A New Loach of the Genus Oxynoemacheilus from the Tigris

Iran. J. Ichthyol. (December 2016), 3(4): 236–250 Received: October 12, 2016 © 2016 Iranian Society of Ichthyology Accepted: December 01, 2016 P-ISSN: 2383-1561; E-ISSN: 2383-0964 doi: 10.7508/iji.2016. http://www.ijichthyol.org

A new loach of the genus Oxynoemacheilus from the Tigris River drainage and its phylogenetic relationships among the nemacheilid fishes (Teleostei: Nemacheilidae) in the Middle East based on mtDNA COI sequences

Golnaz SAYYADZADEH1, Soheil EAGDERI2, Hamid Reza ESMAEILI1*

1Ichthyology and Molecular Systematics Research Lab., Department of Biology, College of Sciences, Shiraz University, Shiraz, Iran. 2Department of Fisheries, Faculty of Natural Resources, University of Tehran, Karaj, Alborz Province, Iran. * Email: [email protected]

Abstract: Oxynoemacheilus parvinae, new species, from the tributaries of the Iranian Sirvan River drainage, belongs to a group of Oxynoemacheilus having a suborbital groove in males and elongated body. It is distinguished from the other species of this group in the Tigris River drainage by a combination of the following characters: 8½-9½ branched dorsal-fin rays, large to medium dark-brown spots especially on the post-dorsal part, emarginated caudal fin, angular shape of bony capsule of swim bladder with developed posterior process, longer head and shallower body. It is also diagnosed from its nearest species (O. bergianus and O. longipinnis) by two fixed, diagnostic nucleotide substitutions in the mtDNA COI barcode region, and a K2P nearest-neighbour distance of 1.4% to O. longipinnis. Maximum Likelihood and Bayesian phylogeny reconstructed based on COI barcode region place the sequenced nemacheilid fish into a monophyletic clade which show between 1.4 % (O. parvinae vs. O. longipinnis) and 16.3 % (O. longipinnis vs. O. merga) K2P sequence divergence. Keywords: Freshwater fish, Middle East, Nemacheilid fish, DNA barcoding. Zoobank: urn:lsid:zoobank.org:pub:90C04FE1-2E63-4D98-86D0-E3758283B227 urn:lsid:zoobank.org:act:6E75409D-9F58-43A7-9E79-857BC79CEA78 Citation: Sayyadzadeh, G.; Eagderi, S. & Esmaeili, H.R. 2016. A new loach of the genus Oxynoemacheilus from the Tigris River drainage and its phylogenetic relationships among the nemacheilid fishes (Teleostei: Nemacheilidae) in the Middle East based on mtDNA COI sequences. Iranian Journal of Ichthyology 3(4): 236-250.

Introduction 2016) are common fishes all over the Middle East The loach fishes of the family Nemacheilidae Regan, (Freyhof et al. 2011). Esmaeili et al. (2010) 1911 with about 667 (24.6% new description for last recognized eight species, Bahrami Kamangar et al. ten years) known species (Eschmeyer & Fang 2016) (2014) described three new species (O. chomanicus, and 48 genera is a species-rich lineage of O. kurdistanicus and O. zagrosensis) with report of cypriniforms, consisting mostly of small benthic two additional species (O. argyrogramma and fishes inhabiting freshwater environments, mostly in O. hamwii) from Tigris River tributaries of Iran, and Eurasia, with one genus, Afronemacheilus, found in Jouladeh-Roudbar et al. (2015) reported 12 species Africa (see Kottelat 2012). including O. araxensis, O. frenatus and O. angorae Nemacheilid loaches of the genus Oxynoema- based on available previously published data. cheilus Bănăraescu & Nalbant, 1967 with about 49 Oxynoemacheilus freyhofi and O. karunensis are two valid species (Eschmeyer & Fang 2016; Freyhof other recently described species from the Karoun 236

Sayyadzadeh et al.- A new species of loach of the genus Oxynoemacheilus from the Tigris River

