Cilia- and Flagella-Associated Protein 69 Regulates Olfactory Transduction Kinetics in Mice

The role of CFAP69 in the male reproductive system

Frederick N. Dong

A dissertation submitted to Johns Hopkins University in conformity with the requirements of the degree of Doctor of Philosophy

Baltimore, Maryland

December, 2018

Abstract

The importance of reproduction for life, human or otherwise, cannot be overstated: without reproduction, an organism and, eventually, its species cease to exist. Thus, infertility is a devastating condition. Shockingly, however, nearly 15% of human couples struggle with infertility, with male infertility contributing to about half of these cases. Furthermore, the cause of half of male infertility cases still cannot be identified. About 30% of male infertility cases are believed to have a genetic component, but many of the genes required for male fertility and what these gene products contribute are still undiscovered. In this dissertation, we set forth the first studies of the role of cila- and flagella-associated protein 69 (CFAP69) in spermatogenesis.

In Chapter 1, I briefly review spermatogenesis and some of its known defects. In Chapter 2, we demonstrate that Cfap69 is expressed in germ cells in the mouse testis and find that CFAP69 is essential for both human and mouse fertility. Its absence preserves the overall progression of spermatogenesis but causes impaired spermiogenesis and disorganization of sperm flagellum components, thus leading to multiple morphological abnormalities of the flagella and infertility. In Chapter 3, we examine CFAP69 itself. We examine the prediction that CFAP69 contains an armadillo repeat domain and the implication that it interacts with other proteins. However, we find that this protein is largely insoluble under physiological extraction conditions not only in heterologous expression systems, but also in mouse testis and sperm, suggesting that the insolubility reflects the function of CFAP69. Finally, in Chapter 4, we explore the implications of our results for human health, the utility of CFAP69 in further studying spermatogenesis at a molecular level, improved tools for studying difficult proteins like CFAP69, and the mysterious roles of CFAP69 in biological systems as diverse as olfaction and platelet morphology.

Advisor: Haiqing Zhao, Ph.D.

Second Reader: Xin Chen, Ph.D.

Committee Members: Allan Spradling, Ph.D.

William Wright, Ph.D.

ii Table of Contents Abstract ...... ii Table of Contents ...... iii List of Tables ...... iv List of Figures ...... v Chapter 1: Introduction ...... 1 1-1. The importance of reproduction ...... 2 1-2. Modes of reproduction ...... 3 1-3. Spermatogenesis and its defects ...... 5 Chapter 2: Absence of CFAP69 causes male infertility due to multiple morphological abnormalities of the flagella in humans and mouse ...... 12 2-1. Introduction ...... 13 2-2. Results ...... 14 2-3. Discussion ...... 33 2-4. Methods ...... 37 2-5. Supplemental Data ...... 45 Chapter 3: Studying the mechanism of CFAP69 function ...... 56 3-1. Introduction ...... 57 3-2. Results ...... 59 3-3. Discussion ...... 70 3-4. Methods ...... 73 Chapter 4: Concluding remarks ...... 79 4-1. CFAP69 and human health ...... 80 4-2. Towards a molecular-level understanding of spermiogenesis ...... 82 4-3. Studying problematic proteins ...... 84 4-4. One CFAP69 function or many? ...... 85 Appendix I. Cilia- and Flagella-Associated Protein 69 Regulates Olfactory Transduction Kinetics in Mice ...... 87 Appendix II. Lamin B1 is required for mature neuron-specific gene expression during olfactory sensory neuron differentiation ...... 100 Bibliography ...... 114

iii List of Tables

Table 2-1. Detailed semen parameters in the two MMAF individuals harboring a CFAP69 mutation...... 32 Table S2-1...... 53 Table S2-2. Primer sequences used for Sanger sequencing verification of CFAP69 variations and respective melting temperatures (Tm)...... 55 Table S2-3. Primers used for RT-qPCR of CFAP69 in human...... 55 Table S2-4. Primer sequences used in human CFAP69 RT-PCR and respective melting temperatures (Tm)...... 55 Table S2-5. All CFAP69 (C7orf63) variations identified by WES...... 55 Table 3-1. The 50 most abundant proteins detected by mass spectrometry after pulldown from mouse testis using recombinant CFAP69...... 69

iv List of Figures

Figure 2-1. Morphology of normal and CFAP69 mutant spermatozoa, and the mutations identified in CFAP69-mutant individuals ...... 22 Figure 2-2. CFAP69 immunostaining in human spermatozoa from controls and CFAP69 mutant individuals...... 23 Figure 2-3. SPAG6 and SPEF2 immunostainings are affected by mutations in CFAP69...... 24 Figure 2-4. Expression of CFAP69 in the mouse testis...... 26 Figure 2-5. Scanning electron microscopy analysis of sperm from epididymides of wildtype and Cfap69 KO mice...... 29 Figure 2-6. The progression of spermatogenesis in Cfap69 KO mice is preserved, but flagellum components are disorganized...... 31 Figure S2-1. Relative mRNA Expression of human CFAP69 transcripts...... 47 Figure S2-2. Electropherograms of Sanger sequencing for the two CFAP69-mutated individuals compared to reference sequence...... 48 Figure S2-3. RT-PCR analyses on peripheral whole blood cells from individual CFAP69_1 showing mRNA decay...... 49 Figure S2-4. Axonemal inner and outer dynein arms are not affected by the absence of CFAP69...... 50 Figure S2-5. Normal acrosome development and nuclear elongation can be observed in testes of Cfap69 KO mice...... 51 Figure S2-6. Schematic cross-section of human sperm flagellar axoneme and localization of MMAF-related proteins...... 52 Figure 3-1. In vitro expression and purification of recombinant CFAP69 and ARM domain from E. coli...... 66 Figure 3-2. In vitro expression and co-purification of recombinant CFAP69 from Sf9 cells. .... 67 Figure 3-3. Differential detergent fractionation of wildtype and Cfap69 KO testis and sperm...... 68

v Chapter 1: Introduction

1 1-1. The importance of reproduction

Biological reproduction encompasses the processes by which various living organisms produce

offspring. It is frequently posited to be a defining feature of life1, and its importance stems from

the inescapable reality that life as we know it is transient. Whether by aging, disease, or

predation, all individual organisms eventually die, and as long as death remains a feature of life,

the process of reproduction might be considered not just a characteristic of life, but possibly

the goal of life: a non-reproducing, mortal life form, even one exquisitely adapted to the

demands of its environment, would without reproduction eventually cease to exist. The traits

that are maintained within and among species must therefore come from reproducing

organisms. Indeed, the result of evolutionary selection may ultimately be to increase the odds

of a species’ reproductive success by enabling its survival, ensuring intra- and inter-specific competitiveness, and promoting behavior favoring reproduction. Thus, all extant lifeforms must have found one way or another to continually ensure their reproductive success. The requirement for reproduction also applies to humans, who are all too mortal. Although the question of whether or not humans make reproduction the goal of their existence is debatable and likely personal, reproduction, or having and raising children (not necessarily solely for the purpose of propagating the species), remains an important goal in life for many individuals and couples. Thus, because reproduction is so fundamental to life, limits or impediments to reproduction are universally devastating. An organism that cannot reproduce will contribute to neither the propagation nor the genetic makeup of its species, effectively rendering its existence biologically meaningless. Likewise, while humans can achieve much more in life than contributing their genetic makeup to the subsequent generation, an inability to produce

2 children can cause great psychological distress and, through seeking treatment, impose

significant economic burden2.

1-2. Modes of reproduction

Although life employs diverse strategies for reproducing, nearly all of these strategies can be grouped into just two widely recognized modes of reproduction: sexual and asexual. The hallmark of asexual reproduction is offspring that are genetically identical to the parent3.

Asexual reproduction is more frequently employed by unicellular prokaryotes or small, unicellular or multicellular eukaryotes, though some plants and fungi also reproduce asexually3.

Compared to sexual reproduction, however, asexual reproduction as the sole mode of reproduction is exceedingly rare in more complex eukaryotic organisms3,4. By some estimates, only 1% of these species are exclusively asexual5, indicating most of these organisms reproduce sexually at some point in their lives.

In contrast to asexual reproduction, a defining feature of sexual reproduction is the genetic mixing achieved through both the fusion of two haploid genomes (syngamy) and through recombination during meiosis. Thus, sexual reproduction leads to offspring carrying novel combinations of genetic elements. Although the overwhelming prevalence of sexual reproduction compared with asexual reproduction suggests that sexual reproduction is comparably advantageous, what those benefits are remains subject to debate, though there is some consensus that the genetic variability arising from sexual reproduction confers adaptability advantageous in situations of inter-species competition6,7,8.

What is clear is that sexual reproduction poses many unique challenges. In particular, a sexually

3 reproducing parent transmits only 50% of its genes to the next generation. In contrast, an

asexually reproducing parent transmits 100%. Thus, sexual reproduction is, on a per offspring basis, half as efficient as asexual reproduction9,10,11,12. This problem is so striking that the

existence of sexual reproduction is frequently seen as paradoxical, triggering a still-ongoing

debate about the advantages conferred by sexual reproduction6, 9,10,11. Moreover, inefficiency is not the only disadvantage of sexual reproduction. Sexual reproduction requires successful

contact between the germ cells or gametes of two individuals of the opposite sex or mating

type. In mammals and many other kinds of life, this challenge has driven the evolution of the

dramatically dimorphic sperm and egg as the male and female gametes respectively. The sperm

generally faces the challenge of first reaching the egg, and then penetrating it – pressures

which gave rise to the archetypal highly motile and very small cell with a compact head and an

elongated tail. The sperm head contains a condensed nucleus, almost no cytoplasm, and a large

vesicle (the acrosome) containing hydrolytic enzymes to enable egg penetration. The long

flagellum contains mitochondria and mechanical-support structures to convey motility to the sperm. These features maximize the chances that least some sperm will successfully contact an egg13. Additional specializations include species-specific proteins found on the sperm head whose corresponding receptors are present on the egg, thus facilitating proper egg recognition and binding14,15. These components are well-preserved in species whose sperm must independently travel any distance in order to reach the egg. Marine species employing external fertilization requiring sperm to seek out eggs in open seawater are one such example16.

Mammals that employ internal fertilization in which sperm must advance through the female’s reproductive tract are another. In contrast, in some arthropod species in which the male

4 directly transfers a sperm-containing spermatophore to the female, the sperm have acquired

motility-inhibiting or axoneme-altering mutations, or have lost their flagella altogether16.

The extraordinary degree of specialization attained by the mammalian spermatozoon requires an equally complex and specialized system to support its production. Such complexity presents a major disadvantage in that greater complexity creates correspondingly more numerous potential points of failure, the disruption of which can lead to infertility. In fact, male infertility as a result of altered spermatogenesis is a common problem with many different causes and manifestations.

1-3. Spermatogenesis and its defects

Mammalian spermatogenesis takes place within the testis, which is divided into two general

compartments: the seminiferous tubules and the interstitium. Most of the space within the

testis is occupied by the highly convoluted seminiferous tubules, in which spermatogenesis

takes place. The seminiferous tubules contain both the germ cells at various stages of

spermatogenesis, as well as the somatic Sertoli cells. These Sertoli cells perform several

functions essential to spermatogenesis, including comprising part of the spermatogonia stem

cell niche, providing structural support for developing germ cells, and controlling nutrient

homeostasis17,18. Sertoli cells also form tight junctions with each other to create the blood-

testis barrier and partition the seminiferous tubule into basal and adluminal compartments, enabling fine control of the adluminal environment in which germ cells mature18,19.

Spermatogenesis begins in the basal compartment with the spermatogonia stem cells (SSCs).

This small population of cells represents about 0.03% of all germ cells in the mouse testis20, but

5 by balancing self-renewal with differentiation into spermatogonia, the SSCs ensure a continuous supply of sperm throughout adult life, enabling in humans production of 120 million

18 21 sperm every day . Among the SSCs are As (single) spermatogonia . Upon division, As spermatogonia can either undergo complete cytokinesis to produce two As spermatogonia in a self-renewing division or differentiate into Apr (paired) spermatogonia that are connected by a

21,22 cytoplasmic bridge left by incomplete cytokinesis . Subsequent divisions of Apr spermatogonia yield chains of Aal (aligned) spermatogonia. Longer chains (8-32) of spermatogonia are stimulated by retinoic acid to begin differentiation into B spermtogonia and, ultimately, spermatocytes22,23.

Male infertility is known to stem from disruption at several points during the development and maturation of spermatogonia. Disruption of the renewal/differentiation balance by, for example, up- or down-regulating expression of the transcription factor Nanos2 leads to accumulation or depletion of spermatogonia in mice24. Spermatogonium differentiation can also be impaired, leading to accumulation of spermatogonia, absence of spermatocytes, and male infertility25.

After differentiation from spermatogonia, spermatocytes undergo meiosis to achieve reductional division and recombination while preserving genetic integrity. A prolonged S-phase is followed by a complex meiotic prophase I traditionally characterized by four cytological stages. In leptotene, chromatin condenses, and double stranded breaks are made. In zygotene and pachytene, synapses form, and chromatids undergo recombination22. Finally, in diplotene, the synaptonemal complex dissociates, and crossovers are visible. Two rounds of division then give rise to the haploid round spermatids.

6 The preservation of genetic integrity during recombination and division is of paramount

importance. Mutations in the components of protective pathways result in infertility: loss of genes essential to processes such as synapsis (Hormad1)25 and double stranded break

formation and repair (Spo11, Atm) lead to spermatoctyte arrest in meiotic prophase I25.

Likewise, loss of genes important in chromosome orientation or cell division lead to arrest in

meiotic metaphase I and male infertility25.

Meiosis in spermatocytes gives rise to haploid round spermatids. The spermatids undergo the

process of spermiogenesis – an elaborate and dramatic cellular remodeling process that must

achieve nuclear condensation, acrosome development, and flagellum formation. Thus, round spermatids are transformed into compact, flagellated spermatozoa capable of fertilizing eggs.

One of the first processes to initiate after meiosis is the development of the acrosome26. The acrosome is a large vesicle-like organelle that contains hydrolytic enzymes. Upon binding of the sperm to the egg, these enzymes are released to facilitate penetration through the zona pellucida26. During acrosome development, coated vesicles bud from the trans-Golgi network and eventually coalesce into a single, large vesicle at the nuclear surface in a process mediated by the acroplaxome, a unique structure containing cytoskeletal proteins such as F-actin and keratin26,25. The acrosome is attached to the nuclear surface and the overlying plasma membrane by the perinuclear theca, also a cytoskeletal structure unique to spermatids26,25.

Disruption of these structures or in vesicle trafficking lead to a variety of abnormalities including absence of the acrosome (globozoospermia), failure of the acrosome to attach to the nuclear surface, or failure of pro-acrosomal granules to coalesce25,26.

7 Flagellum development begins around the same time as acrosome development. The

centrosome localizes on the side of the nucleus opposite to the acrosome, and the distal

centriole nucleates the axoneme. Flagellum assembly occurs by highly conserved processes also

used in the assembly of other cilia, including intraflagellar transport (IFT)26,27. Thus, mutations

in essential IFT genes, axonemal genes, or in dyneins which lead to a variety of severe disorders

such as primary cilia dyskinesia are frequently accompanied by male infertility 26,28. However, due to the highly specialized nature of the sperm flagellum and the presence of sperm-exclusive

structures, sperm flagellum development also requires unique processes likely not found in

other cilia. One unique structure that appears during spermiogenesis is the manchette, a

transient collection of microtubules forming a “skirt” around the nucleus and extending

towards the developing flagellum. The process of intra-manchette transport is believed to

deliver proteins to the base of the developing sperm flagellum, where they are then delivered

to the flagellum proper by IFT26. As expected, manchette morphology defects are frequently

associated with flagellum organizational defects29. The mature mammalian sperm flagellum

also contains outer dense fibers and, along the principal piece, the fibrous sheath. Human male

infertility is frequently characterized by sperm having abnormal flagellum morphology, as well

as an abnormal arrangement of the axoneme and its accessory structures. Little is known about

the assembly of these structures. Outer dense fiber protein 2 is thought to possess self- assembly capabilities and associates with microtubules in vitro30. However, various mouse lines lacking IFT genes or sperm flagellum-required genes often display outer dense fibers in the absence of microtubules27,31,32. Thus, the connection between the assembly of these two components is unclear.

8 Spermiation is the final step of spermiogenesis. The Sertoli cell cytoskeleton facilitates the re- localization of spermatids to the lumen of the seminiferous tubule26. The spermatids are then

released from their attachments to the Sertoli cells and shed into the lumen26. Simultaneously,

the cytoplasm is stripped away and remains with the Sertoli cells after spermatid release26.

Failures in spermiation result in a variety of phenotypes. Spermatids may fail to be released into

the lumen, resulting in abnormal localization and ultimately phagocytosis by Sertoli cells26.

Immature spermatids are also sometimes prematurely released. Cytoplasm removal may be

incomplete, resulting in sperm that still carry cytoplasmic bodies26. These defects are all

associated with decreased male fertility.

While many defects leading to infertility arise during the actual process of spermatogenesis,

this process may also be indirectly affected by defects in other systems. The Sertoli cells depend

on Leydig cells for proper regulation of spermatogenesis. Leydig cells are found in the

interstitium of the testis among seminiferous tubules and secrete testosterone in a tightly

regulated fashion to maintain spermatogenesis. A frequent cause of human male infertility is

abnormal gonadotropin or androgen regulation18. Male hypogonadism is a condition in which

the testes do not produce adequate amounts of testosterone. Hypogonadism can be either

primary, in which the defect lies within the testis, or secondary, in which the defect lies with

the hypothalamus or pituitary gland. Because spermatogenesis is dependent on proper

androgen regulation and timing, impaired spermatogenesis is nearly always an associated

feature of hypogonadism18. One of the most common causes of primary hypogonadism, namely

Klinefelter syndrome, has an underlying genetic basis in a 47,XXY karyotype18, and is often

accompanied by azoospermia.

9 Disruption of sperm development also frequently occurs due to external or occupational factors. For instance, exposure to heavy metals such as lead and to certain organic chemicals causes disruption of spermatogenesis or even cause destruction of the seminiferous epithelium, leading to decreased sperm count or absence of sperm and, therefore, infertility33,34,35. Some pesticides are also associated with altered levels of reproductive hormones and concurrent infertility. Smoking is associated with decreased sperm count and fertility33. Many chemotherapeutic agents are also toxic to the seminiferous epithelium and, upon prolonged exposure, cause permanent testicular atrophy and infertility36. Sexually transmitted diseases can also lead to infertility. Gonorrhea, for example, is associated with obstructive azoospermia.

Thus, it is evident that the price of being able to produce specialized gametes for sexual reproduction is increased vulnerability to reproductive failure at all stages of spermatogenesis.

These failures can and do arise both from genetic and internal problems as well as from external insults. Indeed, infertility remains a serious health problem, affecting 15% of couples globally2,37. Male infertility alone is estimated to contribute to 50% of these cases2. Shockingly, nearly 50% of male infertility cases still have no identifiable cause, indicating an incomplete understanding of spermatogenesis and its supporting processes. Given the number of genes required for spermatogenesis and the propensity for sperm morphology defects to be heritable, it is likely that many sperm morphology defects also have an underlying genetic basis. Thus, there remains a pressing need to both identify the molecular components of spermatogenesis pathways and also to understand what roles they play. Towards this end, we have studied

CFAP69 in the context of spermatogenesis, establishing it as an essential player in human and

10 mouse spermatogenesis and laying the groundwork for advancing our understanding of human and mouse sperm development.

11 Chapter 2: Absence of CFAP69 causes male infertility due to multiple morphological abnormalities of the flagella in humans and mouse

Frederick N. Dong, Amir Amiri-Yekta, Guillaume Martinez, Antoine Saut, Julie Tek, Laurence Stouvenel, Patrick Lorès, Thomas Karaouzène, Nicolas Thierry-Mieg, Véronique Satre, Sophie Brouillet, Abbas Daneshipour, Seyedeh Hanieh Hosseini, Mélanie Bonhivers, Hamid Gourabi, Emmanuel Dulioust, Christophe Arnoult, Aminata Touré, Pierre F. Ray, Haiqing Zhao and Charles Coutton

This chapter was published in the American Journal of Human Genetics, volume 102, issue 4, p.

636-648, on April 5, 2018

DOI: 10.1016/j.ajhg.2018.03.007

Frederick Dong designed and performed all experiments using mouse models.

12 2-1. Introduction

Human male infertility remains a persistent problem, affecting an estimated 15% of couples38.

Male infertility often manifests as decreased sperm count (oligozoospermia), decreased sperm motility (asthenozoospermia), a higher proportion of morphologically defective sperm in the ejaculate (teratozoospermia), or a combination of the above defects. An estimated 30-50% of male infertility cases have a genetic component39. Thus, considerable effort has been made to identify and characterize the large number of genes required for sperm development. The advent of high-throughput sequencing (HTS) technologies has greatly facilitated the identification in infertile males of potentially responsible genes, but detailed studies of the functions of these genes in spermatogenesis is generally not possible in humans, requiring animal models instead40,41. Indeed, many mutant mouse models with defective spermatogenesis have been characterized, and molecular and genetic studies of sperm development in these models have yielded a deeper understanding of spermatogenesis42.

Multiple morphological abnormalities of the flagella (MMAF) phenotype is one of the most severe forms of qualitative sperm defects responsible for male infertility43. This peculiar phenotype is characterized by the presence in the ejaculate of immotile spermatozoa presenting with several severe abnormalities of the sperm flagellum including being short, coiled, absent, and of irregular caliber44. Whole-exome sequencing (WES) analysis revealed that mutations in DNAH1

(MIM:603332), CFAP43 (MIM:617558) and CFAP44 (MIM:617559) are frequently found in MMAF individuals and account for about one third of MMAF cases 45–48. These results established a strong genetic component for MMAF. They also demonstrated that MMAF is genetically heterogeneous and that other relevant genes still await identification. In a large cohort of 78

13 infertile male individuals with MMAF, we have now identified two unrelated individuals harboring homozygous truncating mutations in CFAP69 in addition to identifying individuals with mutations in the known MMAF genes, indicating that this gene is likely to be important for sperm flagellum morphogenesis and male fertility. In parallel, we characterized a Cfap69 knockout mouse model, which we found to recapitulate the MMAF phenotype. Overall, our work demonstrates that

CFAP69 is required for sperm flagellum assembly/stability and that truncating mutations of

CFAP69 induce autosomal-recessive MMAF and primary male infertility.

2-2. Results

Whole-exome sequencing (WES) identifies homozygous truncating mutations in CFAP69 in

MMAF individuals.

In the cohort of 78 MMAF individuals we analyzed, 22 individuals were identified with harmful mutations in the known MMAF-related genes DNAH1, CFAP43, or CFAP44 49. After applying stringent filters and reanalysis of the remaining exomes, we identified two individuals with truncating mutations in CFAP69, which accounts for 2.5% of our cohort (Figure 1D, Table S5).

CFAP69 was reported in public databases to be strongly expressed in the testis and connected with cilia or the flagellum50. We confirmed these data by RT-qPCR experiments in human tissue panels, which indicate that expression of CFAP69 mRNA in testis is predominant and is significantly higher than in other tested tissues (Figure S1). For both individuals, no variants with low frequency in control databases were identified in other genes reported to be associated with cilia, flagella or male fertility. We therefore focused on CFAP69, which appeared to be an excellent

MMAF candidate.

14 CFAP69 (formerly known as c7orf63, NM_001039706) is located on chromosome 7 and contains

23 exons encoding a predicted 941-amino acid protein (A5D8W1). The two CFAP69 variants were found in two unrelated individuals. These two variants were absent from control sequence databases (dbSNP, 1000 Genomes Project, NHLBI Exome Variant Server, gnomAD and in-house database). The variant identified in individual CFAP69_1 is a splicing variant c.860+1G>A, altering a consensus splice donor site of CFAP69 exon 8. The variant identified in individual CFAP69_2 was a stop-gain mutation c.763C>T (p.Gln255Ter) located in exon 8 (Figure 1D, Table S5). The presence of the two variants was confirmed by Sanger sequencing of CFAP69 exon 8 in both individuals

(Figure S2). According to the Human Splicing Finder, the c.860+1G>A mutation abrogates the consensus donor site, leading to altered splicing and subsequent frameshift. No Cfap69 mRNA could be detected by RT-PCR in individual CFAP69_1 (Figure S3), possibly indicating a frameshift and premature translation termination leading to nonsense-mediated decay.

We compared semen parameters of individuals carrying CFAP69 mutations with those of individuals carrying mutations in previously described MMAF-related genes in order to test for potential phenotype-genotype correlation (Table S5). Although there were no significant statistical differences between the semen parameters of the CFAP69 individuals and MMAF individuals with mutations in DNAH1, CFAP43 or CFAP44, we observe very low sperm concentrations and total sperm counts in the ejaculates from both CFAP69-mutant individuals.

Compared to sperm from control samples (Figure 1A), sperm from both individuals showed severe defects characteristic of MMAF (Figure 1B, C). A high rate of head malformations, in particular thin heads and an abnormal acrosomal region, were also observed (Figure 1C, Table 1 and S1). Interestingly, when selecting sperm for intracytoplasmic sperm injection by density

15 gradient centrifugation from individual CFAP69_2, numerous isolated sperm heads were recovered, suggesting a fragility of the head–flagellum connection.

CFAP69 is located in the midpiece of the human sperm flagellum, and its absence is associated with axonemal defects.

To further investigate the pathogenicity of the CFAP69 variants identified, we examined the distribution of CFAP69 in sperm cells from control and CFAP69-mutant individuals by immunofluorescence staining. In sperm from control individuals, we observed CFAP69 concentrated in the midpiece of the sperm flagellum (Figure 2A). This localization was confirmed by co-staining of the sperm mitochondrial protein HSP60 (Figure 2B), which visualizes the mitochondrial sheath in the midpiece51. Importantly, CFAP69 was absent from all sperm cells from both individuals CFAP69_1 and CFAP69_2 (Figure 2A), consistent with the absence of CFAP69 transcript observed in individual CFAP69_1 (Figure S3). We next investigated the flagellar and axonemal defects of CFAP69-mutant individuals. Due to sample availability, these analyses were only carried out for individual CFAP69_2. We observed that in sperm from individual CFAP69_2, staining of SPAG6, an axoneme central pair complex (CPC) protein52, was absent from the flagellum or displayed abnormal localization in the midpiece and the acrosomal region of the spermatozoa (Figure 3A). In contrast, immunostaining of DNALI1 and DNAH5 in sperm from individual CFAP69_2 was comparable with that observed in control cells, suggesting that outer dynein arms (ODAs) and inner dynein arms (IDAs) respectively were not directly affected by mutations in CFAP69 (Figure S4A, B). We also examined the localization of SPEF2, a protein required form sperm flagellum assembly in the mouse53 and described as a putative partner to

CFAP6954. In control sperm, SPEF2 immunostaining appeared very strongly at the base of the

16 flagellum, likely corresponding to the basal body, and lightly throughout the whole sperm flagellum, but in individual CFAP69_2, SPEF2 staining was weak or completely absent whereas tubulin staining remained detectable in the axoneme (Figure 3B).

CFAP69 is found in the mouse testis and is required for male fertility

Various expression55 and RNA-seq data sets56,57 indicate that a Cfap69 transcript is highly expressed in the mouse testis, and the availability of a Cfap69 knockout mouse58 allowed us to investigate the function of CFAP69 in male mouse reproduction. We investigated Cfap69 expression in the male mouse reproductive system by X-gal staining in mice heterozygous for a

Cfap69 knockout-reporter allele (Cfap69tm1b/+ mice; see Methods). In whole-mount preparations from male Cfap69tm1b/+, but not wildtype, mice, strong X-gal staining was observed in the testes

(Figure 4A). The epididymis is known to express endogenous β-galactosidase59,60, and accordingly, we found X-gal staining in wholemount epididymis (Figure 4A) and in the epithelial cells of cauda epididymis from both wildtype and Cfap69tm1b/+ mice (Figure 4B). This suggests that the X-gal staining observed in the Cfap69tm1b/+ epididymal cells is most likely due to endogenous β- galactosidase expression and not Cfap69 expression. However, sperm cells within Cfap69tm1b/+ epididymides, but not in wildtype, were positive for X-gal staining (Figure 4B), suggesting that sperm cells or their precursors express the reporter gene. In testis cryosections, X-gal staining was observed in all seminiferous tubules of Cfap69tm1b/+ testes, but not in wildtype testes (Figure 4C).

The staining first appeared in pachytene spermatocytes and increased in intensity in early and late spermatids (Figure 4D).

17 Western blotting analysis of wildtype adult mouse testis lysates using a custom antibody against

CFAP6958 detects a band around 100 kD (Figure 4E), consistent with the predicted molecular weight of the protein encoded by the testis Cfap69 transcript. The corresponding band was absent from testes of Cfap69 knockout mice (Cfap69tm1b/tm1b; see Methods) (Figure 4E) (Note: for unknown reasons, this antibody gives no staining when used in immunostaining in sections of reproductive tissues). Altogether, these results indicate that CFAP69 is found in germ cells of adult mouse testis, possibly beginning in pachytene spermatocytes and at higher levels after meiosis.

We then assessed fertility and reproductive behavior of Cfap69 knockout mice. When male

Cfap69 knockout mice of 6 weeks age or older were mated to similarly aged wildtype females, they show normal mounting and produce copulatory plugs after mating, indicating that mating behavior is unimpaired in the absence of CFAP69. However, Cfap69 knockout male mice failed to produce any offspring over 3 months of breeding (8 Cfap69 mutant males mated with 2 wildtype females each, no offspring produced over three months), whereas wildtype mating routinely produced offspring (8 wildtype males mated with 2 wildtype females each, 3-4 litters produced per female over three months, 6.93 ± 0.13 pups per litter). Cfap69 knockout female mice produced offspring at a rate similar to that of wildtype female mice when mated with wildtype males (data not shown). These results indicate that CFAP69 is required for male fertility in the mouse, consistent with phenotype analysis by The International Mouse Phenotyping Consortium.

Sperm of Cfap69 knockout mice have profound flagellum morphology defects

18 We next examined Cfap69 knockout sperm by collecting sperm from the cauda epididymides of both wildtype and Cfap69 knockout mice. Samples from Cfap69 knockout mice showed a complete lack of normal-looking sperm, and whereas we could observe sperm swimming in samples collected from wildtype mice, no sperm were observed to be motile in Cfap69 mutant samples. When observed by scanning electron microscopy (SEM), wildtype mouse sperm showed a hook-shaped head and a long flagellum with a clearly defined midpiece, principal piece, and end piece (Figure 5A), but all Cfap69 mutant sperm had severe morphology defects of the flagellum

(Figure 5B). These defects are highly varied and affect all parts of the flagellum. In general, Cfap69 mutant sperm display shortening of both midpiece and principal piece, leading to overall shorter flagella. The flagella frequently show splaying, perforation, or are missing. Additionally, head morphology defects ranging from mild to severe are observed (Figure 5B, III and V), though only a subset of sperm is affected. These defects likely account for the immotility of Cfap69 mutant sperm and the infertility of Cfap69 mutant mice and recapitulate the MMAF phenotype.

Sperm flagellum development during spermiogenesis requires CFAP69

Given the presence of CFAP69 in sperm precursor cells (Figure 4), we sought to gain an understanding of when and how CFAP69 functions during sperm development by examining the histology of Cfap69 knockout testes. Toluidine blue staining of semi-thin testis sections indicates that in knockout mice, the cell composition of the seminiferous epithelium is unaltered as compared to wildtype: all types of germ cells could be observed, including spermatogonia, spermatocytes, spermatids, and spermatozoa (Figure 6A). The somatic Sertoli cells are also present. Staging of seminiferous epithelia by acrosome and nuclear morphology, as well as by cell composition reveals that all twelve stages of the mouse seminiferous epithelium are present in

19 Cfap69 knockout testes (Figure 6B). These findings indicate that the overall progression of spermatogenesis is preserved and that many spermatogenesis and spermiogenesis processes are nominally intact, including meiosis (Figure 6B, xii), acrosome development, and nuclear condensation and elongation (Figure 6B and Figure S5). However, the absence of long flagella in the lumens of Cfap69 knockout seminiferous epithelia is conspicuous (Figure 6A-B). Additionally, sperm with abnormal flagella can be observed in the lumen of Cfap69 knockout seminiferous epithelia (Figure 6A-B). Thus, CFAP69 appears to be required during spermiogenesis for sperm flagellum development.

To better understand the nature of the flagellum defects observed in Cfap69 knockout sperm, we examined their ultrastructure by TEM. Owing to an inability to obtain sufficient quantities of mutant sperm from epididymides for TEM, we instead analyzed sperm in testis sections. The components of the sperm flagellum and their native architecture, including the axoneme, the outer dense fibers (ODFs), the mitochondrial sheath of the midpiece, and the fibrous sheath of the principal piece, are readily observable in longitudinal and cross sections of wildtype, testicular sperm (Figure 6C-F). However, sections of Cfap69 knockout sperm reveal flagellum components in a dramatic state of disarray within bodies of cytoplasm (Figure 6G-K). Although some mitochondria can be observed to localize to regions of mutant sperm flagella that would ordinarily be the midpiece, many appear throughout the cytoplasm (Figure 6G), in contrast to what was observed in wildtype sperm. In addition, in Cfap69 knockout sperm, ODFs are irregular in number and organization (Figure 6G-K). Notably, in longitudinal sections, the ODFs show coiled and tangled arrangements resembling the unusual flagellum morphology observed in whole

Cfap69 knockout sperm (Figure 6G). Additionally, the fibrous sheath is disorganized and largely

20 absent (Figure 6G). Finally, axoneme organization is severely disrupted. Doublet and singlet microtubules are still frequently found to associate with ODFs, but their numbers and their arrangement vary (Figure 6H-K). Microtubule doublets that have been split are also observed

(Figure 6I, asterisk). Large numbers of singlet microtubules, likely from the manchette, were also frequently observed (Figure 6K), indicating an abnormal confluence of the manchette and flagellum components. The abnormal organization of all sperm flagellum components indicates a failure of sperm flagellum development during spermiogenesis in Cfap69 knockout mice and likely accounts for the observed sperm morphology defects.

