Influência Combinada Dos Rios Como Barreira E Do Gradiente De Inundação Nos Padrões Biogeográficos De Anfíbios E Répteis Squamata No Sudeste Da Amazônia

INSTITUTO NACIONAL DE PESQUISAS DA AMAZÔNIA - INPA

PROGRAMA DE PÓS-GRADUAÇÃO EM ECOLOGIA

INFLUÊNCIA COMBINADA DOS RIOS COMO BARREIRA E DO GRADIENTE DE INUNDAÇÃO NOS PADRÕES BIOGEOGRÁFICOS DE ANFÍBIOS E RÉPTEIS SQUAMATA NO SUDESTE DA AMAZÔNIA

LEANDRO JOÃO CARNEIRO DE LIMA MORAES

Manaus, AM Outubro, 2015

LEANDRO JOÃO CARNEIRO DE LIMA MORAES

INFLUÊNCIA COMBINADA DOS RIOS COMO BARREIRA E DO GRADIENTE DE INUNDAÇÃO NOS PADRÕES BIOGEOGRÁFICOS DE ANFÍBIOS E RÉPTEIS SQUAMATA NO SUDESTE DA AMAZÔNIA

Orientadora: Dra. Camila Cherem Ribas Coorientador: Dr. Dante Pavan

Dissertação apresentada ao Instituto Nacional de Pesquisas da Amazônia como parte dos requisitos para obtenção do título de Mestre em Biologia (Ecologia).

Manaus, AM Outubro, 2015

BANCA EXAMINADORA DA DEFESA ORAL PÚBLICA:

Dra. Fernanda de Pinho Werneck (Instituto Nacional de Pesquisas da Amazônia)

Dr. Fernando Mendonça d’Horta (Instituto Nacional de Pesquisas da Amazônia)

Dr. Igor Luis Kaefer (Universidade Federal do Amazonas)

Aprovado por unanimidade

M827 Moraes, Leandro João Carneiro de Lima Influência combinada dos rios como barreira e do gradiente de inundação nos padrões biogeográficos de anfíbios e répteis Squamata no sudeste da Amazônia / Leandro João Carneiro de Lima Moraes. --- Manaus: [s.n.], 2015. viii, 78 f. : il. color.

Dissertação (Mestrado) --- INPA, Manaus, 2015. Orientador : Camila Cherem Ribas. Coorientador : Dante Pavan. Área de concentração : Ecologia.

1. Rios como barreira. 2. Tipos florestais. 3. Herpetofauna. I. Título.

CDD 597.6

Sinopse:

Estudei a influência relativa dos rios como barreira e tipos florestais (formados pelo gradiente de inundação) na geração dos padrões biogeográficos das assembleias de anfíbios e répteis Squamata da região do Médio Rio Tapajós, sudeste da Amazônia.

Detectei que esses fatores afetam diferencialmente a distribuição das espécies e os rios são barreiras mais efetivas para determinadas assembleias e grupos funcionais, permitindo a previsão dos impactos causado pelas grandes hidrelétricas.

Palavras chave: Assembleias, tipos florestais, Rio Tapajós, herpetofauna, hidrelétricas.

III

AGRADECIMENTOS

Agradeço aos meus orientadores Camila Ribas e Dante Pavan por despertarem e apoiarem a ideia deste projeto e pelo aprendizado e disposição constantes. Aos meus pais Maria Helena e João Carlos e minha irmã Bia pelo apoio desde o primeiro momento. À Marina, minha eterna companheira de aventuras, por aceitar o desafio da mudança e estar presente em cada momento desta caminhada, iniciando a formação da nossa família, com a Sushi! Aos amigos que participaram ativamente da nossa vida em Manaus e nos ajudaram muito: Renata, Felipe, Marcelo, Vanessa, Priscilla, Andrea Vanessa, Rafa. Ao INPA e ao Programa de Pós-Graduação em Ecologia por toda a estrutura disponibilizada, pelas disciplinas e também à todos os integrantes das turmas 2013 e 2014 da Ecologia. À todos os integrantes que passaram pela Equipe de Herpetofauna e pelo exigente levantamento dos dados para este projeto: Dante, Luis, Cassimiro, Jerriane, Ana Barbara, Tainá, Daniel, Luanna, Eder, Elizângela, Mauro, Willian, Wilzon, João Paulo, Michelle, Rafael, Guilherme, Hallana, Luciana, Albedi e Zé Mário. Agradeço também aos responsáveis por valiosos registros ocasionais de espécies: Gustavo, Ciça, Odgley, Victor, André Ravetta, Dante Buzzetti, Claudeir, Elizângela, Wilzon, Mauro, Mariel e Eduardo. Ao ajudantes de campo Edcarlos, Adson ‘Pote’, Sebastião I, II e III, Dill, Carlinhos, Clayton, Alcindo ‘Kassamba’, Francisco ‘Lorô’, Ronaldo, Waldir, Wesley, Raimundo, Gerson ‘Marabá’, Antônio, Warlysson ‘Nhonho’, Mariel e Edhimar, pela companhia e auxílio durante as árduas caminhadas, pelos ensinamentos e por permanecerem firmes perante as adversidades. Ao Seu Léo, Dona Maria I, Dona Maria II, Dona Esmeralda (e os outros moradores da Vila Rayol), Gisleine, Luciana, Dona Francisca, moradores da Vila Machado, Chico Pires, Duro, Adriano, Vilica, Baixinho, Bodó, irmãos ‘Frank’, Airton, Seu Zé, e também outros moradores da região do estudo pela ajuda logística no campo, seja abrindo trilhas, cozinhando ou pilotando os veículos, mas também pelos ensinamentos constantes. À CNEC WorleyParsons Engenharia S/A e aos integrantes da empresa pela possibilidade do estudo, através do Estudo de Impacto Ambiental do AHE São Luiz do IV

Tapajós, construção das trilhas de amostragem, financiamento e logística das campanhas de amostragem. Aos integrantes da Força Nacional, Polícia Federal e Polícia Rodoviária Federal pelo auxílio na segurança durante a realização de algumas campanhas de amostragem. Ao Instituto Brasileiro do Meio Ambiente e dos Recursos Naturais Renováveis (IBAMA) pela concessão da licença de coleta de espécimes na área de estudo. À Claudene Barros e aos integrantes do Laboratório de Biologia Molecular GENBIMOL da Universidade Estadual do Maranhão – campus Caxias (UEMA) pelo auxílio no sequenciamento dos espécimes. À Fernanda Werneck, Richard Vogt, Ariane Silva e Vinicius Carvalho pelo auxílio e possibilidade de acesso à Coleção de Anfíbios e Répteis do INPA. A todos os outros pesquisadores que ajudaram de alguma maneira. Na identificação de espécies/linhagens: Pedro Ivo Simões, José Cassimiro, Igor Kaefer, Vinicius Carvalho, Marcelo Gordo, Rafael Fraga, Pedro Peloso, Marinus Hoogmoed, Paulo Bernarde, Alfredo Santos-Jr, Albertina Lima, T.C. Ávila-Pires, Omar Entiauspe, Diego Santana, Sarah Mângia, Rafael de Sá, Antoine Fouquet, Renata Amaro, Stefan Lötters, Thiago Kashi e Willian Duellman. Nas análises estatísticas: Pedro Martins, Juliana Schietti, Randolpho Dias-Terceiro. Na revisão do inglês: Guilherme Sampaio. Aos Drs. Sérgio Borges, Luciano Naka, Pedro Ivo Simões, Igor Kaefer, Adrian Barnett, Albertina Lima, Fernanda Werneck, Fernando d’Horta e Marcelo Gordo e aos integrantes do grupo de Biogeografia e Evolução de Vertebrados pelas sugestões valiosas ao projeto, através de discussões, correções do plano, aula de qualificação e defesa da dissertação. Ao Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPQ) pela concessão da bolsa de mestrado. E finalmente, às principais estrelas deste projeto, os anfíbios e répteis da região do Médio Rio Tapajós, pela possibilidade da realização deste estudo e por fomentarem a nossa curiosidade acadêmica. Espero que este trabalho desperte a necessidade da conservação da biodiversidade nesta região pouco explorada mas muito ameaçada e com alto valor biológico.

RESUMO

A histórica busca pelo reconhecimento dos padrões e processos evolutivos de organismos amazônicos visando reconstruir a história evolutiva desta paisagem megadiversa levou à diversas hipóteses. Com o avanço nas técnicas de amostragem e análise, é crescente a utilização de locais inexplorados e organismos pouco recorridos como modelo nesta busca, como os anfíbios e répteis Squamata. Neste estudo, buscamos entender a influência integrada de rios como barreira e do gradiente de inundação na geração e manutenção dos padrões atuais de distribuição das assembleias de anfíbios e répteis Squamata na região do Médio Rio Tapajós, na Amazônia Oriental, que é pouco conhecida e atualmente ameaçada pela iminente atividade antrópica. Para isso, detectamos os indivíduos em pontos amostrais localizados em todas as margens dos grandes rios, Tapajós e Jamanxim, através de busca ativa, armadilhas de interceptação e queda e encontros ocasionais nos principais períodos do ciclo hidrológico fluvial. Identificamos os táxons com uma abordagem integrativa morfológica, acústica, ecológica e molecular, detectamos e testamos os padrões de distribuição com ordenações uni e multivariadas, regressões lineares e segmentadas e análise de variância. No total, detectamos 92 anfíbios e 101 répteis, 26 e sete, respectivamente, mostraram efeito dos rios como barreira à sua distribuição, evidenciando o Rio Tapajós como uma possível barreira recente e o Rio Jamanxim como uma barreira fraca. Foram encontradas diferenças na composição das assembleias restritas ou não às florestas ripárias e as mais afetadas pelo rio como barreira foram os anfíbios e répteis não ripários, e os anfíbios ripários de igarapés. Anfíbios pequenos, diurnos e terrestres e répteis pequenos a médios, diurnos e semi-arborícolas também demonstram ser especialmente afetados pelos rios como barreira, e devem ser priorizados em novos estudos com esta temática. A região do Médio Rio Tapajós é evidenciada como uma zona de contato faunística, limitando a distribuição de linhagens típicas das regiões Oeste e Leste da Amazônia. A dinâmica fluvial controla os padrões de distribuição na região e pode mudar com alterações provenientes de ações antrópicas, promovendo ou impedindo a segregação dos táxons e extinguindo ambientes relevantes, reforçando a necessidade da preservação desta dinâmica.

Palavras-chave: Assembleias, tipos florestais, Rio Tapajós, herpetofauna, hidrelétricas.

VII

ABSTRACT

Combined influence of riverine barriers and flooding gradient on biogeographic patterns of amphibians and squamates in South-eastern Amazonia

The historical search for recognition of evolutionary patterns and processes of Amazonian organisms aiming to reconstruct the evolutionary history of this mega-diverse landscape led to several hypotheses. Advances in sampling and analysis methods allowed the use of unexplored localities and organisms as a model for this search, such as amphibians and squamates. In this study, we seek to understand the integrated influence of riverine barriers and the flooding gradient in current assemblages distribution patterns of amphibians and squamates in the Middle Tapajós River region, eastern Amazonia, which is little known and threatened by imminent anthropogenic activity. For this, we detect individuals at sampling units located in all banks of the main rivers, Tapajós and Jamanxim, through active search, pitfall traps and occasional encounters in all periods of fluvial hydrological cycle. We identify the taxa with a morphological, acoustic, ecological and molecular integrative approach, detect and test the distribution patterns with uni- and multivariate ordinations, linear and piecewise regressions and analysis of variance. In total, we found 92 amphibians and 101 squamates, and 26 and seven, respectively, showed riverine barrier effect in their distribution, evidencing the Tapajós River as a possible recent barrier and the Jamanxim River as a weak barrier. Differences were found in the composition of assemblages restricted or not to riparian forests and the most affected by the riverine barrier were non-riparian amphibians and squamates, and small stream riparian amphibians. Small, diurnal terrestrial amphibians and small- medium, diurnal semi-arboricole squamates prove to be especially affected by riverine barriers, and should be priorized in further studies with this theme. The Middle Tapajós River region is evidenced as a faunistic contact zone, limiting the distribution of typical lineages of West and East Amazonian regions. The fluvial dynamics controls the distribution patterns in the region and may be affected by changes from anthropogenic activities, promoting or preventing the taxa segregation and extinguishing relevant environments, highlighting the importance to preserve this dynamics.

Keywords: Assemblages, forest types, Tapajós Basin, herpetofauna, hydroelectric power plants.

VIII

LISTA DE FIGURAS

Figure 1. Study area. (a) Location in South America, Brazil, Pará and Amazon Basin. (b) Sampling units, showing the two main rivers and the main interfluves: (M-T) Madeira- Tapajós; (M-T/J) Madeira-Tapajós/Jamanxim; (T-J) Tapajós-Jamanxim; (T-X) Tapajós- Xingu and (T/J-X) Tapajós/Jamanxim-Xingu. (c) Scheme of sampling units, with transect (in black), plots (uniformly distributed in brown and riparian in grey) and pitfall traps (in red). . 32 Figure 2. Direct ordination of the relative abundance of amphibians (a) and squamates (b) in relation to distance to water gradient. Note that some species increase in abundance or are restricted to more humid areas (red square)...... 33 Figure 3. Linear regression for the three main taxonomical groups studied, between the NMDS Axis 1 (species composition) and distance to water, divided in modal distances with three plots agregated: (1) 20-35 m; (2) 36-50 m; (3) 53-62 m;(4) 63-80 m; (5) 82-95 m; (6) 100-150 m; (7) 180-200 m; (8) 250-300 m; (9) 320-380 m; (10) 440- 490 m (11) 500-580 m; (12) 615-700 m; (13) 715-1120 m; (14) 1200-1400 m; (15) 1700-2140 m...... 34 Figure 4. Direct ordination of presence-absence data for all survey methods revealing a higher number of amphibians (a) than squamates (b), which are exclusive to one of the main rivers' banks. Sampling units (letters) and interfluves (acronyms) are on the top. Different colours correspond to main interfluves and species written in red are significantly (ANOVA, p≤0.05) more abundant in one interfluve (inside parentheses)...... 35 Figure 5. NMDS ordinations and composition changes between interfluves for amphibian and squamate assemblages showing the relative riverine barrier strength for these taxa. (a-c) amphibians; (d-f) lizards and (g-i) snakes. Interfluves: (M-T) Madeira-Tapajós; (M-T/J) Madeira-Tapajós/Jamanxim; (T-J) Tapajós-Jamanxim; (T-X) Tapajós-Xingu and (T/J-X) Tapajós/Jamanxim-Xingu...... 36 Figure 6. Relative frequency of amphibian (a) and squamate (b) functional groups with distribution patterns indicating a riverine barrier influence. In black are the proportion of species which suffer barrier effect and in gray which do not suffer barrier effect. The total number of species in each category are inside the bars. Micro-habitat: (TE) terrestrial; (FO) fossorial; (AR) arboricole; (AQ) aquatic; (SR) semi-arboricole and (SA) semi-aquatic. Body size: (SM) small; (MD) medium and (LA) large. Activity period: (CR) crepuscular/nocturnal; (DI) diurnal; (NO) nocturnal and (DN) diurnal/nocturnal...... 37

Figure 7. NMDS ordinations and composition changes for amphibian and squamate assemblages associated with distinct forest types, clustered by composition variation in relation to distance to water, showing the relative riverine barrier strength. (a-c) Non-riparian amphibians; (d-f) Small stream riparian amphibians; (g-i) Large river riparian amphibians; (j- l) Non-riparian squamates and (m-o) Riparian squamates. Interfluves: (M-T) Madeira- Tapajós; (M-T/J) Madeira-Tapajós/Jamanxim; (T-J) Tapajós-Jamanxim; (T-X) Tapajós- Xingu and (T/J-X) Tapajós/Jamanxim-Xingu...... 38

SUMÁRIO

RESUMO ...... VII ABSTRACT ...... VIII

LISTA DE FIGURAS ...... IX

INTRODUÇÃO ...... 1 OBJETIVOS ...... 4

CAPÍTULO I ...... 5 ABSTRACT 7 INTRODUCTION 8 MATERIALS AND METHODS 100 RESULTS 122 DISCUSSION 155 ACKNOWLEDGEMENTS 211 REFERENCES 211 SUPPORTING INFORMATION 29 BIOSKETCHES 29 LIST OF FIGURES LEGENDS 30 FIGURES 32 CONCLUSÕES ...... 39

REFERÊNCIAS BIBLIOGRÁFICAS ...... 61 APÊNDICES ...... 65 1

INTRODUÇÃO

Na floresta Equatorial Amazônica, uma complexa heterogeneidade ambiental e limites ambientais pouco evidentes são ofuscados pela uniformidade de grandes extensões de terras baixas cobertas pelas florestas densas (Hoorn et al., 2010). Com o avanço do conhecimento científico nesta região, resultado do aumento do esforço e padronização das amostragens, inovações nas análises e exploração de áreas consideradas como lacunas de conhecimento, diversos estudos demonstram que variações ambientais são diretamente refletidas nas variações das distribuições de assembleias distintas (Costa e Magnusson, 2010; Magnusson, 2014; Simões et al., 2014). Com o acesso à esta variação fina em estudos biogeográficos utilizando abordagens intra ou interespecíficas e focados em uma determinada região, padrões de distribuição ofuscados ao longo do tempo são evidenciados (e.g. Naka, 2011; Pomara et al., 2013; Boubli et al., 2015; Leite et al., 2015; Dias-Terceiro et al., 2015). Assim como os principais processos causadores da diversificação nesta região, que envolvem interações bidirecionais entre forças históricas e ecológicas (Losos et al., 2013; Beheregaray et al., 2015). O reconhecimento da história evolutiva dos organismos permite a associação com as principais teorias biogeográficas reconhecidas acerca da evolução da paisagem amazônica (Leite e Rogers, 2013; Smith et al., 2014). Com o avanço e a soma deste conhecimento em determinadas regiões e utilizando diversos organismos como modelo, pode-se compreender melhor a história evolutiva da bacia como um todo. Répteis e anfíbios estão entre os organismos com elevado número de linhagens conhecidas para a Amazônia (Duellman, 1979, 2005). Na porção brasileira do bioma, ocorrem cerca de 30% do total de anfíbios e 40% do total de répteis do país (Museu Paraense Emílio Goeldi, 2012; Costa e Bérnils, 2014; Segalla et al., 2014). Porém, a cada ano diversas espécies são reconhecidas e descritas (e.g. Orrico et al., 2014; Lima et al., 2014) ou possuem sua área de ocorrência ampliada (e.g. Simões et al., 2011; Dal Vechio et al., 2015). Estas descobertas indicam que o reconhecimento pleno da diversidade está longe de ser alcançado, e este é o primeiro passo para a identificação dos seus principais padrões biogeográficos. Revisões taxonômicas de espécies amazônicas anteriormente consideradas de ampla distribuição revelam táxons com diferenças fenotípicas sutis, por exemplo, os répteis Plica plica (Murphy e Jowers, 2013) e Thecadactylus rapicauda (Bergmann e Russell, 2007) e os anfíbios Trachycephalus resinifictrix (Gordo et al., 2013), Adenomera spp. (Fouquet et al.,

