DNA Polymerase Eta Prevents Tumor Cell Cycle Arrest and Cell Death

Author Manuscript Published OnlineFirst on October 8, 2018; DOI: 10.1158/0008-5472.CAN-17-3931 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.

DNA Polymerase Eta Prevents Tumor Cell Cycle Arrest And Cell Death

During Recovery from Replication Stress

Ryan P. Barnes1,3, Wei-Chung Tsao1, George-Lucian Moldovan2, and Kristin A. Eckert 1,2

1 Department of Pathology, The Jake Gittlen Laboratories for Cancer Research, Penn State

University College of Medicine, Hershey, PA; 2 Department of Biochemistry & Molecular

Biology, Penn State University College of Medicine, Hershey, PA; 3 Current address:

Department of Environmental and Occupational Health, University of Pittsburgh Graduate

School of Public Health, UPMC Hillman Cancer Center, University of Pittsburgh, Pittsburgh, PA

Running title (60 characters): Pol eta is induced by replication stress Keywords (5): synthetic lethality; XPV; POLH; ATR; chemotherapy Corresponding author: Kristin A. Eckert, Penn State College of Medicine, 500 University Drive H059, Hershey, PA; Tel: +1 717 531 4065; Fax: +1 717 531 5634; Email: [email protected] Conflict of interest statement: The authors declare no conflict of interest.

Statement of Significance: This study demonstrates that replication stress upregulates Pol η (POLH) in tumor cells and reveals a role for Pol η in tumor cell recovery following replication stress.

Page 1

Abstract

Neoplastic transformation and genome instability are enhanced by replication stress, conditions that slow or stall DNA replication forks. Consequently, cancer cells require multiple enzymes and checkpoint signaling pathways to mitigate replication stress for their viability and proliferation. Targeting proteins that enhance cancer cell survival during replication stress is a recent approach in clinical strategies, especially when targets produce synthetic lethality. DNA polymerase eta (Pol η) has many key functions in genome stability, particularly for translesion synthesis. Here we demonstrate that endogenous Pol η displays significant protein induction and forms intense foci throughout the nucleus in response to replication stress induced by drugs that do not directly form DNA adducts. During replication stress, Pol η-deficient cells displayed hyper-activation of the ATR replication checkpoint and arrested late in the cell cycle. During recovery from replication stress, Pol η-deficient cells continue to display aberrant phenotypes, including delayed cell cycle progression, apoptosis, and cell survival. Depletion or inhibition of

ATR was synthetically lethal with Pol η deficiency, particularly when tumor cells were treated with replication stress-inducing drugs. Together our data expand knowledge of the cellular environments that increase endogenous Pol η expression beyond DNA damaging agents and demonstrate that Pol η regulation is central to the replication stress response. Because Pol η is aberrantly expressed in several tumor types, our results are critical for developing more effective chemotherapy approaches and identify co-inhibition of Pol η and ATR as a potential therapeutic strategy.

Page 2

Introduction DNA polymerase eta (Pol η; POLH gene) is a DNA polymerase belonging to a subset of tumor suppressor proteins required for maintaining genome integrity. Homozygous mutation of

POLH results in the human cancer predisposition syndrome Xeroderma Pigmentosum Variant

(XPV) (1,2), and Pol η-deficient mice have an increased incidence of UV-induced skin cancer

(3). Pol η is a specialized DNA polymerase, classically studied in the DNA damage response, due to its unique capacity to accurately bypass the major UV lesion (4). In response to DNA damage, human Pol η is relocalized to replication foci, where it functions in translesion synthesis

(TLS) through a pathway requiring Rad18 (5,6). Following UV irradiation, Pol η is predominantly regulated at the post-translational level and targeted for degradation (reviewed in

(7)). Pol η also performs TLS across cisplatin adducts (8,9). Consequently, Pol η-deficient cells are more sensitive to platinum-based chemotherapeutic drugs, and Pol η expression has been implicated in promoting chemoresistance (10,11).

Human Pol η plays additional key functions in genome stability, including telomere maintenance, homologous recombination, and common fragile site (CFS) replication (12-14).

Early stage, pre-malignant tissues display enhanced activation of the DNA damage response and genome instability within CFS regions (15). CFSs are inherently sensitive to replication stress

(16), the slowing or stalling of DNA replication forks in response to a variety of environments

(17). Current models postulate that replication stress drives genome instability (18), facilitating cancer cell evolution (17,19). To mitigate replication stress, cancer cells rely heavily on the

ATR/Chk1 signaling axis to prevent replication fork collapse and control the cell cycle, ensuring complete genome replication (20). Because of this relationship, replication stress and ATR inhibitors are under intense study (21) and specific inhibitors are in Phase I clinical trials for use in combination chemotherapies (22).

Page 3

Expression of the POLH gene is increased in Head and Neck Squamous Cell Carcinomas

(HNSCC) prior to therapy, and high POLH expression was significantly associated with low patient survival, independent of tumor stage (23). Increased Pol η protein expression was also reported in Non-Small Cell Lung Carcinomas (NSCLC) (24) and in ovarian cancer stem cells

(11). Here, we report that endogenous Pol η is up-regulated at the level of transcript and protein in multiple cancer cell lines by replication stress-inducing drugs that do not form DNA adducts.

We further investigated how Pol η mitigates replication stress. In the presence of replication stress, Pol η-deficient cells have a delayed G2/M cell cycle progression and hyper-activation of the ATR/Chk1 axis. Critically, during recovery from replication stress, Pol η-deficient cells continue to display abnormal phenotypes, including delayed G2/M phase progression, apoptosis and reduced cell survival. Finally, we demonstrate that Pol η-deficient tumor cells are hypersensitive to ATR inhibition or depletion when combined with replication stress. Our results identify replication stress as a possible cause of Pol η (POLH) upregulation in tumor cells, and reveal Pol η’s potential as a synthetically lethal target with ATR inhibition.

Materials and Methods

Human Cell Culture

U-2 OS (purchased from ATCC), HCT-116 (p53 wild-type and null, courtesy of B.

Vogelstein (25)), and 8988T (obtained from Dr. Alec Kimmelman (26)) cells were grown in

DMEM. SV40 transformed XPV cell lines (XP30RO) were a gift from Jean-Sebastian Hoffman

(Cancer Research Center. Toulouse, France) and grown in DMEM/F12 media. XPV cells were complemented with POLH cDNAs (pcDNA 3.1 zeo (-)), and selected in 100 ug/mL Zeocin. hTERT immortalized BJ-5TA cells (purchased from ATCC) were grown in DMEM

Page 4

o 37 C in 5% CO2, and regularly monitored for mycoplasma contamination. For gene knockouts, commercially available CRISPR-Cas9 KO plasmids were used (Santa Cruz Biotechnology sc-

401794 for POLH, sc-406099 for Rad18). Single cell-derived clones were analyzed by immunoblot for loss of protein expression (see Figures for validation).

