Evaluation of Seven Different RNA-Seq Alignment Tools Based on Experimental Data from the Model Plant Arabidopsis Thaliana
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
De Novo Genomic Analyses for Non-Model Organisms: an Evaluation of Methods Across a Multi-Species Data Set
De novo genomic analyses for non-model organisms: an evaluation of methods across a multi-species data set Sonal Singhal [email protected] Museum of Vertebrate Zoology University of California, Berkeley 3101 Valley Life Sciences Building Berkeley, California 94720-3160 Department of Integrative Biology University of California, Berkeley 1005 Valley Life Sciences Building Berkeley, California 94720-3140 June 5, 2018 Abstract High-throughput sequencing (HTS) is revolutionizing biological research by enabling sci- entists to quickly and cheaply query variation at a genomic scale. Despite the increasing ease of obtaining such data, using these data effectively still poses notable challenges, especially for those working with organisms without a high-quality reference genome. For every stage of analysis – from assembly to annotation to variant discovery – researchers have to distinguish technical artifacts from the biological realities of their data before they can make inference. In this work, I explore these challenges by generating a large de novo comparative transcriptomic dataset data for a clade of lizards and constructing a pipeline to analyze these data. Then, using a combination of novel metrics and an externally validated variant data set, I test the efficacy of my approach, identify areas of improvement, and propose ways to minimize these errors. I arXiv:1211.1737v1 [q-bio.GN] 8 Nov 2012 find that with careful data curation, HTS can be a powerful tool for generating genomic data for non-model organisms. Keywords: de novo assembly, transcriptomes, suture zones, variant discovery, annotation Running Title: De novo genomic analyses for non-model organisms 1 Introduction High-throughput sequencing (HTS) is poised to revolutionize the field of evolutionary genetics by enabling researchers to assay thousands of loci for organisms across the tree of life. -
MATCH-G Program
MATCH-G Program The MATCH-G toolset MATCH-G (Mutational Analysis Toolset Comparing wHole Genomes) Download the Toolset The toolset is prepared for use with pombe genomes and a sample genome from Sanger is included. However, it is written in such a way as to allow it to utilize any set or number of chromosomes. Simply follow the naming convention "chromosomeX.contig.embl" where X=1,2,3 etc. For use in terminal windows in Mac OSX or Unix-like environments where Perl is present by default. Toolset Description Version History 2.0 – Bug fixes related to scaling to other genomes. First version of GUI interface. 1.0 – Initial Release. Includes build, alignment, snp, copy, and gap resolution routines in original form. Please note this project in under development and will undergo significant changes. Project Description The MATCH-G toolset has been developed to facilitate the evaluation of whole genome sequencing data from yeasts. Currently, the toolset is written for pombe strains, however the toolset is easily scalable to other yeasts or other sequenced genomes. The included tools assist in the identification of SNP mutations, short (and long) insertion/deletions, and changes in gene/region copy number between a parent strain and mutant or revertant strain. Currently, the toolset is run from the command line in a unix or similar terminal and requires a few additional programs to run noted below. Installation It is suggested that a separate folder be generated for the toolset and generated files. Free disk space proportional to the original read datasets is recommended. The toolset utilizes and requires a few additional free programs: Bowtie rapid alignment software: http://bowtie-bio.sourceforge.net/index.shtml (Langmead B, Trapnell C, Pop M, Salzberg SL. -
Arabidopsis Thaliana
