Epigenetic Inactivation of the Groucho Homologue Gene TLE1 in Hematologic Malignancies

Research Article

Mario F. Fraga,1 Maria Berdasco,1 Esteban Ballestar,1 Santiago Ropero,1 Pilar Lopez-Nieva,1 Lidia Lopez-Serra,1 Jose´I. Martı´n-Subero,2 Maria J. Calasanz,3 Isabel Lopez de Silanes,1 Fernando Setien,1 Sara Casado,1 Agustin F. Fernandez,1,4 Reiner Siebert,2 Stefano Stifani,5 and Manel Esteller1

1Cancer Epigenetics Laboratory, Spanish National Cancer Research Centre, Madrid, Spain; 2Institute of Human Genetics, University Hospital Schleswig-Holstein Campus Kiel, Kiel, Germany; 3Department of Genetics, University of Navarra, Pamplona, Spain; 4Cancer Epigenetics and Biology Program, Catalan Institute of Oncology, Barcelona, Catalonia, Spain; and 5Center for Neuronal Survival, Montreal Neurological Institute, McGill University, Montreal, Quebec, Canada

Abstract the Wnt/B-catenin signaling pathway (4–6). To date, however, An undifferentiated status and the epigenetic inactivation similar hypermethylation events in the AML1 or NOTCH1 of tumor-suppressor genes are hallmarks of transformed pathways that could compromise their differentiating capacities cells. Promoter CpG island hypermethylation of differentiat- have not been identified in cancer cells. To address this issue, we have turned our attention to a Groucho homologue, the Trans- ing genes, however, has rarely been reported. The Groucho ducin-like Enhancer of Split 1 TLE1 homologue Transducin-like Enhancer of Split 1 (TLE1) is a ( ). The Groucho/TLE/Grg family of corepressors operates in many multitasked transcriptional corepressor that acts through the TLE1 acute myelogenous leukemia 1, Wnt, and Notch signaling signaling pathways (7, 8). The human homologue of Groucho, pathways. We have found that TLE1 undergoes promoter CpG (9), has critical transcription factor partners such as TCF/LEF-1 in the case of the Wnt signaling pathway (10), Hairy/Enhancer island hypermethylation–associated inactivation in hemato- of Split 1 HES1 a logic malignancies, such as diffuse large B-cell lymphoma and ( ) in the case of Notch (11), and the AML/CBF runt domain transcription factor family in hematopoiesis (12, 13). AML. We also observed a mutual exclusivity of the epigenetic TLE1 alteration of TLE1 and the cytogenetic alteration of AML1. expression has been associated with immature cells that are TLE1 reintroduction in hypermethylated leukemia/lymphoma progressing toward a terminally differentiated state, suggesting a role during differentiation (14). At the end of hematopoiesis, when cells causes growth inhibition in colony assays and nude mice, whereas TLE1-short hairpin RNA depletion in unmethylated committed progenitors begin to acquire the characteristic diffe- cells enhances tumor growth. We also show that these effects rentiation status of mature hematopoietic cells, target genes from are mediated by TLE1 transcriptional repressor activity on its the AML1, Wnt, and Notch signaling pathways (15, 16) need to be target genes, such as Cyclin D1, Colony-Stimulating Factor 1 repressed by TLE1 (12, 13). Hence, we examined whether epigenetic receptor, and Hairy/Enhancer of Split 1. These data suggest silencing of TLE1 was involved in the development of human that TLE1 epigenetic inactivation contributes to the develop- malignancies. ment of hematologic malignancies by disrupting critical Materials and Methods differentiation and growth-suppressing pathways. [Cancer Res 2008;68(11):4116–22] Human cancer cell lines and primary tumor samples. The 49 human cancer cell lines examined in this study were obtained from the American Type Culture Collection. The cell lines represented 14 types of malignancy Introduction (leukemia, lymphoma, breast, cervix, colon, condrosarcoma, liver, lung, Genetic lesions impairing cell differentiation in human cancer muscle, neuroblastoma, osteosarcoma, prostate, skin, and testis). Cell lines are exemplified by the chromosomal translocations involving the were maintained in appropriate medium and treated with 1 Amol/L 5-aza- transcription factor AML1 in acute myelocytic human leukemia 2¶-deoxycytidine (Sigma) for 3 d to achieve demethylation. One-hundred six (AML; refs. 1, 2) and NOTCH1 in T-cell acute lymphoblastic primary hematologic malignancies were obtained from the Spanish leukemia/lymphoma (3). Transcriptional silencing of tumor- National Cancer Research Centre Tumour Bank, the University of Navarra, and the University Hospital Schleswig-Holstein Campus Kiel. The study was suppressor genes associated with promoter CpG island hyper- approved by the corresponding institutional review boards. methylation has emerged as another hallmark of human tumors DNA methylation analysis of the TLE1 gene. We established TLE1 CpG (4–6). In this latter scenario, genes critical to cell fate, such as island methylation status by PCR analysis of bisulfite-modified genomic SFRPs, WIF-1, and DKK-1, undergo epigenetic silencing in human DNA. First, methylation status was analyzed by bisulfite genomic tumors, leading to the deregulation or constitutive activation of sequencing of both strands of the CpG island. The primers used were 5¶-GAG AAT TTT GTA GTG GGT TGG-3¶ (sense) and 5¶-CAA TCC TAA ACA AAC AAA TCC A-3¶ (antisense). The second analysis used methylation- specific PCR with primers specific to either the methylated or modified Note: Supplementary data for this article are available at Cancer Research Online unmethylated DNA. Primer sequences for the methylated reaction were (http://cancerres.aacrjournals.org/). ¶ ¶ ¶ M.F.F. is a recipient of a Ramon y Cajal Research Fellowship. 5 -GAG TTT GCG AGT ATT CGG TC-3 (sense) and 5 -GAA CTT TCC CCG Requests for reprints: Manel Esteller, Cancer Epigenetics Laboratory, Spanish AAA CGA C-3¶ (antisense), and for the unmethylated reaction, primer National Cancer Research Centre (CNIO), Melchor Ferna´ndez Almagro 3, 28029- sequences were 5¶-TGG GAG TTT GTG AGT ATT TGG TT-3¶ (sense) and Madrid, Spain. Phone: 011-34-917328000; Fax: 011-34-912246923; E-mail: mesteller@ 5¶-TCA AAC TTT CCC CAA AAC AAC-3¶ (antisense). Bisulfite genomic cnio.es. I2008 American Association for Cancer Research. sequencing and methylation-specific PCR oligos were designed to be able to doi:10.1158/0008-5472.CAN-08-0085 discriminate between TLE1 and its pseudogene (LOC 389863) located on