2014), Allobates femoralis (Simões et al., 2010), Hypsiboas fasciatus e H. calcaratus (Caminer e Ron, 2014). A dificuldade do reconhecimento pleno da diversidade de anfíbios e répteis amazônicos reside principalmente no fato de muitos táxons apresentarem elevado grau de conservadorismo fenotípico e polimorfismo intraespecífico, dificultando a definição dos limites específicos (Fouquet et al., 2014; Funk et al., 2011; Jansen et al., 2011). Para a identificação dos táxons que compõem estes complexos de espécies são necessárias abordagens integrativas, com o estudo refinado da morfologia, acústica, ecologia, comportamento e diversidade molecular (Simões et al., 2013; Nascimento, 2014), já que mesmo táxons semelhantes morfologicamente podem apresentar grandes divergências genéticas (Fouquet et al., 2014). Neste cenário de métodos integrativos de identificação e o aumento da densidade de amostragens na Amazônia, a real diversidade destes grupos na região amazônica está sendo desvendada, assim como as suas complexas histórias evolutivas. Dentre as muitas lacunas de conhecimento para estes grupos localizadas na porção brasileira da Amazônia, a região do Médio Rio Tapajós é uma das mais importantes. Os levantamentos e estudos de anfíbios e répteis realizados na Bacia do Rio Tapajós são concentrados no trecho do Baixo Rio Tapajós (Neckel-Oliveira et al., 2000; Azevedo-Ramos e Gallati, 2001; Ribeiro Jr. et al., 2012), enquanto o conhecimento das regiões do Alto e Médio Rio Tapajós é incipiente (Lima et al., 2014). A exploração destes locais é historicamente difícil em virtude destes trechos do rio possuírem pequena representatividade viária e baixa navegabilidade, devido ao leito rochoso (Azevedo-Ramos e Gallatti, 2001). Esta característica promove a formação de trechos com corredeiras e cachoeiras, tornando esta região alvo de projetos recentes que visam a construção de um complexo de usinas hidrelétricas (Brasil, PR, 2011). Com essa iminente ameaça antrópica e o conhecimento que variações em pequena escala da composição de assembleias nos diferentes ecossistemas florestais da Amazônia são relatados (e.g. Menin et al., 2007; Pavan, 2007; Jorge, 2014), o avanço no conhecimento dos padrões de distribuição dos organismos nesta região e seus processos causadores são extremamente necessários. Especialmente a influência dos grandes rios nas assembleias de anfíbios e répteis que habitam as florestas ripárias, tipo florestal mais ameaçado pelo represamento dos rios (Pavan, 2007; Ferreira et al., 2013). Dessa forma, visa- se evitar a perda desta informação biológica e a previsão e mitigação dos futuros impactos ambientais causados por estes empreendimentos.

Considerando o avanço do conhecimento para traçar a história evolutiva da Amazônia, a identificação dos mecanismos geradores da sua megadiversidade, e o incipiente conhecimento sobre os padrões de distribuição das assembleias de anfíbios e répteis Squamata no bioma, nós realizamos uma amostragem intensa destes grupos na ameaçada região do Médio Rio Tapajós. As linhagens foram identificadas através de técnicas integrativas, buscando evidenciar os principais padrões de distribuição dos organismos e os mecanismos históricos e ecológicos causadores destes padrões. As questões que pretendemos responder com esta abordagem foram: se os grandes rios presentes na região atuam de maneira desigual como barreiras, determinando os limites das distribuições das espécies e se os diferentes tipos florestais, florestas de terra firme e alagáveis, influenciam os padrões de distribuição das espécies. Esperamos com este estudo contribuir para o avanço do conhecimento sobre a biogeografia destes grupos, a história evolutiva da paisagem e a conservação biológica desta região.

OBJETIVOS

Objetivo geral

Determinar como os padrões biogeográficos encontrados para as assembleias de anfíbios e répteis Squamata, na região do Médio Rio Tapajós, relacionam-se a fatores históricos e ecológicos.

Objetivos específicos

 Avaliar a influência relativa de barreiras geográficas estabelecidas pelos grandes rios da região (Tapajós e Jamanxim) sobre os padrões de distribuição de assembleias encontrados.  Avaliar a influência relativa das variações ambientais determinadas pelo tipo florestal (Florestas de Terra Firme e Inundáveis) sobre os padrões de distribuição de assembleias encontrados.  Identificar se assembleias de determinados tipos florestais e organismos de determinados grupos funcionais são mais afetados pelas barreiras geográficas estabelecidas pelos grandes rios na região.

CAPÍTULO I

Moraes, L.J.C.L.; Pavan, D.; Barros, M.C.; Ribas, C.C. 2015. Combined influence of riverine barriers and flooding gradient on biogeographical patterns of amphibians and squamates in South-eastern Amazonia. Journal of Biogeography em revisão. 6

Original Article Distribution patterns of amphibians and squamates in South-eastern Amazonia

Combined influence of riverine barriers and flooding gradient on biogeographical patterns of amphibians and squamates in South- eastern Amazonia

LEANDRO JOÃO CARNEIRO DE LIMA MORAES1,5, DANTE PAVAN2, MARIA CLAUDENE BARROS3

AND CAMILA CHEREM RIBAS4

1 Graduate Program in Ecology, Instituto Nacional de Pesquisas da Amazônia (INPA), Av. André Araújo, 2936, 69067-375. Manaus, AM, Brazil. 2 Ecosfera Consultoria e Pesquisa em Meio Ambiente LTDA., R. Gioconda Mussolini, 291, 05591-120. São Paulo, SP, Brazil. 3 Graduate Program in Biodiversity, Environment and Health, Universidade Estadual do Maranhão, Centro de Estudos Superiores de Caxias, Praça Duque de Caxias, S/N, 65604-000. Caxias, MA, Brazil. 4 Biodiversity Section and Zoological Collections, Instituto Nacional de Pesquisas da Amazônia (INPA), Av. André Araújo, 2936, 69067-375. Manaus, AM, Brazil 5 Correspondence: Leandro J.C.L. Moraes. E-mail: [email protected]

Word Count Abstract: 300 Text: 7236 7

ABSTRACT

Aim To investigate how the distribution patterns of amphibian and squamate assemblages in the Middle Tapajós River region are influenced by the distance to water (flooded and non- flooded forests) and riverine barriers (Tapajós and Jamanxim rivers) and, considering the planned hydroelectric dams on both rivers, to discuss the possible impacts on these assemblages.

Location Middle Tapajós River, South-eastern Amazonia.

Methods We conducted diurnal and nocturnal surveys combining pitfall traps and active search along both banks of the Tapajós and Jamanxin Rivers. We identified specimens through an integrative morphological, acoustic, ecological and molecular approach and evaluated the influence of riverine barriers and distance to water using uni- and multivariate ordinations, regressions and ANOVA.

Results We found changes in species composition for both groups along the flooding gradient and differential riverine barrier effects. The rivers restrict the distribution of 33% of amphibians and 8% of squamates. For amphibians, the main distribution barrier is the Tapajós River and for squamates both rivers were of similar importance. The assemblages most affected by riverine barriers were non-riparian amphibians and squamates, as well as riparian amphibians associated with small streams. The functional groups most affected were small, diurnal terrestrial amphibians and small-medium, diurnal semi-arboricole squamates.

Main conclusions The Tapajós River is a distributional boundary for lineages from the western and eastern Amazonia. The fact that many taxa occur on both banks suggests that the Tapajós is a recent or semi-permeable barrier and that the Jamanxim is an even weaker barrier. Anthropogenic actions that affect water level, flooding cycles and river flow may influence these natural patterns and cause changes to the equilibrium of the riverine barrier effect. Studies seeking to identify these influences should focus on the most affected functional groups identified here.

Keywords Assemblages, dispersal limitation, Eastern Amazonia, forest types, herpetofauna, hydropower plants, Tapajós Basin.

INTRODUCTION

Current distribution patterns are shaped by multidirectional interactions between several processes acting at different temporal and spatial scales (Vellend, 2010; Losos et al., 2013). Historically, several processes have been considered drivers of the megadiversity currently found in the Amazonian rain forest. At the regional scale, these processes include Andean orogeny and drainage evolution (Hoorn et al., 2010; Latrubesse et al., 2010), neotectonism (Rossetti, 2014), and climate changes (Haffer, 1969); whereas at the local scale, they may include interactions among biotic and abiotic factors or intrinsic ecological constraints (Cornell & Lawton, 1992). The dynamic equilibrium between historical events and local ecological conditions may have led to the development and maintenance of current Amazonian diversity patterns (Tuomisto & Ruokolainen, 1997). At the regional scale, the fluvial dynamics of the Amazon Basin seem to play an important role in the origin and maintenance of diversity patterns (Wallace 1852). The influence of the evolution of large rivers on the segregation and vicariance of sister-taxa and the distribution patterns of some vertebrates, especially birds (Cracraft, 1985; da Silva et al., 2005) and monkeys (Boubli et al., 2014), strongly support this hypothesis. Nevertheless, Amazonian rivers vary in hydromorphological dynamics and evolution (Sioli, 1968) and therefore exert unequal influence on the evolutionary history of the biota (Gascon et al., 2000; Bates et al., 2004). In addition, species' life-histories, including functional traits such as size or microhabitat preference, directly influence their dispersal capacity (Gascon et al., 1998; Burney & Brumfield, 2009; Smith et al., 2014; Fouquet et al., 2015). For example, riparian or semi-aquatic species are expected to have greater capacity of dispersing across rivers due to the increased contact with aquatic surface (Schiesari et al., 2003; Aleixo, 2006; Cadena et al., 2011). Species assemblages are also influenced by local ecological factors that are assessed only through fine-scale studies of distribution patterns. Environmental variables structuring the assemblages of several Amazonian taxa have already been identified. For example, topographical characteristics, soil composition and microhabitat variation influence the distribution of plants (Emílio et al., 2013; Schietti et al., 2013; Zuquin et al., 2014) and squamates (Pavan, 2007; Fraga et al., 2011; Garda et al., 2012). Distance to streams (Menin, 2011), forest type (Gascon et al., 2000; Pavan, 2007) and leaflitter morphology (Menin et al.,

2007) all influence anuran distribution. However, the overall difficulty researchers have faced in detecting general patterns suggests that the relationship between ecological factors and distribution patterns is idiosyncratic (Dias-Terceiro et al., 2015). Amphibians and squamates are among the most diverse Amazonian vertebrate groups, include several threatened species and play important ecological roles in ecosystem operations, but few studies have tried to correlate their distribution patterns with evolutionary processes (Ron, 2000). Studying these groups as a model to investigate the evolutionary history of the Amazonian landscape may be relevant because they are sensitive to environmental and climatological changes (Kerby et al., 2010; Mitchell & Janzen, 2010) and frequently have low individual motility, showing greater vulnerability to these changes and retaining signals of historical events (Simões et al., 2014). Also, they are generally widely distributed throughout the basin (Duellman, 1979). Most of the studies investigating this correlation focus on intraspecific morphological, acoustic or molecular variation (e.g., Simões et al., 2008; Souza et al., 2013; Fouquet et al. 2014), whereas few address assemblage variations. The studies that do exist show that both historical and ecological factors help shape species distributions within these groups at different scales (Ávila-Pires, 1995; Gascon et al., 2000; Ron, 2000; Dias-Terceiro et al., 2015). The lack of assemblage-level research approaches to investigate these relationships is caused primarily by the lack of basic knowledge of species distributions that has resulted from a concentration of studies in a few accessible areas, lack of standardization and short-term samplings (Azevedo-Ramos & Galatti, 2001). Moreover, incomplete taxonomic knowledge, can hinder the understanding of real distribution patterns (Fouquet et al., 2007). Recently, the Amazon basin has been the focus of large developmental projects, including building dams for hydroelectric energy generation on the primary Amazonian rivers (Brasil, PR, 2011). These dams will affect the water flow and flooding dynamics of the main Amazonian rivers and adjacent forests (Nilsson & Berggren, 2000), and it is unknown how these anthropogenic changes will affect biodiversity. Currently, one of the most threatened Amazonian rivers is the Tapajós as several ongoing projects aim to build consecutive dams along this river and its tributaries (Fearnside, 2015). Here, we aim to understand how the distribution patterns of amphibians and squamates are influenced by riverine barriers and by distance to water, as a proxy for forest type (upland or flooded forest) within the poorly known and threatened region of the Middle Tapajós River. We investigate whether assemblage composition changes with distance from the water

10 and on the opposite banks of the Tapajós and Jamanxim Rivers, the largest rivers that drain the area. We also ask whether the riverine barrier effect varies in relation to specific assemblages or functional groups that occur in forests with different flooding regimes.

MATERIALS AND METHODS

The clear-water Tapajós River is one of the main tributaries of the Amazon River. Its headwaters drain the Precambrian terrain of the Brazilian Shield, which provides low sediment input (Sioli, 1968). The middle Tapajós is located in a geological contact zone, including the northern limit of the cratonic Brazilian Shield and the sedimentary plains of the Amazon River Basin. The dry season occurs between June and August and the rainy season between November and March. Average annual temperature is 26°C and annual rainfall varies from 50 to 375 mm (Alvares et al., 2013).

Amphibian and reptile sampling

Sampling was conducted on both banks of the Tapajós and Jamanxin rivers, at 10 sampling units (Fig. 1). Each unit was comprised of one 4 km transect and seven perpendicular 250 m plots, four of these in upland forests (non-flooded) and three in periodically flooded riparian forests. The plots follow the contour lines of the terrain. Detailed descriptions of environmental variation observed in each sampling unit are available in Appendix S1. The sampling scheme aims to increase standardization and independence (Magnusson et al., 2005). We sampled both transects and plots during six survey campaigns from July 2012 to November 2013, covering all phases of the hydrological cycle. We used complementary methods to register individuals, seeking to maximize regional diversity sampling and to reduce the effect of sampling bias. Using the active search method (Heyer, 1994), five researchers searched for individuals along the centre line of trails at diurnal and nocturnal periods and in all microhabitats accessible visually or through vocalization (in the case of male breeding anurans). The number of anurans calling at each point was estimated during sampling. Each plot was sampled for at least 14 days and nights, and each transect was sampled for six days and nights, totalling more than 340 days of active search surveys.

Pitfall traps (Heyer, 1994) were installed at four random plots, each consisting of three equidistant parallel rows of five buckets. These traps were checked at 24 h intervals for five consecutive days during each survey campaign, totalling an effort of 600 trap nights. Individuals registered through methods other than those described here, or collected by third parties, were considered casual encounters.

Taxa delimitation and identification

We used an integrative approach to taxa delimitation, combining morphological, acoustic, ecological and molecular techniques (Padial et al., 2010). The morphological, acoustic and ecological analyses was based in author’s observations, species descriptions, taxonomic revisions and field guides, and included comparisons with voucher specimens deposited in the collection of amphibians and reptiles at the National Institute for Amazonian Research, including some type series. Molecular species identification was employed for cryptic species complexes. DNA was extracted from tissue samples and the 16S rRNA gene, which is one of the standard markers for these groups (Vences et al., 2012), was amplified through a polymerase chain reaction (PCR) and sequenced in an ABI PRISM 3500 (Life Technologies) sequencer. Additional sequences from related taxa and outgroups were obtained from Genbank. Sequences were aligned in CLUSTAL OMEGA (Sievers et al., 2011) and phylogenetic trees were inferred using Maximum Likelihood in MEGA 5 (Tamura et al., 2011). Clade support was estimated by bootstrap. See Appendix S2 for details of integrative species identification.

Data analyses

To detect whether and how environmental variations between distinct forest types influences assemblage structure, we constructed direct ordinations and dissimilarity matrices using the qualitative (presence-absence) data from the plot surveys. Dissimilarity was measured using the Jaccard index, and the dimensionality was reduced using one axis of a non-metric multidimensional scale (NMDS) (Clarke, 1993). Because some upland plots were located next to water, we considered forest type variation as a continuous measure based on proximity of plots to water bodies. Using regional hydrographic maps, we measured the

12 straight-line distance at 90° from the beginning of the plot to the nearest water body. Correlation between species composition and water proximity (flooding gradient) was analysed by linear regression. We excluded the species for which we sampled less than 5 individuals because it is more difficult to determine whether they are associated with a particular forest type. To evaluate the riverine barrier effect, we constructed dissimilarity matrices using the entire qualitative data from sampling units in each interfluve (Madeira-Tapajós, Tapajós- Jamanxim, Madeira-Tapajós/Jamanxim, Tapajós/Jamanxim-Xingu and Tapajós-Xingu). Dissimilarity was measured using the Jaccard index, and we determined the riverine effects with NMDS. We used these same methods to investigate how riverine barriers affect assemblages from distinct forest types based on the qualitative data of all surveys, considering only the species occurring in each assemblage. For this, we determine the size of riparian forest through assemblages (NMDS Axis1) breakings in relation to distance to water with piecewise regressions. We generated ordinations for the assemblages of (1) non-riparian amphibians, (2) small stream riparian amphibians, (3) large river riparian amphibians, (4) non-riparian squamates, and (5) riparian squamates. The last assemblage showed no composition changes across the two riparian forests types. We used one first NMDS axis to test the assemblage differences in interfluves with an ANOVA and Tukey post-hoc test. To detect significant differences in species abundance between interfluves we also used ANOVA and Tukey test. We evaluated the riverine barrier effect for species from different functional groups based on traits that reflect their life-history: activity period, microhabitat and body size, comparing the relative number of affected species in each category. All of the analyses were performed in R (R Development Core Team, 2014).

RESULTS

We registered 14,253 amphibians of 92 species and 3,410 squamates of 101 species (Table S1). We excluded species recorded at only one site and obtained a final dataset of 79 amphibians and 82 squamates.

Flooding gradient

We detected significant changes in species composition associated with proximity to water for the amphibians and lizards, and weak changes for the snakes (Table 1). The abundance of some species increased close to a watercourse, whereas some species occurred exclusively in these areas, including the amphibians Hypsiboas multifasciatus, H. leucocheilus and Allobates magnussoni and the squamates Bothrops atrox and Uranoscodon superciliosus (Fig. 2, 3). However, no species occurred exclusively in upland forests, which was expected because of their varying degrees of dependence on water.