Downloaded from genome.cshlp.org on September 28, 2021 - Published by Cold Spring Harbor Laboratory Press RESEARCH A Physical Map of Chromosome 2 of Arabidopsis thaliana Eve Ann Zachgo, 2,4 Ming Li Wang, 1'2'4 Julia Dewdney, 1'2 David Bouchez, 3 Christine Carnilleri, 3 Stephen Belmonte, 2 Lu Huang, 2 Maureen Dolan, 2 and Howard M. Goodman 1'2'5 1Department of Genetics, Harvard Medical School and 2Department of Molecular Biology, Massachusetts General Hospital, Boston, Massachusetts 02114; 3Laboratoire de Biologie Cellulaire, Institut National de la Recherche Agronomique (INRA), 78026 Versailles CEDEX, France A yeast artificial chromosome (YAC] physical map of chromosome 2 of Arabidopsis thaliana has been constructed by hybridization of 69 DNA markers and 61 YAC end probes to gridded arrays of YAC clones. Thirty-four YACs in four contigs define the chromosome. Complete closure of the map was not attained because some regions of the chromosome were repetitive or were not represented in the YAC library. Based on the sizes of the YACs and their coverage of the chromosome, the length of chromosome 2 is estimated to be at least 18 Mb. These data provide the means for immediately identifying the YACs containing a genetic locus mapped on Arabidopsis chromosome 2. The small flowering plant Arabidopsis thaliana is ters (Maluszynska and Heslop-Harrison 1991; A1- an excellent model system for metabolic, genetic, bini 1994; Copenhaver et al. 1995). We present and developmental studies in plants. Its haploid here a YAC contig physical map of chromosome nuclear genome is small (-100 Mb), consisting of 2 of A. -
To Find Information About Arabidopsis Genes Leonore Reiser1, Shabari
UNIT 1.11 Using The Arabidopsis Information Resource (TAIR) to Find Information About Arabidopsis Genes Leonore Reiser1, Shabari Subramaniam1, Donghui Li1, and Eva Huala1 1Phoenix Bioinformatics, Redwood City, CA USA ABSTRACT The Arabidopsis Information Resource (TAIR; http://arabidopsis.org) is a comprehensive Web resource of Arabidopsis biology for plant scientists. TAIR curates and integrates information about genes, proteins, gene function, orthologs gene expression, mutant phenotypes, biological materials such as clones and seed stocks, genetic markers, genetic and physical maps, genome organization, images of mutant plants, protein sub-cellular localizations, publications, and the research community. The various data types are extensively interconnected and can be accessed through a variety of Web-based search and display tools. This unit primarily focuses on some basic methods for searching, browsing, visualizing, and analyzing information about Arabidopsis genes and genome, Additionally we describe how members of the community can share data using TAIR’s Online Annotation Submission Tool (TOAST), in order to make their published research more accessible and visible. Keywords: Arabidopsis ● databases ● bioinformatics ● data mining ● genomics INTRODUCTION The Arabidopsis Information Resource (TAIR; http://arabidopsis.org) is a comprehensive Web resource for the biology of Arabidopsis thaliana (Huala et al., 2001; Garcia-Hernandez et al., 2002; Rhee et al., 2003; Weems et al., 2004; Swarbreck et al., 2008, Lamesch, et al., 2010, Berardini et al., 2016). The TAIR database contains information about genes, proteins, gene expression, mutant phenotypes, germplasms, clones, genetic markers, genetic and physical maps, genome organization, publications, and the research community. In addition, seed and DNA stocks from the Arabidopsis Biological Resource Center (ABRC; Scholl et al., 2003) are integrated with genomic data, and can be ordered through TAIR. -
The Enigmatic Charcot-Leyden Crystal Protein
C al & ellu ic la n r li Im C m f u Journal of o n l o a l n o r Clarke et al., J Clin Cell Immunol 2015, 6:2 g u y o J DOI: 10.4172/2155-9899.1000323 ISSN: 2155-9899 Clinical & Cellular Immunology Review Article Open Access The Enigmatic Charcot-Leyden Crystal Protein (Galectin-10): Speculative Role(s) in the Eosinophil Biology and Function Christine A Clarke1,3, Clarence M Lee2 and Paulette M Furbert-Harris1,3,4* 1Department of Microbiology, Howard University College of Medicine, Washington, D.C., USA 2Department of Biology, Howard University College of Arts and Sciences, Washington, D.C., USA 3Howard University Cancer Center, Howard University College of Medicine, Washington, D.C., USA 4National Human Genome Center, Howard