Cancer Res 2008; 68: (11). June 1, 2008 4116 www.aacrjournals.org

Figure 1. Analysis of TLE1 CpG island promoter methylation status and expression. A, schematic depiction of the TLE1 CpG island around the transcription start site (long black arrow). Short vertical lines, CpG dinucleotides. Location of bisulfite genomic sequencing PCR primers (black) and methylation-specific PCR primers are indicated (white). Results are shown of bisulfite genomic sequencing of 12 individual clones in normal lymphocytes (NL1 and NL2) and the cell lines Molt-4, KG1A, Hut-78, and Raji. Presence of a methylated (black square) or unmethylated cytosine (white square) is indicated. An illustrative fragment of the sequencing electropherogram is shown for NL1 and KG1A. A representative methylation-specific PCR for the TLE1 gene is also shown. The presence of a PCR band under lanes M or U indicates methylated or unmethylated genes, respectively. In vitro methylated DNA (IVD) is used as a positive control for methylated DNA. B, RT-PCR analysis of TLE1 expression (top). Treatment with the demethylating agent (ADC + lanes) reactivates TLE1 gene expression. Bottom, immunofluorescence analysis of TLE1 expression. The methylated cell line Hut-78 does not stain for the TLE1 protein, unlike the unmethylated Molt-4 cell. Treatment with the ADC restores protein expression. The histone deacetylase inhibitor trichostatin A reinforces the ADC reactivation effect. C, methylation-specific PCR for the TLE1 gene in human primary malignancies. The presence of a PCR band under lanes M or U indicates methylated or unmethylated genes, respectively. In vitro methylated DNA is used as a positive control for methylated DNA. the X chromosome. To achieve this aim, the MSP oligos contain several tary Table S1). All the bisulfite sequencing analyses presented were polymorphisms of TLE1 and its pseudogene, and bisulfite sequencing oligos developed using the 587 bp PCR that corresponds to TLE1. contain a region of 88 bp located 456 bp upstreamof the transcriptional TLE1 RNA and protein analysis by conventional reverse transcrip- start site of the pseudogene that it is absent fromthe TLE1 promoter. tion-PCR and immunofluorescence. RNA was isolated by using TRIZOL These bisulfite sequencing oligos generate 2 PCR products of 587 and 676 (Life Technologies). Two micrograms of RNA were reverse-transcribed using bp that correspond to TLE1 and its pseudogene, respectively (Supplemen- SuperScript II reverse transcriptase (Life Technologies/Bethesda Research www.aacrjournals.org 4117 Cancer Res 2008; 68: (11). June 1, 2008

