US 2013 0034879A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2013/0034879 A1 Skirgaila et al. (43) Pub. Date: Feb. 7, 2013

(54) DNA POLYMERASES (52) U.S. Cl...... 435/91.2:435/194: 506/1 (75) Inventors: Remigijus Skirgaila, Vilnius (LT); Agne Tubeleviciute, Vilnius (LT); Renata (57) ABSTRACT Rimseliéné, Vilnius (LT); Sigitas Burinskas, Vilnius (LT) A DNA polymerase mutant comprising a Taq DNA poly (73) Assignee: Fermentas UAB, Vilnius (LT) merase amino acid sequence with a mutation at one or more of the following selected amino acid positions: E189K, E230K, (21) Appl. No.: 13/564,940 E507K, H28R, L30R, G38R, F73V, H75R, E76A, E76G, E76K, E90K, K206R, E315K, A348V, L351F, A439T (22) Filed: Aug. 2, 2012 D452N, G504S, E507A, D551N, L552R, I553V, D578N, (30) Foreign Application Priority Data H676R, Q680R, D732G, E734G, E734K, F749V; wherein the polymerase mutant exhibits relative to wild-type DNA Aug. 3, 2011 (GB) ...... 111343.0.1 polymerase increased polymerase speed, increased affinity to DNA substrate and/or increased resistance to a DNA poly Publication Classification merase inhibitor; and wherein, when the mutation is E507K in combination with two or more further mutations or the (51) Int. Cl. mutation is Q680R in combination with four or more further CI2N 9/12 (2006.01) mutations, at least one of the further mutations is at one of the C4OB I/00 (2006.01) selected amino acid positions; and when the mutation is CI2P 19/34 (2006.01) I553V, this is not in combination with D551 S.

Patent Application Publication Feb. 7, 2013 Sheet 2 of 30 US 2013/0034879 A1

Figure 2. Sybr Green l (x)

Patent Application Publication Feb. 7, 2013 Sheet 4 of 30 US 2013/0034879 A1

Figure 4. The frequency of mutations found during high-throughput screening of Taq DNA polymerase for SYBR Green I resistance (Example 1). Position 507, total mutations 14, 2 different amino acids E-> A, 3 sequences (6M8 i, 6M28 1, 6M301) E->K, 11 sequences (6M32.1, 6M401, 6M46.1, 6M57, L6M661, acq81, aq. C11, a q83, aq.A4, aq. C6(gr), Taq B8(gr)) Position 28, total mutations 6, different amino acids H->R, 6 sequences (6M15 1, 6M251, 6M271, 6M391, Taq G6(07), a E2) Position 27, total mutations 4, 2 different amino acids F->S, 1 sequences (6M27 1) F-> 3 sequences (6M571, TaqG6(07), Faq. E2) Position 219, total mutations 4, 1 different amino acids K-> R, 4 sequences (6Mill, L6M66, TacC6(gr), Taqi B8(g)) Position 230, total mutations 4, 2 different amino acids E->G, 1 sequences (6M261) E->K, 3 sequences (6M51, 6M12i, Tad Cil) Position 76, total mutations 3, 1 different amino acids E->G, 3 sequences (6M661, Taq. Eli, Taq. C5(g)) Position 189, total mutations 3, 1 different amino acids E->K, 3 sequences (faq. G6(07), Taq H12, ad E2) Position 26, total mutations 2, 2 different amino acids T->P, I sequences (6M28 ) T-> A, i sequences (6M2 i) Position 38, total mutations 2, 1 different amino acids G->R, 2 sequences (6M31, 6M71) Position 90, total mutations 2, different amino acids E->K, 2 sequences (6M71, L6M281) Position 206, total mutations 2, 1 different amino acids K-> R, 2 sequences (aqG6(07), ad E2) Position 225, total mutations 2, different amino acids K-> R, 2 sequences (6M341, L6M57 i) Position 315, total mutations 2, 2 different amino acids E->G, 1 sequences (L6M271) E->K, 1 sequences (6M3 1) Position 389, total mutations 2, 1 different amino acids G->R, 2 sequences (aq. E1, ad 88(gr)) Position 680, total mutations 2, different amino acids Q-> R, 2 sequences (6M31, 6V1391) Position 2, total mutations 1, 1 different amino acids R->K, 1 sequences (6M27.1) Position 6, total mutations 1, different amino acids P->S, 1 sequences (6M271) Position 20, total mutations 1, 1 different amino acids H->P, 1 sequences (6M291) Position 24, total mutations if i different amino acids Y->H, I sequences (6M6i.) Position 30, total mutations 1, different amino acids !--> P, 1 sequences (Taqi B1) Position 33, total mutations 1, different amino acids t-> R, 1 sequences (6M111) Position 36, total mutations 1, different amino acids S-> R, i sequences (6M28 ) Position 56, total mutations 1, 1 different amino acids K->, 1 sequences (6M3 1.) Position 57, total mutations 1, different amino acids E->G, 1 sequences (Tag Cii) Position 59, total mutations 1, 1 different amino acids G->R, i sequences (6M3i) Position 62, total mutations different amino acids W-> A, 1 sequences (6M111) Position 72, total mutations 1, 1 different amino acids S->f, 1 sequences (68.4261) Patent Application Publication Feb. 7, 2013 Sheet 5 of 30 US 2013/0034879 A1

Position 78, total mutations 1, 1 different amino acids Y->C, 1 sequences (6M321) Position 82, total mutations 1, 1 different amino acids K->R, 1 sequences (Taa E6) Position 85, total mutations 1, 1 different amino acids R->W, 1 sequences (6M571) Position 89, total mutations 1, 1 different amino acids P->O, 1 sequences (6M291) Position 93, total mutations 1, 1 different amino acids P-> 1 sequences (6M611) Position 96, total mutations 1, 1 different amino acids L->F, 1 sequences (L6M51) Position 97, total mutations 1, 1 different amino acids A->W, 1 Sequences (Taq Cii) Position 118, total mutations different amino acids A-> V, 1 sequences (68.12 1) Position 127, total mutations i? different amino acids K->E, 1 sequences (aq C11) Position 14 total mutations i? different amino acids A->T, 1 sequences (6M281) Position 172, total mutations i, different amino acids Y->C, 1 sequences (6M29 l) Position 184, total mutations different amino acids A-> V, 1 sequences (6M281) Position 190, total mutations i, different amino acids S->F, i sequences (6M15 ) Position 19 total mutations i, 1 different amino acids D->N, 1 sequences (6M21) Position 196, total mutations different amino acids V-> A sequences (68415 1) Position 197, total mutations i, different amino acids K->R, sequences (6M311) Position 215, total mutations i, 1 different amino acids E->D, i sequences (6M34) Position 237, total mutations , different amino acids D->G, sequences (6M21) Position 247, total mutations i? different amino acids K->T, 1 sequences (faq C.) Position 253, total mutations i? different amino acids P->S, sequences (6M301) Position 266, total mutations i, different amino acids R->W, 1 sequences (Taq H12) Position 290, total mutations i? different amino acids S->G, i sequences (68428 i) Position 296, total mutations i different amino acids E->G, sequences (Taq. E6) Position 368, total mutations i, 1 different amino acids P-> 1 sequences (6M461) Position 382, total mutations , 1 different amino acids P->S, sequences (6M341) Position 401, total mutations i? different amino acids E->K, 1 sequences (6M261) Position 433, total mutations i? different amino acids W->M, i sequences (faq81) Position 447, total mutations different amino acids ->A, 1 sequences (6M391) Position 449, total mutations i, different amino acids W->M, 1 sequences (faq H12) Position 454, total mutations it i different amino acids A->T, 1 sequences (6M261) Position 480, total mutations i, 1 different amino acids H-> R, 1 Sequences (faq H12) Position 490, total mutations , 1 different amino acids ->P, 1 sequences (6M281) Patent Application Publication Feb. 7, 2013 Sheet 6 of 30 US 2013/0034879 A1

Position 492, total mutations different amino acids R->K, i sequences (L6M29 i) Position 515, total mutations different amino acids S->R, 1 sequences (6M29 1) Position 520, total mutations i, 1 different amino acids E->G, sequences (6M15 1) Position 521 total mutations different amino acids A->W, 1 sequences (Taq Hi2) Position 529, total mutations i, 1 different amino acids V->A, sequences (6M32) Position 543, total mutations different amino acids S->G, i sequences (6M311) Position 55i, total mutations different amino acids D->N, i sequences (6M251) Position 552, total mutations different amino acids --> R, 1 Sequences (6M611) Position 553, total mutations 1, different amino acids I->W, 1 Sequences (Taq. E6) Position 568, total mutations i, 1 different amino acids A->T, 1 sequences (6M7 1) Position 578, total mutations different amino acids D->N, sequences (Taq. Eii) Position 580, total mutations i, 1 different anino acids N->S, 1 sequences (6M25 1) Position 592, total mutations different amino acids Q-> R, 1 sequences (6M571) Position 608, total mutations different annino acids A->W, 1 sequences (6M34) Position 663, total mutations different amino acids K->E, 1 sequences (6M121) Position 672, total mutations i? different amino acids G->{D, sequences (6M341) sosition 676, total mutations i, 1 different amino acids H->R, 1 sequences (6M31 ) Position 705, total mutations different amino acids A->W, 1 sequences (6M32 ) Position 709, total mutations i, 1 different amino acids K->'', 1 sequences (6M331) Position 722, total mutations different amino acids T->A, i sequences (6M311) Position 732, total mutations different amino acids D->G, sequences (6M151) Position 738, total mutations different amino acids K->R, i sequences (6M29 i) Position 757, total mutations 1, different amino acids A->T, 1 sequences (6M57 1) Position 774, total mutations i, 1 different afinino acids E->G, sequences (Tad B) Position 780, total mutations i different amino acids -->P, 1 sequences (6M151) Position 788, total mutations i? different annino acids W-> A sequences (6M29) Position 799, total mutations different amino acids W-> A sequences (6M51) Position 821, total mutations different amino acids W->M, 1 sequences (6M121) Patent Application Publication Feb. 7, 2013 Sheet 7 of 30 US 2013/0034879 A1

Figure 5.

Taq-E189K

Patent Application Publication Feb. 7, 2013 Sheet 8 of 30 US 2013/0034879 A1

Figure 6.

Taq-WT Taq-E189K

Taq-E230K Taq-E507K

SGI in X M O 0.2 0.5 1.5 2 2.5 3 3.5 4 4.5 5 wages 2 25 3 3,54 4.5 5

Patent Application Publication Feb. 7, 2013 Sheet 9 of 30 US 2013/0034879 A1

Figure 7.

Patent Application Publication Feb. 7, 2013 Sheet 10 of 30 US 2013/0034879 A1

Figure 8.

Patent Application Publication Feb. 7, 2013 Sheet 11 of 30 US 2013/0034879 A1

Figure 9. The sequence of plasmid used as a PCR target for of 250 bp and 200 bp DNA fragments amplification in Example 1 (SEQ ID 14).

LOCUS plasmid 5487 bp DNA circular 3-APR-2006 BASE COUNT 1652 a 1 103 c 340 g 1392 t ORIGIN 1 tittgclcaca tigacccgacaccatcgaatggccagatgat taatticclaattittgttga 61 cactictatoattgatagagt tattttacca citccctatea gtgatagaga aaagtgaaat 121 gaatagttcg acaaaaatct agataacgagggcaaaaaatggctagotgg agccacccge 181 agttcgaaaa aggcgccatgatactggaea clgattacat aacaaaagatggtaaaccta 24l taatccgaat ttttaagaaa gagaacgggg agttaaaat agaacttgat CCCcatttitc 301 agccctatatatatgctett cticaaagatg acticcgctat tgaggagata aaggcaataa 361 agggegagag acatggaaaaagtgtgagag tagttgatgcagtgaaagttcaagaagaaat 421 titttgggaag ggaagttgaggtotggaage ttatatttga acacccticaa gacgttccgg 48 ctatgaggga caagataaaa gagcatccagctgttatcga catttacgaa tatgatatac 541 catttgccaa.gcgitat cle alagacaagg gcttgatcc tatggaggga gacgaggagc 601 tLaagctCct cgcctittgac attgaaacgt ttfatcatga aggagatgaatttggaaaag 661 gegagataataatgattagt tatgccgacg aagaagagge cagagtaatt acatggaaaa 72 atal.cgatct gecgatgtc gatgttgtal ccaatgaaagggagatgata aagcgcuttg 78 ttcaggttgttaaagaaaaa gacccggatgtgataataac ttacaatggggacaattittg 841 atttgccgta tetcataaaacgggeagaaa agctgggggt teggettigte ttaggaaggg 901 acaaggaaaa teccgaaccc aagat.ccaga gaatggggga tagcticgct gtagaaatca 961 agggcagaat acattttgat ctittcccagttgtgagaag gacaataaac cttecgacgt i02 atacgcttgaggeggtttatgaagcagttt tsggaaaaac caaaagcaaattaggagegg 08 aggaaattge cgccatctgg gaaacggaag agagcatgaaaaaactggee cagtacticaa 14 tggaagatgc tagggcgact tatgagetcggaaaggaatt ctitccccatggaagetgage 20 tggcgaagct gataggteaa agcgtgtggg atgtctctaggteaagcaccggcaacctcg 1261 tggagtggla tttgttaagg gtggeatatgagaggaacga gctlgetecgaacaaacctg 32 atgaggaaga gtataaaaga cgtttaagaa caact tacct gggaggatatgtaaaagagc 38 cagaaaagggittatgggagaacatcatct atctgact cogtagcttg tatccctcaa 44 taatagttac ceataacgta tegccggacactictegaaaa agagggttge gaaaattatg 50 at attgctcc catagtaagc tataggttctgcaaggact tccgggettt attCecticea 56 tacticgggga cttaattgca atgaggcaag agataaagaagaaaatgaaagctacaattg 62 atcCagtgga aaggaaaatgcttgattata gacaacggge agittaaatla cttgcaaata 68 gttattacgg tatatgggg tatCctaagg caagatggtactegaaggaatgtgcc.gaaa 74 gtgttaccgc atggggaagg cactacatagagatgacgat aaaagaaata gaggaaaaat 80 ttggetttaaagttctittatgcagacaccg acgggttitta tigegacaata teaggagaaa 86 aaccggaaat tattaaaaagaaagcCaggg agttcctaaactacataaac totaaactic 92 caggtetgct tgagettgag tatgaggget tacttgag aggattctttgttacaaaaa 98 agegctatgcagticatagatgaagagggca gaataacaac aaggggettggaagtagtaa 204 ggagggactggagtgaaata gCtaaagaga cticaggeaaaggttittagaggctatactta 210 aagatggaagtgttgaaaaa.gctgtagaaattgttagagatgttttagag aaaatagcaa 26 aatacagggttccacttgaaaagettgtta tecatgagea gattaccagggatttaaagg Patent Application Publication Feb. 7, 2013 Sheet 12 of 30 US 2013/0034879 A1

