Thorleifsson G, Edvardsson 26. Leroy X, Zerimech F, Zini L, Copin MC, Buisine MP, Gosselin B, Aubert V, Sulem P, de Vegt F, d’Ancona FC, den Heijer M, Wetzels JF, Franzson JP, Porchet N: MUC1 expression is correlated with nuclear grade and L, Rafnar T, Kristjansson K, Bjornsdottir US, Eyjolfsson GI, Kiemeney LA, tumor progression in pT1 renal clear cell carcinoma. Am J Clin Pathol Kong A, Palsson R, Thorsteinsdottir U, Stefansson K: Association of 118: 47–51, 2002 variants at UMOD with chronic kidney disease and kidney stones-role of 27. Pastor-Soler NM, Sutton TA, Mang HE, Kinlough CL, Gendler SJ, age and comorbid diseases. PLoS Genet 6: e1001039, 2010 Madsen CS, Bastacky SI, Ho J, Al-Bataineh MM, Hallows KR, Singh S, 10. Wolf MT, Wu XR, Huang CL: Uromodulin upregulates TRPV5 by im- Monga SP, Kobayashi H, Haase VH, Hughey RP: Muc1 is protective pairing caveolin-mediated endocytosis. Kidney Int 84: 130–137, 2013 during kidney ischemia-reperfusion injury. Am J Physiol Renal Physiol 11. Hart TC, Gorry MC, Hart PS, Woodard AS, Shihabi Z, Sandhu J, Shirts B, 308: F1452–F1462, 2015 Xu L, Zhu H, Barmada MM, Bleyer AJ: Mutations of the UMOD gene are 28. Rampoldi L, Scolari F, Amoroso A, Ghiggeri G, Devuyst O: The redis- responsible for medullary cystic kidney disease 2 and familial juvenile covery of uromodulin (Tamm-Horsfall protein): From tubulointerstitial hyperuricaemic nephropathy. JMedGenet39: 882–892, 2002 nephropathy to chronic kidney disease. Kidney Int 80: 338–347, 2011 12. Eckardt KU, Alper SL, Antignac C, Bleyer AJ, Chauveau D, Dahan K, 29. Santambrogio S, Cattaneo A, Bernascone I, Schwend T, Jovine L, Bachi Deltas C, Hosking A, Kmoch S, Rampoldi L, Wiesener M, Wolf MT, A, Rampoldi L: Urinary uromodulin carries an intact ZP domain gener- Devuyst O: Autosomal dominant tubulointerstitial kidney disease: Di- ated by a conserved C-terminal proteolytic cleavage. Biochem Biophys agnosis, classification, and management–A KDIGO consensus report. Res Commun 370: 410–413, 2008 Kidney Int 88: 676–683, 2015 30. Kufe DW: Mucins in cancer: Function, prognosis and therapy. Nat Rev 13. Kirby A, Gnirke A, Jaffe DB, Barešová V, Pochet N, Blumenstiel B, Ye C, Cancer 9: 874–885, 2009 Aird D, Stevens C, Robinson JT, Cabili MN, Gat-Viks I, Kelliher E, Daza R, 31. Schaeffer C, Santambrogio S, Perucca S, Casari G, Rampoldi L: Analysis DeFelice M, Hůlková H, Sovová J, Vylet’al P, Antignac C, Guttman M, of uromodulin polymerization provides new insights into the mecha- Handsaker RE, Perrin D, Steelman S, Sigurdsson S, Scheinman SJ, nisms regulating ZP domain-mediated protein assembly. MolBiolCell Sougnez C, Cibulskis K, Parkin M, Green T, Rossin E, Zody MC, Xavier RJ, 20: 589–599, 2009 Pollak MR, Alper SL, Lindblad-Toh K, Gabriel S, Hart PS, Regev A, 32. Rampoldi L, Caridi G, Santon D, Boaretto F, Bernascone I, Lamorte G, Nusbaum C, Kmoch S, Bleyer AJ, Lander ES, Daly MJ: Mutations causing Tardanico R, Dagnino M, Colussi G, Scolari F, Ghiggeri GM, Amoroso medullary cystic kidney disease type 1 lie in a large VNTR in MUC1 missed A, Casari G: Allelism of MCKD, FJHN and GCKD caused by impairment by massively parallel sequencing. Nat Genet 45: 299–303, 2013 of uromodulin export dynamics. Hum Mol Genet 12: 3369–3384, 2003 14. Etzold S, Juge N: Structural insights into bacterial recognition of in- 33. Cascio S, Zhang L, Finn OJ: MUC1 protein expression in tumor cells testinal mucins. Curr Opin Struct Biol 28: 23–31, 2014 regulates transcription of