Reagents

Aphidicolin (Sigma; DMSO solvent) and hydroxyurea (Santa Cruz Biotechnologies, DMSO solvent) were added to media as indicated. VE-822 (DMSO solvent) was a kind gift from Dr.

Eric Brown (University of Pennsylvania). Antibodies used for immunoblot analyses: anti-Pol eta

(Santa Cruz sc-17770 or Cell Signaling 13848), anti-actin (Abcam ab1801), anti-phospho-Chk1

S317 (CST D12H3), anti-Chk1 (Santa Cruz sc-8408), anti-Mek2 (BD Biosciences 610235), anti- histone H3 (CST 9715), anti-PCNA (Santa Cruz sc-56), anti-Pol delta p125 (Abcam ab186407), anti-Rad18 (Novus NB100-61063), anti-p53 (Santa Cruz D-1), or anti-RPA2 (Abcam ab2175).

Gene depletion was achieved using Stealth siRNA duplexes transfected with RNAimax (Life

Technologies). Cells were transfected twice, and were treated 48-72 hours after the first transfection. The sequence for siRNAs are as follows:

POLH: 5’ UACACGAAUGCUCACAACCAGCUGG 3’ P53: 5’ CCQGUGGUAAUCUACUGGGACGGAA 3’ ATR: 5’ GAGCUCGUCUCUAAACCCUUCUAAA 3’

Quantitative Reverse Transcription PCR

Experiments were performed according to MIQE guidelines, with at least three technical and three biological replicates. Total RNA was extracted using the All Prep Mini Kit or RNAeasy Kit

Page 5

(Qiagen), assessed for quality using the 2200 TapeStation (Agilent), and 1 µg of samples with an

RIN >9 were converted to cDNA using the High Capacity RNA-to-cDNA kit (Life

Technologies) or qScript cDNA Synthesis Kit (Quanta). qPCR was performed with 20 ng cDNA,

1X Taqman target and control probes (18S RNA and Actin) (Life Technologies) and analyzed on the Agilent QuantStudio 7 Flex. Primer/probe efficiencies were verified with a cDNA standard curve, and no template and no reverse transcription controls were performed as appropriate.

Immunofluorescence Microscopy

For endogenous Pol η staining, cells were fixed in 4% paraformaldehyde before extracting with

Triton X-100. Slides were incubated with Pol η antibody overnight (sc-17770 Santa Cruz), before staining with Alexa Flour 488 goat anti-mouse (Life Technologies) and counterstained with DAPI. Exogenous Pol η was studied by transfecting cells with an RFP-tagged POLH expression construct. Cells were treated as indicated 24 hours after transfection. Cells were fixed with cold methanol/acetone, and stained with PCNA antibody (Santa Cruz) as above. PCNA antibody was detected with Alexa Flour 647 secondary. Images were acquired with a Nikon Ti inverted fluorescence microscope equipped with a CoolSNAP HQ2 CCD camera. Z stacks of

0.2 µm thickness were captured using NIS Elements Advance Research software. Images were deconvolved using the blind deconvolution algorithm with 5 iterations and medium background settings. The number of foci in each cell (>60 cells per condition) was automatically quantified using NIS Elements software, using the same threshold for all samples.

Whole Cell Extracts and Cellular Fractionation

For whole cell extracts, cells were lysed with RIPA buffer (Santa Cruz Biotechnology) supplemented with Halt protease and phosphatase inhibitors and PMSF (Life Technologies and

Santa Cruz). Extract concentrations were determined using Bradford Assay (BioRad) before

Page 6

(NIH) and normalized to loading controls (Actin, PCNA, or MEK2).

Cellular fractionation was performed as previously described with some modifications (27).

Cells were lysed in Buffer A supplemented with 1X Halt Protease and Phosphatase Inhibitors and 0.1% Triton X. Nuclei were lysed in Buffer B supplemented with 1X Halt Protease and

Phosphotase Inhibitors before being digested with micrococcal nuclease (New England Biolabs) for 10 minutes at 37oC. The released chromatin bound protein fraction was cleared by high speed centrifugation before analysis. Cells were also fractionated into Triton soluble (TS) and Triton

Insoluble (TI) fractions as previously described (28).

Clonogenic Survival

Cells were seeded in triplicate in six well plates and treated the next day with the indicated doses of Aph or HU for 24 (8988T) or 48 (U2OS) hours. For siRNA experiments, cells were counted on the third day following 2X transfection, and plated. In all cases, treatment media was replaced with fresh, drug-free media, and plates were incubated for 1-2 weeks. Colonies (> 50 cells) were fixed in methanol and stained in crystal violet solution before counting.

Cell Cycle Analyses

For univariate cell cycle analysis, cells were fixed in 70% ethanol, washed and resuspended in propidium iodine/RNase solution before analyzing on a BD FACSCalibur. Data were analyzed using ModFit. Multivariate flow cytometry was performed by treating cells with 1.2 µM Aph for

24 hours. Cells were released into fresh media for the indicated amounts of time and EdU

(20µM, Life Technologies) was added during the last hour of release. The 0 hour samples had

EdU added one hour before harvest. Cells were fixed in 4% paraformaldehyde and permeabilized

Page 7

Downloaded from cancerres.aacrjournals.org on October 1, 2021. © 2018 American Association for Cancer Research. Author Manuscript Published OnlineFirst on October 8, 2018; DOI: 10.1158/0008-5472.CAN-17-3931 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. with 0.1% saponin, before performing the Click-It reaction according to manufacturer’s recommendations (Life Technologies). EdU incorporation was visualized using Sulfo-cyanin5 azide (Luminprobe) at 4µM (Ex. 633/Em.660). Gates were set based on the DMSO treated samples after analyzing compensation controls. Mitotic cells were detected with anti-pH3 antibody conjugated with Alexa Fluor 488. After washing, cells were resuspended in propidium iodine solution and analyzed on BD FACSCanto.

Statistical Analysis

To simultaneously analyze the effects of the independent factors genotype, dose, or time on biological outcomes, one- or two-way ANOVA (GraphPad Prism software) were performed. The p-values for two-way ANOVA are indicated as “ANOVA” in the figures. The specific doses (or time points) contributing to the overall statistical differences between genotypes were determined using Tukey’s or Sidak’s multiple comparison post-hoc tests. The post-hoc results are indicated on graphs as asterisks: * = p<0.05; ** = p<0.01; ***= p<0.001; **** = p<0.0001.

All experiments have been performed at minimum with three biological replicates, using three technical replicates where necessary.

Results

Pol η Expression is Upregulated During Replication Stress

We sought to understand the pathological conditions leading to increased expression of endogenous Pol η, as has been reported in therapy naïve HNSCC and NSCLC tumors (23,24).