Figure 2-1. Morphology of normal and CFAP69 mutant spermatozoa, and the mutations identified in CFAP69-mutant individuals Morphology of spermatozoa from fertile controls (A), individual CFAP69_1 (B) and individual CFAP69_2 (C). Most spermatozoa from CFAP69 individuals have flagella that are short (#), absent (*), of irregular caliber (&) or coiled (@). Head malformations were also observed (Δ). (D) Location and nature of CFAP69 mutations in the gene and protein. Colored squares stand for Armadillo- like helical (orange) repeats and AH/BAR domain (yellow) as predicted by InterPro server. Mutations are annotated in accordance to the HGVS’s recommendations. n= number of alleles.

Figure 2-2. CFAP69 immunostaining in human spermatozoa from controls and CFAP69 mutant individuals. (A) Sperm cells from a fertile control individual and the two CFAP69 mutant individuals stained with anti-CFAP69 (green) and anti-acetylated tubulin (red) antibodies. DNA was counterstained with Hoechst 33342. In the fertile control, the CFAP69 immunostaining (green) is concentrated in the midpiece of the spermatozoa (white arrows) and is not detectable in the principle piece. CFAP69 staining is absent in sperm flagellum from individual CFAP69_1 and individual CFAP69_2. Scale bars: 10 µm. (B) Sperm cell from a fertile control individual stained with anti-HSP60 (red), which detects a mitochondrial protein located in the midpiece, and anti-CFAP69 (green) antibodies. The merged image shows that in control sperm, CFAP69 and HSP60 staining superimpose. Scale bars: 5 µm.

Figure 2-3. SPAG6 and SPEF2 immunostainings are affected by mutations in CFAP69. (A) Sperm cells from a fertile control and CFAP69_2 stained with anti-SPAG6 (green), which detects a protein located in the CPC, and anti-acetylated tubulin (red) antibodies. DNA was counterstained with Hoechst 33342. SPAG6 staining uniformly decorates the full-length flagellum in the fertile control whereas it is absent from the flagellum of sperm from individual CFAP69_2. SPAG6 also shows atypical localization in the midpiece and in the acrosomal region of these spermatozoa. (B) Sperm cells from a fertile control and CFAP69_2 stained with anti SPEF2 (Green) and anti-acetylated tubulin (red) antibodies. DNA was counterstained with Hoechst 33342. In sperm from the fertile control, SPEF2 staining appears mainly located in the basal body and lightly

24 decorates the sperm flagellum. In sperm cells from the individual CFAP69_2, SPEF2 staining is strongly reduced or totally absent. Scale bars: 10 µm.

Figure 2-4. Expression of CFAP69 in the mouse testis. (A) X-gal staining of whole-mount preparations of testis and epididymis from wildtype and Cfap69tm1b/+ mice. (B-D) X-gal staining of cryosections of cauda epididymis (B) and testis (C and D)

26 from wildtype and Cfap69tm1b/+ mice. X-gal staining is shown in red, acrosomes are labeled by peanut agglutinin (PNA, green), and nuclei are stained with DAPI (blue). (B) X-gal staining is found in epithelial cells of both wildtype and Cfap69tm1b/+ epididymides. However, X-gal staining is only found in the sperm of Cfap69tm1b/+ mice and not in those of wildtype mice. (C) X-gal staining is found in all seminiferous tubules of Cfap69tm1b/+ testes but not in those of wildtype testes. (D) In xi, white arrows indicate zygotene spermatocytes, and white solid arrowheads indicate diplotene spermatocytes within stage xi seminiferous epithelia. In Cfap69tm1b/+ testes, strong X-gal staining is found in elongating spermatids, weak X-gal staining, often appearing as a dot, is found in diplotene spermatocytes, and no X-gal staining is found in zygotene spermatocytes. In D-iii, white chevrons indicate round spermatids, and white cleft arrowheads indicate pachytene spermatocytes within stage iii seminiferous epithelia. In Cfap69tm1b/+ mice, weak X-gal staining appearing as dots is found in pachytene spermatocytes, and stronger X-gal staining in round spermatids. Dashed white lines outline the basement membrane. (E) Western blotting analysis of whole testis lysates from WT and Cfap69tm1b/tm1b (Cfap69 KO) mice. The arrow points to the band representing CFAP69. Scale bars: A, 0.5 cm; B, 20 µm; C, 50 µm; D, 5 µm.

Figure 2-5. Scanning electron microscopy analysis of sperm from epididymides of wildtype and Cfap69 KO mice. (A) Sperm from wildtype mice. White arrow indicates junction between midpiece and principal piece, and white arrowhead indicates junction between principal piece and end piece. (B) Sperm from Cfap69 KO mice show severe morphology defects. The thickness and length of the mutant midpiece is variable (compare II, III, VI, VII). The flagella also frequently show splaying into many thin filaments along the entire length of the principal piece (III, VI) or in certain regions (IV, V). These filaments adopt a variety of conformations, including coiled, looped, and tangled. Some sperm essentially lack a flagellum (IX), while others have unusual structures perforated with thin filaments in place of their flagellum (VIII). Head morphology defects ranging from mild (III) to severe (V) are observed, though only a subset of sperm is affected. Scale bar: 5 µm.

30 Figure 2-6. The progression of spermatogenesis in Cfap69 KO mice is preserved, but flagellum components are disorganized. (A, B) Light micrographs of semi-thin, EMbed812 sections of wildtype and Cfap69 KO testis stained with toluidine blue. (A) Red arrows indicate spermatogonia, yellow arrows indicate spermatocytes, yellow arrowheads indicate round spermatids, red arrowheads indicate spermatozoa, and red asterisks indicate Sertoli cells, all of which are present in both wildtype and Cfap69 KO seminiferous epithelia. (B) Seminiferous epithelia from both wildtype and Cfap69 KO mice of stages vii, ix, x, and xii are shown. Stages are determined by acrosome and nuclear morphology of germ cells, as well as by cell composition of the epithelium. In A and B, long flagella are conspicuously absent from the lumens of seminiferous tubules in Cfap69 KO sections. (C-K) Transmission electron micrographs of testicular sperm from wildtype (C-F) and Cfap69 KO (G-K) mice. In C-K, yellow arrows indicate mitochondria, yellow arrowheads indicate outer dense fibers, red arrows indicate fibrous sheath, red arrowheads indicates axoneme microtubules, and yellow “N” indicates the nucleus. In (H), yellow asterisk indicates split microtubule doublets. Scale bars: A, 10 µm; B, 5 µm; C, 1 µm; D, 250 nm; E and F, 100 nm; G, 1 µm; H-K, 100 nm.

31 Table 2-1. Detailed semen parameters in the two MMAF individuals harboring a CFAP69 mutation.

CFAP69 mutated Semen parameters individuals

Sperm Sperm Flagella of Age Total Normal Absent Short Coiled Bent Abnormal Individuals volume concentration Vitality irregular Tapered Thin Micro- Macro- Multiple Abnormal (years) CFAP69 motility 1h spermatozoa flagella Flagella Flagella Flagella acrosomal mutation (ml) (106/ml) caliber head head cephalic cephalic heads base region

CFAP69_1 42 c.860+1G 5 4 1 13 1 1 79 1 0 1 20 14 0 0 0 15 64 >A

CFAP69_2 51 4 6 10 62 12 12 13 7 5 7 c.763C>T 1 37 1 0 0 27 70

Values are percentages unless specified otherwise

32 2-3. Discussion

We showed that, in humans and mice, the presence of biallelic truncating mutations in CFAP69 induces male infertility owing to MMAF, thus establishing CFAP69 as a MMAF-related gene along with DNAH1, CFAP43 and CFAP44. The two individuals in our cohort with CFAP69 mutations presented only with primary infertility without other clinical features, similar to the individuals with DNAH1, CFAP43 and CFAP44 mutations44–48. Although CFAP69 regulates olfactory response kinetics, the individuals did not believe they had a deficient sense of smell and did not wish to participate in any olfaction-related studies.

In both humans and mice, dramatic sperm flagellum defects were observed (Figure 1 and 5). In the adult mouse testis, CFAP69 expression begins during meiosis and strongly increases in subsequent stages (Figure 4). Major processes of the spermatogenic cycle and some spermiogenesis processes appeared normal. TEM analysis of the testis showed dramatic disorganization of all sperm flagellum components (Figure 5), suggesting an essential role for

CFAP69 in normal flagellum formation during spermiogenesis.

We observed no significant differences between the semen parameters of the two individuals carrying mutations in CFAP69 compared to the parameters of individuals with mutations in other

MMAF genes (DNAH1, CFAP43 and CFAP44). However, we found low sperm concentrations in the ejaculates (oligozoospermia) associated with a high rate of head malformations in both CFAP69 mutant individuals (Figure 1, Table 1, Table S1), which were also observed in the Cfap69 knockout mouse model (Figure 5). These observations suggest that mutations in CFAP69 lead to an atypical and more severe MMAF phenotype, and that CFAP69 could also be important for sperm

33 head shaping during spermiogenesis. Whether CFAP69 is required for a process common to head and flagellum development or in distinct processes is not known.

Interestingly, immunostaining experiments with sperm from fertile control individuals showed that CFAP69 is located in the midpiece of the sperm flagellum (Figure 2). The midpiece-specific staining differs from the whole-flagellum staining observed for other axonemal components involved in the MMAF phenotype such as DNAH1, CFAP43 or CFAP4444,45,47 (Figure S6). This localization suggests that CFAP69 is unlikely to belong to the core axoneme. The midpiece of the mammalian sperm flagellum is composed of the mitochondrial sheath surrounding nine outer dense fibers and the axoneme61. However, CFAP69 is not necessarily, and may most likely not be, a mitochondrial or an ODF protein, as CFAP69 is found in other cilia in the mouse and in other organisms that contain neither outer dense fibers nor mitochondria58,62. For example, we recently showed that CFAP69 is present in the cilia of mouse olfactory sensory neurons, which do not contain mitochondria, and that it plays a role in regulating the odor response kinetics of olfactory sensory neurons58. Interestingly, in contrast to sperm flagella, which have severe morphology defects, the olfactory cilia lacking CFAP69 in mouse appeared morphologically normal58, illustrating that the sperm flagellum is assembled and organized differently from other cilia to fulfill its unique functions63. Additionally, proteomic analyses in Chlamydomonas rheinhardtii found CFAP69 enriched in the flagellum64,65. The role of CFAP69 in the function and assembly of these other cilia and its relationship to CFAP69 function in sperm flagellum assembly and function are under investigation.

The human and mouse sperm head and flagellum defects (Figure 1, 5), as well as abnormally localized manchette microtubules (Figure 6), are reminiscent of defects arising from disruption of

34 intramanchette transport (IMT) or intraflagellar (IFT) transport54,66–69. Interestingly, IF staining of

SPEF2, which is involved in IMT, sperm head shaping, and CPC assembly during spermiogenesis53,54,70, is strongly reduced or totally absent from CFAP69-mutant individuals’ sperm cells (Figure 3B). Truncating mutations in Spef2 are also known to cause male infertility in the pig and mouse due to a short sperm tail phenotype associated with severe ultrastructural axonemal and peri-axonemal defects which closely resemble the MMAF phenotype observed in the Cfap69 knockout mouse model53,71. Additionally, reduced and atypical staining of the CPC protein SPAG6 in spermatozoa from our CFAP69 individuals suggests that CFAP69 may be also involved in CPC organization (Figure 3A). We can therefore speculate that CFAP69 might partake in sperm tail biogenesis and CPC assembly through a role in flagellar protein transport (Figure S6).

Although mass spectrometry analysis recently suggested that SPEF2 might interact with CFAP69

(Q8BH53)54, no protein interaction partners for CFAP69 have been confirmed. Bioinformatic analysis does suggest that CFAP69 contains an ARM-repeat domain and an AH/BAR domain

(Figure 1D), indicating CFAP69 function may indeed involve interaction with other proteins. The identity of these proteins and the processes they affect remain to be determined.

Overall we identified two different pathogenic CFAP69 mutations in our cohort of 78 MMAF individuals. Combined with other mutations identified in this cohort in the previously known

MMAF-related genes DNAH1, CFAP43 and CFAP4449, the diagnosis efficiency of MMAF phenotype by WES in our cohort is of 31%. These promising results support the implementation of WES as a routine practice in the genetic investigation of male infertility. This yield is comparable to that obtained in other genetic diseases with a high degree of genetic heterogeneity72,73 and is consistent with the very large number of genes involved in the

35 spermatogenesis74. To improve this diagnosis rate and detect genes with lower mutation prevalence, genetic studies by WES should be performed in larger cohorts of individuals.

36 2-4. Methods

Human subjects and controls

WES was performed for a large cohort of 78 MMAF individuals as previously described49. All individuals presented with a typical MMAF phenotype characterized by severe asthenozoospermia (total sperm motility below 10%) with >5% of sperm having at least three flagellar abnormalities (absent, short, coiled, bent and irregular flagella).

Individual CFAP69_1 is from Iran and was treated in Tehran at the Royan Institute for primary infertility from 2008 to 2015. Individual CFAP69_2 is from North Africa and consulted for primary infertility at the Cochin University Hospital in Paris (France) from 2015 to the present. Both individuals were born to first cousin parents, had normal somatic karyotypes (46,XY) and were negative for Y chromosome Azoospermia Factor (AZF) microdeletions.

Sperm analysis was carried out in the source laboratories during routine biological examination of the individuals according to World Health Organization (WHO) guidelines75. The morphology of the individuals’ sperm was assessed with Papanicolaou staining (Figure 1A-C). The detailed semen parameters of the two CFAP69 individuals are presented in Table 1, and the average semen parameters of the studied MMAF cohort according to genotype are described in the Table

S1.

Informed consent was obtained from all the subjects participating in the study according to local protocols and the principles of the Declaration of Helsinki. Sperm samples were obtained following informed consent from both individuals CFAP69_1 and CFAP69_2. The study was approved by local ethics committees, and the samples were then stored in the CRB Germetheque

37 (certification under ISO-9001 and NF-S 96-900) following a standardized procedure. Sperm samples from fertile individuals with normal spermograms were obtained from CRB

Germetheque. Consent for CRB storage was approved by the CPCP Sud-Ouest of Toulouse

(coordinator of the multi-site CRB Germetheque).

Whole-Exome Sequencing (WES) and bioinformatic analysis

WES and bioinformatic analysis were performed according to our previously described protocol49.

For details, see Supplemental Material and Methods.

Sanger sequencing

CFAP69 mutations identified by WES were validated by Sanger sequencing. PCR primers and protocols used for each individual are listed in the Table S2. Sequencing reactions were carried out with BigDye Terminator v3.1 (Applied Biosystems). Sequencing was carried out on ABI 3130XL

(Applied Biosystems). Sequences were analysed using SeqScape software (Applied Biosystems).

Quantitative real-time RT-PCR (RT-qPCR) analysis

RT-qPCR was performed with cDNAs from various human tissues purchased from Life

Technologies®. A panel of 7 organs was used for experiments: testis, brain, lung, kidney, liver, intestine, and heart. Each sample was assayed in triplicate for each gene on a StepOnePlus

(LifeTechnologies®) with Power SYBR®Green PCR Master Mix (Life Technologies®). The PCR cycle was as follows: 10 min at 95°C, 1 cycle for enzyme activation; 15 s at 95°C, 60 s at 60°C with fluorescence acquisition, 40 cycles for the PCR. RT-qPCR data were normalized using the

76 -ΔΔCt reference housekeeping gene ACTB for human with the -ΔΔCt method . The 2 value was set

38 at 0 in brain cells, resulting in an arbitrary expression of 1. Primers sequences and RT-qPCR conditions are indicated in Table S3. The efficacy of primers was checked using a standard curve.

Melting curve analysis was used to confirm the presence of a single PCR product. Statistics were performed using a two-tailed t-test on Prism 4.0 software (GraphPad, San Diego, CA) to compare the relative expression of CFAP69 transcripts in several organs. Statistical tests with a two-tailed

P value ≤ 0.05 were considered significant.

RT-PCR analysis

Total RNA from whole blood from individual CFAP69_1 was extracted using the mirVana™ PARIS™

Kit (Life Technologies®) according to the manufacturer's protocol. Reverse transcription was carried out for individual CFAP69_1 and two healthy controls (C1 and C2) with 5 μl of extracted

RNA (approximately 500 ng). Hybridization of the oligo-dT was performed by incubation for 5 min at 65°C and quenching on ice in the following mix: 5 μl of RNA, 3μl of poly T oligo primers (dT)12–

18 (10mM, Pharmacia ), 3 μl of the four dNTPs (0.5mM, Roche diagnostics) and 2.2 μl of H2O.

Reverse Transcription was then carried out for 30 min at 55°C after the addition of 4 μl of 5× buffer, 0.5 μl RNase inhibitor, and 0.5 μl of Transcriptor Reverse transcriptase (Roche Diagnostics).

2 μl of the obtained cDNA mix was used for subsequent PCR. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a housekeeping gene (internal control). CFAP69 primer sequences and RT-PCR conditions are indicated in the Table S4.

Immunostaining in human sperm cells

Immunofluorescence (IF) experiments were performed using sperm cells from control individuals and from one or both individuals carrying CFAP69 mutations. Sperm cells were fixed in phosphate-

39 buffered saline (PBS)/4% paraformaldehyde for 1 min at room temperature. After washing in 1 ml PBS, the sperm suspension was spotted onto 0.1% poly L-lysine pre-coated slides (Thermo

Scientific). After attachment, sperm were permeabilized with 0.1% (v/v) Triton X-100 –DPBS

(Triton X-100; Sigma-Aldrich) for 5 min at RT. Slides were then blocked in 5% normal serum–DPBS

(normal goat or donkey serum; GIBCO, Invitrogen) and incubated overnight at 4°C with the following primary antibodies: rabbit polyclonal anti-CFAP69 (ab171156, Abcam, 1:200), mouse monoclonal anti-Hsp60 (ab13532, Abcam, 1:500), rabbit polyclonal anti-SPAG6 (HPA038440,

Sigma-Aldrich, 1:500), rabbit polyclonal anti-SPEF2 (HPA040343, Sigma-Aldrich, 1:500), rabbit polyclonal anti-DNAH5 (HPA037470, Sigma-Aldrich, 1:100), rabbit polyclonal anti-DNALI1

(HPA028305, Sigma-Aldrich, 1:100), monoclonal mouse anti-acetylated-α-tubulin (T7451, Sigma-

Aldrich, 1:2000). Washes were performed with 0.1% (v/v) Tween 20–DPBS, followed by 1 h incubation at room temperature with secondary antibodies. Highly cross-adsorbed secondary antibodies (Dylight 488 and Dylight 549, 1:1000) were from Jackson Immunoresearch®.

Appropriate controls were performed, omitting the primary antibodies. Samples were counterstained with 5 mg/ml Hoechst 33342 (Sigma-Aldrich) and mounted with DAKO mounting media (Life Technology). Fluorescence images were captured with a confocal microscope (Zeiss

LSM 710).

Animals

For all experiments involving mice, animals were handled and euthanized in accordance with methods approved by the Animal Care and Use Committees of each applicable institution. All mice used were adult (6 weeks or older) male mice.

40 Generation of Cfap69tm1b/tm1b mice

We obtained Cfap69tm1a mice as previously described58. The Cfap69tm1a mouse line carries a

Cfap69 knockout first allele77, in which a promoterless, gene-trapping cassette including the LacZ and neo genes was inserted in introns 4-5 of Cfap69, resulting in a floxed exon 5. To generate the

Cfap69tm1b allele, in which exon 5 and neo are excised, resulting in truncation of the CFAP69, but

LacZ remains as a reporter, Cfap69tm1a mice were crossed with the E2a-cre mouse line (B6.FVB-

Tg(EIIa-cre)C5379Lmgd/J, The Jackson Laboratory), which has early embryonic expression of cre recombinase leading to ubiquitous recombination. Genotyping was performed with two primer pairs: for the Cfap69tm1b allele, CTCCAGTGAAAGCCCACCT (forward) and

CGGTCGCTACCATTACCAGT (reverse) with an expected product size of ~450 bp; for the WT Cfap69 allele, ATGACCTAGGATTCATAAGCTTGATCT (forward) and GCGCTGCAACTGGAATCAGA (reverse) with an expected product size of ~300 bp.

X-gal staining and imaging

To collect tissue, mice were deeply anesthetized with Avertin (2,2,2-tribromoethyl alcohol in 2- methyl-2-butanol) and then perfused transcardially first with PBS, pH 7.4, followed by 4% paraformaldehyde (PFA) in PBS. Testes and epididymides were dissected out, and the tunica albigunea of the testis was punctured several times with a needle at each pole. Tissues were then immersed in 4% PFA for 2h at 4˚C. For whole-mount X-gal staining, testes and epididymides were washed in PBS and directly immersed in X-gal staining solution (1 mg/mL X-gal, 2 mM MgCl2, 0.01% sodium deoxycholate, 0.02% NP-40, 5 mM potassium ferricyanide, 5 mM potassium ferrocyanide) for 48 hrs at 37˚C. To prepare tissue cryosections, testes and epididymides were washed in PBS

41 before being cryoprotected in 30% (w/v) sucrose in PBS for 48 hrs. The tissues were then embedded in Tissue-Tek O.C.T. (Sakura, 4583) and cut into 12 µM sections, which were adhered to glass slides. Sections were fixed for 5 minutes in 4% PFA at room temperature, washed in PBS, and immersed in X-gal staining solution for 24 hrs at 37˚C. Sections were then fixed in 4% PFA at room temperature for 10 minutes, washed in PBS, and blocked in 5% normal goat serum and 0.1%

Triton X-100 in PBS for 1 hr at room temperature. Alexa Fluor 488-conjugated peanut agglutinin

(PNA) (Thermo Fisher Scientific, L32458) (1:200) was diluted in blocking solution and applied to sections overnight at 4˚C. Sections were washed in PBS with 0.1% Tween-20, counterstained in

DAPI (1 µg/mL in PBS) for 5 minutes, and mounted in Fluoromount (Sigma Aldrich, F4680).

Fluorescent X-gal imaging using confocal microscopy was performed as previously described78.

Imaging was performed on a Zeiss LSM 700 confocal microscope. X-gal inclusions were excited with a 637 nm laser, and emitted fluorescent signal between 650-770 nm was recorded.

Transmitted light signal was also recorded. PNA and DAPI were simultaneously imaged using standard methods. To produce the final fluorescent image of X-gal staining, the transmitted light image was subtracted from the emitted light image using the “Image Calculator” function in

ImageJ.

Western Blotting

Whole testes were homogenized in 2x Laemmli buffer (65.8 mM Tris-HCl, 26.3% glycerol, 2.1%

SDS, 0.01% bromophenol blue, 10% 2-mercaptoethanol, pH 6.8) using a dounce homogenizer and then heated at 95˚C for 10 minutes. Lysates were fractionated by SDS-PAGE on 8% polyacrylamide gels and transferred to polyvinylidene fluoride membranes by wet transfer in Towbin Buffer

42 without methanol (25 mM Tris base, 192 mM glycine, 0.025% SDS). Membranes were blocked in

3% BSA in tris-buffered saline with Tween-20 (TBST) for 1 hour at room temperature. Custom anti-CFAP69 antibody58 was diluted 1:1000 in blocking solution and incubated with the membrane overnight at 4˚C. The membrane was then washed in TBST and incubated with HRP- conjugated anti-Rabbit IgG antibody (GE Healthcare, NA934) at a 1:2000 dilution in blocking solution for 1 hr at room temperature. After washing, Western Lightning Plus-ECL reagent (Perkin

Elmer NEL103001) was applied to the membrane according to manufacturer instructions. The membranes were then exposed to autoradiography film.

Mouse epididymal sperm collection

Male mice were deeply anesthetized with Avertin. To collect sperm, the cauda epididymides were dissected out and minced in PBS. The tissue was incubated at 37˚C for 30 minutes before the sperm-containing supernatant was collected.

Scanning Electron Microscopy

Sperm were deposited on poly-L-lysine coated coverslips, fixed in 2.5% glutaraldehyde, and postfixed in osmium tetroxide. Coverslips were washed in distilled water and dehydrated through cold

50, 70, 95, and 100% ethanol. Coverslips were then dried at critical point in a Tousimis

Autosamdri-810 Critical Point Dryer, mounted onto specimen stubs, and sputter-coated with palladium before being viewed with a FEI Quanta ESEM 200 scanning electron microscope.

Transmission Electron Microscopy

43 Tissue was prepared for transmission electron microscopy (TEM) according to standard protocols.

Briefly, mice were deeply anesthetized with Avertin and perfused transcardially with PBS and then

5% glutaraldehyde (in 0.1M phosphate buffer, pH 7.4). Testes were dissected out and cut into pieces no more than 2 mm thick in any dimension before being immersed in 5% glutaraldehyde overnight at 4˚C. Samples were then washed in phosphate buffer, post-fixed in osmium tetroxide for 1 hr at 4˚C, washed again, and dehydrated through 1 change each of cold 50, 70, 95% ethanol, and 3 changes of 100% ethanol for 15 minutes each. Tissue fragments were then immersed in 2 changes of propylene oxide, 15 minutes each, before being placed in a 1:1 propyelene oxide:EMbed812 (Electron Microscopy Sciences, 14120) mixture overnight under vacuum.

Samples were further infiltrated with EMbed812 for 6 hrs under vacuum before being placed in fresh EMbed812. Blocks were polymerized at 60˚C for 48 hrs. Pale gold thin sections were cut, collected on copper grids, and stained with uranyl acetate and lead citrate. Images were obtained using a Phillips EM 420 transmission electron microscope.

Histology

Tissue was prepared the same way as for TEM analysis. Semi-thin sections 1-2 µM in thickness were cut from EMbed812-embedded testis blocks with glass knives and placed on drops of water on glass slides. The slides were then placed on a hot plate at low heat for about 30 seconds to dry the water and adhere the sections to the slides. The sections were then covered in a 1% solution of toluidine blue in 2% sodium tetraborate for an additional 30 sec. The slides were then removed from the hot plate, rinsed in distilled water, and mounted in EMbed812.

44 2-5. Supplemental Data

Supplemental Material and Methods

Whole-Exome Sequencing (WES) and bioinformatic analysis

Genomic DNA was isolated from saliva using the Oragen DNA extraction kit (DNAgenotech®,

Ottawa, Canada). Coding regions and intron/exon boundaries were enriched using the “all Exon

V5 kit“ (Agilent Technologies, Wokingham, UK). DNA sequencing was undertaken at the

Genoscope, Evry, France, on the HiSeq 2000 from Illumina®. Sequence reads were aligned to the reference genome (hg19) using MAGIC79. MAGIC produces quality-adjusted variant and reference read counts on each strand at every covered position in the genome. Duplicate reads and reads that mapped to multiple locations in the genome were excluded from further analysis. Positions whose sequence coverage was below 10 on either the forward or reverse strand were marked as low confidence, and positions whose coverage was below 10 on both strands were excluded.

Single nucleotide variations (SNV) and small insertions/deletions (indels) were identified and quality-filtered using in-house scripts. Briefly, for each variant, independent calls were made on each strand, and only positions where both calls agreed were retained. The most promising candidate variants were identified using an in-house bioinformatics pipeline, as follows. Variants with a minor allele frequency greater than 5% in the NHLBI ESP6500 [Exome Variant Server, NHLBI

GO Exome Sequencing Project (ESP), Seattle, WA] or in 1000 Genomes Project phase 1 datasets80, or greater than 1% in ExAC81 or gnomAD (http://gnomad.broadinstitute.org/) were discarded. We also compared these variants to an in-house database of 94 control exomes obtained from subjects from North Africa and the Middle East, corresponding to the geographical origin of most

45 individuals in this study and which is under-represented in public SNP databases. All variants present in homozygous state in this database were excluded. We used Variant Effect Predictor

(VEP version 8182) to predict the impact of the selected variants. We only retained variants impacting splice donor or acceptor sites or causing frameshifts, in-frame insertions or deletions, stop gain, stop loss or missense variants except those scored as "tolerated" by SIFT83 (sift.jcvi.org) and as "benign" by Polyphen-284 (genetics.bwh.harvard.edu/pph2). To predict the impact of mutations within the 5ʹ and 3ʹ splicing consensus, we used the Human Splicing Finder server v 3.0.

All steps from sequence mapping to variant selection were performed using the ExSQLibur pipeline.

46 Supplemental figures

CFAP69 relative expression in Human 14

0 brain testis kidney liver lung muscle intestine

Figure S2-1. Relative mRNA Expression of human CFAP69 transcripts. CFAP69 mRNA levels in a panel of human normal tissues. Results are presented as the mean of triplicates (ratio target gene/ACTB) ± Standard Deviation (SD). RT-qPCR data were normalized using the reference gene ACTB with the -ΔΔCt method.*** Brain expression is arbitrarily set to 1. In human, CFAP69 has the strongest expression in testis compared to other organs. Unpaired t-test, ***P< 0.001.

Figure S2-2. Electropherograms of Sanger sequencing for the two CFAP69-mutated individuals compared to reference sequence.

Figure S2-4. Axonemal inner and outer dynein arms are not affected by the absence of CFAP69. (A) Sperm cells from fertile controls and individual CFAP69_2 stained with anti-DNALI1 (green), which detects a protein located in the inner dynein arm, and anti-acetylated tubulin (red) antibodies. DNA was counterstained with Hoechst 33342. (B) Sperm cells from a fertile control and CFAP69_2 stained with anti-DNAH5 (green), which detects a protein located in the outer dynein arm, and anti-acetylated tubulin (red) antibodies. DNA was counterstained with Hoechst 33342. Immunostaining for DNALI1, DNAH5 were comparable with controls, suggesting that outer dynein arms (ODAs) and inner dynein arms (IDAs) respectively were not directly affected by mutations in CFAP69. Scale bars 10µm.

Figure S2-5. Normal acrosome development and nuclear elongation can be observed in testes of Cfap69 KO mice. Transmission electron micrographs of spermatids during spermiogenesis. Yellow arrows indicate the acrosome, and yellow “N” indicates the nucleus. Scale bars: C and D, 1 µm.

Supplementary Tables

Table S2-1. Average semen parameters in different genotype groups for the 78 included MMAF subjects in the present study.

MMAF with other MMAF with CFAP69 mutations$ Overall MMAF mutation Semen parameters n=22 n=78 n=2

46.5 ± 6.3 39.8 ± 7 41.6 ± 7.7 Mean age (years) (n’=2) (n’=21) (n’=77)

4.5 ± 0.7 3.4 ± 1.2 3.5 ± 1.4 Sperm volume (ml) (n’=2) (n’=20) (n’=75)

5 ± 1.4 20.1 ± 18.8 25.6 ± 32.1 Sperm concentration (106/ml) (n’=2) (n’=20) (n’=75)

5.5 ± 6.3 0.7 ± 2.4 3.9 ± 5.6 Total motility 1 h (n’=2) (n’=21) (n’=76)

37.5 ± 34.6 50.5 ± 22.7 52.7 ± 20 Vitality (n’=2) (n’=19) (n’=72)

6 ± 8.5 0.5 ± 2.3 1.6 ± 2.7 Normal spermatozoa (n’=2) (n’=20) (n’=61)

6.5 ± 7.8 28.1 ± 14.4 20.7 ± 15.7 Absent flagella (n’=2) (n’=15) (n’=66)

46 ± 46.7 57.1 ± 27.9 43.7 ± 27.3 Short Flagella (n’=2) (n’=19) (n’=72)

4 ± 4.2 10.4 ± 6.6 12.8 ± 9.4 Coiled Flagella (n’=2) (n’=16) (n’=69)

2.5 ± 3.5 8.7 ± 5.8 4.2 ± 8.4 Bent Flagella (n’=2) (n’=6) (n’=26)

53 4 ± 4.2 27.9 ± 19.4 31.7 ± 25.1 Flagella of irregular caliber (n’=2) (n’=15) (n’=67)

10.5 ± 13.4 22.5 ± 29 16.5 ± 20.2 Tapered head (n’=2) (n’=13) (n’=68)

25.5 ± 16.2 10.8 ± 13.7 11.1 ± 13.4 Thin head (n’=2) (n’=13) (n’=65)

0.5 ± 0.7 3.8 ± 2.4 4.3 ± 4.8 Microcephalic (n’=2) (n’=14) (n’=67)

0 0.15 ± 0.5 0.6 ± 1.8 Macrocephalic (n’=2) (n’=13) (n’=66)

0 1.9 ± 4 1.9 ± 3.7 Mutliple heads (n’=2) (n’=15) (n’=67)

21 ± 8.5 36.3 ± 26.4 31.2 ± 20.8 Abnormal base (n’=2) (n’=13) (n’=64)

67 ± 4.2 58.3 ± 31.5 61.9 ± 26.7 Abnormal acrosomal region (n’=2) (n’=15) (n’=68)

$ Other mutations correspond to individuals mutated in CFAP43, CFAP44 and DNAH1 according to C. Coutton et al., 2017, Nat Comm. In press. Values are percentages unless specified otherwise. Values are mean +/- SD; n= total number of individuals in each group; n’= number of individuals used to calculate the average based on available data.