River drainage of Iran (Jouladeh-Roudbar et al. 2016; Zoological Museum-Collection of Biology Freyhof 2016). However, Freyhof (2016) considered Department, Shiraz University (ZM-CBSU). O. freyhofi as a synonym of O. euphraticus without Measurements were made with dial calipers and providing any evidence. recorded to 0.1 mm. All measurements are made From these, O. araxensis has been reported from point to point, never by projections. Methods for the Aras River tributaries of Turkey and probably counts and measurements follow Kottelat & Freyhof Iran, O. bergianus is known from Caspian sea, Tigris, (2007). Standard length (SL) is measured from the tip Lakes Namak and Urmia basins, O. brandtii is found of the snout to the end of the hypural complex. The in the Kura and Aras River drainages and in the Lake length of the caudal peduncle is measured from the Urmia basin, O. chomanicus with two others newly insertion of the last anal-fin ray to the end of the described species (O. kurdistanicus and hypural complex, at mid-height of the caudal-fin O. zagrosensis) is known from the Choman base. The last two branched rays articulating on a watershed in the Tigris basin, O. longipinnis is single pterygiophore in the dorsal and anal fins are known from the Tigris, O. persa is known from the counted as "1½". The holotype is included in the Mond and the endorheic Kor River drainage and calculation of means and SD. O. tongiorgii is endemic to the Kor River drainage. It Abbreviations: SL, standard length; HL, head length, seems that at least six additional species occur in the ZM-CBSU, Zoological Museum of Shiraz entire Tigris drainage (O. argyrogramma, University, Collection of Biology Department, O. euphraticus, O. frenatus, O. freyhofi, O. hamwii Shiraz. and O. karunensis). Oxynoemacheilus argyro- DNA extraction and PCR: Genomic DNA was gramma has been reported from the Do-rud River, extracted using Macherey and Nagel NucleoSpin® Sirvan basin, a tributary of the Tigris, Sarvabad, Tissue kits following the manufacturer’s protocol on Kurdistan, Iran and O. hamwii from the Gaveh-Rud an Eppendorf EpMotion® pipetting-roboter with River, Sirvan basin, a tributary of the Tigris, vacuum manifold. The standard vertebrate DNA Kurdistan, Iran (Bahrami Kamangar et al. 2014). The barcode region of the COI (cytochrome c oxidase presence of O. euphraticus and O. frenatus in the subunit 1) was amplified using a M13 tailed primer Iranian part of the Tigris needs to be confirmed but cocktail including FishF2_t1 (5’TGTAAAACGAC they are known to occur in Syria or in Turkey and GGCCAGTCGACTAATCATAAAGATATCGCA Iraq. C), FishR2_t1 (5’CAGGAAACAGCTATGAC ACT Here, based on the morphological characters and TCAGGGTGACCGAAGAATCAGAA), VF2_t1 (5 molecular data set, we describe an additional ’TGTAAAACGACGGCCAGTCAACCAACCACA Oxynoemacheilus species from the tributaries of the AAGACATTGGCAC) and FR1d_t1 (5’CAGGAA Iranian Sirvan River in the Tigris basin and discuss ACAGCTATGACACCTCAGGGTGTCCGAARA its molecular affinity to all Oxynoemacheilus species AYCARAA) (Ivanova et al. 2007). Sequencing of and genera of nemacheilids from Europe and the the ExoSAP-IT (USB) purified PCR product in both Middle East, and all the genera known from Pakistan directions was conducted at Macrogen Europe and Western India, based on the analysis of Laboratories with forward sequencing primer M13F mitochondrial DNA (COI sequences). (5’GTAAAACGACGGCCAGT) and reverse sequencing primer M13R-pUC (5’CAGGAAACAGCTA Material and Methods TGAC). After anesthesia by 1% clove solution, fishes were Molecular data analysis: We used all of 132 fixed in 5% formaldehyde and later stored in 70% or sequences from Sayyadzadeh et al. (under review) directly fixed in 96% ethanol and deposited in the and an additional 8 sequences in this study. Data 237 Iran. J. Ichthyol. (December 2016), 3(4): 236-250