Although Pol η is primarily considered in the context of the DNA damage response (as a TLS polymerase), Pol η protein is actively degraded in response to UV and other genotoxic agents

Page 8

(see (7) for a review). Early events in transformation produce replication stress; therefore, we tested the effects of replication stress on Pol η regulation. We treated tumorigenic human cell lines with increasing doses of Aphidicolin (Aph), a classic inducer of replication stress that inhibits replicative polymerases, but does not directly produce DNA adducts (16,17). Analyses of POLH mRNA levels in U2OS osteosarcoma cells (48 hours) and 8988T pancreatic carcinoma cells (24 hours) revealed a dose-dependent induction of POLH transcript following Aph treatment (Figure 1A). This was not observed for the closely related POLK (polymerase kappa) gene. Consistently, immunoblot analyses demonstrated a marked and significant increase in Pol

η protein following Aph treatment (Figure 1B). We observed a similar induction of POLH transcript and Pol η protein after Aph treatment of hTERT- immortalized BJ-5A fibroblasts, and confirmed the mRNA data relative to two control genes (Figure 1A,B and Supplemental Figure

1A). The levels of other replication proteins (Pol δ catalytic subunit p125, PCNA, and RPA32) were not altered by the same treatments, while Chk1 was phosphorylated at S317 (Figure 1C and

Supplementary Figure S1C,D). To support the interpretation that the responses are due to general replication stress, we treated U2OS and 8988T cells with hydroxyurea (HU), a drug that induces replication stress by inhibiting ribonucleotide reductase. Again, we observed a significant, dose- and time-dependent induction of Pol η, in a manner comparable to Aph, without changes in p125 or PCNA (Figure 1D and Supplementary Figure S1C,D).

Currently, p53 is the only well described transcriptional regulator of POLH (29). To test if p53 plays a role in Pol η induction during the replication stress response, we examined isogenic, p53 wild-type and null HCT116 cells. We confirmed that wild-type cells have more

POLH transcript than p53-deficient cells (Supplementary Figure S1B). However, we observed

POLH transcript induction in both lines following Aph treatment (Figure 1E). We confirmed these results using U2OS cells depleted of p53 by siRNA (Supplementary Figure S1E).

Page 9

Following UV irradiation, Pol η protein increased slightly in p53 wild-type cells, compared to control, but this response was diminished in p53-deficient cells (Figure 1F). Following Aph treatment, we measured a dose-dependent increase of Pol η protein in both p53-proficient and deficient cell lines that was of the same or greater magnitude than the UV response (Figure 1F).

Pol η levels in U2OS cells do not vary substantially with cell cycle stage (30). Never- the-less, we considered whether the increase in Pol η we observe upon replication stress was due to an arrest at a specific stage in the cell cycle. We observed a very similar dose-dependent increase in Pol η in four different cell lines (Figure 1); however, flow cytometry analyses showed that the corresponding Aph-induced changes in cell cycle progression were different for each cell type. For instance, U2OS (p53 wild-type) and HCT116 (p53+/+ and p53-/-) cells displayed an S-phase delay, while 8988T (p53 mutant) cells displayed a G1 phase delay, in response to Aph (Supplementary Figure S2A-B). Together, our data show replication stress in both tumorigenic and normal cells induces Pol η expression, and highlight a p53-independent regulation that may be distinct from the DNA damage response.

Pol Eta Forms Nuclear Foci During Replication Stress

Pol η recruitment to nuclear foci following UV irradiation is a key facet of TLS (6,31).

Therefore, we examined endogenous Pol η foci formation in response to replication stress.

Treatment of 8988T or U2OS human cell lines with DMSO produced few nuclear foci, consistent with previous reports (32). Strikingly, 0.6 µM Aph treatment significantly increased the number of Pol η foci in U2OS (Figures 2A) and 8988T (Supplementary Figure S3A) cells.

We also investigated the relocalization of endogenous Pol η by fractionating cells into cytoplasmic (S2), soluble nuclear (S3), and chromatin fractions (P3). In both cell lines, we

Page 10

Downloaded from cancerres.aacrjournals.org on October 1, 2021. © 2018 American Association for Cancer Research. Author Manuscript Published OnlineFirst on October 8, 2018; DOI: 10.1158/0008-5472.CAN-17-3931 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. observed increased levels of Pol η in the chromatin fraction, confirming endogenous Pol η localizes to DNA during replication stress (Figure 2B and Supplementary S3B). HU treatment resulted in similar Pol η relocalization (Supplementary Figure S3C). We also observed an increase of Pol η in the Triton insoluble chromatin fraction (TI) following Aph treatment of

POLH complemented XPV cells (Supplementary Figure S3D).

We directly compared the recruitment of exogenous Pol η to foci in response to Aph or

UV, using RFP-tagged POLH and U2OS cells. Remarkably, 24 hours of 0.6 µM Aph exposure produced a nearly identical increase in RFP-Pol Eta foci as compared to endogenous Pol η

(mean 50 vs 43 foci per cell, respectively) (Figure 2C, D vs. 2A). A strong UV dose (20J/m2), resulted in high levels of Pol η foci comparable to those formed by Aph. Moreover, the number of Pol η foci that intersect with PCNA after a 6 hour experiment (1.2 µM Aph or 20J/m2 UV) were significantly increased, relative to controls (Figure 2E). Together these data show that replication stress results in the recruitment of Pol η to chromatin/foci at a magnitude similar to

UV irradiation, despite the absence of DNA lesions.

Pol η Mitigates Replication Stress in Human Cells

To examine the biological significance of Pol η up-regulation and re-localization after replication stress, we used a genetic approach and measured the phenotypes of Pol η-deficient cells. Control XPV and wild-type POLH complemented cells have nearly identical cell cycle distributions (Figure 3A and Supplementary Figure S4A). Following 24 hours of 0.3 µM Aph treatment, wild-type POLH complemented cells were unaffected (Figure 3A). XPV cells however, displayed a significant increase in G2/M phase cells (which is also significantly different from complemented cells) and a significant decrease in G1 phase cells (Figure 3A).

Page 11

XPV cells continued to display significantly elevated G2/M phase populations compared to complemented cells, and lower G1 phase populations at higher doses. This result for Aph is in contrast to UV, where XPV cells display a dramatic S-phase arrest that is not observed in wild- type cells (Supplementary Figure S4B). Because this XPV cell model used exogenous POLH, we studied the role of endogenous Pol η using wild-type 8988T tumor cells and two POLH-/- knockout cell lines generated by CRISPR-Cas9. We observed a similar G2/M phase increase in Aph treated POLH-/- 8988T cells in comparison to wild-type cells (Figure 3B and Supplementary

Figure S4C), demonstrating that Pol η promotes progression through late stages of the cell cycle during replication stress.

