BASIC RESEARCH www.jasn.org

Modeling Monogenic Human Nephrotic Syndrome in the Drosophila Garland Cell Nephrocyte

† †‡ Tobias Hermle,* Daniela A. Braun,* Martin Helmstädter, Tobias B. Huber, and Friedhelm Hildebrandt*

*Division of Nephrology, Department of Medicine, Boston Children’s Hospital, Harvard Medical School, Boston, Massachusetts; †Renal Division, University Medical Center Freiburg, Freiburg, Germany, Faculty of Medicine, University of Freiburg, Freiburg, Germany; and ‡BIOSS Center for Biological Signalling Studies, Albert-Ludwigs- University Freiburg, Freiburg, Germany

ABSTRACT Steroid-resistant nephrotic syndrome is characterized by podocyte dysfunction. Drosophila garland cell neph- rocytes are podocyte-like cells and thus provide a potential in vivo model in which to study the pathogenesis of nephrotic syndrome. However, relevant pathomechanisms of nephrotic syndrome have not been studied in nephrocytes. Here, we discovered that two Drosophila slit diaphragm proteins, orthologs of the human genes encoding nephrin and nephrin-like protein 1, colocalize within a fingerprint-like staining pattern that correlates with ultrastructural morphology. Using RNAi and conditional CRISPR/Cas9 in nephrocytes, we found this pattern depends on the expression of both orthologs. Tracer endocytosis by nephrocytes required Cubilin and reflected size selectivity analogous to that of glomerular function. Using RNAi and tracer endocytosis as a functional read-out, we screened Drosophila orthologs of human monogenic causes of nephrotic syndrome and observed conservation of the central pathogenetic alterations. We focused on the coenzyme Q10 (CoQ10)bio- synthesis gene Coq2, the silencing of which disrupted slit diaphragm morphology. Restoration of CoQ10 synthesis by vanillic acid partially rescued the phenotypic and functional alterations induced by Coq2-RNAi. Notably, Coq2 colocalized with mitochondria, and Coq2 silencing increased the formation of reactive oxygen species (ROS). Silencing of ND75, a subunit of the mitochondrial respiratory chain that controls ROS formation independently of

CoQ10, phenocopied the effect of Coq2-RNAi. Moreover, the ROS scavenger glutathione partially rescued the effects of Coq2-RNAi. In conclusion, Drosophila garland cell nephrocytes provide a model with which to study the pathogenesis of nephrotic syndrome, and ROS formation may be a pathomechanism of COQ2-nephropathy.

J Am Soc Nephrol 28: 1521–1533, 2017. doi: https://doi.org/10.1681/ASN.2016050517

Steroid resistant nephrotic syndrome (SRNS) the esophagus. In contrast to pericardial nephro- represents a common cause of CKD.1 In about cytes, GCN can be identified anatomically after brief 30% of cases mutation of a single gene can be iden- dissection. The pericardial nephrocytes were first tified as the cause2–4 and more than 30 causative genes have been discovered.5 The Drosophila neph- rocyteformsslitdiaphragmsacrossmembrane Received May 6, 2016. Accepted November 5, 2016. invaginations called labyrinthine channels. Neph- Published online ahead of print. Publication date available at rocytes have been suggested to be molecularly, ul- www.jasn.org. trastructurally, and functionally analogous to Correspondence: Dr. Tobias Hermle, Boston Children’sHospi- mammalian podocytes.6–8 Thus they offer the op- tal, Harvard Medical School, 300 Longwood Avenue/Enders 561, portunity for in vivo study of podocytopathies in a Boston, MA 02115, or Prof. Friedhelm Hildebrandt, Boston Children’s Hospital, Harvard Medical School, 300 Longwood genetically highly-tractable model organism. There Avenue/Enders 561, Boston, MA 02115. E-mail: tobias.hermle@ are two distinct nephrocyte populations: the pericar- childrens.harvard.edu or friedhelm.hildebrandt@childrens. dial nephrocytes along the heart tube and the garland harvard.edu cell nephrocytes (GCN) in a garland-like ring around Copyright © 2017 by the American Society of Nephrology

J Am Soc Nephrol 28: 1521–1533, 2017 ISSN : 1046-6673/2805-1521 1521 BASIC RESEARCH www.jasn.org

Figure 1. Slit diaphragm proteins localize in a fingerprint pattern analogous to slit diaphragm morphology in TEM and cluster to puncta upon loss of an interaction partner. (A–A’’) Equatorial cross section of GCN costained for the nephrin ortholog Sns (green) and the KIRREL/NEPH1 ortholog Kirre (red). Slit diaphragm proteins localize at the cell periphery. (B–B’’) Surface section of the same neph- rocyte as in (A) reveals a fingerprint-like pattern. Distance between lines is 250–500 nm. (C) 3D reconstruction from a series of confocal sections of the same cell indicates that the visible circumference of the cell is densely covered by Sns/Kirre that are arranged in a fine

1522 Journal of the American Society of Nephrology J Am Soc Nephrol 28: 1521–1533, 2017 www.jasn.org BASIC RESEARCH described as a screening tool for the discovery of renal disease TEM.6,7 The fingerprint-like pattern can be detected as early genes9 and proposed as a model for protein uptake in the prox- as first instar larvae and is present throughout larval develop- imal tubulus.10 Mammalian Neph proteins partially rescue the ment and adulthood (Supplemental Figures 1, A–G’’). Adult Drosophila orthologs in GCN11 and pericardial nephrocytes GCN were described as degenerated9 but testing the same were shown to be impaired by a high-glucose diet.12 Moreover, genetic background we found adult GCN to maintain typi- some novel human monogenic SRNS genes were studied in cal ultrastructure and endocytic activity (Supplemental pericardial nephrocytes.13–15 But nephrocytes have not been Figure 2, A–C). Functionality is further supported by previous tested systematically as a model for SRNS. The conservation reports.19,20 of mechanisms involved in the pathogenesis of SRNS such as We wanted to evaluate Sns localization upon loss of kirre6 actin dysregulation, a role of the extracellular matrix (ECM), or that is known to abrogate labyrinthine channels and slit dia- CoQ10 deficiency is unclear. phragms. Sns protein seems mostly retained at the membrane upon kirre knockdown in the equatorial sections (Figure 1F, Kirre control Figure 1F’) but tangential sections now RESULTS revealed a punctate pattern (Figure 1G, kirre control Figure 1G’). Localization of Sns protein thus seems to be dependent Slit Diaphragm Proteins Show a Fingerprint-Like on the presence of its binding partner Kirre. Conversely, we Pattern tested Kirre localization upon silencing of sns and observed a The slit diaphragm proteins sns and kirre,orthologsofNPHS1 punctate staining pattern of Kirre (Figure 1, H and I’,Sns and KIRREL, were shown to be a prerequisite for slit dia- control in Figure 1, H and I). In conclusion, removal of the phragm formation in nephrocytes6,7 and immunofluorescence slit diaphragm protein Sns resulted in a punctate pattern of the previously showed localization at the cell membrane.6,7,16 unsilenced binding partner Kirre and vice versa.Toevaluate Using established Sns17 and Kirre18 antibodies we confirmed this further we employed a conditional somatic CRISPR/ the published findings6,7,16 (Figure 1, A–A’’). To study sub- Cas9 technique. This approach is useful for the study of cellular localization in more detail we recorded sections tan- nephrocytes as the classic Flp/FRT-based mosaic analysis is gential to the cell surface with high magnification. This prevented in these nondividing cells. Transgenic expression revealed a pattern of Sns and Kirre in parallel lines reminis- of UAS-Cas9 in nephrocytes via Hand-GAL4 combined with cent of a fingerprint (Figure 1, B–B’’). This pattern covered ubiquitous expression of two guide RNAs led to strong re- theentirecell(3D-projectioninFigure1C).Thedistance duction of Sns protein (Figure 1, J and K, negative control between parallel lines ranged from 250 to 500 nm (inset Supplemental Figure 1, E–F’’). Loss of Sns again ensued a Figure 1B’’) corresponding to the distance between two slit punctate staining pattern of Kirre (Figure 1, J’ and K’)thus diaphragms observed by transmission electron microscopy confirming our previous observations in this independent (TEM)(Figure 1D). We compared tangential sections of approach. Some cells displayed low residual levels of Sns pro- GCN in TEM with the tangential sections obtained by con- tein (Figure 1K, cell on the right) resulting in an intermediate focal microscopy and observed an analogous picture of slit staining pattern of Kirre in dashed lines instead of puncta diaphragms/labyrinthine channels as parallel lines with a (Figure 1K’). This suggests that localization of Kirre is distance of 250–500 nm (Figure 1E). This suggests that Sns affected proportionally to the amount of Sns protein. The and Kirre localize to the slit diaphragms. This is in accordance fingerprint pattern requires correct stoichiometry of slit di- with the published findings using immunogold-labeling in aphragm proteins.

linear pattern. (D) EM image of detail from a section cutting through nephrocyte surface perpendicularly shows cross-section of slit diaphragms (black arrow heads) and labyrinthine channels (white asterisks). Distance between two slit diaphragms is approximately 250–500 nm. (E) Planar section of a nephrocyte near the surface through the level of slit diaphragms/labyrinthine channels corresponds to lines in confocal image and confirms typical distance and pattern. Slit diaphragms are located between parallel lines of higher electrodensity. (F–F’’) Knockdown of kirre abolishes signal from Kirre-antibody whereas Sns remains detectable. (G–G’’) Surface section from GCN expressing kirre-RNAi shows Sns protein in a punctate staining pattern although the fingerprint-like pattern is lost. (H–H’’) Silencing of Sns results in strong reduction of cortical Sns signal whereas Kirre protein partially retains its localization at the periphery of the cell. (I–I’’) Surface section of GCN expressing sns-RNAi reveals loss of fingerprint-like pattern and strongly reduced Sns signal. Kirre staining pattern is punctate. Sns and Kirre seem mutually dependent and cluster in puncta upon loss of one interaction partner. (J–J’’) Shown is a GCN from an animal expressing two guide RNAs directed against sns ubiquitously and UAS-Cas9 under the hand-GAL4 driver in nephrocytes. The specific Sns signal at the periphery of the cell is strongly reduced although Kirre protein still is expressed. (K–K’’) CRISPR/Cas9-mediated loss-of-function of sns results in a punctate staining pattern of Kirre on the cell surface. The cell on the right shows residual amounts of Sns protein with an intermediate pattern of Kirre in dashed lines. Hand-GAL4.Cas9/+ (lacking gRNA expression) served as negative control and is shown elsewhere (Supplemental Figure 1, E–F’’). All scale bars represent 500 nm in electron microscopy images and 5 mm in confocal images unless otherwise indicated.