Riverine barriers: widely distributed taxa

Of 79 amphibian species, 49 were detected on all banks of both main rivers. Of these, 33 are also widely distributed in the Amazonia, whereas three are found only south of the Amazon River, five are restricted to the central portion of the southern Amazonia and one is distributed in the eastern Amazonia. Nine other species are poorly known or new taxa with unknown distributions. At least 16 of the widely distributed taxa are species complexes and intraspecific analyses may reveal restricted lineages (Table S1). Regarding the squamates, of the 82 species identified, 54 were widely distributed; and of these, 48 are also widely distributed in the Amazonia. However, at least two are species complexes, especially snakes of the genus Atractus. One species is restricted to the south of the Amazon River and one to the central portion of the southern Amazonia. Two species are distributed in the eastern Amazonia and at least two have uncertain distribution due to conspicuous habits or taxonomic uncertainty (Table S1).

Riverine barriers: taxa with distributions restricted by rivers

The distribution patterns of 30 amphibian and 27 reptile species indicated some riverine barrier effect, with species occurrence restricted to one bank of the main river (Fig. 4). We excluded four amphibians and 20 squamates from the analyses as they were already

14 historically registered on opposite margins or are poorly understood, indicating that the riverine effect on these species could have been due to sampling bias. Fifteen amphibians are restricted to the western bank of the Tapajós, 10 to the eastern bank and one to the eastern bank of the Jamanxim. Only the Tapajós represented an effective barrier, with different species composition on opposite banks. No composition difference was found on opposite banks of the Jamanxim (Table 1). NMDS ordination reflects this dissimilarity and shows a large break in composition associated with the Tapajós and no break associated with the Jamanxim (R²=0.74, stress=0.05) (Fig. 5). Among the squamates, two species were restricted to the western bank of the Tapajós, three to the eastern bank and two to the eastern bank of the Jamanxim. The lizard assemblages on interfluves show some influence from both rivers as barriers. For snakes, no riverine barrier effect was detected (Table 1). In the NMDS ordination, the Tapajós and Jamanxim show some influence as geographical boundaries for lizard assemblages (R²=0.82, stress=0.09) and not significant for snake assemblages (R²=0.49, stress=0.16) (Fig. 5). Some species were present on both banks of these rivers but had extremely unequal abundances on opposite banks. For example, we recorded 49 individuals of the lizard Norops trachyderma on the eastern bank of the Tapajós and only one on the western bank; and for the frog Rhinella gr. margaritifera1, we identified 88 individuals on the western bank and one on the eastern bank. In total, six amphibians and six squamates have unequal abundances between interfluves. Of these, eight are more abundant in the Madeira-Tapajós, two in the Tapajós-Jamanxim and two in the Tapajós-Xingu (Fig. 4). The amphibian functional groups most affected by the riverine barrier effect were small, diurnal and terrestrial species, especially the genera Pristimantis (four taxa), Allobates and Leptodactylus (three taxa each). The most affected squamate functional groups were small-medium sized, diurnal and semi-arboricole species, especially lineages of the genus Gonatodes (two species) (Fig. 6).

Riverine barrier effects on species along the flooding gradient

Because amphibians and squamates are not uniformly distributed in forests with different degrees of flooding, we tested the riverine barrier effect for different classes of assemblages. For amphibians, the riverine barrier effect was stronger for non-riparian and

15 riparian assemblages associated with small streams. In the latter case, this result was influenced by the fact that some species typical of this environment such as Hypsiboas leucocheilus, H. multifasciatus and Leptodactylus leptodactyloides, are often restricted to one bank. No significant riverine barrier effect was detected for riparian assemblages associated with large rivers (Table 1). These effects were visualized in NMDS ordinations: two clusters were segregated by the Tapajós for non-riparian assemblages (R²=0.84, stress=0.004) and the small stream riparian assemblages (R²=0.87, stress=0.05), but no clustering occurred for large river riparian assemblages (R²=0.81, stress=0.06) (Fig. 7). For squamates, the non-riparian assemblages showed a riverine barrier effect associated with opposite banks of the Tapajós, whereas the riparian assemblages were homogeneous (Table 1). In the NMDS ordinations, the Tapajós also segregated two clusters for the non-riparian assemblages (R²=0.86, stress=0.09) but no clustering occurred for the riparian assemblages (R²=0.91, stress=0.15) (Fig. 7).

DISCUSSION

We registered several undescribed or recently described taxa in addition to some distribution extensions, demonstrating the difficulty of characterizing biogeographical patterns based on current taxonomic knowledge without large sampling efforts to collect primary data and the use of integrative species identification approaches. Analyses of amphibian and squamate distribution patterns in the Middle Tapajós River region showed that both ecological (flooding regimes) and historical (riverine barriers) factors influence the structure of assemblages, as reported for other Amazonian regions (Gascon et al., 2000; Dias- Terceiro et al. 2015). Changes in assemblage composition occurred both on opposite banks of the Tapajós and in forests with different flooding regimes. In addition, some functional groups are more affected by riverine barriers than others.

Flooding gradient and species assemblages

Several studies have detected changes in assemblage composition in distinct Amazonian forest ecosystems, e.g., for plants (Wittmann et al., 2004; Schietti et al., 2013), mammals (Haugaasen & Peres, 2005), birds (Bueno et al., 2012) and amphibians and reptiles

(Doan & Arriaga, 2002; Pavan, 2007). In the Middle Tapajós River region, despite the relatively small development of riparian ecosystems due to riverine channel morphology, we detected a change in composition between assemblages along the flooding gradient (distance to water). This was especially the case for amphibians, which have different patterns even between distinct riparian forests. These differences may be due to species endogenous processes, such as intrinsic ecological requirements related to reproduction, behaviour and physiological constraints, which restrict their distributional ranges (Dale & Fortin, 2014). The high intra- and interspecific homogenization among riparian assemblages documented for other Amazonian organisms (e.g., Aleixo, 2006; Cadena et al., 2011) was corroborated, especially for the assemblages associated with large rivers (Igapó forests). This indicates that dispersal across and along the river is facilitated for these organisms. It has been suggested that strong water flow may facilitate dispersal by carrying "rafts" of land or vegetation across or along the rivers (Schiesari et al., 2003; Pavan, 2007). Contrastingly to literature (e.g. Aleixo, 2006; Cadena et al., 2011), we detected changes in the composition of small stream riparian amphibian assemblages on opposite banks of the Tapajós. That difference can be generated by species physiological and behavioural constraints because individuals remain sedentary in these wetlands and never use the upland forests and large river riparian forests, thus hindering the exchange of individuals between banks and may increase morphological and genetic divergence. Analysing the genetic differences in one amphibian with these characteristics, Mullen et al. (2010) noted that gene flow can be low even between nearby streams.

Rivers as barriers to dispersal

For amphibians, the Tapajós is the eastern distributional limit of many groups from the south-western Amazonian highlands, including Hemiphractus scutatus, Dendropsophus bokermanni and Hypsiboas leucocheilus. Some typical lowland lineages from the Solimões Basin, such as Ameerega trivittata, Allobates masniger, Scinax cruentommus and Chiasmocleis bassleri are also registered exclusively on western bank of the Tapajós. The eastern banks of Tapajós and Jamanxim are the distributional limits for some amphibians from the Brazilian Shield highlands, such as Adelphobates galactonotus, Ranitomeya amazonica and Leptodactylus paraensis, and the eastern lowlands, such as Leptodactylus leptodactyloides and Hypsiboas multifasciatus. Some additional amphibians

17 with distributions bounded by the Tapajós are enigmatic, and it is difficult to infer biogeographical patterns. These species include: Synapturanus sp., a genus extremely rare south of the Amazon River (Albertina Lima, com. pess.); Pristimantis gr. lacrimosus3, an undescribed taxon, and Pristimantis reichlei, an Andean lineage that was registered on only the eastern bank of the Tapajós. The Tapajós is also a distributional limit for squamates. Some typical lowland lineages of the Solimões Basin and highland lineages of the south-western Amazonia that occur exclusively on the western bank of the Tapajós include Norops tandai (Solimões Basin) and Gonatodes hasemani (south-western Amazonia highlands). Typical lineages of the Brazilian Shield highlands occur exclusively on the eastern banks of the Tapajós and Jamanxim, such as Enyalius leechi, Gonatodes tapajonicus and Thamnodynastes pallidus, or are much more abundant on this bank, such as Norops trachyderma. In the studied region, the Tapajós and Jamanxin rivers contribute unequally to the origin and maintenance of species distribution patterns. The exchange of individuals between opposite banks of the Tapajós River is higher for riparian than for non-riparian assemblages, whereas the Jamanxim was not an effective barrier for amphibians and was a weak barrier for squamates. Previous studies provided discordant results on the effects of primary Amazonian rivers as barriers to amphibian and reptile dispersal (Ávila-Pires, 1995; Gascon et al., 2000; Ron, 2000; Dias-Terceiro et al., 2015). For amphibians, the Tapajós appears to be a stronger barrier than other Western Amazonian rivers, such as the Juruá River (Ron, 2000), whereas the relatively young Madeira River has impact as a barrier (Dias-Terceiro et al., 2015). The Tapajós had a weak barrier effect for lizard assemblages and is not historically considered a barrier for this group (Ávila-Pires, 1995; da Silva Jr. & Sites, 1995). The river had an even weaker barrier effect on snake assemblages, which was expected as most species are widely distributed in the Amazonia due to their high dispersal capacity (da Silva Jr. & Sites, 1995), or may be due to greater difficulty in detecting them, resulting in fewer records and preventing the patterns definition (Fraga et al., 2014). A small portion of taxa recorded in the present study had their distributions bounded by rivers (33% of amphibians and 8% of squamates), suggesting that the Tapajós might be a recent or semi-permeable barrier. It seems paradoxical that an ancient river located on stable geological terrain (Hoorn et al., 2010) has a small influence on the structure of species assemblages; however, recent phylogeographic studies of several vertebrates (e.g., birds (Ribas et al., 2012, Fernandes et al., 2013), frogs (Jungfer et al., 2013; Simões et al., 2014)

18 and snakes (Nascimento, 2014)) show shallow genetic divergences between intraspecific lineages associated with opposite banks of Brazilian shield rivers. These results may indicate that the intrinsic ability of each lineage to cross a river and to establish populations on the other bank are more relevant than the age, hydromorphology or stability of rivers; or, they may add to the evidence that Brazilian Shield rivers and the surrounding environments have gone through important historical changes in the recent past that may have affected distribution patterns (Rossetti, 2014; Ribas et al., in press.).

Diversification of specific functional groups

Small diurnal terrestrial and semi-terrestrial amphibians with restricted territories, such as those of the genera Allobates, Pristimantis and Adenomera, are abundant in the forest litter and have a low dispersal capacity. The combination of dispersal limitation, which has already been postulated as one major driver of speciation (e.g. for birds, Burney & Brumfield, 2009; Smith et al., 2014 and anurans, Wollenberg et al., 2011), and potential to use new habitats or ecological niches, due to the greater independence from water during the reproductive cycle (Duellman & Trueb, 1994), may promote diversification in these groups. Small semi-arboricole diurnal Gonatodes lizards are equally abundant in forested areas and live mainly in tree trunks. High abundance and niche competition may promote ecological divergence in sympatric species of this genus (Vitt et al., 2000). These biotic interactions and ecological constraints may increase the riverine barrier effect, accelerating allopatric diversification (Gutiérrez et al., 2014). Based on dated phylogenies, Gamble et al., (2008) already postulated that Amazonian Tertiary orogeny and drainage evolution are major drivers of diversification in this group. These amphibian and reptile functional groups are most affected by the emergence of geographical barriers like large rivers, which segregate populations. Therefore, species of these genera or functional groups should be the preferred model organisms in the study of the recent evolution of the Amazon Basin (Simões et al., 2014). However, their recent diversification (Araújo et al., 2008) creates difficulties in identifying taxonomic units, and better taxonomic knowledge is essential for further biogeographical studies.

Integrated influence of rivers and their floodplains on biodiversity patterns

This study demonstrates the relevance of large rivers as drivers of species diversity patterns. River dynamics both create distinct environments that allow the establishment of ecologically distinct assemblages and establish barriers with varying permeabilities for distinct components of these assemblages, both in current and past times. River dynamics also create distinct opportunities for fauna exchange between opposite banks as water flow may increase the longitudinal and transversal passive dispersal of individuals inhabiting riparian forests but not of those inhabiting upland forests, thereby preventing or promoting lineage differentiation. The studied region is a contact zone for amphibians and squamates from the eastern and western Amazonia. This may be due to rainfall seasonality, temperature and geomorphological gradients (Sombroek, 2001). The western bank of the Tapajós River is geomorphically influenced by the Solimões and Amazon sedimentary basins, whereas the eastern bank is highly influenced by the Brazilian Shield (Sombroek, 2000). This difference is evident even in the current river morphology, with a sharp curve along the Brazilian Shield limit. In this region, fauna group components from dense western Amazonian forests, influenced by the Andes and the sedimentary basin, mix with components from drier eastern Amazonian forests that are influenced by the Amazonia-Cerrado transition following these environmental gradients. This mixed influence is evident in the fact that most species restricted to the western bank of the Tapajós inhabit the Western lowlands (69%), whereas those restricted to the eastern bank (78%) are typical of the Brazilian Shield. The river prevents the formation of a continuous gradient in the contact zone of these two distinct Amazonian regions, acting both as an ecological and physical barrier (Tuomisto & Ruokolainen, 1997). For this reason, most of the amphibians and squamates that have shown some riverine barrier effect in this region have no sister-taxa or have unequal abundances on opposite banks, weakening the effect of this river as a vicariant agent to these groups and reinforcing the combined action of recent geomorphological changes and various barrier effects. Ecological constraints also prevent the establishment of many species detected in this study within the lower Tapajós River region of the Amazon Sedimentary Basin, where species richness and composition, especially of amphibian assemblages, change dramatically (see

Neckel-Oliveira et al., 2000). Most of the species that occur in this region are typical of riparian forests associated with large rivers in the middle Tapajós River region.

Considerations about the potential impacts of planned large dams

The imminent construction of hydropower plants, associated with a waterway to increase navigability in the Tapajós Basin (Fearnside, 2015), will significantly affect biogeographical patterns, with the potential to cause several environmental impacts at different scales. After the dams are complete, the rivers on which they are constructed will be in a permanently flooded state. The natural fast water flow of the rivers will transform into lentic systems (Nilsson & Berggren, 2000), breaking the rivers’ longitudinal and transversal functionality (Junk et al., 1989; Vannote et al., 1990) and affecting several organisms that have eco-physiological constraints. Based on the results presented here, we predict that these changes will affect mainly the riparian assemblages, which are distinct from the upland assemblages and include some restricted species, by eliminating the environments needed to complete the species’ life cycle. In the short-term, the fauna rescue programme and river filling process may affect the historical distribution boundaries, mixing components from opposite margins. In the long- term, the higher water volume and lower energy may increase the potential of these rivers to become stronger barriers to dispersal (Ward & Stanford, 1995; Hayes & Sewlal, 2004), thereby affecting both riparian and non-riparian assemblages. This is especially true on the Jamanxim, which is currently highly permeable to dispersion during the dry season. A decrease in the rivers’ permeability will prevent species exchanges among regional species pools, leading to the development of distinct and poorer local diversities on opposite banks (Brown et al., 2011). Furthermore, the Tapajós Basin is known to harbour distinct flora and fauna, with many endemic lineages of plants (Ferreira et al., 2013), frogs (Lima et al., 2014), lizards (Rodrigues, 1980) and birds (Olmos & Pacheco, 2003). Changes in the fluvial dynamics of this region will certainly impact these lineages, whose ecological constraints and evolutionary history associated with the natural fluvial dynamics of the region have led to their current distribution patterns. Anthropogenic actions can thus affect the role of rivers as current and historical drivers of biodiversity patterns, disturbing the regional ecosystem as a whole. Because the

Amazonian rain forest is intrinsically linked to the largest river basin in the world, preserving the integrity of its rivers is crucial to the maintenance of the forested ecosystems. We stress that the biogeographical patterns highlighted here should be part of the discussion of the feasibility of all large developmental projects that affect Amazonian rivers.

ACKNOWLEDGEMENTS

We thank L.F. Storti, J. Cassimiro, M. Hoffman, T.F.D. Rodrigues, J.M.B. Ghelere, A.B. Barros, E.S. Brito and all field mates who helped us in data survey. I.L Kaefer, F.P. Werneck, A.P. Lima, M. Gordo, S.H. Borges, L.N. Naka, P.I. Simões, F.M. d’Horta and A. Barnett provided valuable suggestions. The specimens were collected under collection permit number 066/2012 provided by Instituto Brasileiro do Meio Ambiente e dos Recursos Naturais Renováveis (IBAMA). CNEC Worleyparsons Engenharia S.A. provided financial and logistical support. Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq, Brazil) provided a Master's degree scholarship to L.J.C.L. Moraes and a productivity fellowship to C.C. Ribas (307951/2012-0).

REFERENCES

Aleixo, A. (2006) Historical diversification of floodplain forest specialist species in the Amazon: A case study with two species of the avian genus Xiphorhynchus (Aves: Dendrocolaptidae). Biological Journal of the Linnean Society, 89, 383-395. Alvares, C.A., Stape, J.L., Sentelhas, P.C., Gonçalves, J.L.M. & Sparovek, G. (2013) Koppen's climate classification map for Brazil. Meteorologische Zeitschrift, 22, 711- 728. Araújo, M.B., Nogués-Bravo, D., Diniz-Filho, A.F., Haywood, A.M., Valdes, P.J. & Rahbeck, C. (2008) Quaternary climate changes explain diversity among reptiles and amphibians. Ecography, 31, 8-15. Ávila-Pires, T.C.S. (1995) Lizards of Brazilian Amazonia (Reptilia: Squamata). Zoologische Verhandelingen, 299, 1-706.