processing and sequence assembly was done in BI tree including the posterior probability values BioEdit (Hall 1999) and the ClustalW algorithm from the Maximum Likelihood phylogram is (Higgins & Sharp 1988) was used to create a DNA presented (Fig. 1). The screening for diagnostic sequence alignment. Modeltest (Posada & Crandall nucleotide substitutions in the COI barcode region of 1998), implemented in the MEGA 6 software the studied Oxynoemacheilus species delivered two (Tamura et al. 2011), was used to determine the most positions for the Leilehrud and Sefidbarg Rivers appropriate sequence evolution model for the given which drains to the Sirvan, Tigris (the Persian Gulf) data, treating gaps and missing data with the partial compared to its nearest species (O. bergianus and deletion option under 95% site coverage cutoff. We O. longipinnis): position 50 (G vs. A), position 563 generated maximum likelihood phylogenetic trees (T vs. C). Table 1 lists the average estimates of the with 10,000 bootstrap replicates in RaxML software evolutionary divergence between the 7.2.5 (Stamatakis 2006) under the GTR+G+I model Oxynoemacheilus species recognised here. of nucleotide substitution, with CAT approximation of rate heterogeneity and fast bootstrap to explore Oxynoemacheilus parvinae, new species species phylogenetic affinities. Bayesian analyses of (Figs. 2-10) nucleotide sequences were run with the parallel Holotype: ZM-CBSU H1987, 57.7mm SL; Iran: version of MrBayes 3.1.2 (Ronquist & Huelsenbeck Kermanshah Province: Javanrud city, at Sharvineh 2003) on a Linux cluster with one processor assigned village, Leilehrud (Leileh River), a tributary of to each Markov chain under the most generalizing Sirvan River drainage, Tigris, 34°49'37.9''N model (GTR+G+I) because overparametrization 46°21'30.0''E; R. Zamaniannejad, S. Babaee, apparently does not negatively affect Bayesian R. Khaefi, M. Masoudi, 20 Aug 2012. analyses (Huelsenbeck & Ranala 2004). Each Paratypes: ZM-CBSU H1973, 14, 27-64mm SL; Bayesian analysis comprised two simultaneous runs same as holotype. of four Metropolis-coupled Markov-chains at the Additional material: ZM-CBSU H1988, 10, 46- default temperature (0.2). Analyses were terminated 66mm SL; Iran: Kermanshah Province: Javanrud after the chains converged significantly, as indicated city, at Kalash Bakhan village, Sefidbarg Spring by the average standard deviation of split frequencies (Leilehrud), a tributary of Sirvan River drainage, <0.01. Tigris, 34°54'11.4''N, 46°12'29.9''E. Bayesian inference of phylogeny was conducted Diagnosis: Oxynoemacheilus parvinae belongs to a for 6,000,000 generations. Seven hundred bootstrap group of Oxynoemacheilus having a suborbital replicates were used as ML branch support values. groove in males and elongated body. It is The posterior probabilities equal/higher than 0.95 distinguished from the other species belong to this and bootstrap supports equal/higher than 70% were group in the Tigris River drainage by a combination considered as strong support values (Toussaint et al. of the following characters: 8½-9½ branched dorsal- 2015). MEGA 6 was also used to compute intra-clade fin rays (vs. 7½-8½ in O. bergianus, 8½ in and inter-clade K2P genetic distances. O. longipinnis, 9½-10½ in O. karunensis) large to medium dark-brown spots especially on the post- Results dorsal part in some individuals independent of size We compared eight COI nucleotide sequences of and sexual dimorphism (vs. pale body pattern in Oxynoemacheilus parvinae with all of 132 sequences O. longipinnis, small and more regular bar like in from our last study (Sayyadzadeh et al. under O. bergianus and O. karunensis), slightly to deeply review). Both the ML and BI phylogenetic trees were emarginated caudal fin (vs. deeply emarginated to mostly similar in their topology, hence here only the forked in O. longipinnis), angular shape of bony 238 Sayyadzadeh et al.- A new species of loach of the genus Oxynoemacheilus from the Tigris River

Fig.1. Maximum Likelihood and Bayesian phylogeny reconstructed based on 617 bp of COI 5’ end. The values beside the branches before and after a slash are ML bootstrap and BI posterior probability values, respectively. The ML bootstrap values less than 50% and posterior probability values less than 0.95 are not shown.

239 Iran. J. Ichthyol. (December 2016), 3(4): 236-250

Table 1. Estimates of evolutionary divergence (%) over sequence pairs between species found in the COI barcode region of Oxynoemacheilus species studied.

O. anatolicus O. angorae O. argyrogramma O. bergianus O. brandtii O. ercisianus O. evreni O. frenatus O. O. germencicus O. hamwii O. longipinnis O. merga O. persa O. seyhanensis O. tongiorgii O. zagrosensis O. O.