J Am Soc Nephrol 28: 1521–1533, 2017 Nephrocyte Model of Nephrotic Syndrome 1523 BASIC RESEARCH www.jasn.org

Figure 2. Tracer endocytosis characteristics of GCN support a model of size-dependent filtration across slits and consecutive uptake via Cubilin/Amnionless coreceptors. (A) GCNs rapidly endocytose FITC-albumin. Fluorescence intensity increases with higher dose or incubation time (30 seconds versus 5 minutes). (B) Quantitation of fluorescence intensity after FITC-albumin exposure at two different incubation times using ImageJ shows linear increase until reaching saturation at higher concentrations. Values are presented as a mean6SD from the three brightest cells each from two independent experiments. (C) Simultaneous incubation with two small tracers, FITC-albumin (66 kD) and Texas-Red–dextran (10 kD), for 5 minutes. Increasing the dose of Texas-Red–dextran 10 kD reduces the uptake of FITC-albumin, whose applied concentration was kept constant. This suggests competition for uptake between both dyes. (D) Quantitation of fluorescence for coincubation of FITC-albumin at constant dose and variable concentrations of Texas-Red–dextran (10 kD). Intensity is recorded as grayscale (0–255) using ImageJ. FITC-albumin uptake is decreasing proportionally to the applied con- centrations and increasing uptake of Texas-Red–dextran 10 kD. Offering Texas-Red–dextran in a tenfold mass excess reduces uptake of FITC-albumin to minimal levels. Values are presented as a mean6SD, n=3 per individual tracer dosage. (E) Representative images of

1524 Journal of the American Society of Nephrology J Am Soc Nephrol 28: 1521–1533, 2017 www.jasn.org BASIC RESEARCH

Tracer Uptake Is Mediated by Receptor-Mediated Cubilin and Amnionless have been shown to be required for Endocytosis via Cubilin/Amnionless the function of pericardial10 nephrocytes and GCN.21 Knock- We then explored endocytosis of tracers like dextrans as an down of the ortholog of the alternative protein scavenger Megalin assay for nephrocyte function that was previously de- did not result in a significant reduction, whereas knockdown scribed.6,7,9 Dextrans are regarded as fluid-phase tracers. We of Cubilin or Amnionless seemed to abrogate uptake of FITC- hypothesized that tracer uptake is a read-out of fluid-phase albumin (0.2 mg/ml) almost entirely (Figure 2, E and F). This endocytosis as a function of surface area. Fluid-phase endo- implies Cubilin/Amnionless as the receptor complex. cytosis is generally linear whereas saturability is a hallmark of receptor-mediated endocytosis. We chose a modified ap- Tracer Experiments Are Compatible with proach by exposing third instar larvae to FITC-albumin and Size-Selective Filtration in Nephrocytes analyzed the dose-response relationship in (Figure 2, A and B). Size-selective filtration of hemolymph proteins before entering Fluorescence increased proportionally to an increasing dose of the labyrinthine channels analogous to size-selective filtration FITC-albumin below a threshold of 0.2 mg/ml. Further in- in the glomerulus has previously been proposed.6,7,9,10 We hy- crease of the dose of FITC-albumin beyond this threshold pothesized that tracer endocytosis is not merely a function of resulted in a disproportionally slower increase of fluorescence Cubilin-mediated uptake but also reflects size-selective filtra- reflected in the declining slope of the dose-response curve tion. Therefore, we treated GCN with protamine sulfate, which (Figure 2B, black). Increasing the incubation time tenfold rapidly induces foot-process–effacement in podocytes.22 Prot- lowered this threshold accordingly in a left-shifted curve (Fig- amine at 500 mg/ml for 10 minutes induced partial loss of lab- ure 2B, gray). These findings suggest that tracer uptake occurs yrinthine channels in nephrocytes compared with control treat- in a saturable process and thereby point toward receptor- ment (Figure 2, G and H). Protamine hence perturbs nephrocyte mediated endocytosis. We then tested for receptor competition, ultrastructure including the slit diaphragms. We reasoned that another hallmark of receptor-mediated endocytosis. Keeping a uptake of a large tracer, whose size prevents the passage through saturated dose of FITC-albumin constant under an increasing the slit diaphragm, would be unaffected by protamine-induced dose of a Texas-Red–dextran with a molecular mass of 10 kD we loss of labyrinthine channels. On the other hand, endocytosis of observed a proportionate decrease of FITC-albumin uptake un- a smaller tracer may occur within the labyrinthine channels after der increasing concentrations of 10 kD Texas-Red–dextran (Fig- slit diaphragm passage. This uptake should be reduced by the ure 2, C and D). High doses of Texas-Red–dextran entailed loss of labyrinthine channel surface area. We applied 500 kD minimal uptake of FITC-albumin. FITC-albumin uptake FITC-dextran (1 mg/ml) as a tracer that is unlikely to pass thus also exhibits receptor competition which is characteristic the slit diaphragm and Texas-Red–conjugated avidin of 66 kD for receptor-mediated endocytosis. The protein scavengers (0.02 mg/ml) as a tracer that is expected to pass the slit

fluorescence after incubation with FITC-albumin for 30 seconds at 0.2 mg/ml for control experiments used for normalization (GFP-RNAi) and RNAis for protein scavenger receptors. Cubilin-RNAi and Amnionless-RNAi showed strong reduction of the fluorescent signal. (F) Quantitation of FITC-fluorescence of (E) using ImageJ upon silencing of Megalin, Cubilin, and Amnionless from three independent ex- periments using two independent RNAis each shows a strong reduction for Cubilin and Amnionless, whereas Megalin has no significant effect. Values are presented as a mean6SD, n=3–4 per genotype. (G) Control treatment of nephrocytes for 10 minutes with PBS showed normal slit diaphragms (arrow heads) and labyrinthine channel morphology (white asterisks). (H) Pretreatment of nephrocytes with protamine 500 mg/ml for 10 minutes leads to a partial loss of labyrinthine channels and slit diaphragms. (I) Exposing cells to PBS alone followed by simultaneous exposure to the large tracer FITC-dextran 500 kD (1 mg/ml) and a small tracer Texas-Red–avidin 66 kD (0.02 mg/ ml) resulted in strong uptake of both tracers (upper panel). The same experiment after protamine exposure for 10 min (500 mg/ml) showed strong reduction of avidin uptake whereas the large tracer FITC-dextran was not reduced by the treatment. (J) Quantitation of changes shown in (I) by protamine treatment normalized to mock-treatment for Texas-Red–avidin and FITC-dextran 500 kD shows reduction of 66 kD tracer endocytosis by loss of labyrinthine channels whereas the uptake of FITC-dextran 500 kD is increased in a nonsignificant manner. This suggests that uptake of the small tracer Texas-Red–dextran depends on slit diaphragms and labyrinthine channel surface but uptake of the large tracer FITC-dextran 500 kD is not affected by protamine-induced alteration of ultrastructure. n=5 per treatment. (K) Schematic illustrating hypothesis that competition between tracers depends on passage of the slit diaphragm which thus can serve as a read-out for filtration characteristics. Tracers which pass the slit diaphragm (blue) may approach all of the available receptors inside and outside the labyrinthine channels and thus are able to out-compete other tracers. Tracers whose mass prevents passage of the slit diaphragm (yellow) on the other hand cannot compete for receptors located inside the labyrinthine channels which results in incomplete competition. (L) Shown are representative images of control nephrocytes after incubation with 3 mM FITC-albumin for 5 minutes. The image on top shows FITC-albumin uptake without competition. Competition of FITC-albumin with a tenfold molar excess of tracers of increasing size are shown in a descending order. The tracer avidin (66 kD) competes strongly, whereas the larger tracers transferrin (80 kD) and HRP-avidin (avidin compound whose mass increased to 154 kD by conjugation of two molecules of peroxidase) show mild reduction of FITC-albumin endocytosis. This suggests partial competition and thus implies inability of the two larger tracers to pass the slit diaphragm. (M) Quan- titation of experiments from (I). n=3–4 per intervention.

J Am Soc Nephrol 28: 1521–1533, 2017 Nephrocyte Model of Nephrotic Syndrome 1525 BASIC RESEARCH www.jasn.org

Figure 3. Endocytosis assay in Drosophila GCN shows reduced uptake of FITC-albumin in the majority of orthologs of mammalian genes that if mutated cause nephrosis. (A) Known monogenic causes of SRNS in humans or mice are shown within their protein in- teraction complexes and subcellular localization in the podocyte. Cellular functions are classified as: slit diaphragm complex, ECM interaction proteins, actin regulators, regulators of gene expression, proteins that play a role in endocytosis, and CoQ10 synthesis genes. Gene names in white letters indicate that no ortholog was identified. (B–J) Shown are examples of GCN that were exposed to FITC-albumin for 30 seconds for a selection of genotypes. All scale bars represent 10 mm. The human ortholog is denoted in white. (B) Nephrocytes expressing control RNAis against mCherry (B) or GFP (C) exhibit strong FITC-albumin uptake whereas cells expressing an RNAi directed against the nephrin ortholog sns result only in minimal uptake (D). Reduced uptake is also observed upon knockdown of the orthologs of LAMB2 (E), ITGB4 (F), COQ2 (G), and ARHGAP24 (H). Knockdown of the ortholog of ARHGDIA on the other hand shows uptake similar to control levels (I). An allele of the ortholog of COQ6 hemizygous over a corresponding deficiency shows re- duced uptake as well (J). (K) Quantitation of fluorescent intensity from FITC-albumin uptake is shown. The human ortholog is denoted in brackets. Genes are grouped into functional complexes denoted on top (compare with figure in A). The human ortholog is colored in red when the uptake was significantly reduced in two RNAis and in green when no significant difference to control (mCherry) was observed (P,0.05) for two RNAis. Genes where significant reduction of tracer uptake was observed with one RNAi but did not confirm in the only available second RNAi are denoted as undetermined (yellow). Wild type nephrocytes and GCN expressing an RNAi directed against mCherry showed uptake that is comparable to GFP-RNAi. Knocking down orthologs of genes involved in the slit diaphragm complex, ECM interaction, CoQ10 synthesis, and actin regulation resulted in impaired tracer uptake. The p element insertion allele of