Second, we analyzed ATR signaling by quantifying Chk1 S317 phosphorylation (pChk1)

(34) in both XPV and 8988T models (Figure 3C, D). No significant differences in pChk1 levels were observed between solvent treated Pol η-proficient and deficient cells. However, both XPV and POLH-/- 8988T cells displayed a significant, dose-dependent elevation in pChk1/Chk1, compared to their respective Pol η-proficient cell lines following Aph treatment. Treatment of wild-type and POLH-/- 8988T cells with HU produced similar results (Supplementary Figure

S4D). To determine the domains of Pol η required to suppress pChk1 signaling, we complemented XPV cells with POLH cDNAs, mutated at the C-terminal PIP (PCNA interacting peptide) domain (PIP*) or the UBZ domain (UBZ*). Both mutants have been previously characterized for their roles following UV damage (35). XPV cells expressing PIP* POLH displayed pChk1/Chk1 levels comparable to cells expressing wild-type POLH, whereas UBZ*

POLH expressing cells had increased pChk1/Chk1 levels, similar to XPV cells (Figure 3E).

Importantly, the clones used in this study express Pol η protein at comparable levels (Figure

S4E). We considered whether ATR/Chk1 activation might be correlated with Pol η localization.

While wild-type and PIP* Pol η accumulate on chromatin after Aph treatment, UBZ* Pol η does

Page 12

UV irradiation (36), may be dispensable for Pol η accumulation on chromatin after Aph or HU treatment (Supplementary Figure S3B, C). Taken together, these data show that Pol η is required to suppress hyper-activation of the ATR checkpoint and promote late cell cycle progression in cells exposed to replication stress.

Efficient Replication Stress Recovery Requires Pol η

We investigated whether Pol η-deficiency would impact cell survival following replication stress. Cells were exposed to various doses of Aph or HU for 24-48 hours, and allowed to recover in the absence of drug for 1-2 weeks before counting individual colonies. POLH-/- 8988T and POLH-/- U2OS Crisper knockout clones (Figure 3D and Supplementary Figure S5A) displayed a significant, dose-dependent reduction in clonogenic survival following Aph treatment, compared to wild-type cells (Figure 4A). Importantly, we found similar results when the various knockout cell lines were treated with HU (Figure 4B). We observed more rapid and intense Caspase 3 and PARP1 cleavage in Pol η-deficient, relative to wild-type 8988T cells following Aph treatment (Figure 4C). Because we observed differences between the highly aneuploid POLH-/- 8988T clones (likely due to pre-existing genetic differences within the cloned populations), we verified the sensitivity phenotype using siRNA to transiently deplete POLH during the Aph exposure period, and again observed significantly reduced survival in both lines

(Supplementary Figure S5B-D). Together, these data show Pol η-deficient cells are defective in recovery from replication stress, resulting in elevated apoptotic signaling and decreased clonogenic survival.

Page 13

Pol η-Deficient Cells Display Perturbed Cell Cycle Progression During Replication Stress

Recovery

To understand the mechanistic basis for the impaired survival and increased apoptosis of

Pol η-deficient cells after release from replication stress, we performed an EdU incorporation assay that mirrors the clonogenic survival assay. We treated 8988T wild-type and POLH-/- cells with Aph for 24 hours, and then allowed cells to recover in fresh media. EdU was added during the last hour to interrogate the replication profile of the recovering cells using flow cytometry.

DMSO treated wild-type and POLH-/- 8988T cells displayed similar EdU incorporation profiles

(Figure 5A). After Aph treatment and release however, POLH-/- cells displayed elevated G2/M phase populations, relative to wild-type cells, at all time points investigated, with the strongest effects observed 3 and 8 hours into the recovery period (Figure 5B, C; see Supplemental Table 1 for statistical analyses of all cell cycle populations). Similar changes in cell cycle progression were observed with a second POLH-/- 8988T clone (Supplementary Figure S6A). Significantly fewer EdU+ (S-phase) POLH-/- cells were observed 8 hours after release, concomitant with a significant increase in SubG1 cells (Figure 5B, C), which are likely apoptotic cells (Figure 4C).

This trend of fewer EdU+ cells and greater SubG1 POLH-/- cells continued to be observed up to

24 hours of recovery from Aph treatment. In addition, after 8 hours we observed a strong increase in POLH-/- cells with a >4C DNA content, suggesting an increased level of Aph-induced re-replication (Figure 5B,C). Wild-type cells displayed a slight increase in cells undergoing re- replication, but this population returned to baseline within 24 hours (p=0.53, ANOVA, with post- hoc analysis of 0 hr versus 24 hr). We measured no difference in the unperturbed growth rates of

POLH-/- clones relative to wild-type cells (Supplementary Figure S6B).

Mitotic DNA synthesis (or MiDAS) has been described as a repair pathway in response to replication stress when cells have entered mitosis with incompletely replicated genomes (38).

Page 14

To investigate whether DNA synthesis is occurring within mitotic cells in the Aph release experiment, we used multivariate flow cytometry and staining for EdU (DNA synthesis) and phosphorylated histone H3 (pH3; mitotic cells). The POLH-/- clones displayed significantly elevated levels of pH3+ mitotic cells, relative to wild-type, suggesting progression through mitosis is perturbed in these cells (Figure 6A, B). To quantitate the number of mitotic cells undergoing DNA synthesis, we analyzed the data in two ways. First, we examined dual positive

(EdU+ and pH3+) cells as a proportion of total cells, and found significantly different levels between wild-type and POLH-/- cells (Figure 6C). A 10-fold difference was observed at time 0, increasing to 100-fold one hour after release. Pol η-deficient cells have been shown to display an increased number of mitotic cells with EdU-positive foci (39). Interestingly, our flow cytometry analyses reveal that many of the EdU+pH3+ POLH-/- cells have <4C DNA content (premature mitotic cells), especially one hour after release (Figure 6A), which may reflect premature chromatin condensation. Second, we normalized the number of (EdU+ pH3+) cells to the number of mitotic cells (pH3+), because the total mitotic population is small relative to total and differs between genotypes (Figure 6B). This analysis again revealed a significant difference between the genotypes that is maximal one hour after release (Figure 6D). Approximately 40% of mitotic POLH-/- cells were EdU+ at one hour, decreasing to ~ 10% at three hours. In sharp contrast, the proportion of EdU+ mitotic wild-type cells was less than 5% at time 0 and 1 hour following release, and disappeared after 3 hours (Figure 6D). We interpret these data to indicate that the absence of Pol η during recovery from replication stress prevents cells from completing genome duplication prior to entering mitosis, potentially requiring mitotic DNA synthesis for repair.

Pol η-Deficient Cells Display Synthetic Lethality with ATR Inhibition

Page 15

ATR inhibitors are in Phase I clinical trials for use in combination therapies targeting

DNA repair/replication pathways to generate synthetic lethality (22). Because Pol η-deficient cells display increased ATR/Chk1 signaling during replication stress (Figure 3), we reasoned that these cells might display enhanced cytotoxicity when ATR is inhibited. Co-treatment of 8988T cells with Aph and VE-822 (a highly specific ATR inhibitor (40)) resulted in slight PARP1 and

Caspase 3 cleavage (Figure 7A). However, this apoptotic signaling was magnified in POLH-/- cells, which were also sensitive to VE-822 alone. While establishing VE-822 treatment conditions, we surprisingly found that VE-822 inhibited the Aph-induced Pol η protein increase

(Figure 7B), suggesting ATR signaling may impact Pol η expression during replication stress.