galilaeus parvinae

O. anatolicus

O. angorae 5

O. argyrogramma 12 12

O. bergianus 9 8 14

O. brandtii 13 14 14 12

O. ercisianus 11 12 9 13 15

O. evreni 9 9 11 8.9 14 12

O. frenatus 12 11 8 11 14 10 11

O. galilaeus 12 12 9 11 14 8 11 6

O. germencicus 2 5 11 9.5 14 10 10 12 12

O. hamwii 9 9 13 9.9 14 13 6 12 13 10

O. longipinnis 9 8 15 2.1 13 14 9 11 12 10 10

O. merga 15 16 14 15 11 15 16 16 15 15 15 16

O. persa 11 12 5 12 14 9 11 8 6.9 11 12 13 14

O. seyhanensis 6 7 12 6.7 12 13 8 11 11 8 8 6.6 15 10

O. tongiorgii 12 12 11 11 14 11 12 9 8.4 11 12 12 14 9 12

O. zagrosensis 10 12 4 14 13 9 11 8 8.3 10 12 14 13 5 11 10

O. parvinae 8 8 14 1.8 13 13 9 10 11 9 10 1.4 16 12 6 11 13 capsule of swim bladder with developed posterior dorsal-fin origin, depth decreasing below dorsal-fin process (Fig. 10). Oxynoemacheilus parvinae is also base and decreasing very slowly towards caudal-fin distinguished from O. karunensis by absence of two base. No hump at nape. Greatest body width at prominent black spots at the caudal-fin base (vs. pectoral-fin base. Section of head roundish, flattened presence). It is further distinguished from its nearest on ventral surface. Caudal peduncle slender, species (O. bergianus and O. longipinnis) by having compressed laterally, 2.1-2.6 (mean 2.4) times longer two fixed, diagnostic nucleotide substitutions in the than deep. A small, usually triangular axillary lobe at mtDNA COI sequences, and a K2P nearest- base of pelvic fin, fully attached to body. Pectoral fin neighbour distance of 1.4% to O. longipinnis and mostly shorter than head length (longer in few 1.8% to O. bergianus. individuals) and reaching approximately 69-99% of Description: See Figures 2-10 for general appearance distance from pectoral-fin origin to pelvic-fin origin. and Table 2 for morphometric data. Middle sized and Pelvic-fin origin below first or second branched moderately elongate species with a slightly pointed dorsal-fin ray, fin not reaching vertical of tip of last head. Head length 24.5-28 %SL. Body deepest at dorsal-fin ray, reaching to anus. Anal-fin origin dorsal-fin origin or about midline between nape and below tip of last dorsal-fin ray. Anus about one eye

240 Sayyadzadeh et al.- A new species of loach of the genus Oxynoemacheilus from the Tigris River

Table 2. Morphometric data of Oxynoemacheilus parvinae holotype ZM-CBSU H1987, paratypes, ZM-CBSU H1972, n=14)

Holotype Min Max Mean SD Standard length (mm) 57.65 26.8 64.2 52.4 In percent of standard length Head length 25.2 24.5 26.7 25.4 0.6 Body depth at dorsal-fin origin 16.4 15.2 17.2 16.3 0.6 Body width at dorsal-fin origin 12.3 10.2 13.7 12.0 0.8 Predorsal length 52.0 48.4 52.8 50.5 1.4 Postdorsal length 33.0 32.9 37.1 34.4 1.2 Prepelvic length 54.8 51.0 56.8 54.5 1.6 Preanal length 76.8 70.3 77.2 74.6 1.9 Distance between pectoral and pelvic-fin origins 30.6 24.4 31.9 29.1 2.0 Distance between pelvic and anal-fin origins 21.2 18.3 21.4 19.8 1.1 Depth of caudal peduncle 7.4 7.4 8.8 7.8 0.4 Length of caudal peduncle 19.0 17.3 19.9 18.4 0.8 Dorsal-fin depth 21.7 19.9 24.9 22.8 1.4 Pectoral fin length 22.52 20.7 27.8 24.2 1.6 Pelvic fin length 18.5 16.6 20.1 18.5 0.8 In percent of head length Head depth at nape 54 51 61 56 2.8 Head depth at eye 45 45 54 50 2.4 Snout length 41 38 46 42 2.1 Eye diameter 15 14 17 15 1.0 Postorbital distance 43 42 49 46 1.7 Maximum head width 60 56 65 60 3.1 Interorbital width 23 23 32 27 2.3 diameter in front of anal-fin origin. Anal fin not nostril slightly overlapping posterior nostril when reaching caudal-fin base. No dorsal or ventral folded back. Mouth small, arched (Fig. 7). Lips thick, adipose crest on caudal peduncle. Margin of dorsal with poorly marked furrows. A deep median fin straight or slightly concave. Caudal fin slightly to interruption in lower lip. Median incision in upper lip deeply emarginated. Largest known specimen 64mm small. Processus dentiformis narrow and pointed. No SL. median notch in lower jaw. Inner rostral barbel Dorsal fin with 8½-9½ branched rays. Anal fin reaching to base of maxillary barbell or slightly in with 4½-5½ branched rays. Caudal fin with 8+8-9+8 front, outer one reaching to vertical of anterior eye branched rays. Pectoral fin with 10-11 and pelvic fin margin or slightly in front. Maxillary barbel reaching with 7-8 branched rays. Body covered by embedded vertical of middle eye or in some individuals slightly scales, predorsal region between head and dorsal fin beyond. Male with suborbital grove, absent in naked. Lateral line complete, reaching to caudal-fin female. base. One central and two lateral pores in Coloration: Head and body with yellowish supratemporal canal, 6-7 pores in supraorbital, 6 background colour and dark-brown pattern. Head pores in preoperculo-mandibular, 4 and 11 pores in brown on top and down to lower margin of eye or infraorbital canal. Anterior nostril opening at end of with spotted pattern, cheeks and ventral head surface a low, pointed and flap-like tube. Tube of anterior without colour pattern ventral head surface brown in 241 Iran. J. Ichthyol. (December 2016), 3(4): 236-250