1526 Journal of the American Society of Nephrology J Am Soc Nephrol 28: 1521–1533, 2017 www.jasn.org BASIC RESEARCH diaphragm. In mock-treated nephrocytes (10 minutes PBS only) Silencing Orthologs of Human Genes Defective in both tracers show robust endocytosis after 5 minutes (Figure 2I, Monogenic SRNS Impairs Nephrocyte Tracer Uptake upper panel). Then we recorded uptake of both tracers after More than 30 genes have been identified as monogenic causes treatment with protamine (Figure 2I, lower panel). Assessing of SRNS in humans5 (Figure 3A). We hypothesized that the the effect of protamine compared with mock treatment we no- functional modules responsible for monogenic SRNS may be ticed no reduction of 500 kD FITC-dextran but a strong reduc- conserved in GCN. Analysis of a set of 36 established human tion of uptake of the smaller Texas-Red–avidin (Figure 2J). The and mouse genes using a combination of BLASTanalysis and loss of labyrinthine channels/slit diaphragms therefore is reflec- query of online databases (www.ensembl.org and the diopt ted by the reduced uptake of the smaller tracer whereas endo- tool26)rendered29putativeDrosophila orthologs (Figure cytosis of 500 kD dextran appears to be independent of dis- 3A, Supplemental Table 1). We silenced the Drosophila genes turbed ultrastructure. This suggests that tracer endocytosis in GCN by 2–3 independent RNAis. Nephrocyte function also reflects size-selective filtration and a 66 kD tracer can be was assessed by FITC-albumin endocytosis and the fluores- useful to study nephrocyte function. cent signal was quantifiedandnormalizedtoacontrolex- periment performed in parallel (Figure 3K, Supplemental Receptor Competition Experiments Suggest a Figure 4, Supplemental Table 2). We categorized genes as Filtration Cut-Off around 66–80 kD “likely functionally-relevant” (red) if at least two RNAi lines The size cut-off for glomerular filtrationinmammalsisap- impaired tracer uptake significantly, and “negative” if two proximately 70 kD23,24 and we hypothesized that filtration in RNAis had no significant effect (green). If an observed tracer GCN has a similar cut-off. This is supported by findings in impairment was not confirmed by a second RNAi and no fur- pericardial nephrocytes that suggested a size cut-off around ther RNAi line was available, the result would be considered 70 kD.9 To test this in GCN we employed the phenomenon of “undetermined” (yellow). Efficient knockdown was confirmed receptor competition. We reasoned that a tracer whose mass using immunofluorescence for the orthologs of CRB2, ITGA3, exceeds the filtration cut-off cannot compete for receptors and ITGB4 (Supplemental Figure 5). Hence we identified five located within the labyrinthine channels. As a smaller tracer orthologs of genes related to the slit diaphragm complex can still be taken up inside the labyrinthine channels, this (NPHS1, KIRREL, TJP1/ZO1, NPHS2, CD2AP), three ortho- should result in partial competition (schematic in Figure logs connected to the ECM (ITGA3, ITGAB3, COL4A3), four 2K). We exposed uptake of 66 kD FITC-albumin to a tenfold orthologs involved in actin regulation (ACTN4, ARHGAP24, molar competition of tracers with increasing size: 66 kD MYH9, ANLN), and one endocytosis factor (CUBN)as Texas-Red–avidin, 80 kD tracer Texas-Red–transferrin, and a likely relevant for nephrocyte function. The orthologs of 154 kD HRP-avidin (Figure 2, L and M). The smaller avidin LAMB2,SMARCAL1,SCARB2, and the Drosophila KANK showed strong reduction of FITC-albumin endocytosis remain undetermined (Figure 3K, Supplemental Figure 4, whereas transferrin and the avidin, whose size had been mod- Supplemental Table 2). A functional significance was also ified by HRP-conjugation, reduced FITC-albumin endocytosis observed for the orthologs of the CoQ10 synthesis genes only about 30% compared with uptake without competition COQ2 and ADCK4. The single RNAi line targeting the or- (Figure 2M). This suggests incomplete competition as predicted. tholog of COQ6 had no effect but a p element insertion allele Transferrin, a known ligand of cubilin,25 and avidin seem to (CG7277KG03584) impairs tracer uptake significantly when compete for the same receptors as they are effectively out- being homozygous or hemizygous with a corresponding de- competed by an excess of FITC-albumin in the reverse experiment ficiency (Figure 3K). Neither allele nor deficiency affect (Supplemental Figure 3, A–D). These data are in accordance tracer endocytosis heterozygous with wild type (Supplemen- with a filtration cut-off between 66 and 80 kD analogous to the tal Figure 4, Supplemental Table 2) Thus a functional role for mammalian glomerular slit diaphragm. the ortholog of COQ6 seems likely. TUNEL colabeling

the ortholog of COQ6 is quantified homozygous and hemizygous over a short deficiency both resulting in reduced uptake. Values are presented as mean6SD of the ratio to a control experiment (GFP-RNAi) done in parallel, n=3–4 per genotype. Statistical significance was calculated using ANOVA and Dunnet post hoc analysis. ACTN4,actinin,a4; ADCK4,aarfdomain-–containing kinase 4; ANLN, actin- binding protein anillin; ARHGAP24, rho gtpase–activating protein 24; ARHGDIA, rho gdp–dissociation inhibitor a; CD2AP,cd2- associated protein; COL4A3, collagen Type IV, a-3; COQ2, coq2 homolog (s. cerevisiae); COQ6, coq6 homolog (s. cerevisiae); CRB2, crumbs homolog 2 (drosophila); CUBN, cubilin; DGKE, diacylglycerol kinase, «, 64-kd; FAT1, fat tumor suppressor homolog 1 (drosophila); INF2, inverted formin 2; ITGA3, integrin a-3; ITGB4, integrin b-4; KANK1, kn motif- and ankyrin repeat domain–containing protein 1; KANK2,knmotif– and ankyrin repeat domain-containing protein 2; KANK4, kn motif– and ankyrin repeat domain–containing protein 4; KIRREL, kin of ire–like; LAMB2,lamininb-2; LMX1B, lim homeobox transcription factor 1 b; MYH9, myosin heavy chain 9, nonmuscle; MYO1E,myosin1e;NPHS1, nephrin; NPHS2, podocin; PDSS2, prenyl diphosphate synthase, subunit 2; PTPRO, protein-tyrosine phosphatase, receptor type o; SCARB2, scavenger receptor class b, member 2; SMARCAL1, swi/snf-related, matrix-associated, actin- dependent regulator of chromatin, subfamily a-like protein 1; TJP1, tight junction protein 1.

J Am Soc Nephrol 28: 1521–1533, 2017 Nephrocyte Model of Nephrotic Syndrome 1527 BASIC RESEARCH www.jasn.org

Figure 4. Coq2-RNAi results in mislocalization and loss of slit diaphragm proteins and can be partially rescued by feeding vanillic acid. (A–A”) Garland nephrocytes expressing Coq2-RNAi costained for Sns and Kirre reveal partial protein mislocalization from the slit di- aphragm on the cell surface toward the interior of the cell (for comparison see Figure1, A–A’’). The peripheral line of slit diaphragm proteins seems replaced by clustered signals (white arrow) or lost (white arrow head). (B–B’’) Surface section shows a mixture of clustering in puncta, loss, or increased distance of ridges formed by slit diaphragm proteins (for comparison see Figure1, B–B’’). (C) EM image of control-RNAi (GFP) shows slit diaphragms at regular distances (black arrow heads) and labyrinthine channels (white asterisks) that rarely exceed a depth of 500 nm. (D and E) EM images of nephrocytes expressing Coq2-RNAi show reduced number of slit

1528 Journal of the American Society of Nephrology J Am Soc Nephrol 28: 1521–1533, 2017 www.jasn.org BASIC RESEARCH suggested impairment of tracer uptake to be independent Sns/Kirre-staining and TEM using a second Coq2-RNAi of apoptosis for sns-RNAi and Coq2-RNAi (Supplemental matched the findings with the first Coq2-RNAi (Supplemental Figure 6, A–C). Figure 7, A–E’’). Taken together, 16 of 29 orthologous genes significantly To examine the specificity for CoQ10 synthesis we used affected nephrocyte function across the functional modules vanillic acid which had previously been shown to bypass a of slit diaphragm complex, ECM interactors, CoQ10 synthesis, block in the CoQ10 biosynthesis pathway downstream of and actin regulation. This suggests that the central pathome- COQ6 and COQ2 in yeast.30 Feeding flies with this compound chanisms of monogenic human SRNS are reflected by GCN. partially restored GCN function in Coq2 silencing whereas the function of control nephrocytes remained unchanged (Figure Knockdown of Coq2 Results in Mislocalization/Loss of 4, G–H). Vanillic acid treatment also largely restored the stain- Slit Diaphragms and Labyrinthine Channels ing pattern of Sns/Kirre (Figure 4, K–L’’)comparedwith In humans, mutations of COQ2 have been identified as a treatment with vehicle (H2O) alone (Figure 4, I–J’’). In the treatable cause of SRNS2,27,28 although the pathogenesis re- ultrastructural analysis vanillic acid increased areas of normal mains unclear.29 Hence we explored the role of Coq2 in the slit diaphragm frequency from about 15% to 60% compared Drosophila nephrocyte. Staining Sns and Kirre upon Coq2 si- with vehicle control (Figure 4, M–O). Elongated channels and lencing we noticed a partial displacement from the membrane duplications of slit diaphragms were still observed occasion- for both proteins (Figure 4, A–A’’). Confocal sections through ally (Figure 4N). The Coq2-RNAi phenotype thus was partially the surface showed areas lacking Sns/Kirre, misspacing of the rescued by substitution of vanillic acid. lines of the fingerprint-like pattern, and clusters of slit dia- phragm proteins (Figure 4, B–B’’). Accordingly, although slit Mitochondrial ROS Formation Occurs in Coq2 Silencing diaphragms densely populate the surface of control GCN (Fig- The pathogenesis of COQ2-nephropathy could be conveyed ure 4C), Coq2 silencing causes large areas without slit dia- through defects directly affecting the slit diaphragm via lack of phragms (Figure 4D). When labyrinthine channels were still CoQ10, e.g., by affecting lipid rafts or lipid oxidation. An present, they were elongated and thinner. Frequently multiple indirect mechanism of COQ2 deficiency via increased ROS- consecutive slit diaphragms were present inside these channels formation and mitochondrial dysfunction has also been sug- (Figure 4, D and E). To quantify loss of slit diaphragms, we gested.31 To analyze this in GCN, we first studied localization evaluated the cell membrane of a full diameter of six cells each of Coq2. As no anti-Coq2 antibodies are available we for control-RNAi and Coq2-RNAi. We categorized slit dia- employed a GFP-reporter allele that drives Coq2 under endog- phragm frequency $2/mm as normal (i.e., distance between enous promoter.32 Costaining cells expressing this reporter slits #500 nm). On average, nephrocytes expressing control- with the mitochondrial marker ATP5A showed colocalization, RNAi exhibited normal slit diaphragm frequency on 87% of indicating that Coq2 most likely resides in mitochondria (Fig- the analyzed cell surface. In contrast, only 4% of the surface of ure 5A). Lack of Coq2-dependent CoQ10 synthesis is known to nephrocytes expressing Coq2-RNAi showed the regular fre- interfere with electron transfer at the mitochondrial respira- quency whereas the remainder displayed a reduced frequency tory chain, which in turn increases ROS formation.33 There- (0.5–2 slits/mm, 24%) or only sporadic slit diaphragms (#0.5 fore we analyzed the redox state of these cells with the ROS slits/mm, 72%, Figure 4F). This amounts to a strong loss of slit indicator dihydroethidium (DHE). This compound is blue- diaphragms upon Coq2 silencing. fluorescent in the reduced state but shifts toward the red