Figure 2. Tumor suppressor–like properties of TLE1. A, effect of TLE1 transfection on the in vitro growth of KG1A, Hut-78, and Raji cells. Left, RT-PCRs of TLE1 in untransfected and transfected cells. Middle, decrease in the number of cells after TLE1 transfection; right, recovery of TLE1 expression by immunofluorescence analysis. The plots show the monitoring over time of the number of cells after transfecting the cell lines KG1A, Hut-78, and Raji with TLE1. B, colony formation assay (left). Two (R1 and R2) independent experiments were carried out. Example of the colony focus assay after a 2-wk selection with G418. Bottom, detailed images from the top panels. C, effect of TLE1 transfection on the growth of KG1A and Raji cells in nude mice. Tumor weight was monitored over time. Shown are female athymic nude mice 45 d after injection of 106 KG1A or Raji cells. Note the large tumor on the left flank, corresponding to empty vector cells, and the absence of visible tumor on the opposite flank, corresponding to TLE1-transfected cells. GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Cancer Res 2008; 68: (11). June 1, 2008 4118 www.aacrjournals.org

Laboratories) and amplified using specific primers for TLE1 (forward, chronic myeloid leukemia (100%, 1 of 1) cell lines (Supplementary 5¶-CCC ATA TCC TGC TCC TTT TG-3‘; reverse, 5‘-GGT TGA GGG TGT TGA Fig.S1;Fig.1A). However, it was unmethylated in acute j j TCT GG-3‘). PCR was performed for 25 cycles (94 C for 30 s, 57 C for 30 s, lymphocytic leukemias (ALL; n = 7) and in all solid tumor cell j and 72 C for 30 s). Immunofluorescence experiments were developed using lines (Supplementary Fig. S1). The hypermethylation event was the TLE1 antibody (Abcam). TLE1 transfection and small interfering RNA assay. cancer specific because all normal peripheral leukocytes analyzed The TLE1 n expression vector pcDNA3-TLE1 was constructed by cloning the cDNA ( = 12) were completely unmethylated at the TLE1 CpG island corresponding to the TLE1 gene fromMOLT4 cell line into the pcDNa3 (Supplementary Fig. S1; Fig. 1A). Most importantly, lymphoma and vector (Invitrogen) and confirmed by sequencing. For transfection experi- leukemia cell lines with TLE1 CpG island hypermethylation, such ments, we used the pcDNA3 vector containing the TLE1 gene or pcDNA3 as Hut-78 and KG1A, did not express TLE1 transcript and protein empty vector. Transfection was performed by electroporating 107 cells in (Fig. 1B). However, TLE1 unmethylated leukemia cell lines, such 0.8 mL PBS with 40 Ag of the vector at 250 V and 975 uF. Electroporated as Molt-4, strongly expressed TLE1 transcript and protein (Fig. 1B). 6 À1 cells were washed with PBS and seeded with 10 cells mL in fresh We established a further link between TLE1 CpG island hyper- medium containing 20% fetal bovine serum. Transfected cells were selected À methylation and its gene silencing by the treatment of the by the addition of G418 (600 AgmL1). MOLT4 cells were nucleofected with 1.5 Ag of small interfering RNA (siRNA; Qiagen) using the Cell Line methylated cell lines with a DNA demethylating agent. The Nucleofector kit L (Amaxa Biosystems). C siRNA (a control sequence not treatment of the TLE1-hypermethylated Hut-78 and KG1A matching any known human gene) was AATTCTCCGAACGTGTCACGT and lymphoma and leukemia lines with the demethylating drug for TLE-1 siRNA was CTCGGCAAGCCTCCAGCCATA. Cells were harvested 5-aza-2¶-deoxycytidine restored the expression of the TLE1 RNA 1 to 2 d after electroporation. transcript and protein (Fig. 1B). Colony formation assay and mouse xenograft model. Colony The observed epigenetic disruption of TLE1 in undifferentiated formation on methylcellulose medium (StemCell Technologies) was leukemia and lymphoma cells was not just an in vitro cell culture assayed. Transfected cells were added to a medium containing 80% phenomenon. We extended our TLE1 CpG island methylation methylcellulose and 20% conditioned medium from Hut-78 cultures and À analysis to 106 patients with hematologic malignancies, including 600 AgmL1 G418. The mixture was then placed in a 6-well plate and incubated for 15 d. Colonies containing >20 cells were considered positive. 