222 actacaaage cattggtect catgtagega tagcaaaaag actagecgca agagggataa 228 aagtgaaacc gggcacaataataagetata tegttcticaa aggaagegga aagataageg 2341 atagggtaattt tacttaca gaatacgatc ctgaaaagca caagtacgat ccagattact 240 acatagaaaa ccaagttittgccggcagtacttagaatcct taagcatttggatatagaa 246 aggaggattt aagatatcaa agctcaaaac aaaccggct agatgcatgg cteaaaaggt 252 gatatetaac taagcttgac ctgtgaagtgaaaaatggcg cacattgtgc gacatttitt 258 ttgtctg.ccg tttaccgctactgcgtcacg gatctocacg cgccctgtag cggcgcatta 264 agcgcggcgg gtgtggtggt tacgcgcagc gtgaccgcta cacttgccag cgccctagog 270 cccgctectt togctttctt coct tccttt ctegccacgttcgc.cggctt tocccgtcaa 276 gctictaaatcgggggctccc tittagggtte cgatttagtgctttacggca cctegacccc 282 aaaaaactitg attagggtgatggttcacgt agtgggccat cgccctgata gacggtttitt 288 cgccct ttga cgttggagtC cacgttctitt aatagtggac tettgttcca aactggaaca 294 acacticaacc ctatetcggt ctattettittgatttataagggattittgcc gattitcggcc. 300 tattggttaa aaaatgaget gatttaacaa aaatttaacg.cgaattittaa caaaatatta 306 acgcttacaatttcaggtgg cacttittcggggaaatgtgc gcggaacccc tatttgttta 32 ttitttctaaa tacattcaaa tatgtatcc.gcticatgagacaataaccctgataaatgctt 318i caataatattgaaaaaggaa gagtatgagt attcaacatt tecgtgtcgc cct tattecc 324 ttttittgcgg cattttgcct tcctgtttttgcticacccag aaacgctggtgaaagtaaaa 330 gatgctgaag atcagttggg tgcacgagtgggttacatcgaactggatct caa.cagcggt 336 aagatccttg agagtttitcg ccc.cgaagaacgtttitccaatgatgagcacttittaaagtt 342 ctgctatgtggcgcggtatt atcccgtatt gacgc.cggge aagageaact cggtegecgc 348 atacactatt citcagaatga cttggttgag tacticaccag teacagaaaa gcatcttacg 354 gatggcatga cagtaagaga attatgcagt gctgccataa ccatgagtgataacactgcg 360 gccaacttac ttctgacaac gatcggagga ccgaaggage taaccgcttt tttgcacaac 366 atgggggatc atgtaactcg ccttgatcgttgggaaccggagctgaatga agccatacca 372 aacgacgagc gtgacaccac gatgcctgta gcaatggcaacaacgttgcgcaaactata 378 actggcgaac tact tactet agettcccgg caacaattgatagactggatggaggcggat 384 aaagttgcag gaccacttctg.cgcteggcc ct tccggctggctggtttattgctgataaa 390 totggagecggtgagegtgg Ctcticgcggt atcattgcag cactggggcc agatggtaag 396 ccctcccgta togtagttat ctacacgacggggagticagg caactatggatgaacgaaat 402 agacagatcgctgagatagg tgcctcactg attaagcattggtaggaattaatgatgtct 408 cgtttagata aaagtaaagt gattaa.cagc gcattagagc tgettaatgaggteggaatc 44 gaaggtttaa caacccgtaa acticgcccagaagctaggtg tagageagcc tacattgtat 420 tagcatgtaa aaaataagcgggetttgctic gacgcctag ccattgagatgttagatagg 426 caccatactic acttittgccc tittagaaggggaaagctggc aagatttittt acgtaataac 432 gctaaaagtt tagatgtgc tittactaagt catcgcgatggageaaaagt acatttaggt 438 acacggccta cagaaaaacagtatgaaact ctegaaaatcaattagcctt tttatgccaa 444 caaggtttitt cactagagaatgcattatatgcacticagog cagtggggcattt tactitta 450 g.gttgcgtattggaagatca agagcatcaa.gtc.gctaaag aagaaaggga aacacctact 456 actgatagtatgccgccatt attacgacaa getatcgaat tatttgatca ccaaggtgca 462 gagccagcct tcttattegg cctgaattgatcatatgcggattagaaaaacaacttaaa 468 tgtgaaagtgggtettaaaa gcagcataac ctitttitccgt gatggtaact tcactagttt 474 aaaaggatct aggtgaagat cotttittgat aatcteatga ccaaaatccc ttaacgtgag 480i tttitcgttcc actgagegtc. agacccc.gta gaaaagatca aaggatcttctgagatect 486 ttttittctgc gcgtaatctgctgcttgcaaacaaaaaaac caccgctaccagcggtggtt Patent Application Publication Feb. 7, 2013 Sheet 13 of 30 US 2013/0034879 A1

492 tgtttgccgg atcaagaget accaactictt tttccgaagg taactggctt cagcagagcg 498 cagataccaa atactgtcct tctagtgtag ccgtagttaggccaccactt Caagaactet 504 gtagcaccgc ctacatacct cgctctgcta atcctgttac cagtggctgc tigccagtggc 50 gataagtcgtgtcttaccgg gttggactica agacgatagt taccggataaggegeagegg 56 tegggctgaacggggggttcgtgcacacag cccagcttgg agcgaacgac ctacaccgaa 522 ctgagatace tacagcgtgagctatgagaaag.cgccacgc titcccgaagg gagaaaggcg 528 gacaggtatc cggtaagegg cagggtegga acaggagagc gcacgagggagctitcCaggg 534 ggaaacgcct ggtatettta tagtectgtcgggttcgcc acctctgact tgagcgt.cga 540 tittttgtgatgctcgtcaggggggcggagc ctatggaaaaacgccagcaa.cgcggcctitt 546 ttacggttcc tiggccttttgctggcct ?/

Patent Application Publication Feb. 7, 2013 Sheet 15 of 30 US 2013/0034879 A1

Figure 11. The frequency of mutations found during first high-throughput screening of Taq DNA polymerase L0 library for shorter amplification and annealing times (Example 2).

Position 230, total mutations 33, 1 different amino acids E->K, 33 sequences (8-1, 8-2, 8-4, 8-5, 8-6, 8-9, 8-12, 8-13, 8-14, 8-15, L8-16, 8-17, 8-18, 8-9, 8-2t, 8 22, 8-23, 8-25, 8-26, 8-27, 8-28, 18-29, 8-32, 8-34, L8-35, 8-37, 8-38, 8-39, 18-43, 18-44, 8-46, 8-50, 8-52) Position 30, total mutations 32, 3 different amino acids L->Q, sequences (8-21) L->P, 21 sequences (3-5, 8-6, 8-7, 8-8, 8-9, 8-it, 8-4, 8-15, 8-16, 8-19, 18-22, 8-23, 8-32, 8-34, 8-39, 8 43, 8-44, 8-46, 8-50, 8-5, 8-52) L-> R, 10 sequences (8-1, 8-3, 8-18, L8-20, 8-24, 8-25, 8-26, 8-27, 8-28, L8-35) Position 452, total mutations 18, 1 different amino acids D-> N, 18 sequences (8-2, 3-5, 8-6, 8-9, 8-14, 8-5, 8-8, 8-20, 8-25, 18-27, 8-29, 8-32, 8-39, 38-44, 8-46, 8-50, 8-51, 8-52) Position 504, total mutations 15, different amino acids G->S, 5 sequences (8-2, 8-4, 8-5, 8-6, 8-9, 8-14, 8-i.5, 8-8, 8-25, 8-27, 8-29, 8-39, 8-46, 8-5 8-52) Position 3ii, tota mutations 5, 2 different amino acids L->F, 4 sequences (8-19, 8–23, 8-43, 8-52) L->R, i. sequences (8-16) Position 507, tota mutations 5, 2 different amino acids E->G, 2 sequences (8-14, L8-46) E->A, 3 sequences (8-20, 8–22, 8-24) Position 189, tota mutations 4, different amino acids E->K, 4 sequences (8-11, 8-30, 8-35, 8-38) Position 285, tota mutations 3, 1 different amino acids F->S, 3 sequences (8-7, 8-20, 8-30) Position 348, tota mutations 3, different amino acids A->W, 3 sequences (8-i9, 8-23, 843) Position 3, total mutations 2, 1 different amino acids G->E, 2 sequences (8-1, L8-12) Position 137, tota mutations 2, 2 different amino acids R->C, 1 sequences (8-27) R->H, 1 sequences (8-52) Position 155, tota mutations 2, 1 different amino acids V->i, 2 sequences (8-8, 8-15) Position 197, tota mutations 2, different amino acids K->R, 2 sequences (8-3, 8-7) Position 283, tota mutations 2, 2 different a mino acids H->R, sequences (8-28) H->, i. sequences (8-27) Position 335, tota mutations 2, 2 different amino acids A->T, 1. Sequences (8-22) A-> V, 1 sequences (8-28) Position 461, tota mutations 2, different amino acids -> R, 2 sequences (8-23, 8-43) Position 470, tota mutations 2, 2 different a mino acids -->f, 1. sequences (8-30) -->P, 1. Sequences (8-16) Position 474, tota mutations 2, different amino acids W-> 1, 2 sequences (8-7, 8-26) Position 552, tota mutations 2, different amino acids L->F, 2 sequences (8-32, 8-37) Position 664, tota mutations 2, 1 different amino acids ->A, 2 sequences (8-8, 8-18) Position 680, tota mutations 2, 2 different amino acids Q-> R, 1 sequences (L8-28) Q->K, sequences (8-2) Position 739, tota mutations 2, 1 different amino acids S->G, 2 sequences (8-3, 8-11) Position 749, tota mutations 2, different amino acids F->i, 2 sequences (8-34, 8-38) Patent Application Publication Feb. 7, 2013 Sheet 16 of 30 US 2013/0034879 A1

Position 799, total mutations 2, 1 different amino acids V->A, 2 sequences (8-18, 8-37) Position 2, total mutations 1, different amino acids R->K, 1 sequences (8-4) Position 20, total mutations i? different amino acids H->R, 1 sequences (8-44) Position 24, total mutations 1, different amino acids Y->H, 1 sequences (8-38) Position 28, total mutations i? different amino acids H->R, 1 sequences (8-21) Position 29, total mutations i? different amino acids A->, 1 sequences (8-26) Position 36, total mutations i? different amino acids S->G, 1 Sequences (8-6) Position 37, total mutations i? different amino acids R->W, sequences (8-7) Position 65, total mutations i? different amino acids V->A, 1 sequences (8-19) Position 66, total mutations i? different amino acids F->t, 1 sequences (8-2) Position 77, total mutations i? different amino acids A->, 1 sequences (8-12) Position 82, total mutations i? different amino acids K->E, 1 sequences (8-27) Position 97, total mutations i? different amino acids A->S, 1 sequences (8-35) Position i.14, total mutations 1, 1 different amino acids P-> 1 sequences (8-50) Position 124, total mutations 1, 1 different amino acids S->G, 1 sequences (8-25) Position 132, total mutations 1, 1 different amino acids E->G, sequences (8-23) Position 151, total mutations 1, 1 different amino acids D->N, sequences (8-7) Position i62, total mutations 1, 1 different amino acids --> H, 1 Sequences (8-26) Position 183, total mutations 1, 1 different amino acids R->G, 1 sequences (8-3) Position i92, total mutations 1, 1 different amino acids N->D, sequences (8-21) Position 205, total mutations 1, 1 different amino acids R->G, 1 sequences (8-46) Position 206, total mutations 1, 1 different amino acids K-> R, sequences (8-44) Position 214, total mutations 1, 1 different amino acids --> P, 1 sequences (8-i5) Position 221, total mutations 1, 1 different amino acids --> P, 1 sequences (8-i3) Position 238, total mutations 1, 1 different amino acids D->N, i sequences (8-6) Position 239, total mutations 1, 1 different amino acids --> P, 1 sequences (8-i2) Position 241, total mutations 1, 1 different amino acids --> P, 1 sequences (8-i6) Position 244, total mutations 1, 1 different amino acids D->N, 1 sequences (8-29) Position 248, total mutations 1, 1 different amino acids V-> A sequences (8-44) Position 255, total mutations 1, 1 different amino acids E->G, sequences (8-38) Position 262, total mutations 1, 1 different amino acids R->W, 1 sequences (8-30) Position 264, total mutations 1, 1 different amino acids P->S, 1 sequences (8-1) Position 266, total mutations 1, 1 different amino acids R->Q, Sequences (8-28) Patent Application Publication Feb. 7, 2013 Sheet 17 of 30 US 2013/0034879 A1

Position 277, total mutations i? different amino acids E->K, sequences (18-34) Position 315, total mutations i? different amino acids E->G, 1 Sequences (8-3) Position 333, total mutations i, 1 different amino acids H->R, 1 sequences (8-4) Position 36, total mutations i? different amino acids ->M, sequences (8-51) Position 383, total mutations 1, 1 different amino acids S->F, 1 sequences (8-13) Position 385, total mutations 1, 1 different amino acids T->i, i sequences (8-28) Position 399, total mutations 1, 1 different amino acids T->M, 1 sequences (8-12) Position 403, total mutations 1, 1 different amino acids G->R, sequences (8-2) Position 419, total mutations 1, 1 different amino acids R->K, 1 sequences (8-2) Position 425, total mutations 1, 1 different amino acids R->K, 1 Sequences (8-12) Position 443, total mutations 1, 1 different amino acids H->R, i sequences (8-21) Position 446, total mutations 1, 1 different amino acids A->i, 1 sequences (8-5) Position 450, total mutations 1, 1 different amino acids R->H, i sequences (8-37) Position 47, total mutations 1, 1 different amino acids E->K, 1 sequences (8-8) Position 499, total mutations 1, 1 different amino acids G->E, 1 Sequences (8-i) Position 518, total mutations 1, 1 different amino acids V->A, 1 sequences (8-5) Position 532, total mutations 1, 1 different amino acids I->W, 1 sequences (8-38) Position 534, total mutations 1, 1 different amino acids Q-> R, 1 sequences (8-34) Position 623, total mutations 1, 1 different amino acids S->P, 1 sequences (8-16) Position 63i, total mutations 1, 1 different amino acids V->A, 1 sequences (8-1) Position 636, total mutations 1, 1 different amino acids R->W, i sequences (18-22) Position 657, total mutations 1, different amino acids |-> R, 1 sequences (8-1) Position 676, total mutations 1, 1 different amino acids H->R, sequences (8-29) Position 678, total mutations 1, different amino acids L->P, sequences (8-35) Position 694, total mutations 1, different amino acids E->K, sequences (8-27) Position 695, total mutations 1, different amino acids R->C, 1 sequences (8-2) Position 698, total mutations 1, different amino acids Q-> R, 1 Sequences (8-2) Position 701, total mutations 1, different amino acids P-> 1 Sequences (8-21) Position 707, total mutations 1, different amino acids I->T, 1 sequences (8-6) Position 747, total mutations 1, different amino acids M->W, sequences (8-28) Position 755, total mutations 1, different amino acids G->D, 1 Sequences (8-26) Position 772, total mutations 1, different amino acids L->P, sequences (8-37) Position 779, total mutations 1, different amino acids M->W, sequences (8-29) Patent Application Publication Feb. 7, 2013 Sheet 18 of 30 US 2013/0034879 A1

Position 788, total mutations 1, 1 different amino acids W->A, 1 sequences (8-43) Position 791, total mutations 1, 1 different amino acids A->T, 1 sequences (8-17) Position 795, total mutations 1, 1 different amino acids R->G, 1 Sequences (8-27) Position 802, total mutations 1, 1 different amino acids --> R, 1 sequences (8-30) Position 806, total mutations 1, 1 different amino acids V->A, 1 sequences (8-46) Position 825, total mutations 1, 1 different amino acids E->K, 1 sequences (8-4) Position 832, total mutations 1, 1 different amino acids E->G, 1 sequences (8-12)

Patent Application Publication Feb. 7, 2013 Sheet 20 of 30 US 2013/0034879 A1

Figure 13. The frequency of mutations found during second high-throughput screening of Taq DNA polymerase L3 library for shorter amplification and annealing times (Example 2),