Fig.2. Oxynoemacheilus parvinae, ZM-CBSU H1987, holotype, 58mm SL; Iran: Kermanshah Prov., Leilehrud. some individuals. A pale brown line between anterior is known from few localities in Kermanshah eye margin and tip of snout. A large, dark-brown province, near Sefidbarg, Gandab, and Sharvin blotch at dorsal-fin origin and at caudal fin base. villages, from the tributaries of Leilehrud, Sirvan Three to four wide dark-brown blotch on posterior River drainages at the border of Iran and Iraq which half part, fused with blotches on flank forming drains to the Tigris, Persian Gulf. saddles in some individuals. Flank with 7-8 dark- At the Sefidbarg sampling site, the river is about brown, irregularly shaped, vertically elongated 5m wide, with substrate consisting of coarse gravel blotches along lateral midline, 4-5 large blotches on and small boulders, with semi fast-flowing and semi- posterior half flank in some individuals. Flank transparent waters. Some vegetations were found at blotches narrower than interspaces (wider in some the riverbanks (Figs. 11, 12). Drought, water use and individuals), usually dissociated and often faded in pollution are main threats to this fish. front of dorsal-fin origin, more clearly set on caudal Etymology: Oxynoemacheilus parvinae is named peduncle, rarely joined with saddles on back or after Parvin E'tesami, also Parvin Etesami (Persian: March 16, 1907 – April 5, 1941), a) (پروین اعتصامی forming bars on flank. Dorsal fin with 2–3, Pectoral fin with 3-4 and caudal fin with 3–5 brown bands of 20th-century famous Persian poet of Iran. small, elongated blotches on fin-rays. Anal- and Remarks: In addition to O. longipinnis and pelvic-fins with few dark-brown spots on rays, O. bergianus, there are six Oxynoemacheilus species hyaline in some individuals. in Iranian Tigris River drainage, that five of them Distribution and Habitat: Oxynoemacheilus parvinae have been described recently from Choman 242 Sayyadzadeh et al.- A new species of loach of the genus Oxynoemacheilus from the Tigris River

Fig.3. Oxynoemacheilus parvinae, ZM-CBSU H1984, H1980, H1982 paratypes, a, 57mm SL, b, 46mm SL, c, 32mm SL; Iran: Kermanshah Prov., Leilehrud River.

Fig.4. Oxynoemacheilus parvinae, ZM-CBSU H1984, H1980, H1982, paratypes, a, 57mm SL, b, 46mm SL, c, 32mm SL; Iran: Kermanshah Prov., Leilehrud River.

243 Iran. J. Ichthyol. (December 2016), 3(4): 236-250

Fig.5. Oxynoemacheilus parvinae, ZM-CBSU H1984, H1980, H1982, paratypes, a, 57mm SL, b, 46mm SL, c, 32mm SL; Iran: Kermanshah Prov., Leilehrud River.

Fig.6. Oxynoemacheilus parvinae, ZM-CBSU M1509, M1510, M1508, a, 62mm SL, b, 56mm SL, c, 51mm SL; Iran: Kermanshah Prov., Sefidbarg River.

244 Sayyadzadeh et al.- A new species of loach of the genus Oxynoemacheilus from the Tigris River

Fig.7. Oxynoemacheilus parvinae, ZM-CBSU H1987, holotype, 58mm SL; Iran: Kermanshah Prov., Leilehrud.

Fig.8. Oxynoemacheilus parvinae, ZM-CBSU M1509, 62mm SL; Iran: Kermanshah Prov., Sefidbarg River.

Fig.9. Oxynoemacheilus parvinae, ZM-CBSU M1510, 56mm SL; Iran: Kermanshah Prov., Sefidbarg River. 245 Iran. J. Ichthyol. (December 2016), 3(4): 236-250

Fig.10. Swim bladder capsule. Oxynoemacheilus parvinae, ZM-CBSU MO161, 59 mm SL; Iran: Kermanshah Prov., Sefidbarg River.