47 diffuse large B-cell lymphomas (B-DLCL), AML, and 34 ALL. We Six-week-old female athymic nude mice nu/nu (Harlan Sprague-Dawley) were used for KG1A and Raji tumor xenografts. Ten specimens were used. Both flanks of each animal were injected s.c. with 107 cells in a volume of 200 AL of PBS. The right flank was always used for TLE1-transfected cells and the left for empty vector control cells. Tumor development at the site of injection was measured daily. Quantitative reverse transcription-PCR. Two micrograms of total RNA were converted to cDNA with the ThermoScriptTM RT-PCR System (Invitrogene) using Oligo-dT as primer. PCR amplifications were performed in 96-well optical plates in a volume of 20 AL. We used 0.20 Ag of cDNA, 5 pmol of each primer, and 10 ALof2Â SYBRGreen PCR Master Mix (Applied Biosystems). Three measurements were taken and the amounts were calculated by extrapolating froma standard curve. Expression values were normalized against the expression of h-glucuronidase, used as an endogenous control. PCR reactions were run and analyzed using the Prism 7700 Sequence Detection System(Applied Biosystems). Primersare shown in Supplementary Table S1. Quantitative chromatin immunoprecipitation. The chromatin immunoprecipitation (ChIP) assay was performed with the same TLE1 antibody used for Western blotting and the antibodies against HDAC1 (Abcam), and acetylated histone H3 (Upstate Biotechnologies). Chromatin was sheared to an average length of 0.25 F 1 kb. PCR amplifications were performed in 96-well optical plates in a volume of 20 AL. We used 0.2 Ag of immunoprecipitated DNA, 5 pmol of each primer, and 10 ALof 2Â SYBRGreen PCR Master Mix (Applied Biosystems). Three measurements were made and the amounts calculated extrapolating from a standard curve. PCR reactions were run and analyzed using the Prism7700 Sequence Detection System (Applied Biosystems). Primers are shown in Supplemen- tary Table S1.

Results and Discussion TLE1 has a typical CpG island around its transcription start site (Fig. 1A). We first determined the TLE1 CpG island methylation status of a panel of 49 human cancer cell lines from 14 tumor types by bisulfite genomic sequencing of multiple clones and methyla- A Figure 3. Effect of TLE1 depletion on cell growth. A, TLE1 expression tion-specific PCR (Supplementary Fig. S1; Fig. 1 ). Strikingly, TLE1 monitored by RT-PCR in control Molt-4 cells and TLE1-interfered cells. CpG island hypermethylation was only found in hematologic GAPDH was used as a control. B, effect of TLE1 reduction on the in vitro growth A of Molt-4 cells. The pictures show the decrease in the number of cells after malignancies (Supplementary Fig. S1; Fig. 1 ). It was present in TLE1 transfection, and the plots show the monitoring over time of the number of AML (43%, 3 of 7), non–Hodgkin’s lymphoma (100%, 5 of 5), and cells after TLE1 interference. www.aacrjournals.org 4119 Cancer Res 2008; 68: (11). June 1, 2008

Figure 4. Effect of TLE1 expression on target genes. A, quantitative RT-PCR analysis of the expression of the TLE1, AML1, CYD1, C-MYC, CSF1R, BCL2, and HES1 genes in Raji and Hut-78 cells transfected with TLE1 or with an empty vector (mock). B, determination of promoter occupancy at the CYD1, CSF1R, and HES1 genes by quantitative ChIPin the cells lines Hut-78 and Raji transfected with TLE1. The immunoprecipitation antibodies (iP AB) were against TLE1, AcH3, and HDAC1. The results are expressed as the relative change of net (B/U, bound/unbound fractions) enrichment (values, >0) or impoverishment (values, <0) of the cells transfected with TLE1 versus the controls cells transfected with an empty vector (mock).