Position 73, total mutations 5, 3 different amino acids F->W, 3 sequences (2-12, G5-11, G5-12) F->S, 1 sequences (3-5) F-> 1 sequences (3-2) Position 144, total mutations 5, 2 different amino acids D->G, 4 sequences (2-12, G5-il, G5-12, G5-7) D->N, 1 sequences (4-7) Position 206, total mutations 5, different amino acids K->R, 5 sequences (2-12, 3-9, 4-12, G5-il, G5-12) Position 30, total mutations 3, 1 different amino acids !-->P, 3 sequences (3-3, 3-8, 3-9) Position 75, total mutations 3, different amino acids H->R, 3 sequences (-5, 3-8, G5-10) Position 90, total mutations 3, 1 different amino acids E->G, 3 sequences (1-8, 3-1, 4-5) Position 143, total mutations 3, 2 differentainino acids K->E, 2 sequences (2-5, G5-23) K-> R, 1 sequences (1-10) Position 351, total mutations 3, different amino acids -->, 3 sequences (2-12, 4-15, GS-12) Position 397, total mutations 3, 2 different amino acids E->G, 1 sequences (1-10) E->K, 2 sequences (2-12, G5-12) Position 439, total mutations 3, 1 different amino acids A->, 3 sequences (2-2, 4-15, G5-1) Position 24, total mutations 2, different amino acids Y->H, 2 sequences (1-, 3-5) Position 26 total mutations 2, 2 different amino acids T->P, sequences (3-4) T->A, 1 sequences (i-9) Position 33, total mutations 2, 2 different amino acids ->P, 1 sequences (1-7) |->R, 1 sequences (4-4) Position 50, total mutations 2, 2 different amino acids S->D, sequences (4-3) S->G, 1 sequences (4-12) Position 55, total mutations 2, different amino acids --> P, 2 sequences (1-2, 3-9) Position 57, total mutations 2, different amino acids E->G, 2 sequences (3-2, 3-5) Position 65, total mutations 2, different amino acids W->I, 2 sequences (4-4, G5-1) Position 132, total mutations 2, 2 different amino acids E->G, 1 sequences (G5-10) E->K, i sequences (4-2) Position 34, total mutations 2, 1 different amino acids Y->C, 2 sequences (1-2, 4–3) Position 141, total mutations 2, 2 different amino acids A->, 1 sequences (4-2) A-> V, 1 sequences (1-4) Position 189, total mutations 2, 1 different amino acids E->K, 2 sequences (2-5, G5-23) Position 212, total mutations 2, 1 different annino acids G->R, 2 sequences (3-4, G5-17) Position 230, total mutations 2, 2 different amino acids E-> A, 1 sequences (G5-8) E->K, sequences (G5-19) Patent Application Publication Feb. 7, 2013 Sheet 21 of 30 US 2013/0034879 A1

Position 245, total mutations 2, 2 different amino acids ->P, sequences (3-9) {->R, 1 sequences (G5-6) Position 246, total mutations 2, 2 different amino acids A->, sequences (1-2) A-> V, i sequences (3-4) Position 275, total mutations 2, 1 different amino acids R->G 2 sequences (4-4, G5-i7) Position 278, total mutations 2, different amino acids F-> 2 sequences (1-5, i-7) Position 303, total mutations 2, different amino acids E->G, 2 sequences (1-4, 3-5) Position 311, total mutations 2, 2 different amino acids ->f, 1 sequences (G5-0) --> P, 1 Sequences (2-5) Position 344, total mutations 2, 1 different amino acids D->N, 2 sequences (1-5, 1-8) Position 461, total mutations 2, different amino acids -> R, 2 sequences (1-4, 1-11) Position 507, total mutations 2, 2 different amino acids E->A, 1 sequences (4-15) E->K, 1 sequences (G5-il) Position 551, total mutations 2, different amino acids D->G, 2 sequences (2-2, 2-12) Position 568, total mutations 2, different amino acids A-> V, 2 sequences (3-3, 3-5) Position 592, total mutations 2, different amino acids Q->R, 2 sequences (2-5, 4-4) Position 698, total mutations 2, different amino acids Q-> R, 2 sequences (4-15, G5-2) Position 720, total mutations 2, different amino acids V->A, 2 sequences (3-3, 3-5) Position 732, total mutations 2, 1 different amino acids D->G, 2 sequences (1-9, G5-23) Position 734, total mutations 2, 2 different amino acids E->G, sequences (1-5) E->K, 1 sequences (2-12) Position 749, total mutations 2, 2 different amino acids F->W, 1 sequences (3-1) F-> 1 sequences (G5-19) Position 6, total mutations 1, 1 different amino acids P-> 1 Sequences (4-5) Position 15, total mutations 1, 1 different amino acids ->f, 1 sequences (1-7) Position 18, total mutations 1, 1 different amino acids D->G, 1 sequences (4-2) Position 27, total mutations 1, 1 different amino acids F->S, sequences (3-2) Position 28, total mutations 1, 1 different amino acids H->P, 1 sequences (G5-17) Position 29, total nutations 1, 1 different annino acids A->, sequences (4-14) Position 38, total mutations 1, 1 different amino acids G-> R, 1 sequences (4-5) Position 46, total mutations 1, 1 different amino acids G->D, 1 sequences (G5-8) Position 52, total mutations 1, 1 different amino acids !->P, sequences (i-10) Position 56, total mutations 1, 1 different amino acids K->E, 1 sequences (4-15) Position 61, total mutations 1, 1 different annino acids A-> V, i sequences (4-2) Position 64, total mutations 1, 1 different amino acids V-> A sequences (4-3) Position 67, total mutations 1, 1 different amino acids D->G, sequences (G5-6) Patent Application Publication Feb. 7, 2013 Sheet 22 of 30 US 2013/0034879 A1

Position 69, total mutations 1, 1 different amino acids K->Q, sequences (2-2) Position 76, total mutations 1, 1 different amino acids E->G, 1 sequences (4-8) Position 80, total mutations 1, 1 different amino acids G->R, 1 sequences (G5-8) Position 91, total mutations different amino acids D->G, 1 sequences (G5-10) Position 92, total mutations different amino acids F-> 1 Sequences (3-8) Position 97, total mutations different amino acids A->i, i sequences (4-14) Position 102, total mutations 1, 1 different amino acids |->Q, sequences (G5-12) Position 110, total mutations 1, 1 different amino acids R->C, 1 Sequences (1-11) Position i.18, total mutations 1, 1 different amino acids A-> V, 1 Sequences (G5-ii) Position 31, total mutations 1, 1 different amino acids K-> R, 1 sequences (1-4) Position i47, total mutations 1, 1 different amino acids Q-> R, i sequences (3-8) Position 168, total mutations 1, 1 different amino acids ->P, 1 sequences (3-3) Position 173, total mutations 1, 1 different amino acids G->S, 1 sequences (i-4) Position 174, total mutations 1, 1 different amino acids ->Q, Sequences (4-15) Position 175, total mutations 1, 1 different amino acids R->G, 1 sequences (3-3) Position 76, total mutations 1, 1 different amino acids P->S, sequences (4-7) Position i77, total mutations 1, 1 different amino acids D->G, sequences (3-8) Position i97, total mutations 1, 1 different amino acids K->R, 1 sequences (i-5) Position 209, total mutations 1, 1 different amino acids E->K, sequences (4-14) Position 214, total mutations 1, 1 different amino acids i->P, 1 sequences (3-2) Position 226, total mutations 1, 1 different amino acids P->S, 1 sequences (3-8) Position 236, total mutations 1, 1 different amino acids M->1, 1 sequences (G5-8) Position 237, total mutations 1, 1 different amino acids D->G, sequences (3-8) Position 238, total mutations 1, 1 different amino acids D->G, sequences (4-3) Position 243, total mutations 1, 1 different amino acids W->R, 1 sequences (4-2) Position 244, total mutations 1, 1 different amino acids D->G, 1 Sequences (G5-10) Position 251 total mutations 1, 1 different amino acids D->G, 1 sequences (1-7) Position 260, total mutations 1, 1 different amino acids K->E, 1 sequences (G5-12) Position 267, total mutations 1, 1 different amino acids E->G, i sequences (3-8) Position 284, total mutations 1, 1 different amino acids E->A, 1 sequences (4-2) Position 289, total mutations 1, 1 different amino acids E->G, 1 sequences (1-8) Position 292, total mutations 1, 1 different amino acids K->R, 1 sequences (4-6) Position 297, total mutations 1, 1 different amino acids A->W, i. Sequences (2-2) Patent Application Publication Feb. 7, 2013 Sheet 23 of 30 US 2013/0034879 A1

Position 304, total mutations i? different amino acids G->E, 1 sequences (4-8) Position 310, total mutations i? different amino acids W->M, sequences (3-5) Position 32, total mutations 1, 1 different amino acids S->F, 1 sequences (1-7) Position 314, total mutations 1, 1 different amino acids K->R, 1 sequences (G5-1) Position 326, total mutations 1, different amino acids A->T, 1 sequences (4-4) Position 333, total mutations i? different amino acids H->Y, sequences (4-4) Position 339, total mutations i different amino acids Y->S, sequences (1-9) Position 366, total mutations i? different amino acids G->S, sequences (G5-8) Position 367, total mutations 1, 1 different amino acids ->f, 1 sequences (4-5) Position 385, total mutations 1, 1 different amino acids -> A 1 sequences (4-12) Position 400, total mutations 1, different amino acids E->K, i. Sequences (1-11) Position 406, total mutations i? different amino acids A-> V, 1 sequences (G5-17) Position 41i, total mutations i? different amino acids R->G, sequences (2-12) Position 415, total mutations i? different amino acids N->D, sequences (G5-6) Position 48, total mutations 1, 1 different amino acids G->E, 1 sequences (4-6) Position 420, total mutations 1, 1 different amino acids -->f, 1 sequences (G5-0) Position 43, total mutations 1, different amino acids R->Q, 1 sequences (3-8) Position 432, total mutations i? different amino acids E->K, 1 sequences (4-6) Position 452, total mutations i? different amino acids D->N, 1 sequences (4-4) Position 462, total mutations i, different amino acids E->G, 1 sequences (2-2) Position 463, total mutations 1, 1 different amino acids V->A, 1 sequences (G5-12) Position 487, total mutations 1, 1 different amino acids R->W, 1 sequences (G5-12) Position 492, total mutations 1, different amino acids R->G, 1 sequences (1-9) Position 502, total mutations i? different amino acids A->i, 1 sequences (G5-6) Position 503, total mutations i? different amino acids I->W, sequences (4-7) Position 515, total mutations i, 1 different amino acids S-> N, 1 sequences (G5-1) Position 516, total mutations i, different amino acids A->T, 1 sequences (G5-23) Position 518, total mutations 1, 1 different amino acids V->A, 1 sequences (G5-19) Position 530, total mutations 1, different amino acids E->G, sequences (4-2) Position 538, total mutations 1, different amino acids ->f, sequences (G5-1) Position 543, total mutations i? different amino acids S->N, 1 sequences (3-9) Position 547, total mutations i? different amino acids D->G, 1 sequences (G5-8) Position 549, total mutations 1, 1 different amino acids -->S, 1 Sequences (1-8) Patent Application Publication Feb. 7, 2013 Sheet 24 of 30 US 2013/0034879 A1

Position 553, total mutations i, different annino acids I->W, sequences (i-1) Position 567, total mutations 1, 1 different amino acids T->M, sequences (4-7) Position 577, total mutations 1, 1 different amino acids S->P, 1 sequences (GS-1) Position 596, total mutations different anino acids R-> Q, sequences (4-6) Position 6i2, total mutations different amino acids S-> R, 1 sequences (2-2) Position 630, total mutations different amino acids R->O, 1 Sequences (G5-11) Position 634, total mutations i? different amino acids E->G, sequences (4-4) Position 640, total mutations 1, different amino acids T->A, 1 sequences (3-8) Position 646, total mutations i? different amino acids M->i, 1 Sequences (2-5) Position 664, total mutations i, different amino acids T->A, 1 sequences (4-2) Position 676, total mutations i, different annino acids H-> R, 1 sequences (G5-6) Position 680, total mutations i, 1 different anio acids Q-> R, i sequences (2-2) Position 685, total mutations i, 1 different amino acids P->S, 1 sequences (G5-23) Position 692, total mutations 1, 1 different amino acids F->I, sequences (3-5) Position 707, total mutations 1, 1 different amino acids I->M, i sequences (i-7) Position 717, total mutations 1 different amino acids R->W, 1 sequences (1-7) Position 722, total mutations 1 different amino acids T->A, 1 sequences (4-3) Position 742, total mutations i i different amino acids E->A, 1 sequences (4-4) Position 745, total mutations 1, different amino acids E->A, 1 sequences (G5-8) Position 752, total mutations 1, different amino acids P->S, 1 sequences (1-11) Position 765, total mutations i, 1 different annino acids M->T, 1 sequences (G5-19) Position 767, total mutations i, 1 different annino acids K->E, sequences (4-3) Position 773, total mutations 1, 1 different amino acids E->G, sequences (2-2) Position 799, total mutatios 1, 1 different amino acids W->A 1 sequences (G5-1) Position 814, total mutatiors different amino acids A->T, 1 sequences (1-9) Position 820, total mutatiors different amino acids E->W, 1 sequences (3-5) Patent Application Publication Feb. 7, 2013 Sheet 25 of 30 US 2013/0034879 A1

Figure 14.

Patent Application Publication Feb. 7, 2013 Sheet 26 of 30 US 2013/0034879 A1

Figure 15

Patent Application Publication Feb. 7, 2013 Sheet 27 of 30 US 2013/0034879 A1

Figure 16.

Patent Application Publication Feb. 7, 2013 Sheet 28 of 30 US 2013/0034879 A1

Figure 17.

M0.00% 0.075% 0.015%. 0.00% 0.001%, 0.0025%, 0.005%0.0075% 0.015% Patent Application Publication Feb. 7, 2013 Sheet 29 of 30 US 2013/0034879 A1

Figure 18.

Patent Application Publication Feb. 7, 2013 Sheet 30 of 30 US 2013/0034879 A1

Figure 19.