diaphragms (arrow heads) and labyrinthine channels (asterisks). Where present, channels appear elongated and narrower compared with control (C). Slit diaphragms are often mislocalized into the labyrinthine channels and multiplied (red arrow heads). (F) Quantitation of frequency of slit diaphragms measured along one complete GCN diameter for control-RNAi compared with Coq2-RNAi as mean of six cells from three different animals. Frequency of slit diaphragms was classified into three groups: normal (.2 slits/mm), reduced (0.5–2 slits/mm), and sporadic (,0.5 slits/mm). Note the strong reduction of slit diaphragms in Coq2-RNAi. (G and H) Supplementing vanillic acid with the food increases FITC-albumin uptake compared with control treatment with H2O, suggesting a partially restored nephrocyte function. Feeding vanillic acid to flies expressing control-RNAi has no relevant influence on FITC-albumin uptake. (H) Quantitation of experiments from (G). Rescue with vanillic acid blunts the phenotype of Coq2 silencing. n=4 per genotype and intervention. (I–J’’) Nephrocytes from

flies treated with vehicle (H2O) show a phenotype similar to untreated cells (A–A’’). (K–L’’) Upon treatment with vanillic acid slit diaphragm proteins are more adherent to cell surface and the fingerprint pattern of Sns/Kirre is restored (L–L’’). (M) EM image of a nephrocyte ex- pressing Coq2-RNAi after treatment with vehicle (H2O) shows a similar phenotype to untreated cells (see D–E). (N) Treating flies ex- pressing Coq2-RNAi with vanillic acid improves frequency of slit diaphragms formed on the surface (black arrow heads). Slit diaphragms inside labyrinthine channels (red arrow head) and elongated labyrinthine channels are less frequently observed than with vehicle alone. (O)

Quantitation of slit diaphragm frequency of one complete diameter for Coq2-RNAi with vehicle (H2O) compared with Coq2-RNAi treated with vanillic acid as mean of six cells from three different animals. Frequency of slit diaphragms was classified into three groups: normal (.2 slits/mm), reduced (0.5–2 slits/mm), and sporadic (,0.5 slits/mm). Note the increase of slit diaphragms on surface upon application of vanillic acid. All scale bars represent 500 nm in electron microscopy images and 5 mm in confocal images.

J Am Soc Nephrol 28: 1521–1533, 2017 Nephrocyte Model of Nephrotic Syndrome 1529 BASIC RESEARCH www.jasn.org

Figure 5. Increased ROS formation in Coq2 loss-of-function. (A–A”) GCNs expressing a third-copy reporter allele of Coq2 with an insertion of GFP in frame costained for the mitochondrial marker ATP5A indicates localization of Coq2 to the mitochondria. (B) GCN expressing control-RNAi or Coq2-RNAi after 5 minutes of incubation with ROS indicator DHE. Stronger intranuclear signal of DHE upon knockdown of Coq2 indicates increased ROS (dotted circles in right panel without DAPI mark nuclei). (C) Quantitation of nuclear DHE signal indicates significant increase of ROS formation upon knockdown of Coq2. (D) GCN show a decrease of FITC-albumin uptake upon knockdown of ND75, a subunit of the complex I of the respiratory chain, as shown by representative images for one RNAi line and quantitation for two independent RNAis. (E–E’’) Silencing of ND75 results in displacement of Sns/Kirre from the membrane toward the interior of the cell. Areas denuded from labyrinthine channels appear on the cell surface. Knockdown of ND75-RNAi thus results in a phenocopy of Coq2 silencing. (F) TEM analysis of GCN expressing ND75-RNAi reveals loss of slits/labyrinthine channels or elongated channels with multiple slit diaphragms (red arrow heads). (G) Quantitation of slit diaphragm frequency on the full circumference of cells expressing ND75-RNAi. One complete diameter of six cells from three different animals was analyzed. Frequency of slit diaphragms was classified into three groups: normal (.2 slits/mm), reduced (0.5–2 slits/mm), and sporadic (,0.5 slits/mm). Values are presented as mean percentage6SD for each category. Note strong reduction of slit diaphragms upon knockdown of ND75 similar to knockdown of Coq2. Control is identical to control from Figure 4F. (H) Treatment of control or Coq2-RNAi with glutathione for 5 days partially restores uptake of FITC-albumin in Coq2-RNAi nephrocytes but has no effect on control-RNAi–expressing cells. (I) Quantitation of experiments in (H), n=3–5 per genotype and intervention. (J) TEM imaging after treatment of flies expressing Coq2-RNAi with the ROS scavenger glutathione for 5 days partially restores slit diaphragm frequency on the cell surface in ultrastructural analysis. Slit diaphragm localized

1530 Journal of the American Society of Nephrology J Am Soc Nephrol 28: 1521–1533, 2017 www.jasn.org BASIC RESEARCH spectrum upon oxidation by superoxide anions. The oxidized of slit diaphragm complex, interaction with the ECM, actin reg- form of DHE intercalates with DNA. We incubated GCN ex- ulation, regulation of gene expression, endocytosis, and CoQ10 pressing control-RNAi or Coq2-RNAi with DHE and recorded biosynthesis. red fluorescence (Figure 5B). Quantitation of the nuclear sig- Mutations in CoQ10 biosynthesis genes represent the only nal revealed a significant increase demonstrating intensified monogenic form of human SRNS, in whom gene identifica- ROS formation (Figure 5C). Then we tested if interference tion led to definition of a treatment approach. We employed with respiratory chain function independent of CoQ10 syn- GCN to model human COQ2 nephropathy and found Coq2 thesis results in a phenotype similar to Coq2 knockdown. This to be required for slit diaphragm morphology and function. would suggest an indirect pathogenesis related to mitochon- Vanillic acid supplementation of Drosophila rescued the Coq2 drial energy metabolism and not directly to lack of CoQ10 deficiency in GCN. This compound was shown to restore yeast 30,36 37 itself. We silenced ND75, a subunit of the respiratory chain CoQ10 biosynthesis but also is a mild antioxidant and complex, which is known to increase ROS formation.34,35 Up- regulates gene expression in certain bacteria.38 Vanillic acid take of FITC-albumin was reduced upon ND75 silencing sug- has been suggested as a treatment for deficient human CoQ10 gesting impairment of nephrocyte function (Figure 5D). Test- biosynthesis.30 Our findings imply that the pathogenesis of Coq2 ing localization of slit diaphragm proteins upon ND75 is linked to mitochondrial ROS formation but not to CoQ10 silencing we found that Sns/Kirre were displaced from function outside of mitochondria, such as a role as an antioxidant the cell membrane and mislocalized intracellularly (Figure 5, at lipid rafts. In podocytes, excess ROS may cause podocyte ap- E–E’’). When slit diaphragm proteins were detectable on the optosis39,40 or cytoskeletal rearrangements.41,42 surface, the fingerprint pattern was discontinuous and irregu- The use of GCN to model podocyte disease is an attractive lar (Figure 5, E–E’’, insets). This phenotype was highly remi- alternative to pericardial nephrocytes as GCN are discernible niscent of the phenotype of Coq2 silencing. We performed anatomically without use of a marker. Both nephrocyte models TEM analysis of ND75 knockdown and observed widespread are limited by their evolutionary distance and the morphologic loss of labyrinthine channels and slit diaphragms with only 4% and functional disparities between fly and humans. However, of the cell surface displaying normal slit diaphragm frequency no mammalian in vitro model that forms functional slit dia- (Figure 5, F–G). The few remaining labyrinthine channels were phragmsisavailable.Therapid,versatile,andinexpensive elongated and narrowed with frequently multiple slit dia- analysis this model offers facilitates screening approaches phragms inside the channels (Figure 5F). Knockdown of and dissection of pathways of human SRNS. ND75 thus results in a phenocopy of Coq2-RNAi. Toinvestigate Our findings lay the groundwork for using GCN to study the role of ROS formation further we fed the ROS scavenger pathogenesis of SRNS, and we employ this model to identify glutathione to Drosophila larvae. Supplementing glutathione ROS formation as a potential mechanism of COQ2 nephropathy. resulted in an increased FITC uptake when Coq2 was silenced, whereas there was no relevant effect on control nephrocytes (Figure 5, H and I). In TEM we observed a partial rescue of the CONCISE METHODS slit diaphragm frequency (55%, Figure 5, J and K) and the fingerprint-like staining pattern of Sns/Kirre was partially re- Fly Husbandry and Genetics stored (Figure 5, L and M). ROS scavenging thus partially res- Overexpression and transgenic RNAi studies were performed using cues the phenotype of Coq2 silencing. the UAS/GAL4 system (RNAi crosses grown at 25 or 29°C). Supple-