Fig.11. Habitat of Oxynoemacheilus parvinae, Iran: Leilehrud (Leileh River) at Sharvin village a tributary of Sirvan River drainage. watershed in Kurdistan Province (O. chomanicus, fin base (vs. presence). O. kurdistanicus and O. zagrosensis) and Karoun Oxynoemacheilus longipinnis has recently been River drainage (O. freyhofi and O. karunensis). All transferred to this genus, and based on our molecular of them (except O. karunensis) with O. kiabii belong data there are some undescribed species from this to a group without suborbital groove (vs. present in basin. Oxynoemacheilus parvinae). Oxynoemacheilus Oxynoemacheilus parvinae is distinguished parvinae is distinguished from O. karunensis by from O. argyrogramma (Heckel, 1847) from the absence of two prominent black spots at the caudal- central Euphrates basin and O. euphraticus 246 Sayyadzadeh et al.- A new species of loach of the genus Oxynoemacheilus from the Tigris River

Fig.12. Habitat of Oxynoemacheilus parvinae, Iran: Sefidbarg River at Gandab. (Bănărescu & Nalbant, 1964) by having a complete emarginated caudal fin (vs. truncate). lateral line (vs. incomplete) it is also distinguished Oxynoemacheilus parvinae is distinguished from O. argyrogramma by having a more slender from O. persa from the Kor River drainage in central body [maximum body depth (%SL) 15.2-17.2 vs. Iran by having bony capsule of swim bladder 17.1-20.8 and caudal peduncle length (%SL) 19.9- connected by a wide manubrium (vs. a narrower 24.9 vs. 15.6-17]. It is distinguished from O. hamwii manubrium), longer head (HL in percent of SL: 24.5- (Krupp & Schneider, 1991) from Syria by having a 26.7 vs. 22-24.4). shallow caudal peduncle [7.4-8.8 vs. 8.5-10.6 (%SL)] Oxynoemacheilus parvinae is distinguished and 8½-9½ branched dorsal-fin rays (vs. 7½-8½). from O. tongiorgii, another species from the Kor Oxynoemacheilus parvinae is distinguished from River drainage in Central Iran, by a deeply O. brandtii (Kura loach), by having a shallow body emarginated caudal fin (vs. truncate), a slenderer (body depth in percent of SL: 15.2-17.2 vs. 17.3-23), caudal peduncle (vs. deep) and swim bladder 8½-9½ branched dorsal-fin rays (vs. 7½-8½) and capsules connect by wide manubrium (vs. absent). large to medium dark-brown spots especially on the Comparative material: All from Iran. O. bergianus: post-dorsal part in some individuals independent of ZM-CBSU H1552, 3, 31-38mm SL; Gillan prov.: size and sexual dimorphism (vs. small and more Safidrud River at Emamzadeh Hashem, Caspian regular bar like). basin, 37°01'12.5''N 49°37'59.9''E. —ZM-CBSU Oxynoemacheilus parvinae is distinguished H1555, 46, 26-59mm SL; Alborz prov.: Kordan from O. lenkoranensis by presence of suborbital River, Namak basin, 35°57'12.3''N 50°50'18.0''E. — groove in males (vs. absent). ZM-CBSU H1601, 73, 26-51mm SL; Ardabil prov.: Oxynoemacheilus parvinae is distinguished Qareh Sou River at Kangarloo, Caspian-Aras basin, from O. araxensis from Kandili Karassu, upper 39°25'40.7''N 47°19'14.6''E. —ZM-CBSU H1674, Araxes basin, eastern Turkey by having a deeply 75, 23-53mm SL; West Azarbayjan prov.: Agh Chay