proinflammatory cytokines by forming a com- 15. Corfield AP: Mucins: A biologically relevant glycan barrier in mucosal plex with nuclear factor-kB p65 and binding to cytokine promoters: Im- protection. Biochim Biophys Acta 1850: 236–252, 2015 portance of extracellular domain. JBiolChem286: 42248–42256, 2011 16. Hollingsworth MA, Swanson BJ: Mucins in cancer: Protection and 34. Suzuki Y, Sutoh M, Hatakeyama S, Mori K, Yamamoto H, Koie T, Saitoh control of the cell surface. Nat Rev Cancer 4: 45–60, 2004 H, Yamaya K, Funyu T, Habuchi T, Arai Y, Fukuda M, Ohyama C, Tsuboi 17. Jonckheere N, Skrypek N, Frénois F, Van Seuningen I: Membrane-bound mucin S: MUC1 carrying core 2 O-glycans functions as a molecular shield modular domains: From structure to function. Biochimie 95: 1077–1086, 2013 against NK cell attack, promoting bladder tumor metastasis. Int J Oncol 18. Hattrup CL, Gendler SJ: Structure and function of the cell surface 40: 1831–1838, 2012 (tethered) mucins. Annu Rev Physiol 70: 431–457, 2008 35. Jung SE, Seo KY, Kim H, Kim HL, Chung IH, Kim EK: Expression of 19. Roy MG, Livraghi-Butrico A, Fletcher AA, McElwee MM, Evans SE, MUC1 on corneal endothelium of human. Cornea 21: 691–695, 2002 Boerner RM, Alexander SN, Bellinghausen LK, Song AS, Petrova YM, 36. Engelstaedter V, Heublein S, Schumacher AL, Lenhard M, Engelstaedter H, Tuvim MJ, Adachi R, Romo I, Bordt AS, Bowden MG, Sisson JH, Andergassen U, Guenthner-Biller M, Kuhn C, Rack B, Kupka M, Mayr D, Woodruff PG, Thornton DJ, Rousseau K, De la Garza MM, Moghaddam Jeschke U: Mucin-1 and its relation to grade, stage and survival in ovarian SJ, Karmouty-Quintana H, Blackburn MR, Drouin SM, Davis CW, Terrell carcinoma patients. BMC Cancer 12: 600, 2012 KA, Grubb BR, O’Neal WK, Flores SC, Cota-Gomez A, Lozupone CA, 37. Cao Y, Karsten U, Zerban H, Bannasch P: Expression of MUC1, Thomsen- Donnelly JM, Watson AM, Hennessy CE, Keith RC, Yang IV, Barthel L, Friedenreich-related antigens, and cytokeratin 19 in human renal cell Henson PM, Janssen WJ, Schwartz DA, Boucher RC, Dickey BF, Evans carcinomas and tubular clear cell lesions. Virchows Arch 436: 119– CM: Muc5b is required for airway defence. Nature 505: 412–416, 2014 126, 2000

J Am Soc Nephrol 27: 3447–3458, 2016 Mucin-1 Upregulates TRPV5 3457 CLINICAL RESEARCH www.jasn.org

38. Hoenderop JG, Müller D, Van Der Kemp AW, Hartog A, Suzuki M, 50. Poland PA, Rondanino C, Kinlough CL, Heimburg-Molinaro J, Arthur Ishibashi K, Imai M, Sweep F, Willems PH, Van Os CH, Bindels RJ: CM, Stowell SR, Smith DF, Hughey RP: Identification and character- Calcitriol controls the epithelial calcium channel in kidney. JAmSoc ization of endogenous galectins expressed in Madin Darby canine Nephrol 12: 1342–1349, 2001 kidney cells. JBiolChem286: 6780–6790, 2011 39. Ekici AB, Hackenbeck T, Morinière V, Pannes A, Buettner M, Uebe S, 51. Yu LG, Andrews N, Zhao Q, McKean D, Williams JF, Connor LJ, Janka R, Wiesener A, Hermann I, Grupp S, Hornberger M, Huber TB, Gerasimenko OV, Hilkens J, Hirabayashi J, Kasai K, Rhodes JM: Galectin-3 Isbel N, Mangos G, McGinn S, Soreth-Rieke D, Beck BB, Uder M, interaction with Thomsen-Friedenreich disaccharide on cancer-associated Amann K, Antignac C, Reis A, Eckardt KU, Wiesener MS: Renal fibrosis is MUC1 causes increased cancer cell endothelial adhesion. J Biol Chem the common feature of autosomal dominant tubulointerstitial kidney 282: 773–781, 2007 diseases caused by mutations in mucin 1 or uromodulin. Kidney Int 86: 