M 1 2 3 4 5, 6 M 1 2 3 4 5 6 US 2013/0034.879 A1 Feb. 7, 2013

DNA POLYMERASES amino acid sequence with a mutation at one or more of the following selected amino acid positions: E189K, E230K, FIELD OF THE INVENTION E507K, H28R, L30R, G38R, F73V, H75R, E76A, E76G, E76K, E90K, K206R, E315K, A348V, L351F, A439T 0001. The present invention relates to DNA polymerases, D452N, G504S, E507A, D551N, L552R, I553V, D578N, which possess increased resistance to PCR inhibitors, H676R, Q680R, D732G, E734G, E734K, F749V; wherein increased affinity to DNA substrate and increased DNA poly the polymerase mutant exhibits relative to wild-type DNA merization efficiency. polymerase increased polymerase speed, increased affinity to BACKGROUND OF THE INVENTION DNA substrate and/or increased resistance to a DNA poly merase inhibitor; and wherein, when the mutation is E507K 0002 Polymerase chain reaction (PCR) is probably the in combination with two or more further mutations or the most popular application in contemporary molecular biology mutation is Q680R in combination with four or more further and diagnostics. The key components of PCR are thermo mutations, at least one of the further mutations is at one of the stable DNA polymerases, which synthesize new DNA selected amino acid positions; and when the mutation is complementary to a DNA matrix. There are many different I553V, this is not in combination with D551 S. polymerases, which are used in PCR. Even though Taq DNA 0006 Taq DNA polymerase mutants may be provided polymerase was the first enzyme employed in PCR and many with increased resistance to SYBR Green I dye present in new enzymes were discovered since that time, this poly PCR mixture as well as mutants able to perform DNA ampli merase continues to be the most popular and widely used in fication faster and/or more efficiently as compared to the wild majority of PCR applications due to its robustness and effi type enzyme. One set of mutant variants of polymerase out ciency as well as easy and cost efficient production process. performs the wild type enzyme in PCR assays which contain Taq DNA polymerase has been studied very intensively and SYBR Green I fluorescent dye in reaction mixture. Another there is a lot of biochemical as well as structural data available set of mutants is useful in different PCR applications with on it. Within the course of these studies many different muta shorter DNA elongation times as compared to the ones typi tions of Taq DNA polymerase have been created and studied, cally required for the wild type Taq DNA polymerase. A third which in one or another way improve properties of this set of mutants exhibit increased resistance to blood, SDS, enzyme. Some mutations are important for enzyme fidelity GuHCl and heparin inhibition and may be used in direct DNA (U.S. Pat. No. 6,395,524, U.S. Pat. No. 6,602,695 and U.S. amplification from blood samples (at blood concentrations, Pat. No. 5.614.365), some alter 5'-3' exonuclease activity which are inhibitory to wild type Taq DNA polymerase) or (U.S. Pat. No. 5,466.591), change enzyme properties related from unpurified/partially purified DNA samples in different to labeled nucleotide incorporation (Brandis et al., 1998), lysis buffers. make the enzyme “cold sensitive” (Barnes and Kermekchiev, 0007. The wild type Taq DNA polymerase amino acid 2000) or increase polymerase resistance to different PCR sequence is shown in FIG.1. The numbering system used in inhibitors (Kermekchiev and Barnes, 2004; Kermekchiev and the present application is based on this sequence. A DNA Kirilova, 2006). Such mutants of Taq DNA polymerase are polymerase mutant according to the present invention com useful in qPCR, DNA sequencing, amplification of DNA prises the wild type sequence with a mutation at one of the samples containing various PCR inhibitors (dye, blood, soil). indicated selected amino acid positions or at a plurality of the For example, SYBR Green I intercalating dye is used in indicated selected amino acid positions. Where there is a qPCR. This inhibits Taq DNA polymerase and can decrease mutation at one or more of the indicated selected amino acid PCR efficiency and sensitivity. Increased polymerase resis positions it is also possible for there to be one or more further tance to SYBR Green I may be associated with increased mutations at other positions in the wild type sequence. The enzyme resistance to other PCR inhibitors from blood and number of these further mutations and the position of any soil (Kermekchiev et al., 2009; Zhang et al., 2010). such further mutation is such that the properties of increased 0003 Mutation at various differentamino acid positions in polymerase speed, increased affinity to DNA substrate and the Taq DNA polymerase are known to improve various dif increased resistance to a DNA polymerase inhibitor conferred ferent properties. These include K219, K225, E520, D578, by mutation at the indicated selected amino acid positions are A608 (Brandis et al., 1998: Holliger et al., 2001), S515 (Har not impaired. Such further mutations are preferably conser dinet al., 2006), A521, V529, Q592 (Brandis et al., 1998) and vative mutations. In a preferred embodiment mutations of the S543 (Jestin et al., 2005; Vatta et al., 2005). In one example, wildtype sequence occur only in the indicated selected amino the positively charged Taq DNA polymerase mutation E507K acid positions. It is also possible for there to be additions to is known to improve the RNA target dependent activity by the amino acid sequence, for example at one or both ends of 50% compared to the parent enzyme. the sequence, without Substantially affecting the activity of 0004 Currently PCR represents one of the fastest growing the polymerase. segments of molecular biology applications market. New 0008 Advantageously, the number of mutations at the one applications for PCR and new variants of PCR are being or more selected amino acid positions is limited, for example developed and introduced for research and diagnostic appli to no more than three of the selected amino acid positions. It cations, such as fast qPCR, digital PCR and direct sample-to has surprisingly been found that a relatively low number of PCR which require novel enzymatic properties. Therefore, mutations can give rise to advantageous properties of a there is a need in the industry for Taq DNA polymerase mutant polymerase. In one arrangement, the amino acid derivatives possessing novel, improved properties. sequence has a mutation at only one of the selected amino acid positions. In another arrangement, the amino acid SUMMARY OF THE INVENTION sequence has a mutation at only two of the selected amino 0005. In a first aspect, the present invention provides a acid positions. By providing DNA polymerase mutants with DNA polymerase mutant comprising a Taq DNA polymerase a limited number of mutations in the primary structure it is US 2013/0034.879 A1 Feb. 7, 2013 thought that the tertiary, three dimensional structure of the tion at the following selected amino acid positions: H28R-- polymerase is not altered significantly. Mutants according to E507K, H28R--Q680R, E507K+Q680R, L552R+Q680R, the invention can exhibit relative to wild type DNA poly E23OK+E507K, E189K+E507K, E315K+E507K, E23OK+ merase one or more of the advantageous properties of E315K, E507K+L552R. Such DNA polymerase mutants increased polymerase speed, increased affinity to DNA sub may exhibit both increased resistance to a DNA polymerase strate and increased resistance to a DNA polymerase inhibi inhibitor and exhibit an increased affinity to a DNA substrate tOr relative to wild type DNA polymerase. 0009. In one aspect of the invention, the DNA polymerase 0014 Preferably, the Kd of a DNA polymerase mutant mutant exhibits increased polymerase speed relative to wild exhibiting increased resistance to a DNA polymerase inhibi type DNA polymerase. Such DNA polymerase mutants tor for a DNA oligoduplex substrate is no more than 10 nM in include those with a mutation at one or more of the following the presence of SYBR Green I dye at a concentration of selected amino acid positions: E189K, E230K, E507K, approximately 0.4 um. This is typically measured as H28R, L30R, F73V, H75R, E76A, E76G, E76K, E90K, described above by electrophoretic shift mobility assay fol K206R, A439T. D452N, G504S, D551N, I553V, H676R, lowing incubation in a suitable buffer such as 40 mM Tris, 20 D732G, E734G, F749V. It is preferred that the DNA poly mM acetic acid, 1 mM EDTA at pH8.4, in the presence of merase mutant exhibits an increased polymerase speed which 10% v/v glycerol at 4°C. for 30 mins. is at least 1.5 times faster than wild type DNA polymerase, 0015. In one preferred arrangement according to the preferably at least three times and more preferably at least 12 invention the DNA polymerase mutant has mutations at one times faster. Polymerase speed may be measured by perform or more of the amino acid positions E189K, E230K and ing PCR on phage lambda DNA such as a 1825bp fragment E507K. Mutations at two or three of these positions give rise of phage lambda DNA. Alternatively, the polymerase speed to a DNA polymerase mutant which has both increased affin may be measured by performing PCR on human genomic ity to DNA substrate and increased resistance to SYBR Green DNA such as, for example, on a 2.5 kbp fragment. The PCR I dye. buffer used for such assays may be based either on KCl or on 0016. In a further aspect, the present invention provides a ammonium sulfate. Quantitative analysis of PCR products kit for nucleic acid amplification, such as PCR, which com may be performed using agarose gel electrophoresis, gener prises a DNA polymerase mutant as described herein together ally with 1% gels. Further details of typical measurements are with one or more reagents for a DNA synthesis reaction. Such presented in Example 2 below. reagents include appropriate buffers, primers and nucleotides 0010. In a further aspect, the DNA polymerase mutant suitable for the nucleic acid amplification reaction. according to the invention exhibits increased affinity to DNA 0017. The invention further provides a process for the substrate, relative to wild type DNA polymerase. The DNA production of a DNA polymerase mutant as described herein. polymerase mutant preferably includes a mutation at one or The process comprises: more of the following selected amino acid positions: E189K, E230K, E507K, H75R, E315K, A348V, L351F, L552R, 0.018 (1) subjecting a polynucleotide encoding a DNA D578N. The DNA polymerase mutant may include double polymerase to error-prone PCR to generate a mutant mutations wherein the selected amino acid positions are pref library comprising an array of differently-mutated poly erably selected from: H28R--E507K, H28R--Q680R, nucleotides; E507K+Q680R, L552R+Q680R, E230K+E507K, E189K+ 0.019 (2) screening the mutant library for increased E507K, E315K+E507K, E230K+E315K, E507K+L552R. polymerase speed, increased polymerase affinity to 0011 Increased affinity to DNA substrate is generally DNA substrate or increase resistance to a DNA poly expressed in terms of the dissociation constant Kd, which merase inhibitor; may typically be measured for a DNA oligoduplex substrate 0020 (3) selecting one or more mutant DNA poly for example using an electrophoretic shift mobility assay merases from Screening step 2; and following incubation in a suitable buffer such as 40 mM Tris, 0021 (4) repeating steps 1 to 3 until a final DNA poly 20 mMacetic acid, 1 mM EDTA at pH8.4, in the presence of merase mutant is obtained. 10% v/v glycerol at 4°C. for 30 mins. 0022. According to this process, the mutant library pro 0012. The Kd of wild type Taq DNA polymerase under duced by error-prone PCR in step (1) comprises an array of these conditions is generally in the range 1.71 to 3.97 nM. polynucleotides at least some of which incorporate one or Thus, a value of Kd below 1.71 nM denotes increased affinity more mutations. On the basis that the mutations are generated to the DNA oligoduplex substrate relative to the wild type in an essentially random way, some polynucleotides will polymerase. It is preferred that the Kd for the mutant poly encode DNA polymerases which are non-functional, some merase is no more than 1 nM and is typically in the range 0.14 will encode DNA polymerases which have essentially normal to 1 nM. function and others will encode DNA polymerases with prop 0013. In a further aspect, the DNA polymerase mutant erties which are either superior or inferior to the wild type according to the invention exhibits increased resistance to a DNA polymerase. Screening step (2) may typically be per DNA polymerase inhibitor. The DNA polymerase inhibitor formed on one or more members of the library so as to may be selected from SYBR Green I dye, blood, SDS, gua identify the desired characteristics of polymerases encoded nadinium salts and heparin. Such DNA polymerase mutants by the one or more members of the library. Following selec preferably include a mutation at one or more of the following tion step (3) a polynucleotide encoding one or more selected selected amino acid positions: E189K, E230K, E507K, DNA polymerases is subjected once again to error-prone H28R, L30R, G38R, H75R, E76A, E76G, E76K, E90K, PCR in accordance with step (1) and the process is repeated E315K, A439T. D452N, G504S, E507A, D551N, L552R, until Such time as a suitable mutant polymerase is obtained I553V, D578N, H676R, Q68OR, D732G, E734G, E734K. through screening and selection. This process of directed The DNA polymerase mutants may include a double muta evolution is described in further detail below. US 2013/0034.879 A1 Feb. 7, 2013

DETAILED DESCRIPTION OF INVENTION 0041 FIG. 18 shows the results of gel electrophoresis 0023 The invention will now be described in further following PCR of a 1.825 kbp amplicon performed in the detail, by way of example only, with reference to the accom presence of guanidinium hydrochloride comparing commer panying drawings, in which: cial Taq polymerase and wild type Taq polymerase with poly 0024 FIG. 1 shows the amino acid sequence of wild type merases according to the invention; and Taq DNA polymerase: 0042 FIG. 19 shows the results of gel electrophoresis 0025 FIG. 2 shows the results of gel electrophoresis fol following PCR of a 1.825 kbp amplicon performed in the lowing PCR of a 250 bp amplicon performed with wild type presence of heparin comparing commercial Taq polymerase polymerase and a pool of mutant polymerases at different and wildtype Taq polymerase with polymerases according to SYBR Green I concentrations; the invention. 0026 FIG. 3 shows the sequencing results of Taq DNA polymerase mutants selected after high throughput screening EXAMPLE 1. for SYBR Green I resistance: Mutant Taq DNA Polymerase Library Screening for 0027 FIG. 4 shows the frequency of mutations found dur ing high throughput screening of Taq DNA polymerase for Increased Resistance to SYBR Green I Dye SYBR Green I resistance: 0043 Taq DNA polymerase is widely used in qPCR 0028 FIG. 5 shows the results of gel electrophoresis fol because it is a robust and efficient enzyme, which has 5'-3' lowing PCR of a 200 bp amplicon comparing wild type poly exonuclease activity (required to activate Taqman probe), no merase with polymerases of the invention; 3'-5' exonuclease activity (no degradation of PCR primers) 0029 FIG. 6 shows the results of gel electrophoresis fol and is not sensitive to dUTP used to avoid contamination in lowing PCR of a 500 bp amplicon at different SYBR Green I qPCR master mixes. SYBR Green I intercalating dye used in concentrations using wild type enzymes or enzymes accord qPCR inhibits Taq DNA polymerse (Nath et al., 2000) and ing to the invention; can decrease PCR efficiency and sensitivity. In some cases 0030 FIG. 7 shows the results of polyacrylamide gel elec problem can be solved by adjusting buffer composition, reac trophoresis in an electrophoretic mobility shift assay for wild tion conditions and/or using higher amounts of Taq DNA type polymerase and polymerases according to the invention; polymerase. 0031 FIG. 8 shows the results of polyacrylamide gel elec 0044. In order to select for Taq DNA polymerase mutants trophoresis in an electrophoretic mobility shift assay for wild with increased resistance to SYBR Green I we have per type polymerase and polymerases according to the invention formed directed evolution of Taq DNA polymerase. The in the presence of SYBR Green I dye; amino acids sequence of parental wild type Taq DNA poly 0032 FIG. 9 shows the sequence of plasmid 1 used as a merase used for mutagenesis is given in FIG. 1. The initial PCR target for DNA amplification; library of genes (LO) coding for mutant Taq DNA poly 0033 FIG. 10 shows the sequencing results of Taq DNA merases was generated by error-prone PCR using a modified polymerase mutants selected after first high throughput protocol described by Zaccolo et al. (Zaccolo et al., 1996). screening of Taq DNA polymerase library for shorter ampli Quality of the library was checked by sequencing of 8 ran fication and annealing times; domly picked clones. One clone had deletion, which resulted 0034 FIG. 11 shows the frequency of mutations found in frameshift of coding sequence. Other 7 clones had from 2 during first high throughput Screening of Taq DNA poly to 6 nucleotide Substitutions per gene. The ratio of transitions merase library for shorter amplification and annealing times; to transversions was 2.4:1. As a result mutant polymerases 0035 FIG. 12 shows the sequencing results of Taq DNA had from 1 to 5 amino acids changes or on the average 2.85 polymerase mutants selected after the second high through mutations per gene. put screening of Taq DNA polymerase library for shorter 0045 SYBR Green I dye 10,000x stock solution was amplification and annealing times; obtained from Invitrogen and was used in our experiments. 0036 FIG. 13 shows the frequency of mutations found Several rounds of high-throughput screening were performed during the second high throughput Screening of Taq DNA for the expressed polymerase ability to perform PCR at polymerase library for shorter amplification and annealing increasing concentrations of SYBR Green I (0.6x-2.5x). times; After the several screening rounds 37 random clones of indi 0037 FIG. 14 shows the results of gel electrophoresis vidual mutants and the pool of all selected mutants were following PCR of a 1825 bp amplicon using various poly chosen for further investigation. Initially the pool of plasmids merases in the presence of ammonium sulfate or potassium encoding selected polymerases was purified. Then the N-ter chloride; minal (His)GlyAla tag was fused to PCR amplified Taq 0038 FIG. 15 shows the results of agarose gel electro polymerase genes. Pool of mutant enzymes and wt Taq poly phoresis following PCR on a 2.5 kbp amplicon with various merase with the same affinity tag were expressed in E.coli polymerases in the presence of ammonium Sulfate or potas cells and purified using Ni-NTA Superflow (Qiagen) chroma sium chloride; tography. In order to check the efficiency of our screening we 0039 FIG. 16 shows the results of gel electrophoresis have tested wit Taq polymerase and pool of mutants for ability following PCR of a 1.825 kbp amplicon in the presence of to perform PCR at different SYBR Green I concentrations blood comparing commercial and wild type polymerase with (FIG.2). In our particular (target/primer/buffer) amplification polymerases according to the invention; systemTaq DNA polymerase typically can synthesize 250 bp 0040 FIG. 17 shows the results of gel electrophoresis PCR fragment in the presence of 0.2-0.5x SYBR Green I dye. following PCR of a 1.825 kbp amplicon performed in the Meanwhile the pool of mutant Taq DNA polymerases can presence of SDS comparing commercial Taq polymerase and generate the same 250 bp PCR fragment in the presence of at wild type Taq polymerase with polymerases according to the least 2 times higher concentration (1x) of SYBR Green I dye invention; (FIG. 2). It is evident that in case of enzyme pool resistance to US 2013/0034.879 A1 Feb. 7, 2013