54 Table S2-2. Primer sequences used for Sanger sequencing verification of CFAP69 variations and respective melting temperatures (Tm). Primer names Primer sequences (5’-3’) Tm CFAP69-Ex8F AAAAATGTCAATATTGTAAAGCACAAA 58°C CFAP69-Int8R TGTGGCTTGTTATTGTGCAG

Table S2-3. Primers used for RT-qPCR of CFAP69 in human. Primer names Primer sequences (5’-3’) Tm CFAP69-RTqPCR-Ex12F ATTGACTGGTCTGCAGCACA 60°C CFAP69-RTqPCR-Ex13R ACTGTAACGCATCTGGGCAA GAPDH-RTqPCR-F AGCCACATCGCTCAGACAC 60°C GAPDH-RTqPCR-R GCCCAATACGACCAAATCC

Table S2-4. Primer sequences used in human CFAP69 RT-PCR and respective melting temperatures (Tm). Primer names Primer sequences (5’-3’) Tm CFAP69-RT-Ex7F TTCTGCAGCATCTCTCAACTTC 57°C CFAP69-RT-Ex10R CAAATCCTTGGTAAAGCCACA

Table S2-5. All CFAP69 (C7orf63) variations identified by WES. Variant cDNA Patie Canonical Amino acid Ex Nation Allelic Gene coordinat Variati nts Transcripts variations on ality status es ons CFA CFAP chr7:8990 ENST000003 c.860+1 splice_donor_ Homozy 8 Iranian P69 69_1 1273 89297 G>A variant gous CFA CFAP chr7:8990 ENST000003 c.763C> Tunisia Homozy p.Gln255Ter 8 P69 69_2 1175 89297 T n gous

55 Chapter 3: Studying the mechanism of CFAP69 function

56 3-1. Introduction

CFAP69 is essential for normal sperm flagellum development in humans and mice, and

disruption of the Cfap69 gene leads to severe sperm flagellum defects. The defects affect all components of the sperm flagellum, causing severe disorganization of the axoneme and

flagellum accessory structures, including the mitochondrial sheath, the outer dense fibers, and

the fibrous sheath. Sperm head defects are also occasionally observed. Curiously, a recurrent

feature of sperm possessing morphology defects is that several components are simultaneously

affected. For instance, sperm carrying a mutation affecting the head-tail junction also feature defects in the axoneme and its accessory structures85. Recent research suggests that not only are there many separate processes required for spermiogenesis, but that these processes are tightly intertwined and often required for the development of multiple sperm components. For

example, the manchette and its associated intra-manchette transport process appear

important for both sperm flagellum development86,87 and for sperm head and acrosome

development88. Furthermore, even within this one structure, mutations of some proteins affect

head development more severely than tail development88, whereas others mostly affect tail

development31,89. This suggests that intra-manchette transport encompasses distinct processes that are independent to a degree, but which also depend on a common cytoskeletal structure.

The interdependencies of these spermiogenesis processes, and even the sequence in which they occur, are still poorly understood. Even less understood are the molecular agents that

constitute these processes, how they function individually and in concert, and how they the

govern interactions among their respective processes.

57 Likewise, although it is clear CFAP69 is required for sperm flagellum development, what specific processes CFAP69 participates in and is required for, e.g. axoneme elongation versus fibrous sheath assembly, remain unclear. This is in part due to a lack of understanding of the exact sequence of events during spermiogenesis and of their aforementioned interdependencies. For example, how the assembly of flagellum accessory structures such as the outer dense fibers depends on the assembly of the axoneme, if at all, or whether these processes depend on another common process is not known. While each outer dense fiber is associated with an axonemal doublet, some ultrastructural studies suggest that outer dense fibers can appear normal even in the presence of abnormal axonemes52,90. In contrast, in CFAP69 mutant mice, no flagellum structures are normal. Other studies indicate that outer dense fiber proteins associate with microtubules in vitro, potentially suggesting outer dense fiber assembly is dependent on axoneme assembly30. For this reason, the true spermiogenesis defect in Cfap69 mutant mice is still mysterious, and which observed phenotypes arise from the failure of

CFAP69-dependent processes and which are secondary to this failure is not yet resolved.

Furthermore, although data regarding the cellular location of CFAP69 are still sparse, western blotting experiments, reporter analysis, and immunostaining in human sperm against CFAP69 suggest that CFAP69 is present in both testicular germ cells undergoing spermatogenesis as well as mature spermatozoa, suggesting that CFAP69 may play a role in multiple processes throughout and after spermatogenesis. Identifying these processes and elucidating the role

CFAP69 plays in each of them would not only improve our understanding of how sperm flagella are developed, but also how the different structures and their morphogenesis are or are not interdependent. Towards this end, we found that CFAP69 has homology to many ARM domain-

58 containing proteins, suggesting it interacts with other proteins. Thus, studying CFAP69 and its

interaction partners represents an opportunity to make inroads in understanding the molecular

players in one of the most stunning cellular remodeling processes found in nature.

3-2. Results

CFAP69 likely contains an armadillo repeat domain

CFAP69 appears to localize to the cilia of mouse olfactory sensory neurons and potentially the midpiece of human sperm flagella. Beyond this, little information is available concerning the localization of CFAP69. Even less information is available that would illuminate the actual function of CFAP69, therefore leaving the origin of the sperm development and olfactory defects in CFAP69 KO mice unresolved. To begin to understand the function of CFAP69, we used Phyre2 to predict potential functional domains in the 942 amino acid mouse CFAP69 sequence believed to correspond to testis and olfactory sensory neuron CFAP69 isoforms as detected by western blotting, RNA-seq56, and RT-PCR. Phyre2 predicts protein structure by identifying sequences homologous to the sequence of the protein of interest and then examining known structures for these homologous sequences91. Phyre2 analysis yields a predicted protein structure for CFAP69 with a prominent, characteristic domain of pairs of alpha helixes: an armadillo repeat domain (ARM domain). As expected, this predicted structure resembles the crystal structure of ARM domain of murine b-catenin. The CFAP69 ARM domain appears to span approximately the middle 50% of CFAP69 from amino acids 130-650. A closer analysis of the Phyre2 results indicates high confidence in the prediction of this domain.

Notably, the 20 templates predicted with highest confidence to be homologous to CFAP69 and

59 that were used to model this domain are all ARM domain-containing proteins, including APC, b- catenin, and plakoglobin. These proteins are all predicted with greater than 90% confidence to be true homologues of CFAP69, indicating a high probability the middle portion of mouse

CFAP69 does indeed adopt an ARM domain fold91. In addition, predicted structures for human

CFAP69 and the Chlamydomonas rheinhardtii orthologue FAP69 also contain an ARM domain

and, as should be expected, are predicted to share many of the same ARM domain-containing

proteins as structural homologues. No homologous sequences were found for the regions on

either side of the ARM domain, resulting in a lack of high confidence structural predictions.

The apparent conservation of the CFAP69 ARM domain across species as divergent as humans

and C. rheinhardtii suggests that the ARM domain has an integral role in CFAP69 function.

Although ARM domain-containing proteins have diverse functions, the ARM domain itself

appears to be important for mediating protein-protein interactions. The ARM domain of APC is

known to interact with several proteins, including PP2A and ASEF, and crystal structures of

several of these interactions exist92. b-catenin and plakoglobin both interact with proteins as

diverse as cadherins and transcription factors through their ARM domains93. Thus, the

predicted presence of an ARM domain in CFAP69 strongly suggests that protein-protein

interactions are integral to its function, and we therefore sought to identify and characterize

these interaction partners.

CFAP69 expressed in heterologous systems is largely insoluble under native extraction

conditions

60 To identify potential interaction partners of CFAP69, we aimed to purify CFAP69 and its associated proteins. While an antibody against CFAP69 exists, western blotting indicates that the specificity of this antibody is relatively poor. In both the testis and olfactory epithelium, western blotting detects several bands of greater intensity than the CFAP69 band, indicating this antibody is not suited for immunoprecipitation (See chapter 2, Appendix I). Instead, we decided to produce recombinant CFAP69 to use as bait to capture interaction partners from tissue lysates.

Recombinant proteins are frequently produced in E. coli due to the simplicity of expression induction in this system and the potential to recover relatively large quantities of protein94.

Using this system, we expressed both full length CFAP69 and the CFAP69 ARM domain as N- terminal GST fusion proteins. After induction of protein expression, cells were lysed under mild, physiological conditions (see methods) to preserve the structure of the protein, and the soluble and insoluble portions were separated by centrifugation and fractionated by SDS-PAGE.

Western blotting against GST revealed that both full length CFAP69 and the ARM domain were successfully expressed at different IPTG concentrations, with higher concentrations seeming to cause increased presence of lower molecular weight bands potentially representing degradation products (Fig. 3-1 A and C). Coomassie blue staining revealed that prominent bands corresponding to the predicted size of the CFAP69 and ARM domain fusion proteins, indicating a relatively high level of protein expression (Fig. 3-1 B and D), but unfortunately, these bands were observed exclusively in the insoluble fractions, and pulldown using glutathione failed to capture much, if any recombinant protein as assessed by Coomassie blue staining (Fig. 3-1 B and D). To enhance solubility, expression trials were performed in which

61 molecular chaperones GroESL were co-expressed with the CFAP69 constructs95. However,

CFAP69 protein remained in the insoluble fraction, and the bands corresponding to the chaperones were found in the soluble fractions, indicating that recombinant CFAP69 expressed under these conditions in E. coli is not readily soluble.

Because misfolding and aggregation leading to protein insolubility are problems commonly encountered when using E. coli as a heterologous expression system, we next expressed full

length CFAP69 in Sf9 cells by baculovirus-mediated expression and in HEK293 cells by

expression vector transfection. Both of these cell types are eukaryotic and likely better able to

produce and properly fold eukaryotic proteins than E. coli. When lysates from infected or

transfected cells were separated into soluble and insoluble portions as before, fractionated by

SDS-PAGE, and analyzed by Coomassie blue staining, no obvious band corresponding to CFAP69

was observed in the lysates from either cell type (Fig. 3-2A). However, western blotting

revealed that CFAP69 is in fact expressed (Fig. 3-2B), indicating that the quantity expressed was

likely insufficient for observation by Coomassie blue staining. While a large portion of CFAP69

expressed in Sf9 cells was found in the insoluble fraction (Fig. 3-2B), CFAP69 was also detected

in the soluble fraction. Small-scale purification of CFAP69 from HEK293 cells was successful, but

the quantity was too low to be detected by Coomassie blue staining. Because HEK293 cultures

are more difficult to scale up, the quantity of protein needed for a pulldown experiment would

be difficult to obtain from this system. Instead, we purified CFAP69 from a larger-scale Sf9

cultures and used it as bait to capture potential interaction partners from mouse testis lysates.

The resultant protein mixture was fractionated by SDS-PAGE and stained by Coomassie blue or

analyzed by western blotting (Fig. 3-2 C and D). Compared with a testis lysate-only pulldown

62 control, the CFAP69-containing (CFAP69+) pulldown samples appear to show additional bands possibly representing co-purified interacting proteins (Fig. 3-2 C). The gel regions surrounding

these bands were excised and analyzed by mass spectrometry to identify any proteins present.

As seen in Table 1, the most abundant protein by total number of peptides detected in the

CFAP69+ sample that was not found in the control sample was CFAP69 itself, accounting for about 60% of peptides detected. However, no other protein found only in the CFAP69+ sample accounted for more than 0.05% of total peptides detected. Furthermore, the protein whose

apparent abundance showed the largest difference between the CFAP69+ and CFAP69- samples

was a heat shock protein (HSP7a) with sequence identity to the homologous Bombyx mori protein, indicating potential carryover during purification from Sf9 cells, or non-specific binding

to the affinity support or epitope tag96. (No Sf9 peptide database was readily available, so we

chose to compare our mass spectrometry results to a library of B. mori [silkworm] peptides).

Given these results, we were unable to identify with confidence any potential true interaction

partners of CFAP69.

Curiously, western blotting showed that the CFAP69 protein in the insoluble cell fractions from

HEK293 and Sf9 cells was very slightly larger in size than soluble CFAP69 (Fig. 3-2B). The small

size difference is suggestive of a post-translational modification, so we purified insoluble

CFAP69 under denaturing conditions and assessed whether any phosphorylation was present

by mass spectrometry. The results indicate two phosphorylation sites at S846 and T898, both of

which fall outside the predicted ARM domain. However, soluble CFAP69 was not able to be

purified with sufficient homogeneity for similar analysis. Because endogenously biotinylated

proteins have high affinity for the StrepTactin XT resin, and because the proteins are highly

63 soluble, they are abundantly co-purified with soluble CFAP69. Thus, whether or not differential phosphorylation accounts for the size difference and, potentially, the solubility difference in

CFAP69 from the soluble and insoluble fractions remains unknown.

CFAP69 in mouse testis and sperm is resistant to common mild detergents

That CFAP69 was partially insoluble when expressed in both Sf9 and HEK293 cells was surprising and suggested the insolubility was a feature of the protein itself, its cellular localization, or its function rather than a byproduct of heterologous expression. Thus, we investigated the solubility of endogenous CFAP69 in mouse testis and sperm by differential detergent fractionation. Tissues were extracted sequentially in buffers containing detergents of increasing strength that had been previously demonstrated to extract specific portions of mammalian cells97. The first fraction was extracted with digitonin, which permeabilizes the plasma membrane and releases cytosolic proteins, most microtubules, and microtubule-associated proteins. The second fraction was extracted with Triton X-100, which solubilizes the plasma membrane, integral membrane proteins, and membrane-bound organelles. The nucleus was extracted with deoxycholate. Finally, the remaining matter, consisting largely of cytoplasmic and nuclear intermediate filaments, was solubilized in sodium dodecyl sulfate. Each of these fractions was analyzed by western blotting against CFAP69. Surprisingly, while some CFAP69 was detected in the first fraction from the testis, the majority appeared to localize to the fourth, least soluble fraction (Fig. 3-3B). Similarly, in the epididymal sperm fractions, nearly all

CFAP69 was observed in the fourth fraction, with very little if any CFAP69 observed in the first three fractions (Fig. 3-3A). Furthermore, in testis fraction 4, two bands around 100kDa can be observed in the fourth fraction, while only one can be observed in the first fraction. These two

64 bands are reminiscent of the soluble and insoluble bands observed in the Sf9 and HEK293 cells.

These results indicate that a large portion of endogenous testicular CFAP69 and nearly all of sperm CFAP69 are insoluble, suggesting that CFAP69 in its native state is relatively insoluble or closely associated with insoluble cellular elements.

Figure 3-1. In vitro expression and purification of recombinant CFAP69 and ARM domain from E. coli. (A) and (C). Western blotting analysis of expression induction at three concentrations of IPTG for (A) full length CFAP69 and (C) the CFAP69 ARM domain. The expected size for the full length CFAP69 and ARM domain GST fusion are approximately 130kD and 100kD respectively. Induction was carried out for 3 hours, and blots were probed with a mouse anti-GST antibody. For both proteins, western blotting detects many lower molecular weight bands at the two higher concentrations of IPTG, suggesting degradation of the recombinant protein. (B) and (D). Coomassie blue staining polyacrylamide gels following SDS-PAGE. Full length CFAP69 (B) or the CFAP69 ARM domain (D) was purified using glutathione. -, uninduced whole cell lysate; +, induced whole cell lysate; S, soluble cell lysate fraction; I, insoluble cell lysate fraction; W, wash fraction; E, elution fraction. Asterisks indicate bands representing recombinant CFAP69. These bands are only observed in the whole cell lysates and the insoluble fractions.

66 Figure 3-2. In vitro expression and co-purification of recombinant CFAP69 from Sf9 cells. (A). Coomassie blue staining after SDS-PAGE of Sf9 lysates infected with CFAP69-TST baculovirus at various multiplicities of infection (MOI) at different times post-infection. The expected size of CFAP69-TST is approximately 105kD. No obvious band at the expected size can be observed in the infected lysates. (B). Western blotting analysis of infected Sf9 cell lysates at various MOIs 48 hours post- infection. S, soluble cell lysate fraction; I,insoluble cell lysate fraction. Blots were probed with Streptactin conjugated to HRP. Recombinant CFAP69 is detected in approximately equal quantities in both MOI conditions. CFAP69 in fraction I runs slightly slower than CFAP69 in fraction S. (C). Coomassie blue staining after SDS-PAGE of pulldown from testis lysate with (+) and without (-) recombinant CFAP69. Testis lysates were passed through StrepTactin XT columns with or without bound CFAP69, and captured proteins were eluted with biotin in several fractions. Asterisks indicate distinct bands appearing only in CFAP69 + fractions. (D). Western blotting of the same samples as in (C) with Streptactin-HRP. Arrowhead indicates endogenously biotinyated protein that was abundantly co-purified due to the affinity of biotin for StrepTactin. Arrow indicates CFAP69.

Figure 3-3. Differential detergent fractionation of wildtype and Cfap69 KO testis and sperm. Western blotting analysis of testis (A) and epididymal sperm (B) fractionated with a series of detergents. W = whole tissue homogenized in 2x Laemmli buffer. Each fraction represents the proteins solubilized by a particular detergent. The blots were probed with custom rabbit anti- CFAP69 antibody, and the arrow indicates the band representing CFAP69. In (A), there is a larger molecular weight band present only in the wildtype samples. The identify of this band is not known.

68 Rank Gene Symbol # Fragments % Fragments Rank Gene Symbol # Fragments % Fragments 1 Cfap69 253 21.01% 26 Eif2s2 2 0.17% 2 Hspa4 8 0.66% 27 Prkaca 2 0.17%

3 Psmc1 5 0.42% 28 Prmt5 2 0.17% 4 Xpo1 4 0.33% 29 Chd3 2 0.17% 5 Dnaja1 4 0.33% 30 Uhrf1 2 0.17% 6 Trmt1l 3 0.25% 31 Tubal3 1 0.08% 7 Psmc6 3 0.25% 32 Rpa1 1 0.08% 8 Larp7 3 0.25% 33 Txndc5 1 0.08% 9 Ap2a1 3 0.25% 34 Poldip3 1 0.08% 10 Ddx1 3 0.25% 35 Pla2g6 1 0.08% 11 Psmc4 3 0.25% 36 P01806_HVM36_MOUSE 1 0.08% 12 Atp2a1 3 0.25% 37 Rsph1 1 0.08% 13 9530053A07Rik 3 0.25% 38 Kpna2 1 0.08% 14 Dnajc10 2 0.17% 39 Rbm46 1 0.08% 15 Tufm 2 0.17% 40 Tomm70a 1 0.08% 16 Dnaja4 2 0.17% 41 Psmd6 1 0.08% 17 Dnajb11 2 0.17% 42 Canx 1 0.08% 18 Lonp1 2 0.17% 43 Eif3d 1 0.08% 19 Pspc1 2 0.17% 44 Lrch3 1 0.08% 20 Anxa1 2 0.17% 45 Dnajc7 1 0.08% 21 Tbc1d5 2 0.17% 46 Hnrnpdl 1 0.08% 22 Acadvl 2 0.17% 47 Vtn 1 0.08% 23 Sep9 2 0.17% 48 Pcbp1 1 0.08% 24 Pygb 2 0.17% 49 Ipo5 1 0.08% 25 Slc2a3 2 0.17% 50 Ppm1b 1 0.08%

Table 3-1. The 50 most abundant proteins detected by mass spectrometry after pulldown from mouse testis using recombinant CFAP69. Only proteins unique to the CFAP69+ sample were included. These were subsequently sorted by number of peptide fragments detected per protein

69 3-3. Discussion

Analysis of human, mouse, and C. rheinhardtii CFAP69 predicts the presence of an ARM domain

in all of these orthologues, suggesting that this domain, and therefore protein-protein

interactions, are important to CFAP69 function. While these results are purely predictive and

still lack experimental support, Phyre2 and other similar prediction algorithms have been

shown to accurately assess the confidence of predictions regarding structural homology, which correlates strongly with the accuracy of modeling91. In conjunction with the fact that the majority of ARM domain-containing proteins are known to interact with other proteins, these

results strongly support the hypothesis that CFAP69 interacts with other proteins. However,

knowing that CFAP69 likely contains an ARM domain does not shed much light on the actual function, as ARM domain-containing proteins have been shown to interact with many different

kinds of proteins and to therefore influence many processes within the cell. These include

nuclear transport, transcriptional regulation, and cell-cell adhesion. Indeed, the same ARM

domain can contain regions that interact with different proteins93, and the possibility that

CFAP69 interacts with multiple proteins cannot be ruled out. Interestingly, several other

proteins shown to be essential for sperm flagellum development in mice are also predicted to

contain ARM domains. For example, SPAG6, an axoneme-associated protein required for

normal sperm flagellum development, contains an ARM domain and is known to interact with

other proteins98. Unlike CFAP69, SPAG6 also appears to be essential for other cilia, as lack of

SPAG6 causes severe defects such as hydrocephalus in mice98. Likewise, some other essential

axonemal proteins also appear to ARM domains, including ARMC4, the disruption of which

70 causes primary ciliary dyskinesia99. The significance of these proteins having ARM domains, if

there is any, is not known.

While our attempts to identify protein interaction partners of CFAP69 have to date been

unsuccessful, our studies have yielded some insights into the nature of CFAP69. We found that

CFAP69 is insoluble when expressed in E. coli – an inconvenient though unsurprising result.

Methods exist for the solubilization and refolding of insoluble recombinant proteins expressed

in E. coli, but there is little guarantee that refolding yields proteins in the native conformation, which is an important pre-requisite for capturing bona fide interacting proteins. Therefore, we elected instead to express this protein in eukaryotic systems. Surprisingly, we found that much of CFAP69 expressed in HEK293 and Sf9 cells is still insoluble. Furthermore, after purification of soluble CFAP69 and pulldown to capture interaction partners from testis lysate, no promising candidates were detected. While our mass spectrometry experiments were not quantitative, intra-run peptide abundances can provide some information about that protein’s actual abundance within the sample, and our results indicate that all of the proteins unique to the

CFAP69+ sample were extremely low in abundance. Furthermore, the most enriched protein in the CFAP69+ sample relative to the control sample was likely a Sf9 heat shock protein, potentially suggesting misfolding in Sf9 cells rather than pulldown of this protein as an interaction partner from testis lysates.

Additionally, we found that the relative insolubility of CFAP69 appears to be a feature of the protein rather than a byproduct of overexpression. Notably, differential detergent fractionation of mouse testis and sperm reveals that most CFAP69 protein is found in the least soluble fraction requiring SDS for solubilization. This fraction has been shown to be enriched in

71 intermediate filaments and desmosome components, and many ARM domain-containing proteins have also been shown to be associated with desmosomes. Within the testis, desmosomes are present between Sertoli cells and germ cells up until spermatids begin elongating100,19 – after flagellum development initiates. However, little information about the role of desmosomes or intermediate filaments in spermatogenesis and whether these junctions could potentially influence flagellum development is available, and the significance of the relative insolubility of CFAP69 remains unknown.

Taken together, our results indicate that our initial approach to expressing CFAP69 for use as bait is likely inappropriate and infeasible when considering the properties of this protein.

Alternative approaches to identifying interacting proteins include the use of proximity proteomics, such as by APEX101 or BioID102. By fusing an enzyme to CFAP69 that catalyzes labeling of surrounding proteins in a proximity-dependent manner, these methods circumvent the insolubility of CFAP69 while enabling specific labeling of physiologically relevant interaction partners. These methods also enable the detection of transient interacting partners.

Furthermore, since labeling with these methods would occur within cells rather than in bulk lysate, these studies would permit identification of interaction partners at distinct stages and in distinct cell types of spermatogenesis – a notable advantage over our previously attempted methods. Such results would help to clarify what processes CFAP69 is important for.

Lastly, towards the goal of understanding CFAP69 function, detailed localization studies of

CFAP69 using either an effective antibody or a tagged allele of CFAP69 would be extremely informative. The repeated failure of custom antibodies to produce any immunostaining results in mouse reproductive tissues has frustrated efforts to obtain this information, but efforts are

72 currently underway to generate a mouse carrying a tagged CFAP69 allele. Identifying where

CFAP69 is located in developing spermatids as well as mature spermatozoa would greatly

increase our understanding of the role of CFAP69 in spermatogenesis and, in conjunction with

identification and characterization of CFAP69-interacting proteins, would shed light on the

processes that contribute to sperm flagellum development.

3-4. Methods

Structural prediction using Phyre2

The amino acid sequences of human and mouse CFAP69 as well as C. rheinhardtii FAP69 used

for analysis were obtained from Uniprot. The Phyre2 server was used according to the authors’ published protocol91.

CFAP69 expression in E. coli

All constructs were generated by restriction-ligation cloning. For expression in E. coli, full length

CFAP69 and the ARM domain (amino acids 2-670) cDNA were cloned into the EcoRI site of

pGEX-2T to generate N-terminal GST fusion proteins. Constructs were transformed either alone

or co-transformed with pBB528 and pBB541 (encoding the bacterial chaperones GroESL, and a

gift from Bernd Bukau) into BL21(DE3) competent cells (NEB C2527I) according to the

manufacturer’s instructions. Colonies were inoculated in LB with the appropriate antibiotics

and grown overnight at 37˚C, 250rpm. The following day, the overnight culture was diluted

1:200 in fresh LB containing the appropriate antibiotics and grown at room temperature until

the O.D. 600 was approximately 0.5 as measured by Beckman Coulter DU 530

73 spectrophotometer. Isopropyl β-D-1-thiogalactopyranoside (IPTG) was added to a final concentration of 40µM to induce expression, and cultures were incubated at room

temperature for an additional 3 hours. The cultures were then centrifuged at 6000xg for 20

minutes to harvest the cells. The LB was discarded, and the cells washed once in phosphate

buffered saline (PBS), pH 7.4 before being resuspended in lysis buffer (50mM Tris pH 8.0,

150mM NaCl, 1mg/mL lysozyme, 250U/mL Benzonase [Sigma-Aldrich E1014], Roche cOmplete mini protease inhibitor tablet [Sigma-Aldrich 11836170001]). The cell solution was incubated for 30 minutes at room temperature with agitation, after which the soluble and insoluble were separated by centrifugation at 20000xg for 30 minutes at 4˚C. 2x Laemmli buffer (65.8mM Tris-

HCL pH 6.8, 26.3% (w/v) glycerol, 2.1% SDS, 0.01% bromophenol blue, 10% 2-mercaptoethanol) was added to each fraction, and the fractions were analyzed by SDS-PAGE, described below.

CFAP69 expression in HEK293 cells

HEK293 cells were maintained in culture medium consisting of low glucose Dulbecco’s Modified

Eagle Medium (Gibco 11966025) supplemented with 10% fetal bovine serum (FBS) and passaged when approximately 80% confluent. To passage, culture medium is aspirated, and cells are washed in Hank’s Balanced Salt Solution (HBSS, Gibco 14170112). The HBSS is then aspirated, and Trypsin-EDTA (Gibco 25200056) is added to cover the cells. After incubation for 5 minutes at 37˚C, cells are resuspended in culture medium plated at the appropriate density.

CFAP69 expression vectors were generated by cloning full length CFAP69 cDNA with a C- terminal hexa-histidine tag into the NotI-XhoI sites of pEGFP-N1. Plasmids were purified using

Qiagen Plasmid Purification Kits according to the manufacturer’s instructions. The day before

74 transfection, cells were plated to reach 80-90% confluency in 24 hours. To transfect, culture medium was exchanged for transfection medium (DMEM supplemented with 5% FBS). Roughly

1.2µg Plasmid DNA per 1 x 106 cells was resuspended in HBSS of volume equal to 10% of the culture medium volume. An equal volume of PEI solution is prepared (5mg/mL linear PEI MW

40,000 [Polysciences 24765] in 0.2N HCl, diluted 100-fold in HBSS). The DNA and PEI solutions are combined, gently mixed by pipetting, and incubated at room temperature for 5 minutes, after which the solution is added dropwise to the cells. After 3 hours, the medium is exchanged with fresh transfection medium.

48 hours after transfection, cells were lysed in NP-40 lysis buffer (150 mM NaCl, 1.0% NP-40, 50 mM Tris, pH 8.0, and Roche cOmplete mini) by incubating for 30 minutes with agitation at 4˚C.

Soluble and insoluble fractions were separated by centrifugation at 20000xg for 30 minutes at

4˚C. 2x Laemmli buffer was added to each fraction, and the fractions were analyzed by SDS-

PAGE and western blotting.

CFAP69 expression in Sf9 cells

Sf9 cells were maintained as suspension cultures in SF-900 III SFM (Gibco 12658001) at 27˚C,

125RPM and subcultured at densities of 2-4 x 106 cells/mL. Baculovirus was produced using the

Bac-to-Bac Baculovirus Expression System (Gibco 10359016) using the manufacturer’s directions. CFAP69 was cloned as a C-terminal TwinStrep Tag (TST) (IBA Life Sciences) fusion into the EcoRI-XhoI sites of pFastBac1, supplied with the Bac-to-Bac system. Viruses were amplified once according to the manufacturer’s instructions. To express CFAP69, Sf9 cells were infected at a multiplicity of 3, assuming a titer of 1x107 plaque forming units per mL. Cells were

75 harvested 72h after infection by centrifugation at 10000g, 4˚C for 15 minutes. The cells were then washed once in PBS before being lysed in NP-40 lysis buffer as described above.

Purification of CFAP69-TST and capture of interaction partners.

Soluble CFAP69 was purified from Sf9 cells by affinity chromatography using StrepTactin XT (IBA

Life Sciences), which has nanomolar affinity for the TwinStrep Tag. Following lysis of infected

Sf9 cells in NP-40 lysis buffer, the soluble portion was separated from the insoluble portion by centrifugation. The soluble portion was then loaded onto a StrepTactin XT gravity flow column, and CFAP69 was purified according to the manufacturer’s instructions.

To capture interaction partners from testis lysates, wildtype mouse testes were homogenized in

NP-40 lysis buffer using a dounce homogenizer, and the soluble and insoluble fractions were separated as described above. Following binding of CFAP69 to the StrepTactin XT column and extensive washing, the soluble fraction of the testis lysate was added to the column. Only a single wash was performed to maximize retention of interaction partners, and the column’s contents were eluted following the manufacturer’s instructions. The eluate was analyzed subsequently by Coomassie blue staining, western blotting, and mass spectrometry.

To purify insoluble CFAP69, the insoluble fraction of Sf9 cell lysates was solubilize in 8M urea.

This solution was diluted in NP-40 lysis buffer to reduce the concentration of urea to 6M.

CFAP69 was then purified on a StrepTactin XT column using the manufacturer’s instructions.

SDS-PAGE, Coomassie blue staining, and western blotting

76 SDS-PAGE was performed using 8% polyacrylamide gels. For Coomassie blue staining, gels were fixed for 15 minutes in 40% ethanol and 10% acetic acid, washed in deionized water, and submerged in QC Colloidal Coomassie (Bio-Rad 161-0803) overnight with gentle agitation. Gels were then de-stained in 3 changes of deionized water over 3 hours before being photographed.

For western blotting, proteins were transferred from polyacrylamide gels to polyvinylidene fluoride membranes by wet transfer in Towbin Buffer (25 mM Tris base, 192 mM glycine, 20% methanol, 0.025% SDS). Membranes were blocked in 3% BSA in tris-buffered saline with Tween-

20 (TBST) for 1 hour at room temperature. Custom anti-CFAP69 antibody58 was diluted 1:1000 in blocking solution and incubated with the membrane overnight at 4˚C. The membrane was then washed in TBST and incubated with HRP-conjugated anti-Rabbit IgG antibody (GE

Healthcare, NA934) at a 1:2000 dilution in blocking solution for 1 hr at room temperature.

After washing, Western Lightning Plus-ECL reagent (Perkin Elmer NEL103001) was applied to the membrane according to manufacturer instructions. The membranes were then exposed to autoradiography film.

Mass spectrometry

For analysis of protein samples by mass spectrometry, samples were fractionated on polyacrylamide gels and stained with coomassie blue as detailed above. Regions of interest were excised from the gel and sent to the Taplin Mass Spectrometry Factility (Harvard Medical

School, Boston, MA) for analysis by liquid chromatography-tandem mass spectrometry.

Differential detergent fractionation

77 To collect mouse testes and sperm, mice were first deeply anesthetized with Avertin (2,2,2- tribromoethyl alcohol in 2-methyl-2-butanol) and then euthanized by cervical dislocation. The testes and cauda epididymides were dissected into PBS, pH 7.4. To collect sperm, the epididymides were finely minced in the PBS with scissors and incubated at 37˚C for 15 minutes.

The sperm-containing supernatant was then transferred to a new tube.

Differential detergent fractionation was performed following the protocol described by Ramsby and Makowski95. Testes were suspended in the first detergent solution and homogenized with a dounce homgenizer. Sperm were directly suspended in the first detergent solution.

Centrifugation and subsequent extractions were performed strictly according to the previously described protocol. Fractions were then analyzed by western blotting.

78 Chapter 4: Concluding remarks

79 The results of this thesis begin to establish a role for CFAP69 in spermiogenesis, but our

understanding of the protein’s function is still preliminary, and much work remains to be

completed. It is the writer’s hope that the missteps and successes documented herein will be

useful to other scientists who choose to investigate the function of CFAP69.

Thus far, our studies of CFAP69 have illustrated the defects accompanying the loss of this protein, but they do not shed much light on spermiogenesis itself. Crucially, the actual function of CFAP69 is still unknown and should be a priority in future investigations.

4-1. CFAP69 and human health

Our studies of CFAP69 in the male mouse reproductive system attest to the utility of mouse

models for understanding spermatogenesis. In particular, mouse models enable in depth examination of the testicular origins of sperm defects – an approach that is difficult in humans.

This is possible due to the conservation of many spermatogenesis processes and components between humans and mice. On a similar note, however, a disadvantage of these models is that

many mutations found to impact spermatogenesis in mice have yet to be confirmed in humans.

We are fortunate to have established that CFAP69 is in fact required in human spermatogenesis

– a somewhat unsurprising result considering the conservation of CFAP69 between mouse and human, but a significant one nonetheless. This finding adds one more mutation to the litany of factors contributing to male infertility and will enable more refined diagnosis for at least some hitherto idiopathic sperm defects.