247 Iran. J. Ichthyol. (December 2016), 3(4): 236-250

at road between Tabriz and Maku, Caspian-Aras accession numbers: KX980090, KX980091, basin, 38°51'51.9''N 45°08'01.1''E. KX980092). —ZM-CBSU M1507, M1508, M1509, Oxynoemacheilus brandtii: ZM-CBSU H1749, M1510, M1511; Iran: Kermanshah province: 29, 29-55mm SL; West Azarbayjan prov.: Javanrud city, at Gandab, Sefidbarg Spring Barandozchay River at Barandoz village, Urmia (Leilehrud), a tributary of Sirvan River drainage, basin, 37°24'58.4''N 45°08'56.5''E. —ZM-CBSU Tigris, 34°52'01.2''N 46°20'16.5''E (GenBank H1779, 5, 32-53mm SL; West Azarbayjan prov.: accession numbers: KX980085, KX980086, Nazloochay River at Tebok village, Urmia basin, KX980087, KX980088, KX980089). 37°55'31.7''N 47°19'23.7''E. See lists of materials by Sayyadzadeh et al. Oxynoemacheilus chomanicus: ZM-CBSU (under review) for all other species examined in the H1814, 15, 30-62mm SL; Kordistan prov.: Boeen molecular genetic analysis in this study. River at road between Baneh and Boeen, Tigris basin, 35°56'35.5"N 45°56'36.5"E. Acknowledgments Oxynoemacheilus kiabii: ZM-CBSU H1785, 4, We are pleased to thank R. Zamaniannejad, 38-48mm SL; Hamadan prov.: Dehno stream at S. Babaee, R. Khaefi, H. Mehraban, M. Masoudi, Nahavand, Tigris basin, 34°35'40.3"N 48°44'19.9"E. R. Sadeghi, H. Darvishnia, M. Razbanian, Oxynoemacheilus kurdistanicus: ZM-CBSU A. Gholamhosseini and A. Jouladeh-Roudbar for H1802, 12, 25-37mm SL; Kordistan prov.: Choman helping with fish collection in Iran. Many thanks to River at Tajaban, Tigris basin, 35°56'53"N, 45°41' Environment Departments of Ilam, Khuzestan and 40"E. Kurdistan provinces, for supporting field surveys in Oxynoemacheilus longipinnis: ZM-CBSU Iran. The research work was funded by Shiraz H1168, 20, 28.6-48.5mm SL; Iran: Ilam prov.: University and was approved by Ethics Committee of Meymeh River at Zarab, 33°08'25.6"N 46°55' Biology Department (SU- 9233856). 42.6"E. 12 Sep. 2012. —ZM-CBSU H1968, 5, 42- 50mm SL; Iran: Ilam prov.: Godarkhosh River, References Tigris River tributary. Bahrami Kamangar, B.; Prokofiev, A.M.; Ghaderi, E. & Oxynoemacheilus persa: ZM-CBSU H1852, 17, Nalbant, T.T. 2014. Stone loaches of Choman 34-56mm SL; Fars prov.: Ghadamgah spring at River system, Kurdistan, Iran (Teleostei: Cyprini- Dorudzan, Kor basin, 30°14'19.65"N 52°22'23.3"E. formes: Nemacheilidae). Zootaxa 3755 (1): 033- —ZM-CBSU H1869, 98, 24-71mm SL; Iran: Fars 061. Eschmeyer, W.N. & Fong, J. 2016. Catalog of fishes: prov.: Archin Qant at Safashahr, Kor basin, Species by Family/Subfamily. (http://research 30°36'16.9"N 52°56'40.1"E. archive.calacademy.org/research/ichthyology/catal Oxynoemacheilus tongiorgii: ZM-CBSU og/SpeciesByFamily.asp Electronic version H1844, 8, 31-58mm SL; Fars prov.: Ghadamgah accessed 12 August 2016. spring at Dorudzan, Kor basin, 30°14'19.65"N Esmaeili, H.R.; Coad, B.W.; Gholamifard, A.; Nazari, N. 52°22'23.3"E. & Teimory, A. 2010. Annotated checklist of the Oxynoemacheilus zagrosensis: ZM-CBSU freshwater fishes of Iran. Zoosystematica Rossica H1829, 15, 27–39 mm SL; Kordistan prov.: Choman 19: 361-386. River at Tajaban, Tigris basin, 35°56'53"N, Freyhof, J.; Erk'akan, F.; Özeren, C. & Perdices, A.J. 45°41'40"E. 2011. An overview of the western Palaearctic loach Material used in the molecular genetic analysis: genus Oxynoemacheilus (Teleostei: Nemacheil- idae). Ichthyological Exploration of Freshwaters Oxynoemacheilus parvinae ZM-CBSU M1763, 22: 301-312. M1764, M1765; same as holotype (GenBank 248 Sayyadzadeh et al.- A new species of loach of the genus Oxynoemacheilus from the Tigris River