52. Picard N, Van Abel M, Campone C, Seiler M, Bloch-Faure M, 589–599, 2014 Hoenderop JG, Loffing J, Meneton P, Bindels RJ, Paillard M, Alhenc- 40. Zhao Q, Guo X, Nash GB, Stone PC, Hilkens J, Rhodes JM, Yu LG: Gelas F, Houillier P: Tissue kallikrein-deficient mice display a defect in Circulating galectin-3 promotes metastasis by modifying MUC1 local- renal tubular calcium absorption. J Am Soc Nephrol 16: 3602–3610, ization on cancer cell surface. Cancer Res 69: 6799–6806, 2009 2005 41. Cha SK, Wu T, Huang CL: Protein kinase C inhibits caveolae-mediated 53. Chang Q, Hoefs S, van der Kemp AW, Topala CN, Bindels RJ, endocytosisofTRPV5.AmJ Physiol Renal Physiol 294: F1212–F1221, 2008 Hoenderop JG: The beta-glucuronidase klotho hydrolyzes and acti- 42. Cha SK, Ortega B, Kurosu H, Rosenblatt KP, Kuro-O M, Huang CL: vates the TRPV5 channel. Science 310: 490–493, 2005 Removal of sialic acid involving Klotho causes cell-surface retention of 54. Hilkens J, Ligtenberg MJ, Vos HL, Litvinov SV: Cell membrane-associated TRPV5 channel via binding to galectin-1. Proc Natl Acad Sci U S A 105: mucins and their adhesion-modulating property. Trends Biochem Sci 17: 9805–9810, 2008 359–363, 1992 43. Conner SD, Schmid SL: Regulated portals of entry into the cell. Nature 55. Yu LG: The oncofetal Thomsen-Friedenreich carbohydrate antigen in 422: 37–44, 2003 cancer progression. Glycoconj J 24: 411–420, 2007 44. Kirchhausen T, Macia E, Pelish HE: Use of dynasore, the small molecule 56. Bresalier RS, Niv Y, Byrd JC, Duh QY, Toribara NW, Rockwell RW, inhibitor of dynamin, in the regulation of endocytosis. Methods Enzy- Dahiya R, Kim YS: Mucin production by human colonic carcinoma cells mol 438: 77–93, 2008 correlates with their metastatic potential in animal models of colon 45. Elola MT, Wolfenstein-Todel C, Troncoso MF, Vasta GR, Rabinovich cancer metastasis. J Clin Invest 87: 1037–1045, 1991 GA: Galectins: Matricellular glycan-binding proteins linking cell adhe- 57. Nakamori S, Ota DM, Cleary KR, Shirotani K, Irimura T: MUC1 mucin sion, migration, and survival. Cell Mol Life Sci 64: 1679–1700, 2007 expression as a marker of progression and metastasis of human co- 46. Haudek KC, Patterson RJ, Wang JL: SR proteins and galectins: What’s lorectal carcinoma. Gastroenterology 106: 353–361, 1994 in a name? Glycobiology 20: 1199–1207, 2010 58. Liu FT, Rabinovich GA: Galectins as modulators of tumour progression. 47. Demetriou M, Granovsky M, Quaggin S, Dennis JW: Negative regu- Nat Rev Cancer 5: 29–41, 2005 lation of T-cell activation and autoimmunity by Mgat5 N-glycosylation. 59. Roozbeh J, Merat A, Bodagkhan F, Afshariani R, Yarmohammadi H: Nature 409: 733–739, 2001 Significance of serum and urine neuraminidase activity and serum and 48. Leunissen EH, Nair AV, Büll C, Lefeber DJ, van Delft FL, Bindels RJ, urine level of sialic acid in diabetic nephropathy. Int Urol Nephrol 43: Hoenderop JG: The epithelial calcium channel TRPV5 is regulated dif- 1143–1148, 2011 ferentially by klotho and sialidase. JBiolChem288: 29238–29246, 2013 49. More SK, Srinivasan N, Budnar S, Bane SM, Upadhya A, Thorat RA, Ingle AD, Chiplunkar SV, Kalraiya RD: N-glycans and metastasis in galectin-3 transgenic mice. Biochem Biophys Res Commun 460: 302– This article contains supplemental material online at http://jasn.asnjournals. 307, 2015 org/lookup/suppl/doi:10.1681/ASN.2015101100/-/DCSupplemental.

3458 Journal of the American Society of Nephrology J Am Soc Nephrol 27: 3447–3458, 2016