SYBR Green I inhibition is an average value and some of the SYBR Green I dye inhibition in PCR experiments are pre individual enzymes from the pool should have higher resis sented in Table 1. Performed PCR inhibition experiments tances, and some lower than the average resistance of the pool allowed us to identify many individual mutations, which of polymerases. Different properties of selected mutant increase Taq DNA polymerase resistance to SYBR Green I enzymes are determined by various mutations accumulated dye and may be used in production of commercial enzymes during the mutagenesis/screening procedure. Some muta and kits. Different mutants increase Taq polymerase resis tions should be beneficial, Some can be supplementary, neu tance from 2 to 10 times (1-5x concentration of SYBRGreen tral or even negative. Therefore it is critical to understand the I). Enzyme resistance to SYBR Green I dye is additive (cumu nature of selected mutants and elucidate individual properties lative) and in most cases can be increased constructing double of single amino acids changes. As a consequence 37 random or triple mutants. For example, mutant E23OK can tolerate clones of individual positive hits were sequenced and anal 2-2.5.x and E507K-2-3x concentration of SYBR Green I. ized (FIG. 3). Two clones (L6M1 1, L6M4 1) had stop Subsequently double mutant E230K+E507K can tolerate 3-4. codons and were excluded from further analyzis. The number 5x and triple mutant E230K+E507K+E189K-3.5-5x con of amino acid changes in selected mutants varies from 1 to 8. centration of SYBR Green I (Table 1). Many more multiple On average there are 3.6 amino acids changes per gene. The mutant combinations were tested and found to have increased frequency of all found mutations was calculated and is given SYBR Green I resistance comparing to single mutants (Table in FIG. 4. The most often mutated position in our selection 1). Additivity of SYBR Green resistance is very important was glutamate 507 (E507K-11 mutants; E507A-3). There feature, which enables design of mutant polymerases with are 4 selected clones, which contain only single mutation of individual properties according to specific application E507 amino acid (L6M8 1-E507A: L6M40 1, Taq B3, requirements. Taq A4-E507K) (FIG. 1). Other most frequently mutated 0048 Bioinformatic analysis of selected Taq DNA poly positions are H28 (H28R-6); F27 (F27L-3; F27S-1); K219 merase mutants with increased resistance to SYBR Green I (K219R-4); E230 (E230K-3; E230G-1); E76 (E76G-3) and dye revealed that in most cases changes were associated with E189 (E189K-3). amino acids which eliminate negative charge (E76G, E507A, 0046. The general assumption is that most frequently D578N, D732G), add positive charge (H28R, G38R, L552R, mutated amino acids are the most important and have the H676R, Q680R) or change negative charge to positive one biggest impact on Taq DNA polymerase resistance to SYBR (E90K, E189K, E230K, E315K, E507K). In all cases mutant Green I inhibition. In order to elucidate individual properties polymerases acquired higher total positive charge and either of different mutations single and multiple mutants of Taq could less interact with positively chargedSYBR Green Idye polymerase were constructed (with addition of N-terminal or should have increased affinity to negatively charged Sub (His)Gly-Ala tag for purification), expressed, partially puri strate (DNA). In both cases such enzymes should become fied and analyzed. The wt and mutant Taq DNA polymerases more resistant to SYBR Green I inhibition during PCR. If this were purified using two step procedure: initial denaturation of hypothesis is correct, then mutations scope could be broad E. coli proteins for 15 minutes at 75° C. and subsequent ened by using similar Substitutions and constructing mutants Ni-NTA affinity chromatography. As a result Taq DNA poly with increased positive charge (amino acids change X=>K, merase variants were typically purified to ~80% homogeneity R) or decreased negative charge network (amino acids change according to SDS-PAGE densitometry analysis. The activi D, E=>X). In order to test the polymerase affinity to DNA we ties of purified polymerases were evaluated using standard have measured dissociation constant (Kd) value of protein polymerase unit definition assay and if necessary (for DNA interaction using electrophoretic mobility shift assay example in PCR applications) equal amounts of polymerase (EMSA). Wild type Taq DNA polymerase and mutants Kd units were used for analysis. were measured directly (without SYBR Green I) and with 0047. The ability of wt and individual mutants of Taq SYBRGreen I. Polyacrylamidgel electrophoresis pictures of polymerase to perform PCR at different SYBR Green I con typical experiment are shown in FIGS. 7 and 8. Calculated Kd centrations was tested using many different target/primer/ values for wt Taq DNA polymerase and different mutant buffer systems. In this example we present two PCR per variants are summarized in the Table 2. The Kd of wt Taq formed either on plasmid DNA (~200 bp fragment) or on DNA polymerase and DNA oligoduplex complex was human genomic DNA (~500 bp fragment). Amplification is obtained to be in the range of 1.71-3.97 nM without SYBR performed in the presence of 0.2-5x concentration of SYBR Green I dye and in the range of 6.17-9.39 nM with SYBR Green I dye. The threshold concentration of SYBR Green I Green I (0.2x). Meanwhile most mutant variants have Kd dye (at which full length DNA fragment is still synthesized) is below 1.0 nM without SYBR Green I (E189K, E230K, determined and is used to characterize enzyme of interest E315K, E507K, L552R, D578N, H28R--E507K, H28R resistance to SYBR Green. The precise threshold value Q680R, E507K+Q680R, L552R+Q680R, E230K+E507K, depends on particular target/primer/buffer system used for E189K+E507K, E315K+E507K, E23OK+E315K, E507K-- PCR, therefore it is very important to have wt Taq DNA L552R, E189K+E230K+E507K) and <10 nM. Kd in the pres polymerase control reactions performed in parallel. Agarose ence of SYBR Green I. It is also important to stress that gel electrophoresis pictures of typical experiment are shown EMSA measurements performed at 0.1 nM concentration of in FIGS. 5 and 6. In both cases (amplification of 200 bp and oligoduplex are good to calculate Kd values above 1 nM and 500 bp DNA fragments) wt Taq DNA polymerase can syn give only approximate results for Kd values below 1 nM. thesize PCR product at 0.5x concentration of SYBR Green I Consequently Kd values determined for mutant Taq DNA dye in reaction mixture. Meanwhile Taq DNA polymerase polymerases to be in the range of 0.14-1 nM can be much mutants tolerate substantially higher concentrations of SYBR lower. Overall data confirm the statement, that mutations of Green I dye in reaction mixture (E189K-1.5x (200 bp) and interest, which were identified, possess 5-10 times increased 2.5x (500 bp): E230K-2.5x (200 bp) and 2x (500 bp): affinity to DNA substrate (E189K, E230K, E315K, E507K, E507K-2x (200 bp) and 3x (500 bp)). Summarized data of L552R, D578N, H28R-E507K, L552R+Q68OR, E23OK+ US 2013/0034.879 A1 Feb. 7, 2013

E507K, E189K+E507K, E315K+E507K, E230K+E315K, The reaction was stopped on ice, and an aliquot was spotted E507K+L552R, E189K+E230K+E507K). It is very likely, onto a DE-81 filter-paper disc. The disc was dried on a heat that SYBR Green I, present in PCR, binds to DNA target, block, washed in 7.5% sodium phosphate buffer for 5 minutes hinders polymerase binding to Substrate and in Such a way 3 times and once in 70% ethanol for 2 minutes, and then dried decreases the efficiency of PCR. Consequently mutant poly again. The incorporated radioactivity on the dried filter-paper merases with increased affinity are more resistant to SYBR disc was counted using a Beckman LS-1801 scintillation Green I inhibition. The Kd of some mutant polymerases counter. One unit of Taq DNA polymerase catalyzes the (E189K, E23OK, E315K, E507K, L552R, D578N, H28R incorporation of 10 nmol of deoxyribonucleotides into a E507K, H28R--Q680R, E507K+Q680R, L552R+Q680R, polynucleotide fraction (adsorbed on DE-81) in 30 min at 70° E315K+E507K, E23OK+E315K, E507K+L552R, E189K+ C. E230K+E507K) in the presence of SYBR Green I (0.2x) is increased to the level of wt Taq DNA polymerase Kd without Mutagenic PCR SYBR Green I and is below 5 nM (Table 2). Diminished Kd of mutant polymerases and DNA/DNA substrate complex 0.052 Mutant Taq DNA polymerase gene variants were confirms the hypothesis, that positive charges (accumulated constructed using modified error-prone PCR protocol during the screening of Taq DNA polymerase for SYBR described by Zaccolo (Zaccolo et al., 1996). Briefly, a PCR Green I dye resistance) increase the affinity of enzyme to comprising 75 mM Tris-HCl (pH 8.8 at 25° C.), 20 mM negatively charged DNA and in Such a way neutralize the (NH)SO, 0.01% (v/v) Tween 20, 10 ng template DNA inhibitory effect of positively charged SYBRGreen I dye. Taq forward and reverse primers (0.5 uMeach), dNTPs (200 uM DNA polymerases with increased affinity could be very use each), 0.4 uM dPTP (TriLink BioTechnologies), 10 uM ful in many different PCR and qPCR applications since in 8-oxo-dGTP (TriLink BioTechnologies), 1.5 mM MgCl2 and Some cases increased affinity can lead to increased enzyme 9.75 u of Taq polymerase in a total volume of 390 uL was processivity, polymerization Velocity, resistance to different carried out with the thermal profile 2 min at 94° C. followed inhibitors, more sensitive PCR, etc. by 30 cycles of 30s 94° C., 30 S 50° C., 2 min 40 s 72° C. and finished with 10 min at 72° C. Amplified PCR product was Methods and Materials digested with appropriate restriction endonucleases and cloned into an expression vector using T4 DNA ligase. Polymerase Purification 0049. The expression plasmid coding for the mutant or wt Mutant Taq DNA Polymerases are More Tolerant to SYBR Taq DNA polymerase variants fused to the N-terminal (His) Green I Dye in PCR Gly-Ala tag was expressed in E. coli cells. The E. coli cells were harvested by centrifugation at 4°C. (5000 rpm for 10 0053 10000x SYBR Green I dye solution was obtained min, Beckman J2-21 centrifuge, JA-10 rotor) and resus from Invitrogen (S7567) and stored in small aliquots at -20° pended in buffer A (50 mMNaH2PO,300 mMNaCl, 10 mM C. Fresh serial dilutions (in nuclease-free water) of SYBR imidazole and 10 mM 2-mercaptoethanol, pH 8.0) with 1 mM Green I dye stock solution were used in PCR. A typical SYBR phenylmethanesulphonyl-fluoride (Sigma). After Sonication Green I dye solution at a dilution of 0.2x is estimated to have on ice (7.5 min), samples were centrifugated at 16 170 g for a concentration of 0.4 uM (Gudnason et al 2007, Zipper et al 20 min (Eppendorf 5417R). Next, the supernatant was heated 2004). at 75° C. for 15 minto denature most of the E. coli meZofilic Amplification of 250 bp Bacterial Plasmid DNA Target with proteins. Pool of Mutant Taq Polymerases 0050 Precipitated proteins were removed by centrifuga tion (at 16 170 g for 20 min) and the supernatant was loaded 0054 PCR mixtures comprising 10 mM Tris-HCl (pH onto a Ni-NTA Superflow (Qiagen) minicolumn. To remove 8.8), 50 mM KC1, 0.08% (v/v) Nonidet P40, dNTPs (200M unspecifically bound proteins, the minicolumn was washed each), 1.5 mM MgCl, 0.5uM each of primer 1 and 2 (Table with buffer B (50 mM NaHPO, 300 mM NaCl, 20 mM 3), 6 ng plasmid 1 DNA (FIG. 9), 0.5 u of polymerase and imidazole, 10 mM 2-mercaptoethanol and 0.1% Triton various amounts of SYBR Green I dye (at the final concen X-100, pH 8.0); the polymerase was eluted with buffer C (50 tration of 0,0.2,0.5, 1, 1.5, 2, 4x) in a total volume of 20 LL mM NaH2PO4, 300 mM. NaCl, 250 mM imidazole, 10 mM were Subjected to the following thermocycling conditions: 2 2-mercaptoethanol and 0.1% Triton X-100, pH 8.0). Poly min at 94° C. followed by 30 cycles of 30s 94°C.,30s 50° C., merase was dialysed against storage buffer (20 mM Tris-HCl 20 s 72° C. PCR products were analyzed in 2% agarose gel (pH 8.0), 1 mM DTT, 0.1 mM EDTA, 100 mM KC1, 0.5% electrophoresis. (v/v) Nonidet P40, 0.5% (v/v) Tween 20 and 50% (v/v) glyc Amplification of 200 bp Bacterial Plasmid DNA Target with erol) and stored at -20°C. Mutant Taq Polymerases Polymerase Unit Definition Assay 0055 PCR mixtures comprising 10 mM Tris-HCl (pH 8.8), 50 mM KC1, 0.08% (v/v) Nonidet P40, dNTPs (200M 0051. The DNA polymerase activity of purified mutant each), 1.5 mM MgCl2, 0.5uM each of primer 3 and 4 (Table Taq DNA polymerases was measured according to the fol 3), 6 ng plasmid 1 DNA (FIG. 9), 0.5 u of polymerase and lowing protocol. The enzyme was incubated in a reaction various amounts of SYBR Green I dye (at the final concen mixture (50 ul) consisting of 67 mM Tris-HCI (pH 8.8), 6.7 tration of 0,0.2,0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5 or 5x) in a total mM MgCl, 50 mM. NaCl, 1 mM DTT, 0.1 mg/ml BSA, 200 volume of 20 uL were subjected to the following thermocy uM of each of dATP, dCTP, dTTP and dGTP, 0.4 MBq/ml of cling conditions: 3 min at 94°C. followed by 30 cycles of 30 methyl-Hlthymidine 5'-triphosphate (Amersham), and 250 s 94° C.,30s 50° C., 15s 72° C. PCR products were analyzed ug/ml of activated salmon sperm DNA at 70° C. for 30 min. in 1-2% agarose gel electrophoresis. US 2013/0034.879 A1 Feb. 7, 2013