We also depleted ATR from 8988T cells by ~50% using siRNA (Figure 7C). POLH-/- cells transfected with ATR siRNA displayed cleavage of both Caspase 3 and PARP1 after Aph treatment, while control siRNA and all wild-type cells were unaffected (Figure 7D), similar to

ATR inhibition (Figure 7A). Consistent with Figure 4, we observed a significant reduction in

POLH-/- cell clonogenic survival after Aph treatment, following transfection with the control siRNA (Figure 7E). Following ATR depletion (DMSO treated control), wild-type 8988T cells had reduced cloning efficiency, compared to control siRNA transfected cells. This difference was greater in POLH-/- cells, highlighting the increased reliance of Pol η-deficient cells on ATR signaling for survival. Importantly, POLH-/- cells displayed a significantly enhanced, Aph dose- dependent reduction in survival following ATR siRNA, compared to wild-type cells and control siRNA. Together these data show that inhibiting ATR signaling produces a synthetic lethality in

Pol η-deficient during replication stress.

Discussion

Page 16

Replication stress is a key driver of genome instability and tumorigenesis (15,17,19). In this study, we sought to understand the cellular role of the tumor suppressor protein, Pol η, in the replication stress response. Pol η is well studied after UV treatment of human cells, where it is targeted for degradation, presumably after TLS occurs (reviewed in (7)). Paradoxically, POLH transcript or Pol η protein levels are increased in tumors, prior to therapy, suggesting some feature of cancer cell evolution induces Pol η expression (23,24). Using multiple human cell lines, we show here that endogenous Pol η is upregulated at the transcript and protein level in response to replication stress-inducing drugs that do not directly form DNA adducts (Figure 1 and S1). Importantly, the expression of other replication proteins (Pol δ/p125, PCNA, and

RPA2) as well as POLK did not change during replication stress. POLH transcript is induced by double-strand break causing agents in a p53-dependent manner (29). However, we show here that the POLH transcriptional response to Aph is not p53-dependent (Figure 1). We also show that Pol η relocalizes to chromatin and nuclear foci in response to replication stress-inducing drugs (Figure 2). In total, our data highlight a heretofore unexplored mode of regulation of Pol η during the replication stress response, that is independent of DNA lesions. Our results suggest that Pol η may be concomitantly up-regulated during tumorigenesis to mitigate the detrimental effects of replication stress.

Transformed cells become reliant on various proteins to cope with replication stress and subsequent genome instability. Pol η is present at the replication fork (32), and was proposed to be required during S-phase to prevent replication fork stalling within CFS regions (39).

Replicative DNA polymerases stall at genome regions sensitive to replication stress, e.g., non-B

DNA forming sequences within CFSs (41,42) and telomeric DNA (43). Pol η localizes to CFS sequences after Aph treatment (39) and promotes CFS stability (14). In vitro, Pol η can take over

Page 17

DNA synthesis from a Pol δ holoenzyme stalled at CFS-derived sequences and carry out Aph- resistant DNA synthesis (41). In cells with functional Pol η under replication stress, Pol η is induced (Figure 1) and recruited to nuclear foci containing PCNA (Figure 2), where we suggest it extends Pol δ replication intermediates that are stalled or abandoned at difficult-to-replicate sequences (Supplementary Figure S7). In this way, Pol η generates the optimal DNA templates for replicative polymerases to resume replication fork elongation. In the presence of replication stress, Pol η-deficient cells display defective G2/M phase progression (Figure 3), which differs from the UV damage response wherein Pol η-deficient cells stall in S-phase (Figure S4B, and

(33)). This cell cycle delay is accompanied by increased activation of the ATR/Chk1 axis.

Because replicative DNA polymerase synthesis is inhibited within repetitive sequences in the absence of replication stress (41,42), we suggest that Pol η-deficient cells cannot resume fork elongation efficiently, creating gaps in the genome (Supplementary Figure S7). We show that ubiquitin interaction, but not Rad18, is required for Pol η to access DNA in response to replication stress (Figure 3). As Pol η has many post-translational modifications and protein interactions (7), future studies are needed to determine the pathways regulating Pol η in response to replication stress. Our data suggest that Pol η induction (and relocalization) during replication stress is a mechanism by which delayed replication is prevented; however, since we have not identified the factors regulating Pol η (POLH), we cannot exclude other possibilities.

Pol η-deficient tumor cells display significantly reduced clonogenic survival and marked

Caspase 3 and PARP1 cleavage during recovery from replication stress treatments (Figure 4).

To understand this mechanistically, we examined replication profiles by flow cytometry. This revealed that during the recovery period, POLH-/- 8988T cells had persistently elevated G2/M phase populations and increased SubG1 cells, relative to wild-type cells (Figure 5). ATR

Page 18

6). In striking contrast, after replication stress release, POLH-/- cells had significantly elevated

EdU-positive, mitotic cells, with up to 40% of mitotic cells displaying DNA synthesis (Figure 6).

DNA synthesis in mitosis (MiDAS) has previously been reported in cells undergoing replication stress (38). Our study is the first to show this can persist and even increase during replication stress recovery in the absence of Pol η. Because a portion of these EdU+/pH3+ cells had less than 4C DNA content, it is possible they also represent interphase cells with premature chromosome condensation. Together, our data show that Pol η-deficient cells continue to display abnormal phenotypes during recovery from replication stress. We postulate that Pol η has an essential role in late S/G2 pathways to complete genome duplication even after replication stress is relieved. Consequently, Pol η-deficient cells display delayed G2 phase progression and enter mitosis with incomplete genomes causing elevated mitotic DNA synthesis, ultimately leading to elevated apoptosis and reduced cell survival.

Our data revealed that Pol η-deficient cells are more reliant on ATR signaling to maintain viability during replication stress. We tested this using both a pharmacologic and genetic approach. Pol η-deficient cells showed dramatically elevated apoptotic signaling, in comparison to wild-type, when ATR signaling was impaired during replication stress (Figure 7). Critically,

ATR depletion together with Aph treatment resulted in a 50-fold reduction in the clonogenic survival of Pol η-deficient cells, a significantly greater response than wild-type cells (Figure 7).