Freyhof, J. 2016. Oxynoemacheilus karunensis, a new Tamura, K.; Peterson, D.; Peterson, N.; Stecher, G.; Nei, species from the Persian Gulf basin (Teleostei: M. & Kumar, S. 2011. MEGA5: Molecular Nemacheilidae). Zootaxa 4175: 94-100. evolutionary genetics analysis using maximum Hall, T.A. 1999. BioEdit: a user-friendly biological likelihood, evolutionary distance, and maximum sequence alignment editor and analysis program parsimony methods. Molecular Biology and for Windows 95/98/NT. Nucleic Acids Symposium Evolution 28: 2731–2739. Series 41: 95-98. Toussaint, E.F.; Beutel, R.G.; Morinière, J.; Jia, F.; Xu, Higgins, D.G. & Sharp, P.M. 1988. CLUSTAL: a package S.; Michat, M.C.; Zhou, X.; Bilton, D.T.; Ribera, I.; for performing multiple sequence alignment on a Hájek, J. & Balke, M. 2015. Molecular phylogeny microcomputer. Gene 73: 237-244. of the highly disjunct cliff water beetles from South Huelsenbeck, J.P. & Ranala, B. 2004. Frequentist Africa and China (Coleoptera: Aspidytidae). properties of Bayesian posterior probabilities of Zoological Journal of the Linnean Society 176: phylogenetic trees under simple and complex 537-546. substitution models. Systematic Biology 53: 904- 913. Ivanova, N.V.; Zemlak, T.S.; Hanner, R.H. & Hebert, P.D.N. 2007. Universal primer cocktails for fish DNA barcoding. Molecular Ecology Notes 7: 544- 548. Jouladeh-Roudbar, A.; Vatandoust, S.; Eagderi, S.; Jafari- Kenari, S. & Mousavi-Sabet, H. 2015. Freshwater fishes of Iran; an updated checklist. Aquaculture, Aquarium, Conservation and Legislation, International Journal of the Bioflux 8: 855-909. Jouladeh-Roudbar, A.; Eagderi, S. & Hosseinpour, T. 2016. Oxynoemacheilus freyhofi, a new nemacheilid species (Teleostei, Nemacheilidae) from the Tigris basin, Iran. FishTaxa 1(2): 94-107. Kottelat, M. & Freyhof, J. 2007. Handbook of European Freshwater Fishes. Kottelat, Cornol and Freyhof, Berlin. 646 p. Posada, D. & Crandall, K.A. 1998. MODELTEST: testing the model of DNA substitution. Bioinformatics 14: 817-818. Ronquist, F. & Huelsenbeck, J.P. 2003. MRBAYES 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19: 1572-1574. Sayyadzadeh, G.; Esmaeili, H.R; Eagderi, S.; Jouladeh- Roudbar, A.; Masoudi, M. & Vatandoust, S. 2016. Re-description and molecular systematics of Oxynoemacheilus longipinnis from the Persian Gulf basin (Teleostei, Nemacheilidae). Zookeys under review. Stamatakis, A. 2006. RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics 22: 2688-2690. 249 Iran. J. Ichthyol. (December 2016), 3(4): 236–250 Received: October 12, 2016 © 2016 Iranian Society of Ichthyology Accepted: December 01, 2016 P-ISSN: 2383-1561; E-ISSN: 2383-0964 doi:10.7508/iji.2016.02 http://www.ijichthyol.org

گونه جدید از لوچ ماهیان جنس Oxynoemacheilus از حوضه آبریز تیگره و روابط فیلوژنتیکی آن در میان لوچ ماهیان )ماهیان استخوانی عالی: لوچ ماهیان جویباری بدونخار( خاورمیانه بر اساس توالی ژن سیتوکروم اکسیداز میتوکندریایی

گلناز صیادزاده1، سهیل ایگدری2، حمید رضا اسماعیلی1*

1آزمایشگاه تحقیقاتی ماهیشناسی و سیستماتیک مولکولی، بخش زیستشناسی، دانشکده علوم، دانشگاه شیراز، شیراز، ایران. 2گروه شیالت، دانشکده منابع طبیعی، دانشگاه تهران، کرج، ایران.

چکیده: گونه جدید Oxynoemacheilus parvinae از انشعابات حوضه آبریز سیروان، متعلق به گروهی از لوچ ماهیان جنس Oxynoemacheilus میباشد که دارای یک شیار زیر چشمی در افراد نر و بدنی کشیده میباشند. این گونه از دیگر گونههای این گروه در حوضه تیگره توسط ترکیبی از ویژگیهای زیر تشخیص داده می شود: تعداد 2/1 8 الی 2/1 9 شعاع نرم در باله پشتی، لکههای بزرگ تا متوسط قهوه ای-تیره بهویژه روی بخش عقبی-پشتی بدن، باله دمی اندکی فرورفته، زاویهدار بودن کپسول کیسه شنا همراه با زوائد عقبی تکوین یافته، سر کشیدهتر و ارتفاع کمتر بدن. این گونه همچنین از نزدیکترین گونههای خود )O. bergianus و O. longipinnis( در داشتن تعداد دو جابجائی نوکلئوتیدی تشخیصی در ژن سیتوکروم اکسیداز میتوکندریایی و کمترین فاصله ژنتیکی به میزان 4/1 درصد )با O. longipinnis( متمایز میباشد. بازسازی درختهای تکاملی بیشترین درست نمایی و بیزین براساس منطقه بارکد ژن سیتوکروم اکسیداز، لوچ ماهیان جنس Oxynoemacheilus را در یک گروه مونوفیلیتیک جای داد که کمترین فاصله ژنتیکی 4/1 درصد )O. parvinae vs. O. longipinnis( و بیشترین آن 3/16 درصد )O. longipinnis vs. O. merga( محاسبه گردید. کلماتکلیدی: Oxynoemacheilus parvinae، تاکسونومی، پراکنش، حوضه خلیج فارس، ایران.

250