Amplification of 500 bp Human Genomic DNA Target with EXAMPLE 2 Mutant Taq Polymerases 0056 PCR mixtures (20 uL) containing: 10 mM Tris-HCl Mutant Taq DNA Polymerase Library Screening for (pH 8.8), 50 mM KC1, 0.08% (v/v) Nonidet P40, dNTPs (200 Increased Amplification Speed uM each), 1.5 mM MgCl, 0.5 LM each of primer 5 and 6 0059 PCR and qPCR applications are widely used in (Table 3), 40 ng of human genomic DNA, 0.5u of polymerase almost all molecular biology, biochemistry and clinical diag and various amounts of SYBR Green I dye (at the final con nostic laboratories over the world. Faster PCR applications centration of 0,0.2,0.5, 1, 1.5, 2, 2.5,3,3.5, 4, 4.5 or 5x) were are highly desirable due to the fact that they decrease time Subjected to the following thermocycling conditions: 3 minat spent for DNA amplification, required machine working time 95° C. followed by 35 cycles of 30s 95°C., 30 s 60° C., 30s and increase the efficiency of analytical procedure. Fast PCR 72°C. PCR products were analyzed in 1% agarose gel elec machines are already available on the market and now the trophoresis. limiting step is the enzyme Suitable for fast applications. Taq DNA polymerase, which is widely used in PCR and qPCR. Increased Affinity of Mutant Taq DNA Polymerases for was subjected to in vitro evolution aiming to increase its Primer-Template DNA amplification speed and decrease time required for elongation step during PCR. Two different libraries of Taq DNA poly Preparation of Radioactively Labeled Probe for merase were used for high-throughput screening in this Electrophoretic Mobility Shift Assay example. 0057 Radioactively labeled probe for electrophoretic mobility shift assay was prepared as follows. A single 1 Screening stranded 24-mer oligonucleotide 1 was radioactively labeled at 5'-termini with polynucleotide kinase (PNK). Briefly, reac 0060. The same mutant Taq DNA polymerase library (LO) tion mixture containing 1x PNK buffer A (50 mM Tris-HCl as in Example 1 was used for selection of improved Taq DNA (pH 7.6), 10 mM MgCl, 5 mM DTT, 0.1 mM spermidine), 1 polymerase variants. Several rounds of high-throughput uMoligonucletide 1, 1 uMY-P-ATP (Hartmann Analytic) screening were performed testing expressed polymerase abil and 0.5 u?ul PNK was incubated at 37° C. for 30 min, then ity to perform PCR using shorter and shorter amplification PNK was inactivated by heating the sample at 70° C. for 10 and annealing times with every Screening round. Subse min. A dsDNA probe for electrophoretic mobility shift assays quently 43 random clones of individual mutants were was prepared by annealing radioactively labeled oligonucle sequenced and analized (FIG.10). Two clones (L8-10, L8-42) otide 1 to a single-stranded 44-mer oligonucleotide 2 as fol had stop codons and were excluded from further analyzis. The lows. A mixture consisting of 75 mM Tris-HCl (pH 8.8), 20 number of amino acid changes in selected mutants varies mM (NH)SO, 0.01%(v/v) Tween 20, 2 mMMgCl2, 20 nM from 2 to 12. On average there are 5.4 amino acids changes of unpurified radioactively labeled oligonucleotide 1 and 25 per gene. The frequency of all identified mutations was cal nM of oligonucleotide 2 was incubated at 94° C. for 4 min, culated and is given in FIG. 11. The most often mutated then the sample was transferred to the glass with pre-boiled positions in this selection were glutamate 230 (E230K-33 mutants), leucine 30 (L30P-21 mutants; L30R-10; L30O water and left to cool slowly overnight. 1), aspartate 452 (D452N-18 mutants), glycine 504 (G504S Electrophoretic Mobility Shift Assay 15 mutants), leucine 311 (L311 F-4 mutants; L311 R-1), glutamate 507 (E507A-3 mutants; E507G-2), glutamate 189 0058 Serial dilutions of mutant Taq polymerase were pre (E189K-4 mutants). There are 2 identical selected clones pared in polymerase storage buffer: 20 mM Tris-HCl (pH (L8-9, L8-39), which specifically contain only 4 most fre 8.0), 1 mM DTT, 0.1 mM EDTA, 100 mM KC1, 0.5% (v/v) quent mutations (L30P, E230K, D452N, G504S). Nonidet P40, 0.5% (v/v) Tween 20 and 50% (v/v) glycerol. Mutant Taq polymerase at various concentrations (0.25, 0.5, 2"Screening 1, 2.5, 5, 10, 25, 50, and 100 nM) was incubated with 0.1 nM radioactively labeled dsDNA probe (see above) in 1x TAE 0061 An additional screening of Taq DNA polymerase for buffer (40 mM Tris, 20 mMacetic acid, 1 mM EDTA, pH 8.4) mutant variants able to perform PCR at shorter amplification with 10% (vol/vol)glycerol and without or with Sybr Green and annealing times was performed using library (L3) with I dye (0.2x final concentration) at +4°C. for 30 min. 5ul of increased mutational load. The L3 library was also generated samples were run on a native 12% polyacrylamide gel to by error-prone PCR using a modified protocol described by separate the protein-DNA complex from the free DNA. Gels Zaccolo et al. (Zaccolo et al., 1996). Quality of the library was were dried and exposed to storage phosphor Screens (FujiF checked by sequencing of 9 randomly picked clones. Two ilm). Screens were scanned with phosphorimager scanner clones had deletions, which resulted in frameshift of coding (Typhoon) at resolution 100. The concentration of poly sequence. Other 7 clones had from 2 to 9 nucleotide substi merase-DNA complex was determined from Scanned gels tutions per gene. The ratio of transitions to transversions was using Total lab 100; the dissociation constant of polymerase 6:1. As a result mutant polymerases had from 1 to 5 amino DNA complex K (nM) was calculated with GraphPad using acids changes or on the average 3 mutations per gene. Several the following equation: rounds of high-throughput screening were performed testing expressed polymerase ability to perform PCR using shorter and shorter amplification and annealing times with every screening round. Subsequently 42 random clones of indi where ESI is the concentration of formed polymerase-DNA vidual mutants after the screening were sequenced. Two complex (nM), Elo is the initial concentration of polymerase clones had deletions/insertions, three clones had truncated N (nM), So-the initial concentration of DNA substrate (0.1 terminus and were omitted from analyzis (FIG. 12). The nM). number of amino acid changes in selected mutants varies US 2013/0034.879 A1 Feb. 7, 2013

from 2 to 10. On average there are 5.4 amino acids changes SO based buffer (FIG. 15A). Using KCl based buffer some per gene. The frequency of all found mutations was calculated mutant enzymes (point mutants) were able to amplify target and is given in FIG. 13. The most often mutated positions in under fast ~25 S/kb (E230K; E507K) and even very fast ~12 this selection were phenylalanine 73 (F73V-3 mutants: s/kb (E230K; E507K) cycling conditions (FIG. 15B). Many F73S-1: F73L-1), aspartate 144 (D144G-4 mutants: more point mutants of Taq DNA polymerase identified during D144N-1), lysine 206 (K206R-5 mutants), leucine 30 our screenings were tested in the same type PCR assay under (L30P-3 mutants), histidine 75 (H75R-3 mutants), normal, fast and very fast cycling conditions. Summarized glutamate 90 (E90G-3 mutants), lysine 143 (K143E-2 data on all PCR are given in Table 4. The Taq mutant consid mutants; K143R-1), leucine 351 (L351F-3 mutants), ered to be fast if it was able to amplify both targets from phage glutamate 397 (E397K-2 mutants; E397G-1), alanine 439 lambda and human genomic DNA under fast cycling condi (A439T-3 mutants). tions at least in one buffer system (with (NH)SO or with KCl): E76G; E76A: D551N; I553V; D732G; F73V; H75R; Mutant Analysis K206R: A439T; F749V; D452N; G504S (Table 4). The Taq mutant considered to be very fast if it was able to amplify both 0062. The general assumption is that most frequently targets from phage lambda and human genomic DNA under mutated amino acids found during the screening are the most very fast cycling conditions at least in one buffer system (with important and have the biggest impact on Taq DNA poly (NH)SO or with KCl): E90K; E189K: E230K; E507K: merase properties. Site specific mutagenesis was used to con H676R: H28R: E76K; E734K; L30R (Table 4). Two high struct novel polymerase mutants, by introducing mutation throughput Screenings using Taq mutants libraries L0 or L3 most oftenly found in our selective enrichment procedure and were performed in this example. The frequencies of all found which were not described elsewhere in the literature. In order mutations are calculated and given in FIGS. 11 and 13. As in to elucidate individual properties of different mutations Example 1 most of mutants either possess eliminated nega single mutants of Taq polymerase were constructed (with tive charge (D452N, E507G, E507A, D144G, D144N, E90G, addition of N-terminal (His)Gly-Ala tag for purification), E397G), added positive charge (L30R, L311R, H75R) or expressed, partially purified and analyzed. The wt and mutant changed negative charge to positive one (E230K, E189K, Taq DNA polymerases were purified using two step proce E397K). Consequently mutant polymerases became more dure: initial denaturation of E. coli proteins for 15 minutes at positively charged and could have increased affinity to nega 75° C. and subsequent Ni-NTA affinity chromatography. As a tively charged substrate (DNA). In order to test the poly result Taq DNA polymerase variants were typically purified merase affinity to DNA we have measured dissociation con to -80% homogeneity according to SDS-PAGE densitometry stant (Kd) value of protein-DNA interaction using analysis. The activities of purified polymerases were evalu electrophoretic mobility shift assay (EMSA). Calculated Kd ated using standard polymerase unit definition assay and, if values for wt Taq DNA polymerase and different mutant necessary (for example in PCR applications), equal amounts variants are summarized in the Table 5. The Kd of wt Taq of polymerase units were used for analysis. The ability of wt DNA polymerase and DNA oligoduplex complex was and individual mutants of Taq polymerase to perform PCR obtained to be in the range of 1.71-3.97 nM (Table 2). In using shorter amplification and annealing times was tested addition to already previously identified mutants with using few different target/primer/buffer systems. Four PCR increased affinity Kdk1 nM (E230K, E189K) we have found, were performed either on phage lambda DNA (1825bp frag that mutants A348V. H75R and L351F have Kdk1 nM (Table ment) or on human genomic DNA (~2.5 kbp fragment) using 1) and should be attributed to the group of high affinity Taq PCR buffer based either on KCl or on (NH)SO (see meth mutants described in Example 1 (Table 2). ods and materials). Amplification was performed using three 0063 Mutants of Taq DNA polymerase able to perform different in length (Normal, Fast, Very fast) cycling condi tions. In all cases wt Taq DNA polymerase with His tag PCR under fast or very fast conditions could be used in fast purified in similar way was used as a control. Agarose gel PCR and qPCR applications, saving instrument and electrophoresis pictures of typical experiment are shown in researcher time, increasing laboratory throughput Volume. FIGS. 14 and 15. Phage lambda DNA amplification (1825bp Methods and Materials fragment) was performed using -30 S/kb (normal), ~10 S/kb (fast) and 2.5 S/kb (very fast) extension rates. Recommended Polymerase Purification extension rate for Taq DNA polymerase is 30-60 S/kb. In this test PCR wt Taq DNA polymerase used as a control was able 0064. The same as in Example 1. to amplify 1825 bp DNA fragment only under normal (-30 S/kb) cycling conditions (FIG. 14). Mutant enzymes (point Polymerase Unit Definition Assay mutants) identified in our screening were able to amplify 0065. The same as in Example 1. target under fast ~10 s/kb (L30R: E230K; D452N; G504S: E507K: E189K) and even very fast -2.5 S/kb (L30R: E230K; Mutagenic PCR E507K: E189K) cycling conditions (FIG. 14). Human genomic DNA amplification (~2.5 kbp fragment) was per 0066. The same as in Example 1. formed using -50 S/kb (normal), -25 S/kb (fast) and 12 S/kb Mutant Taq DNA Polymerases Synthesize DNA Faster in (very fast) extension rates. In this test PCR wt Taq DNA polymerase used as a control has synthesized only minor End-Point PCR Than Wild-Type Taq amount of 2.5 kbp DNA fragment even under normal (-50 0067 Amplification of 1825bp Phage Lambda DNA Tar S/kb) cycling conditions (FIG. 15). Meanwhile mutant get with Mutant Taq DNA Polymerases enzymes (point mutants) identified in our screening were able 0068. PCR mixtures comprising 10 mM Tris-HCl (pH to amplify target under fast ~25 S/kb and even very fast ~12 8.8), 50 mM KC1, 0.08% (v/v) Nonidet P40, 1.5 mM MgCl, s/kb (E189K: E230K; E507K) cycling conditions in (NH) (buffer with KCl) or 75 mM Tris-HCl (pH 8.8), 20 mM US 2013/0034.879 A1 Feb. 7, 2013

(NH)SO, 0.01%(v/v) Tween 20, 2 mMMgCl, (buffer with DNA fragment even in the presence of 0.5% of blood. Mean (NH)SO) and dNTPs (200 uM each), 0.5 M each of while mutant polymerases (E189K, E230K, E507K, H28R) primer 7 and 8 (Table 3), 0.25 ng phage lambda DNA, 0.5u of were able to perform PCR in the presence of 4-8% of blood. polymerase in a total volume of 25 uL were subjected to the I0081) Typical picture of PCR inhibition with SDS is given following three thermocycling conditions: in FIG. 17. Under chosen PCR conditions commercial Taq 0069. 1) 5 min at 95° C. followed by 20 cycles of 30s and wt his-Taq synthesized specific DNA fragment in the 95° C., 30 s 60° C., 60s 72° C.; presence of 0.0025% and 0.001% of SDS respectively. Mean (0070 2) 5 min at 95° C. followed by 20 cycles of 30s while mutant polymerases (E189K, E230K, E507K) were 95° C., 10 s 60° C., 20s 72° C.; able to perform PCR in the presence of 0.005-0.0075% of (0071 3) 5 min at 95° C. followed by 20 cycles of 30s SDS. 95° C., 5 s 60° C., 5 s 72° C. I0082 Typical picture of PCR inhibition with GuHCl is 0072 PCR was performed on Eppendorf Mastercycler, given in FIG. 18. Under chosen PCR conditions commercial using "BLOCK CONTROL option, ramping slope 3°/s. Taq synthesized specific DNA fragment in the presence of 20 PCR products were analyzed in 1% agarose gel electrophore mM of GuHC1. Another control enzyme withis-Taq (should S1S. be used for direct comparison with Taq polymerase mutants) Amplification of 2.5 kb Human Genomic DNA Target with was notable to synthesize 1.8 kbp DNA fragment even in the Mutant Taq Polymerases presence of 10 mM of GuHC1. Meanwhile mutant poly 0073 PCR mixtures (25uL) comprising 10 mM Tris-HCl merases (E189K, E230K, E507K, H28R) were able to per (pH 8.8), 50 mM KC1, 0.08% (v/v) Nonidet P40, 1.5 mM form PCR in the presence of 40-70 mM of GuHC1. MgCl, (buffer with KCl) or 75 mM Tris-HCl (pH 8.8), 20 mM I0083) Typical picture of PCR inhibition with heparin is (NH)SO, 0.01%(v/v) Tween 20, 2 mMMgCl, (buffer with given in FIG. 19. Under chosen PCR conditions commercial (NH)SO) and dNTPs (200 uM each), 0.5 M each of Taq and withis-Taq synthesized specific DNA fragment in the primer 9 and 10 (Table 3), 125 ng human genomic DNA presence of 0.0025 UPS and 0.001 UPSheparin (per 25ul of (blood purified, using “Genomic DNA purification Kit' PCR reaction) respectively. Meanwhile mutant polymerases (K0512-Fermentas)), 0.5u of polymerase were subjected to (D452N, D551N, G504S) were able to perform PCR in the the following thermocycling conditions: presence of 0.0062 UPSheparin (per 25ul of PCR reaction). (0074 1) 5 min at 95° C. followed by 30 cycles of 30s I0084 Summarized data on all PCR inhibition experiments 95° C., 30 s 65° C., 2 min 72° C. are given in Table 6. Tested Taq DNA polymerase mutants 0075 2) 5 min at 95°C. followed by 30 cycles of 30s have different resistances to various PCR inhibitors. Some 95° C., 20 s 65° C., 1 min 72° C. mutants are more resistant to blood (E189K, E230K, E507K, (0076. 3) 5 min at 95° C. followed by 30 cycles of 30s H28R), some mutants are more resistant to SDS (E189K, 95° C., 10 s 60° C., 30s 72° C. E230K, E507K, E90K, E76K, H676R, L30R, D452N, 0077. PCR was performed on Eppendorf Mastercycler, E734K, D732G, D551N, I553V, G504S, HT5R, E76G, using "BLOCK CONTROL option, ramping slope 3°/s. E76A, A439T. E734G), some mutants are more resistant to PCR products were analyzed in 1% agarose gel electrophore GuHCL (E189K, E230K, E507K, H28R, E90K, E76K, S1S. H676R, L30R) and some mutants are more resistant to hep arin (D452N, D551N, G504S) (Table 6). Most interesting are Increased Affinity of Mutant Taq DNA Polymerases for Taq mutants with the highest resistances to tested PCR inhibi Primer-Template DNA tors (except heparin) and increased amplification speed: 0078. The same as in Example 1. E189K, E230K and E507K (Table 6 and Table 4). I0085 Mutants of Taq DNA polymerase able to perform EXAMPLE 3 PCR in the presence of different inhibitors are very important and can be used for amplification of partially purified or Mutants of Taq DNA Polymerase Resistant to unpurified DNA samples. Skipped or simplified nucleic acids Different PCR Inhibitors purification step makes diagnostic procedure faster, cheaper and more convenient for user. Different “direct PCR' kits 0079 Mutant polymerases with increased resistances from plants, tissues, blood, etc could be prepared and com could be used in PCR and qPCR applications without target mercialized on the basis of newly discovered mutations and DNA purification step (directly after the lysis or after partial/ their combinations. simplified purification step). Consequently we have tested most interesting Taq DNA polymerase mutants identified in Methods and Materials example 1 and example 2 in PCR performed with various inhibitors known to be incompatible with wt Taq DNA poly The Measurements of wt Taq DNA Polymerase and Mutant merase. PCR was performed on phage lambda DNA using Enzymes Resistance to Different PCR Inhibitors Taq DNA polymerase (recombinant, Fermentas, it EP0404) and wt His-Taq as the controls. The set of Taq DNA poly I0086 Amplification of 1825bp Phage Lambda DNA Tar merase single amino acid mutants (E189K: E230K; E507K: get with Mutant Taq DNA Polymerases H28R: E90K; E76K; H676R; L30R: D452N; E734K; I0087 PCR mixtures comprising 50 mM Tricine (pH 8.8), D732G; D551N; I553V; G504S: H75R; E76G: E76A: 20 mM (NH)SO, 0.01% (v/v) Tween 20, 2.5 mM MgCl, A348V: A439T; E734G) was tested for increased resistance dNTPs (200uMeach), 0.5uMeach of primer 7 and 8 (Table to different PCR inhibitors (blood: SDS, GuHCl, heparin). 3), 0.25 ng phage lambda DNA, INHIBITORX and 1 u of 0080 Typical picture of PCR inhibition with blood is polymerase in a total volume of 25 uL were subjected to the given in FIG. 16. Under chosen PCR conditions neither com following thermocycling conditions: 5 min at 95°C. followed mercial Taq, nor wt his-Taq were able to synthesize 1.8 kbp by 30 cycles of 20s 95°C., 25 s 60° C., 80s 72° C. PCR was US 2013/0034.879 A1 Feb. 7, 2013