observed that TLE1 CpG island hypermethylation was a common Thus, if it is widely accepted that the probability of simultaneous event in B-DLCLs (36%, 17 of 47) and AMLs (24%, 6 of 25), whereas hits in the same molecular pathway in a given tumor is very low, it was much less prevalent in ALLs (2.9%, 1 of 34; Fig. 1C). This is a simultaneous molecular lesions in TLE1 and AML1 in the same similar scenario than the one encountered in the cancer cell lines leukemia sample should be a rare event. To test whether this described above. inverse association exists, we have analyzed the TLE1 CpG island It is interesting to remember that TLE1 binds to the AML/CBFa promoter methylation status in 24 primary AMLs carrying the runt domain transcription factor family (12, 13), and that the AML1-ETO translocation. We have observed an unmethylated imbalance of this signaling pathway by the presence of the AML1- TLE1 CpG island in all AMLs positive for AML1-ETO (0%, 0 of 24) ETO translocation occurs in a subset of AMLs (1, 2). Importantly, compared with the 24% (6 of 25) frequency of TLE1 hyper- the AML1 binding site for TLE1 is located at its carboxilic methylation in the primary AMLs without translocation described end, which is lost when AML1 is translocated with ETO (12, 13). above (P = 0.02, Fisher’s exact test). Thus, the mutual exclusivity of

Cancer Res 2008; 68: (11). June 1, 2008 4120 www.aacrjournals.org

Downloaded from cancerres.aacrjournals.org on September 29, 2021. © 2008 American Association for Cancer Research. TLEI Epigenetic Activation the epigenetic alteration of TLE1 and the cytogenetic alteration of Polycomb members (21). Thus, we examined whether the AML1 suggests that they play a critical and cooperative role in expression of characteristic target genes of each pathway was human leukemogenesis. altered by the reintroduction of TLE1 in leukemia/lymphoma cell Froma functional standpoint, we next wanted to determine lines (KG1A, Hut-78, and Raji) with TLE1 CpG island hyper- whether epigenetic inactivation blocked growth suppression methylation. AML1 expression itself was used as a negative and differentiation in those hematologic malignancies with control because it is known not to be regulated by TLE1 (12, 13). TLE1-methylation–associated silencing. We adopted a double Upon efficient re-expression of TLE1 in transfected cells (Fig. 4A), approach in addressing this question. First, we transfected TLE1 we observed down-regulation of the AML1 pathway growth- in hematologic malignancies with TLE1 hypermethylation, such promoting factors Colony-Stimulating Factor 1 receptor (CSF1R; as the cell lines KG1A, Hut-78, and Raji. Upon restoration of TLE1 refs. 22, 23) and B-Cell Lymphoma 2 (BCL2; ref. 24), the oncogene expression, as showed by reverse transcription PCR (RT-PCR) and myc (C-MYC; ref. 25), and Cyclin D1 (CYD1; ref. 26) from the immunofluorescence analyses (Fig. 2A), all three leukemia/ Wnt pathway; and the HES1 (27) fromthe Notch signaling lymphoma cell lines experienced reduced cell growth (Fig. 2A). pathway (Fig. 4A). A further link between TLE1 re-expression We further showed the growth inhibitory features of TLE1 and repression of the described target genes was established by reintroduction in colony focus assays and nude mouse models. the development of ChIP experiments for those particular In the colony formation assay, we observed that TLE1 re- promoters. TLE1-transfected cells exhibited occupancy by the expression revealed tumor-suppressor activity, whereby there TLE1 protein in the 5¶-regulatory regions of the CYD1, CSF1R, was a marked 78% lower colony formation density with respect and HES1 genes, recruitment of the transcriptional repressor to the empty vector (Fig. 2B). We next tested the ability of TLE1- HDAC1, and an associated reduction of a histone modification transfected KG1A and Raji leukemia cells to form tumors in nude marker associated with transcriptional activation, histone H3 mice compared with empty vector–transfected cells (Fig. 2C). acetylation (Fig. 4B). These findings are evidence of the proposed Cells transfected with the empty vector formed tumors rapidly, role of TLE1 as a transcriptional repressor that targets HDAC1 to but cells infected with the TLE1 expression vector had much promoters and mediates gene repression through histone H3 lower tumorigenicity (Fig. 2C). At the time of sacrifice, tumors deacetylation (18, 19). were 6 to 10 times larger in mice with the empty vector than in Overall, our results indicate that TLE1 promoter CpG island the TLE1-transfected xenografts (Fig. 2C). Finally, we also knocked methylation-mediated silencing occurs in leukemia and lymphoma down TLE1 expression by RNA interference in an expressing cells, where it might prevent the development of growth inhibitory leukemia cell line unmethylated at the TLE1 CpG island, Molt-4. and differentiating programs mediated by three critical pathways, We observed that significantly reduced TLE1 expression (Fig. 3A) AML1, Wnt, and Notch. was associated with increased cell growth (Fig. 3B). Further evidence of the tumor-suppressor function of TLE1 is provided Disclosure of Potential Conflicts of Interest by its location in a commonly deleted segment in del(9q) No potential conflicts of interest were disclosed. AML (17). Finally, we wanted to characterize the putative mechanisms mediating the described tumor-suppressor activity of TLE1 in Acknowledgments hematologic malignancies. TLE1 is a multitasked transcriptional Received 1/8/2008; revised 2/25/2008; accepted 3/31/2008. Grant support: Health (FIS01-04 and FIS P1061267) and Education and Science corepressor that acts through the AML1, Wnt, and Notch signaling (I+D+I MCYT08-03 and Consolider MEC09-05) Departments of the Spanish pathways (12, 13). The TLE1-related silencing effects on gene Government, the European Grant Transfog LSHC-CT-2004-503438, and the Spanish transcription might be associated with its interaction with Association Against Cancer. The costs of publication of this article were defrayed in part by the payment of page chromatin proteins involved in transcriptional repression, such charges. This article must therefore be hereby marked advertisement in accordance as Histone Deacetylase 1 (HDAC1; refs. 18, 19), Sirtuin 1 (20), and with 18 U.S.C. Section 1734 solely to indicate this fact.