It is sometimes tempting to see a disease-related gene as a treatment target, but CFAP69 may not be a good candidate for infertility treatment. Only a small portion of patients with multiple

80 morphological abnormalities of the flagellum (MMAF) have thus far been shown to carry

CFAP69 mutations, or any other single-gene mutation, illustrating the heterogeneity present in this disorder and the challenge of finding treatments for MMAF in general. Furthermore, rectifying mutations that disrupt later stages of spermatogenesis, i.e. spermiogenesis versus stem cell maintenance, to treat infertility may not even be necessary. In contrast to defects in meiosis, testis development, or germ cell maintenance in which germ cells are arrested in diploid stages or absent altogether, defects in spermiogenesis permit the development of haploid spermatids. Importantly for male infertile patients with MMAF, intra-cytoplasmic sperm injection has been shown to be effective103,104. The availability of an established procedure yielding good results obviates the usefulness of therapies targeting specific spermiogenesis genes that would benefit only a select group of patients.

Perhaps more interesting is CFAP69 as a potential target for contraceptive development.

CFAP69 has several ideal characteristics as a contraceptive target. First, CFAP69 is absolutely required for sperm development, as we fail to observe any normal sperm in both humans and mice lacking CFAP69. Second, CFAP69 seems dispensable for general wellbeing, although presently available data suggests that CFAP69 may have functions in other biological systems

(discussed in section 4-4). Mice lacking Cfap69 show no overt deficiencies in behavior, morphology, general health, or lifespan. Likewise, patients with CFAP69 mutations are also found to be in generally good health and do not report any other clinical abnormalities (Chapter

2)105. Indeed, the two patients we worked with did not even report noticeable olfactory deficits.

This is in contrast to some other genes required for sperm flagellum development, which are essential ciliary genes and the disruption of which lead to serious clinical abnormalities. Thus,

81 CFAP69 presents a potential contraceptive target that would yield highly specific effects and be

efficacious. At the same time, however, spermatogenesis is by its very nature hard to disrupt

owing in large part to the constancy and sheer scale of sperm production (an adult male

produces about 120 million sperm every day)18. Furthermore, only one sperm is necessary for

fertilization. A major challenge in targeting a specific gene to induce infertility would be to

maintain sufficient inhibition in all germ cells, lest residual spermatogenesis produce enough

functional spermatozoa to render treatment ineffective.

4-2. Towards a molecular-level understanding of spermiogenesis

While the benefits to human health of studying CFAP69 may be debatable, the scientific merits

are not. Spermiogenesis remains one of the most dramatic cell transformation processes

observed and has fascinated scientists for decades. Each of the individual processes of spermiogenesis – whether acrosome development or flagellum assembly – is extraordinary in magnitude even at the anatomical level, and they have been described at the visible light level in painstaking detail. Such magnitude is likely in turn to require intricate cellular programs, and in contrast to the physical changes, research is only beginning to unravel the molecular programs that underpin spermiogenesis. Understanding these processes would illuminate not only the process itself, but also some mechanisms by which cells are capable of and ultimately effect drastic change. Additionally, the degree of coordination throughout spermatogenesis is remarkable: wave after wave of highly stereotyped germ cell differentiation occurs with precise timing in the seminiferous epithelium. This precision is maintained in spermiogenesis even largely in the absence of transcriptional regulation (owing to the condensation of the nucleus),

82 indicating a remarkable degree of translational and post-translation control. The mechanisms by which sequences of spermatogenesis and spermiogenesis processes are precisely coordinated and initiated, and even the precise order of events, are still mysterious and await

discovery.

Based on the phenotype of mice and humans lacking Cfap69, studying CFAP69 may serve as a

point from which to study either a process upon which sperm flagellum assembly specifically

depends, or for understanding how flagellum assembly processes are coordinated. CFAP69

seems to be specifically required for the assembly of the sperm flagellum rather than for ciliary

assembly in general, indicating that CFAP69 is capable of playing a specialized, specific role

during spermiogenesis distinct from those used by other cilia, and the presence of defects

affecting all components of the sperm flagellum indicate CFAP69 either coordinates

development of these components or is required for a process that is required by all of these

components. Interestingly, as our results in Chapter 2 show, Cfap69 KO mice have sperm that

also have axonemal defects. During spermiogenesis, the axoneme is one of the earliest

structures to begin assembly in a process resembling ciliogenesis in other cells. That the sperm

axoneme is disrupted while other cilia remain seemingly normal suggests that sperm axoneme

assembly may depend on sperm-specific processes. Much remains to be learned about CFAP69,

and for now, CFAP69 represents one of a number of proteins associated with a spectrum of

abnormal spermiogenesis phenotypes, but for which no definitive functions have been

ascribed, in part owing to the surprising difficulty of studying this protein.

83 4-3. Studying problematic proteins

The difficulty of studying CFAP69 far exceeded my expectations. Encountering a protein that is ill-behaved during heterologous expression is not uncommon. An antibody needing extensive optimization for immunostaining is also routine. However, in the case of CFAP69, these difficulties have thus far proven insurmountable. A key to overcoming these problems is to work with the endogenous protein, and with the advent and steady improvement of

CRISPR/Cas9 technologies, this approach is now feasible. Specifically, efficient CRISPR/Cas9 technology enables rapid, efficient, and affordable modification of endogenous genes. Potential modifications now include tags that achieve many diverse functions, including serving as epitopes, fluorescent proteins, or even acting to label nearby proteins. As CFAP69 appears refractory to antibody labeling, generating an allele tagged with a robust labeling system, as mentioned in Chapter 3, is likely a more viable method of studying CFAP69 localization.

Proximity-based protein labeling enzymes are likely to be a particularly valuable tool in the testis for elucidating the many complex and intertwined pathways at cell- and stage-specific resolution. Such methods naturally have their own drawbacks. A major one is the lack of information for most proteins about which portions of a molecule may safely be modified without altering its native properties. Nonetheless, these new methods represent promising ways to make advances into not just understanding CFAP69, but also spermiogenesis more generally.

Though frustrating, this experience also served as a valuable reminder of the importance of challenging the assumptions on which assessments of an experiment’s feasibility are built. In

84 planning pulldown experiments, an important requirement is that the native protein in its

physiological setting be soluble under the mild conditions that permit physiological interactions

to occur. While we were able to purify soluble recombinant CFAP69, we have shown that native

CFAP69 is largely insoluble, suggesting the soluble form is not representative of native CFAP69,

therefore leaving the properties and relevance of this soluble form debatable. Our failure to

assess from the very beginning whether the properties of CFAP69 were conducive to such

pulldown experiments resulted in an unnecessarily circuitous route to this discovery and represents a hard-won but important lesson to the writer.

4-4. One CFAP69 function or many?

CFAP69 may have a specialized role in sperm flagellum development, but our studies have

shown that this is not the only role of CFAP69. CFAP69 is also important for proper regulation of olfactory signal transduction kinetics. How the roles of CFAP69 in spermatogenesis and olfaction – two seemingly disconnected processes – are related is an enduring and perplexing mystery. Given the nature of the olfactory and spermatogenic defects in Cfap69 mutant mice, it is difficult to even speculate what might be a common underlying issue. Perhaps it is more likely that CFAP69 has different roles in different systems, especially considering the functional flexibility of armadillo repeat domains.

We have also observed CFAP69 protein in the mature sperm themselves, suggesting that

CFAP69 may play yet another role separate from spermiogenesis. Furthermore, preliminary phenotyping data from the International Mouse Phenotyping Consortium suggest that Cfap69 knockout mice have increased lean to fat mass, decreased circulating insulin, and lower mean

85 platelet volume. Although decreased circulating insulin and altered lean to fat mass ratio can be

conceivably related, these intriguing phenotypes appear disparate and unrelated when

considered together with the reproductive and olfactory phenotypes. Also intriguing is the fact

that the unicellular green alga Chlamydomonas rheinhardtii possesses an apparent orthologue

of this protein, and that it has been detected in axonemal protein mass spectrometry

screens106. While no mutational analysis of FAP69 has been conducted in C. rheinhardtii, the

localization of FAP69 suggests that it is a ciliary protein, which is consistent with the detection of mouse CFAP69 in olfactory sensory neuron cilia and its role in sperm flagellum development.

How cilia factor into regulation of fat mass or platelet volume and the overall effects of these variations on the animal are not known and could represent an interesting line of investigation.

86 Appendix I. Cilia- and Flagella-Associated Protein 69 Regulates Olfactory Transduction Kinetics in Mice

Anna K. Talaga, Frederick N. Dong, Johannes Reisert, and Haiqing Zhao.

This chapter was published in the Journal of Neuroscience in 2017.

DOI: 10.1523/JNEUROSCI.0392-17.2017

Frederick Dong conducted analysis of olfactory sensory neuron cilia morphology.

87 The Journal of Neuroscience, June 7, 2017 • 37(23):5699–5710 • 5699

Cellular/Molecular Cilia- and Flagella-Associated Protein 69 Regulates Olfactory Transduction Kinetics in Mice

X Anna K. Talaga,1 Frederick N. Dong,1 Johannes Reisert,2 and XHaiqing Zhao1 1Department of Biology, The Johns Hopkins University, Baltimore, Maryland 21218, and 2Monell Chemical Senses Center, Philadelphia, Pennsylvania 19104

Animals detect odorous chemicals through specialized olfactory sensory neurons (OSNs) that transduce odorants into neural electrical signals. We identified a novel and evolutionarily conserved protein, cilia- and flagella-associated protein 69 (CFAP69), in mice that regulates olfactory transduction kinetics. In the olfactory epithelium, CFAP69 is enriched in OSN cilia, where olfactory transduction occurs. Bioinformatic analysis suggests that a large portion of CFAP69 can form Armadillo-type ␣-helical repeats, which may mediate protein–protein interactions. OSNs lacking CFAP69, remarkably, displayed faster kinetics in both the on and off phases of electrophysiological responses at both the neuronal ensemble level as observed by electroolfactogram and the single-cell level as observed by single-cell suction pipette recordings. In single-cell analysis, OSNs lacking CFAP69 showed faster response integration and were able to fire APs more faithfully to repeated odor stimuli. Furthermore, both male and female mutant mice that specifically lack CFAP69 in OSNs exhibited attenuated performance in a buried food pellet test when a background of the same odor to the food pellet was present even though they should have better temporal resolution of coding olfactory stimulation at the peripheral. Therefore, the role of CFAP69 in the olfactory system seems to be to allow the olfactory transduction machinery to work at a precisely regulated range of response kinetics for robust olfactory behavior. Key words: CFAP69; olfaction

Significance Statement Sensory receptor cells are generally thought to evolve to respond to sensory cues as fast as they can. This idea is consistent with mutational analyses in various sensory systems, where mutations of sensory receptor cells often resulted in reduced response size and slowed response kinetics. Contrary to this idea, we have found that there is a kinetic “damper” present in the olfactory transduction cascade of the mouse that slows down the response kinetics and, by doing so, it reduces the peripheral temporal resolution in coding odor stimuli and allows for robust olfactory behavior. This study should trigger a rethinking of the significance of the intrinsic speed of sensory transduction and the pattern of the peripheral coding of sensory stimuli.

Introduction behavior. Although the mechanisms for sensory transduction Sensory receptor cells detect and transduce salient sensory stim- vary among different systems, sensory receptor cells have evolved uli into cellular electrical signals that encode the type, intensity, to be sensitive, rapid responding, and adaptable. duration, and kinetics of the stimuli. These electrical signals are In the vertebrate olfactory system, olfactory sensory neurons transmitted to and eventually interpreted by the brain to guide (OSNs) in the nose detect and transduce odorous chemicals, or odorants, into membrane depolarization, which leads to generation and transmission of action potentials (APs) to the olfactory Received Feb. 10, 2017; revised April 27, 2017; accepted April 29, 2017. Author contributions: A.K.T., J.R., and H.Z. designed research; A.K.T., F.N.D., and J.R. performed research; A.K.T., bulb of the brain (Firestein, 2001). Olfactory transduction takes J.R., and H.Z. analyzed data; A.K.T., J.R., and H.Z. wrote the paper. place in the cilia of the OSN, which extend from the tip of the This work was supported by the National Institutes of Health (Grant DC007395 to H.Z.) and the Monell Chem OSN dendrite into the mucus covering the nasal epithelium. In Senses Center Fund (Grant G20OD020296 to J.R.). A.K.T. and F.N.D. were partially supported by NIH training grant the vast majority of OSNs, transduction is mediated through a T32GM007231. We thank Aaron Stephen for the initiation of and the early effort in this study; Randall Reed, Marnie Halpern, Samer Hattar, and Rejji Kuruvilla for critical discussion and suggestions; and members of the Zhao, Hattar, G-protein-coupled, cAMP-mediated signaling cascade (Kleene, and Kuruvilla laboratories for discussion. 2008; Kaupp, 2010; Ferguson and Zhao, 2016). Specifically, the The authors declare no competing financial interests. binding of an odorant to its G-protein-coupled odorant receptor Correspondenceshouldbeaddressedtoeitherofthefollowing:HaiqingZhao,DepartmentofBiology,TheJohns (Buck and Axel, 1991) can lead to sequential activation of the Hopkins University, 3400 N. Charles Street, Baltimore, MD 21218, E-mail: [email protected]; or Johannes Reisert, Monell Chemical Senses Center, 3500 Market Street, Philadelphia, PA 19104, E-mail: [email protected]. odorant receptor, the olfactory G-protein Golf (Jones and Reed, DOI:10.1523/JNEUROSCI.0392-17.2017 1989; Belluscio et al., 1998) and the G-protein effector adenylyl Copyright © 2017 the authors 0270-6474/17/375699-12$15.00/0 cyclase 3 (AC3) (Bakalyar and Reed, 1990; Wong et al., 2000). 5700 • J. Neurosci., June 7, 2017 • 37(23):5699–5710 Talaga et al. • CFAP69 Regulates Olfactory Response

Activation of AC3 then leads to synthesis of cAMP, which in turn to genotype the Cfap69 allele by PCR, with expected band sizes being 750 binds to and opens the olfactory cyclic-nucleotide-gated (CNG) bp for WT and 921 bp for the floxed exon. channel (Dhallan et al., 1990; Brunet et al., 1996), allowing influx X-gal and immunofluorescent staining. Deeply anesthetized mice (by of cations Na ϩ and Ca 2ϩ and triggering membrane depolariza- Avertin) were transcardially perfused with PB, pH 7.4, followed by 4% tion. Intraciliary Ca 2ϩ can open a calcium-activated chloride (w/v) paraformaldehyde (4% PFA in PBS), and then postfixed in 4% PFA for 1 h. The tissue was decalcified in 500 mM EDTA in PBS for 1–2 d and channel (Kleene and Gesteland, 1991; Kurahashi and Yau, 1993), then cryoprotected in 30% (w/v) sucrose in PBS for 1 d. The tissue was Anoctamin 2 (ANO2) (Pifferi et al., 2009; Stephan et al., 2009; Ϫ cut into 18-␮m-thick coronal cryosections. For X-gal staining (Mom- Rasche et al., 2010; Billig et al., 2011), which is responsible for Cl baerts et al., 1996), tissue sections were washed in PBS and incubated in efflux and further membrane depolarization. The electrical re- PBS containing potassium ferricyanide, potassium ferrocyanide, and sponse of OSNs not only rapidly turns on, but also rapidly turns X-gal (Sigma-Aldrich) at 37°C for 12–16 h. For immunofluorescent off when the odor stimulus is removed. Rapid termination of the staining, sections were incubated at 4°C overnight with primary antibod- response enables OSNs to recover sufficiently to respond to ies (except for anti-CFAP69 antibody, which was incubated for 2 d) in subsequent stimulation. To achieve rapid termination, OSNs ac- PBS containing 0.1% (v/v) Triton X-100 and 1% (v/v) donkey serum. tively remove cilial cAMP and Ca 2ϩ, thus closing the CNG chan- After washing, the sections were incubated with fluorescent secondary nel and the chloride channel, respectively. The cAMP is degraded antibodies for 1 h at room temperature. After washing, the sections by phosphodiesterase 1 C in the cilia (Yan et al., 1995; Cygnar and mounted in Fluoromount Aqueous Mounting Medium (Sigma-Aldrich) 2ϩ containing DAPI stain and imaged on an LSM 700 confocal microscope Zhao, 2009) and Ca is extruded from the cilia by a potassium- with Zen software (Zeiss). Primary antibodies were used at the following dependent sodium/calcium exchanger, NCKX4 (Stephan et al., dilutions: anti-CFAP69 (rabbit, custom antibody), 1:100; anti-acetylated 2011). tubulin (mouse; Sigma-Aldrich T7451, RRID: AB_609894, 1:500; Ross et Despite substantial knowledge about the above-mentioned al., 2005; Tadenev et al., 2011); phalloidin–Alexa Fluor-488 (Thermo core components of the olfactory transduction cascade, less un- Fisher Scientific, A12379, 1:500); anti-G␥13 (rabbit, 1:200, gift of R. derstood is how the transduction process is regulated to allow for Reed; Li et al., 2013), 1:200; anti-AC3 (rabbit, Santa Cruz Biotechnology proper sensitivity and response kinetics when responding to sc-588, 1:200, RRID: AB_630839) (Zou et al., 2007); and anti-ANO2 odors. To better understand olfactory transduction, we sought to (rabbit, Santa Cruz Biotechnology, sc-292004, RRID: AB_10844038, investigate a novel protein, cilia- and flagella-associated protein 1:100; Dibattista et al., 2012; Maurya and Menini, 2014). The following 69 (CFAP69), which was found previously in an OSN cilial pro- secondary antibodies were used in 1:400 dilutions: anti-rabbit–Alexa Fluor-488 (donkey, Thermo Fisher Scientific, A-21206) for anti- teomic analysis (Stephan et al., 2009). The function of this pro- CFAP69, anti-G␥13, and anti-ANO2; anti-rabbit–Alexa Fluor-546 tein had not been investigated in any system. By selectively (goat, Thermo Fisher Scientific, A-11029) for anti-AC3; and anti-mouse- knocking out the Cfap69 gene in mature OSNs, we were able to Alexa-546 (goat, Thermo Fisher Scientific, A-21123) for anti-acetylated study the role of CFAP69 in olfaction. tubulin. Custom antibodies. Rabbit antibodies were generated against the anti- Materials and Methods genic peptide fragment CKVKPPLNDPKKSIPT, which spans aa 927–942 Animals. For all experiments involving mice, animals were handled and (the very C terminus) of the CFAP69 protein, by Thermo Fisher Scien- euthanized in accordance with methods approved by the Animal Care tific. Thermo Fisher Scientific performed the peptide synthesis, antibody and Use Committees of each applicable institution. All analyses involving generation, and affinity purification. mice were performed on adult (2- to 8-month-old) mice. Experiments Cilia preparation. A preparation enriched in olfactory cilia was pre- were performed on both male and female mice. pared by the calcium shock method (Anholt et al., 1986). Briefly, deeply Evolutionary analysis. The evolutionary history of the CFAP69 protein anesthetized mice were transcardially perfused with PBS to remove blood was inferred using the UPGMA method (Sneath and Sokal, 1973). The from the olfactory tissue. Olfactory mucosa were dissected into a solution evolutionary distances were computed using the Poisson correction containing the following (in mM): 120 NaCl, 5 KCl, 1.2 MgCl2, and 10 method (Zuckerkandl and Pauling, 1965) and are in the units of the HEPES, pH 8.0, plus 10 mM CaCl2, and were treated by end-over-end number of amino acid substitutions per site. The analysis involved 10 aa rotation for 20 min at 4°C. The sample was centrifuged at low speed to sequences. All positions containing gaps and missing data were elimi- pellet large cellular debris and the cilia in the supernatant were then nated. There were a total of 683 positions in the final dataset. Evolution- transferred to a new tube. The cilia were pelleted under high-speed cen- ary analyses were conducted in MEGA6 (Tamura et al., 2013). trifugation (18,000 RCF) for 30 min and resuspended in a TEM buffer Generation of conditional Cfap69 mutant mice.TheA330021E22 (10 mM Tris-HCl, 3 mM MgCl2, and 2 mM EDTA, pH 8.0). Rik tm1a(KOMP)Wtsi (abbreviated to Cfap69 tm1a in this study) mouse strain Western blotting. Olfactory epithelium (OE) tissues were homogenized was created from an embryonic stem cell clone (EPD0713_1_E05) gen- and cilia preparations were dissolved in 2ϫ Laemmli buffer followed by erated by the Wellcome Trust Sanger Institute and made into mice by the SDS-PAGE. After electrophoresis, the separated proteins were trans- KOMP Repository (www.KOMP.org) and the Mouse Biology Program ferred onto a polyvinylidene difluoride membrane. The blot was blocked (www.mousebiology.org) at the University of California–Davis. The with 5% nonfat dry milk or 2% BSA and incubated overnight with pri- Cfap69 tm1a mice used in the present study were recovered from the cryo- mary antibodies at 4°C. After washing, the blot was incubated with HRP- preserved embryos from KOMP by the Johns Hopkins University trans- linked secondary antibodies for 1 h at room temperature. After washing, genic core facility. Cfap69 tm1a mice carry a KO first allele in which a the blot was treated with ECL-Plus reagent (Pierce) and exposed to film. promoterless cassette including LacZ and neo genes were inserted in Primary antibodies were used at the following dilutions: anti-CFAP69 introns 4–5 of the Cfap69 gene. For the OSN-specific conditional KO (rabbit, custom antibody, 1:1000); anti-␣-tubulin (mouse, Sigma- mice, the Cfap69 tm1a mice were crossed with the ubiquitously expressing Aldrich T8203, RRID: AB_1841230), 1:10,000; anti-olfactory marker Flippase line 129S4/SvJaeSor-Gt(ROSA)26Sor tm1(FLP1)Dym/J (The Jackson protein (OMP) (goat, Wako 544–10001, RRID: AB_664696, 1:10,000; Laboratory) to excise the LacZ/neo cassette. These mice were then Buiakova et al., 1996); and anti-AC3 (rabbit, Santa Cruz Biotechnology, crossed with an OSN-specific Cre line B6;129P2-Omp tm4(cre)Mom/ SC-588, RRID: AB_630839, 1:1000; Zou et al., 2007). The following sec- MomJ (Omp Cre) (The Jackson Laboratory) and then backcrossed for two ondary antibodies were used at 1:2000 dilutions: anti-rabbit-HRP (goat, to three generations to C57BL/6 mice to obtain offspring of several ge- GE Healthcare, NA934) for anti-CFAP69 and anti-AC3; anti-goat-HRP notypes including the conditional CFAP69 mutant mice Cfap69 flox/flox; (rabbit, Thermo Fisher Scientific, 61–1620) for anti-OMP; anti-mouse- Omp Cre/ϩ and the control littermates Cfap69 ϩ/ϩ;Omp Cre/ϩ.Primers HRP (sheep, GE Healthcare, NA931) for anti-␣-tubulin. TCAAACAGCACAGGAGATTCA (AT112) and TGCAAATGAATTAG Dolichos biflorus agglutinin (DBA) staining. Mice were deeply anes- CAGTATCTTCA (AT115), which span the floxed exon 5 region, were used thetized by Avertin injection and decapitated. The head was bisected 1–2 Talaga et al. • CFAP69 Regulates Olfactory Response J. Neurosci., June 7, 2017 • 37(23):5699–5710 • 5701 mm off center and the septum dissected into 4% paraformaldehyde and ment and had ad libitum access to water. Mice were weighed for 3 d fixed for 10 min at room temperature. Septa were rinsed 3ϫ for 5 min in before the start of the experiment to establish a baseline weight, deprived 1ϫ PBS, blocked in 3% BSA in 1ϫ PBS for 1 h at room temperature, and of food for 24 h before the experiment, and subsequently restricted to incubated with rhodamine-conjugated DBA (5 mg/ml, 1:500 dilution in 0.12 g of rodent chow (Harlan Teklad) per gram body weight per day. blocking solution; Vector Laboratories) overnight at 4°C. Septa were Mice were weighed before the beginning of the experiment every day to then washed 3ϫ for 5 min in 1ϫ PBS. OE on both sides of the septum was make sure that they did not drop below 80% baseline body weight. The peeled off into PBS, placed on a slide, mounted in Fluoromount Aqueous testing chambers were clean cages of dimensions 30 ϫ 19 ϫ 13 (L ϫ W ϫ H, Mounting Medium, and imaged on an LSM 700 confocal microscope in cm) filled with ϳ 650 cm 3 of wood shavings as bedding. Two 40–60 with Zen software (Zeiss). Only cells from the ventral region of the sep- mg pieces of de-creamed Oreo cookies (Nabisco) were buried just below tum were examined. Cilia length was quantified in Fiji software (Schin- the surface of the bedding in the following manner. The cage area was delin et al., 2012) using the segmented line tool to trace cilia and the designated into halves length-wise. One cookie piece was buried in a “measure” function to determine length. The mice used in this assay were randomized location within the left half, the other within the right half. from the Cfap69 tm1b line, which was generated by crossing Cfap69 tm1a to Including two pellets in the experiment reduced the effective search area the early embryonically expressing Cre recombinase mouse line B6.FVB- by half and better controlled for variance in the depth that the pellet was Tg(EIIa-cre)C5379Lmgd/J (The Jackson Laboratory). Cfap69 tm1b line is buried. In a single trial, a mouse was placed in the center of the cage and thus a Cfap69 whole-body KO line. was given 200 s to locate either of the two pellets. Latency in finding the Cell proliferation assay. Mice were injected intraperitoneally with 125 first pellet was recorded when the mouse touched the pellet. After the ␮g of 5-ethynyl-2Ј deoxyuridine (EdU) (Thermo Fisher Scientific). Ten mouse located the first pellet, it was allowed to consume it. If a mouse hours after the injection, the tissue was fixed and cryoprotected as de- failed to find a pellet within the allotted 200 s, the cookie pellet was scribed above. OE tissue was cut into 20 ␮m sections. EdU-labeled cells exposed and presented to the mouse for subsequent consumption. After were detected using the Click-iT EdU Alexa Fluor 488 Imaging Kit the trial, each mouse was returned to its respective cage. Mice were tested (Thermo Fisher Scientific). Sections were mounted in Fluoromount- in a single trial per day for 10 consecutive days. On day 6, the pellet was containing DAPI stain and imaged. The mice were 2 months old and positioned on the surface of the bedding for a visible pellet control trial. were from 3 different litters. From day 7 on, mice were allotted 300 s to find the buried Oreo. On day EOG recordings. EOG recordings were conducted as described previ- 8, 1 g of powdered Oreo was infused evenly into the test bedding to ously (Cygnar et al., 2010). Amyl acetate and heptaldehyde were first produce background odor (low background). On day 9, 3 g of powdered diluted in DMSO to result in a series of stock solutions ranging from 5 ϫ Oreo was infused evenly into the test bedding (high background). On day Ϫ6 10 M to 5 M, respectively. Each stock solution was then diluted 50-fold 10, the bedding was once again free of background odor. The testing in water to generate a series of odorant solutions ranging from 1 ϫ 10 Ϫ7 order of the animals was randomized for each day and fresh bedding was to 0.1 M in concentrations. The 1 M amyl acetate solution was obtained by used every day for each mouse. a 5-fold dilution of the 5 M stock in water. Vapor phase odorant was Statistical analyses. Comparisons between two groups were deter- generated by putting 5 ml of an odorant solution of a given concentration mined by unpaired Student’s t test or Fisher’s exact test. Unless otherwise in a sealed 60 ml glass bottle and letting the odorant solutions equilibrate indicated, data are shown as mean Ϯ SEM. Statistical difference was in the bottles for at least 30 min. Delivery of odorant stimuli was con- considered when p Ͻ 0.05. trolled by a Picospritzer (Parker Hannifin). Note that the vapor concentration of odorants in each bottle is unknown, but will vary as a function Results of the concentration of odorants in the liquid phase. Even though the CFAP69 is a conserved protein enriched in OSN cilia exact odorant concentrations are unknown, the odorant stimuli at the We became interested in CFAP69, which was originally anno- surface of the OE for a given concentration will be consistent between tated as Q8BH53, after it was found in an OSN cilial proteomic tissue preparations, allowing for comparison between WT and mutant screen that was enriched for membrane proteins Ͼ 55 kDa mice. EOGs were recorded from a consistent position on turbinate IIB from the left half of the head. The data were collected and analyzed using (Stephan et al., 2009). In addition to detecting known OSN cilial AxoGraph Software (Molecular Devices) at a sampling rate of 1 kHz. All proteins such as AC3 and the CNG channel, the screen detected two recordings were filtered at 25 Hz before analysis. For measuring termi- proteins of unknown function, Q8BH53/CFAP69 and TMEM16B. nation time constants, the time windows used for the fit were as follows: TMEM16B, or Anoctamin 2 (ANO2), was shown to be a calcium- Ϫ6 Ϫ5 Ϫ4 2.4–4 s for 10 M, 2.4–4.5 s for 10 M, 2.4–10 s for 10 M, 2.4–15 s activated chloride channel (Pifferi et al., 2009; Stephan et al., 2009; Ϫ3 Ϫ2 for 10 M, and 2.4–20 s for 10 –1 M. Billig et al., 2011), but the function of CFAP69 remains unknown. OSN single-cell suction pipette recordings. Mice were euthanized using Many other screens have also detected either Cfap69 (A330021E22Rik) CO2 followed by cervical dislocation. Single-cell suction recordings transcript or CFAP69 protein in rat and mouse olfactory systems (Lowe and Gold, 1991; Reisert and Matthews, 1998) were performed as (Okazaki et al., 2002; Su et al., 2004; Sammeta et al., 2007; Mayer described previously (Ponissery Saidu et al., 2012). The cell body of an et al., 2009; Bennett et al., 2010; Rasche et al., 2010; Diez-Roux et isolated OSN was sucked into the tip of a recording pipette, leaving the cilia and the dendritic knob accessible for solution changes. The recorded al., 2011; Kanageswaran et al., 2015). signals were sampled at 10 kHz using a Cambridge Electronic Design In mice, the Cfap69 gene is found on chromosome 5. The acquisition board and Signal software. Recordings were filtered at DC-50 longest transcript is predicted to have 23 exons coding a protein Hz to monitor the receptor current and at DC-5000 Hz to also display the of 942 aa (Ensembl ENSMUSG00000040473). A cDNA contain- current for APs. All experiments were performed at 37°C. Rapid solution ing an open reading frame of 942 aa was amplified from the exchanges were achieved by transferring the tip of the recording pipette mouse nasal mucosa by RT-PCR. Based on bioinformatic analy- across the interface of neighboring streams of solution using the Perfu- sis (InterProScan 5, Superfamily 1.75), a large portion of CFAP69 sion Fast-Step SF-77B solution changer (Warner Instruments). Mamma- may form Armadillo-type ␣-helical repeats or ARM repeats (Fig. lian Ringer’s solution contained the following (in mM): 140 NaCl, 5 KCl, 1A; Gough et al., 2001; Jones et al., 2014). Although CFAP69 was 1 MgCl , 2 CaCl , 0.01 EDTA, 10 HEPES, and 10 glucose. The pH was 2 2 originally annotated as a hypothetical transmembrane protein in adjusted to 7.5 with NaOH. Odorant solutions were made daily from a the OSN cilial proteomic screen (Stephan et al., 2009), our hy- stock containing 1 mM each of cineole and acetophenone. All chemicals were purchased from Sigma-Aldrich. dropathy analysis (Mobyle@RPBS) failed to find any predicted Buried food pellet test. The buried food pellet test was performed using transmembrane domains. Further bioinformatic analysis sug- adult Cfap69 ϩ/ϩ;Omp Cre/ϩ (n ϭ 22–23) and Cfap69 flox/flox;Omp Cre/ϩ gests that CFAP69 is evolutionally conserved among eukaryotes (n ϭ 22–25) mice at Zeitgeber time 8–1. All animals were housed indi- and can be found in humans, rodents, reptiles, amphibians, and vidually with wood shavings as bedding for the duration of the experi- some ciliated unicellular eukaryotes (Fig. 1B). 5702 • J. Neurosci., June 7, 2017 • 37(23):5699–5710 Talaga et al. • CFAP69 Regulates Olfactory Response

Figure 1. CFAP69 is an evolutionarily conserved protein enriched in OSN cilia. A, Schematic of the CFAP69 protein. CFAP69 consists of 942 aa and is predicted to have ARM repeat domains. B, Evolutionary relationships of taxa based on protein sequences. The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances. The evolutionary distances are in the units of the number of amino acid substitutions per site. The sum of branch length in the tree is 4.53259594. C, X-gal staining of OE sections from control and Cfap69 tm1a mice. LacZ is expressed in the OE in Cfap69 tm1a mice (right), but not in controls lacking the tm1a allele (left). Scale bar, 20 ␮m. D, Western blot analysis of OE and olfactory cilia preparations for CFAP69. Lanes were loaded with the same amount of total proteins. E, Immunofluorescent staining showing that CFAP69 is expressed in the cilial layer of the OE and colocalizes with acetylated tubulin, a marker of the cilia. Scale bar, 20 ␮m.