performed on Eppendorf Mastercycler epgradient S, PCR TABLE 2-continued products were analyzed in 1% agarose gel electrophoresis. INHIBITOR X: The dissociation constants (Kod) of wt and mutant Taq DNA polymerases and oligoduplex substrate determined without and 0088 Fresh blood stabilized with sodium citrate 0%, with (0.2X) SYBR Green I dye. EMSA measurements were 0.5%, 1%, 2%, 4%, 8% (v/v); performed at fixed 0.1 nM concentration of oligoduplex and I0089 SDS (Sodium Dodecyl Sulphate, Amresco 0227-1 0.25-100 nM concentration gradient of polymerase. kg) 0%, 0.001%, 0.0025%, 0.005%, 0.0075%, 0.015% (w/v); Kd 0090 GuHCl (Guanidine Hydrochloride, Roth 0037.1) 0 mM, 10 mM, 20 mM, 40 mM, 70 mM, 100 mM; Mutant name Kd, nM (+0.2XSYBR Green I), nM 0091 Heparin (Sigma, H3125) 0, 0.001, 0.0025, 0.00625, 0.015625, 0.039 UPS heparin (per 25 ml of PCR E31SK O.SO 2.50 reaction). ESO7A 1.14 7.29 E507K O-18-0.19 3.91-422 TABLE 1. LSS2R O.S3 188-749 D578N O.70 2.66 The threshold concentrations of SYBR Green I dye H676R 4.87 10.94 (at which full length DNA fragment is still synthesized) determined for wt and different mutants of Taq DNA polymerase. Q68OR 3.18 9.61 SYBR Green I stock concentration is 10'000X and D732G 1.82 8.10 amplification was performed using 0.2-5X concentration of dye. H28R-ESO7K O.25 4.71 Amplification of H28R + Q68OR O.95 2.17 200 bp Amplification of 500 bp E507K + Q68OR O.71 3.25 fragment from fragment from human Mutant name plasmid DNA genomic DNA L552R + Q68OR O.29 2.63 E23 OK - ESO7K O.18 2.73-795 witHis-Taq O.S O.2-0.5 E189K - ESO7K O.29 6.61 H28R G38R E31SK - ESO7K O.30 3.66 E76G n.d. E23 OK - E315K 0.37 2.60 E90K .5 .5 E189K .5 2.5 ESO7K - LSS2R O.25 2.13 E23 OK 2.5 2 E189K -- E23OK - ESO7K O.14 O43 E31SK .5 .5 ESO7A 2 .5 E507K 2 3 *the range of Kd values is given if more than one experiment was performed LSS2R 2 .5 D578N .5 H676R .5 TABLE 3 Q68OR D732G The oligonucleotide sequences used in Examples. H28R-ESO7K 2.5 n.d. H28R + Q68OR .5 .5 Oligo E507K+ Q68OR 2.5 n.d. nucleotide Designation Sequence (5' to 3') L552R + Q68OR 3.5 n.d. E23 OK - ESO7K 4.5 3 Primer 1 agseql GCGTTATCTCATAGACAAGG GC E189K-ESO7K 5 4 E315K. ESO7K 4 4 Primer 2 agseq2 GTAAGTTATTATCACATCCG GGTC E23 OK - E31SK 3 2.5 ESO7K - LSS2R n.d. 3 Primer 3 Pra1 AATGGCTAGCTGGAGCCAC E189K-- E23OK - ESO7K 5 3.5 Primer 4 Seq prom TATCTCCT CAATAGCGGAGTCATC n.d.—not determined Primer 5 Forward CAAGGTCATCCATGACAACTTTG GAPDH

TABLE 2 Primer 6 Rewerse GTCCACCACCCTGTTGCTGTAG GAPDH The dissociation constants (Kod) of wt and mutant Taq DNA polymerases and oligoduplex substrate determined without and Oligo- A422 TTTTAGCCGCTAGAGTCGACCTGC with (0.2X) SYBR Green I dye. EMSA measurements were nucleotide 1 performed at fixed 0.1 nM concentration of oligoduplex and 0.25-100 nM concentration gradient of polymerase. Oligo- A424 GGAGACAAGCTTGTATGCCTGCAGGT nucleotide 2 CGACTCTAGCGGCTAAAA Kd Mutant name Kd, nM (+0.2XSYBR Green I), nM Primer 7 - 16 ATCCTGAACCCATTGACCTCCAAC witHis-Taq 1.71-3.97% 6.17-9.39 Primer 8 - 19 ACTGAATCCCCGATCATCTATCGC H28R O.83-1.59 2.61-8.39 G38R 2.47 7.24 Primer 9 CAGCTCAGTGGTTTTCATTG GTTG E90K 1.53 7.86 E189K O.40 2.69 Primer 10 CTGTGAGGCAGAGACAGCAGAGAC E23OK 0.37 4.76 US 2013/0034.879 A1 Feb. 7, 2013 10

TABLE 4 The summarized data on different PCR experiments performed under normal (1), fast (2) and very fast (3) cycling conditions. PCR was performed on two different targets: phage lambda and human genomic DNA in two different buffers based either on (NH4)2SO4 or on KCI. amplification of 1825 bp DNA fragment from amplification of 2.5 kbp DNA fragment from phage lambda DNA human genomic DNA with (NH4)2SO4 with KC with (NH4)2SO4 with KC Polymerase 1 2 3 1 2 3 1 2 3 1 2 3

Taq DNA pol. ------Fermentas #EPO404 witHis-Taq ------Y24H ------T26R ------F27S ------G38R ------E76G ------E90K ------insp E189K ------E23 OK ------E507K ------D551N ------553V ------H676R ------D732G ------H28P ------H28R ------F73V ------H75R ------E76A ------E76K ------insp -- K143E ------K2O6R ------R275G ------F278L ------D344N ------L351F ------E397K ------N415D ------A439T ------E734G ------E734K ------. ------insp F749L. -- F749V ------L3OP ------L3OR ------D452N ------GSO4S ------F285S ---- L311F ------A348V ------insp—non-specific amplification +—minor amount of target PCR fragment ++ normal amount of target PCR fragment +++-abundant amount of target PCR fragment

TABLE 5 TABLE 5-continued The values of dissociation constant (Kid) determined for oligoduplex The values of dissociation constant (Kid) determined for oligoduplex Substrate and mutant Taq DNA polymerases in Example 2. Substrate and mutant Taq DNA polymerases in Example 2. EMSA measurements were performed at fixed 0.1 nM concentration EMSA measurements were performed at fixed 0.1 nM concentration of oligoduplex and 0.25-100 nM concentration gradient of polymerase. of oligoduplex and 0.25-100 nM concentration gradient of polymerase. The WT-Taq polymerase Kid is 1.71-3.97 nM. The WT-Taq polymerase Kid is 1.71-3.97 nM.

Mutant name Mutant Mutant name Mutant (1st name (2” (1st name (2” Screening) Frequency Kid, nM screening) Frequency Kd, nM Screening) Frequency Kid, nM screening) Frequency Kd, nM

E23OK 33 0.37: F73V 5 4.56-4.92 D452N 18 1.14 L3OP 3 3.08 L3OP 32 3.08 K2O6R 5 242-12.72 GSO4S 15 6.03 HASR 3 0.57 L3OR 2.43 L311F 5 3.20 E90K 3 1.53%

US 2013/0034.879 A1 Feb. 7, 2013

TABLE 7-continued Summary of Taq DNA polymerase mutants Resistance Increased Increased to SYBR Resistance Resistance Resistance Resistance Mutation speed affinity Green to blood to SDS to GuHCl to heparin

E189K-ESO7K -- -- E31SK-ESO7K -- -- E23OK - E31 SK -- -- ESO7K - LSS2R -- -- E189K-- E23 OK.------

Summarized information from Tables 1,2,4, 5, 6 and FIG, 19.

REFERENCES AMPLIFICATION IN THE PRESENCE OF PCR INHIBITORS. WOO8O3411OA2 0092 Abramson, R. D. and Gelfand, D. H. (1993). 5' to 3' exonuclease mutations of thermostable DNA polymerases. 0104 Kermekchiev, M. B. and Barnes, W.M. (2004). USE U.S. Pat. No. 5,466,591 OF WHOLE BLOOD IN PCR REACTIONS 0093. Abramson, R. D. and Gelfand, D. H. (1993). 5' to 3' EP1747290A2 exonuclease mutations of thermostable DNA polymerases. 0105 Kermekchiev, M. B., Kirilova, L. I. Vail, E. E. and U.S. Pat. No. 5,466,591 Barnes, W. M. (2009). Mutants of Taq DNA polymerase 0094 Allawi, H., BARTHOLOMAY. C. T. CHEHAK, L, resistant to PCR inhibitors allow DNA amplification from CURTIS, M. L., EIS, P. S. HALL, J. G., IP, H. S. KAISER, whole blood and crude soil samples. Nucleic Acids Res, 37, M. KWIATKOWSKI, R. W.J., LUKOWIAK, A.A, LYAM e40. ICHEV, V, MA, W, OLSON-MUNOZ, M. C, OLSON, S. 0106 Leconte, A. M., Patel, M. P. Sass, L. E. McInerney, M, SCHAEFER, J. J., SKRZYPCZYNSKI, Z, TAKOVA, P. Jarosz, M. Kung, L, Bowers, J. L. Buzby, P. R. Efcavitch, T.Y. VEDVIK, K. L., LYAMICHEV, N. E. and NERI, B. P. J. Wand Romesberg, F. E. (2010). Directed Evolution of (2001). DETECTION OF RNA. WO/2001/090337 DNA Polymerases for Next-Generation Sequencing. 0095 Barnes, W.M. and Kermekchiev, M.B. (2000). Cold Angew Chem Int Ed Engl sensitive mutant DNA polymerases. U.S. Pat. No. 6,214, 0107 Loeb, L.A., Hood, L and Suzuki, M. (1996). Ther 557 mostable polymerases having altered fidelity and method 0096. Brandis, J., Bloom, C and Richards, J. H. (1998). of identifying and using same. U.S. Pat. No. 6,395,524 DNA polymerases having improved labeled nucleotide incorporation properties. U.S. Pat. No. 6,265,193 (0.108 Nath, K., Sarosy, J. W. Hahn, J and Di Como, C.J. 0097. Brandis, J., Bloom, C and Richards, J. H. (1998). (2000). Effects of ethidium bromide and SYBR Green I on DNA polymerases having improved labeled nucleotide different polymerase chain reaction systems. J Biochem incorporation properties. U.S. Pat. No. 6,265,193 Biophy's Methods, 42, 15-29. 0098 Gudnason, H., Dufva, M., Bang, D.D. and Wolff, A. 0109 Patel, P. H. and Loeb, L. A. (2001). DNA poly (2007). Comparison of multiple DNA dyes for real-time merase mutant having one or more mutations in the active PCR: effects of dye concentration and sequence composi site. U.S. Pat. No. 6,602,695 tion on DNA amplification and melting temperature 0110 Tabor, S. and Richardson, C. (1994). DNA poly Nucleic Acids Res, 35, e127 merase having modified nucleotide binding site for DNA 0099 Hardin, S., Gao, X, Briggs, J, Willson, Rand Tu, S. sequencing. U.S. Pat. No. 5,614.365 (2006). Mutant polymerases. US2007/0172861 0111 Vatta, P., Brandis, J. W. Bolchakova, E.V and Spur 0100 Holliger, P., Ghadessy, F and D'Abbadie, M. geon, S.L. (2005). Mutant DNA polymerases and methods (2006). Generating a pol A DNA polymerase, useful in of use. US20060223,067 PCR amplification, sequencing of damaged DNA tem 0112 Zaccolo, M., Williams, D. M. Brown, D. M and plates, or in creating novel polymerase activities, com Gherardi, E. (1996). An approach to random mutagenesis prises preparing and expressing nucleic acid encoding an of DNA using mixtures of triphosphate derivatives of engineered DNA polymerase. US20070020653 nucleoside analogues. J Mol Biol, 255, 589-603. 0101 Holliger, P., Ghadessy, F and Ong, J. L. (2001). 0113. Zhang, Z. Kermekchiev, M. B and Barnes, W. M. Directed evolution method. EP180.6406 (2010). Direct DNA amplification from crude clinical 0102 Jestin, J., Vichier-guerre, S and Ferris, S. (2005). samples using a PCR enhancer cocktail and novel mutants Methods for Obtaining Thermostable Enzymes, Dna Poly of taq.J Mol Diagn, 12, 152-161. merase I Variants from Thermus Aquaticus Having New 0114 Zipper, H., Brunner, H., Bernhagen, J. and Vitz Catalytic Activities, Methods for Obtaining the Same, and thum, F. (2004). Investigations on DNA intercalation and Applications to the Same. US20080014609 surface binding by SYBR Green I, its structure determina (0103 Kermekchiev, M. and Kirilova, L. (2006). USE OF tion and methological implications. Nucleic Acids Res, 32. TAQ POLYMERASE MUTANT ENZYMES FOR DNA e103 US 2013/0034.879 A1 Feb. 7, 2013 13

SEQUENCE LISTING

<16O is NUMBER OF SEO ID NOS : 14

<210s, SEQ ID NO 1 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer 1

<4 OOs, SEQUENCE: 1 gcgittatcto atagacaagg gC 22

<210s, SEQ ID NO 2 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer 2

<4 OOs, SEQUENCE: 2 gtaagttatt at cacatc.cg ggit c 24

<210s, SEQ ID NO 3 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer 3

<4 OOs, SEQUENCE: 3 aatggctago: tagccac 19

<210s, SEQ ID NO 4 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer 4

<4 OOs, SEQUENCE: 4 tat citcctica atagoggagt catc 24

<210s, SEQ ID NO 5 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer 5

<4 OOs, SEQUENCE: 5 caaggit catc catgacaact ttg 23

<210s, SEQ ID NO 6 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer 6

<4 OOs, SEQUENCE: 6 gtccaccacc ctdttgctgt ag 22 US 2013/0034.879 A1 Feb. 7, 2013 14

- Continued <210s, SEQ ID NO 7 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide 1 <4 OO > SEQUENCE: 7 ttittagcc.gc tagagt cac ctgc 24