References 8. Jennings BH, Pickles LM, Wainwright SM, Roe SM, 13. Imai Y, Kurokawa M, Tanaka K, et al. TLE, the Pearl LH, Ish-Horowicz D. Molecular recognition of human homolog of groucho, interacts with AML1 1. Tenen DG. Disruption of differentiation in human transcriptional repressor motifs by the WD domain and acts as a repressor of AML1-induced trans- cancer: AML shows the way. Nat Rev Cancer 2003;3: of the Groucho/TLE corepressor. Mol Cell 2006;22: activation. Biochem Biophys Res Commun 1998;252: 89–101. 645–55. 582–9. 2. Yamagata T, Maki K, Mitani K. Runx1/AML1 in 9. Stifani S, Blaumueller CM, Redhead NJ, Hill RE, 14. Liu Y, Dehni G, Purcell KJ, et al. Epithelial expression normal and abnormal hematopoiesis. Int J Hematol Artavanis-Tsakonas S. Human homologs of a Drosophila and chromosomal location of human TLE genes: 2005;82:1–8. Enhancer of split gene product define a novel family of implications for notch signaling and neoplasia. 3. Grabher C, von Boehmer H, Look AT. Notch 1 nuclear proteins. Nat Genet 1992;2:119–27. Genomics 1996;31:58–64. activation in the molecular pathogenesis of T-cell 10. Daniels DL, Weis WI. h-catenin directly displaces 15. Radtke F, Wilson A, MacDonald HR. Notch signaling acute lymphoblastic leukaemia. Nat Rev Cancer 2006; Groucho/TLE repressors fromTcf/Lef in Wnt-mediated in T- and B-cell development. Curr Opin Immunol 2004; 6:347–59. transcription activation. Nat Struct Mol Biol 2005;12: 16:174–9. 4. Feinberg AP, Tycko B. The history of cancer epige- 364–71. 16. Staal FJ, Clevers HC. WNT signalling and haemato- netics. Nat Rev Cancer 2004;4:143–53. 11. Grbavec D, Stifani S. Molecular interaction between poiesis: a WNT-WNT situation. Nat Rev Immunol 2005;5: 5. Jones PA, Baylin SB. The epigenomics of cancer. Cell TLE1 and the carboxyl-terminal domain of HES-1 21–30. 2007;128:683–92. containing the WRPW motif. Biochem Biophys Res 17. Sweetser DA, Peniket AJ, Haaland C, et al. Delinea- 6. Esteller M. Cancer epigenomics: DNA methylomes Commun 1996;223:701–5. tion of the minimal commonly deleted segment and and histone-modification maps. Nat Rev Genet 2007;8: 12. Levanon D, Goldstein RE, Bernstein Y, et al. identification of candidate tumor-suppressor genes in 286–98. Transcriptional repression by AML1 and LEF-1 is del(9q) acute myeloid leukemia. Genes Chromosomes 7. Chen G, Courey AJ. Groucho/TLE family proteins and mediated by the TLE/Groucho corepressors. Proc Natl Cancer 2005;44:279–91. transcriptional repression. Gene 2000;249:1–16. Acad Sci U S A 1998;95:11590–5. 18. Palaparti A, Baratz A, Stifani S. The Groucho/