These results suggest that targeting Pol η and ATR in combination may be a viable, new treatment strategy for cancer patients. Indeed, TLS polymerases such as Pol η are emerging as key enzymes mediating tumor cell responses to chemotherapy (45). Recently, the Rev3 subunit of Pol ζ was identified as a synthetic lethal partner with combined ATR inhibition and cisplatin

Page 19

Downloaded from cancerres.aacrjournals.org on October 1, 2021. © 2018 American Association for Cancer Research. Author Manuscript Published OnlineFirst on October 8, 2018; DOI: 10.1158/0008-5472.CAN-17-3931 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. treatment (46). Moreover, reducing Rev3 expression sensitizes NSCLC cells to cisplatin therapy in a mouse model (47). Given that personalized oncology approaches are state-of-the-art, our synthetic lethality results suggest that the Pol η/POLH status of tumors should be evaluated to identify patients most likely to benefit from adjuvant therapy with ATR inhibitors. For example,

72% of colorectal carcinomas and 22% of NSCLCs have decreased POLH gene expression, relative to normal tissue (23,48), making them good targets for synthetic lethality. Additionally,

Pol η expression is correlated with resistance to platinum-based therapeutics (10,11). Given that

Pol η is a potential target for small molecule inhibition (8,9), our results support the development of Pol η-specific inhibitors to use in an adjuvant setting.

Acknowledgements

We thank the Penn State Hershey Flow Cytometry Core Facility for assistance with flow cytometry analysis. We are very grateful to Dr. Elise Fouquerel in the lab of Dr. Patricia Opresko at the University of Pittsburgh for assistance with microscopy, and to Suzanne Hile for technical help and assistance in preparing figures. We also thank Dr. Agnes Cordonnier, for POLH cDNAs and Patricia Opresko for the TagRFP-POLH construct. We are grateful for the generous support of this research by the Donald B. and Dorothy L. Stabler Foundation and the Jake Gittlen

Laboratories for Cancer Research.

References

1. Masutani C, Kusumoto R, Yamada A, Dohmae N, Yokoi M, Yuasa M, et al. The XPV (xeroderma pigmentosum variant) gene encodes human DNA polymerase eta. Nature 1999;399:700-4 2. Broughton BC, Cordonnier A, Kleijer WJ, Jaspers NG, Fawcett H, Raams A, et al. Molecular analysis of mutations in DNA polymerase eta in xeroderma pigmentosum- variant patients. Proc Natl Acad Sci U S A 2002;99:815-20

Page 20

3. Lin Q, Clark AB, McCulloch SD, Yuan T, Bronson RT, Kunkel TA, et al. Increased susceptibility to UV-induced skin carcinogenesis in polymerase eta-deficient mice. Cancer Res 2006;66:87-94 4. Masutani C, Kusumoto R, Iwai S, Hanaoka F. Mechanisms of accurate translesion synthesis by human DNA polymerase eta. Embo J 2000;19:3100-9 5. Kannouche PL, Wing J, Lehmann AR. Interaction of human DNA polymerase eta with monoubiquitinated PCNA: a possible mechanism for the polymerase switch in response to DNA damage. Molecular Cell 2004;14:491-500 6. Watanabe K, Tateishi S, Kawasuji M, Tsurimoto T, Inoue H, Yamaizumi M. Rad18 guides poleta to replication stalling sites through physical interaction and PCNA monoubiquitination. Embo J 2004;23:3886-96 7. Barnes R, Eckert K. Maintenance of Genome Integrity: How Mammalian Cells Orchestrate Genome Duplication by Coordinating Replicative and Specialized DNA Polymerases. Genes (Basel) 2017;8:19 8. Ummat A, Rechkoblit O, Jain R, Roy Choudhury J, Johnson RE, Silverstein TD, et al. Structural basis for cisplatin DNA damage tolerance by human polymerase eta during cancer chemotherapy. Nat Struct Mol Biol 2012;19:628-32 9. Zhao Y, Biertumpfel C, Gregory MT, Hua YJ, Hanaoka F, Yang W. Structural basis of human DNA polymerase eta-mediated chemoresistance to cisplatin. Proc Natl Acad Sci U S A 2012;109:7269-74 10. Albertella MR, Green CM, Lehmann AR, O'Connor MJ. A role for polymerase eta in the cellular tolerance to cisplatin-induced damage. Cancer Res 2005;65:9799-806 11. Srivastava AK, Han C, Zhao R, Cui T, Dai Y, Mao C, et al. Enhanced expression of DNA polymerase eta contributes to cisplatin resistance of ovarian cancer stem cells. Proc Natl Acad Sci U S A 2015;112:4411-6 12. Garcia-Exposito L, Bournique E, Bergoglio V, Bose A, Barroso-Gonzalez J, Zhang S, et al. Proteomic Profiling Reveals a Specific Role for Translesion DNA Polymerase eta in the Alternative Lengthening of Telomeres. Cell Reports 2016;17:1858-71 13. McIlwraith MJ, Vaisman A, Liu Y, Fanning E, Woodgate R, West SC. Human DNA polymerase eta promotes DNA synthesis from strand invasion intermediates of homologous recombination. Mol Cell 2005;20:783-92 14. Rey L, Sidorova JM, Puget N, Boudsocq F, Biard DS, Monnat RJ, Jr., et al. Human DNA polymerase eta is required for common fragile site stability during unperturbed DNA replication. Mol Cell Biol 2009;29:3344-54 15. Gorgoulis VG, Vassiliou LV, Karakaidos P, Zacharatos P, Kotsinas A, Liloglou T, et al. Activation of the DNA damage checkpoint and genomic instability in human precancerous lesions. Nature 2005;434:907-13 16. Glover TW, Wilson TE, Arlt MF. Fragile sites in cancer: more than meets the eye. Nature Reviews Cancer 2017;17:489-501 17. Techer H, Koundrioukoff S, Nicolas A, Debatisse M. The impact of replication stress on replication dynamics and DNA damage in vertebrate cells. Nature Reviews Genetics 2017;18:535-50 18. Burrell RA, McClelland SE, Endesfelder D, Groth P, Weller MC, Shaikh N, et al. Replication stress links structural and numerical cancer chromosomal instability. Nature 2013;494:492-6 19. Macheret M, Halazonetis TD. DNA replication stress as a hallmark of cancer. Annu Rev Pathol 2015;10:425-48