Using the Cfap69 tm1a reporter mouse line (see Materials and colocalizes with a cilial marker, acetylated tubulin (Fig. 1E). Little Methods), we detected broad expression of the reporter gene CFAP69 expression was observed in the remainder of the tissue. LacZ in the OSN layer of the OE consistent with the only other report of Cfap69 expression (Fig. 1C; McClintock et al., 2008). Using antibodies against CFAP69, we detected a band of ϳ 115 Knocking out Cfap69 in OSNs cause no overt structural and kDa by Western blot analysis of OE and OE cilia preparations, molecular alterations in the OE which is in agreement with the calculated molecular weight of To study CFAP69 function in OSNs, we generated conditional flox/flox Cre/ϩ CFAP69 (106 kDa; Fig. 1D). In cilia preparation samples, a Cfap69 KO mice (Cfap69 ;Omp mice, hereafter re- weaker band just below the 115 kDa band also appeared. This ferred to as conditional Cfap69 mutants, or Cfap69 mutants) in lower band perhaps corresponded to a smaller splice variant that which the Cfap69 gene is specifically knocked out in mature we detected in the OE using 5Ј rapid amplification of cDNA ends OSNs. We crossed the Cfap69 tm1a line first to a ubiquitous- analysis. The shorter variant had an alternative transcription start flippase mouse line to excise the LacZ/neo reporter cassette and site, but is in the same frame as the predominant 942 aa coding generate the floxed allele of Cfap69. The Cfap69 flox/flox mice were form and codes for a protein that is 897 aa. Immunostaining then crossed to mice carrying Cre-recombinase in the OMP lo- showed that CFAP69 is expressed in the cilial layer of the OE and cus. Conditional Cfap69 mutants showed no CFAP69 protein Talaga et al. • CFAP69 Regulates Olfactory Response J. Neurosci., June 7, 2017 • 37(23):5699–5710 • 5703

Figure2. ConditionalCfap69mutantmicehavegrosslynormalOE.A,ImmunofluorescentstainingofOEsectionsfromcontrolandconditionalCfap69mutant(Cfap69cKO)mice.CFAP69staining is absent in the conditional Cfap69 mutant mice. Staining of acetylated tubulin (AceT), G␥13, AC3, ANO2, as well as phalloidin (Phol), which labels the apical microvilli of sustentacular cells, are comparablebetweenthecontrolandconditionalCfap69mutantmice.SectionsarecounterstainedwithDAPI.Scalebar,20␮m.B,WesternblotanalysisoftotalOEproteins.Right,Expressionlevel relative to tubulin. Control, n ϭ 4; Cfap69 cKO, n ϭ 4 mice. Error bars indicate SEM. C, Left, Whole-mount preparation of septal OE with cilia of a subset of ventral region OSNs labeled by rhodamine-conjugated Dolichos biflorus agglutinin. Scale bar, 10 ␮m. Right, Quantification of the number of cilia per OSN (error bars indicate SEM) and their lengths. Box, Interquartile range; whiskers, minimum and maximum values. WT and Cfap69 whole-body KO, n ϭ 4 mice with the cilia of 10 OSNs per animal examined. D, EdU labeling of proliferating cells in OE. Left, Proliferating cellsaremostlyfoundnearthebottomoftheOEinbothgenotypes.SectionsarecounterstainedwithDAPI.Scalebar,20␮m.Right,Quantification.Control,nϭ 5;Cfap69cKOnϭ 4mice.Errorbars indicate SEM. expression in the OE, as assayed by immunostaining and Western whole-body KO mice, the number of cilia per OSN and the length blotting (Fig. 2A,B). of the cilia were not different from WT mice by DBA staining, Cfap69 mutants have no obvious abnormality in feeding and which stains cilia of a subset of OSNs (Lipscomb et al., 2002; mating behaviors under the laboratory housing conditions. Mu- Challis et al., 2015; Fig. 2C). We also investigated cell prolifera- tants showed morphologically indistinguishable OE tissue com- tion in Cfap69 mutants and found no difference in the incorpo- pared with controls (Cfap69 ϩ/ϩ;Omp Cre/ϩ littermates, hereafter ration of the nucleotide analog EdU compared with the controls referred to as the control mice). Immunostaining against the cil- (Fig. 2D). Overall, we observed no overt structural or molecular ial marker acetylated tubulin and the actin marker phalloidin, alterations in the OE of conditional Cfap69 mutants. which stains microvilli of the supporting cells, appeared normal in the OE tissue (Fig. 2A). Typical expression and localization of Cfap69 mutant OSNs display faster response kinetics olfactory transduction components, including G␥13 (Li et al., To investigate olfactory response in conditional Cfap69 mutants, 2013), AC3, and ANO2, was also observed (Fig. 2A). Western blot we recorded EOG, the summed extracellular receptor potential analysis showed no changes in the protein levels of AC3 and from many OSNs measured at the OE surface (Scott and Scott- OMP, a mature OSN marker, in the OE tissue (Fig. 2B). In the Johnson, 2002). Typically, a 100 ms odorant pulse elicits a dose- 5704 • J. Neurosci., June 7, 2017 • 37(23):5699–5710 Talaga et al. • CFAP69 Regulates Olfactory Response

Figure 3. CFAP69 mutant mice exhibit similar response size within a range of odorant concentrations: EOG analysis. A, B, EOG responses (A) and dose–response relationship (B) of peak EOG amplitudesevokedby100mspulsesofamylacetate.EachtraceinArepresentstheaveragedEOGresponseacrossmiceatthegivenconcentration.Control,nϭ 8–12;Cfap69cKO,nϭ 10–14mice. Error bars indicate SEM. *p Ͻ 0.05, Student’s t test. C, D, EOG responses (C) and dose–response relationship (D) of peak EOG amplitudes evoked by 100 ms pulses of heptaldehyde. Each trace in C represents the averaged EOG response across mice at the given concentration. Control, n ϭ 7–10; Cfap69 cKO, n ϭ 6–11 mice. Error bars indicate SEM, Student’s t test. Note that the odorant concentrations indicated on the x-axis are the concentrations of the liquid solution from which the vapors of the odorant are generated. dependent response that peaks within 200–400 ms and decays resulted in more transient EOG responses in Cfap69 mutants thereafter in a few seconds. We found that conditional Cfap69 than in controls, as measured by the duration between the two mutants displayed EOG amplitudes similar to the controls across time points when the EOG amplitudes are half of the peak a broad range of odorant concentrations from low to high when (Fig. 4E,J). pulsed with two commonly used odorants, amyl acetate (Fig. We next investigated how odor response might be altered at 3A,B) and heptaldehyde (Fig. 3C,D). When stimulated with amyl the single-cell level using suction pipette recordings. In this ex- acetate, however, the Cfap69 mutants did not reach the same periment, suction current responses of individual OSNs to odor- maximal EOG amplitude at the highest odorant concentrations ant pulses were recorded from OSN cell bodies and an odorant compared with the controls (Fig. 3A,B) and the response seem- pulse was applied at the exposed cilia and dendritic knob (Ponis- ingly saturates at lower concentrations. When stimulated with sery Saidu et al., 2012). Typically, a responsive OSN generates a heptaldehyde, the mutants showed similar responses throughout quickly increasing current after a short delay; the current declines the experimental concentration range. The response amplitudes to a lower level after reaching its peak and returns back to baseline were reduced at the highest heptaldehyde concentrations, but the after odorant exposure ceases. The suction pipette recording reductions were not statistically significant (Fig. 3C,D). technique also allows for monitoring the generation of APs. The most noticeable difference in the EOG between the con- OSNs were exposed for 1 s (-sec) to the odorant mixture (100 ␮M trol and the Cfap69 mutant was in the response kinetics. Cfap69 each of cineole and acetophenone; Fig. 5A). OSNs lacking mutants displayed faster kinetics both in activation and termina- CFAP69 generated receptor currents with response magnitude tion of the response when pulsed with 100 ms amyl acetate or (Imax) comparable to that of the control OSNs (Fig. 5B). The heptaldehyde (Fig. 4). Cfap69 mutants displayed a significantly Cfap69 mutant OSNs and the control OSNs showed no signifi- faster rise time, measured as the time from 1% to 99% of the peak, cant difference in parameters including time-to-peak (Fig. 5C), across all odorant concentrations for the two odorants tested the time between stimulation onset and the peak current; the (Fig. 4B,G). The activation latency, defined as the time from the response delay (Fig. 5D), measured as the time between stimula- start of odorant stimulation to 1% of the peak, was comparable tion onset and the generation of the first AP; and the rise time between control mice and Cfap69 mutants at most of the ex- (Fig. 5E), measured as the time-to-peak minus the response de- perimental concentrations (Fig. 4C,H), whereas, at one low lay. The mutant OSNs, however, showed a larger rise rate of the Ϫ6 Ϫ5 concentration of each odorant (10 M amyl acetate or 10 M receptor current, which is measured as the rise time divided by heptaldehyde), Cfap69 mutants displayed decreased latency Imax (Fig. 5F). During the 1 s stimulation, the receptor current of compared with the controls. Cfap69 mutants also displayed faster mutant OSNs declined more than that of control OSNs, as man- termination of the response. The response termination rate was ifested by a smaller ratio of current at the end of 1 s stimulation measured by the time constant (␶), which was obtained by fitting (I1s)/Imax in the mutant OSNs (Fig. 5G,H). The response termi- the EOG termination phase with a single exponential decay. nation rate was measured by T20, which is the time required for Cfap69 mutants had significantly deceased time constant across the current at 1 s to fall to 20% of its value. The T20 of the mutant all odorant concentrations for the two odorants tested (Fig. OSN was significantly smaller than that of the control OSN (Fig. 4D,I). The faster kinetics both in activation and termination 5I). Here, the single-cell data show changes in response kinetics Talaga et al. • CFAP69 Regulates Olfactory Response J. Neurosci., June 7, 2017 • 37(23):5699–5710 • 5705

Ϫ4 Figure4. CFAP69slowsdownOSNresponsekinetics:EOGanalysis.A–E,Responsesto100mspulsesofamylacetate.A,Amplitude-normalizedEOGresponsesto10 M amylacetate.Eachtrace represents the averaged EOG response across mice. Control, n ϭ 11, Cfap69 cKO, n ϭ 10 mice. B, EOG rise time, the time from 1% to 99% of the peak amplitude. C, EOG activation latency, the time from stimulation onset to 1% of the peak amplitude. D, EOG termination rate. The time constant (␶) is determined by fitting a single exponential function to the termination phase of the EOG trace. E, Width (timespan) of the EOG response at 50% of the peak amplitude. In B–E, Control, n ϭ 8–12; Cfap69 cKO, n ϭ 10–14 mice. *p Ͻ 0.05; **p Ͻ 0.01. Error bars indicate SEM. Student’s t test. Ϫ4 F–J,Responsesto100mspulsesofheptaldehyde.F,Amplitude-normalizedEOGresponsesto10 M heptaldehyde.EachtracerepresentstheaveragedEOGresponseacrossmice.Control,nϭ 10; Cfap69cKO,nϭ 10mice.G,EOGrisetime.H,EOGactivationlatency.I,EOGterminationrate.J,Width(timespan)oftheEOGresponseat50%ofthepeakamplitude.G–J,Control,nϭ 7–10;Cfap69 cKO,nϭ 6–11mice.*pϽ 0.05;**pϽ 0.01.ErrorbarsindicateSEM,Student’sttest.Notethattheodorantconcentrationsindicatedonthex-axisaretheconcentrationsoftheliquidsolutionfrom which the vapors of the odorant are generated. in Cfap69 mutant OSNs, including faster rise rate, more transient odorants induced receptor currents that were 45% of the maxi- response, and faster termination, consistent with the EOG re- mum in control OSNs; the response increased with increasing sults. Together, these data suggest that CFAP69 functions to slow stimulus duration until the stimulus duration was ϳ 0.2 s. Fur- down both the activation and the shutoff of the odor response in ther prolonging the stimulation did not further increase the re- OSNs. sponse amplitude (Fig. 6A,B). In contrast, even at the shortest (30 ms) stimulus duration, OSNs lacking CFAP69 already reached Cfap69 mutant OSNs integrate the stimulus faster ϳ 82% of their maximal response (Fig. 6B). Therefore, OSNs OSNs integrate the odor stimulus over time (Firestein et al., 1990; lacking CFAP69 integrate the stimulus faster. Firestein et al., 1993; Bhandawat et al., 2005) such that longer exposures yield larger responses. In single-cell experiments, we Cfap69 mutant OSNs fire APs more faithfully to delivered odorant pulses (100 ␮M each of cineole and acetophe- repeated stimuli none) of increasing duration to determine whether response in- APs are typically only generated during the activation phase of the tegration was altered in OSNs lacking CFAP69. A 30 ms pulse to receptor current (Reisert and Matthews, 2001; Ghatpande and 5706 • J. Neurosci., June 7, 2017 • 37(23):5699–5710 Talaga et al. • CFAP69 Regulates Olfactory Response

Figure 5. CFAP69 slows down OSN response kinetics: single-cell analysis. A, Representative suction current traces of control and Cfap69 cKO OSNs toa1spulse of 100 ␮M each of cineole and B C D acetophenone. , Imax, the peak amplitude of the suction current. , Time-to-peak, the time from stimulation onset to the peak amplitude of the current. , Response delay, the time between E F G stimulation onset and the first AP. , Rise time, measured as the time-to-peak minus the response delay. , Rise rate, measured as Imax divided by the rise time. , I1s, the current at the end of 1 s H I B I stimulation. , I1s/Imax. ,T20, the time for the response to fall to 20% of I1s. In – , OSN numbers are shown in the parentheses. Error bars indicate SEM, Student’s t test.

Figure6. CFAP69slowsdownOSNresponseintegration.A,RepresentativetracesfromcontrolandCfap69cKOOSNswhenexposedtovaryinglengthsofodorantstimulation.B,Normalizedpeak ϭ ϭ current (Imax). Control, n 13; Cfap69 cKO, n 16 OSNs. Error bars indicate SEM, Student’s t test.

Reisert, 2011). Because Cfap69 mutant OSNs exhibited faster re- OSNs generated APs 100% of the time to the first pulse. We then sponse kinetics, we investigated how such faster kinetics might examined the chance that an OSN generated an AP in response to affect the encoding of APs. We delivered21sodorant pulses (100 the second pulse. When the interpulse interval is short, OSNs ␮M each of cineole and acetophenone) with varied interpulse, or often fail to generate APs to the second pulse if the response to the recovery, interval to individual OSNs. The interpulse interval first has not yet terminated. Under such conditions, OSNs are still varied from 0.25 to 10 s. Both the control and Cfap69 mutant sufficiently depolarized to maintain voltage-gated Na ϩ channel Talaga et al. • CFAP69 Regulates Olfactory Response J. Neurosci., June 7, 2017 • 37(23):5699–5710 • 5707

amount of time (Fig. 8B). On day 8 (“low background odor”), a small amount of powdered food was added to the bedding in the test cage. Control mice took a slightly but not significantly longer time to locate the pellet compared with the previous day. How- ever, conditional Cfap69 mutants took significantly longer to locate the buried food pellet than the control animals did. On day 9 (“high background odor”), a larger amount of powdered food was infused into the bedding. Again, control mice performed this task comparably to day 8. Cfap69 conditional mutants took even more time to locate the buried food pellet (Fig. 8B). On day 10, when there was again no background odor, Cfap69 conditional mutants then took longer, but not significantly longer, to locate the pellet (Fig. 8B). These behavioral assays suggest that CFAP69 is required for challenging olfactory tasks. Discussion In this study, we identify a novel protein, CFAP69, in mice that is enriched in olfactory cilia and plays a critical role in regulating the response of OSNs, especially the response kinetics. OSNs lacking CFAP69 displayed faster kinetics in both onset and offset of elec- Figure7. Cfap69mutantOSNsfireAPstorepeatedstimulimorefaithfullythancontrolOSNs. trophysiological responses and were able to fire APs more faith- Individual OSNs were stimulated with two pulses of an odorant mixture with varied interpulse fully to repeated stimuli. In mammalian OSNs, aside from the interval. The chance of an AP is generated to the second pulse is plotted against the interpulse core transduction components, several proteins, including OMP interval time. Control, n ϭ 14–15; Cfap69 cKO, n ϭ 35–43 OSNs. Error bars indicate Ϯ 95% (Buiakova et al., 1996; Ivic et al., 2000; Reisert et al., 2007; Lee et confidence intervals, Fisher’s exact test. al., 2011), Ric-8b (Von Dannecker et al., 2005; Kerr et al., 2008), RGS2 (Sinnarajah et al., 2001), MUPP1 (Dooley et al., 2009; inactivation (Trotier and MacLeod, 1983; Trotier, 1994; Reisert Baumgart et al., 2014), and Goofy (Kaneko-Goto et al., 2013), and Matthews, 1999, 2001) and prevent AP generation by the have been shown previously to regulate olfactory signaling. All of second pulse. We found that the chance of a Cfap69 mutant OSN these proteins, except RGS2, perform functions enhancing the being able to generate APs to the second pulse was significantly transduction process. Although blockage of RGS2 leads to in- greater than control OSNs at short interpulse intervals (Fig. 7). creased electrophysiological response (Sinnarajah et al., 2001), After a 0.5 s interpulse period, Cfap69 mutant OSNs generated an no protein has been shown previously to slow down OSN re- AP at 89% of the time, whereas controls OSNs only generated an sponse kinetics. CFAP69 thus represents a new and unconven- AP at 60% of the time (Fig. 7). Therefore, Cfap69 mutant OSNs tional regulator of the olfactory transduction process. fire APs to repeated stimuli more faithfully than control OSNs. In sensory biology, it is seemingly reasonable that sensory The control and Cfap69 OSNs only reliably generated an AP when receptor cells evolve to respond to sensory cues as fast as possible. the interpulse interval was Ն2 s. These data suggest that CFAP69, This thought is consistent with mutational analyses in various by slowing down the transduction kinetics, reduces temporal res- sensory systems, where mutations of sensory receptor cells often olution and reliability of AP generation of OSNs in coding odor resulted in reduced sensitivity and slowed response kinetics. stimuli. From a systems perspective, it is also conceivable that a sensor should function as quickly as it can to report the information of Cfap69 mutant mice show attenuated performance in an stimuli, both on and off, to the next processing stage and a fast olfactory behavioral task response kinetics is essential for such purpose. Contrary to this Given that Cfap69 mutant OSNs exhibited alterations in the way thought, we have found that there is a native “damper” present to that they relay odor information, we examined how such altera- slow down a sensory transduction process and, by doing so, it re- tions may influence odor perception in a behavioral assay. We duces the peripheral temporal resolution in coding sensory stimuli. chose the buried food pellet test, in which food-restricted mice An insightful finding of this study is that, even though Cfap69 need to use their olfactory sense to locate a buried food pellet mutant mice should have better temporal resolution of coding under bedding (Stephan et al., 2011; Pietra et al., 2016). Over the olfactory stimuli at the peripheral sensory receptor level, they course of the first phase of the experiment, both the control mice performed inferiorly in an olfactory behavioral task under certain and Cfap69 conditional mutants were able to locate the buried conditions. Under the conditions used in the buried food pellet food pellet with increasing rapidity, measured as the time to reach test, the loss of CFAP69 in OSNs led to poorer performance of the the pellet, over5d(Fig. 8A). Cfap69 mutants took slightly but not animal when a background of the same odor to the food pellet significantly longer time to locate the pellet. To control for any was present, although the loss of CFAP69 is tolerable when such motivational, cognitive, or motor defects, the pellet was posi- background odor was not applied. These behavioral assays sug- tioned on the surface of the bedding on day 6 (visible pellet). Both gest that CFAP69 may be more needed for food-finding behav- the control and Cfap69 mutant mice were able to locate the pellet iors as occur in natural settings, where many salient background equally rapidly (Fig. 8A). odors are present. Therefore, faster transduction kinetics and In the second phase of the experiment, we infused powdered better temporal resolution in coding olfactory stimuli at the pe- food into the bedding to create a background of the same odor. ripheral sensory receptor cell level is not always beneficial to the On day 7, the mice performed the same task as in days 1–5 and evolutionary fitness of the animal. there was no background food odor. On this day, both the control How could faster transduction kinetics lead to a reduced abil- and Cfap69 mutant mice were able to locate the pellet in a similar ity of mice to find an odor source in the presence of a background 5708 • J. Neurosci., June 7, 2017 • 37(23):5699–5710 Talaga et al. • CFAP69 Regulates Olfactory Response

Figure 8. Conditional Cfap69 mutant mice show attenuated performance in an odor-localization behavioral task. A, Time to reach the first food pellet in the buried food pellet test. The time to locate the food pellet is plotted against the trial day for each individual mouse. On day 6 (visible pellet), the pellet was left on the surface of the bedding to be visible to the mouse. Controls, n ϭ 22–23; Cfap69 cKO, n ϭ 22–25 mice, Student’s t test. B, Time to reach the first pellet when a background odor that is the same as the food pellet is present. Controls, n ϭ 14–15; Cfap69 cKO, n ϭ 14 mice, Student’s t test. of the same odor? The faster transduction kinetics caused by the acetate and heptaldehyde as stimulating odorants for EOG re- lack of CFAP69 apparently affects the AP coding property of cordings in several previous studies (Song et al., 2008; Cygnar and OSNs. The fact that Cfap69 mutant OSNs can fire APs more Zhao, 2009; Stephan et al., 2011; Cygnar et al., 2012; Ferguson faithfully to a recurring stimulus (Fig. 7) despite the adaptation and Zhao, 2017) and did not observe any odorant-dependent effect (Fig. 5H) caused by the 1 s sustained exposure is consistent effect between these two odorants. In previous studies, mutations with the idea that the adaptive filter (Ghatpande and Reisert, in OSNs often caused reduced response size and/or slower re- 2011) of Cfap69 OSNs in coding odor stimuli is impaired. A more sponse kinetics, unlike the Cfap69 mutant. Several things could faithful ability in generating APs in response to repeated stimuli underlie the observed reduction in the EOG amplitude at high indicates that mutant OSNs extend their ability in coding odor odorant concentrations and the odorant-dependent effect be- stimuli to higher stimulation frequencies. This extended band- tween amyl acetate and heptaldehyde. First, the reduction in the width, likely due to impairment of the adaptive filter, would re- EOG amplitude at high odorant concentrations could reflect a sult in extended and increased signal input to the olfactory bulb. direct effect of the lack of CFAP69 on the olfactory transduction This also potentially increases the noise input to the olfactory process. Second, it could be due to the integrative nature of the bulb. When a background of the same odor is present, the central EOG signal. The EOG signal results from the summation of the olfactory circuit of Cfap69 mutant mice for detecting this odor potential changes of individual responding OSNs in the record- could be overwhelmed by a barrage of signal inputs plus associ- ing field. The integration of more transient individual signals of ated noise from OSNs due to the extended bandwidth, explaining the same size could lead to, not only more transient, but also the observed behavioral deficit. Such alteration in the coding smaller ensembles than the integration of less transient signals, property of OSNs seems to be tolerable in “simple” situations especially when the difference in the width of individual signals such as in the absence of the background odor, when the amount become more pronounced. Third, intrinsic odorant receptor prop- of input from OSNs is limited. In addition, when responding to erties could account for the odorant-dependent effect because an odorant stimulus, OSNs likely code the “molecular flux” in- amyl acetate and heptaldehyde should be recognized by different stead of simply the odorant concentration at the level of trans- sets of odorant receptors. Future studies, especially at the single- duction (Firestein and Shepherd, 1991). The faster stimulus cell level, are needed to delineate the detailed effect of CFAP69 on integration of mutant OSNs (Fig. 6) means that mutant OSNs OSN physiology. have a shorter time to estimate an odorant concentration. When An outstanding question remaining to be answered is what is a background of the same odor as that of the food pellet was the mechanism by which CFAP69 regulates olfactory response. present in the buried food pellet test, the mice needed to detect an Bioinformatic analysis suggests that CFAP69 is an ARM-repeat odor against a background of lower concentration. It is also pos- protein. Proteins containing ARM repeats, including Importin-␣ sible that the behavioral deficit of mutant mice stems from the and ␤-catenin, partake in a wide variety of cellular activities altered integration property of OSNs, which affords shorter time and often perform their functions through mediating protein– periods for mutant mice at the behavioral level to detect concen- protein interactions (Groves and Barford, 1999; Hatzfeld, 1999; tration differences. Regardless, CFAP69 allows the olfactory Andrade et al., 2001). CFAP69 could bind directly or influence transduction machinery to work at a properly regulated range of indirectly through intermediate(s), one or more of the core response kinetics for robust olfactory behavior. transduction components in the olfactory transduction cascade. We found that Cfap69 mutant OSNs displayed similar re- Therefore, a major effort in future studies should be to identify sponse size to the control OSNs in most of our electrophysiolog- the interaction partner(s) of CFAP69 to understand how CFAP69 ical recordings. In the single-cell analysis, Cfap69 mutant OSNs performs its function. and the control OSNs showed similar response sizes to the mix of CFAP69 is an evolutionarily conserved protein. We found cineole and acetophenone at the concentration used. In the EOG homologous Cfap69 genes by sequence search in species ranging analysis, we did observe that Cfap69 mutant mice showed re- from unicellular eukaryotes to humans, including all mammalian duced EOG amplitudes at the highest odorant concentrations, species searched for and many animals across all major classes of especially when responding to amyl acetate. We have used amyl vertebrates. However, we were unable to find the homologous Talaga et al. • CFAP69 Regulates Olfactory Response J. Neurosci., June 7, 2017 • 37(23):5699–5710 • 5709 gene in several vertebrate and invertebrate species, including gion of mouse vomeronasal sensory neurons. J Gen Physiol 140:3–15. some common model animals such as zebrafish, Drosophila CrossRef Medline melanogaster, and Caenorhabditis elegans. Because the olfactory Diez-Roux G, et al. (2011) A high-resolution anatomical atlas of the transcriptome in the mouse embryo. PLoS Biol 9:e1000582. CrossRef Medline transduction process of primary OSNs is conserved throughout Dooley R, Baumgart S, Rasche S, Hatt H, Neuhaus EM (2009) Olfactory the vertebrates, it will be interesting to find how the olfactory receptor signaling is regulated by the post-synaptic density 95, Drosophila system in those vertebrate animals lacking Cfap69 accommodates discs large, zona-occludens 1 (PDZ) scaffold multi-PDZ domain protein the lack of a CFAP69-dependent regulatory mechanism. 1. FEBS J 276:7279–7290. CrossRef Medline In addition to the main OE, Cfap69 is also expressed in Ferguson CH, Zhao H (2016) Cyclic AMP signaling in the main olfactory several other tissues and cells, including the testis and the epithelium. In: Chemosensory transduction: the detection of odors, choroid plexus of the brain (https://www.mousephenotype.org/ tastes, and other chemostimuli (Zufall F, Munger SD, eds), pp 123–140. data/imageComparator?¶meter_stable_idϭ IMPC_ALZ_ San Diego: Academic. Ferguson CH, Zhao H (2017) Simultaneous loss of NCKX4 and CNG chan- 076_001&accϭ MGI:2443778). This study represents the first nel desensitization impairs olfactory sensitivity. J Neurosci 37:110–119. investigation of the function of this novel protein and should CrossRef Medline provide a reference for continuing studies of CFAP69 function Firestein S (2001) How the olfactory system makes sense of scents. Nature outside of the olfactory system. 413:211–218. CrossRef Medline Firestein S, Shepherd GM (1991) A kinetic model of the odor response in References single olfactory receptor neurons. J Steroid Biochem Mol Biol 39:615– Andrade MA, Perez-Iratxeta C, Ponting CP (2001) Protein repeats: struc- 620. CrossRef Medline tures, functions, and evolution. J Struct Biol 134:117–131. CrossRef Firestein S, Shepherd GM, Werblin FS (1990) Time course of the membrane Medline current underlying sensory transduction in salamander olfactory receptor Anholt RR, Aebi U, Snyder SH (1986) A partially purified preparation of neurones. J Physiol 430:135–158. CrossRef Medline isolated chemosensory cilia from the olfactory epithelium of the bullfrog, Firestein S, Picco C, Menini A (1993) The relation between stimulus and Rana catesbeiana. J Neurosci 6:1962–1969. Medline response in olfactory receptor cells of the tiger salamander. J Physiol Bakalyar HA, Reed RR (1990) Identification of a specialized adenylyl cyclase 468:1–10. CrossRef Medline that may mediate odorant detection. Science 250:1403–1406. CrossRef Ghatpande AS, Reisert J (2011) Olfactory receptor neuron responses coding Medline for rapid odour sampling. J Physiol 589:2261–2273. CrossRef Medline Baumgart S, Jansen F, Bintig W, Kalbe B, Herrmann C, Klumpers F, Ko¨ster Gough J, Karplus K, Hughey R, Chothia C (2001) Assignment of homology SD, Scholz P, Rasche S, Dooley R, Metzler-Nolte N, Spehr M, Hatt H, to genome sequences using a library of hidden Markov models that rep- Neuhaus EM (2014) The scaffold protein MUPP1 regulates odorant- resent all proteins of known structure. J Mol Biol 313:903–919. CrossRef mediated signaling in olfactory sensory neurons. J Cell Sci 127:2518– Medline 2527. CrossRef Medline Groves MR, Barford D (1999) Topological characteristics of helical repeat Belluscio L, Gold GH, Nemes A, Axel R (1998) Mice deficient in G(olf) are proteins. Current opinion in structural biology 9:383–389. CrossRef anosmic. Neuron 20:69–81. CrossRef Medline Medline Bennett MK, Kulaga HM, Reed RR (2010) Odor-evoked gene regulation Hatzfeld M (1999) The armadillo family of structural proteins. Int Rev and visualization in olfactory receptor neurons. Mol Cell Neurosci 43: Cytol 186:179–224. Medline 353–362. CrossRef Medline Ivic L, Pyrski MM, Margolis JW, Richards LJ, Firestein S, Margolis FL (2000) Bhandawat V, Reisert J, Yau KW (2005) Elementary response of olfactory Adenoviral vector-mediated rescue of the OMP-null phenotype in vivo. receptor neurons to odorants. Science 308:1931–1934. CrossRef Medline Nat Neurosci 3:1113–1120. CrossRef Medline Billig GM, Pa´l B, Fidzinski P, Jentsch TJ (2011) Ca2ϩ-activated ClϪ cur- Jones DT, Reed RR (1989) Golf: an olfactory neuron specific-G protein in- rents are dispensable for olfaction. Nat Neurosci 14:763–769. CrossRef volved in odorant signal transduction. Science 244:790–795. CrossRef Medline Medline Brunet LJ, Gold GH, Ngai J (1996) General anosmia caused by a targeted Jones P, Binns D, Chang HY, Fraser M, Li W, McAnulla C, McWilliam H, disruption of the mouse olfactory cyclic nucleotide-gated cation channel. Maslen J, Mitchell A, Nuka G, Pesseat S, Quinn AF, Sangrador-Vegas A, Neuron 17:681–693. CrossRef Medline Scheremetjew M, Yong SY, Lopez R, Hunter S (2014) InterProScan 5: Buck L, Axel R (1991) A novel multigene family may encode odorant recep- genome-scale protein function classification. Bioinformatics 30:1236– tors: a molecular basis for odor recognition. Cell 65:175–187. CrossRef 1240. CrossRef Medline Medline Kanageswaran N, Demond M, Nagel M, Schreiner BS, Baumgart S, Scholz P, Buiakova OI, Baker H, Scott JW, Farbman A, Kream R, Grillo M, Franzen L, Altmu¨ller J, Becker C, Doerner JF, Conrad H, Oberland S, Wetzel CH, Richman M, Davis LM, Abbondanzo S, Stewart CL, Margolis FL (1996) Neuhaus EM, Hatt H, Gisselmann G (2015) Deep sequencing of the Olfactory marker protein (OMP) gene deletion causes altered physiolog- murine olfactory receptor neuron transcriptome. PLoS One 10:e0113170. ical activity of olfactory sensory neurons. Proc Natl Acad Sci U S A 93: CrossRef Medline 9858–9863. CrossRef Medline Kaneko-Goto T, Sato Y, Katada S, Kinameri E, Yoshihara S, Nishiyori A, Challis RC, Tian H, Wang J, He J, Jiang J, Chen X, Yin W, Connelly T, Ma L, Kimura M, Fujita H, Touhara K, Reed RR, Yoshihara Y (2013) Goofy Yu CR, Pluznick JL, Storm DR, Huang L, Zhao K, Ma M (2015) An olfactory cilia pattern in the mammalian nose ensures high sensitivity to coordinates the acuity of olfactory signaling. J Neurosci 33:12987–12996, odors. Curr Biol 25:2503–2512. CrossRef Medline 12996a. CrossRef Medline Cygnar KD, Zhao H (2009) Phosphodiesterase 1C is dispensable for rapid Kaupp UB (2010) Olfactory signalling in vertebrates and insects: differences response termination of olfactory sensory neurons. Nat Neurosci 12:454– and commonalities. Nat Rev Neurosci 11:188–200. CrossRef Medline 462. CrossRef Medline Kerr DS, Von Dannecker LE, Davalos M, Michaloski JS, Malnic B (2008) Cygnar KD, Stephan AB, Zhao H (2010) Analyzing responses of mouse ol- Ric-8B interacts with G alpha olf and G gamma 13 and co-localizes with G factory sensory neurons using the air-phase electroolfactogram record- alpha olf, G beta 1 and G gamma 13 in the cilia of olfactory sensory ing. J Vis Exp 37: pii: 1850. CrossRef Medline neurons. Mol Cell Neurosci 38:341–348. CrossRef Medline Cygnar KD, Collins SE, Ferguson CH, Bodkin-Clarke C, Zhao H (2012) Kleene SJ (2008) The electrochemical basis of odor transduction in verte- Phosphorylation of adenylyl cyclase III at serine1076 does not attenuate brate olfactory cilia. Chem Senses 33:839–859. CrossRef Medline olfactory response in mice. J Neurosci 32:14557–14562. CrossRef Medline Kleene SJ, Gesteland RC (1991) Calcium-activated chloride conductance in Dhallan RS, Yau KW, Schrader KA, Reed RR (1990) Primary structure and frog olfactory cilia. J Neurosci 11:3624–3629. Medline functional expression of a cyclic nucleotide-activated channel from olfac- Kurahashi T, Yau KW (1993) Co-existence of cationic and chloride compo- tory neurons. Nature 347:184–187. CrossRef Medline nents in odorant-induced current of vertebrate olfactory receptor cells. Dibattista M, Amjad A, Maurya DK, Sagheddu C, Montani G, Tirindelli R, Nature 363:71–74. CrossRef Medline Menini A (2012) Calcium-activated chloride channels in the apical re- Lee AC, He J, Ma M (2011) Olfactory marker protein is critical for func- 5710 • J. Neurosci., June 7, 2017 • 37(23):5699–5710 Talaga et al. • CFAP69 Regulates Olfactory Response