Azevedo-Ramos, C. & Galatti, U. (2002) Patterns of amphibian diversity in Brazilian Amazonia: conservation implications. Biological Conservation 103, 103-111. Bates, J.M., Haffer, J. & Grismer, E. (2004) Avian mitochondrial DNA sequence divergence across a headwater stream of the Rio Tapajós, a major Amazonian river. Journal of Ornithology, 145, 199-205. Boubli, J.P., Ribas, C., Lynch Alfaro, J., da Silva, M.N.F., Pinho, G.M., & Farias, I.P. (2014) Spatial and temporal patterns of diversification on the Amazon: a test of the riverine hypothesis for all diurnal primates of Rio Negro and Rio Branco in Brazil. Molecular Phylogenetics and Evolution, 82, 400-412. Brasil, PR (Presidência da República). (2011) PAC-2 Relatórios. PR, Brasília, DF. Available at: www.brasil.gov.br. Brown, B.L., Swan, C.M., Auerbach, D.A., Grant, E.H.C., Hitt, N.P., Maloney, K.O., Patrick, P. (2011) Metacommunity theory as a multispecies, multiscale framework for studying the influence of river network structure on riverine communities and ecosystems. Journal of the North American Benthological Society, 30, 310-327. Bueno, A.S., Bruno, R.S., Pimentel, T.P., Sanaiotti, T.M. & Magnusson, W.E. (2012) The width of the riparian habitats for understory birds in an Amazonian forest. Ecological Applications, 22, 722-734. Burney, C.W. & Brumfield, R.T. (2009) Ecology predicts levels of genetic differentiation in neotropical birds. American Naturalist, 174, 358-368. Cadena, C.D., Gutiérrez-Pinto, N., Dávila, N. & Chesser, R.T. (2011) No population genetic structure in a widespread aquatic songbird from the Neotropics. Molecular Phylogenetics and Evolution, 58, 540-545. Clarke, K.R. (1993) Non-parametric multivariate analyses of changes in community structure. Australian Journal of Ecology, 18, 117-143. Cornell, H.V. & Lawton, J.H. (1992) Species interactions, local and regional processes, and limits to the richness of ecological communities: a theoretical perspective. Journal of Animal Ecology, 61, 1-12. Cracraft, J. (1985) Historical biogeography and patterns of differentiation within the South American avifauna: areas of endemism. Ornithological Monographs, 36, 49-84. Dale M.R.T. & Fortin M.J. (2014). Spatial analysis: a guide for ecologists. 2nd edn. Cambridge University Press, Cambridge.

Dias-Terceiro, R.G., Kaefer, I.L., de Fraga, R., de Araújo, M.C., Simões, P.I. & Lima, A.P. (2015) A matter of scale: historical and environmental factors structure anuran assemblages from the Upper Madeira river, Amazonia. Biotropica, 47, 259-266. Doan, T.M. & Arriaga, W.A. (2002) Microgeographic variation in species composition of the herpetofaunal commities of Tambopata region, Peru. Biotropica, 34, 101-117. Duellman, W.E. (1979) The South American herpetofauna: Its origin, evolution, and dispersal. Museum of Natural History/University of Kansas, Kansas. Duellman, W.E. & Trueb L. (1994) Biology of Amphibians. Johns Hopkins University Press, Baltimore. Emílio, T., Quesada, C.A., Costa, F. et al. (2013) Soil physical constraints limit palm and tree basal area in Amazonian forests. Plant Ecology & Diversity, 7, 130204073052004. Fearnside, P.M. 2015. Amazon Dams and Waterways: Brazil’s Tapajós Basin Plans. Ambio, 44, 426-439. Ferreira, L.V., Cunha, D.A., Chaves, P.P., Matos, D.C.L. & Parolin, P. 2013. Impacts of hydroelectric dams on alluvial riparian plant communities in eastern Brazilian Amazonian. Anais da Academia Brasileira de Ciências, 85, 241-251. Fernandes, A.M., Gonzalez, J., Wink, M. & Aleixo, A. (2013) Multilocus phylogeography of the wedge-billed woodcreeper Glyphorynchus spirurus (Aves, Furnariidae) in lowland Amazonia: widespread cryptic diversity and paraphyly reveal a complex diversification pattern. Molecular Phylogenetics and Evolution, 66, 270-282. Fouquet, A., Gilles, A., Vences, M., Marty, C., Blanc, M. & Gemmell, N.J. (2007) Underestimation of species richness in Neotropical frogs revealed by mtDNA analyses. PLoSOne, 32, e1109. Fouquet, A., C.S. Cassini, C.F.B. Haddad, N. Pech & Rodrigues, M.T. (2014) Species delimitation, patterns of diversification and historical biogeography of the Neotropical frog genus Adenomera (Anura, Leptodactylidae). Journal of Biogeography, 41, 855- 870. Fouquet, A., Courtois, E.A., Baudain, D., Jucivaldo Dias Lima, J.D., Souza, S.M., Noonan, B.P. & Rodrigues, M.T. (2015) The trans-riverine genetic structure of 28 Amazonian frog species is dependent on life history. Journal of Tropical Ecology, 31, 361-373. Fraga, R., Lima, A.P. & Magnusson, W.E. (2011) Mesoscale spatial ecology of a tropical snake assemblage: the width of riparian corridors in Central Amazonia. The Herpetological Journal, 21, 51-57.

Fraga, R., Stow, A.J., Magnusson, W.E. & Lima, A.P. (2014) The Costs of Evaluating Species Densities and Composition of Snakes to Assess Development Impacts in Amazonia. PLoS ONE, 9, e105453. Gascon, C., Lougheed, S.C. & Bogart, J.P. (1998) Patterns of genetic population differentiation in four species of Amazonian frogs: a test of the Riverine Barrier Hypothesis. Biotropica, 30, 104–119. Gascon, C., Malcolm, J.R., Patton, J.L., Silva, M.N.F., Bogart, J.P., Lougheed, S.C., Peres, C.A., Neckel, S. & Boag, P. (2000) Riverine barriers in the geographic distribution of Amazonian species. Proceedings of the National Academy of Sciences, 97, 13672- 13677. Garda, A.A., Wiederhecker, H.C., Gainsbury, A.M., Costa, G.C., Pyron, R.A., Vieira, G.H.C., Werneck, F.P. & Colli, G.R. (2012) Microhabitat Variation Explains Local-scale Distribution of Terrestrial Amazonian Lizards in Rondônia, Western Brazil. Biotropica, 45, 245–252. Gutiérrez, E.E., Boria, R.A. & Anderson, R.P. (2014) Can biotic interactions cause allopatry? Niche models, competition, and distributions of South American mouse opossums. Ecography, 37: 741–753. Haffer, J. (1969) Speciation in Amazonian forest birds. Science, 165, 131-137. Haugaasen, T. & Peres, C.A. (2005) Mammal assemblage structure in Amazonian flooded and unflooded forests. Journal of Tropical Ecology, 21, 133-145. Hayes F.E. & Sewlal, J.A.N. (2004) The Amazon River as a dispersal barrier to passerine birds: effects of river width, habitat and taxonomy. Journal of Biogeography, 31, 1809- 1818. Heyer, W.R., Donnelly, M.A., Mcdiarmid, R.W., Hayek, L.C. & Foster, M.S. (1994) Measuring and monitoring biological diversity: Standard methods for amphibians. Smithsonian Institution Press, Washington. Hoorn, C., Wesselingh, F.P., terSteege, H., Bermudez M.A., Mora A., Sevink J., Sanmartín I.A., Sanchez-Meseguer, A, Anderson, C.L., Figueiredo, J.P., Jaramillo, C., Riff, D., Negri, F.R., Hooghiemstra, H., Lundberg, J., Stadler, T., Särkinen, T. & Antonelli, A. (2010) Amazonia through time: Andean uplift, climate change, landscape evolution, and biodiversity. Science, 330, 927-931. Jungfer, K.H., Faivovich, J., Padial, J.M. et al. (2013) Systematics of spiny-backed treefrogs (Hylidae: Osteocephalus): an Amazonian puzzle. Zoologica Scripta, 42, 351-380.

Junk W.J., P.B. Bayley & Sparks, R.E. (1989) The flood pulse concept in river – floodplain systems. Canadian Special Publication of Fisheries and Aquatic Sciences, 106, 110- 127. Kerby, J.L., Richards-Hrdlicka, K.L., Storfer, A. & Skelly, D.K. (2010) An examination of amphibian sensitivity to environmental contaminants: are amphibians poor canaries? Ecology Letters, 13, 60-67. Latrubesse, E.M., Cozzuol, M., Silva-Caminha, S.A.F., Rigsby, C.A., Absy, M.L. & Jaramillo, C. (2010) The Late Miocene paleogeography of the Amazon Basin and the evolution of the Amazon river system. Earth-Science Reviews, 99, 99-124. Lima, A.P., Simões, P.I. & Kaefer, I.L. (2014). A new species of Allobates (Anura: Aromobatidae) from the Tapajós River basin, Pará State, Brazil. Zootaxa 3889: 355- 387. Losos, J.B., Arnold, S.J., Bejerano, G., Brodie III, E.D., Hibbett, D., Hoekstra, H.E., Mindell, D.P., Monteiro, A., Moritz, C., Allen Or, H., Petrov, D.A., Renner, S.A., Ricklefs, R.E., Soltis, P.S. & Turner T.L. (2013) Evolutionary biology for the 21st century. PLoS Biology, 11, e1001466. Magnusson, W.E., Lima, A.P., Luizão, R., Luizão, F., Costa, F.R.C., de Castilho, C.V. & Kinupp, V.P. (2005) RAPELD: a modification of the Gentry method for biodiversity surveys in long-term ecological research sites. Biota Neotropica. 5, 1-5. Menin, M., Lima, A.P., Magnusson, W.E. & Waldez, F. (2007) Topographic and edaphic effects on the distribution of terrestrially reproducing anurans in Central Amazonia: mesoscale spatial patterns. Journal of Tropical Ecology, 23, 539-547. Menin, M., Waldez, F. & Lima, A.P. (2011) Effects of environmental and spatial factors on the distribution of anuran species with aquatic reproduction in central Amazonia. Herpetological Journal, 21, 255-261. Mitchell N.J. & Janzen, F.J. (2010) Temperature-dependent sex determination and contemporary climate change. Sexual Development, 4, 129-140. Mullen, L.B., Woods, H.A., Schwartz, M.K., Sepulveda, A.J., Lowe, W.H. (2010) Scale- dependent genetic structure of the Idaho giant salamander (Dicamptodon atterimus) in stream networks. Molecular Ecology, 19, 898-909. Nascimento, D.S. (2014) Filogenia molecular de serpentes neotropicais do grupo Bothrops atrox (Linnaeus, 1758) (Viperidae: Crotalinae). Msc. dissertation. Universidade de Brasília, Brasília.

Nilsson C. & Berggren, K. (2000) Alteration of riparian ecosystems caused by river regulation. BioScience, 50, 783-792. Olmos, F. & Pacheco, J.F. (2003) Rediscovery of Golden-crowned Manakin Lepidothrix vilasboasi. Cotinga, 20, 48-50. Padial, J.M., Miralles, A., de la Riva, I. & M. Vences (2010) The integrative future of taxonomy. Frontiers in Zoology, 7, 16. Pavan, D. (2007) Assembléias de répteis e anfíbios do Cerrado ao longo da bacia do rio Tocantins e o impacto do aproveitamento hidrelétrico da região na sua conservação. Phd. thesis. Universidade de São Paulo, São Paulo. R Development Core Team. (2014) R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. Ribas, C.C., Aleixo, A., Nogueira, A.C.R., Miyaki, C.Y. & Cracraft, J. (2012) A palaeobiogeographic model for biotic diversification within Amazonia over the past three million years. Proceedings of the Royal Society B: Biological Sciences, 279, 681- 689. Rodrigues, M.T. 1980. Descrição de uma nova espécie de Gonatodes da Amazônia (Sauria, Gekkonidae). Papéis Avulsos de Zoologia, 33, 309-314. Ron, S. (2000) Biogeographic area relationships of lowland Neotropical rainforest based on raw distributions of vertebrate groups. Biological Journal of Linnean Society, 71, 379- 402. Rossetti, D.F. (2014) The role of tectonics in the late Quaternary evolution of Brazil’s Amazonian landscape. Earth Science Reviews, 139, 362-389. Schiesari, L., Zuanon, J., Azevedo-Ramos, C., Garcia, M., Gordo, M., Messias, M. & Vieira, E.M. (2003) Macrophyte rafts as dispersal vectors for fishes and amphibians in the Lower Solimões River, Central Amazon. Journal of Tropical Ecology, 19, 333-336. Schietti, J., Emilio, T., Rennó, C.D., Drucker, D.P., Costa, F.R.C., Nogueira, A., Baccaro, F.B., Figueiredo, F., Castilho, C.V., Kinupp, V., Guillaumet, J.L., Garcia, A.R.M. Lima, A.P. & Magnusson, W.E. (2013) Vertical distance from drainage drives floristic composition changes in an Amazonian rainforest. Plant Ecology & Diversity, 6, 1-13. Simões, P.I., Lima, A.P., Magnusson, W.E., Hödl, W. & Amézquita, A. (2008) Acoustic and morphological differentiation in the frog Allobates femoralis: Relationships with the upper Madeira River and other potential geological barriers. Biotropica, 40, 607-614.

Simões, P.I., Stow, A., Hödl, W., Amézquita, A., Farias, I.P. & Lima, A.P. (2014) The value of including intraspecific measures of biodiversity in environmental impact surveys is highlighted by the Amazonian brilliant-thighed frog (Allobates femoralis). Tropical Conservation Science, 7, 811-828. da Silva Jr., N.J. & Sites Jr., J.W. (1995) Patterns of diversity of neotropical squamate reptiles species with emphasis on the Brazilian Amazon and the conservation potential of indigenous reserves. Conservation Biology, 9, 873-901. da Silva, J.M.D., Rylands, A.B. & da Fonseca, G.A.B. (2005) The fate of the Amazonian areas of endemism. Conservation Biology, 19, 689-694. Sioli, H. (1968) Hydrochemistry and geology in the Brazilian Amazon region. Amazoniana, 1, 267-277. Smith, B.T., McCormack, J.E., Cuervo, A.M., Hickerson, M.J., Aleixo, A., Cadena, C.D., Pérez-Emán, J., Burney, C.W., Xie, X., Harvey, M.G., Faircloth, B.C., Glenn, T.C., Derryberry, E.P., Prejean, J., Fields, S. & Brumfield, R.T. (2014) The drivers of tropical speciation. Nature, 515, 406-409. Sombroek, W.G. (2000) Amazon landforms and soils in relation to biological diversity. Acta Amazonica, 30, 81-100. Sombroek, W. (2001) Spatial and temporal patterns of Amazon rainfall - Consequences for the planning of agricultural occupation and the protection of primary forests. Ambio, 30, 388-396. Souza, S.M., Rodrigues, M.T. & Cohn-Haft, M. (2013) Are amazonia rivers biogeographic barriers for lizards? A study on the geographic variation of the spectacled lizard Leposoma osvaldoi Ávila-Pires (Squamata, Gymnophthalmidae). Journal of Herpetology, 47, 511-519. Tuomisto, H. & Ruokolainen, K. (1997) The role of ecological knowledge in explaining biogeography and biodiversity in Amazonia. Biodiversity and Conservation, 6, 347-357 Vannote, R.L., Minshal, G.W., Cummins, K.W., Sedell, J.R. & Cushing, C.E. (1980) The River Continuum Concept. Canadian Journal of Fisheries and Aquatic Sciences, 37, 130-137 Vellend, M. (2010) Conceptual synthesis in community ecology. The Quarterly Review of Biology, 85, 183-206.

Vences, M., Nagy, Z.T., Sonet, G. & Verheyen, E. (2012) DNA barcoding amphibians and reptiles. In: Kress, W.J., & D. L. Erickson (eds.): DNA Barcodes: Methods and Protocols. Springer Protocols Methods in Molecular Biology, 858, 79-107. Vitt, L.J., Souza, R.A., Sartorius, S.S., Ávila-Pires, T.C.S. & Espósito, M.C. (2000) Comparative ecology of sympatric Gonatodes (Squamata: Gekkonidae) in the western Amazon of Brazil. Copeia, 2000, 83-95. Wakeley, J. & Aliacar, N. (2001) Gene genealogies in a metapopulation. Genetics 159, 893- 905. Wallace, A.R. (1852) On the monkeys of the Amazon. Proceedings of the Zoological Society of London, 20, 107-110. Ward J.V. & Stanford, J.A. (1995) The serial discontinuity concept: extending the model to floodplain rivers. Regulated rivers: Research & Management, 10, 159-168. Wittmann, F., Junk, W.J. & Piedade, M.T.F. (2004) The várzea forests in Amazonia: flooding and the highly dynamic geomorphology interact with natural forest succession. Forest Ecology and Management, 196, 199-212. Wollenberg, K.C., Vieites, D.R., Glaw, F. & Vences, M. (2011) Speciation in little: the role of range and body size in the diversification of Malagasy mantellid frogs. BMC Evolutionary Biology, 11, 217. Zuquim, G., Tuomisto, H., Jones, M.M., Prado, J., Figueiredo, F.O.G., Moulatlet, G.M., Costa, F.R.C., Quesada, C.A. & Emilio T. (2014). Predicting environmental gradients with fern species composition in Brazilian Amazonia. Journal of Vegetation Science, 25, 1195-1207.

Table 1. Summary statistical results of distance to water (linear regression) and riverine barriers effects (ANOVA) to changes in species composition of distinct taxa and assemblages, and the main rivers differential barrier strengths (Tukey test). Italicized results are significant (≤0.05). Interfluve barriers: (Tapajós 1) Madeira-Tapajós vs. Tapajós-Xingu; (Tapajós 2) Madeira-Tapajós vs. Tapajós-Jamanxim; (Jamanxim 1) Madeira- Tapajós/Jamanxim vs. Tapajós/Jamanxim-Xingu; (Jamanxim 2) Tapajós-Jamanxim vs. Tapajós/Jamanxim-Xingu.

Distance to Riverine Tapajós Tapajós Jamanxim Jamanxim Groups and Taxa water barrier 1 2 1 2 assemblages F1,13 p F4,18 p p p p p

Total 34.9 0.001 7.6 <0.001 0.001 0.005 0.2 0.9 Non-riparians - - 9.2 <0.001 <0.001 0.003 0.09 0.9 Small streams - - 3.9 0.01 0.02 0.03 0.8 0.8 riparians

Amphibians Large rivers - - 0.9 0.4 - - - - riparians

Lizards 12.5 0.003 7.3 0.001 0.02 0.6 0.004 0.09 Snakes 3.7 0.07 0.7 0.6 - - - - Non-riparians - - 5.8 0.003 0.006 0.02 0.2 0.09

Squamates Riparians - - 0.6 0.6 - - - -

SUPPORTING INFORMATION

Additional Supporting Information may be found in the online version of this article:

Appendix S1. Forest types description. Appendix S2. Integrative taxa identification. Table S1. List of registered species.

BIOSKETCHES

Leandro J.C.L. Moraes is a graduate student in Ecology at the National Institute of Amazonian Research (INPA), and this study is part of his Msc. Dissertation. He is interested in biogeographical patterns and integrated evolutionary history of amphibians/reptiles and landscape in Neotropical region.

Author’s contributions: L.J.C.L.M., D.P. and C.C.R. conceived the idea. L.J.C.L.M. and D.P. collected the data. M.C.B. performed molecular sequencing. L.J.C.L.M, D.P. and C.C.R.