In summary, our data suggest that loss of Coq2 exerts its path- mentation experiments were performed by adding 200 mlH2O 6 ologic effects by ROS formation induced by CoQ10 deficiency. 0.25 mM glutathione or 10 mM vanillic acid consecutively 0, 1, 3, and 4 days before dissection. The RNAi stocks used throughout the study where obtained from DISCUSSION the Vienna Drosophila Resource Center or Bloomington Drosophila Stock Center at Indiana University (BDSC). RNAi-lines and the Here, we systematically screened the orthologs of genes that if CG7277 allele and deficiency are specified in Supplemental Table 2. mutated cause SRNS in humans using tracer endocytosis in Wild type flies were obtained from Bloomington (BDSC # 8522). Drosophila GCN. We detected a loss-of-function phenotype in Prospero-GAL46 or Hand-GAL4 (kindly provided by A. Paululat via this system for 16 out of 29 genes, thereby demonstrating its rele- H. Jasper) were used to drive expression in nephrocytes. vance as a model system for human SRNS. The genes we found to The CRISPR gRNA construct targeting sns was generated using a be required for GCN function pertained to the functional categories described protocol43 using pCFD4 (#49411; Addgene) and injected

in labyrinthine channels and elongated labyrinthine channels may still be found. (K) Quantitation of experiments in (J) for six cells from three animals. Control is identical to control from Figure 4O. (L–M’’) Treatment of Coq2-RNAi with glutathione partially restores typical local- ization including fingerprint pattern of Sns/Kirre (M–M’’). Compare with vehicle-only controls in Figure 4, I–J’’. All scale bars represent 500 nm in electron microscopy images and 5 mm in confocal images unless otherwise stated.

J Am Soc Nephrol 28: 1521–1533, 2017 Nephrocyte Model of Nephrotic Syndrome 1531 BASIC RESEARCH www.jasn.org into flies expressing phiC31 integrase under vasa promoter with an ACKNOWLEDGMENTS attP landing site in 51C (#24482; BDSC) by Bestgene. Tandem guide RNA sequences are as follows: AGTGCCAGGTGGGACCGGCT and We thank Susan Abmayr, Alvaro Glavic, Renjie Jiao, David Bilder, Zhe CTACGGAGCTTATGAGTGCG. Restricted Cas9 expression was Han, Ulrich Tepass, Karl-Friedrich Fischbach, Paul Hartley, and achieved by genetic combination of Hand-GAL4 and UAS-Cas9.P Heinrich Jasper for sharing reagents, the Developmental Studies (#54594; BDSC) by standard crosses. Hybridoma Bank for antibodies, Bloomington Drosophila Stock Center and Vienna Drosophila RNAi Center for flystocks.Wethank Immunohistochemistry and TUNEL Detection Maria Ericsson (Harvard Medical School Electron Microscopy Fa- GCN were dissected, fixed for 15 minutes in PBS containing 4% cility) for technical assistance. paraformaldehyde, and stained according to the standard procedure. This research was supported by grants from the National Institutes of The following primary antibodies were used: rabbit anti-sns17 (1:500, Health (DK076683 and DK086542) to F.H. and by a Research Fellowship gift from S. Abmayr), guinea pig anti-Kirre18 (1:200, gift from S. Ab- from the Deutsche Forschungsgemeinschaft (DFG) to T.H. (HE 7456/1-1). mayr), mouse anti-ATP5A (1:200, ab14748; Abcam), rat anti-Crumbs44 T.B.H. was supported by the DFG and European Research Council. (1:500, gift from U. Tepass), Alexa Fluor 647 anti-HRP (1:1000, 323– F.H. is the Warren E. Grupe Professor. T.H. designed and per- 605–021; Jackson Immuno Research), mouse anti-mys (1:50, CF.6G11; formed the experiments, D.A.B. critically reviewed the paper. M.H., DSHB), and mouse anti-mew (1:40, DK.1A4; DSHB). Hoechst 33342 and T.B.H. were involved in adult nephrocyte analysis. T.H. wrote the (1:1000; Thermofisher) was used to visualize nuclei. Apoptotic cells paper with help from F.H., F.H. conceived of and directed the project. were visualized using the In Situ Cell Death Detection Kit (Thermo- fisher) according to the manufacturer’s instructions. For imaging, a Leica SP5x confocal microscope was used. Image DISCLOSURES processing was done by ImageJ and Adobe Photoshop CS4 software. None.

Fluorescent Tracer Uptake and ROS Measurement Nephrocytes were dissected in PBS and incubated with DHE (30 mM, REFERENCES 5 min), FITC-albumin (Sigma) or Texas-Red–dextran (10 kD), Texas-Red–avidin, Texas-Red–transferrin (80 kD), HRP-avidin 1. Vivante A, Hildebrandt F: Exploring the genetic basis of early-onset – (154 kD), and FITC-dextran (500 kD) (all from Thermofisher) for chronic kidney disease. Nat Rev Nephrol 12: 133 146, 2016 2.SadowskiCE,LovricS,AshrafS,PabstWL,GeeHY,KohlS, 30 seconds or 5 minutes as indicated. After a fixation of 5 minutes in Engelmann S, Vega-Warner V, Fang H, Halbritter J, Somers MJ, Tan 8% paraformaldehyde cells were rinsed in PBS and exposed to W, Shril S, Fessi I, Lifton RP, Bockenhauer D, El-Desoky S, Kari JA, Hoechst 33342 (1:1000) for 20 seconds and mounted in Antifade Zenker M, Kemper MJ, Mueller D, Fathy HM, Soliman NA, Diamond (Thermofisher). Cells were imaged using a Leica SP5x con- Hildebrandt F; SRNS Study Group: A single-gene cause in 29.5% of focal microscope. Quantification of fluorescent tracer uptake was cases of steroid-resistant nephrotic syndrome. JAmSocNephrol26: 1279–1289, 2015 performed with ImageJ software. Average fluorescence of the three 3. Trautmann A, Bodria M, Ozaltin F, Gheisari A, Melk A, Azocar M, Anarat brightest cells was measured and intensity of the background sub- A, Caliskan S, Emma F, Gellermann J, Oh J, Baskin E, Ksiazek J, Remuzzi tracted. If applicable, the results are expressed as a ratio to a control G, Erdogan O, Akman S, Dusek J, Davitaia T, Özkaya O, Papachristou F, experiment with EGFP-RNAi that was done in parallel. Firszt-Adamczyk A, Urasinski T, Testa S, Krmar RT, Hyla-Klekot L, Pasini A, Özcakar ZB, Sallay P, Cakar N, Galanti M, Terzic J, Aoun B, Caldas Afonso A, Szymanik-Grzelak H, Lipska BS, Schnaidt S, Schaefer F; Electron Microscopy PodoNet Consortium: Spectrum of steroid-resistant and congenital fi Dissected GCN were xed in 4% formaldehyde and 0.5% glutaralde- nephrotic syndrome in children: The PodoNet registry cohort. Clin J Am hyde in 0.1Mcacodylatebuffer,pH7.4,and TEMwascarried outusing Soc Nephrol 10: 592–600, 2015 standard techniques. One complete diameter of six cells from three 4. Giglio S, Provenzano A, Mazzinghi B, Becherucci F, Giunti L, Sansavini different animals was analyzed. Frequency of slit diaphragms was G, Ravaglia F, Roperto RM, Farsetti S, Benetti E, Rotondi M, Murer L, fi . m – Lazzeri E, Lasagni L, Materassi M, Romagnani P: Heterogeneous ge- classi ed into three groups: normal ( 2slits/ m), reduced (0.5 2 netic alterations in sporadic nephrotic syndrome associate with re- m , m slits/ m), and sporadic ( 0.5 slits/ m). Areas where the labyrin- sistance to immunosuppression. JAmSocNephrol26: 230–236, 2015 thine channels are cut obliquely are recognizable by elongated 5. Lovric S, Ashraf S, Tan W, Hildebrandt F: Genetic testing in steroid- stretches of higher electrodensity along the cell surface. These areas resistant nephrotic syndrome: When and how? Nephrol Dial Transplant – were excluded from the quantitation. 31: 1802 1813, 2016 6. Weavers H, Prieto-Sánchez S, Grawe F, Garcia-López A, Artero R, Wilsch-Bräuninger M, Ruiz-Gómez M, Skaer H, Denholm B: The insect Statistical Analyses nephrocyte is a podocyte-like cell with a filtration slit diaphragm. Na- Paired t test was used to determine the statistical significance ture 457: 322–326, 2009 between two interventions. ANOVA followed by Sidak correc- 7. Zhuang S, Shao H, Guo F, Trimble R, Pearce E, Abmayr SM: Sns and tion (unless otherwise indicated) was used for multiple comparisons Kirre, the Drosophila orthologs of Nephrin and Neph1, direct adhesion, fi fusion and formation of a slit diaphragm-like structure in insect neph- (GraphPad Prism software). Asterisks indicate signi cance as follows: rocytes. Development 136: 2335–2344, 2009 * , , , fi P 0.05, **P 0.01, ***P 0.001. A statistically signi cant difference 8. Denholm B, Skaer H: Bringing together components of the flyrenal was defined as P,0.05. system. Curr Opin Genet Dev 19: 526–532, 2009