tional maturation of olfactory sensory neurons and development of Preibisch S, Rueden C, Saalfeld S, Schmid B, Tinevez JY, White DJ, mother preference. J Neurosci 31:2974–2982. CrossRef Medline Hartenstein V, Eliceiri K, Tomancak P, Cardona A (2012) Fiji: an open- Li F, Ponissery-Saidu S, Yee KK, Wang H, Chen ML, Iguchi N, Zhang G, Jiang P, source platform for biological-image analysis. Nat Methods 9:676–682. Reisert J, Huang L (2013) Heterotrimeric G protein subunit Ggamma13 is CrossRef Medline critical to olfaction. J Neurosci 33:7975–7984. CrossRef Medline Scott JW, Scott-Johnson PE (2002) The electroolfactogram: a review of its Lipscomb BW, Treloar HB, Greer CA (2002) Cell surface carbohydrates history and uses. Microsc Res Tech 58:152–160. CrossRef Medline reveal heterogeneity in olfactory receptor cell axons in the mouse. Cell Sinnarajah S, Dessauer CW, Srikumar D, Chen J, Yuen J, Yilma S, Dennis JC, Tissue Res 308:7–17. CrossRef Medline Morrison EE, Vodyanoy V, Kehrl JH (2001) RGS2 regulates signal Lowe G, Gold GH (1991) The spatial distributions of odorant sensitivity transduction in olfactory neurons by attenuating activation of adenylyl and odorant-induced currents in salamander olfactory receptor cells. cyclase III. Nature 409:1051–1055. CrossRef Medline J Physiol 442:147–168. CrossRef Medline Sneath PHA, Sokal RR (1973) Numerical taxonomy: the principles and Maurya DK, Menini A (2014) Developmental expression of the calcium- practice of numerical classification. San Francisco: W.H. Freeman. activated chloride channels TMEM16A and TMEM16B in the mouse ol- Song Y, Cygnar KD, Sagdullaev B, Valley M, Hirsh S, Stephan A, Reisert J, factory epithelium. Dev Neurobiol 74:657–675. CrossRef Medline Zhao H (2008) Olfactory CNG channel desensitization by Ca2ϩ/CaM Mayer U, Ku¨ller A, Daiber PC, Neudorf I, Warnken U, Schno¨lzer M, Frings S, via the B1b subunit affects response termination but not sensitivity to Mo¨hrlen F (2009) The proteome of rat olfactory sensory cilia. Proteom- recurring stimulation. Neuron 58:374–386. CrossRef Medline ics 9:322–334. CrossRef Medline Stephan AB, Shum EY, Hirsh S, Cygnar KD, Reisert J, Zhao H (2009) ANO2 McClintock TS, Glasser CE, Bose SC, Bergman DA (2008) Tissue expression is the cilial calcium-activated chloride channel that may mediate olfactory patterns identify mouse cilia genes. Physiol Genomics 32:198–206. Medline amplification. Proc Natl Acad Sci U S A 106:11776–11781. CrossRef Mombaerts P, Wang F, Dulac C, Chao SK, Nemes A, Mendelsohn M, Ed- Medline mondson J, Axel R (1996) Visualizing an olfactory sensory map. Cell Stephan AB, Tobochnik S, Dibattista M, Wall CM, Reisert J, Zhao H (2011) 87:675–686. CrossRef Medline The Na(ϩ)/Ca(2ϩ) exchanger NCKX4 governs termination and adapta- Okazaki Y et al. (2002) Analysis of the mouse transcriptome based on function of the mammalian olfactory response. Nat Neurosci 15:131–137. tional annotation of 60,770 full-length cDNAs. Nature 420:563–573. CrossRef Medline CrossRef Medline Su AI, Wiltshire T, Batalov S, Lapp H, Ching KA, Block D, Zhang J, Soden R, Pietra G, Dibattista M, Menini A, Reisert J, Boccaccio A (2016) The Ca2ϩ- Hayakawa M, Kreiman G, Cooke MP, Walker JR, Hogenesch JB (2004) activated Cl- channel TMEM16B regulates action potential firing and A gene atlas of the mouse and human protein-encoding transcriptomes. axonal targeting in olfactory sensory neurons. J Gen Physiol 148:293–311. Proc Natl Acad Sci U S A 101:6062–6067. CrossRef Medline CrossRef Medline Tadenev AL, Kulaga HM, May-Simera HL, Kelley MW, Katsanis N, Reed RR Pifferi S, Dibattista M, Menini A (2009) TMEM16B induces chloride cur- (2011) Loss of Bardet-Biedl syndrome protein-8 (BBS8) perturbs olfac- rents activated by calcium in mammalian cells. Pflugers Arch 458:1023– tory function, protein localization, and axon targeting. Proc Natl Acad Sci 1038. CrossRef Medline U S A 108:10320–10325. CrossRef Medline Ponissery Saidu S, Dibattista M, Matthews HR, Reisert J (2012) Odorant- Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: Mo- induced responses recorded from olfactory receptor neurons using the lecular evolutionary genetics analysis version 6.0. Mol Biol Evol 30:2725– suction pipette technique. J Vis Exp 62:e3862. CrossRef Medline 2729. CrossRef Medline Rasche S, Toetter B, Adler J, Tschapek A, Doerner JF, Kurtenbach S, Hatt H, Trotier D (1994) Intensity coding in olfactory receptor cells. Semin Cell Biol Meyer H, Warscheid B, Neuhaus EM (2010) Tmem16b is specifically 5:47–54. CrossRef Medline expressed in the cilia of olfactory sensory neurons. Chem Senses 35:239– Trotier D, MacLeod P (1983) Intracellular recordings from salamander ol- 245. CrossRef Medline factory receptor cells. Brain Res 268:225–237. CrossRef Medline Reisert J, Matthews HR (1998) Naϩ-dependent Ca2ϩ extrusion governs Von Dannecker LE, Mercadante AF, Malnic B (2005) Ric-8B, an olfactory response recovery in frog olfactory receptor cells. J Gen Physiol 112:529– putative GTP exchange factor, amplifies signal transduction through the 535. CrossRef Medline olfactory-specific G-protein Galphaolf. J Neurosci 25:3793–3800. CrossRef Reisert J, Matthews HR (1999) Adaptation of the odour-induced response Medline in frog olfactory receptor cells. J Physiol 519:801–813. CrossRef Medline Wong ST, Trinh K, Hacker B, Chan GC, Lowe G, Gaggar A, Xia Z, Gold GH, Reisert J, Matthews HR (2001) Response properties of isolated mouse olfac- Storm DR (2000) Disruption of the type III adenylyl cyclase gene leads tory receptor cells. J Physiol 530:113–122. CrossRef Medline to peripheral and behavioral anosmia in transgenic mice. Neuron 27:487– Reisert J, Yau KW, Margolis FL (2007) Olfactory marker protein modulates 497. CrossRef Medline the cAMP kinetics of the odour-induced response in cilia of mouse olfac- Yan C, Zhao AZ, Bentley JK, Loughney K, Ferguson K, Beavo JA (1995) tory receptor neurons. J Physiol 585:731–740. CrossRef Medline Molecular cloning and characterization of a calmodulin-dependent phos- Ross AJ, et al. (2005) Disruption of Bardet-Biedl syndrome ciliary proteins phodiesterase enriched in olfactory sensory neurons. Proc Natl Acad Sci perturbs planar cell polarity in vertebrates. Nat Genet 37:1135–1140. U S A 92:9677–9681. CrossRef Medline CrossRef Medline Zou DJ, Chesler AT, Le Pichon CE, Kuznetsov A, Pei X, Hwang EL, Firestein S Sammeta N, Yu TT, Bose SC, McClintock TS (2007) Mouse olfactory sen- (2007) Absence of adenylyl cyclase 3 perturbs peripheral olfactory pro- sory neurons express 10,000 genes. J Comp Neurol 502:1138–1156. jections in mice. J Neurosci 27:6675–6683. CrossRef Medline CrossRef Medline Zuckerkandl E, Pauling L (1965) Molecules as documents of evolutionary Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, history. J Theor Biol 8:357–366. CrossRef Medline Appendix II. Lamin B1 is required for mature neuron-specific gene expression during olfactory sensory neuron differentiation

Crystal M. Gigante, Michele Dibattista, Frederick N. Dong, Xiaobin Zheng, Sibiao Yue, Stephen G. Young, Johannes Reisert, Yixian Zheng, and Haiqing Zhao

This chapter was published in Nature Communications in 2017.

DOI: 10.1038/ncomms15098

Frederick Dong contributed RT-qPCR validation of differentially-expressed genes as detected by RNA sequencing.

100 ARTICLE

Received 4 Jul 2016 | Accepted 28 Feb 2017 | Published 20 Apr 2017 DOI: 10.1038/ncomms15098 OPEN Lamin B1 is required for mature neuron-speciﬁc gene expression during olfactory sensory neuron differentiation

Crystal M. Gigante1,2, Michele Dibattista3,4, Frederick N. Dong1, Xiaobin Zheng2, Sibiao Yue2, Stephen G. Young5, Johannes Reisert3, Yixian Zheng2 & Haiqing Zhao1

B-type lamins are major constituents of the nuclear lamina in all metazoan cells, yet have specific roles in the development of certain cell types. Although they are speculated to regulate gene expression in developmental contexts, a direct link between B-type lamins and developmental gene expression in an in vivo system is currently lacking. Here, we identify lamin B1 as a key regulator of gene expression required for the formation of functional olfactory sensory neurons. By using targeted knockout in olfactory epithelial stem cells in adult mice, we show that lamin B1 deficient neurons exhibit attenuated response to odour stimulation. This deficit can be explained by decreased expression of genes involved in mature neuron function, along with increased expression of genes atypical of the olfactory lineage. These results support that the broadly expressed lamin B1 regulates expression of a subset of genes involved in the differentiation of a specific cell type.

1 Department of Biology, The Johns Hopkins University, Baltimore, Maryland 21218, USA. 2 Department of Embryology, Carnegie Institution for Science, Baltimore, Maryland 21218, USA. 3 Monell Chemical Senses Center, Philadelphia, Pennsylvania 19104, USA. 4 Department of Basic Medical Sciences, Neuroscience and Sensory Organs, University of Bari ‘A. Moro’, Bari 70121, Italy. 5 Department of Medicine, Molecular Biology Institute and Department of Human Genetics, University of California, Los Angeles, California 90095, USA. Correspondence and requests for materials should be addressed to Y.Z. (email: [email protected]) or to H.Z. (email: [email protected]).

NATURE COMMUNICATIONS | 8:15098 | DOI: 10.1038/ncomms15098 | www.nature.com/naturecommunications 1 ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms15098

amins, nuclear intermediate filament proteins, are the major carrying a conditional Lmnb1 allele21 (Lmnb1fl, Supplementary constituents of the nuclear lamina, a protein network under Fig. 1a). A Cre-dependent red fluorescent reporter allele22 L Ai9 the nuclear envelope that functions in maintaining the (R26 ) was introduced to allow for the visualization and structure and organization of the nucleus. Despite broad isolation of mutant horizontal basal cells and their progeny based expression, lamins B1 and B2 appear to have specific roles in on tdTomato (Tomato) fluorescence (Supplementary Fig. 1a–c). the development, differentiation and aging of certain tissues and Under laboratory housing conditions, horizontal basal cells are cell types1. Lamins have speculated roles in regulating changes in largely quiescent23,24. Accordingly, olfactory epithelia from and the long-term stabilization of gene expression during mutant animals (K5Cre;Lmnb1fl/fl) were almost entirely differentiation2,3, but studies have not yet shown a direct link composed of Tomato-negative Lmnb1fl/fl cells, with the between B-type lamins and the expression of genes involved in exception of Tomato-positive (presumptively Lmnb1 À / À ) development. Furthermore, these roles for B-type lamins have horizontal basal cells (Fig. 1a, Supplementary Fig. 1c–d). recently been challenged by reports that lamin B mutant Horizontal basal cells can produce all cell types of the olfactory embryonic stem cells do not exhibit deficits in gene expression epithelium upon tissue damage16,18, allowing us to induce or gene association with the nuclear lamina4,5. The lack of expansion of Lmnb1 À / À cells through temporally controlled in depth in vivo mutational studies have left the question of damage. We induced olfactory epithelium damage chemically how B-type lamins regulate development, differentiation and using the drug methimazole (Supplementary Fig. 1e), which is aging unanswered. known to activate horizontal basal cells16. Indeed, following Deletion of the gene encoding lamin B1 (Lmnb1) in mice regeneration, Tomato-positive cells (horizontal basal cells and produces severe defects in the development of the nervous progeny) were lamin B1-deficient in mosaic mutant olfactory system, while many other tissues remain intact4,6. Lamin B1 epithelium based on antibody staining (Fig. 1b,c). By contrast, has been shown to have diverse functions in many cellular neighbouring Tomato-negative cells (Lmnb1fl/fl) exhibited processes in vitro and in invertebrates2,3, and it remains unclear normal lamin B1 staining (Fig 1b,c). Quantification of lamin which functions of lamin B1 underlie the specific requirement B1 antibody staining revealed that 93.7% of all Tomato-positive in the nervous system. There have been reports that neuronal cells were lamin B1 negative, compared to 3.5% of control cells genes relocate to and from the nuclear lamina in correlation (Supplementary Fig. 1d). Given the small minority (6.3%) of with changes in gene expression during differentiation or Tomato-positive cells expressing lamin B1, Tomato-positive neuronal activation7–14, yet evidence showing a direct role for cells in mosaic mutant epithelium will henceforth be referred lamins in the expression of these genes is lacking. Unfortunately, to as Lmnb1 À / À . Thus, recovery from injury produced the perinatal lethality and extensive cell death observed upon a mosaic mutant olfactory epithelium, consisting of both Lmnb1 knockout in the embryonic nervous system has made control (Lmnb1fl/fl) and mutant (Lmnb1 À / À )cells(Fig.1; in vivo analysis difficult. Supplementary Fig. 1). We sought to investigate the role of lamin B1 in the Lmnb1 mosaic mutant olfactory epithelia were grossly development of neurons using the olfactory epithelium because indistinguishable from control epithelia by DIC microscopy it is a site of robust neurogenesis in adult animals. Resident stem or DAPI staining at all time points analysed (Supplementary and progenitor cells produce all neuronal and non-neuronal cell Fig. 1f, see below). Examination of sparse Tomato-expressing cells types of the epithelium throughout the lifespan of mammals in in mosaic mutant tissue revealed Lmnb1 À / À cells with the response to normal turnover or damage15–17. The differentiation typical morphology of olfactory sensory neurons, stem cells, of stem/progenitor cells into mature neurons involves progenitors and supporting cells (Fig. 1d). Moreover, sparse characteristic changes in cellular morphology, connectivity and Tomato-positive clones in mosaic mutant animals (Lmnb1 À / À gene expression. The well-characterized neuronal differentiation cells) and control littermates (Lmnb1 þ / À cells) consisted of program, the peripheral location and the robust, inducible similar proportions of sustentacular cells, neurons and progeni- neurogenesis make the olfactory epithelium an optimal system tors (Supplementary Fig. 1g). to study the role of lamin B1 in the development of neurons in adult animals. We conditionally deleted Lmnb1 from a population of Lmnb1 knockout produces attenuated olfactory neuron response. postnatally established, quiescent stem cells in the olfactory Given that many Lmnb1 À / À cells exhibited the typical bipolar epithelium and examined the differentiation and function of morphology of mature neurons, we tested if olfactory sensory olfactory sensory neurons lacking lamin B1. In the absence of neuron function was affected by Lmnb1 knockout. We recorded lamin B1, olfactory sensory neurons exhibit attenuated responses the electrical responses of single, dissociated Lmnb1 À / À to odour stimulation and abnormal nuclear pore distribution. olfactory sensory neurons to odour stimulation using the suction Using a combination of candidate and unbiased profiling pipette technique25. Tomato-positive Lmnb1 À / À (mutant) or approaches, we show that this functional deficit is likely the Lmnb1 þ / À (control) olfactory neurons were dissociated from result of decreased expression of specific genes that are required mosaic mutant or mosaic heterozygote epithelia, respectively, in mature olfactory sensory neurons. and stimulated with a two-odorant mixture (Cineole and Acetophenone). Fewer mutant neurons responded to odour stimulation, and, for neurons that did respond, the response Results amplitude was much smaller in mutant cells compared to Lmnb1 conditional knockout in the adult olfactory epithelium. controls (Fig. 1e–i). At 100 mM of each odorant, the highest We designed a genetic system to deplete Lmnb1 in the concentration tested, 19% of mutant neurons responded, adult olfactory epithelium to avoid the perinatal lethality and compared to 32% of control neurons, and the average response wide spread cell death produced by lamin B1 knockout in the amplitude of mutant neurons was less than half of that in controls brain. Lmnb1 knockout was confined to horizontal basal cells, (Fig. 1e,g). Dose-response analysis revealed significant decreases a population of postnatally established resident olfactory in the average response amplitude of mutant cells at all epithelium stem cells16,18 by exploiting their expression of concentrations above 10 mM of the odorant mixture (Fig. 1h,i). cytokeratin 5 (K5)19. Mice carrying a K5 promoter-driven Moreover, the dose-response relation appeared flattened Cre recombinase transgene (K5Cre20) were crossed to mice in mutant neurons (Fig. 1i), showing that lack of lamin

2 NATURE COMMUNICATIONS | 8:15098 | DOI: 10.1038/ncomms15098 | www.nature.com/naturecommunications NATURE COMMUNICATIONS | DOI: 10.1038/ncomms15098 ARTICLE

a Steady state Post regeneration Lamin B1 Lmnb1–/– lineage

Supporting cells

Neurons

Stem and progenitor cells

Post regeneration b c d Control Control Control

Mutant

Lamin B1 Tomato

Lamin B1 Tomato Mutant

Mutant Mutant Tomato

Lamin B1 Tomato

e Odour responsive fg Non responsive Odorant 100 * 0 120 80 90 60 –50 60 40 *** Control Odour-induced 30 20 peak current (pA)

Suction current (pA) Mutant Percent of total neurons –100 0 0 Control Mutant –1 0 1 2 3 Control Mutant Time (s)

h Control Mutant i 0 150 Control ** Mutant * –40 Acetophenone + 100 * cineole 100 µM –80 30 µM 50 10 µM

Odour-induced

3 µM peak current (pA)

Suction current (pA) –120 1 µM 0 2 4 6 2 4 6 –1 0 1 2 3 –1 0 1 2 3 1 10 100 Time (s) Time (s) Odorant (µM)

Figure 1 | Mosaic knockout of Lmnb1 in the olfactory epithelium and response of Lmnb1 À / À neurons to odour stimulation. (a) Cartoon depiction of Lmnb1 mosaic knockout strategy during adult neurogenesis in the olfactory epithelium. Under normal laboratory conditions (Steady-State, left), Cre-expressing Lmnb1 À / À horizontal basal cells (red) are largely quiescent and the majority of the olfactory epithelium expresses lamin B1 protein (blue). After damage-induced activation, Lmnb1 À / À horizontal basal cells give rise to interspersed Lmnb1 À / À daughter cells (red) that become all cell types of the epithelium, resulting in a mosaic epithelium containing both Lmnb1-null and Lmnb1-expressing cells (Post regeneration, right). (b,c) Lamin B1 antibody staining of control (K5Cre;Lmnb1fl/ þ ) and mosaic mutant (K5Cre; Lmnb1fl/fl) olfactory epithelium post regeneration. Horizontal basal cell lineage can be identified by expression of a Cre-dependent Tomato reporter allele. Tomato-expressing cells are presumptively Lmnb1 À / À in mutant epithelium, Lmnb1 þ / À in controls. Tomato-negative cells are presumptively Lmnb1fl/fl in mutant epithelium, Lmnb1fl/ þ in control. Scale bars indicate 50 mm(b) and 25 mm(c). (d) Sparse Tomato expression in Lmnb1 À / À cells in the mosaic mutant epithelium showing cellular morphology of mutant cells. Scale bar indicates 25 mm. (e) Percentage of odorant-responsive neurons. 32% (35 out of 110) of control (Lmnb1 þ / À ) neurons and 19% (23 out of 122) of mutant (Lmnb1 À / À ) dissociated Tomato-positive neurons responded to a 1-s stimulation of 100 mM odorant mix (100 mM Acetophenone and 100 mM Cineole). *Po0.05, chi-squared test. (f) Representative responses of a control and a mutant neuron to a 1-s stimulation of 100 mM odorant mix. (g) Average peak response amplitude. Control neurons, 108.8±11.7 pA (n ¼ 35); mutant neurons, 46.4±8.5 pA (n ¼ 23). Data are expressed as mean±s.e.m. ***Po0.001, unpaired Student’s t-test (h) Dose-response traces of a control and a mutant neuron to a 1-s stimulation of odorant mix at increasing concentration from 1 to 100 mM. (i) Dose-response relationships of the peak amplitude to the odorant mix. n ¼ 10 cells. All data are expressed as mean±s.e.m. **Po0.01, *Po0.05, unpaired Student’s t-test.

NATURE COMMUNICATIONS | 8:15098 | DOI: 10.1038/ncomms15098 | www.nature.com/naturecommunications 3 ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms15098

a b Control Mutant Mutant Mutant

mAb414 mAb414 Control Mutant

mAb414 mAb414 Tomato mAb414 Tomato mAb414 Tomato

c d e Mutant Mutant 0.8 Control Mutant Mutant 0.6

0.4

0.2 Fraction of cells 0.0 DAPI 12≥3 Tomato Number of DAPI Foci

Figure 2 | Nuclear architecture and organization of Lmnb1 À / À cells. (a) Distribution of nuclear pore complexes by antibody staining with mAb414, which recognizes several FG nucleoporins, in Lmnb1 mosaic mutant and control epithelium. Arrows show nuclei of Tomato-positive cells, Lmnb1 À / À in mutant and Lmnb1 þ / À in control. Scale bar indicates 25 mm. (b,c) Higher magnification of mAb414 staining in Lmnb1 mosaic mutant epithelium. Blue arrows indicate nuclei of Lmnb1 À / À cells; yellow arrows show Lmnb1fl/fl cells. Scale bars indicate 25 mm(b) and 5 mm(c). (d) Single confocal slice of DAPI stained nuclei from Lmnb1 mosaic mutant olfactory epithelium showing DAPI-bright foci in the nucleoplasm indicative of heterochromatin reorganization. A single DAPI-bright focus can be seen in a Tomato positive Lmnb1 À / À cell (blue arrow) and Tomato-negative Lmnb1fl/fl cell (yellow arrow). (e) Quantification of the number of DAPI bright foci in mutant (Lmnb1 À / À ) and control (Lmnb1fl/fl) cells. Error bars indicate ± 95% confidence intervals. Data are from four mice, 4200 cells per mouse, two independent groups.

B1 disrupted the neurons’ ability to dynamically encode odorant Lmnb1 facilitates mature olfactory sensory neuron formation. concentration. The decrease in both the number of odorant- The abnormal response and nuclear pore distribution of responsive cells and the response size suggests a role for lamin Lmnb1 À / À neurons prompted us to investigate any cellular B1 in the formation of functional olfactory sensory neurons. and molecular changes that may underlie or result from these phenotypes. We employed a candidate approach to investigate all stages of olfactory neuron differentiation from stem cells. Lamin B1 is required for proper nuclear pore distribution. Lamin B1 has been implicated in mitosis, cell cycle and cell Lamins are generally believed to maintain the structure and death, yet neither proliferation rate nor number of apoptotic cells organization of the nuclear periphery2, and several recent studies nor tissue thickness differed between mosaic mutant and control have underscored the importance of the nuclear envelope in the olfactory epithelia at any time point examined (Fig. 3a–c). differentiation of neurons and other cell types26. We, therefore, Moreover, the expansion of Lmnb1 À / À stem cells was compar- examined the nuclei of Lmnb1 À / À cells in the olfactory epithelia. able to control (Lmnb1 þ / À ) stem cells, based on histology and Both gross nuclear shape and the expression pattern of lamin flow cytometry (Fig. 3d, Supplementary Fig. 3a,b). Regenerated B2 appeared unchanged in Lmnb1 À / À cells (Supplementary Lmnb1 mosaic mutant epithelia exhibited the stereotypical Fig. 2a–c). Despite normal staining pattern for lamin B2, antibody olfactory epithelium cellular organization. Sustentacular cells, staining revealed clustered nuclear pore complexes in Lmnb1 À / À olfactory progenitors and immature neurons were present in the cells, while nuclear pores were evenly distributed in neighbouring mosaic mutant olfactory epithelium in a pattern similar to the Lmnb1fl/fl cells in mosaic mutant tissue and in all cells in control control (Fig. 3e–i, Supplementary Fig. 3a–c). Many Lmnb1 À / À tissue (Fig. 2a–c). cells expressed markers of neural progenitors (Sox2 and LSD1) Mature olfactory sensory neurons exhibit a unique nuclear and immature neurons (GAP43) (Fig. 3e–i). Moreover, reorganization of peripheral heterochromatin to one or a few Lmnb1 À / À Tomato-positive nerves innervated glomeruli of the chromocenters in the nucleoplasm during differentiation, olfactory bulb (Supplementary Fig. 3d,e), the target of olfactory through a process involving the downregulation of Lamin B sensory neurons, suggesting that Lmnb1 À / À cells were capable of Receptor and lamin A/C8,27. Lmnb1 knockout did not impact the becoming immature olfactory sensory neurons. formation of these chromocenters (Fig. 2d,e), which can be In contrast, Lmnb1 À / À cells were either decreased in or observed as DAPI bright foci enriched in HP1, H4K20me3 and devoid of olfactory marker protein (OMP), the most widely used H3K9me3 (ref. 8). Accordingly, cells in the neuronal layer of marker of mature olfactory sensory neurons (Fig. 4a,b). This Lmnb1 mosaic mutant olfactory epithelia were negative for LBR observation was confirmed by western blot of mosaic mutant and lamin A/C staining (Supplementary Fig. 2d,e). olfactory mucosa, which revealed decreased expression of OMP Altogether, these data show that lamin B1 is not required for all and a second mature neuron protein, adenylyl cyclase 3 (AC3) in aspects of nuclear architecture in the olfactory neuron lineage but fully regenerated samples (Fig. 4c,d, Supplementary Fig. 4a,b), is necessary to maintain even nuclear pore distribution. when the epithelium is composed of mostly mature neurons16,28.

4 NATURE COMMUNICATIONS | 8:15098 | DOI: 10.1038/ncomms15098 | www.nature.com/naturecommunications NATURE COMMUNICATIONS | DOI: 10.1038/ncomms15098 ARTICLE

a b c d Proliferation rate Cell death Control 400 Control 10 Control m) 60 µ Mutant Mutant Mutant 300 100 40 80 200 5 60 20 100 40 20 33 44 56 33 333 3 56 353333 3 6 Tissue thickness (

0 0 0 % fluorescent cells 0 EdU positve cells per mm CC3 positive cells per mm

1 week4 weeks 4 weeks8 weeks 1 week4 weeks Control Mutant 6–8 weeks 6–8 weeks Undamaged Undamaged Undamaged

e Control Control Control

Sox2 Tomato Sox2 Tomato DAPI

Mutant Mutant Mutant

Sox2 Tomato Sox2 Tomato DAPI

fhg Control Control Mutant

LSD1 Tomato DAPI GAP43 Tomato DAPI LSD1 Mutant Mutant i Mutant

LSD1 Tomato DAPI GAP43 Tomato DAPI GAP43

Figure 3 | Cellular dynamics and distribution in the Lmnb1 mosaic mutant olfactory epithelium. (a) Proliferation rate in Lmnb1 mosaic mutant and control olfactory epithelium. Cells retaining EdU after a 24-h pulse were counted in undamaged tissue (Steady-state, Fig. 1a) or at various time points after damage-induced regeneration. Mean þ s.e.m. are displayed; number of samples (n) is reported on each bar; each n represents data from one animal. (b) Apoptosis rate in Lmnb1 mosaic mutant olfactory epithelium. Cells that stained for cleaved caspase 3 (CC3) were counted in undamaged tissue (Steady-State) or at several time points after damage-induced regeneration. Mean þ s.e.m. are shown; number of samples (n) is shown on each bar; each n represents data from one animal. (c) Average thickness of mosaic mutant olfactory epithelium. Mean þ s.e.m. are shown; n is shown on each bar; each n represents data from one animal. (d) Percentage of Tomato-positive cells in mosaic mutant and control olfactory epithelium 4 weeks after methimazole-induced regeneration, as determined by flow cytometry. Each point represents data from one animal. (e) Expression of pluripotency marker Sox2 by antibody staining in the olfactory epithelium of mosaic mutant (K5Cre;Lmnb1fl/fl) and control (K5Cre;Lmnb1fl/ þ ) mice. Sox2 is expressed in the nuclei of apical supporting cells and basal progenitors. Tomato-expressing cells are Lmnb1 À / À in mutants and Lmnb1 þ / À in controls. Scale bar indicates 25 mm. (f,h) Antibody staining for progenitor marker, LSD1. Scale bar indicates 25 mm. (g,i) Expression of immature olfactory neuron protein, growth- associated protein of 43 kDa (GAP43) by antibody staining. Scale bar indicates 50 mm.