University College of Medicine, Washington, D.C., USA *Corresponding author: Furbert-Harris PM, Department of Microbiology, Howard University Cancer Center, 2041 Georgia Avenue NW, Room #530, 20060, Washington, D.C., USA, Tel: 202-806-7722, Fax: 202-667-1686; Email: [email protected] Received date: Febuary 22, 2015, Accepted date: April 25, 2015, Published date: April 29, 2015 Copyright: © 2015 Clarke CA, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Abstract Eosinophilic inflammation in peripheral tissues is typically marked by the deposition of a prominent eosinophil protein, Galectin-10, better known as Charcot-Leyden crystal protein (CLC). Unlike the eosinophil’s four distinct toxic cationic proteins and enzymes [major basic protein (MBP), eosinophil-derived neurotoxin (EDN), eosinophil cationic protein (ECP), and eosinophil peroxidase (EPO)], there is a paucity of information on the precise role of the crystal protein in the biology of the eosinophil. -
Spontaneous Puberty in 46,XX Subjects with Congenital Lipoid Adrenal Hyperplasia
Spontaneous puberty in 46,XX subjects with congenital lipoid adrenal hyperplasia. Ovarian steroidogenesis is spared to some extent despite inactivating mutations in the steroidogenic acute regulatory protein (StAR) gene. K Fujieda, … , T Sugawara, J F Strauss 3rd J Clin Invest. 1997;99(6):1265-1271. https://doi.org/10.1172/JCI119284. Research Article Congenital lipoid adrenal hyperplasia (lipoid CAH) is the most severe form of CAH in which the synthesis of all gonadal and adrenal cortical steroids is markedly impaired. We report here the clinical, endocrinological, and molecular analyses of two unrelated Japanese kindreds of 46,XX subjects affected with lipoid CAH who manifested spontaneous puberty. Phenotypic female infants with 46,XX karyotypes were diagnosed with lipoid CAH as newborns based on a clinical history of failure to thrive, hyperpigmentation, hyponatremia, hyperkalemia, and low basal values of serum cortisol and urinary 17-hydroxycorticosteroid and 17-ketosteroid. These patients responded to treatment with glucocorticoid and 9alpha- fludrocortisone. Spontaneous thelarche occurred in association with increased serum estradiol levels at the age of 10 and 11 yr, respectively. Pubic hair developed at the age of 12 yr 11 mo in one subject and menarche was at the age of 12 yr in both cases. Both subjects reported periodic menstrual bleeding and subsequently developed polycystic ovaries. To investigate the molecular basis of the steroidogenic lesion in these patients, the StAR gene was characterized by PCR and direct DNA sequence -
Large Scale Genomic Rearrangements in Selected Arabidopsis Thaliana T
bioRxiv preprint doi: https://doi.org/10.1101/2021.03.03.433755; this version posted March 7, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 Large scale genomic rearrangements in selected 2 Arabidopsis thaliana T-DNA lines are caused by T-DNA 3 insertion mutagenesis 4 5 Boas Pucker1,2+, Nils Kleinbölting3+, and Bernd Weisshaar1* 6 1 Genetics and Genomics of Plants, Center for Biotechnology (CeBiTec), Bielefeld University, 7 Sequenz 1, 33615 Bielefeld, Germany 8 2 Evolution and Diversity, Department of Plant Sciences, University of Cambridge, Cambridge, 9 United Kingdom 10 3 Bioinformatics Resource Facility, Center for Biotechnology (CeBiTec, Bielefeld University, 11 Sequenz 1, 33615 Bielefeld, Germany 12 + authors contributed equally 13 * corresponding author: Bernd Weisshaar 14 15 BP: [email protected], ORCID: 0000-0002-3321-7471 16 NK: [email protected], ORCID: 0000-0001-9124-5203 17 BW: [email protected], ORCID: 0000-0002-7635-3473 18 19 20 21 22 23 24 25 26 27 28 29 30 page 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.03.03.433755; this version posted March 7, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. -
Comprehensive Analysis of CRISPR/Cas9-Mediated Mutagenesis in Arabidopsis Thaliana by Genome-Wide Sequencing