<210s, SEQ ID NO 8 &211s LENGTH: 44 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide 2 <4 OOs, SEQUENCE: 8 ggagacaa.gc titg tatgcct gcaggtogac totagcggct aaaa 44

<210s, SEQ ID NO 9 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer 7

<4 OOs, SEQUENCE: 9 atcctgaacc cattgacct c caac 24

<210s, SEQ ID NO 10 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer 8

<4 OOs, SEQUENCE: 10 actgaatc cc cqatcatcta t cqc 24

<210s, SEQ ID NO 11 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer 9

<4 OOs, SEQUENCE: 11

Cagcticagtg gttitt cattg gttg 24

<210s, SEQ ID NO 12 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer 10

<4 OOs, SEQUENCE: 12

Ctgtgaggca gagacagcag agac 24

<210s, SEQ ID NO 13 &211s LENGTH: 832 212. TYPE: PRT <213> ORGANISM: Thermus aquaticus US 2013/0034.879 A1 Feb. 7, 2013 15

- Continued <4 OOs, SEQUENCE: 13 Met Arg Gly Met Lieu Pro Lieu. Phe Glu Pro Lys Gly Arg Val Lieu. Lieu. 1. 5 1O 15 Val Asp Gly His His Lieu Ala Tyr Arg Thr Phe His Ala Lieu Lys Gly 2O 25 3O Lieu. Thir Thr Ser Arg Gly Glu Pro Val Glin Ala Val Tyr Gly Phe Ala 35 4 O 45 Llys Ser Lieu. Lieu Lys Ala Lieu Lys Glu Asp Gly Asp Ala Val Ile Val SO 55 6 O Val Phe Asp Ala Lys Ala Pro Ser Phe Arg His Glu Ala Tyr Gly Gly 65 70 7s 8O Tyr Lys Ala Gly Arg Ala Pro Thr Pro Glu Asp Phe Pro Arg Glin Lieu. 85 90 95 Ala Lieu. Ile Lys Glu Lieu Val Asp Lieu. Lieu. Gly Lieu Ala Arg Lieu. Glu 1OO 105 11 O Val Pro Gly Tyr Glu Ala Asp Asp Val Lieu Ala Ser Lieu Ala Lys Llys 115 12 O 125 Ala Glu Lys Glu Gly Tyr Glu Val Arg Ile Lieu. Thir Ala Asp Lys Asp 13 O 135 14 O Lieu. Tyr Glin Lieu Lleu Ser Asp Arg Ile His Val Lieu. His Pro Glu Gly 145 150 155 160 Tyr Lieu. Ile Thr Pro Ala Trp Leu Trp Glu Lys Tyr Gly Lieu. Arg Pro 1.65 17O 17s Asp Gln Trp Ala Asp Tyr Arg Ala Lieu. Thr Gly Asp Glu Ser Asp Asn 18O 185 19 O Lieu Pro Gly Wall Lys Gly Ile Gly Glu Lys Thr Ala Arg Llys Lieu. Lieu. 195 2OO 2O5 Glu Glu Trp Gly Ser Lieu. Glu Ala Lieu. Lieu Lys Asn Lieu. Asp Arg Lieu. 21 O 215 22O Llys Pro Ala Ile Arg Glu Lys Ile Lieu Ala His Met Asp Asp Lieu Lys 225 23 O 235 24 O Lieu. Ser Trp Asp Lieu Ala Lys Val Arg Thr Asp Lieu Pro Lieu. Glu Val 245 250 255 Asp Phe Ala Lys Arg Arg Glu Pro Asp Arg Glu Arg Lieu. Arg Ala Phe 26 O 265 27 O Lieu. Glu Arg Lieu. Glu Phe Gly Ser Lieu. Lieu. His Glu Phe Gly Lieu. Lieu. 27s 28O 285 Glu Ser Pro Lys Ala Lieu. Glu Glu Ala Pro Trp Pro Pro Pro Glu Gly 29 O 295 3 OO Ala Phe Val Gly Phe Val Lieu. Ser Arg Lys Glu Pro Met Trp Ala Asp 3. OS 310 315 32O Lieu. Lieu Ala Lieu Ala Ala Ala Arg Gly Gly Arg Val His Arg Ala Pro 3.25 330 335 Glu Pro Tyr Lys Ala Lieu. Arg Asp Lieu Lys Glu Ala Arg Gly Lieu. Lieu. 34 O 345 35. O Ala Lys Asp Lieu. Ser Val Lieu Ala Lieu. Arg Glu Gly Lieu. Gly Lieu Pro 355 360 365 Pro Gly Asp Asp Pro Met Lieu. Lieu Ala Tyr Lieu. Lieu. Asp Pro Ser Asn 37 O 375 38O Thir Thr Pro Glu Gly Val Ala Arg Arg Tyr Gly Gly Glu Trp Thr Glu 385 390 395 4 OO US 2013/0034.879 A1 Feb. 7, 2013 16

- Continued Glu Ala Gly Glu Arg Ala Ala Lieu. Ser Glu Arg Lieu. Phe Ala Asn Lieu. 4 OS 41O 415 Trp Gly Arg Lieu. Glu Gly Glu Glu Arg Lieu. Lieu. Trp Lieu. Tyr Arg Glu 42O 425 43 O Val Glu Arg Pro Lieu. Ser Ala Val Lieu Ala His Met Glu Ala Thr Gly 435 44 O 445 Val Arg Lieu. Asp Val Ala Tyr Lieu. Arg Ala Lieu. Ser Lieu. Glu Val Ala 450 45.5 460 Glu Glu Ile Ala Arg Lieu. Glu Ala Glu Val Phe Arg Lieu Ala Gly. His 465 470 47s 48O Pro Phe Asn Lieu. Asn. Ser Arg Asp Glin Lieu. Glu Arg Val Lieu. Phe Asp 485 490 495 Glu Lieu. Gly Lieu Pro Ala Ile Gly Llys Thr Glu Lys Thr Gly Lys Arg SOO 505 51O Ser Thir Ser Ala Ala Val Lieu. Glu Ala Lieu. Arg Glu Ala His Pro Ile 515 52O 525 Val Glu Lys Ile Lieu. Glin Tyr Arg Glu Lieu. Thir Lys Lieu Lys Ser Thr 53 O 535 54 O Tyr Ile Asp Pro Lieu Pro Asp Lieu. Ile His Pro Arg Thr Gly Arg Lieu. 5.45 550 555 560 His Thr Arg Phe Asn Glin Thr Ala Thr Ala Thr Gly Arg Lieu. Ser Ser 565 st O sts Ser Asp Pro Asn Lieu. Glin ASn Ile Pro Val Arg Thr Pro Lieu. Gly Glin 58O 585 59 O Arg Ile Arg Arg Ala Phe Ile Ala Glu Glu Gly Trp Lieu. Lieu Val Ala 595 6OO 605 Lieu. Asp Tyr Ser Glin Ile Glu Lieu. Arg Val Lieu Ala His Lieu. Ser Gly 610 615 62O Asp Glu Asn Lieu. Ile Arg Val Phe Glin Glu Gly Arg Asp Ile His Thr 625 630 635 64 O Glu Thir Ala Ser Trp Met Phe Gly Val Pro Arg Glu Ala Val Asp Pro 645 650 655 Lieu Met Arg Arg Ala Ala Lys Thir Ile Asin Phe Gly Val Lieu. Tyr Gly 660 665 67 O Met Ser Ala His Arg Lieu. Ser Glin Glu Lieu Ala Ile Pro Tyr Glu Glu 675 68O 685 Ala Glin Ala Phe Ile Glu Arg Tyr Phe Glin Ser Phe Pro Llys Val Arg 69 O. 695 7 OO Ala Trp Ile Glu Lys Thr Lieu. Glu Glu Gly Arg Arg Arg Gly Tyr Val 7 Os 71O 71s 72O Glu Thir Lieu. Phe Gly Arg Arg Arg Tyr Val Pro Asp Lieu. Glu Ala Arg 72 73 O 73 Val Lys Ser Val Arg Glu Ala Ala Glu Arg Met Ala Phe Asn Met Pro 740 74. 7 O Val Glin Gly Thr Ala Ala Asp Lieu Met Lys Lieu Ala Met Val Lys Lieu 7ss 760 765 Phe Pro Arg Lieu. Glu Glu Met Gly Ala Arg Met Lieu. Lieu. Glin Val His 770 775 78O Asp Glu Lieu Val Lieu. Glu Ala Pro Lys Glu Arg Ala Glu Ala Val Ala 78s 79 O 79. 8OO

Arg Lieu Ala Lys Glu Val Met Glu Gly Val Tyr Pro Lieu Ala Val Pro 805 810 815

US 2013/0034.879 A1 Feb. 7, 2013 19

- Continued tggcatgitaa aaaataag.cg ggctittgctic gacgc.ct tag ccattgagat gttagatagg 426 O caccatactic acttittgc cc tittagaaggg gaaagctggc aagattittitt acgtaataac 432O gctaaaagtt ttagatgtgc titt actaagt catcgcgatg gagcaaaagt acatttaggit 438 O acacggccta cagaaaaa.ca gitatgaaact citcgaaaatc aattagcctt tittatgccaa 4 44 O caaggtttitt cactagagaa togcattatat gcact cagog cagtgggg.ca ttt tactitta 4500 ggttgcgt at taagat.ca agagcatcaa gtc.gctaaag aagaaaggga aac acct act 456 O actgatagta togcc.gc.catt attacgacaa got at cqaat tatttgatca cca aggtgca 462O gagccago: ct tct tatt cqg ccttgaattig at catatgcg gattagaaaa acaacttaaa 468O tgttgaaagtg ggit cittaaaa goagcataac Ctttitt.ccgt gatgg taact t cactag titt 474. O aaaaggat ct aggtgaagat cotttittgat aatct catga ccaaaatcc c ttaacgtgag 48OO ttitt cqttico actgagcgtc agaccc.cgta gaaaagat.ca aaggat.cttic titgagat cot 486 O tttitttctgc gcgtaatctg. citgcttgcaa acaaaaaaac caccqct acc agcggtggitt 492 O tgtttgc.cgg at Caagagct accaactictt ttt cogalagg taactggctt Cagcagagcg 498O cagataccaa at actgtc.ct tctagtgtag ccg tagttag gccaccactt caagaactict 5040 gtag caccgc ctacatacct cqctctgcta atcctgttac cagtggctgc tigc.ca.gtggc 51OO gatalagtogt gtc.ttaccgg gttggactica agacgatagt taccggataa ggcgcagcgg 516 O tcgggctgaa cigggggttc gtgcacacag cccagcttgg agcgaacgac Ctacaccgaa 522 O

Ctgagatacc tacagcgtga gctatgagaa agcgc.cacgc titc.ccgaagg gagaaaggcg 528 O gacaggitatic cqgtaa.gcgg Cagggtcgga acaggagagc gcacgaggga gct tccaggg 534 O ggaaacgc.ct ggt at Cttta tagt cctgtc gggtttcgcc acctctgact tagdgtcga 54 OO tttttgttgat gct cqt Cagg gggggggagc ctatggaaaa acgc.ca.gcaa cqcggcc titt 546 O ttacggttcc toggccttittg ctggc ct 54.87

1. A DNA polymerase mutant comprising a Taq DNA 5. The DNA polymerase mutant according to claim 1, polymerase amino acid sequence with a mutation at one or which exhibits increased polymerase speed relative to wild more of the following selected amino acid positions: E189K, type DNA polymerase. E230K, E507K, H28R, L30R, G38R, F73V, H75R, E76A, 6. The DNA polymerase mutant according to claim 5, E76G, E76K, E90K, K206R, E315K, A348V, L351F, A439T wherein the selected amino acid positions are E189K, D452N, G504S, E507A, D551N, L552R, I553V, D578N, E230K, E507K, H28R, L30R, F73V, H75R, E76A, E76G, H676R, Q680R, D732G, E734G, E734K, F749V; wherein E76K, E90K, K206R, A439T. D452N, G504S, D551N, the polymerase mutant exhibits relative to wild-type DNA I553V, H676R, D732G, E734G, F749V. polymerase increased polymerase speed, increased affinity to 7. The DNA polymerase mutant according to claim 5, DNA substrate and/or increased resistance to a DNA poly which exhibits an increased polymerase speed which is at merase inhibitor; and wherein, when the mutation is E507K least 1.5 times faster than wild-type DNA polymerase. in combination with two or more further mutations or the 8. The DNA polymerase mutant according to claim 1, mutation is Q680R in combination with four or more further which exhibits increased affinity to DNA substrate relative to mutations, at least one of the further mutations is at one of the wild-type DNA polymerase. selected amino acid positions; and when the mutation is 9. The DNA polymerase mutant according to claim 8. I553V, this is not in combination with D551 S. wherein the selected amino acid positions are E189K, 2. The DNA polymerase mutant according to claim 1, E230K, E507K, H75R, E315K, A348V, L351F, L552R, wherein the amino acid sequence has a mutation at no more D578N. than three of the selected amino acid positions. 10. The DNA polymerase mutant according to claim 1, 3. The DNA polymerase mutant according to claim 2, which exhibits increased resistance to a DNA polymerase wherein the amino acid sequence has a mutation at only one inhibitor selected from the group consisting of SYBR Green of the selected amino acid positions. I dye, blood, SDS, guanidinium salts and heparin. 4. The DNA polymerase mutant according to claim 2, 11. The DNA polymerase mutant according to claim 10, wherein the amino acid sequence has a mutation at only two wherein the selected amino acid positions are E189K, of the selected amino acid positions. E230K, E507K, H28R, L30R, G38R, H75R, E76A, E76G, US 2013/0034.879 A1 Feb. 7, 2013 20

E76K, E90K, E315K, A439T. D452N, G504S, E507A, 17. Use of a DNA polymerase mutant according to claim 1, D551N, L552R, I553 V, D578N, H676R, Q68OR, D732G, in a polymerase chain reaction. E734G, E734K. 18. A process for the production of a DNA polymerase 12. The DNA polymerase mutant according to claim 4, mutant according to claim 1, which process comprises: wherein the selected amino acid positions are: H28R-- (1) Subjecting a polynucleotide encoding a DNA poly E507K, H28R--Q680R, E507K+Q680R, L552R+Q680R, merase to error-prone PCR to generate a mutant library E23OK+E507K, E189K+E507K, E315K+E507K, E23OK+ comprising an array of differently-mutated polynucle E315K, E507K+L552R. otides; 13. The DNA polymerase mutant according to claim 8, wherein the Kd for a DNA oligoduplex substrate is no more (2) screening the mutant library for increased polymerase than 1 nM, as measured by electrophoretic shift mobility speed, increased polymerase affinity to DNA substrate assay following incubation in 40 mM Tris, 20 mMacetic acid, or increase resistance to a DNA polymerase inhibitor; 1 mM EDTA at pH8.4, in the presence of 10% V/v glycerol at (3) selecting one or more mutant DNA polymerases from 4° C. for 30 mins. Screening step 2; and 14. DNA polymerase mutant according to claim 10, (4) repeating steps 1 to 3 until a final DNA polymerase wherein the Kd for a DNA oligoduplex substrate in the pres mutant is obtained. ence of 0.4LMSYBR Green I dye is no more than 10 nM, as 19. A DNA polymerase mutant obtained by the process of measured by electrophoretic shift mobility assay following claim 18. incubation in 40 mM Tris, 20 mMacetic acid, 1 mM EDTA at 20. The DNA polymerase mutant according to claim 5, pH8.4, in the presence of 10% V/v glycerol at 4°C. for 30 which exhibits an increased polymerase speed which is at mins. least 3 times faster than wild-type DNA polymerase. 15. The DNA polymerase mutant according to claim 1, wherein the selected amino acid positions are E189K, E230K 21. The DNA polymerase mutant according to claim 5, and E507K. which exhibits an increased polymerase speed which is at 16. A kit for nucleic acid amplification, which comprises a least 12 times faster than wild-type DNA polymerase. DNA polymerase mutant according to claim 1 and one or more reagents for a DNA synthesis reaction.