Page 21

20. Dungrawala H, Rose KL, Bhat KP, Mohni KN, Glick GG, Couch FB, et al. The Replication Checkpoint Prevents Two Types of Fork Collapse without Regulating Replisome Stability. Molecular Cell 2015;59:998-1010 21. Dobbelstein M, Sorensen CS. Exploiting replicative stress to treat cancer. Nature Reviews Drug Discovery 2015;14:405-23 22. Rundle S, Bradbury A, Drew Y, Curtin NJ. Targeting the ATR-CHK1 Axis in Cancer Therapy. Cancers (Basel) 2017;9:41 23. Ceppi P, Novello S, Cambieri A, Longo M, Monica V, Lo Iacono M, et al. Polymerase eta mRNA expression predicts survival of non-small cell lung cancer patients treated with platinum-based chemotherapy. Clin Cancer Res 2009;15:1039-45 24. Zhou W, Chen YW, Liu X, Chu P, Loria S, Wang Y, et al. Expression of DNA translesion synthesis polymerase eta in head and neck squamous cell cancer predicts resistance to gemcitabine and cisplatin-based chemotherapy. PLoS One 2013;8:e83978 25. Bunz F, Dutriaux A, Lengauer C, Waldman T, Zhou S, Brown JP, et al. Requirement for p53 and p21 to sustain G2 arrest after DNA damage. Science 1998;282:1497-501 26. O'Connor KW, Dejsuphong D, Park E, Nicolae CM, Kimmelman AC, D'Andrea AD, et al. PARI overexpression promotes genomic instability and pancreatic tumorigenesis. Cancer Res 2013;73:2529-39 27. Mendez J, Stillman B. Chromatin association of human origin recognition complex, cdc6, and minichromosome maintenance proteins during the cell cycle: assembly of prereplication complexes in late mitosis. Mol Cell Biol 2000;20:8602-12 28. Durando M, Tateishi S, Vaziri C. A non-catalytic role of DNA polymerase eta in recruiting Rad18 and promoting PCNA monoubiquitination at stalled replication forks. Nucleic Acids Res 2013;41:3079-93 29. Liu G, Chen X. DNA polymerase eta, the product of the xeroderma pigmentosum variant gene and a target of p53, modulates the DNA damage checkpoint and p53 activation. Mol Cell Biol 2006;26:1398-413 30. Diamant N, Hendel A, Vered I, Carell T, Reissner T, de Wind N, et al. DNA damage bypass operates in the S and G2 phases of the cell cycle and exhibits differential mutagenicity. Nucleic Acids Res 2012;40:170-80 31. Kannouche P, Broughton BC, Volker M, Hanaoka F, Mullenders LH, Lehmann AR. Domain structure, localization, and function of DNA polymerase eta, defective in xeroderma pigmentosum variant cells. Genes Dev 2001;15:158-72 32. Despras E, Sittewelle M, Pouvelle C, Delrieu N, Cordonnier AM, Kannouche PL. Rad18- dependent SUMOylation of human specialized DNA polymerase eta is required to prevent under-replicated DNA. Nature communications 2016;7:13326 33. Sokol AM, Cruet-Hennequart S, Pasero P, Carty MP. DNA polymerase eta modulates replication fork progression and DNA damage responses in platinum-treated human cells. Sci Rep 2013;3:3277 34. Niida H, Katsuno Y, Banerjee B, Hande MP, Nakanishi M. Specific role of Chk1 phosphorylations in cell survival and checkpoint activation. Mol Cell Biol 2007;27:2572- 81 35. Baldeck N, Janel-Bintz R, Wagner J, Tissier A, Fuchs RP, Burkovics P, et al. FF483-484 motif of human Poleta mediates its interaction with the POLD2 subunit of Poldelta and contributes to DNA damage tolerance. Nucleic Acids Res 2015;43:2116-25 36. Hoege C, Pfander B, Moldovan GL, Pyrowolakis G, Jentsch S. RAD6-dependent DNA repair is linked to modification of PCNA by ubiquitin and SUMO. Nature 2002;419:135- 41

Page 22

37. Choe KN, Nicolae CM, Constantin D, Imamura Kawasawa Y, Delgado-Diaz MR, De S, et al. HUWE1 interacts with PCNA to alleviate replication stress. EMBO reports 2016;17:874-86 38. Minocherhomji S, Ying S, Bjerregaard VA, Bursomanno S, Aleliunaite A, Wu W, et al. Replication stress activates DNA repair synthesis in mitosis. Nature 2015;528:286-90 39. Bergoglio V, Boyer AS, Walsh E, Naim V, Legube G, Lee MY, et al. DNA synthesis by Pol eta promotes fragile site stability by preventing under-replicated DNA in mitosis. J Cell Biol 2013;201:395-408 40. Fokas E, Prevo R, Pollard JR, Reaper PM, Charlton PA, Cornelissen B, et al. Targeting ATR in vivo using the novel inhibitor VE-822 results in selective sensitization of pancreatic tumors to radiation. Cell Death & Disease 2012;3:e441 41. Barnes RP, Hile SE, Lee MY, Eckert KA. DNA polymerases eta and kappa exchange with the polymerase delta holoenzyme to complete common fragile site synthesis. DNA Repair 2017;57:1-11 42. Shah SN, Opresko PL, Meng X, Lee MY, Eckert KA. DNA structure and the Werner protein modulate human DNA polymerase delta-dependent replication dynamics within the common fragile site FRA16D. Nucleic Acids Res 2010;38:1149-62 43. Lormand JD, Buncher N, Murphy CT, Kaur P, Lee MY, Burgers P, et al. DNA polymerase delta stalls on telomeric lagging strand templates independently from G- quadruplex formation. Nucleic Acids Res 2013;41:10323-33 44. Bhowmick R, Minocherhomji S, Hickson ID. RAD52 Facilitates Mitotic DNA Synthesis Following Replication Stress. Mol Cell 2016;64:1117-26 45. Yamanaka K, Chatterjee N, Hemann MT, Walker GC. Inhibition of mutagenic translesion synthesis: A possible strategy for improving chemotherapy? PLoS Genetics 2017;13:e1006842 46. Mohni KN, Thompson PS, Luzwick JW, Glick GG, Pendleton CS, Lehmann BD, et al. A Synthetic Lethal Screen Identifies DNA Repair Pathways that Sensitize Cancer Cells to Combined ATR Inhibition and Cisplatin Treatments. PLoS One 2015;10:e0125482 47. Doles J, Oliver TG, Cameron ER, Hsu G, Jacks T, Walker GC, et al. Suppression of Rev3, the catalytic subunit of Pol{zeta}, sensitizes drug-resistant lung tumors to chemotherapy. Proc Natl Acad Sci U S A 2010;107:20786-91 48. Pillaire MJ, Selves J, Gordien K, Gourraud PA, Gentil C, Danjoux M, et al. A 'DNA replication' signature of progression and negative outcome in colorectal cancer. Oncogene 2010;29:876-87

Page 23

Figure Legends

Figure 1: Pol η Expression is Up-Regulated During Replication Stress. (A) mRNA levels.

The indicated cells were treated with Aph (DMSO solvent) for 24 hours (8988T) or 48 hours

(U2OS; BJ-5A), and changes in POLH and POLK transcript levels, relative to 18S RNA, were analyzed by qRT-PCR. (B) Protein levels. Cells were treated as in (A) and analyzed by immunoblot. Relative changes in Pol η protein, normalized to PCNA, are indicated. U, untreated; D, DMSO treated. (C) Changes in replication proteins. Immunoblot analysis for

U2OS cells treated with Aph for 24 hours. (D) HU response. U2OS cells were treated with HU for 48 hours and analyzed by quantitative immunoblot. (E) POLH induction is p53- independent. Wild-type and p53-/- HCT-116 cells were treated with Aph for 24 hours as indicated and processed for qRT-PCR. (F). Pol η induction is p53-independent. Wild-type and p53-/- HCT-116 cells were treated with Aph for 24 hours or UV-irradiated, followed by immunoblot analysis. Relative changes in Pol η protein, normalized to Actin or PCNA, are indicated. All experiments in this figure have been performed at minimum with three biological replicates, using three technical replicates where necessary. Graphs show means with S.E.M. All statistical analyses were done by One- or Two-Way ANOVA with Post-Hoc analyses. * = p<0.05; ** = p<0.01; ***= p<0.001; **** = p<0.0001.