1532 Journal of the American Society of Nephrology J Am Soc Nephrol 28: 1521–1533, 2017 www.jasn.org BASIC RESEARCH

9. Zhang F, Zhao Y, Han Z: An in vivo functional analysis system for renal 27. Diomedi-Camassei F, Di Giandomenico S, Santorelli FM, Caridi G, gene discovery in Drosophila pericardial nephrocytes. JAmSoc Piemonte F, Montini G, Ghiggeri GM, Murer L, Barisoni L, Pastore A, Nephrol 24: 191–197, 2013 Muda AO, Valente ML, Bertini E, Emma F: COQ2 nephropathy: A newly 10. Zhang F, Zhao Y, Chao Y, Muir K, Han Z: Cubilin and amnionless me- described inherited mitochondriopathy with primary renal involve- diate protein reabsorption in Drosophila nephrocytes. JAmSoc ment. JAmSocNephrol18: 2773–2780, 2007 Nephrol 24: 209–216, 2013 28. McCarthy HJ, Bierzynska A, Wherlock M, Ognjanovic M, Kerecuk L, Hegde S, 11. Helmstädter M, Lüthy K, Gödel M, Simons M, Ashish, Nihalani D, Feather S, Gilbert RD, Krischock L, Jones C, Sinha MD, Webb NJ, Christian M, Rensing SA, Fischbach KF, Huber TB: Functional study of mammalian Williams MM, Marks S, Koziell A, Welsh GI, Saleem MA; RADAR the UK SRNS Neph proteins in Drosophila melanogaster. PLoS One 7: e40300, 2012 Study Group: Simultaneous sequencing of 24 genes associated with steroid- 12. Na J, Sweetwyne MT, Park AS, Susztak K, Cagan RL: Diet-Induced podo- resistant nephrotic syndrome. Clin J Am Soc Nephrol 8: 637–648, 2013 cyte dysfunction in Drosophila and mammals. Cell Rep 12: 636–647, 2015 29. Desbats MA, Lunardi G, Doimo M, Trevisson E, Salviati L: Genetic bases 13. Gee HY, Zhang F, Ashraf S, Kohl S, Sadowski CE, Vega-Warner V, Zhou and clinical manifestations of coenzyme Q10 (CoQ 10) deficiency. W, Lovric S, Fang H, Nettleton M, Zhu JY, Hoefele J, Weber LT, J Inherit Metab Dis 38: 145–156, 2015 Podracka L, Boor A, Fehrenbach H, Innis JW, Washburn J, Levy S, Lifton RP, 30. Doimo M, Trevisson E, Airik R, Bergdoll M, Santos-Ocaña C, Hildebrandt F, Otto EA, Han Z, Hildebrandt F: KANK deficiency leads to podocyte dys- Navas P, Pierrel F, Salviati L: Effect of vanillic acid on COQ6 mutants identified in function and nephrotic syndrome. J Clin Invest 125: 2375–2384, 2015 patients with coenzyme Q10 deficiency. Biochim Biophys Acta 1842: 1–6, 2014 14. Ashraf S, Gee HY, Woerner S, Xie LX, Vega-Warner V, Lovric S, Fang H, 31. Quinzii CM, Garone C, Emmanuele V, Tadesse S, Krishna S, Dorado B, Song X, Cattran DC, Avila-Casado C, Paterson AD, Nitschké P, Bole- Hirano M: Tissue-specific oxidative stress and loss of mitochondria in Feysot C, Cochat P, Esteve-Rudd J, Haberberger B, Allen SJ, Zhou W, CoQ-deficient Pdss2 mutant mice. FASEB J 27: 612–621, 2013 Airik R, Otto EA, Barua M, Al-Hamed MH, Kari JA, Evans J, Bierzynska A, 32. Sarov M, Barz C, Jambor H, Hein MY, Schmied C, Suchold D, Stender B, Saleem MA, Böckenhauer D, Kleta R, El Desoky S, Hacihamdioglu DO, Janosch S, Kj VV, Krishnan RT, Krishnamoorthy A, Ferreira IR, Ejsmont Gok F, Washburn J, Wiggins RC, Choi M, Lifton RP, Levy S, Han Z, RK, Finkl K, Hasse S, Kampfer P, Plewka N, Vinis E, Schloissnig S, Knust Salviati L, Prokisch H, Williams DS, Pollak M, Clarke CF, Pei Y, Antignac E, Hartenstein V, Mann M, Ramaswami M, VijayRaghavan K, Tomancak C, Hildebrandt F: ADCK4 mutations promote steroid-resistant ne- P, Schnorrer F: A genome-wide resource for the analysis of protein phrotic syndrome through CoQ10 biosynthesis disruption. JClinInvest localisation in. eLife 5: e12068, 2016 123: 5179–5189, 2013 33. Turrens JF: Mitochondrial formation of reactive oxygen species. 15. Gee HY, Saisawat P, Ashraf S, Hurd TW, Vega-Warner V, Fang H, Beck JPhysiol552: 335–344, 2003 BB, Gribouval O, Zhou W, Diaz KA, Natarajan S, Wiggins RC, Lovric S, 34. Owusu-Ansah E, Banerjee U: Reactive oxygen species prime Drosophila Chernin G, Schoeb DS, Ovunc B, Frishberg Y, Soliman NA, Fathy HM, haematopoietic progenitors for differentiation. Nature 461: 537–541, 2009 Goebel H, Hoefele J, Weber LT, Innis JW, Faul C, Han Z, Washburn J, 35. Hochmuth CE, Biteau B, Bohmann D, Jasper H: Redox regulation by Antignac C, Levy S, Otto EA, Hildebrandt F: ARHGDIA mutations cause Keap1 and Nrf2 controls intestinal stem cell proliferation in Drosophila. nephrotic syndrome via defective RHO GTPase signaling. JClinInvest Cell Stem Cell 8: 188–199, 2011 123: 3243–3253, 2013 36. Ozeir M, Mühlenhoff U, Webert H, Lill R, Fontecave M, Pierrel F: Coenzyme 16. Tutor AS, Prieto-Sánchez S, Ruiz-Gómez M: Src64B phosphorylates Q biosynthesis: Coq6 is required for the C5-hydroxylation reaction and Dumbfounded and regulates slit diaphragm dynamics: Drosophila as a substrate analogs rescue Coq6 deficiency. Chem Biol 18: 1134– 1142, 2011 model to study nephropathies. Development 141: 367–376, 2014 37. Kumar S, Prahalathan P, Raja B: Antihypertensive and antioxidant po- 17. Bour BA, Chakravarti M, West JM, Abmayr SM: Drosophila SNS, a tential of vanillic acid, a phenolic compound in L-NAME-induced hyper- member of the immunoglobulin superfamily that is essential for myo- tensive rats: A dose-dependence study. Redox Rep 16: 208–215, 2011 blast fusion. Genes Dev 14: 1498–1511, 2000 38. Gitzinger M, Kemmer C, Fluri DA, El-Baba MD, Weber W, Fussenegger 18. Galletta BJ, Chakravarti M, Banerjee R, Abmayr SM: SNS: Adhesive M: The food additive vanillic acid controls transgene expression in properties, localization requirements and ectodomain dependence in mammalian cells and mice. Nucleic Acids Res 40: e37, 2012 S2 cells and embryonic myoblasts. Mech Dev 121: 1455–1468, 2004 39. Susztak K, Raff AC, Schiffer M, Böttinger EP: Glucose-induced reactive 19. Kosaka T, Ikeda K: Reversible blockage of membrane retrieval and oxygen species cause apoptosis of podocytes and podocyte depletion endocytosis in the garland cell of the temperature-sensitive mutant of at the onset of diabetic nephropathy. Diabetes 55: 225–233, 2006 Drosophila melanogaster, shibirets1. J Cell Biol 97: 499–507, 1983 40. Das R, Xu S, Quan X, Nguyen TT, Kong ID, Chung CH, Lee EY, Cha SK, 20. Andreenkova OV, Karpova EK, Menshanov PN, Rauschenbach IY: [Knock- Park KS: Upregulation of mitochondrial Nox4 mediates TGF-b-induced down of InR gene in ventral nephrocytes promotes resistance to toxic stress apoptosis in cultured mouse podocytes. Am J Physiol Renal Physiol in Drosophila melanogaster females]. Genetika 51: 263–265, 2015 306: F155–F167, 2014 21. Gleixner EM, Canaud G, Hermle T, Guida MC, Kretz O, Helmstädter M, 41. Stanley A, Thompson K, Hynes A, Brakebusch C, Quondamatteo F: Huber TB, Eimer S, Terzi F, Simons M: V-ATPase/mTOR signaling regu- NADPH oxidase complex-derived reactive oxygen species, the actin lates megalin-mediated apical endocytosis. Cell Rep 8: 10–19, 2014 cytoskeleton, and Rho GTPases in cell migration. Antioxid Redox Signal 22. Seiler MW, Venkatachalam MA, Cotran RS: Glomerular epithelium: 20: 2026–2042, 2014 Structural alterations induced by polycations. Science 189: 390–393, 1975 42. Nimnual AS, Taylor LJ, Bar-Sagi D: Redox-dependent downregulation 23. Hamano Y, Grunkemeyer JA, Sudhakar A, Zeisberg M, Cosgrove D, of Rho by Rac. Nat Cell Biol 5: 236–241, 2003 Morello R, Lee B, Sugimoto H, Kalluri R: Determinants of vascular per- 43. Port F, Chen HM, Lee T, Bullock SL: Optimized CRISPR/Cas tools for meability in the kidney glomerulus. JBiolChem277: 31154–31162, 2002 efficient germline and somatic genome engineering in Drosophila. 24. Scott RP, Quaggin SE: Review series: The cell biology of renal filtration. Proc Natl Acad Sci USA 111: E2967–E2976, 2014 J Cell Biol 209: 199–210, 2015 44. Pellikka M, Tanentzapf G, Pinto M, Smith C, McGlade CJ, Ready DF, 25. Kozyraki R, Fyfe J, Verroust PJ, Jacobsen C, Dautry-Varsat A, Gburek J, Tepass U: Crumbs, the Drosophila homologue of human CRB1/RP12, is Willnow TE, Christensen EI, Moestrup SK: Megalin-dependent cubilin- essential for photoreceptor morphogenesis. Nature 416: 143–149, 2002 mediated endocytosis is a major pathway for the apical uptake of transferrin in polarized epithelia. Proc Natl Acad Sci USA 98: 12491–12496, 2001 26. Hu Y, Flockhart I, Vinayagam A, Bergwitz C, Berger B, Perrimon N, Mohr SE: An integrative approach to ortholog prediction for disease-focused This article contains supplemental material online at http://jasn.asnjournals. and other functional studies. BMC Bioinformatics 12: 357, 2011 org/lookup/suppl/doi:10.1681/ASN.2016050517/-/DCSupplemental.

J Am Soc Nephrol 28: 1521–1533, 2017 Nephrocyte Model of Nephrotic Syndrome 1533

A A’ A’’

1

st

Sns Kirre merge instar

B surface B’ B’’

RNAi

- Sns Kirre merge

C C’ C’’

2

pros>GFP

nd

Sns Kirre merge instar

D surface D’ D’’

Sns Kirre merge

E E’ E’’

3rd

instar Sns Kirre merge surface

F F’ F’’ Hand>Cas9/+

Sns Kirre merge

surface 250 nm

G G’ G’’ adult

RNAi

-

Sns Kirre merge pros>GFP Suppl. Fig. 1. Fingerprint-like pattern of Sns/Kirre is maintained throughout development (A-B) Control Garland nephrocyte dissected from 1st instar larva and stained for Sns/Kirre. Fingerprint-like pattern is visible as dots in cross section (A-A’’) or fine lines on the surface (B- B’’). Distance of lines is 250-500 nm.