International Journal of Molecular Sciences Article Comprehensive Analysis of CRISPR/Cas9-Mediated Mutagenesis in Arabidopsis thaliana by Genome-Wide Sequencing Wenjie Xu 1,2 , Wei Fu 2, Pengyu Zhu 2, Zhihong Li 1, Chenguang Wang 2, Chaonan Wang 1,2, Yongjiang Zhang 2 and Shuifang Zhu 1,2,* 1 College of Plant Protection, China Agricultural University, Beijing 100193 China 2 Institute of Plant Quarantine, Chinese Academy of Inspection and Quarantine, Beijing 100176, China * Correspondence: [email protected] Received: 9 July 2019; Accepted: 21 August 2019; Published: 23 August 2019 Abstract: The clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein (Cas) system has been widely applied in functional genomics research and plant breeding. In contrast to the off-target studies of mammalian cells, there is little evidence for the common occurrence of off-target sites in plants and a great need exists for accurate detection of editing sites. Here, we summarized the precision of CRISPR/Cas9-mediated mutations for 281 targets and found that there is a preference for single nucleotide deletions/insertions and longer deletions starting from 40 nt upstream or ending at 30 nt downstream of the cleavage site, which suggested the candidate sequences for editing sites detection by whole-genome sequencing (WGS). We analyzed the on-/off-target sites of 6 CRISPR/Cas9-mediated Arabidopsis plants by the optimized method. The results showed that the on-target editing frequency ranged from 38.1% to 100%, and one off target at a frequency of 9.8%–97.3% cannot be prevented by increasing the specificity or reducing the expression level of the Cas9 enzyme. -
Locdb: Experimental Annotations of Localization for Homo Sapiens and Arabidopsis Thaliana Shruti Rastogi1,* and Burkhard Rost1,2,3
D230–D234 Nucleic Acids Research, 2011, Vol. 39, Database issue Published online 11 November 2010 doi:10.1093/nar/gkq927 LocDB: experimental annotations of localization for Homo sapiens and Arabidopsis thaliana Shruti Rastogi1,* and Burkhard Rost1,2,3 1Department of Biochemistry and Molecular Biophysics, Columbia University, 701 West, 168th Street, New York, NY 10032, USA, 2Technical University Munich, Bioinformatics, Department of Computer Science and Institute of Advanced Studies (IAS) and 3New York Consortium on Membrane Protein Structure (NYCOMPS), TUM Bioinformatics, Boltzmannstr. 3, 85748 Garching, Germany Downloaded from Received August 15, 2010; Revised September 24, 2010; Accepted September 27, 2010 ABSTRACT stepped up to the challenge to increase the amount of annotations (6–15). These data sets capture aspects of LocDB is a manually curated database with protein function and, more generally, of global cellular nar.oxfordjournals.org experimental annotations for the subcellular processes. localizations of proteins in Homo sapiens (HS, UniProt (release 2010_07) (16) constitutes the most human) and Arabidopsis thaliana (AT, thale cress). comprehensive and, arguably, the most accurate Currently, it contains entries for 19 604 UniProt resource with experimental annotations of subcellular proteins (HS: 13 342; AT: 6262). Each database localization. However, even this excellent resource entry contains the experimentally derived locali- remains incomplete for the proteomes from Homo sapiens (HS) and Arabidopsis thaliana (AT): of the zation in Gene Ontology (GO) terminology, the at Medical Center Library, Duke University on January 13, 2011 experimental annotation of localization, localization 20 282 human proteins in Swiss-Prot (17), 14 502 have predictions by state-of-the-art methods and, where annotations of localization (72%), but for only 3720 (18%) these annotations are experimental. -
An Open-Sourced Bioinformatic Pipeline for the Processing of Next-Generation Sequencing Derived Nucleotide Reads
bioRxiv preprint doi: https://doi.org/10.1101/2020.04.20.050369; this version posted May 28, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. An open-sourced bioinformatic pipeline for the processing of Next-Generation Sequencing derived nucleotide reads: Identification and authentication of ancient metagenomic DNA Thomas C. Collin1, *, Konstantina Drosou2, 3, Jeremiah Daniel O’Riordan4, Tengiz Meshveliani5, Ron Pinhasi6, and Robin N. M. Feeney1 1School of Medicine, University College Dublin, Ireland 2Division of Cell Matrix Biology Regenerative Medicine, University of Manchester, United Kingdom 3Manchester Institute of Biotechnology, School