30 analyzed the data. L.J.C.L.M. led the writing and all authors contributed to writing and reviewing the manuscript.

Editor: Şerban Procheş

LIST OF FIGURES LEGENDS

Figure 1. Study area. (a) Location in South America, Brazil, Pará and Amazon Basin. (b) Sampling units, showing the two main rivers and the main interfluves: (M-T) Madeira- Tapajós; (M-T/J) Madeira-Tapajós/Jamanxim; (T-J) Tapajós-Jamanxim; (T-X) Tapajós- Xingu and (T/J-X) Tapajós/Jamanxim-Xingu. (c) Scheme of sampling units, with transect (in black), plots (uniformly distributed in brown and riparian in grey) and pitfall traps (in red). Figure 2. Direct ordination of the relative abundance of amphibians (a) and squamates (b) in relation to distance to water gradient. Note that some species increase in abundance or are restricted to more humid areas (red square). Figure 3. Linear regression for the three main taxonomical groups studied, between the NMDS Axis 1 (species composition) and distance to water, divided in modal distances with three plots agregated: (1) 20-35 m; (2) 36-50 m; (3) 53-62 m;(4) 63-80 m; (5) 82-95 m; (6) 100-150 m; (7) 180-200 m; (8) 250-300 m; (9) 320-380 m; (10) 440- 490 m (11) 500-580 m; (12) 615-700 m; (13) 715-1120 m; (14) 1200-1400 m; (15) 1700-2140 m. Figure 4. Direct ordination of presence-absence data for all survey methods revealing a higher number of amphibians (a) than squamates (b), which are exclusive to one of the main rivers' banks. Sampling units (letters) and interfluves (acronyms) are on the top. Different colours correspond to main interfluves and species written in red are significantly (ANOVA, p≤0.05) more abundant in one interfluve (inside parentheses). Figure 5. NMDS ordinations and composition changes between interfluves for amphibian and squamate assemblages showing the relative riverine barrier strength for these taxa. (a-c) amphibians; (d-f) lizards and (g-i) snakes. Interfluves: (M-T) Madeira-Tapajós; (M-T/J) Madeira-Tapajós/Jamanxim; (T-J) Tapajós-Jamanxim; (T-X) Tapajós-Xingu and (T/J-X) Tapajós/Jamanxim-Xingu. Figure 6. Relative frequency of amphibian (a) and squamate (b) functional groups with distribution patterns indicating a riverine barrier influence. In black are the proportion of species which suffer barrier effect and in gray which do not suffer barrier effect. The total

31 number of species in each category are inside the bars. Micro-habitat: (TE) terrestrial; (FO) fossorial; (AR) arboricole; (AQ) aquatic; (SR) semi-arboricole and (SA) semi-aquatic. Body size: (SM) small; (MD) medium and (LA) large. Activity period: (CR) crepuscular/nocturnal; (DI) diurnal; (NO) nocturnal and (DN) diurnal/nocturnal. Figure 7. NMDS ordinations and composition changes for amphibian and squamate assemblages associated with distinct forest types, clustered by composition variation in relation to distance to water, showing the relative riverine barrier strength. (a-c) Non-riparian amphibians; (d-f) Small stream riparian amphibians; (g-i) Large river riparian amphibians; (j- l) Non-riparian squamates and (m-o) Riparian squamates. Interfluves: (M-T) Madeira- Tapajós; (M-T/J) Madeira-Tapajós/Jamanxim; (T-J) Tapajós-Jamanxim; (T-X) Tapajós- Xingu and (T/J-X) Tapajós/Jamanxim-Xingu.

FIGURES

Figure 2. Direct ordination of the relative abundance of amphibians (a) and squamates (b) in relation to distance to water gradient. Note that some species increase in abundance or are restricted to more humid areas (red square).

Figure 3. Linear regression for the three main taxonomical groups studied, between the NMDS Axis 1 (species composition) and distance to water, divided in modal distances with three plots agregated: (1) 20-35 m; (2) 36-50 m; (3) 53-62 m;(4) 63-80 m; (5) 82-95 m; (6) 100-150 m; (7) 180-200 m; (8) 250-300 m; (9) 320-380 m; (10) 440- 490 m (11) 500-580 m; (12) 615-700 m; (13) 715-1120 m; (14) 1200-1400 m; (15) 1700-2140 m.

Figure 4. Direct ordination of presence-absence data for all survey methods revealing a higher number of amphibians (a) than squamates (b), which are exclusive to one of the main rivers' banks. Sampling units (letters) and interfluves (acronyms) are on the top. Different colours correspond to main interfluves and species written in red are significantly (ANOVA, p≤0.05) more abundant in one interfluve (inside parentheses).

Figure 5. NMDS ordinations and composition changes between interfluves for amphibian and squamate assemblages showing the relative riverine barrier strength for these taxa. (a-c) amphibians; (d-f) lizards and (g-i) snakes. Interfluves: (M-T) Madeira-Tapajós; (M-T/J) Madeira-Tapajós/Jamanxim; (T-J) Tapajós-Jamanxim; (T-X) Tapajós- Xingu and (T/J-X) Tapajós/Jamanxim-Xingu.

Figure 6. Relative frequency of amphibian (a) and squamate (b) functional groups with distribution patterns indicating a riverine barrier influence. In black are the proportion of species which suffer barrier effect and in gray which do not suffer barrier effect. The total number of species in each category are inside the bars. Micro-habitat: (TE) terrestrial; (FO) fossorial; (AR) arboricole; (AQ) aquatic; (SR) semi-arboricole and (SA) semi-aquatic. Body size: (SM) small; (MD) medium and (LA) large. Activity period: (CR) crepuscular/nocturnal; (DI) diurnal; (NO) nocturnal and (DN) diurnal/nocturnal.

Figure 7. NMDS ordinations and composition changes for amphibian and squamate assemblages associated with distinct forest types, clustered by composition variation in relation to distance to water, showing the relative riverine barrier strength. (a-c) Non-riparian amphibians; (d-f) Small stream riparian amphibians; (g-i) Large river riparian amphibians; (j-l) Non-riparian squamates and (m-o) Riparian squamates. Interfluves: (M-T) Madeira-Tapajós; (M-T/J) Madeira-Tapajós/Jamanxim; (T-J) Tapajós-Jamanxim; (T-X) Tapajós-Xingu and (T/J-X) Tapajós/Jamanxim-Xingu.

CONCLUSÕES

 O Médio Rio Tapajós e o Rio Jamanxim possuem contribuição desigual na geração dos padrões de distribuição das assembleias de anfíbios e répteis Squamata nesta região.  O Médio Rio Tapajós é uma barreira mais efetiva para os anfíbios, enquanto o Rio Jamanxim é uma barreira fraca, sendo mais efetiva para os répteis Squamata.  As assembleias de anfíbios e répteis Squamata divergem em relação aos tipos florestais presentes na região (florestas ripárias e de terra firme).  As assembleias que sofrem efeito dos grandes rios como barreira são os anfíbios e répteis Squamata não ripários, e os anfíbios ripários de igarapés. Os anfíbios ripários de igapó e os répteis ripários não sofrem este efeito, indicando uma maior dispersão entre margens. No entanto, para os répteis, a detecção dos padrões reais pode ser influenciada pela baixa detectabilidade das espécies, especialmente de serpentes.  Os anfíbios pequenos, diurnos e terrestes e os répteis pequenos a médios, diurnos e semi-arborícolas são os grupos funcionais especialmente afetados pelos grandes rios como barreira nesta região, especialmente os gêneros de anfíbios Allobates, Adenomera, Pristimantis e Leptodactylus e de répteis Gonatodes. Esta característica é conferida pela baixa capacidade de dispersão destas espécies, evidenciando esses organismos como bons modelo em novos estudos biogeográficos.  Os gradientes ambientais na região do Médio Rio Tapajós geram uma zona de contato faunística, onde assembleias provenientes dos ambientes à Oeste e Leste da Amazônia se encontram. O Rio Tapajós funciona como uma barreira ecológica e física para essas faunas distintas, devido à diferentes restrições ecológicas.  Alterações antrópicas na região, como a construção de usinas hidrelétricas, podem alterar os efeitos naturais dos grandes rios como mecanismos geradores dos padrões de diversidade, assim como extinguir linhagens endêmicas e ambientes relevantes para o ciclo de vida das espécies, especialmente as florestas ripárias. A preservação da integridade fluvial é tão importante quanto a preservação dos ecossistemas florestais.

SUPPORTING INFORMATION

Appendix S1. Forest types description.

We briefly described the principal forest types on study area based in observations along the sampling surveys and literature records. The fluvial dynamic of Tapajós River led to the development and maintenance of two principal forest types: riparian and non-riparian forests. The riparian forests can be further divided into two main types, those that occur on the banks of the large rivers (Igapó) and those occurring along the banks of small streams within the forest (Palm swamp forests):

Non-riparian forest Riparian forest Riparian forest Upland forests Large rivers riparian forests Small streams riparian forests Name in Portuguese Terra firme. Igapó. Açaizal. Location in study Predominant forest type in the region, Mainly on western margin of the Tapajós Homogeneously distributed among interfluves, area1 homogeneously distributed among interfluves. River. Rarer on eastern margin and in the following the course of small streams. banks of the Jamanxim River. Forest type origin1 In the dry land of plateaus and slopes the Flooding period of Tapajós and Jamanxim The water flow is lower and often interrupted by forests do not suffer the direct effect of rivers during the rainy season is essential for fall of organic material from the marginal forest, riverine flood pulse, creating this forest type. nutrients retention in ecosystem and generating a muddy environment dominated by The maintenance of natural patterns of their maintenance of high biomass in their banks as adapted palms. assemblages actively depends on the integrity these are quickly exported downstream due to of adjacent flooded forests, as many species the rapid water flow. The interaction of this use them during its life cycle. flood pulse, rapid water flow and low sediments input create that distinct forest type. Flood pulse Do not suffers. Sazonal, one pulse by year and predictable. Higher, frequent and unpredictable, suffering oscillation1,4 greater effect of local rainfall. Productivity2 Lower. Higher. Higher. Canopy1,3 Tall, non-uniform. Tall, uniform or non-uniform Short, usually uniform. 41

Non-riparian forest Riparian forest Riparian forest Upland forests Large rivers riparian forests Small streams riparian forests Number of strata1,3 Three. Two. One or Two. Solar incidence1 Lower. Higher. Higher, anthropogenic changes by cutting the palms to collect their fruit or palmetto favour the onset of clearing areas. Main typical plant Trees: Bertollethia excelsa, Goupia glabra, Trees: Goupia glabra, Protium spruceanum, Palms: Euterpe oleracea, Socratea exorriza. species3 Jacaranda copaia, Protium paniculatum, Macrolobium acaciifolium, Apeiba echinata, Trees: Mollia lepidota, Protium spruceanum. Carapa guianensis, Apeiba echinata and Paramachaerium ormosioides, Dialium Dialium guianense. Palms: Oenocarpus guianense, Hevea brasiliensis. Palms: distichus, Astrocaryum vulgare, Attalea Oenocarpus distichus, Socratea exorrhiza, speciosa, A. maripa Attalea speciosa, A. maripa.

Main typical Natural water bodies are very rare, which Aquatic breeding species which reproduce in Aquatic breeding species which depends on the amphibian species1 decreases the abundance of aquatic-breeding lakes and marginal channels that arise in the low water flow to reproduce, as Hypsiboas species. Although no amphibian is restrict to dry and beginning of flooding periods in these leucocheilus, H. multifasciata, H. cinerascens, this forest, the abundance of terrestrial or forests, as Leptodactylus petersii, L. Dendropsophus spp., Allobates magnussoni and semi-terrestrial breeding species increase, as mystaceus, Hypsiboas boans, H. A. aff. flaviventris. When the stream runs through Adenomera spp., Allobates spp., Ameerega geographicus, H. calcaratus, Rhinella marina, a rocky channel and the water flow increases, spp. and Pristimantis spp. and those that Rhaebo guttatus, Dendropsophus spp., Scinax abundance of centrolenids known to reproduce in reproduce in water filled trunk cavities, as cruentommus, Osteocephaus taurinus. these environments also increase, as Trachycephalus spp. and Osteocephalus spp. Hyalinobatrachium cappellei and Vitreorana ritae. Main typical Small lizards of forest litter, which prefer the Heliothermic lizards, as Ameiva ameiva, Heliothermic lizards, as Ameiva ameiva, squamate species1 low sunlight input through the canopy, as Tupinambis teguixin, Copeoglossum Kentropyx calcarata or Copeoglossum Chatogekko amazonicus and Pseudogonatodes nigropunctatum. nigropunctatum and semi-aquatic lizards, as cf. guianensis and species of family Potamites ecpleopus, Leposoma spp., Neusticurus Gymnophthalmidae. bicarinatus and Uranoscodon superciliosus. Several snakes forage in these humid regions, following the greater amphibians, lizards and mammals abundance.

Non-riparian forest Riparian forest Riparian forest Upland forests Large rivers riparian forests Small streams riparian forests Images

Photo by Elizângela Brito Photo by Dante Pavan Photo by Dante Pavan

Photo by Leandro Moraes Photo by Dante Pavan Photo by Marina Maximiano

Photo by Leandro Moraes Photo by Dante Pavan Photo by Leandro Moraes

Non-riparian forest Riparian forest Riparian forest Upland forests Large rivers riparian forests Small streams riparian forests

Photo by Dante Pavan Photo by Leandro Moraes

1 Author’s, personal observations; 2 Furch, 1997; 3 Domingues, 2014, 4 Junk et al., 1989.

Appendix S2. Integrative taxa identification.

We adopt the evolutionary species concept (Wiley, 1978) and the integrative approach of taxa identification was realized through several steps in order to delimit units for biogeographical analyses (Padial et al., 2010). The first step performed was the morphological delimitation and taxa were delimited by morphometric and colouration patterns analyses. Simultaneously, we performed acoustic analyses, by comparison of sonograms and spectrograms for amphibians, as well as environmental analyses, such as preferred habitat of the species and behavioral observations. These steps filtered cryptic groups located in taxa delimited by morphological approach. The identification of taxa delimited through these steps was performed with original descriptions, field guides and taxonomic revisions, as well as comparisons with voucher specimens deposited in the collection of amphibians and reptiles at the National Institute for Amazonian Research. Several researchers and taxonomic experts also assisted in identifying the taxa as Pedro Ivo Simões (PUC-RS), José Cassimiro da Silva Junior (USP), Igor Luis Kaefer (UFAM), Vinicius Tadeu de Carvalho (UFAM), Jerriane Oliveira Gomes (MPEG), Marcelo Gordo (UFAM), Miguel Trefaut Urbano Rodrigues (USP), Rafael de Fraga (INPA), Pedro Luis Vieira Peloso (AMNH), Marinus Steven Hoogmoed (MPEG), Paulo Sérgio Bernarde (UFAC), Alfredo Pedroso dos Santos-Jr (PUC-RS), Albertina Pimentel Lima (INPA), Teresa Cristina Ávila-Pires (MPEG), Omar Machado Entiauspe (IFSUL), Diego José Santana Silva (UFMS), Sarah Mângia Barros (UFPB), Rafael O. de Sá (U. Richmond), Renata C. Amaro (USP), Antoine Fouquet (CNRS Guyane), Stefan Lötters (U. Trier), Thiago de Carvalho Kashi (UFU) e Willian Edward Duellman (U. Kansas). If the taxonomic delimitation after analyzing all the data of the previous steps still remained confusing and irresolute, we performed molecular species identification. Among amphibians, molecular data was obtained for the following genera and species groups: Caecilia sp., Allobates sp., Amazophrynella sp., Rhinella gr. margaritifera, Rhinella gr. marina, Pristimantis gr. lacrimosus, Pristimantis gr. conspicillatus, Pristimantis aff. ockendeni, Hemiphractus sp., Dendropsophus gr. microcephalus, Hypsiboas gr. albopunctatus, Hypsiboas aff. boans, Hypsiboas aff. geographicus, Osteocephalus sp., Phyllomedusa gr. hypocondrialis, Scinax gr. ruber, Scinax gr. rostratus, Trachycephalus sp., Adenomera sp., Leptodactylus gr. melanonotus, Leptodactylus gr. pentadactylus e Leptodactylus aff. mystaceus. Among squamates molecular data was used for the following genera and species groups: Chironius sp., Norops gr. chrysolepis, Plica sp. and Cercosaura 45

sp. In total, we obtained sequences of the mtDNA gene coding for the 16S rRNA for 132 individuals. Total DNA was isolated using the phenol-chloroform protocol (Sambrook & Russel, 2001). Amplifications of mtDNA 16S gene region were performed using the primers: L1987-5'GCCTCGCCTGTTTACCAAAAAC3' and H2609-5'CCGGTCTGAACTCAGATC ACGT3' (Palumbi et al., 1991). Sequencing was performed using the Big Dye Terminator sequencing kit (Applied Biosystems) and an automatic DNA sequencer ABI PRISM 3500 (Life Technologies). Sequences from closely related taxa were downloaded from GenBank.

Alignment was performed in CLUSTAL OMEGA (Sievers et al., 2011) and corrected manually, and phylogenetic trees were constructed using maximum likelihood in MEGA 5 (Tamura et al., 2011). Clade support was estimated by bootstrap (1000 replicates). To determine to which lineage within a species complex each individual belong we evaluated bootstrap support and p-distances. The molecular identification was circularly compared with the morphological, acoustic and ecological delimitation, increasing the reliability of distribution patterns See Fig. S1 for an example of this integrative identification, for the genus Allobates.

Figure S1. Example of integrative taxa identification for genus Allobates. (a) taxa are delimited by comparative morphological (a1), acoustic (a2) and ecological (a3) data. In (a3), green dots indicate species that occur preferentially in upland forests and blue dots species of small streams riparian forests. (b) Phylogenetic tree of 16S mtDNA used for molecular delimitation, diferent colours represent distinct lineages with elevated clade support, and taxa recorded in the study are highlighted, located inserted in some of these lineages. These delimitations approaches are cyclically compared, defining the seven taxonomic units for biogeographical analyses.