(C-D) Control Garland nephrocyte dissected from a 2nd instar larva and stained for Sns/Kirre.

(D) Fingerprint-like pattern is visible like in the second instar larval stage.

(E-F’’) GCN from 3rd instar larva with expression of Cas9 driven by Hand-GAL4 without expression of gRNA. Sns and Kirre localize towards the cell periphery (E) and a fingerprint-like pattern is detected in the surficial section. This genotype serves as a negative control for CRISPR/Cas9-mediated gene silencing.

(G) Control garland cell nephrocyte dissected from adult animal several days after eclosion. Sns and Kirre are expressed and the fingerprint pattern is maintained A no tracer A’ A’’

HRP Dapi Hand-GFP

Texas-Red TR-Dextran 10 kDa

Texas-Red-dextran 10 kDa

B 30 sec pulse, no chase B’ B’’

GAL4 GAL4 -

Dapi Hand-GFP

Texas-Red Hand-GFP TR-Dextran 10 kDa

adult RFP; Dot RFP;

- Texas-Red-dextran 10 kDa

C 30 sec pulse, chase 10 min C’ C’’

ANF -

MHC HRP Dapi Hand-GFP

Texas-Red Hand-GFP TR-Dextran 10 kDa GFP,

- D D Hand

Suppl. Fig. 2. Adult nephrocytes show tracer endocytosis (A-C) Control Garland nephrocyte dissected from adult animals several days after eclosion. The Hand-GFP, MHC-ANF-RFP;Dot-GAL4 is used as lack of uptake was previously described in this background. The filter set is optimized for Texas-Red but not RFP (endogenous tracer). (A) The adult GCN are identified by Hand-GFP, HRP and two nuclei as GCN. Without tracer incubation there is no red fluorescence visible.

(B) Exposure for 30 sec to Texas-Red-dextran results in appearance of small red vesicles at the periphery of the cell. This indicates rapid tracer uptake.

(C) The same exposure as in (B) followed by 4 rinses and chasing for 10 min without tracer shows first appearance of vesicles deeper in the cell (arrow). GCN cell membrane is marked by the anti-HRP antibody.

(D) Surface detail of a GCN dissected from adult animal shows typical nephrocyte ultrastructure with slit diaphragms (black arrow heads) and labyrinthine channels.

(E) Magnification from the image in (D). Slit membranes are visible (black arrow heads) and show regular morphology compared to the larval stage (compare Fig. 1D).

A B 1.4 TR-transferrin, TR-transferrin 80 kDa no comp. 1.2 TR-transferrin, comp. albumin No compet. 1.0 0.8

0.6

0.4 +FITC-albumin ****

0.2 Fluorescence intensity gray] intensity Fluorescence

0

1.2 TR-avidin, C TR-avidin 66 kDa D no comp. 1.0 TR-avidin, comp. alb. No compet. 0.8

0.6

0.4 ***

+FITC-albumin 0.2 Fluorescence intensity [ratio] intensity Fluorescence 0

Suppl. Fig. 3. Albumin out-competes uptake of transferrin and avidin. (A) Control Garland nephrocytes incubated for 5 min with 3 µM Texas-Red-transferrin alone (upper panel) or in presence of an excess of 30 µM FITC-albumin (lower panel). Uptake of Texas-Red-transferrin is strongly reduced by competition.

(B) Quantitation of fluorescence from (A). N=3 per intervention.

(C) Control Garland nephrocytes incubated for 5 min with 3 µM Texas-Red-avidin (3 µM) alone (upper panel) or in presence of an excess of 30 µM FITC-albumin (lower panel). Uptake of Texas-Red-avidin is strongly reduced by competition.

(D) Quantitation of fluorescence from (C). N=3 per intervention.

Supplementary Table 1. 37 genes that if mutated cause human SRNS and their Drosophila orthologues. Left column indicates functional group of nephrosis genes (see Suppl. Fig.4) followed by human genes involved in the pathogenesis of nephrotic syndrome, literature reference, human accession number, and the corresponding Drosophila orthologue. Orthologues were identified using BLAST analysis and online tools and the number of potential orthologues was restricted to a single gene. COL4A3, ZO1 and KIRREL/NEPH1 are not published monogenic causes of SRNS in humans. They are included due to previous findings implying their relevance for podocytes and of their orthologues for nephrocytes6. CATE- HUMAN HUMAN GENE FULL NAME REFERENCE ACCESSION DROSOPHILA ORTHOLOGUE ANNO- GORY GENE (1st AUTHOR/ NUMBER ORTHO- FULL NAME TATION SYMBOL YEAR) LOGUE SYMBOL 1 NPHS1 NEPHRIN Kestila/1998 NM_004646.3 sns sticks and stones CG33141 KIRREL KIN OF IRRE-LIKE Donoviel/20012 NM_018240.5 kirre kin of irre CG3653 CIN85 and CD2AP 3 CD2AP CD2-ASSOCIATED PROTEIN Lowik/2007 NM_012120.2 cindr orthologue CG31012 CRUMBS, DROSOPHILA, HOMOLOG 4 CRB2 OF, 2 Ebarasi/2015 NM_173689.5 crb crumbs CG6383 FAT TUMOR SUPPRESSOR, 5 FAT1 DROSOPHILA, HOMOLOG OF, 1 Gee/2016 NM_005245.3 ft fat CG3352 6 NPHS2 PODOCIN Boute/2000 NM_014625.2 Mec2 Mec2 CG7635 DIACYLGLYCEROL KINASE, EPSILON, 7 DGKE 64-KD Ozaltin/2013 NM_003647.2 Dgkε Diacyl glycerol kinase ε CG8657 Slit membrane complex PROTEIN-TYROSINE PHOSPHATASE, Protein tyrosine 8 PTPRO RECEPTOR-TYPE, O Ozaltin/2011 NM_030667.2 Ptp10D phosphatase 10D CG1817 9 TJP 1 TIGHT JUNCTION PROTEIN 1 (Huber/2003 ) NM_003257.4 pyd polychaetoid CG43140 10 COL4A3 COLLAGEN, TYPE IV, ALPHA-3 (Malone/2014 ) NM_000091.4 vkg Viking CG16858 multiple edematous 11 ITGA3 INTEGRIN, ALPHA-3 Has/2012 NM_005501.2 mew wings CG1771 12 action ITGB4 INTEGRIN, BETA-4 Kambham/2000 NM_000213.3 mys myospheroid CG1560

ECM inter- 13 LAMB2 LAMININ, BETA-2 Zenker/2004 NM_002292.3 LanB1 LanB1 CG7123 14 ADCK4 AARF DOMAIN-CONTAINING KINASE 4 Ashraf/2013 NM_024876.3 CG32649 NN CG32649 Diomedi- Coenzyme Q 15 10 COQ2 COQ2, S. CEREVISIAE, HOMOLOG OF Camassei/2007 NM_015697.7 Coq2 biosynthesis protein 2 CG9613 COQ6, S. CEREVISIAE, HOMOLOG OF Heeringa/201116 NN CoQ COQ6 NM_182476.2 CG7277 CG7277 PRENYL DIPHOSPHATE SYNTHASE, 17 PDSS2 SUBUNIT 2 Lopez/2006 NM_020381.3 CG10585 NN CG10585 18 ACTN4 ACTININ, ALPHA-4 Kaplan/2000 NM_004924.4 Actn α actinin CG4376 19 ANLN ACTIN-BINDING PROTEIN ANILLIN Gbadegesin/2014 NM_018685.2 scra scraps CG2092 Rho GTPase activating 20 ARHGAP24 RHO GTPase-ACTIVATING PROTEIN 24 Akilesh/2011 NM_001025616.2 RhoGAP92B protein at 92B CG4755 RHO GDP-DISSOCIATION INHIBITOR 21 ARHGDIA ALPHA Gupta/2013 NM_001185078.1 RhoGDI RhoGDI CG7823 22 INF2 INVERTED FORMIN 2 Brown/2010 NM_022489.3 form3 formin 3 CG33556

KANK 1 NM_001256876.1

Actin regulation Actin KANK2 KN MOTIF- AND ANKYRIN REPEAT NM_015493.6 23 KANK4 DOMAIN-CONTAINING PROTEIN 1 Gee/2015 NM_181712.4 Kank Kank CG10249 24 MYO1E MYOSINMYOSIN, IE HEAVY CHAIN 9, Mele/2011 NM_004998.3 Myo61F Myosin 61F CG9155 25 MYH9 NONMUSCLE Heath/2001 NM_002473.4 zip zipper CG15792

26 CUBN CUBILIN Ovunc/2011 NM_001081.3 Cubn Cubilin ortholog CG32702 SCAVENGER RECEPTOR CLASS B, epithelial membrane

Endo- CG2727 cytosis 27 SCARB2 MEMBERSWI/SNF-RELATED, 2 MATRIX- Berkovic/2008 NM_005506.3 emp protein ASSOCIATED, ACTIN-DEPENDENT REGULATOR OF CHROMATIN, 28 SMARCAL1 SUBFAMILY A-LIKE PROTEIN 1 Boerkoel/2002 NM_014140.3 Marcal1 Marcal1 CG3753 LIM HOMEOBOX TRANSCRIPTION FACTOR 1, BETA Vollrath/199829 NN

Trans- criptional regulation LMX1B NM_00117414.1 CG32105 CG32105 30 PLCE1 PHOSPHOLIPASE C, EPSILON-1 Hinkes/2006 NM_016341.3 31 EMP2 EPITHELIAL MEMBRANE PROTEIN 2 Gee/2014 NM_001424.4 32 WDR73 WD REPEAT-CONTAINING PROTEIN 73 Colin/2014 NM_032856.2 33 CFH COMPLEMENT FACTOR H Sethi/2012 NM_000186.3 34 WT1 WILMS TUMOR 1 Jeanpierre/1998 NM_024426.4 TRANSFER RNA, MITOCHONDRIAL, No No orthologous identifiedgene 35 MTTL1 LEUCINE, 1; Yasukawa/2000 NC_012920.1 wild type CG7277KG03584/+ pros>sns-RNAi (Skaer) pros>Coq-RNAi 2 A Ctrl B COQ6 C NPHS1 D COQ2

FITC-albumin FITC-albumin FITC-albumin FITC-albumin E 1.4 ns

ns

1.2 ns ns ns ns 1.0 ns ns

0.8 ** 0.6 ** **

0.4

0.2 **** Fluorescence intensity [ratio] intensity Fluorescence

0

Suppl. Fig. 4. Additional FITC-albumin uptake experiments. (A-D) Shown are examples FITC-albumin uptake after 30 sec exposure of wild type GCN (A) and GCN heterozygous for CG7277KG03584 over a wild type chromosome (B). Robust robust FITC-albumin endocytosis can be observed in both genotypes. GCN expressing RNAi directed against sns (B), and a second RNAi directed against Coq2 show reduced FITC-albumin uptake. All scale bars represent 10 µm.