www.aacrjournals.org 4121 Cancer Res 2008; 68: (11). June 1, 2008

transducin-like enhancer of split transcriptional repress- repeat proteins and regulates histone methylation. Nat 24. Shikami M, Miwa H, Nishii K, et al. Low BCL-2 ors interact with the genetically defined amino-terminal Cell Biol 2006;8:1277–83. expression in acute leukemia with t(8;21) chromosomal silencing domain of histone H3. J Biol Chem 1997;272: 22. ZhangDE,FujiokaK,HetheringtonCJ,etal. abnormality. Leukemia 1999;13:358–68. 26604–10. Identification of a region which directs the monocytic 25. He TC, Sparks AB, Rago C, et al. Identification of c- 19. Courey AJ, Jia S. Transcriptional repression: the long activity of the colony-stimulating factor 1 (macrophage MYC as a target of the APC pathway. Science 1998;281: and the short of it. Genes Dev 2001;15:2786–96. colony-stimulating factor) receptor promoter and binds 1509–12. 20. Ghosh HS, Spencer JV, Ng B, McBurney MW, Robbins PEBP2/CBF (AML1). Mol Cell Biol 1994;14:8085–95. 26. Tetsu O, McCormick F. h-catenin regulates expres- PD. Sirt1 interacts with transducin-like enhancer of 23. Rhoades KL, Hetherington CJ, Rowley JD, et al. Syner- sion of cyclin D1 in colon carcinoma cells. Nature 1999; split-1 to inhibit nuclear factor nB-mediated transcrip- gistic up-regulation of the myeloid-specific promoter for 398:422–6. tion. BiochemJ 2007;408:105–11. the macrophage colony-stimulating factor receptor by 27. Jarriault S, Brou C, Logeat F, Schroeter EH, Kopan R, 21. Higa LA, Wu M, Ye T, Kobayashi R, Sun H, Zhang H. AML1 and the t(8;21) fusion protein may contribute to leu- Israel A. Signalling downstream of activated mammalian CUL4–1 ubiquitin ligase interacts with multiple WD40- kemogenesis. Proc Natl Acad Sci U S A 1996;93:11895–900. Notch. Nature 1995;377:355–8.

Cancer Res 2008; 68: (11). June 1, 2008 4122 www.aacrjournals.org

Downloaded from cancerres.aacrjournals.org on September 29, 2021. © 2008 American Association for Cancer Research. Epigenetic Inactivation of the Groucho Homologue Gene TLE1 in Hematologic Malignancies

Mario F. Fraga, Maria Berdasco, Esteban Ballestar, et al.

Cancer Res 2008;68:4116-4122.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/68/11/4116

Supplementary Access the most recent supplemental material at: Material http://cancerres.aacrjournals.org/content/suppl/2008/05/28/68.11.4116.DC1

Cited articles This article cites 27 articles, 7 of which you can access for free at: http://cancerres.aacrjournals.org/content/68/11/4116.full#ref-list-1

Citing articles This article has been cited by 10 HighWire-hosted articles. Access the articles at: http://cancerres.aacrjournals.org/content/68/11/4116.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/68/11/4116. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.