Table S1. Amphibians and squamates registered in the study area, their relative riverine barrier effect and forests types preference. Survey methods: (AS) Active search; (PT) Pitfall traps and (CE) Casual encounter. Preferred forest type in the study region: (UF) Upland forests, (RF) Riparian forests, (SRF) Small streams riparian forests, (LRF) Large rivers riparian forests, (IP) Indistinct preference and (AQ) Aquatic. Known distribution: (WD) Widely distributed in Amazonia; (EA) Eastern Amazonia; (CAS) Central Amazonia at South of Amazon River, (CWA) Central-western Amazonia, (SA) Widely distributed at South of Amazon river, (DD) Disjunct distribution and (WA) Western Amazonia. Distribution in study area: (WD) Widely distributed, (RE) Restricted to one margin of main rivers and (site N) Only recorded at site N. Restricted to interfluve: (MT) Madeira-Tapajós, (MTJ) Madeira-Tapajós/Jamanxim, (TJ) Tapajós-Jamanxim, (TX) Tapajós-Xingu and (TJX) Tapajós/Jamanxim-Xingu. Activity period: (CR) crepuscular/nocturnal, (DI) diurnal, (NO) nocturnal and (DN) diurnal/nocturnal. Micro- habitat: (TE) terrestrial, (FO) fossorial, (AR) arboricole, (AQ) aquatic, (SR) semi-arboricole and (SA) semi-aquatic. Body size: (SM) small, (MD) medium and (LA) large. Abundance: We consider the number of individuals registered as a measure of abundance, but these numbers are relative to each group due to distinct encounter rates. Amphibians: abundant (n≥100), uncommon (11

Riverine Survey Forest Known Distribution Restricted Activity Micro Body Taxa barrier Abundance (n) Methods type distribution in study area to period habitat size effect Amphibia

Gymnophiona

Caeciliidae

Caecilia tentaculata (Linnaeus 1758) PT, CE IP WD22 WD _ no NO22 FO8,22 LA8 rare (5) Caudata

Plethodontidae

Bolitoglossa tapajonica Brcko et al., 2013 AS, CE UF, SRF CAS23 WD _ no NO8,23 AR23 SM8 uncommon (31) Anura

Allophrynidae

Allophryne ruthvenii Gaige, 1926 AS UF, RF WD1 WD _ no NO8,45 AR8,45 SM8 uncommon (14) Aromobatidae

Allobates femoralis (Boulenger, 1884) PT, AS, CE UF, RF WD1 WD _ no DI8,46 TE8,46 SM8 abundant (476) Allobates masniger (Morales, 2002) PT, AS, CE UF, SRF CAS24 RE MT yes DI8,46 TE8,46 SM8 abundant (211) Allobates magnussoni Simões et al., 2014 PT, AS, CE SRF CAS25 WD _ no DI8,46 TE8,46 SM8 uncommon (69) Allobates tapajos Lima, Simões & Kaefer, 2015 PT, AS, CE UF, RF ? WD _ no DI8,46 TE8,46 SM8 uncommon (89) Allobates cf. crombiei PT, AS, CE UF, SRF EA26 RE TX yes DI8,46 TE8,46 SM8 abundant (182) Allobates aff. flaviventris PT, AS SRF CWA25 RE MT yes DI8,46 TE8,46 SM8 uncommon (23) Allobates sp. AS, CE UF, SRF ? site J _ _ DI8,46 TE8,46 SM8 rare (5) Bufonidae

Amazophrynella vote Ávila et al., 2012 PT, AS, CE UF, RF CAS27 WD _ no DI8,46 TE8,46 SM8 abundant (556) Amazophrynella sp. AS SRF ? site J _ _ DI8,46 TE8,46 SM8 uncommon (17)

Riverine Survey Forest Known Distribution Restricted Activity Micro Body Taxa barrier Abundance (n) Methods type distribution in study area to period habitat size effect Atelopus sp. PT, AS, CE UF, SRF ? RE TX yes DI8,46 TE8,46 SM8 uncommon (12) Rhaebo guttatus (Schneider, 1799) PT, AS, CE UF, RF WD1 WD _ no NO8,46 TE8,46 LA8 uncommon (64) Rhinella magnussoni Lima, Menin & Araújo, 2007 PT, AS, CE UF, SRF CAS28 WD _ no DI8,46 TE8,46 MD8 abundant (535) Rhinella marina (Linnaeus, 1758) PT, AS, CE UF, RF WD1 WD _ no NO8,46 TE8,46 LA8 uncommon (84) Rhinella gr. margaritifera1 PT, AS, CE UF, SRF ? WD _ no DI8,46 TE8,46 LA8 uncommon (95) Rhinella gr. margaritifera2 PT, AS, CE UF, SRF ? WD _ no DI8,46 TE8,46 LA8 abundant (461) Rhinella gr. margaritifera3 PT, AS UF, SRF ? RE MT yes DI8,46 TE8,46 MD8 rare (3) Centrolenidae

Hyalinobatrachium cappellei Van Lidth de Jeude, 1904 AS, CE SRF WD29 WD _ no NO8,45 AR8,45 SM8 uncommon (60) Vitreorana ritae (Lutz, 1952) AS, CE SRF WD1 site J _ _ NO8,45 AR8,45 SM8 rare (6) Ceratophryidae

Ceratophrys cornuta (Linnaeus, 1758) PT, AS, CE UF, RF WD1 WD _ no NO8,46 TE8,46 MD8 uncommon (29) Craugastoridae Pristimantis reichlei Padial & De la Riva, 2009 PT, AS, CE UF, SRF WA30 RE TX yes CR8,47 TE8,47 SM8 abundant (120) Pristimantis gr. conspicillatus1 PT, AS, CE UF, RF ? RE MT yes CR8,47 TE8,47 SM8 abundant 446) Pristimantis gr. conspicillatus2 PT, AS, CE UF, RF ? RE TX yes CR8,47 TE8,47 SM8 abundant (2145) Pristimantis gr. lacrimosus1 AS, CE UF, SRF ? WD _ no CR8,47 AR8,47 SM8 uncommon (28) Pristimantis gr. lacrimosus2 AS, CE IP ? site C _ _ CR8,47 AR8,47 SM8 uncommon (22) Pristimantis gr. lacrimosus3 AS, CE SRF ? RE TX yes CR8,47 AR8,47 SM8 rare (2) Pristimantis sp1 AS, CE UF, SRF ? RE MTJ no8 CR8,47 TE8,47 SM8 rare (5) Pristimantis sp2 AS IP ? site D _ _ _ _ _ rare (1) Pristimantis sp3 AS, CE UF, RF ? WD _ no CR8,47 TE8,47 SM8 uncommon (68) Odontophrynidae

Proceratophrys concavitympanum Giaretta et al., 2000 AS IP CAS31 site J _ _ NO8,31 TE8,31 MD8 rare (3) Dendrobatidae

Adelphobates galactonotus (Steindachner, 1864) PT, AS, CE UF, RF EA1 RE TX yes DI8,46 TE8,46 SM8 abundant (192) Ameerega hahneli (Boulenger, 1884) AS, CE UF, RF WD1 site D _ _ DI8,46 TE8,46 SM8 rare (6) Ameerega trivitatta (Spix, 1824) PT, AS, CE UF, SRF WD1 RE MT yes DI8,46 TE8,46 SM8 abundant (214) Ranitomeya amazonica (Schulte, 1999) AS, CE IP DD32 RE TJX yes DI8,46 AR8,46 SM8 rare (4) Eleutherodactylidae

Adelophryne sp. PT, AS, CE UF, SRF ? RE MT yes DI8 TE8 SM8 uncommon (63) Hemiphractidae

Riverine Survey Forest Known Distribution Restricted Activity Micro Body Taxa barrier Abundance (n) Methods type distribution in study area to period habitat size effect Hemiphractus scutatus (Spix, 1824) AS, CE UF, SRF WA1 RE MT yes NO8,46 TE8,46 MD8 rare (3) Hylidae

Cruziohyla craspedopus (Funkhouser, 1957) CE IP WD33 site B _ _ NO8,46 AR8,46 MD8 rare (2) Dendropsophus bokermanni (Goin, 1960) AS, CE LRF WA1 RE MT yes NO8,46 AR8,46 SM8 uncommon (16) Dendropsophus leucophyllatus (Beireis, 1783) AS, CE RF WD1 WD _ no NO8,46 AR8,46 SM8 uncommon (27) Dendropsophus minutus (Peters, 1872) AS, CE IP WD1 site C _ _ _ _ _ rare (1) Dendropsophus ozzyi Orrico et al., 2014 AS, CE SRF CAS34 RE MT yes NO8,46 AR8,46 SM8 rare (2) Dendropsophus gr. microcephalus1 AS, CE RF ? WD _ no NO8,46 AR8,46 SM8 abundant (187) Dendropsophus gr. microcephalus2 AS, CE RF ? WD _ no NO8,46 AR8,46 SM8 uncommon (63) Dendropsophus gr. microcephalus3 AS IP ? site C _ _ _ _ _ rare (1) Dryaderces sp. AS IP ? site E _ _ _ _ _ rare (1) Hypsiboas boans (Linnaeus, 1758) AS, CE LRF WD1 WD _ no NO8,46 AR8,46 LA8 abundant (170) Hypsiboas calcaratus (Troschel, 1848) AS, CE LRF WD1 WD _ no NO8,46 AR8,46 MD8 uncommon (13) Hypsiboas cinerascens (Spix, 1824) AS, CE RF WD1 WD _ no NO8,46 AR8,46 SM8 abundant (318) Hypsiboas fasciatus (Günther, 1858) AS, CE LRF WD1 WD _ no NO8,46 AR8,46 SM8 uncommon (47) Hypsiboas geographicus (Spix, 1824) AS, CE LRF WD1 WD _ no NO8,46 AR8,46 MD8 rare (6) Hypsiboas leucocheilus (Caramaschi & Niemeyer, 2003) AS, CE SRF CAS35 RE MT yes NO8,46 AR8,46 MD8 uncommon (71) Hypsiboas multifasciatus (Günther, 1859) AS, CE SRF EA1 RE TX yes NO8,46 AR8,46 MD8 abundant (208) Hypsiboas sp1 AS, CE SRF ? WD _ no NO8,46 AR8,46 MD8 uncommon (27) Hypsiboas sp2 AS, CE SRF ? WD _ no NO8,46 AR8,46 MD8 uncommon (14) Osteocephalus buckleyi (Boulenger, 1882) AS, CE SRF WD1 WD _ no NO8,46 AR8,46 SM8 uncommon (41) Osteocephalus leprieurii(Duméril and Bibron, 1841) AS, CE UF, RF WD1 WD _ no NO8,46 AR8,46 SM8 abundant (156) Osteocephalus taurinus Steindachner, 1862 AS, CE UF, RF WD36 WD _ no NO8,46 AR8,46 LA8 abundant (287) Osteocephalus gr. taurinus AS, CE UF, RF WD36 WD _ no NO8,46 AR8,46 MD8 abundant (805) Phyllomedusa hypochondrialis (Daudin, 1800) AS, CE UF, RF EA37 WD _ no NO8,46 AR8,46 SM8 uncommon (86) Phyllomedusa tomopterna (Cope, 1868) CE UF, RF WD1 WD _ no NO8,46 AR8,46 SM8 rare (2) Phyllomedusa vaillanti Boulenger, 1882 AS, CE UF, RF WD1 WD _ no NO8,46 AR8,46 MD8 abundant (101) Scinax cruentommus (Duellman, 1972) AS, CE LRF WA1 RE MT yes NO8,46 AR8,46 SM8 uncommon (28) Scinax garbei (Miranda-Ribeiro, 1926) AS, CE UF, RF WD1 WD _ no NO8,46 AR8,46 SM8 uncommon (12) Scinax gr. ruber CE LRF WD1 WD _ no NO8,46 AR8,46 SM8 rare (8) Trachycephalus coriaceus (Peters, 1867) AS UF WD1 RE TX no1 NO8,46 AR8,46 LA8 rare (2) Trachycephalus cunauaru Gordo et al., 2013 AS, CE UF WD38 WD _ no NO8,46 AR8,38 LA8 abundant (398)

Riverine Survey Forest Known Distribution Restricted Activity Micro Body Taxa barrier Abundance (n) Methods type distribution in study area to period habitat size effect Trachycephalus helioi Nunes et al., 2013 AS, CE UF CAS39 WD _ no NO8,46 AR8,39 LA8 abundant (303) Leptodactylidae

Adenomera andreae (Müller, 1923) PT, AS, CE UF, RF WD41 WD _ no DI8,41 TE8,41 SM8 abundant (2822) Adenomera sp1 PT, AS, CE UF, SRF CAS41 RE MT yes DI8,41 TE8,41 SM8 rare (3) Adenomera sp2 PT, AS, CE UF, SRF EA41 RE TX yes DI8,41 TE8,41 SM8 abundant (164) Engystomops freibergi (Donoso-Barros, 1969) PT, AS, CE UF, RF SA40 WD _ no NO8,40 TE8,40 SM8 abundant (583) Leptodactylus knudseni Heyer, 1972 AS UF WA42 RE MT yes NO8,42 TE8,42 LA8 rare (3) Leptodactylus leptodactyloides (Andersson, 1945) AS,CE SRF DD42 RE TX yes NO8,42 TE8,42 SM8 uncommon (28) Leptodactylus mystaceus (Spix, 1824) PT, AS, CE UF, RF WD42 WD _ no NO8,42 TE8,42 SM8 abundant (110) Leptodactylus paraensis Heyer, 2005 PT, AS, CE UF EA42 RE TX yes NO8,42 TE8,42 LA8 rare (4) Leptodactylus pentadactylus (Laurenti, 1768) PT, AS, CE RF WD42 WD _ no NO8,42 TE8,42 LA8 abundant (152) Leptodactylus petersii (Steindachner, 1864) PT, AS, CE RF WD42 WD _ no NO8,42 TE8,42 SM8 uncommon (56) Leptodactylus rhodomystax Boulenger, 1884 PT, AS, CE UF, RF WD42 WD _ no NO8,42 TE8,42 MD8 uncommon (79) Leptodactylus stenodema Jiménez de la Espada, 1875 CE IP WA42 site G _ _ _ _ _ rare (1) Leptodactylus sp1 PT, AS, CE UF ? WD _ no NO8 TE8 LA8 abundant (173) Leptodactylus sp2 AS IP ? site J _ _ _ _ _ rare (1) Lithodytes lineatus (Schneider, 1799) PT, AS, CE UF WD1 WD _ no NO8,46 TE8,46 MD8 uncommon (49) Microhylidae

Chiasmocleis avilapiresae Peloso and Sturaro, 2008 PT, AS, CE UF, RF SA43 WD _ no NO8,43 FO8,43 SM8 uncommon (34) Chiasmocleis bassleri Dunn, 1949 PT, AS UF, RF WA43 RE MT yes NO8,43 FO8,43 SM8 rare (5) Chiasmocleis hudsoni Parker, 1940 PT, AS, CE UF, RF WD43 WD _ no NO8,43 FO8,43 SM8 uncommon (63) Ctenophryne geayi Mocquard, 1904 PT, AS UF, RF WD44 WD _ no NO8,46 FO8,46 MD8 abundant (142) Hamptophryne boliviana (Parker, 1927) PT, AS UF, RF WD1 RE TJX no1 NO8,46 FO8,46 SM8 rare (3) Synapturanus sp. AS UF ? RE MT yes NO8,46 FO8,46 SM8 uncommon (11) Pipidae

Pipa arrabali Izecksohn, 1976 PT, AS, CE AQ DD1 RE TJ no1 NO8,46 AQ8,46 SM8 rare (8) Pipa pipa (Linnaeus, 1758) AS, CE AQ WD1 WD _ no NO8,46 AQ8,46 LA8 rare (8)

Riverine Survey Forest Known Distribution Restricted Activity Micro Body Taxa barrier Abundance (n) Methods type distribution in study area to period habitat size effect Reptilia

Squamata

Amphisbaenidae

Amphisbaena amazonica Vanzolini 1951 PT, CE IP WD4 RE MT no4 NO8,46 FO8,46 MD8 rare (3) Amphisbaena sp1 PT IP ? RE MTJ no7 NO8,46 FO8,46 MD8 rare (2) Amphisbaena sp2 AS, CE IP ? WD _ no NO8,46 FO8,46 SM8 rare (3) Aniliidae

Anilius scytale (Linnaeus, 1758) AS, CE UF, RF WD3 RE TX no3 NO8,16 FO8,16 LA8 rare (3) Boidae

Boa constrictor (Linnaeus, 1758) CE UF, RF WD3 RE MTJ no3 NO8,16 TE8,16 LA8 rare (2) Corallus batesii (Gray, 1860) AS, CE UF SA5 RE MT no5 NO8,16 AR8,16 LA8 rare (3) Corallus hortulanus (Linnaeus, 1758) AS, CE UF, RF WD3 WD _ no NO8,16 AR8,16 LA8 abundant (25) Epicrates cenchria (Linnaeus, 1758) AS, CE UF, RF WD3 RE MTJ no3 NO8,16 SR8,16 LA8 uncommon (6) Eunectes murinus (Linnaeus, 1758) CE RF, AQ WD3 site B _ _ _ _ _ rare (1) Colubridae

Apostolepis sp. CE UF ? site E _ _ _ _ _ rare (1) Atractus latifrons (Günther, 1868) PT UF WD3 site G _ _ _ _ _ rare (1) Atractus major Boulenger, 1894 PT, AS UF, RF WD3 RE TX no3 NO8,16 FO8,16 MD8 rare (2) Atractus snethlagae Cunha & Nascimento, 1983 AS, CE UF, RF WD3 RE MTJ no3 NO8,16 FO8,16 MD8 rare (2) Atractus cf. schach PT, CE UF, RF ? RE TJX no3 NO8,16 FO8,16 MD8 rare (3) Chironius fuscus (Linnaeus, 1758) PT, AS, CE UF, RF WD3 WD _ no DI8,16 TE8,16 LA8 abundant (17) Chironius multiventris Schmidt & Walker, 1943 AS, CE UF, RF WD3 WD _ no DI8,16 SR3,8 LA8 uncommon (6) Chironius scurrulus (Wagler, 1824) AS, CE UF, RF WD3 RE MTJ no3 DI8,16 TE8,16 LA8 rare (4) Dendrophidion dendrophis (Schlegel, 1837) CE UF WD3 WD _ no DI8,16 TE8,16 MD8 rare (2) Dipsas catesbyi (Sentzen, 1796) AS, CE UF, RF WD9 WD _ no NO8,9 SR8,9 MD8 abundant (23) Dipsas pavonina Schlegel, 1837 AS, CE UF, RF DD9 RE TX yes NO8,9 SR8,9 MD8 uncommon (9) Drepanoides anomalus (Jan, 1863) PT, AS, CE UF, RF WD3 WD _ no NO8,16 TE8,16 MD8 abundant (15) Drymarchon corais (Boie, 1827) AS, CE UF, RF WD16 WD _ no DI8,16 TE8,16 LA8 rare (3) Drymoluber dichrous (Peters, 1863) AS, CE UF, RF WD10 WD _ no DI8,16 TE8,16 LA8 abundant (17) Erythrolamprus aesculapii (Linnaeus, 1766) CE UF, RF WD3 site J _ _ _ _ _ rare (1) Erythrolamprus breviceps (Cope, 1860) PT, CE UF, RF WD3 RE TX no3 DI8,48 TE8,48 MD8 rare (3) Erythrolamprus oligolepis (Boulenger, 1905) PT UF, RF SA18 RE MT no18 DI8,48 TE8,48 MD8 rare (3)