Figure 2: Replication Stress Induces Pol η Relocalization. (A) Endogenous Pol η foci formation. U2OS cells were treated as indicated for 24 hours before processing for IF. Fixed cells were stained with Pol Eta antibody and counterstained with DAPI. The number of foci in each cell was determined by thresholding and graphed, showing the mean and standard deviation. Data are from individual cells. (B) Chromatin Association. Cells were treated as in

Page 24

(A), but fractionated into cytoplasmic (S2), soluble nuclear (S3), or chromatin fractions (P3), and analyzed by immunoblot. (C-E) Exogenous Pol η Foci Formation. 24 hours following transfection with RFP-POLH expression vector, U2OS cells were treated with 0.6 µM Aph for

24 hours, 1.2 µM Aph for 6 hours, or 20J/m2 UV and recovered 6 hours. Following fixation, cells were stained with PCNA antibody and the number of RFP-Pol Eta foci was quantified (D) as in

(A). (E) Using thresholding for RFP-Pol Eta and PCNA, the intersection of the two was determined and analyzed. Data were analyzed by T-Test or One-Way ANOVA with Tukey’s multiple comparison. **** = p<0.0001

Figure 3: Pol η Mitigates Late Cell Cycle Delay and ATR activation in Response to

Replication Stress. (A, B) Cell cycle progression. XPV and XPV+POLH complemented cells

(A) or wild-type and POLH-/- C.1 8988T cells (B) were treated with Aph for 24 hours followed by PI staining and analysis by flow cytometry (see also Supplemental Figure 3). Statistical significance #, relative to untreated; *, comparison of cell lines. (C, D) ATR signaling.

XPV/complemented XPV Cells (C) or 8988T/POLH-/- cells (D) were treated with varying doses of Aph for 24 hours and analyzed by immunoblot. Quantification of pChk1(Ser317) relative to total Chk1 is shown. (E) Domain analysis. XPV and WT or mutant POLH complemented cells were treated with Aph (A) or DMSO (D) and analyzed for pChk1 as in (C). PIP*, C-terminal PIP domain mutant; UBZ*, UBZ domain mutant. (F). Chromatin association. XPV and complemented cells were treated as in (E), and separated into Triton soluble and insoluble fractions. All statistical analyses were done by One- or Two-Way ANOVA with Post-Hoc analyses. Graphs shown means with S.E.M.

Page 25

Figure 4: Pol η-deficient cells are Sensitive to Replication Stress-inducing Drugs. (A)

Clonogenic survival after Aph. Wild-type (, black line) or POLH-/- (nu; gray lines) cells were treated with Aph for 24 hr (8988T) or 48 hr (U2OS), followed by culturing in the absence of drug for an additional 1-2 weeks. (B) Clonogenic survival after HU. 8988T or U2OS cells were treated as in (A), but with HU instead of Aph. All experiments (A,B) have at least three biological replicates with three technical replicates therein, and were analyzed by Two-Way

ANOVA (p value shown on graph); Post-Hoc test results are also depicted with *. (C) Aph increases apoptosis in Polη-deficient cells. Wild-type or POLH-/- 8988T cells were treated as in

(A), but analyzed by immunoblot at the indicated times following transfer into drug-free medium.

Figure 5: Efficient Replication Stress Recovery Requires Pol η. (A) DMSO solvent control.

Representative scatterplots (EdU vs PI) following 24 hours DMSO treatment of wild-type and

POLH-/- 8988T cells (B). Cell cycle analyses after release from replication blockade.

Representative scatterplots of 1.2µM Aph-treated populations at the start (0 hours) and at indicated hours during recovery from replication stress. (C). Quantitation of various cell populations following Aph release. All data are the mean ± SD and were analyzed by Two-way

ANOVA (p value on graph) with Post-Hoc analyses.

Figure 6: Pol η Prevents MiDAS Following Replication Stress. 8988T wild-type and POLH-/- cells were treated as in Figure 5. (A) Representative scatterplots of pH3 vs PI intensity with

EdU+ cells labeled red. (B) Quantitation of (pH3+) ÷ (total) cells at all timepoints. (C)

Page 26

Quantitation of (pH3+ EdU+) ÷ (total) cells at all timepoints. (D) Quantitation of (pH3+EdU+) ÷

(pH3+) within the mitotic cell population. Note that Panel B is a linear scale while Panels C and

D are logarithmic scales. All data are the mean ± SD were analyzed by Two-way ANOVA (p value on graph) with Post-Hoc analyses.

Figure 7: Pol η-Deficiency is Synthetic Lethal with Replication Stress and ATR inhibition.

(A) Apoptotic signaling induced by ATR inhibition. 8988T cells were treated with the ATR inhibitor VE-822 (500 nM) for 1 hour prior to treatment with VE-822 ± 1.2 µM Aph for 24 hours and analyzed by immunoblot. (B) ATR inhibition mitigates Pol η induction. 8988T cells were treated as in (A), and analyzed quantitatively for pChk1 (left) and Pol η (right) levels, relative to

PCNA. (C) ATR depletion. Following siRNA transfection, wild-type and POLH-/- 8988T cells were analyzed for ATR expression. (D) ATR depletion enhances Aph-induced apoptotic signaling. Following siRNA transfection, wild-type and POLH-/- were treated with Aph as indicated for 24 hours before processing for immunoblot. (E) ATR is synthetic lethal with

POLH. Wild-type and POLH-/- cells from (D) were analyzed for clonogenic survival analysis.

Csi, control siRNA. All data are the mean ± SEM and were analyzed by Two-way ANOVA (p value on graph) with Post-Hoc analyses, or T-test (B).

Page 27

DNA Polymerase Eta Prevents Tumor Cell Cycle Arrest And Cell Death During Recovery from Replication Stress

Ryan P Barnes, Wei-Chung Tsao, George-Lucian Moldovan, et al.

Cancer Res Published OnlineFirst October 8, 2018.

Updated version Access the most recent version of this article at: doi:10.1158/0008-5472.CAN-17-3931

Supplementary Access the most recent supplemental material at: Material http://cancerres.aacrjournals.org/content/suppl/2018/10/06/0008-5472.CAN-17-3931.DC1

Author Author manuscripts have been peer reviewed and accepted for publication but have not yet been Manuscript edited.

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/early/2018/10/10/0008-5472.CAN-17-3931. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.