Mutant olfactory mucosa displayed decreased levels of lamin B1 One of the earliest events in olfactory sensory neuron in all samples that had undergone regeneration (Fig. 4c,d, maturation is odorant receptor expression29, where each Supplementary Fig. 4a,b), even though samples were prepared mature neuron expresses strictly one allele of one odorant from mosaic tissue. In contrast, levels of GAP43, lamin B2 and receptor gene out of over 1,200 genes in the mouse genome30–32. actin were comparable to controls at all time points (Fig. 4c,d, We investigated the expression of an odorant receptor reporter Supplementary Fig. 4a,b). Taken together, these data suggest that allele, M72-IRES-tauLacZ (ref. 33) in K5Cre;Lmnb1fl/fl mice. Lmnb1 À / À cells are capable of becoming immature neurons but Whole mount X-gal staining of Lmnb1 mosaic mutant olfactory have reduced ability to become mature neurons. epithelia revealed a significant decrease in the number of cells

NATURE COMMUNICATIONS | 8:15098 | DOI: 10.1038/ncomms15098 | www.nature.com/naturecommunications 5 ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms15098 expressing odorant receptor M72 4 weeks after regeneration odorant receptor could suggest altered odorant receptor (Fig. 4e,f, Supplementary Fig. 4c). Independently, the number of expression. Altogether, these results support a requirement for cells expressing a different odorant receptor reporter, P2-IRES- lamin B1 in the formation of mature olfactory sensory neurons. tauLacZ (ref. 34), was also decreased (Fig. 4f, Supplementary Fig. 4d). Zonal distribution (Fig. 4e) and axon targeting of either P2 or M72 olfactory neurons to the olfactory bulb was Transcriptome analysis of Lmnb1 À / À cells. We observed comparable to controls Given no evidence of increased cell decreased expression of several mature neuron proteins in mosaic death in mutant tissue (Fig. 3a–c), fewer cells expressing a given Lmnb1 mutant olfactory epithelium (Fig. 4, Supplementary

ab Control Mutant Mutant

OMP OMP OMP Control Mutant

Tomato Tomato Tomato Control Mutant

OMP Tomato OMP Tomato OMP Tomato

cd Steady-state Post regeneration Control Mutant 1.5 1.5 Control Mutant Lamin B1 1.0 1.0 OMP * AC3 0.5 0.5 * *

GAP43 level Relative protein 0.0 7776660.0 14 7 14 7 14 7 14 7 14 7 14 7 Lamin B2 OMP OMP AC3 GAP43 Beta actin Lamin B1 Beta actin Lamin B1 Beta actin Lamin B2

ef M72 expressing cells 400 Control Mutant 300

200

100 *

0 4 342 12 7

M72(LacZ) Control Steady-State 1 Week 4 Weeks P2 expressing cells 800 Control Mutant 600 * LacZ positive cells on turbinates 400

200

0 6 9 3 3 7 8 5 5 5 4 s M72(LacZ) Mutant Steady-State 1 Week 4 Week /6 Weeks 8 Weeks 5

6 NATURE COMMUNICATIONS | 8:15098 | DOI: 10.1038/ncomms15098 | www.nature.com/naturecommunications NATURE COMMUNICATIONS | DOI: 10.1038/ncomms15098 ARTICLE

Fig. 4); however, we did not observe a compensatory increase normally transient stage of development that has not yet been in any other cell type, including immature neurons or neural characterized. progenitors (Fig. 3, Supplementary Fig. 3). This led us to take an Even though the sorted cells used for RNA-seq included stem unbiased profiling approach to investigate the molecular cause cells, progenitors, neurons and supporting cells, GO analysis of underlying the disruption in mature neurons upon Lmnb1 genes downregulated in Lmnb1 À / À cells revealed many processes knockout. specific to neurons (Supplementary Data 4). Many downregulated Lmnb1 À / À cells were isolated from mosaic mutant olfactory genes were specific to mature olfactory sensory neurons, including epithelia by fluorescence-activated cell sorting based on Tomato members of the olfactory signal transduction cascade (Fig. 5c). fluorescence 4 weeks after damage-induced regeneration Comparison of changes in gene expression in Lmnb1 À / À cells (Supplementary Fig. 5a,b), the earliest time point at which with published transcriptome datasets for individual olfactory decreases in mature neuron proteins were observed (Fig. 4, epithelium cell types37,38 revealed correlation between differentially Supplementary Fig. 4). Sorted Tomato positive, Lmnb1 þ / À cells expressed genes and genes expressed in mature neurons but not were used as controls. PCR of complementary DNA (cDNA) with genes expressed in other cell types of the epithelium from sorted cells revealed Lmnb1 transcript depletion in cells (Supplementary Fig. 6b–i), supporting a specific deficit in the sorted from mosaic mutant epithelia compared to control expression of mature olfactory neuron genes in Lmnb1 À / À cells. (Fig. 5a). RNA-seq was performed using RNA extracted from We next examined the expression of genes that are known to 4150,000 sorted cells, resulting in 450 million 50 bp reads per regulate olfactory sensory neuron maturation, including sample (GSE80044). Differential expression analysis using edgeR genes involved in genome reorganization8,39, epigenetic (Bioconductor) revealed 626 genes significantly downregulated changes38,40, transcription factor expression41, the unfolded (Supplementary Data 1) and 185 genes upregulated protein response42 and protein feedback43–45. A total of 27 (Supplementary Data 2) in Lmnb1 À / À cells compared to odorant receptors were downregulated in Lmnb1 À / À cells, Lmnb1 þ / À controls (FDRo0.05) (Fig. 5b,c, Supplementary including Olfr17 (P2), but the variation between samples for Fig. 5c). An independent ChIP-seq analysis of active promoter most odorant receptors was too high to make conclusions mark, H3K4me3, by FARP-ChIP-seq for low-cell number35 (Supplementary Fig. 6b). Genes involved in the unfolded protein revealed that changes in gene expression correlated with response, cilia trafficking, axon targeting and activity-dependent changes in the accumulation of H3K4me3 at promoter regions feedback were downregulated in Lmnb1 À / À cells, while genes in sorted Lmnb1 À / À cells (GSE80290, Fig. 5d,e, Supplementary involved in heterochromatin reorganization and epigenetic Fig. 5d–g). Furthermore, the expression levels of several changes during neuronal maturation were unchanged. A total candidate genes determined by qPCR of lamin B1 mosaic of 11 out of 35 genes involved in odorant receptor expression mutant olfactory epithelium correlated with RNA-sequencing were differentially expressed in in Lmnb1 À / À cells; out of 45 results (Supplementary Fig. 6a). genes expressed in the nuclear lamina, zero were differentially Gene ontology (GO) analysis of genes upregulated in Lmnb1 À / À expressed in Lmnb1 À / À cells (gene lists can be found in samples revealed three categories that reached statistical threshold Supplementary Data 5). (FDRo0.05): lipocalin superfamily,cellcycleandextracellular Enrichment of H3K9me3, a marker of constitutive hetero- matrix (Supplementary Data 3).11ofthe185upregulatedgenes chromatin, occurs at odorant receptor clusters during olfactory were members of the lipocalin superfamily, associated with odorant neuron differentiation and is thought to be involved in odorant binding (Supplementary Data 2). We also found several receptor regulation and silencing40,46. To determine if lamin B1 genes involved in immune response, cell death and DNA packaging affected the distribution of this marker at odorant receptor loci (specifically Histone H1 variants). Many of the genes upregulated in and across the genome, H3K9me3 FARP-ChIP-seq was Lmnb1 À / À cells are not known to be highly expressed in any cell performed on sorted Tomato-positive Lmnb1 À / À and type of the olfactory epithelium, including several genes involved in Lmnb1 þ / À cells. Precipitated DNA was sequenced producing diverse signalling pathways. For instance, Lmnb1 À / À cells expressed B50 million 50 bp reads per sample (n ¼ 2, GSE80290). There high levels of g protein subunit Gng5,whichisnottypically were no changes in the distribution of H3K9me3 across the expressed in olfactory neurons. One exception was the up regulation genome or at odorant receptor clusters in Lmnb1 À / À cells of Pax6, which is typically expressed in the olfactory epithelium in a (Fig. 5f,g, Supplementary Fig. 5h–i). subset of progenitors, supporting cells and duct cells36.The Transcriptome and ChIP analyses of Lmnb1 À / À cells upregulation of genes not typically expressed in the olfactory complemented the electrophysiological and protein expression neuron lineage supports the idea that Lmnb1 À / À cells are findings, leading us to conclude that lamin B1 is dispensable for not simply arrested in an immature state or becoming another early differentiation in the olfactory sensory neuron lineage, but is olfactory epithelium cell type but may be acquiring an atypical required for the formation of functional mature neurons. fate. Alternatively, Lmnb1 À / À cells may be arrested in a Furthermore, the gene expression changes caused by Lmnb1

Figure 4 | Formation of mature olfactory sensory neurons in Lmnb1 mosaic mutant olfactory epithelium. (a,b) Antibody staining for mature olfactory sensory neuron marker, olfactory marker protein (OMP), in olfactory epithelium of control (K5Cre;Lmnb1fl/ þ ) and mosaic mutant (K5Cre; Lmnb1fl/fl) mice. Tomato expression indicates Lmnb1 À / À cells in mutant, Lmnb1 þ / À cells in control. Scale bars indicate 25 mm(a) and 10 mm(b). (c) Western blot of olfactory mucosa proteins from mosaic mutant (K5Cre;Lmnb1fl/fl) and control (Lmnb1fl/fl) mice 8 weeks after methimazole-induced regeneration. AC3, mature olfactory neuron protein adenylyl cyclase 3; GAP43, an immature neuron marker. (d) Quantification of western blots showing relative protein levels in mosaic mutant and control olfactory mucosa. Steady-state, undamaged tissue; Post regeneration, 6–8 weeks after methimazole-induced damage. All values, except beta actin, were normalized to beta actin for the same sample. All values are plotted relative to control. Data are expressed as mean þ s.e.m. Number of samples (n) is shown on each bar; each sample was taken from one animal. *Po0.05 unpaired Student’s t-test, corrected for multiple comparisons using Holm-Sidak test. (e) Whole mount X-gal staining of olfactory epithelium from mosaic mutant and control animals carrying a LacZ- tagged allele of odorant receptor M72 (M72-IRES-tauLacZ). Dark puncta on olfactory turbinates are indicative of cells expressing the tagged odorant receptor allele. Scale bars indicate 0.5 mm. (f) Quantification of odorant receptor reporter allele expression for M72-IRES-tauLacZ or P2-IRES-tauLacZ. Total positive cells on medial surface of nasal turbinates were counted for each animal. Data are expressed as mean þ s.e.m.; number of samples (n) is shown on each bar; each n represents data from one animal *Po0.05, unpaired Student’s t-test.

NATURE COMMUNICATIONS | 8:15098 | DOI: 10.1038/ncomms15098 | www.nature.com/naturecommunications 7 ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms15098 mutation suggest a role for lamin B1 in the upregulation of distinct decreases in the expression of mature neuron-specific mature neuron-specific genes during differentiation. genes and upregulation of genes not typically highly expressed in the olfactory lineage. This aberrant gene expression likely underlies the disrupted function of Lmnb1 mutant cells, where Discussion Lmnb1 À / À neurons exhibited reduced, altered odorant response The findings of this study establish a link between lamin B1 and along with a decrease in the number of cells responsive to odour in vivo developmental changes in gene expression. We report stimulation. Together, our data support a necessary role for lamin

a b

+/– –/–

2 Lmnb1 Lmnb1

Lmnb1 Log10 cpm 0 S15

Expression level mutant −2 GAP43 −20 2 4 Expression level control Log10 cpm

c d Lcn11 Gm14743 Log2 fold change Obp1a C mm9 Mup5 2 105,280,000 105,300,000 105,320,000 Mup4 Chr7 Gm14744 Control 5430402E10Rik 1 15 20 kb Klhl23 H3K4me3 Top2a 0 Krt15 Krt14 Cbx5 –1 Krt5 0 Sox2 Pax6 –2 15 Mutant Lbr Cyp2a5 H3K4me3 Nup98 Hist3h2a Dnmt1 Kdm1a Olfactory transduction 0 Rps6 Myo7a Omp BC144936 Lmna Calm2 Capn5 Actb Capn5 Lmnb2 Cbx2 Slc24a4 Bbs1 Bbs2 Gnb1 mm9 4,100,000 4,150,000 4,200,000 4,250,000 Ncam1 Chr12 Ebf4 Calm1 Control 100 kb Lmnb1 12 Atf5 Gng13 H3K4me3 Ppp2r2c Kcnc4 Pde4a Kcna6 Ncam2 Pde1c Rtp2 0 Syt7 Adcy3 Cbx4 Cnga2 12 Mutant Scn3b H3K4me3 Rtp1 Cnga4 Gnal S100a5 Omp Omp Kirrel2 Cngb1 0 Hcn2 Adcy3 Olfm1 Gnal Dnajc27 Cenpo Adcy3 Ptrhd1 Syt1 Ano2 Cend1 1 2 12

ef Control olfr 1.2 Mutant olfr 1.0 Control non-olfr 0.8 Mutant non-olfr 4 0.6 2 0.4

mutant v. 0.2

1 H3K9me3 density (RPKM) 0.0 –2–1 0 1 2 Lmnb1 0 Position relative to TSS (kb)

–1 g control RNA-seq mm9 38,000,000 39,000,000 40,000,000 41,000,000 Chr9 –2 Control 1 Mb 2.5 H3K9me3 Log2 fold change –4 –2 –1 012 0 Mutant Log2 fold change Lmnb1 mutant v. control 2.5 H3K9me3 H3K4me3 ChIP-seq

0 RefSeq genes Olfr cluster

8 NATURE COMMUNICATIONS | 8:15098 | DOI: 10.1038/ncomms15098 | www.nature.com/naturecommunications NATURE COMMUNICATIONS | DOI: 10.1038/ncomms15098 ARTICLE

B1 in cell type-specific gene expression during development that normal brain patterning during early development, which is required for proper cell function. may be caused by a defect in neuronal differentiation. In Olfactory neuron differentiation involves extensive regulation humans, Lmnb1 duplications have been linked to demyelinating to ensure that terminal differentiation does not proceed until leukodystrophy54, and Lmnb1 polymorphisms have been linked a functional odorant receptor is expressed. Previous studies to neural tube defects55. Future studies are needed to address have shown that disrupting olfactory neuron differentiation if lamin B1 regulates gene expression during differentiation results in decreases in mature neurons accompanied by in other neuronal systems. accumulation of immature neurons and progenitors and/or B-type lamins have been implicated in many cellular processes, increased cell death and epithelium thinning8,41,42,47–49. We so determining the role of an individual lamin in one process can report a novel phenotype upon Lmnb1 mutation, whereby be difficult, especially in the case of multiple severe phenotypes. Lmnb1 À / À cells progress through early stages of differentiation The unique approach taken to knockout Lmnb1 in the adult normally yet display defects at the final stage of olfactory sensory olfactory epithelium provides several advantages. In a mosaic neuron maturation with no changes in cell death, tissue thinning knockout tissue, potential non-cell autonomous defects caused or increase in any other cell type in the epithelium. The increased by Lmnb1 knockout in a given cell could be compensated by expression of genes not known to be highly expressed in any nearby Lmnb1-expressing cells. Thus, our findings support cell type of the olfactory epithelium may represent an arrest at least a cell autonomous role for lamin B1 in olfactory neuron at a transient stage of neuronal development that is not differentiation. In addition, as olfactory neuron differentiation in typically observed, which may offer further opportunities to the adult olfactory epithelium mirrors differentiation during investigate olfactory neuron development. embryonic development in many ways, we expect that lamin B1 We provide several lines of evidence that expression of at would play a similar role during embryonic development. least a few odorant receptors is perturbed in Lmnb1–/– cells. Disruption of B-type lamins has resulted in nuclear blebbing Previous studies have suggested that the concerted action of and/or disrupted nuclear pore organization in several cell heterochromatin inversion, epigenetic changes, transcription types6,21,56–59. There is evidence that at least some aspects of factor expression, the unfolded protein response and odorant lamin function, including nuclear pore distribution, may rely more receptor signalling ensure expression of exactly one functional on total lamin concentration than on a specific lamin type57. There odorant receptor (for review, see Monahan and Lomvardas50 and is also evidence that lamin B1 and lamin B2 have distinct roles Rodriguez51). We found evidence for normal heterochromatin in vivo in the nervous system4,60. Mature olfactory sensory neurons inversion, epigenetic changes at odorant receptor genes, and do not express A-type lamins8, and it is possible that the level of expression of epigenetic modifiers in Lmnb1–/– cells, while lamin B2 alone is insufficient to compensate the function of lamin observing decreased expression of transcription factors, B1. Consistent with this, we did observe disrupted distribution of members of the unfolded protein response, odorant receptor nuclear pore complexes in Lmnb1 À / À cells. chaperones, odorant receptors and olfactory signal transduction Nuclear pores are important in nuclear transport, cell proteins, including AC3, in Lmnb1–/– cells. A recent study signalling, genome organization and gene expression, and several suggests that AC3 is one of the earliest proteins expressed as part recent studies have underscored the importance of nuclear pore of a feedback loop that regulates odorant receptor expression42,48. complexes and nuclear transport in the regulation of cell fate and Thus, the decreased levels of AC3 in Lmnb1 À / À cells may result differentiation in neurons and other cell types26,61. In fact, B-type in the defects in odorant receptor expression we observed. lamins have been shown to ensure nuclear retention of Further investigation into odorant receptor regulation is needed phosphorylated Erk by maintaining the even distribution of to distinguish if Lmnb1–/– cells have exited the feedback loop42,48, nucleoporins or nuclear pores in both Drosophila58 and cultured if Lmnb1 mutation has revealed an additional layer of regulation, mouse neurons62. It is, therefore, possible that abnormal nuclear or if Lmnb1 mutation results in defects upstream of odorant pore distribution may underlie the changes in gene expression receptor expression during development. observed upon Lmnb1 mutation in the olfactory lineage. The specific terminal differentiation phenotype produced by In general, B-type lamins are thought to regulate gene expression Lmnb1 knockout in the olfactory epithelium is also in stark through repression of genes at the nuclear periphery63,64. This contrast to the cell cycle defects, massive cell death and improper repressive role of lamins is based on observations that regions of migration observed upon Lmnb1 knockout in the developing the genome associated with the nuclear lamina exhibit low gene brain and retina4,6,52. Lamin B2 was the first B-type lamin density, low expression and epigenetic signatures of hetero- implicated in nervous system development53; however, knockout chromatin; that experimentally targeting genes to the nuclear of lamin B1 causes more severe neural defects4,6,52. Either lamina can, though does not always, result in gene repression; and targeted6 or germ line4 deletion of Lmnb1 in mice produces that lamin depletion has resulted in de-repression of silent genes in widespread neural cell death, disrupted neuronal migration and some cases2,3. Mature olfactory sensory neurons, however, exhibit decreased brain size late in embryonic development despite a unique organization of most heterochromatin away from the

Figure 5 | Transcriptome profiling of Lmnb1 À / À mutant olfactory cells. (a) PCR amplification of cDNA from sorted mutant (Lmnb1 À / À ) or control (Lmnb1 þ / À ) Tomato positive cells. Thirty five cycles of PCR were performed to amplify Lmnb1 exon 10/11, ribosomal protein S15 and immature neuron marker GAP43. (b) Scatterplot depicting expression level (average CPM) of genes in sorted mutant (Lmnb1 À / À ) versus control (Lmnb1 þ / À ) cells (n ¼ 2 independent experiments) based on RNA-seq. Each point represents one gene. Results of differential expression analysis are shown by colour: red FDRo0.05; black FDR40.05. (c) Heatmaps of log2 fold change in expression of select genes in mutant and control cells. Genes involved in olfactory signal transduction are displayed separately. Data shown are for two experimental replicates (1 and 2). (d) Histograms showing the distribution of activate promoter histone modification, H3K4me3, across the locus of two mature olfactory neuron genes (Omp and Adcy3 (AC3)) in sorted mutant and control cells based on FARP-ChIP-seq. (e) Correlation between changes in gene expression (log2 fold change from RNA-seq analysis) and H3K4me3 promoter abundance (log2 fold change from FARP-ChIP-seq analysis) in mutant cells compared to controls for genes differentially expressed by RNA-seq. Pearson correlation R ¼ 0.55, Po0.001 F-test. (f) Average distribution of constitutive heterochromatin mark H3K9me3 across odorant receptor (olfr) and non- odorant receptor genes (non-olfr) in Lmnb1 À / À and Lmnb1 þ / À control cells based on FARP-ChIP-seq (n ¼ 2 independent groups). (g) Representative histograms showing the distribution of H3K9me3 across an odorant receptor cluster in mutant and control cells.

NATURE COMMUNICATIONS | 8:15098 | DOI: 10.1038/ncomms15098 | www.nature.com/naturecommunications 9 ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms15098 nuclear periphery8,65, where it is unlikely to be in direct contact and male mice maintained on a mixed genetic background aged 2–6 months were with lamin B1. In contrast to being a general repressor of gene used in all assays. Mutant animals and littermate controls were assigned to the expression, we find that lamin B1 is required for the upregulation same treatment group; experimental methods and analyses were randomly assigned to the entire treatment group. All data collection was performed using numeric of lineage-specific genes involved in mature neuron function. Our animal identifiers; animal genotype was later decoded and used for data analysis. observations, therefore, suggest that lamin B1 may play a broader Lmnb1fl mice contain Lmnb1 exon 2 flanked by lox sites, resulting in a null role in gene expression than has previously been appreciated. allele upon Cre-mediated recombination21 (Supplementary Fig. 1a). K5Cre mice 20 Gene association with the nuclear lamina can be rather contain a transgene for Cre recombinase under the Keratin 5 promoter . Within the olfactory epithelium, K5 expression is limited to the horizontal basal cells; dynamic, and several neuronal genes relocate to and from the however, K5 is abundant in the epidermis, yet Lmnb1 knockout does not produce nuclear lamina in correlation with changes in gene expression a phenotype in the epidermis21. Mice containing a Cre-dependent red fluorescent during differentiation or neuronal activation7–9,12. Lamin B1 reporter allele (RosatdTomato, R26Ai9) were obtained from Jackson Laboratories22. association with genomic loci is most frequently determined by P2-IRES-tauLacZ and M72-IRES-tauLacZ mice contain knock-in alleles of a fusion tau-LacZ downstream of an internal ribosome entry site following the coding identifying regions of the genome methylated by a lamin 33,34 Cre 66 sequence of the endogenous P2 or M72 odorant receptor gene . Omp mice B1-DNA adenine methyltransferase fusion protein (DamID) ; contain Cre recombinase knocked in at the endogenous Omp locus67. To reduce however, it is currently not feasible to perform DamID in the potential influence of strain background, all K5Cre, OmpCre, and Lmnb1fl mice olfactory sensory neurons due to the inability to culture them. were backcrossed to the B6 background for at least five generations. Expression of genes that associate with lamin B1 in several tissue 7 culture cells seems unaffected by Lmnb1 knockout in olfactory Stem cell activation through methimazole-induced damage. Mice 2–3 months sensory neurons (Supplementary Fig. 6k–n). Future technological of age were given two 50 mg per kg intraperitoneal injections of methimazole advances that allow for the global analysis of chromatin-lamin (Sigma M8506) three days apart28. Mice recovered 1–8 weeks after the second association during olfactory neuron differentiation will shed light injection before tissue collection (Supplementary Fig. 1C). on the whether lamin B1 affects locus-specific organization or some other aspect of genome organization during olfactory Antibody staining. All procedures were performed following standard protocol. sensory neuron differentiation. Mice were transcardially perfused with PBS followed by 4% paraformaldehyde Lastly, our examination of the olfactory epithelium revealed solution. Heads were postfixed in 4% paraformaldehyde, decalcified in 250 mM ° ° high expression of Lmnb1 in mature olfactory neurons, leading us EDTA PBS at 4 C over 3–6 days, cryoprotected in 30% sucrose PBS 4 C for 3–6 additional days, then frozen in Tissue-Tek O.C.T compound and stored at to wonder if lamin B1 plays a role in the maintenance of mature, À 20 °C until cryosectioning, except for lamin A/C staining, which was performed postmitiotic neurons of the olfactory epithelium. To address this on unfixed tissue sections that were post-fixed in methanol-acetone. 10 mm thick question, we attempted to use the OMP-Cre mouse line67 to sections were subjected to immunofluorescence following standard protocol. knockout Lmnb1 in mature olfactory sensory neurons (Supple- All antibodies and dilutions are described in Table 1. Slides were mounted in Fluoromount and imaged on a Leica Sp5 confocal microscope. Tomato signal is mentary Fig. 7). We observed clear evidence of recombination endogenous fluorescence. All control images are from littermates in the same of genomic DNA in the olfactory epithelium of the OMP-Cre- treatment group as the mutant animal. Reported cell death rate (cleaved caspase driven conditional Lmnb1 mutants (OmpCre/ þ ;Lmnb1fl/fl), but three positive cells per mm) for each animal (n) is an average of at least 15 fields of saw no changes in lamin B1 antibody staining in mutant olfactory view taken from similar olfactory regions; B10 mm of tissue was counted for each animal. Tissue thickness for a given animal (n) was determined using epithelium (Supplementary Fig. 7a–c). We further found no at least 10 fields of view; similar areas of epithelium were examined in each animal. difference in the number of OMP-positive mature neurons, tissue For lamin B1 knockout quantification, cells in the neuron layer of the olfactory thickness, cell death or proliferation in OMP-Cre-driven epithelium were counted as either positive or negative for lamin B1 antibody conditional Lmnb1 mutants (Supplementary Fig. 7d–g). We staining. All cells within a given field were counted. Olfactory epithelia were from K5Cre;Lmnb1fl/fl (mosaic mutant) and K5Cre;Lmnb1fl/ þ (mosaic control) did not observe any evidence of lamin B1 protein depletion in the littermate mice from the same treatment group. Data shown are from five sets of olfactory epithelium of OMP-Cre-driven knockout mice, even littermate mice; over 200 cells were counted for each mouse. after six months of age. The lack of lamin B1 protein depletion in The numbers of different cell types produced by control (Lmnb1 þ / À ) and OmpCre/ þ ;Lmnb1fl/fl olfactory epithelium could arise from mutant (Lmnb1 À / À ) horizontal basal cells were determined by the morphology inefficient recombination, despite the evidence of recombination and tissue stratification of Tomato positive cells within clones after tissue regeneration. Rectangular cells at the apical surface with basal nuclei were counted that we observed. Alternatively, lamin B1 protein may be very as sustentacular cells, tear shaped cells with processes that were located in the stable in postmitotic neurons, which is supported by several lines middle layer of the epithelium were counted as neurons, and rounded cells with no of evidence in the literature. First, a peptide-labelling screen obvious processes at the base of the epithelium were counted as progenitors. identified lamin B1 as one of the most stable proteins in neurons Bowman’s gland cells and other minor cell types were ignored in this analysis due 68 to their rarity. Per cent of cells considers only those cell types that were counted. of the adult brain . Another group has identified lamin B1 as fl/fl 52 Olfactory epithelia were from K5Cre;Lmnb1 (mosaic mutant) and a very stable protein in the retina . Second, to date, all published K5Cre;Lmnb1fl/ þ (mosaic control) mice. Data shown are from five sets of strategies to knock out Lmnb1 or Lmnb2 in vivo in mice have littermate mice; over 100 cells were counted for each mouse; images used in this been targeted to stem cells or other proliferative cell populations. study were also used in the lamin B1 knockout quantification described above. Employing this strategy, B-type lamin knockout has been Graphing and statistical analyses were performed in Prism 6. successful in the whole embryo4,53,56, keratinocytes of the 21 6 skin , progenitors of the forebrain , and stem cells in the Western blotting. All procedures were performed following standard protocol. olfactory epithelium (this study). Still, it remains unclear whether Whole olfactory mucosa was homogenized after mice were transcardially perfused the failure to deplete lamin B1 in mature olfactory neurons was with PBS. Protein estimations were performed using Pierce BCA Assay Kit (Life Technologies). Total protein of 25–50 mg was used for western blotting caused by lamin stability, incomplete recombination, or both. following standard protocol. Each sample (n) was taken from a single mouse; each Regardless the reason, lamin B1 protein was not depleted in the sample was tested for all proteins; littermate controls that were part of the same OmpCre/ þ ;Lmnb1fl/fl line, leaving the role of Lmnb1 in the treatment group were used for all mutant animals. Antibodies and dilutions are maintenance of mature, postmitotic neuron maintenance described in Table 1. Blots were developed using Perkin Elmer ECL Plus Lightning substrate (NEL105001EA), exposed to X-ray film and converted to scanned images. currently unclear. Relative protein abundance was determined by pixel intensity using ImageJ (NIH). Raw value for each band was normalized to beta actin for the same sample then reported relative to control average for each experimental group (littermates, same Methods blot). Group normalization was performed to allow for comparison across different Mice. Mice were housed in 12-h light/dark cycle with access to food and water ad time points and account for any differences due to age and treatment group. libitum. All procedures relating to mouse care and treatment were approved by and Western blot images have been cropped for presentation, but full size images performed in accordance with the guidelines of the Animal Care and Use Com- are presented in Supplementary Fig. 8 Graphing and statistical analyses were mittees of Johns Hopkins University and Monell Chemical Senses Center. Female performed in Prism 6.

10 NATURE COMMUNICATIONS | 8:15098 | DOI: 10.1038/ncomms15098 | www.nature.com/naturecommunications NATURE COMMUNICATIONS | DOI: 10.1038/ncomms15098 ARTICLE

Table 1 | Antibodies used in this study.

Antigen/reagent Dilution (WB) Dilution (IF) Dilution (ChIP) Source Provider Catalogue # or citation Sox2 NA 1:400 NA Goat Santa Cruz SC-17320 LSD1 NA 1:200 NA Rabbit Abcam ab17721 Lamin A/C NA 1:5 NA Mouse H. Herrmann Kolb Nucleus 2011 Lamin B Receptor NA 1:100 NA Guinea Pig H. Herrmann Hoffmann Nature Genetics 2002 Cleaved Caspase 3 NA 1:400 NA Rabbit Cell Signaling 9661s Phalloidin-AlexaFluor488 NA 1:400 NA NA Invitrogen A12379 mAb414 NA 1:100 NA Mouse Abcam ab24609 Lamin B1 1:2,000 1:200 NA Goat Santa Cruz SC-6216 OMP 1:10,000 1:1,000 NA Goat Wako 544-10001-WAKO GAP43 1:5,000 1:400 NA Rabbit Abcam ab137910 Lamin B2 1:2,500 1:100 NA Mouse Thermo-Fisher 33-2100 AC3 1:10,000 NA NA Rabbit Santa-Cruz SC-588 Beta Actin 1:5,000 NA NA Rabbit Cell Signaling 4970L H3K9me3 NA NA 1 mg ml À 1 Rabbit Abcam ab8898 H3K4me3 NA NA 0.5 mg ml À 1 Rabbit Cell Signaling 9751S

EdU labelling. All procedures were performed following standard protocol. (B10 U, Qiagen 79254) for 10 min at room temperature before being transferred Mice were injected IP with 500 ml of 12.5 mg ml À 1 EdU 24 h before tissue to a 1% FBS PBS solution. Single cells were isolated using a cell strainer and sorted collection. EdU visualization was performed using Click-IT EdU labelling kit using a FACS Aria II (BD Biosciences). Gating was optimized using cells from (Life Technologies C10337). Proliferation rate (EdU positive cells per mm) K5Cre;R26Ai9/ þ mice after methimazole-induced regeneration and nonfluorescent reported for a given animal (n) is an average of at least 12 fields of view. Fields of control. Sorted cells were used in RNA-seq and ChIP-seq experiments. view were taken from similar olfactory regions across animals. Approximately 6 mm of tissue was counted for each animal. Graphing and statistical analyses were performed in Prism 6. RNA sequencing and analysis. Approximately 150,000 to 600,000 Tomato- positive mutant or heterozygous olfactory epithelial cells were sorted from a single mouse for each sample. Data are based on two sets of age-, sex- and treatment- Whole mount X-gal staining. All procedures were performed following standard matched littermates (four samples from four mice, two groups). Libraries were protocol. Mice were perfused with PBS then exposed turbinates of bisected heads prepared using Illumina RNA Prep Kit 2 and sequenced, producing approximately were subjected to whole mount X-gal staining following standard protocol33. 50 million 50 bp reads per sample. For detailed description, please see Olfactory epithelia were imaged using a stereomicroscope under low magnification. Supplementary Methods. Values reported for each animal (n) represent the positive cells on turbinates as an average of left and right sides, except where tissue was damaged. Data collected for ChIP sequencing each of the two tagged odorant receptor alleles are from two independent cohorts . Approximately 500,000 Tomato-positive mutant or hetero- of animals. Graphing and statistical analyses were performed in Prism 6. zygous olfactory epithelial cells were sorted from a single mouse. Each sample was crosslinked, sonicated, split into two groups and subjected to ChIP with either anti- H3K9me3 or anti-H3K4me3 (Table 1). Data for H3K9me3 are based on two sets of Counting nuclear chromocenters. Number of DAPI-bright foci were counted for age-, sex- and treatment-matched littermates; data for H3K4me3 are based on cells in the neuronal layer of the olfactory epithelium by analysing confocal Z-stacks a single set. Libraries were prepared from precipitated DNA and sequenced, of DAPI stained 10 mm cryosections from mosaic mutant animals containing Tomato producing B50 million 50 bp reads per sample. For detailed description of reporter allele. Z stacks spanned 8 mm in Z direction. Nuclei were counted only if the analysis, please see Supplementary Methods. entire nucleus was included in Z stack. Over 150 cells were counted for each of four animals from three or more fields of view. All animals were K5Cre;Lmnb1fl/fl gen- qPCR RNA was extracted from olfactory mucosa using TRIzol (Life Technologies) otype. Graphing and statistical analyses were performed in Prism 6. . followed by DNase I digestion, according to the manufacturers’ protocols. cDNA was generated using the RETROscript Reverse Transcription Kit (Thermo Fisher Single cell electrophysiology. Responses of isolated olfactory sensory neurons Scientific) with Oligo dTs. Primer sequences can be found in Supplementary were recorded using the suction-pipette technique25. Briefly, the cell body of an Table 1. qPCR was performed on a StepOnePlus Real-Time PCR system isolated olfactory sensory neuron was gently sucked into the tip of the recording (Applied Biosystems) using Maxima SYBR green/ROX qPCR Master Mix Â 2 pipette so that the cilia remain exposed to the bath solution. The recorded current (Thermo Fisher Scientific). All reactions were performed in triplicate; Ct values (termed suction current), when filtered at DC—5,000 Hz ( À 3 dB, 8-pole Bessel were averaged for each gene in each sample. Results were analysed by the 2 filter) represents the slow transduction current which enters at the cilia with À DDCt method69 with normalization to the geometric mean of Actb, Gapdh and superimposed fast capacitive currents corresponding to action potential firing at Ubc70. For details, see Supplementary Methods. the onset of the current response. Fast solution changes and odorant exposures were achieved by transferring the tip of the recording pipette containing the neuron Data availability Raw sequencing data and count data is available through across the interface of neighbouring streams of solutions using the Perfusion . the following GEO accessions: GSE80044 for RNA-seq data and GSE80290 for Fast-Step solution changer (Warner Instrument Corporation). The receptor ChIP-seq data. In addition, all relevant data are available from the authors. current was isolated by filtering the suction current with a bandwidth of DC-50 Hz ( À 3 dB, 8-pole Bessel filter). The suction current was sampled at 10 kHz and recorded with a Warner PC-501A patch clamp amplifier, digitized using References Power1401 II A/D converter and Signal acquisition software (Cambridge 1. Kim, Y., McDole, K. & Zheng, Y. The function of lamins in the context of tissue Electronic Design, U.K.). building and maintenance. Nucleus 3, 256–262 (2012). Mammalian Ringer’s solution contained (in mM) 140 NaCl, 5 KCl, 1 MgCl2, 2. Gruenbaum, Y. & Foisner, R. Lamins: nuclear intermediate filament proteins 2CaCl2, 0.01 EDTA, 10 HEPES and 10 glucose. The pH was adjusted to 7.5 with with fundamental functions in nuclear mechanics and genome regulation. NaOH. Acetophenone and Cineole 1 mM stock solution in Ringer’s were prepared Annu. Rev. Biochem. 84, 131–164 (2015). and the odorant solutions at their final concentration were prepared daily. All 3. Dechat, T. et al. Nuclear lamins: major factors in the structural organization chemicals were purchased from Sigma-Aldrich. Fast solution changes and odorant and function of the nucleus and chromatin. Genes Dev. 22, 832–853 (2008). exposures were achieved by transferring the tip of the recording pipette containing 4. Kim, Y. et al. Mouse B-type lamins are required for proper organogenesis but the neuron across the interface of neighbouring streams of solutions using the not by embryonic stem cells. Science 334, 1706–1710 (2011). Perfusion Fast-Step solution changer (Warner Instrument Corporation). All 5. Amendola, M. & van Steensel, B. Nuclear lamins are not required for lamina- experiments were performed at 37 °C. associated domain organization in mouse embryonic stem cells. EMBO Rep. 16, 610–617 (2015). FACS sorting. Olfactory mucosa was dissected into sterile PBS, cut into small 6. Coffinier, C. et al. Deficiencies in lamin B1 and lamin B2 cause pieces and then digested in 10 U Papain in 2.5 mM Cystein per 0.5 mM EDTA neurodevelopmental defects and distinct nuclear shape abnormalities in PBS at 37 °C for 15 min. Samples were triturated and treated with DNaseI neurons. Mol. Biol. Cell 22, 4683–4693 (2011).