Riverine Survey Forest Known Distribution Restricted Activity Micro Body Taxa barrier Abundance (n) Methods type distribution in study area to period habitat size effect Erythrolamprus reginae (Wagler, 1824) PT, AS, CE UF, RF WD3 WD _ no DI8,48 TE8,48 MD8 abundant (17) Erythrolamprus typhlus (Linnaeus, 1758) PT, AS, CE UF, RF WD3 WD _ no DI8,48 TE8,48 MD8 abundant (14) Helicops angulatus (Linnaeus, 1758) AS, CE RF, AQ WD3 WD _ no DN8,16 AQ8,16 MD8 abundant (15) Helicops polylepis Günther, 1861 AS, CE RF, AQ WD16 WD _ no DN8,16 AQ8,16 MD8 rare (3) Hydrodynastes bicinctus (Herrmann, 1804) CE RF, AQ WD16 site B _ _ DI8,16 AQ8,16 LA8 rare (2) Hydrops martii (Wagler, 1824) CE AQ WD3 site B _ _ NO8,16 AQ8,16 LA8 rare (2) Hydrops triangularis (Wagler, 1824) CE AQ WD12 RE MT no3 NO8,12 AQ8,12 MD8 rare (2) Imantodes cenchoa (Linnaeus, 1758) AS, CE UF, RF WD3 WD _ no NO8,16 AR8,16 MD8 abundant (38) Imantodes lentiferus (Cope, 1894) AS, CE UF, RF WD16 WD _ no NO8,16 AR8,16 MD8 rare (4) Leptodeira annulata (Linnaeus, 1758) PT, AS, CE UF, RF WD3 WD _ no NO8,16 SR8,16 MD8 abundant (16) Leptophis ahaetulla (Linnaeus, 1758) CE UF, RF WD3 WD _ no DI8,16 SR8,16 MD8 rare (2) Mastigodryas boddaerti (Sentzen, 1796) AS, CE UF, RF WD3 WD _ no DI8,16 TE8,16 MD8 uncommon (6) Oxyrhopus formosus (Wied, 1820) PT, AS, CE UF, RF WD16 WD _ no NO8,16 SR8,16 MD8 abundant (11) Oxyrhopus melanogenys (Tschudi, 1845) PT, AS, CE RF WD16 WD _ no NO8,16 TE8,16 MD8 abundant (19) Oxyrhopus petolarius Reuss, 1834 AS UF, RF WD16 site C _ _ _ _ _ rare (1) Philodryas argentea (Daudin, 1803) AS, CE UF, RF WD3 WD _ no DI8,16 SR8,16 MD8 abundant (19) Pseudoboa coronata Schneider, 1801 PT IP WD3 site I _ _ _ _ _ rare (1) Phrynonax polylepis (Peters, 1867) AS, CE UF, RF WD3 WD _ no DI8,16 TE8,16 LA8 rare (5) Rhynobothrium lentiginosum (Scopoli, 1785) AS, CE UF, RF WD11 WD _ no NO8,16 TE8,16 LA8 rare (4) Siphlophis cervinus (Laurenti, 1768) AS, CE UF, RF WD3 RE TJX no3 NO8,16 SR8,16 MD8 rare (2) Siphlophis compressus (Daudin, 1803) PT, AS, CE UF, RF WD3 WD _ no NO8,16 SR8,16 MD8 abundant (27) Siphlophis worontzowi (Prado, 1940) CE RF WD17 site B _ _ _ _ _ rare (1) Spilotes pullatus (Linnaeus, 1758) CE UF, RF WD3 site J _ _ _ _ _ rare (1) Spilotes sulphureus (Wagler, 1824) CE UF WD3 site E _ _ _ _ _ rare (1) Taeniophallus brevirostris (Peters, 1863) PT UF WD3 site B _ _ _ _ _ rare (1) Taeniophallus quadriocellatus Santos-Jr et al., 2008 PT, AS UF, RF EA19 WD _ no DN8,19 TE8,19 MD8 rare (3) Taeniophallus sp. PT UF, RF ? site A _ _ DN8,19 TE8,19 MD8 rare (2) Tantilla melanocephala (Linnaeus, 1758) PT, AS, CE UF, RF WD3 RE MTJ no3 DN8,16 TE8,16 MD8 uncommon (7) Thamnodynastes cf. pallidus (Linnaeus, 1758) AS,CE UF, SRF EA16 RE TJX yes NO8,16 SR8,16 MD8 uncommon (9) Xenopholis scalaris (Wucherer, 1861) PT, AS, CE UF, RF WD3 WD _ no NO8,16 TE8,16 SM8 abundant (17) Dactyloidae

Dactyloa phyllorhina (Myers & Carvalho, 1945) PT IP CAS2 site I _ _ _ _ _ rare (1)

Riverine Survey Forest Known Distribution Restricted Activity Micro Body Taxa barrier Abundance (n) Methods type distribution in study area to period habitat size effect Dactyloa punctata (Daudin, 1802) PT, AS, CE UF, RF WD2 WD _ no DI2,8 AR2,8 MD8 uncommon (13) Norops fuscoauratus (D'Orbigny, 1837) PT, AS, CE UF, RF WD2 WD _ no DI2,8 AR2,8 SM8 abundant (86) Norops ortonii (Cope, 1868) PT, AS, CE UF, RF WD2 WD _ no DI2,8 AR2,8 SM8 rare (8) Norops tandai (Ávila-Pires, 1995) PT, AS, CE UF, RF CAS2 RE MT yes DI2,8 AR2,8 SM8 abundant (96) Norops trachyderma (Cope, 1875) PT, AS, CE UF, RF DD2 WD _ no DI2,8 AR2,8 SM8 abundant (211) Elapidae

Micrurus hemprichii (Jan, 1858) PT, AS, CE UF, RF WD3 WD _ no NO8,16 TE8,16 MD8 abundant (27) Micrurus lemniscatus (Linnaeus, 1758) AS, CE RF WD3 WD _ no NO8,16 SA8,16 LA8 uncommon (7) Micrurus paraensis Cunha & Nascimento, 1973 AS, CE UF, RF EA20 WD _ no NO8,16 TE8,16 MD8 rare (3) Micrurus surinamensis (Cuvier, 1817) AS, CE UF, RF WD3 RE MTJ no3 NO8,16 SA8,16 LA8 rare (2) Gymnophthalmidae

Alopoglossus angulatus (Linnaeus, 1758) PT, CE UF, RF WD2 WD _ no DI2,8 TE2,8 SM8 rare (6) Arthrosaura reticulata (O'Shaughnessy, 1881) PT, AS, CE UF, RF WD2 WD _ no DI2,8 TE2,8 SM8 uncommon (24) Bachia flavescens (Bonnaterre, 1789) PT UF WD2 WD _ no DI2,8 FO2,8 SM8 rare (2) Cercosaura argulus Peters, 1863 PT, CE UF WD13 site J _ _ DI2,8 TE2,8 SM8 rare (3) Cercosaura ocellata Wagler, 1830 PT, AS, CE UF, RF WD14 WD _ no DI2,8 TE2,8 SM8 abundant (67) Cercosaura sp. PT, AS, CE UF, RF ? WD _ no DI8 TE8 SM8 uncommon (19) Iphisa elegans Gray, 1851 PT, AS, CE UF, SRF WD2 WD _ no DI2,8 TE2,8 SM8 abundant (105) Leposoma osvaldoi Ávila-Pires, 1995 PT, AS, CE SRF CAS2 WD _ no DI2,8 TE2,8 SM8 abundant (87) Neusticurus bicarinatus (Linnaeus, 1758) AS SRF WD2 site J _ _ _ _ _ rare (1) Potamites ecpleopus Cope, 1876 PT, AS, CE SRF DD2 RE TX yes DI2,8 SA2,8 SM8 abundant (50) Ptychoglossus brevifrontalis Boulenger, 1912 PT, AS, CE UF WD2 WD _ no DI2,8 TE2,8 SM8 uncommon (26) Rondonops biscutatus Colli et al., 2015 PT IP ? site G _ _ _ _ _ rare (1) Iguanidae

Iguana iguana (Linnaeus, 1758) AS, CE LRF WD2 WD _ no DI2,8 SR2,8 LA8 rare (4) Leiosauridae

Enyalius leechii (Boulenger, 1885) PT, AS UF EA2 RE TX yes DI2,8 SR2,8 MD8 rare (4) Leptotyphlopidae

Trilepida macrolepis (Peters, 1857) AS, CE UF, RF WD16 WD _ no NO8,16 FO8,16 MD8 rare (4) Phyllodactylidae

Thecadactylus rapicauda (Houttuyn, 1782) AS, CE UF, RF WD2 WD _ no NO2,8 AR2,8 MD8 uncommon (35)

Riverine Survey Forest Known Distribution Restricted Activity Micro Body Taxa barrier Abundance (n) Methods type distribution in study area to period habitat size effect Polychrotidae

Polychrus marmoratus (Linnaeus, 1758) AS IP WD2 site J _ _ _ _ _ rare (1) Scincidae

Copeoglossum nigropunctatum (Spix, 1825) PT, AS, CE UF, RF WD2 WD _ no DI2,8 SR2,8 SM8 abundant (121) Sphaerodactylidae

Chatogekko amazonicus (Andersson, 1918) PT, AS, CE UF WD2 WD _ no DI2,8 TE2,8 SM8 abundant (170) Gonatodes hasemani Griffin, 1917 PT, AS, CE UF, RF WA2 RE MT yes DI2,8 SR2,8 SM8 rare (4) Gonatodes humeralis (Guichenot, 1855) PT, AS, CE UF, RF WD2 WD _ no DI2,8 SR2,8 SM8 abundant (449) Gonatodes tapajonicus Rodrigues, 1980 PT, AS, CE UF, SRF CAS2 RE TJX yes DI2,8 SR2,8 SM8 abundant (118) Pseudogonatodes cf. guianensis Parker, 1935 PT, AS UF WD2 RE MTJ no2 DI2,8 TE2,8 SM8 uncommon (14) Teiidae

Ameiva ameiva (Linnaeus, 1758) PT, AS, CE UF, RF WD2 WD _ no DI2,8 TE2,8 MD8 abundant (429) Kentropyx calcarata Spix, 1825 PT, AS, CE UF, RF WD2 WD _ no DI2,8 TE2,8 MD8 abundant (593) Tupinambis longilineus Ávila-Pires, 1995 AS IP CAS15 site E _ _ DI2,8 TE2,8 LA8 rare (2) Tupinambis teguixin (Linnaeus, 1758) PT, AS, CE LRF WD2 RE MTJ no2 DI2,8 TE2,8 LA8 rare (9) Tropiduridae

Plica plica (Linnaeus, 1758) PT, AS, CE UF, RF WD2 WD _ no DI2,8 AR2,8 MD8 abundant (51) Plica umbra (Linnaeus, 1758) PT, AS, CE UF, RF WD2 WD _ no DI2,8 AR2,8 MD8 uncommon (39) Uranoscodon superciliosus (Linnaeus, 1758) PT, AS, CE RF WD2 WD _ no DI2,8 AR2,8 MD8 uncommon (26) Typhlopidae

Amerotyphlops reticulatus (Linnaeus, 1758) PT, CE UF WD3 WD _ no NO8,16 FO8,16 MD8 uncommon (6) Viperidae

Bothrops atrox (Linnaeus, 1758) AS, CE RF WD3 WD _ no NO8,16 TE8,16 LA8 abundant (57) Bothrops bilineata (Wied, 1821) AS, CE UF SA21 WD _ no NO8,16 AR8,16 MD8 rare (3) Bothrops taeniata (Wagler, 1824) AS, CE UF SA6 RE MTJ no6 NO8,16 SR8,16 LA8 rare (4) Lachesis muta (Linnaeus, 1766) AS, CE UF WD3 RE MTJ no3 NO8,16 TE8,16 LA8 rare (3)

References: 1 Frost, 2015; 2 Ávila-Pires, 1995; 3 Fraga et al., 2013; 4 Gans, 2005; 5 Henderson et al., 2009; 6 Souza et al., 2013; 7 Jerriane Gomes, pers. comm.; 8 Authors, personal observations; 9 Lima & Prudente, 2009; 10 Caldeira-Costa et al., 2013; 11 Arruda et al., 2015; 12 Albuquerque & de Lema, 2008; 13 Freitas et al., 2013; 14 Sales et al., 2014; 15 Caldeira-Costa et al., 2008; 16 Wallach et al., 2014; 17 Dal Vechio et al., 2015; 18 França et al., 2013; 19 Santos Jr. et al., 2008; 20 Feitosa et al., 2007; 21 Bernarde et al., 2011; 22 Maciel & Hoogmoed, 2011; 23 Brcko et al., 2013; 24 Tsuji-Nishikido et al., 2012; 25 Lima et al., 2014; 26 Lima et al., 2012; 27 Ávila et al., 2012; 28 Lima et al., 2007; 29 Noronha et al., 2012; 30 Padial & De la Riva, 2009;

31 Bernardo et al., 2012; 32 Brown et al., 2011; 33 Bitar et al., 2015; 34 Orrico et al., 2014; 35 Pansonato et al., 2011; 36 Jungfer et al., 2013; 37 Bruschi et al., 2013; 38 Gordo et al., 2013; 39 Nunes et al., 2013; 40 Funk et al., 2008; 41 Fouquet et al., 2014; 42 Sá et al., 2014; 43 Peloso et al., 2014; 44 Freitas et al., 2014, 45 Guayasamin et al., 2009, 46 Pough et al., 2015, 47 Lynch & Duellmann, 1997, 48Dixon, 1989.

REFERENCES

Albuquerque, N.R. & de Lema, T. (2008) Taxonomic revision of the Neotropical water snake Hydrops triangularis (Serpentes, Colubridae). Zootaxa, 1685, 55-66. Arruda, L.A.G, Carvalho, M.A. & Kawashita-Ribeiro, R.A. (2015) New records of the Amazon banded snake Rhinobothryum lentiginosum (Serpentes: Colubridae) from Mato Grosso State, Brazil, with natural history notes. Salamandra, 51, 199-205. Ávila, R.W., Carvalho, V.T., Gordo, M., Kawashita-Ribeiro R.A. & Morais, D.H. (2012) A new species of Amazophrynella (Anura: Bufonidae) from southern Amazonia. Zootaxa, 3484, 65-74. Ávila-Pires, T.C.S. (1995) Lizards of Brazilian Amazonia (Reptilia: Squamata). Zoologische Verhandelingen, 299, 1-706. Bernarde, P.S., Costa, H.C., Machado R.A. & São-Pedro, V.A. (2011) Bothriopsis bilineata bilineata (Wied, 1821) (Serpentes: Viperidae): New records in the states of Amazonas, Mato Grosso and Rondônia, northern Brazil. Check List, 7, 343-347. Bernardo, P.H., Matiazzi, W. & Guerra-Fuentes, A. (2012) Distribution extention and distribution map of Chiasmocleis jimi Caramaschi and Cruz 2002 (Amphibia: Anura: Microhylidae) and Proceratophrys concavitympanum Giaretta, Bernarde and Kokubum, 2000 (Amphibia: Anura: Cycloramphidae). Check List, 8, 152-154. Bitar, Y.O.C, Silva, K.R.A., Filho, H.F.S. & Pinheiro, L.C. (2015) Amphibia, Anura, Hylidae, Cruziohyla craspedopus (Funkhouser, 1957): distribution extension and first record from the state of Pará, Brazil. Check List, 11, 1-2. Brcko, I.C., Hoogmoed, M.S. & Neckel-Oliveira, S. (2013) Taxonomy and distribution of the salamander genus Bolitoglossa Duméril, Bibron & Duméril, 1854 (Amphibia, Caudata, Plethodontidae) in Brazilian Amazonia. Zootaxa 3686, 401-431. Bruschi, D.P., Busin, C.S., Toledo, L.F., Vasconcellos, G.A., Strussmann, C., Weber, L.N., Lima, A.P., Lima, J.D. & Recco-Pimentel, S.M. (2013) Evaluation of the taxonomic status of populations assigned to Phyllomedusa hypochondrialis (Anura, Hylidae, Phyllomedusinae) based on molecular, chromosomal, and morphological approach. BMC Genetics, 14, 1-14. Brown, J.L., Twomey, E., Amézquita A., de Souza, M.B., Caldwell, J.P., Lötters, S., von May, R., Melo-Sampaio, P.R., Mejía-Vargas, D., Pérez-Peña, P.E., Pepper, M., Poelman, E.H., Sanchez-Rodriguez, M. & Summers, K. (2011) A taxonomic revision of

the Neotropical poison frog genus Ranitomeya (Amphibia: Dendrobatidae). Zootaxa, 3083, 1-120. Caldeira-Costa, H., São Pedro, V.A., Péres Jr, A.K. & Feio, R.N. (2008) Reptilia, Squamata, Teiidae, Tupinambis longilineus: Distribution extension. Check List, 4, 267-268. Caldeira-Costa, H., Moura, M.R. & Feio, R.N. (2013) Taxonomic revision of Drymoluber Amaral, 1930 (Serpentes: Colubridae). Zootaxa 3716, 349-394. Dal Vechio, F., Junior, M.T., Neto, A.M. & Rodrigues, M.T. (2015) On the snake Siphlophis worontzowi (Prado, 1940): notes on its distribution, diet and morphological data. Checklist, 11, 1-5 Dixon, J.R. (1989) A key and checklist to the neotropical snake genus Liophis, with country list and maps. Smithsonian Herpetological Information Service, 79, 1-40. Domingues, M.J. (2014) Flora da AID. In: Estudo de impacto ambiental – EIA, AHE São Luiz do Tapajós. CNEC WorleyParsons. São Paulo, SP. Feitosa, D.T., Prudente, A.L.C. & Lima, A.C. (2007): Redescription and variation of Micrurus paraensis Cunha & Nascimento 1973 (Serpentes, Elapidae). Zootaxa, 1470, 35-45. Fouquet, A., Cassini, C.S., Haddad, C.F.B., Pech, N. & Rodrigues, M.T. (2014) Species delimitation, patterns of diversification and historical biogeography of the Neotropical frog genus Adenomera (Anura, Leptodactylidae). Journal of Biogeography, 41, 855- 870. Fraga, R. de, Lima, A.P., Prudente, A.L.C. & Magnusson, W.E. (2013) Guide to the snakes of the Manaus region – Central Amazonia. Editora INPA, Manaus. França, D.P.F, Freitas, M.A., Bernarde, P.S. & Uhlig, V.M. (2013) Erythrolamprus oligolepis (Boulenger, 1905) (Serpentes: Dipsadidae): First record for the state of Acre, Brazil. Check List, 9, 668–669. Freitas, M.A., Oliveira e Sousa, S., Vieira, R.S., Farias, T. & Moura, G.J.B. (2013) First record of Cercosaura argulus (Peters, 1863) (Squamata: Gymnophthalmidae) for the state of Maranhão, Brazil. Check List, 9,1541-1542 Freitas, M.A., Dias, I.R., Farias, T., Oliveira e Sousa, S., Vieira, R.S., de Moura, G.J.B. & Uhlig, V. (2014) First record of Ctenophryne geayi Mocquard, 1904 (Amphibia: Anura) for the state of Maranhão, Brazil. Check List, 10, 585-587. Furch, K. (1997) Chemistry of várzea and igapó soils and nutrient inventory of their floodplain forests. In: Junk, W.E. (Ed.) The Central Amazon Floodplain. Berlin Heidelberg: Springer-Verlag.