of Earth and Environmental Sciences, University of Manchester, United Kingdom [email protected] 5Institute of Paleobiology and Paleoanthropology, National Museum of Georgia, Tbilisi, Georgia 6Department of Evolutionary Anthropology, University of Vienna, Austria *Corresponding Author Abstract The emerging field of ancient metagenomics adds to these Bioinformatic pipelines optimised for the processing and as- processing complexities with the need for additional steps sessment of metagenomic ancient DNA (aDNA) are needed in the separation and authentication of ancient sequences from modern sequences. Currently, there are few pipelines for studies that do not make use of high yielding DNA cap- available for the analysis of ancient metagenomic DNA ture techniques. These bioinformatic pipelines are tradition- 1 4 ally optimised for broad aDNA purposes, are contingent on (aDNA) ≠ The limited number of bioinformatic pipelines selection biases and are associated with high costs. -
Sequence Alignment/Map Format Specification
Sequence Alignment/Map Format Specification The SAM/BAM Format Specification Working Group 3 Jun 2021 The master version of this document can be found at https://github.com/samtools/hts-specs. This printing is version 53752fa from that repository, last modified on the date shown above. 1 The SAM Format Specification SAM stands for Sequence Alignment/Map format. It is a TAB-delimited text format consisting of a header section, which is optional, and an alignment section. If present, the header must be prior to the alignments. Header lines start with `@', while alignment lines do not. Each alignment line has 11 mandatory fields for essential alignment information such as mapping position, and variable number of optional fields for flexible or aligner specific information. This specification is for version 1.6 of the SAM and BAM formats. Each SAM and BAMfilemay optionally specify the version being used via the @HD VN tag. For full version history see Appendix B. Unless explicitly specified elsewhere, all fields are encoded using 7-bit US-ASCII 1 in using the POSIX / C locale. Regular expressions listed use the POSIX / IEEE Std 1003.1 extended syntax. 1.1 An example Suppose we have the following alignment with bases in lowercase clipped from the alignment. Read r001/1 and r001/2 constitute a read pair; r003 is a chimeric read; r004 represents a split alignment. Coor 12345678901234 5678901234567890123456789012345 ref AGCATGTTAGATAA**GATAGCTGTGCTAGTAGGCAGTCAGCGCCAT +r001/1 TTAGATAAAGGATA*CTG +r002 aaaAGATAA*GGATA +r003 gcctaAGCTAA +r004 ATAGCT..............TCAGC -r003 ttagctTAGGC -r001/2 CAGCGGCAT The corresponding SAM format is:2 1Charset ANSI X3.4-1968 as defined in RFC1345. -
A Bioinformatics Analysis of the Arabidopsis Thaliana Epigenome Ikhlak Ahmed
A bioinformatics analysis of the arabidopsis thaliana epigenome Ikhlak Ahmed To cite this version: Ikhlak Ahmed. A bioinformatics analysis of the arabidopsis thaliana epigenome. Agricultural sciences. Université Paris Sud - Paris XI, 2011. English. NNT : 2011PA112230. tel-00684391 HAL Id: tel-00684391 https://tel.archives-ouvertes.fr/tel-00684391 Submitted on 2 Apr 2012 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. 2011 PhD Thesis Ikhlak Ahmed Laboratoire: CNRS UMR8197 - INSERM U1024 Institut de Biologie de l'ENS(IBENS) Ecole Doctorale : Sciences Du Végétal A Bioinformatics analysis of the Arabidopsis thaliana Epigenome Supervisors: Dr. Chris Bowler and Dr. Vincent Colot Jury Prof. Dao-Xiu Zhou President Prof. Christian Fankhauser Rapporteur Dr. Raphaël Margueron Rapporteur Dr. Chris Bowler Examiner Dr. Vincent Colot Examiner Dr. Allison Mallory Examiner Dr. Michaël Weber Examiner Acknowledgement I express my deepest gratitude to my supervisors Dr. Chris Bowler and Dr. Vincent Colot for the support, advice and freedom that I enjoyed working with them. I am very thankful to Chris Bowler who trusted in me and gave me the opportunity to come here and work in the excellent possible conditions. I have no words to express my thankfulness to Vincent Colot for his enthusiastic supervision and the incredibly valuable sessions we spent together that shaped my understanding of DNA methylation.