(E) Quantitation of fluorescent intensity for genotypes as indicated compared normalized to GFP-RNAi (N=3 per intervention). Human orthologue is denoted in brackets, red letters indicate signfificantly reduced FITC-albumin endocytosis, green letters indicate no significant effect (may diverge from the two further RNAi shown in Fig. 3). The allele and deficiency affecting the orthologue of COQ6 are heterozygous over a wild type chromosome. Statistical significance was calculated using ANOVA and Dunnet’s post hoc analysis.

pros>control-RNAi pros>mys-RNAi A B

Mys (beta-integrin) Mys (beta-integrin) pros>control-RNAi pros>mew-RNAi C D

Mew (alpha-integrin) Mew (alpha-integrin) pros>control-RNAi pros>crumbs-RNAi E F

Crumbs Crumbs

Suppl. Fig. 5. Knock-down efficiency tested by Immunofluorescence. (A-F) All images are recorded with identical settings for control and knockdown. (A) GCN expressing control RNAi stained for the orthologue of ITGB4.

(B) Silencing of the orthologue of ITGBA strongly reduces signal of the anti-mys antibody suggesting efficient knockdown.

(C) GCN expressing control RNAi stained for the orthologue of ITGA3.

(D) Silencing of the orthologue of ITGBA strongly reduces signal of the anti-mew antibody suggesting efficient knockdown.

(E) GCN expressing control RNAi stained for the orthologue of CRB2.

(F) Silencing of the orthologue of CRB2 strongly reduces signal of the anti-crumbs antibody suggesting efficient knockdown.

control-RNAi

A A’ C RNAi

- sns-RNAi

Coq2-RNAi [gray] [gray]

TUNEL

pros>GFP TUNEL FITC-albumin

B B’

RNAi

- sns TUNEL TUNEL

pros> FITC-albumin Fluorescence intensity intensity Fluorescence

Supplementary Fig. 6. Uptake of TUNEL-negative cells is strongly affected upon knockdown of sns and Coq2. (A-A’) Control garland cell nephrocytes are TUNEL-negative and show strong uptake of FITC-albumin. (B-B’) Silencing sns results in the appearance of TUNEL-positive nephrocytes like the cell below in the middle of the representative image. TUNEL- negative and TUNEL-positive cells alike show a reduced uptake of FITC-albumin. (C) Quantitation of FITC-albumin-uptake using Image J for TUNEL-negative cells expressing control-RNAi (EGFP-RNAi) or RNAis directed against sns or Coq2 (N= 3 animals for each genotype). B Coq2-RNAi 2

C control-RNAi A B **** Coq2-RNAi-2

100 * * 80 **** * * 60 * 40 *** * 20

0 Circumference Circumference [%] Coq2-RNAi-2 Coq2-RNAi-2

D Sns D’ Kirre D’’ merge

2

-

RNAi -

E Sns E’ Kirre E’’ merge pros>Coq2

Supplementary. Fig. 7. Coq2-RNAi findings are confirmed by a second RNAi- line. (A-B) EM-images of nephrocytes expressing a second Coq2-RNAi show reduced number of SDs (arrow heads) and labyrinthine channels (asterisks). SDs are often mislocalized into the labyrinthine channels and multiplied (red arrow heads).

(C) Quantitation of frequency of SD measured along one complete GNC diameter for control-RNAi compared to Coq2-RNAi as mean of 6 cells from 3 different animals. Frequency of SDs was classified into three groups: normal (>2 slits/µm), reduced (0.5-2 slits/µm) and sporadic (<0.5 slits/µm). Note the strong reduction of SDs in Coq2-RNAi.

(D-D’’) Immunostaining of Sns/Kirre in Garlands expressing Coq2-RNAi2 reveals gaps and partial misplacement of Sns/Kirre from the membrane.

(E-E’’) Surface section of nephrocyte expressing Coq2-RNAi 2 shows gaps of Sns/Kirre on the surface.

All Scale bars represent 500 nm in electron microscopy images and 5 µm in confocal images. Supplementary Table 2. Drosophila RNAi lines used in this study. Drosophila stocks were obtained from from Vienna Drosophila Drosophila Resource Center (VDRC) or Bloomington Drosophila Stock Center at Indiana University (BDSC) unless otherwise indicated. Source ID is noted as Transformant ID (VDRC) or stock number (BDSC). Uptake is denoted as percent of uptake compared to control (GFP-RNAi). stock name CG # source source ID# uptake [%] UAS-EGFP-RNAi - BDSC 41553 100 UAS-mCherry-RNAi - BDSC 35785 95 UAS-sns-RNAi CG33141 VDRC 109442 10 UAS-sns-RNAi CG33141 BDSC 64872 12 UAS-sns-RNAi CG33141 H. Skaer - 7 UAS-kirre-RNAi CG3653 VDRC 27227 8 UAS-kirre-RNAi CG3653 VDRC 109585 17 UAS-pyd-RNAi CG43140 BDSC 35225 14 UAS-pyd-RNAi CG43140 BDSC 33386 13 UAS-Mec2-RNAi CG7635 VDRC 104601 57 UAS-Mec2-RNAi CG7635 BDSC 61259 54 UAS-Cindr-RNAi CG31012 BDSC 38328 47 UAS-Cindr-RNAi CG31012 BDSC 38976 54 UAS-crb-RNAi CG6383 BDSC 40869 66 UAS-crb-RNAi CG6383 BDSC 34999 78 UAS-Ptp10D-RNAi CG1817 VDRC 110443 43 UAS-Ptp10D-RNAi CG1817 BDSC 39001 93 UAS-Ptp10D-RNAi CG1817 VDRC 1101 76 UAS-Dgke-RNAi CG8657 VDRC 4659 75 UAS-Dgke-RNAi CG8657 BDSC 57750 83 UAS-ft-RNAi CG3352 VDRC 108863 81 UAS-ft-RNAi CG3352 BDSC 34970 92 UAS-ft-RNAi CG3352 VDRC 9396 94 UAS-LanB1-RNAi CG7123 VDRC 23121 14 UAS-LanB1-RNAi CG7123 BDSC 42616 71 UAS-mys-RNAi CG1560 BDSC 33642 51 UAS-mys-RNAi CG1560 VDRC 29619 19 UAS-mys-RNAi CG1560 BDSC 27735 42 UAS-mew-RNAi CG1771 BDSC 44553 47 UAS-mew-RNAi CG1771 BDSC 27543 54 UAS-vkg-RNAi CG16858 BDSC 50895 57 UAS-vkg-RNAi CG16858 VDRC 106812 47 UAS-Coq2-RNAi CG9613 BDSC 27054 13 UAS-Coq2-RNAi (2) CG9613 VDRC 108373 34 UAS-CG32649-RNAi CG32649 VDRC 110801 12 UAS-CG32649-RNAi CG32649 BDSC 57039 46 UAS-CG7277-RNAi CG7277 VDRC 30693 108 CG7277KG03584/Def CG7277 BDSC 13964/9602 53 CG7277KG03584 hom CG7277 BDSC 13964 31 CG7277KG03584/+ CG7277 BDSC 13964 97 CG7277 Deficiency/+ CG7277 BDSC 9602 94 UAS-CG10585-RNAi CG10585 VDRC 110196 69 UAS-CG10585-RNAi CG10585 BDSC 51910 104 UAS-RhoGAP92B-RNAi CG4755 VDRC 105663 45 UAS-RhoGAP92B-RNAi CG4755 BDSC 33391 55 UAS-Kank-RNAi CG10249 BDSC 33432 69 UAS-Kank-RNAi CG10249 VDRC 15009 53 UAS-scra-RNAi CG2092 VDRC 104674 80 UAS-scra-RNAi CG2092 BDSC 53358 39 UAS-scra-RNAi CG2092 VDRC 33465 59 UAS-RhoGDI-RNAi CG7823 VDRC 105765 94 UAS-RhoGDI-RNAi CG7823 VDRC 46154 76 UAS-RhoGDI-RNAi CG7823 BDSC 40902 92 UAS-zip-RNAi CG3533 VDRC 104208 98 UAS-zip-RNAi CG3533 BDSC 36727 48 UAS-zip-RNAi CG3533 BDSC 38259 52 UAS-Myo61F-RNAi CG9155 VDRC 110682 101 UAS-Myo61F-RNAi CG9155 BDSC 41689 82 UAS-Myo61F-RNAi CG9155 VDRC 49345 45 UAS-Actn-RNAi CG4376 BDSC 34874 98 UAS-Actn-RNAi CG4376 VDRC 7762 22 UAS-Actn-RNAi CG4376 VDRC 110719 49 UAS-form3-RNAi CG33556 VDRC 45594 105 UAS-form3-RNAi CG33556 VDRC 42302 92 UAS-Marcal1-RNAi CG3753 VDRC 34701 55 UAS-Marcal1-RNAi CG3753 BDSC 33709 64 UAS-CG32105-RNAi CG32105 VDRC 108747 113 UAS-CG32105-RNAi CG32105 VDRC 51269 87 UAS-Cubn-RNAi CG32702 BDSC 51736 4 UAS-Cubn-RNAi CG32702 BDSC 28702 4 UAS-emp-RNAi CG2727 VDRC 12233 118 UAS-emp-RNAi CG2727 BDSC 40947 40 UAS-ND75-RNAi CG2286 BDSC 33910 30 UAS-ND75-RNAi CG2286 BDSC 33911 53 UAS-mgl-RNAi CG42611 BDSC 33940 73 UAS-mgl-RNAi CG42611 VDRC 105071 71 UAS-Amnionless-RNAi CG11592 VDRC 104099 1 UAS-Amnionless-RNAi CG11592 BDSC 41956 3