Funk W.C., Angulo A., Caldwell J.P., Ryan M.J. & Cannatella D.C. (2008) Comparison of morphology and calls of two cryptic species of Physalaemus (Anura: Leiuperidae). Herpetologica, 64, 290-304. Frost, D.R. (2015) Amphibian Species of the World: an Online Reference. Version 6.0. Electronic Database accessible at http://research.amnh.org/herpetology/amphibia/ index.html. American Museum of Natural History, New York, USA. Acess 06 Jun 2015. Gans, C. (2005) Checklist and bibliography of the amphisbaenia of the world. Bulletin of the American Museum of Natural History, 289, 1-130. Gordo, M., Toledo, L.F., Suárez, P., Kawashita-Ribeiro, R.A., Ávila, R.W., Morais, D.H. & Nunes, I. (2013). A New Species of Milk Frog of the Genus Trachycephalus tschudi (Anura, Hylidae) from the Amazonian Rainforest. Herpetologica, 69, 466-479. Guayasamin, J.M., Castroviejo-Fisher, S., Trueb, L., Ayarzagüena, J., Rada, M. & Vilà, C. (2009) Phylogenetic systematics of Glassfrogs (Amphibia: Centrolenidae) and their sister taxon Allophryne ruthveni. Zootaxa, 2100, 1-97. Henderson, R.W., Passos, P. & Feitosa, D. (2009) Geographic variation in the Emerald Treeboa, Corallus caninus (Squamata: Boidae). Copeia, 2009, 572-582. Jungfer, K.H., Faivovich, J., Padial, J.M., Castroviejo-Fisher, S., Lyra, M.L., Berneck, B.M., Iglesias, P.P., Kok, P.J.R., MacCulloch, R.D., Rodrigues, M.T., Verdade, V.K, Torres- Gastello, C.P., Chaparro, J.C., Valdujo, P.H., Reichle, S., Moravec, J., Gvoždík, V., Gagliardi-Urrutia, G., Ernst, R., De la Riva, I., Means, D.B., Lima, A.P., Señaris, J.C., Wheeler, W.C. & Haddad, C.F.B. (2013) Systematics of spiny-backed treefrogs (Hylidae: Osteocephalus): an Amazonian puzzle. Zoologica Scripta, 42, 351-380. Junk W.J., P.B. Bayley & Sparks, R.E. (1989) The flood pulse concept in river – floodplain systems. Canadian Special Publication of Fisheries and Aquatic Sciences, 106, 110- 127. Lima, A.P., Menin, M. & Araújo, M.C. (2007) A new species of Rhinella (Anura: Bufonidae) from Brazilian Amazon. Zootaxa, 1663, 1-15. Lima, A.C. & Prudente, A.L.C. (2009) Morphological variation and systematics of Dipsas catesbyi (Sentzen, 1796) and Dipsas pavonina Schlegel, 1837 (Serpentes: Dipsadinae). Zootaxa, 2203, 31-48. Lima, A.P., Erdtmann, L.K. & Amézquita, A. (2012) Advertisement call and colour in life of Allobates crombiei (Morales) “2000” [2002] (Anura: Aromobatidae) from the type Locality (Cachoeira do Espelho), Xingu River, Brazil. Zootaxa, 3475, 86-88.

Lima, A.P., Simões, P.I. & Kaefer, I.L. (2014) A new species of Allobates (Anura: Aromobatidae) from the Tapajós River basin, Pará State, Brazil. Zootaxa, 3889, 355- 387. Lynch, J.D. & Duellman, W.E. (1997) Frogs of the genus Eleutherodactylus in western Ecuador. Systematics, ecology, and biogeography. Special Publication. Natural History Museum, University of Kansas, 23, 1-236. Maciel, A.O. & Hoogmoed, M.S. (2011) Taxonomy and distribution of caecilian amphibians (Gymnophiona) of Brazilian Amazonia, with a key to their identification. Zootaxa, 2984, 1-53. Noronha, J.C., Rodrigues, D.J., Barros, A.B. & Almeida, E.J. (2012) New record and distribution map of Hyalinobatrachium cappellei (van Lidth de Jeude 1904) (Anura: Centrolenidae). Herpetology Notes, 5, 467-468. Nunes, I., Suárez, P., Gordo, M. & Pombal, J.P. (2013) A second species of Trachycephalus Tschudi (Anura: Hylidae) with a single vocal sac from the Brazilian Amazon. Copeia, 2013, 634-640. Orrico, V.G.D., Peloso, P.L.V., Sturaro, M.J., Da Silva-Filho, H.F., Neckel-Olivera, S., Gordo, M., Faivovich, J. & Haddad, C.F.B. (2014) A new "Bat-voiced" species of Dendropsophus Fitzinger, 1843 (Anura, Hylidae) from the Amazon Basin, Brazil. Zootaxa, 3881, 341-361. Padial, J.M. & De la Riva, I. (2009) Integrative taxonomy reveals cryptic Amazonian species of Pristimantis (Anura: Strabomantidae). Zoological Journal of the Linnean Society, 155: 97–122. Palumbi, S.R., Martin, A., Romano, S., Mcmillan, W.O., Stice, L. & Grabowski, G. (1991) The Simple Fool's Guide to PCR. University of Hawaii, Honolulu. Pansonato, A., Ávila, R.W., Kawashita-Ribeiro, R.A. & Morais, D.H. (2011) Advertisement call and new distribution records of Hypsiboas leucocheilus (Anura: Hylidae). Salamandra, 47, 55-58. Peloso, P.L.V., Sturaro, M.J., Forlani M.C., Gaucher, P., Motta, A.P. & Wheeler, W.C. (2014) Phylogeny, taxonomic revision, and character evolution of the genera Chiasmocleis and Syncope (Anura, Microhylidae) in Amazonia, with descriptions of three new species. Bulletin of the American Museum of Natural History, 136, 1-96. Sá, R.O., Grant, T., Camargo, A. Heyer, W.R., Ponssa, M.L. & Stanley, E. (2014) Systematics of the Neotropical genus Leptodactylus Fitzinger, 1826 (Anura:

Leptodactylidae): Phylogeny, the relevance of non-molecular evidence, and species accounts. South American Journal of Herpetology, 9, 1-128. Sales, R.F.D., Jorge J.S., Meira-Ribeiro, M. & Freire, E.M.X. (2014) New record of Cercosaura ocellata Wagler, 1830 (Squamata, Gymnophthalmidae) in northeastern Brazil, with a distribution map for the species in South America. Check List 10, 1531- 1534. Sambrook, J. & Russel D.W. (2001) Molecular Cloning: a Laboratory Manual. 3rd edn. Cold Spring Harbor Laboratory Press, New York. Santos Jr., A.P., Di-Bernardo, M., & Lema, T. (2008) New Species of the Taeniophallus occipitalis Group (Serpentes, Colubridae) from Eastern Amazonia, Brazil. Journal of Herpetology, 42, 419-426. Sievers, F., Wilm, A., Dineen, D., Gibson, T.J., Karplus, K., Li, W., Lopez, R., McWilliam, H., Remmert, M., Söding, J., Thompson, J.D. & Higgins, D.G. (2011) Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Molecular Systems Biology, 7, 539. Souza, J.D.R., Venâncio, N.M., Freitas, M.A., Souza, M.B. & Veríssimo, D. (2013) First record of Bothrops taeniatus Wagler, 1824 (Reptilia: Viperidae) for the state of Acre, Brazil. Check List, 9, 430-431. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M. & Kumar, S. (2011) MEGA5: Molecular Evolutionary Genetics Analysis using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Molecular Biology and Evolution, 28, 2731-2739. Tsuji-Nishikido, B.M., Kaefer, I.L., Freitas, F.C., Menin, M. & Lima, A.P. (2012) Significant but not diagnostic: differentiation through morphology and calls in the Amazonian frogs Allobates nidicola and A. masniger. Herpetological Journal, 22, 105–114. Wallach, V., Williams, K.L. & Boundy, J. (2014) Snakes of the World: a Catalogue of Living and Extinct Species. CRC Press, Boca Raton, 1209 pp. Wiley, E.O. (1978) The evolutionary species concept reconsidered. Systematic Zoology, 27, 17–26.

REFERÊNCIAS BIBLIOGRÁFICAS

Azevedo-Ramos, C.; Galatti, U. 2002. Patterns of amphibian diversity in Brazilian Amazonia: conservation implications. Biological Conservation, 103: 103-111. Beheregaray, L.B.; Cooke, G.M.; Chao, N.L.; Landguth, E.L. 2015. Ecological speciation in the tropics: insights from comparative genetic studies in Amazonia. Frontiers in Genetics, 5: 1-19. Boubli, J.P.; Ribas, C.; Lynch Alfaro, J.; da Silva, M.N.F.; Pinho, G.M.; Farias, I.P. 2014. Spatial and temporal patterns of diversification on the Amazon: a test of the riverine hypothesis for all diurnal primates of Rio Negro and Rio Branco in Brazil. Molecular Phylogenetics and Evolution, 82: 400-412. Brasil, PR (Presidência da República). 2011. PAC-2 Relatórios. PR, Brasília, DF. Disponível em: http://www.brasil.gov.br. Caminer, M.; Ron, S.R. 2014. Systematics of treefrogs of the Hypsiboas calcaratus and Hypsiboas fasciatus species complex (Anura, Hylidae) with the description of four new species. ZooKeys, 370: 1-68. Costa, F.R.C.; Magnusson, W.E. 2010. The need for large-scale, integrated studies of biodiversity - the experience of the program for biodiversity research in brazilian amazonia. Natureza & Conservação, 8: 3-12. Costa, H.C.; Bérnils, R.S. 2014. Répteis brasileiros: Lista de espécies. Disponível em . Acesso em 06 jun 2015. Dal Vechio, F.; Junior, M.T.; Neto, A.M.; Rodrigues, M.T. 2015. On the snake Siphlophis worontzowi (Prado, 1940): notes on its distribution, diet and morphological data. Checklist, 11(1). Duellman, W.E. 1979. The South American herpetofauna: Its origin, evolution, and dispersal. v.7. Kansas: Museum of Natural History/University of Kansas. 485 p. Duellman, W.E. 2005. Cusco Amazônico. The Lives of amphibians and reptiles in an Amazonian Rainforest. Comstock Publishing Associates, Cornell University Press, Ithaca, New York. 488pp. Fouquet, A.; C.S. Cassini, C.S.; Haddad, C.F.B.; Pech, N.; Rodrigues, M.T. 2014. Species delimitation, patterns of diversification and historical biogeography of the Neotropical frog genus Adenomera (Anura, Leptodactylidae). Journal of Biogeography, 41(5): 855- 870.

Funk, W.C.; Caminer, M.; Ron, S.R. 2011. High levels of cryptic species diversity uncovered in Amazonian frogs. Proceedings of the Royal Society B: Biological Sciences, 279: 1806-1814. Gordo, M.; Toledo, L.F.; Suárez, P.; Kawashita-Ribeiro, R.A.; Ávila, R.W., Morais, D.H.; Nunes, I. 2013. A new species of Milk Frog of the genus Trachycephalus Tschudi (Anura, Hylidae) from the Amazonian rainforest. Herpetologica, 69: 466-479. Hoorn, C.; Wesselingh, F.P.; terSteege, H.; Bermudez M.A.; Mora A.; Sevink J.; Sanmartín I.A.; Sanchez-Meseguer, A; Anderson, C.L.; Figueiredo, J.P.; Jaramillo, C.; Riff, D.; Negri, F. R.; Hooghiemstra, H.; Lundberg, J.; Stadler, T.; Särkinen, T.; Antonelli, A. 2010. Amazonia through time: Andean uplift, climate change, landscape evolution, and biodiversity. Science, 330: 927-931. Jansen, M.; Bloch, R.; Schulze, A.; Pfenninger, M. 2011. Integrative inventory of Bolivia’s lowland anurans reveals hidden diversity. Zoologica Scripta, 40: 567-583. Jorge, R.F. 2014. Fatores determinantes dos padrões de distribuição e densidade de Allobates sumtuosus e Atelopus spumarius em duas bacias de drenagem em 64 Km² de floresta de terra-firme na Amazônia central. Dissertação de Mestrado. Instituto Nacional de Pesquisas da Amazônia, Manaus, Amazonas. Leite, Y.L.R.; Kok, P.R.J.; Weksler, M. 2015. Evolutionary affinities of the ‘Lost World’ mouse suggest a late Pliocene connection between the Guiana and Brazilian shields. Journal of Biogeography, 42: 706–715. Leite, R.N.; Rogers, D.S. 2013. Revisiting Amazonian phylogeography: insights into diversification hypotheses and novel perspectives. Organisms Diversity and Evolution, 13(4): 639-664. Lima, A.P.; Simões, P.I.; Kaefer, I.L. 2014. A new species of Allobates (Anura: Aromobatidae) from the Tapajós River basin, Pará State, Brazil. Zootaxa, 3889: 355- 387. Losos, J.B.; Arnold, S.J.; Bejerano, G.; Brodie III, E.D.; Hibbett, D.; Hoekstra, H.E.; Mindell, D.P.; Monteiro, A.; Moritz, C.; Allen Or, H.; Petrov, D.A.; Renner, S.A.; Ricklefs, R.E.; Soltis, P.S.; Turner, T.L. 2013 Evolutionary biology for the 21st century. PLoS Biology, 11: e1001466. Magnusson, W.E. 2014. Uncertainty and the design of in-situ biodiversity-monitoring programs. Nature Conservation, 8: 77-94.

Menin, M.; Lima, A.P.; Magnusson, W.E.; Waldez, F. 2007. Topographic and edaphic effects on the distribution of terrestrially reproducing anurans in Central Amazonia: mesoscale spatial patterns. Journal of Tropical Ecology, 23: 539-547. Murphy J.C.; Jowers, M.J. 2013. Treerunners, cryptic lizards of the Plica plica group (Squamata, Sauria, Tropiduridae) of northern South America. ZooKeys, 355: 49-77. Museu Paraense Emílio Goeldi, 2012. Censo da Biodiversidade da Amazônia Brasileira. Disponível em < http://www.museu-goeldi.br/censo/>. Acesso em 06 jun 2015. Nascimento, D.S. 2014. Filogenia molecular de serpentes neotropicais do grupo Bothrops atrox (Linnaeus, 1758) (Viperidae: Crotalinae). Dissertação de Mestrado. Universidade de Brasília, Brasília. Naka, L.N. 2011. Avian distribution patterns in the Guiana Shield: implications for the delimitation of Amazonian areas of endemism. Journal of Biogeography, 38: 681-696. Neckel-Oliveira, S.; Magnusson, W.E.; Lima, A.P. 2000. Diversity and distribution of frogs in an Amazonian savanna in Brazil. Amphibia-Reptilia, 21(3):317-326. Orrico, V.G.D.; Peloso, P.L.V.; Sturaro, M.; da Silva, J.; Filho, H.F.; Neckel-Oliveira, S.; Gordo, M.; Faivovich, J.; Haddad, C.F.B. 2014. A new “Bat-Voiced” species of Dendropsophus Fitzinger, 1843 (Anura, Hylidae) from the Amazon Basin, Brazil. Zootaxa, 3881: 341-361. Pavan, D. 2007. Assembléias de répteis e anfíbios do Cerrado ao longo da bacia do rio Tocantins e o impacto do aproveitamento hidrelétrico da região na sua conservação. Tese de doutorado. Universidade de São Paulo, São Paulo. Pomara, L.Y.; Ruokolainen, K.; Young, K.R. 2013. Avian species composition across the Amazon river: the roles of dispersal limitation and environmental heterogeneity. Journal of Biogeography, 41: 784-796. Ribeiro Jr., J.W.; Lima, A.P.; Magnusson, W.E. 2012. The effect of riparian zones on species diversity of frogs in Amazonian forests. Copeia, 2012(3):375-381. Segalla, M.V.; Caramaschi, U.; Cruz, C.A.G; Grant, T.; Haddad, C.F.B.; Langone, J.A.; Garcia, P.C.A. 2014. Brazilian Amphibians: List of Species. Disponível em . Acesso em 06 jun 2015. Simões, P.I.; Lima, A.P.; Faria, I.P. 2010. The description of a cryptic species related to the pan-Amazonian frog Allobates femoralis (Boulenger 1883) (Anura: Aromobatidae). Zootaxa, 2406: 1-18 Simões, P.I.; Kaefer, I.L.; Lima, I.P. 2011. The first record of the rare microhylid Altigius alios Wild, 1995 in Brazil. Herpetology Notes, 4: 141-142.

Simões, P.I.; Kaefer, I.L.; Farias, I.P.; Lima, A.P. 2013. An integrative appraisal of the diagnosis and distribution of Allobates sumtuosus (Morales, 2002) (Anura, Aromobatidae). Zootaxa, 3746: 401-421. Simões, P.I.; Stow, A.; Hödl, W.; Amézquita, A.; Farias, I.P.; Lima, A.P. 2014. The value of including intraspecific measures of biodiversity in environmental impact surveys is highlighted by the Amazonian brilliant-thighed frog (Allobates femoralis). Tropical Conservation Science, 7(4): 811-828. Smith, B.T.; McCormack, J.E.; Cuervo, A.M.; Hickerson, M.J.; Aleixo, A.; Cadena, C.D.; Pérez-Emán, J.; Burney, C.W.; Xie, X.; Harvey, M.G.; Faircloth, B.C.; Glenn, T.C.; Derryberry, E.P.; Prejean, J.; Fields, S.; Brumfield, R.T. 2014. The drivers of tropical speciation. Nature, 515, 406-409.

APÊNDICES Ata da Aula de Qualificação

Ata da Defesa da Dissertação