NATURE COMMUNICATIONS | 8:15098 | DOI: 10.1038/ncomms15098 | www.nature.com/naturecommunications 11 ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms15098

7. Peric-Hupkes, D. et al. Molecular maps of the reorganization of genome- 36. Guo, Z. et al. Expression of Pax6 and Sox2 in adult olfactory epithelium. nuclear lamina interactions during differentiation. Mol. Cell 38, 603–613 J. Comp. Neurol. 518, 4395–4418 (2010). (2010). 37. Nickell, M. D., Breheny, P., Stromberg, A. J. & McClintock, T. S. Genomics 8. Clowney, E. J. et al. Nuclear aggregation of olfactory receptor genes governs of mature and immature olfactory sensory neurons. J. Comp. Neurol. 520, their monogenic expression. Cell 151, 724–737 (2012). 2608–2629 (2012). 9. Kohwi, M., Lupton, J. R., Lai, S. L., Miller, M. R. & Doe, C. Q. Developmentally 38. Colquitt, B. M., Allen, W. E., Barnea, G. & Lomvardas, S. Alteration of genic regulated subnuclear genome reorganization restricts neural progenitor 5-hydroxymethylcytosine patterning in olfactory neurons correlates with competence in Drosophila. Cell 152, 97–108 (2013). changes in gene expression and cell identity. Proc. Natl Acad. Sci. USA 110, 10. Crepaldi, L. et al. Binding of TFIIIC to sine elements controls the relocation of 14682–14687 (2013). activity-dependent neuronal genes to transcription factories. PLoS Genet. 9, 39. Markenscoff-Papadimitriou, E. et al. Enhancer interaction networks as a means e1003699 (2013). for singular olfactory receptor expression. Cell 159, 543–557 (2014). 11. Dhar, S. S., Ongwijitwat, S. & Wong-Riley, M. T. Chromosome conformation 40. Magklara, A. et al. An epigenetic signature for monoallelic olfactory receptor capture of all 13 genomic loci in the transcriptional regulation of the expression. Cell 145, 555–570 (2011). multisubunit bigenomic cytochrome C oxidase in neurons. J. Biol. Chem. 284, 41. Roby, Y. A. et al. Zfp423/OAZ mutation reveals the importance of Olf/EBF 18644–18650 (2009). transcription activity in olfactory neuronal maturation. J. Neurosci. 32, 12. Williams, R. R. et al. Neural induction promotes large-scale chromatin 13679–13688a (2012). reorganisation of the Mash1 locus. J. Cell Sci. 119, 132–140 (2006). 42. Dalton, R. P., Lyons, D. B. & Lomvardas, S. Co-opting the unfolded 13. Wittmann, M. et al. Synaptic activity induces dramatic changes in the geometry protein response to elicit olfactory receptor feedback. Cell 155, 321–332 of the cell nucleus: interplay between nuclear structure, histone H3 ð2013Þ: phosphorylation, and nuclear calcium signaling. J. Neurosci. 29, 14687–14700 43. Lewcock, J. W. & Reed, R. R. A feedback mechanism regulates monoallelic (2009). odorant receptor expression. Proc. Natl Acad. Sci. USA 101, 1069–1074 (2004). 14. Walczak, A. et al. Novel higher-order epigenetic regulation of the Bdnf gene 44. Serizawa, S. et al. Negative feedback regulation ensures the one receptor-one upon seizures. J. Neurosci. 33, 2507–2511 (2013). olfactory neuron rule in mouse. Science 302, 2088–2094 (2003). 15. Kondo, K. et al. Age-related changes in cell dynamics of the postnatal mouse 45. Shykind, B. M. et al. Gene switching and the stability of odorant receptor gene olfactory neuroepithelium: cell proliferation, neuronal differentiation, and cell choice. Cell 117, 801–815 (2004). death. J. Comp. Neurol. 518, 1962–1975 (2010). 46. Lyons, D. B. et al. Heterochromatin-mediated gene silencing facilitates the 16. Leung, C. T., Coulombe, P. A. & Reed, R. R. Contribution of olfactory neural diversification of olfactory neurons. Cell Rep. 9, 884–892 (2014). stem cells to tissue maintenance and regeneration. Nat. Neurosci. 10, 720–726 47. Wang, S. Z., Ou, J., Zhu, L. J. & Green, M. R. Transcription factor ATF5 is (2007). required for terminal differentiation and survival of olfactory sensory neurons. 17. Schwob, J. E. Neural regeneration and the peripheral olfactory system. Anat. Proc. Natl Acad. Sci. USA 109, 18589–18594 (2012). Rec. 269, 33–49 (2002). 48. Lyons, D. B. et al. An epigenetic trap stabilizes singular olfactory receptor 18. Iwai, N., Zhou, Z., Roop, D. R. & Behringer, R. R. Horizontal basal cells are expression. Cell 154, 325–336 (2013). multipotent progenitors in normal and injured adult olfactory epithelium. Stem 49. Kolterud, A., Alenius, M., Carlsson, L. & Bohm, S. The Lim homeobox Cells 26, 1298–1306 (2008). gene Lhx2 is required for olfactory sensory neuron identity. Development 131, 19. Holbrook, E. H., Szumowski, K. E. & Schwob, J. E. An immunochemical, 5319–5326 (2004). ultrastructural, and developmental characterization of the horizontal basal cells 50. Monahan, K. & Lomvardas, S. Monoallelic expression of olfactory receptors. of rat olfactory epithelium. J. Comp. Neurol. 363, 129–146 (1995). Annu. Rev. Cell Dev. Biol. 31, 721–740 (2015). 20. Berton, T. R. et al. Tumor formation in mice with conditional inactivation of 51. Rodriguez, I. Singular expression of olfactory receptor genes. Cell 155, 274–277 Brca1 in epithelial tissues. Oncogene 22, 5415–5426 (2003). (2013). 21. Yang, S. H. et al. An absence of both lamin B1 and lamin B2 in keratinocytes 52. Razafsky, D. et al. Lamin B1 and lamin B2 are long-lived proteins with distinct has no effect on cell proliferation or the development of skin and hair. Hum. functions in retinal development. Mol. Biol. Cell 27, 1928–1937 (2016). Mol. Genet. 20, 3537–3544 (2011). 53. Coffinier, C. et al. Abnormal development of the cerebral cortex and cerebellum 22. Madisen, L. et al. A robust and high-throughput Cre reporting and in the setting of lamin B2 deficiency. Proc. Natl Acad. Sci. USA 107, 5076–5081 characterization system for the whole mouse brain. Nat. Neurosci. 13, 133–140 (2010). (2010). 54. Padiath, Q. S. et al. Lamin B1 duplications cause autosomal dominant 23. Caggiano, M., Kauer, J. S. & Hunter, D. D. Globose basal cells are neuronal leukodystrophy. Nat. Genet. 38, 1114–1123 (2006). progenitors in the olfactory epithelium: a lineage analysis using a replication- 55. Robinson, A. et al. Is LMNB1 a susceptibility gene for neural tube defects in incompetent retrovirus. Neuron 13, 339–352 (1994). humans? Birth Defects Res. A. Clin. Mol. Teratol. 97, 398–402 (2013). 24. Mackay-Sim, A. & Kittel, P. Cell dynamics in the adult mouse olfactory 56. Vergnes, L., Peterfy, M., Bergo, M. O., Young, S. G. & Reue, K. Lamin B1 is epithelium: a quantitative autoradiographic study. J. Neurosci. 11, 979–984 required for mouse development and nuclear integrity. Proc. Natl Acad. Sci. (1991). USA 101, 10428–10433 (2004). 25. Ponissery Saidu, S., Dibattista, M., Matthews, H. R. & Reisert, J. Odorant- 57. Guo, Y., Kim, Y., Shimi, T., Goldman, R. D. & Zheng, Y. Concentration- induced responses recorded from olfactory receptor neurons using the suction dependent lamin assembly and its roles in the localization of other nuclear pipette technique. J. Vis. Exp. 62, e3862 (2012). proteins. Mol. Biol. Cell 25, 1287–1297 (2014). 26. Yang, J. et al. Gating pluripotency via nuclear pores. Trends Mol. Med. 20, 1–7 58. Chen, H., Chen, X. & Zheng, Y. The nuclear lamina regulates germline stem cell (2014). niche organization via modulation of EGFR signaling. Cell Stem Cell 13, 73–86 27. Solovei, I. et al. LBR and lamin A/C sequentially tether peripheral (2013). heterochromatin and inversely regulate differentiation. Cell 152, 584–598 59. Guo, Y. & Zheng, Y. Lamins position the nuclear pores and centrosomes by (2013). modulating dynein. Mol. Biol. Cell 26, 3379–3389 (2015). 28. Booker-Dwyer, T., Hirsh, S. & Zhao, H. A unique cell population in the mouse 60. Lee, J. M. et al. Reciprocal knock-in mice to investigate the functional olfactory bulb displays nuclear beta-catenin signaling during development and redundancy of lamin B1 and lamin B2. Mol. Biol. Cell 25, 1666–1675 olfactory sensory neuron regeneration. Dev. Neurobiol. 68, 859–869 (2008). ð2014Þ: 29. Saito, H., Mimmack, M., Kishimoto, J., Keverne, E. B. & Emson, P. C. 61. Ibarra, A., Benner, C., Tyagi, S., Cool, J. & Hetzer, M. W. Nucleoporin- Expression of olfactory receptors, G-proteins and AxCAMs during the mediated regulation of cell identity genes. Genes Dev. 30, 2253–2258 (2016). development and maturation of olfactory sensory neurons in the mouse. Brain 62. Giacomini, C., Mahajani, S., Ruffilli, R., Marotta, R. & Gasparini, L. Lamin B1 Res. Dev. Brain Res. 110, 69–81 (1998). protein is required for dendrite development in primary mouse cortical 30. Chess, A., Simon, I., Cedar, H. & Axel, R. Allelic inactivation regulates olfactory neurons. Mol. Biol. Cell 27, 35–47 (2016). receptor gene expression. Cell 78, 823–834 (1994). 63. Reddy, K. L., Zullo, J. M., Bertolino, E. & Singh, H. Transcriptional repression 31. Buck, L. & Axel, R. A novel multigene family may encode odorant receptors: mediated by repositioning of genes to the nuclear lamina. Nature 452, 243–247 a molecular basis for odor recognition. Cell 65, 175–187 (1991). (2008). 32. Zhang, X. & Firestein, S. Genomics of olfactory receptors. Results Probl. Cell 64. Zullo, J. M. et al. DNA sequence-dependent compartmentalization and Differ. 47, 25–36 (2009). silencing of chromatin at the nuclear lamina. Cell 149, 1474–1487 (2012). 33. Mombaerts, P. et al. Visualizing an olfactory sensory map. Cell 87, 675–686 65. Yoon, K. H. et al. Olfactory receptor genes expressed in distinct lineages are (1996). sequestered in different nuclear compartments. Proc. Natl Acad. Sci. USA 112, 34. Feinstein, P. & Mombaerts, P. A contextual model for axonal sorting into E2403–E2409 (2015). glomeruli in the mouse olfactory system. Cell 117, 817–831 (2004). 66. Vogel, M. J., Peric-Hupkes, D. & van Steensel, B. Detection of in vivo protein- 35. Zheng, X. et al. Low-cell-number epigenome profiling aids the study of lens DNA interactions using DamID in mammalian cells. Nat. Protoc. 2, 1467–1478 aging and hematopoiesis. Cell Rep. 13, 1505–1518 (2015). (2007).

12 NATURE COMMUNICATIONS | 8:15098 | DOI: 10.1038/ncomms15098 | www.nature.com/naturecommunications NATURE COMMUNICATIONS | DOI: 10.1038/ncomms15098 ARTICLE

fl 67. Li, J., Ishii, T., Feinstein, P. & Mombaerts, P. Odorant receptor gene choice is sequence analysis. S.G.Y. provided Lmnb1 mice. M.D., X.Z., S.Y., J.R. and S.G.Y. reset by nuclear transfer from mouse olfactory sensory neurons. Nature 428, commented on the manuscript. 393–399 (2004). 68. Toyama, B. H. et al. Identification of long-lived proteins reveals exceptional stability of essential cellular structures. Cell 154, 971–982 (2013). Additional information 69. Livak, K. J. & Schmittgen, T. D. Analysis of relative gene expression data using Supplementary Information accompanies this paper at http://www.nature.com/ -DD real-time quantitative PCR and the 2 CT method. Methods 25, 402–408 naturecommunications (2001). 70. Vandesompele, J. et al. Accurate normalization of real-time quantitative Competing interests: The authors declare no competing financial interests. RT-PCR data by geometric averaging of multiple internal control genes. Reprints and permission information is available online at http://npg.nature.com/ Genome Biol. 3, research0034.1-0034.11 (2002). reprintsandpermissions/

Acknowledgements How to cite this article: Gigante, C. M. et al. Lamin B1 is required for mature We thank Y. Guo and L. Hugendubler for help with flow cytometry and F. Tan and neuron-specific gene expression during olfactory sensory neuron differentiation. A. Pinder for help with sequencing and analysis. We are thankful to H. Herrmann for the Nat. Commun. 8, 15098 doi: 10.1038/ncomms15098 (2017). Lamin A/C and Lamin B Receptor antibodies. We thank R. Johnston, X. Chen, R. Kuruvilla and S. Hattar for critical discussion. We also thank members of the Zhao, Publisher’s note: Springer Nature remains neutral with regard to jurisdictional claims in Zheng, Hattar and Kuruvilla labs for suggestions and discussion. This work was published maps and institutional affiliations. supported by NIH grants DC007395 (H.Z.), GM056312 (Y.Z.), GM110151 (Y.Z.), AG035626 (S.G.Y.) and G20OD020296 (infrastructure improvement at the Monell This work is licensed under a Creative Commons Attribution 4.0 Chemical Senses Center) and Ellison Medical Foundation (Y.Z.). C.M.G., F.N.D., X.Y. International License. The images or other third party material in this were partially supported by NIH training grant T32GM007231. article are included in the article’s Creative Commons license, unless indicated otherwise in the credit line; if the material is not included under the Creative Commons license, Author contributions users will need to obtain permission from the license holder to reproduce the material. C.M.G., Y.Z. and H.Z. designed experiments and wrote the manuscript. C.M.G. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/ performed all experiments and analyses except electrophysiology, qPCR, and ChIP-seq analysis. M.D. and J.R. performed electrophysiological experiments and analyses. F.N.D. performed qPCR experiments and analysis. S.Y. aided in ChIP. X.Z. performed ChIP-seq r The Author(s) 2017

NATURE COMMUNICATIONS | 8:15098 | DOI: 10.1038/ncomms15098 | www.nature.com/naturecommunications 13

Bibliography

1. Koshland, D. E. The Seven Pillars of Life. Science 295, 2215–2216 (2002).

2. Agarwal, A., Mulgund, A., Hamada, A. & Chyatte, M. R. A unique view on male infertility

around the globe. Reprod. Biol. Endocrinol. RBE 13, (2015).

3. de Meeûs, T., Prugnolle, F. & Agnew, P. Asexual reproduction: Genetics and evolutionary

aspects. Cell. Mol. Life Sci. 64, 1355–1372 (2007).

4. Kearney, M. R. Why is sex so unpopular in the Australian desert? Trends Ecol. Evol. 18, 605–

607 (2003).

5. Schaefer, I. et al. No evidence for the ‘Meselson effect’ in parthenogenetic oribatid mites

(Oribatida, Acari). J. Evol. Biol. 19, 184–193 (2006).

6. Hurst, L. D. & Peck, J. R. Recent advances in understanding of the evolution and

maintenance of sex. Trends Ecol. Evol. 11, 46–52 (1996).

7. Hamilton, W. D., Axelrod, R. & Tanese, R. Sexual reproduction as an adaptation to resist

parasites (a review). Proc. Natl. Acad. Sci. 87, 3566–3573 (1990).

8. Lively, C. M. A Review of Red Queen Models for the Persistence of Obligate Sexual

Reproduction. J. Hered. 101, S13–S20 (2010).

9. Meirmans, S., Meirmans, P. G. & Kirkendall, L. R. The Costs Of Sex: Facing Real-world

Complexities. Q. Rev. Biol. 87, 19–40 (2012).

10. Otto, S. P. The Evolutionary Enigma of Sex. Am. Nat. 174, S1–S14 (2009).

11. Otto, S. P. & Lenormand, T. Evolution of sex: Resolving the paradox of sex and

recombination. Nat. Rev. Genet. 3, 252–261 (2002).

114 12. Meirmans, S. The Evolution of the Problem of Sex. in Lost Sex: The Evolutionary Biology of

Parthenogenesis (eds. Schön, I., Martens, K. & Dijk, P.) 21–46 (Springer Netherlands,

2009). doi:10.1007/978-90-481-2770-2_2

13. Hosken, Dave Birkhead, Tim R. & Pitnick, Scott. Sperm Biology. (Academic Press, 2008).

14. Kamei, N. & Glabe, C. G. The species-specific egg receptor for sea urchin sperm adhesion is

EBR1,a novel ADAMTS protein. Genes Dev. 17, 2502–2507 (2003).

15. Inoue, N., Ikawa, M., Isotani, A. & Okabe, M. The immunoglobulin superfamily protein

Izumo is required for sperm to fuse with eggs. Nature 434, 234–238 (2005).

16. Baccetti, B. Evolution of the spermatozoon. Bolletino Zool. 51, 25–33 (1984).

17. França, L. R., Hess, R. A., Dufour, J. M., Hofmann, M. C. & Griswold, M. D. The Sertoli cell:

one hundred fifty years of beauty and plasticity. Andrology 4, 189–212 (2016).

18. Alvin M. Matsumoto, W. J. B. Chapter 19 - Testicular Disorders. in Williams Textbook of

Endocrinology 91 (Elsevier, 2015).

19. Kopera, I. A., Bilinska, B., Cheng, C. Y. & Mruk, D. D. Sertoli–germ cell junctions in the testis:

a review of recent data. Philos. Trans. R. Soc. B Biol. Sci. 365, 1593–1605 (2010).

20. Tagelenbosch, R. A. J. & de Rooij, D. G. A quantitative study of spermatogonial

multiplication and stem cell renewal in the C3H/101 F1 hybrid mouse. Mutat. Res. Mol.

Mech. Mutagen. 290, 193–200 (1993).

21. Phillips, B. T., Gassei, K. & Orwig, K. E. Spermatogonial stem cell regulation and

spermatogenesis. Philos. Trans. R. Soc. B Biol. Sci. 365, 1663–1678 (2010).

22. Ahmed, E. & de Rooij, D. Staging of Mouse Seminiferous Tubule Cross-Sections. in Meiosis

(ed. Keeney, S.) 263–277 (Humana Press, 2009). doi:10.1007/978-1-60761-103-5_16

115 23. Griswold, M. D. Spermatogenesis: The Commitment to Meiosis. Physiol. Rev. 96, 1–17

(2015).

24. Sada, A., Suzuki, A., Suzuki, H. & Saga, Y. The RNA-binding protein NANOS2 is required to

maintain murine spermatogonial stem cells. Science 325, 1394–1398 (2009).

25. Jan, S. Z. et al. Molecular control of rodent spermatogenesis. Biochim. Biophys. Acta BBA -

Mol. Basis Dis. 1822, 1838–1850 (2012).

26. O’Donnell, L. Mechanisms of spermiogenesis and spermiation and how they are disturbed.

Spermatogenesis 4, e979623 (2014).

27. Agustin, J. T. S., Pazour, G. J. & Witman, G. B. Intraflagellar transport is essential for

mammalian spermiogenesis but is absent in mature sperm. Mol. Biol. Cell 26, 4358–4372

(2015).

28. Escudier, E., Duquesnoy, P., Papon, J. F. & Amselem, S. Ciliary defects and genetics of

primary ciliary dyskinesia. Paediatr. Respir. Rev. 10, 51–54 (2009).

29. Lehti, M. S. & Sironen, A. Formation and function of the manchette and flagellum during

spermatogenesis. Reproduction 151, R43–R54 (2016).

30. Donkor, F. F., Mönnich, M., Czirr, E., Hollemann, T. & Hoyer-Fender, S. Outer dense fibre

protein 2 (ODF2) is a self-interacting centrosomal protein with affinity for microtubules. J.

Cell Sci. 117, 4643–4651 (2004).

31. Zhang, Z. et al. MEIG1 is essential for spermiogenesis in mice. Proc. Natl. Acad. Sci. 106,

17055–17060 (2009).

32. Sironen, A. et al. Loss of SPEF2 Function in Mice Results in Spermatogenesis Defects and

Primary Ciliary Dyskinesia. Biol. Reprod. 85, 690–701 (2011).

116 33. Irvine, D. S. Epidemiology and aetiology of male infertility. Hum. Reprod. 13, 33–44 (1998).

34. Eaton, M. et al. Seven-year follow-up of workers exposed to 1,2-dibromo-3-chloropropane.

J. Occup. Med. Off. Publ. Ind. Med. Assoc. 28, 1145–1150 (1986).

35. Jamalan, M., Ghaffari, M. A., Hoseinzadeh, P., Hashemitabar, M. & Zeinali, M. Human

Sperm Quality and Metal Toxicants: Protective Effects of some Flavonoids on Male

Reproductive Function. Int. J. Fertil. Steril. 10, 215–223 (2016).

36. Boekelheide, K. Mechanisms of Toxic Damage to Spermatogenesis. JNCI Monogr. 2005, 6–8

(2005).

37. Winters, B. R. & Walsh, T. J. The Epidemiology of Male Infertility. Urol. Clin. North Am. 41,

195–204 (2014).

38. Sharlip, I. D. et al. Best practice policies for male infertility. Fertil. Steril. 77, 873–882 (2002).

39. Zorrilla, M. & Yatsenko, A. N. The Genetics of Infertility: Current Status of the Field. Curr.

Genet. Med. Rep. 1, (2013).

40. Ray, P. F. et al. Genetic abnormalities leading to qualitative defects of sperm morphology or

function. Clin. Genet. 91, 217–232 (2017).

41. Mitchell, M. J. et al. Single gene defects leading to sperm quantitative anomalies. Clin.

Genet. 91, 208–216 (2017).

42. de Boer, P., de Vries, M. & Ramos, L. A mutation study of sperm head shape and motility in

the mouse: lessons for the clinic. Andrology (2014). doi:10.1111/andr.300

43. Coutton, C., Escoffier, J., Martinez, G., Arnoult, C. & Ray, P. F. Teratozoospermia: spotlight

on the main genetic actors in the human. Hum. Reprod. Update 21, 455–485 (2015).

117 44. Ben Khelifa, M. et al. Mutations in DNAH1, which encodes an inner arm heavy chain dynein,

lead to male infertility from multiple morphological abnormalities of the sperm flagella.

Am. J. Hum. Genet. 94, 95–104 (2014).

45. Amiri-Yekta, A. et al. Whole-exome sequencing of familial cases of multiple morphological

abnormalities of the sperm flagella (MMAF) reveals new DNAH1 mutations. Hum. Reprod.

Oxf. Engl. 31, 2872–2880 (2016).

46. Sha, Y. et al. DNAH1 gene mutations and their potential association with dysplasia of the

sperm fibrous sheath and infertility in the Han Chinese population. Fertil. Steril. 107, 1312-

1318.e2 (2017).

47. Tang, S. et al. Biallelic Mutations in CFAP43 and CFAP44 Cause Male Infertility with Multiple

Morphological Abnormalities of the Sperm Flagella. Am. J. Hum. Genet. 100, 854–864

(2017).

48. Wang, X. et al. Homozygous DNAH1 frameshift mutation causes multiple morphological

anomalies of the sperm flagella in Chinese. Clin. Genet. (2016). doi:10.1111/cge.12857

49. Coutton, C. et al. Mutations in CFAP43 and CFAP44 cause male infertility and flagellum

defects in Trypanosoma and human. Nature Communications in press (2018).

50. Ivliev, A. E., ’t Hoen, P. A. C., van Roon-Mom, W. M. C., Peters, D. J. M. & Sergeeva, M. G.

Exploring the transcriptome of ciliated cells using in silico dissection of human tissues. PloS

One 7, e35618 (2012).

51. Magnoni, R. et al. The Hsp60 folding machinery is crucial for manganese superoxide

dismutase folding and function. Free Radic. Res. 48, 168–179 (2014).

118 52. Sapiro, R. et al. Sperm antigen 6 is the murine homologue of the Chlamydomonas

reinhardtii central apparatus protein encoded by the PF16 locus. Biol. Reprod. 62, 511–518

(2000).

53. Sironen, A. et al. Loss of SPEF2 function in mice results in spermatogenesis defects and

primary ciliary dyskinesia. Biol. Reprod. 85, 690–701 (2011).

54. Lehti, M. S., Zhang, F.-P., Kotaja, N. & Sironen, A. SPEF2 functions in microtubule-mediated

transport in elongating spermatids to ensure proper male germ cell differentiation. Dev.

Camb. Engl. 144, 2683–2693 (2017).

55. Wu, C., Macleod, I. & Su, A. I. BioGPS and MyGene.info: organizing online, gene-centric

information. Nucleic Acids Res. 41, D561-565 (2013).

56. Margolin, G., Khil, P. P., Kim, J., Bellani, M. A. & Camerini-Otero, R. D. Integrated

transcriptome analysis of mouse spermatogenesis. BMC Genomics 15, 39 (2014).

57. da Cruz, I. et al. Transcriptome analysis of highly purified mouse spermatogenic cell

populations: gene expression signatures switch from meiotic-to postmeiotic-related

processes at pachytene stage. BMC Genomics 17, 294 (2016).

58. Talaga, A. K., Dong, F. N., Reisert, J. & Zhao, H. Cilia- and Flagella-Associated Protein 69

Regulates Olfactory Transduction Kinetics in Mice. J. Neurosci. Off. J. Soc. Neurosci. 37,

5699–5710 (2017).

59. Björkgren, I. et al. Dicer1 ablation in the mouse epididymis causes dedifferentiation of the

epithelium and imbalance in sex steroid signaling. PloS One 7, e38457 (2012).

119 60. Merkwitz, C., Blaschuk, O., Schulz, A. & Ricken, A. M. Comments on Methods to Suppress

Endogenous β-Galactosidase Activity in Mouse Tissues Expressing the LacZ Reporter Gene.

J. Histochem. Cytochem. Off. J. Histochem. Soc. 64, 579–586 (2016).

61. Fawcett, D. W. The mammalian spermatozoon. Dev. Biol. 44, 394–436 (1975).

62. Tewari, R., Bailes, E., Bunting, K. A. & Coates, J. C. Armadillo-repeat protein functions:

questions for little creatures. Trends Cell Biol. 20, 470–481 (2010).

63. Lee, L. Mechanisms of mammalian ciliary motility: Insights from primary ciliary dyskinesia

genetics. Gene 473, 57–66 (2011).

64. Pazour, G. J., Agrin, N., Leszyk, J. & Witman, G. B. Proteomic analysis of a eukaryotic cilium.

J. Cell Biol. 170, 103–113 (2005).

65. Yang, P. et al. Radial spoke proteins of Chlamydomonas flagella. J. Cell Sci. 119, 1165–1174

(2006).

66. Lehti, M. S. & Sironen, A. Formation and function of the manchette and flagellum during

spermatogenesis. Reprod. Camb. Engl. 151, R43-54 (2016).

67. Zhang, Z. et al. Intraflagellar transport protein IFT20 is essential for male fertility and

spermiogenesis in mice. Mol. Biol. Cell (2016). doi:10.1091/mbc.E16-05-0318

68. San Agustin, J. T., Pazour, G. J. & Witman, G. B. Intraflagellar transport is essential for

mammalian spermiogenesis but is absent in mature sperm. Mol. Biol. Cell 26, 4358–4372

(2015).

69. Liu, H. et al. IFT25, an intraflagellar transporter protein dispensable for ciliogenesis in

somatic cells, is essential for sperm flagella formation. Biol. Reprod. 96, 993–1006 (2017).

120 70. Sironen, A. et al. Expression of SPEF2 during mouse spermatogenesis and identification of

IFT20 as an interacting protein. Biol. Reprod. 82, 580–590 (2010).

71. Sironen, A., Thomsen, B., Andersson, M., Ahola, V. & Vilkki, J. An intronic insertion in KPL2

results in aberrant splicing and causes the immotile short-tail sperm defect in the pig.

Proc. Natl. Acad. Sci. U. S. A. 103, 5006–5011 (2006).

72. Farwell, K. D. et al. Enhanced utility of family-centered diagnostic exome sequencing with

inheritance model-based analysis: results from 500 unselected families with undiagnosed

genetic conditions. Genet. Med. Off. J. Am. Coll. Med. Genet. 17, 578–586 (2015).

73. Fogel, B. L., Lee, H., Strom, S. P., Deignan, J. L. & Nelson, S. F. Clinical exome sequencing in

neurogenetic and neuropsychiatric disorders. Ann. N. Y. Acad. Sci. 1366, 49–60 (2016).

74. Matzuk, M. M. & Lamb, D. J. The biology of infertility: research advances and clinical

challenges. Nat. Med. 14, 1197–1213 (2008).

75. Wang, Y. et al. Variability in the morphologic assessment of human sperm: use of the strict

criteria recommended by the World Health Organization in 2010. Fertil. Steril. (2014).

doi:10.1016/j.fertnstert.2013.12.047

76. Livak, K. J. & Schmittgen, T. D. Analysis of relative gene expression data using real-time

quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods San Diego Calif 25, 402–

408 (2001).

77. Skarnes, W. C. et al. A conditional knockout resource for the genome-wide study of mouse

gene function. Nature 474, 337–342 (2011).

78. Levitsky, K. L., Toledo-Aral, J. J., López-Barneo, J. & Villadiego, J. Direct confocal acquisition

of fluorescence from X-gal staining on thick tissue sections. Sci. Rep. 3, 2937 (2013).

121 79. SEQC/MAQC-III Consortium. A comprehensive assessment of RNA-seq accuracy,

reproducibility and information content by the Sequencing Quality Control Consortium.

Nat. Biotechnol. 32, 903–914 (2014).

80. 1000 Genomes Project Consortium et al. An integrated map of genetic variation from 1,092

human genomes. Nature 491, 56–65 (2012).

81. Lek, M. et al. Analysis of protein-coding genetic variation in 60,706 humans. Nature 536,

285–291 (2016).

82. McLaren, W. et al. The Ensembl Variant Effect Predictor. Genome Biol. 17, 122 (2016).

83. Kumar, P., Henikoff, S. & Ng, P. C. Predicting the effects of coding non-synonymous variants

on protein function using the SIFT algorithm. Nat. Protoc. 4, 1073–1081 (2009).

84. Adzhubei, I. A. et al. A method and server for predicting damaging missense mutations. Nat.

Methods 7, 248–249 (2010).

85. Yuan, S. et al. Spata6 is required for normal assembly of the sperm connecting piece and

tight head–tail conjunction. Proc. Natl. Acad. Sci. 112, E430–E439 (2015).

86. Kierszenbaum, A. L. Spermatid manchette: Plugging proteins to zero into the sperm tail.

Mol. Reprod. Dev. 59, 347–349 (2001).

87. Kierszenbaum, A. L. Intramanchette transport (IMT): Managing the making of the spermatid

head, centrosome, and tail. Mol. Reprod. Dev. 63, 1–4 (2002).

88. Zhou, J. et al. RIM-BP3 is a manchette-associated protein essential for spermiogenesis.

Development 136, 373–382 (2009).

89. Li, W. et al. A MEIG1/PACRG complex in the manchette is essential for building the sperm

flagella. Development 142, 921–930 (2015).

122 90. Li, R.-K. et al. Iqcg Is Essential for Sperm Flagellum Formation in Mice. PLOS ONE 9, e98053

(2014).

91. Kelley, L. A., Mezulis, S., Yates, C. M., Wass, M. N. & Sternberg, M. J. E. The Phyre2 web

portal for protein modeling, prediction and analysis. Nat. Protoc. 10, 845–858 (2015).

92. Morishita, E. C. et al. Crystal Structures of the Armadillo Repeat Domain of Adenomatous

Polyposis Coli and Its Complex with the Tyrosine-Rich Domain of Sam68. Structure 19,

1496–1508 (2011).

93. Choi, H.-J., Gross, J. C., Pokutta, S. & Weis, W. I. Interactions of Plakoglobin and β-Catenin

with Desmosomal Cadherins BASIS OF SELECTIVE EXCLUSION OF α- AND β-CATENIN FROM

DESMOSOMES. J. Biol. Chem. 284, 31776–31788 (2009).

94. de Marco, A., Vigh, L., Diamant, S. & Goloubinoff, P. Native folding of aggregation-prone

recombinant proteins in Escherichia coli by osmolytes, plasmid- or benzyl alcohol–

overexpressed molecular chaperones. Cell Stress Chaperones 10, 329–339 (2005).

95. de Marco, A. Protocol for preparing proteins with improved solubility by co-expressing with

molecular chaperones in Escherichia coli. Nat. Protoc. 2, 2632–2639 (2007).

96. Mellacheruvu, D. et al. The CRAPome: a Contaminant Repository for Affinity Purification

Mass Spectrometry Data. Nat. Methods 10, 730–736 (2013).

97. Ramsby, M. L. & Makowski, G. S. Differential Detergent Fractionation of Eukaryotic Cells. in

2-D Proteome Analysis Protocols 53–66 (Humana Press, 1999). doi:10.1385/1-59259-584-

7:53

98. Sapiro, R. et al. Male Infertility, Impaired Sperm Motility, and Hydrocephalus in Mice

Deficient in Sperm-Associated Antigen 6. Mol. Cell. Biol. 22, 6298–6305 (2002).

123 99. Onoufriadis, A. et al. Combined exome and whole-genome sequencing identifies mutations

in ARMC4 as a cause of primary ciliary dyskinesia with defects in the outer dynein arm. J.

Med. Genet. 51, 61–67 (2014).

100. Mruk, D. D. & Cheng, C. Y. Desmosomes in the testis. Spermatogenesis 1, 47–51 (2011).

101. Hung, V. et al. Spatially resolved proteomic mapping in living cells with the engineered

peroxidase APEX2. Nat. Protoc. 11, 456–475 (2016).

102. Kim, D. I. et al. An improved smaller biotin ligase for BioID proximity labeling. Mol. Biol.

Cell mbc.E15-12-0844 (2016). doi:10.1091/mbc.E15-12-0844

103. Wambergue, C. et al. Patients with multiple morphological abnormalities of the sperm

flagella due to DNAH1 mutations have a good prognosis following intracytoplasmic sperm

injection. Hum. Reprod. 31, 1164–1172 (2016).

104. Coutton, C., Escoffier, J., Martinez, G., Arnoult, C. & Ray, P. F. Teratozoospermia: spotlight

on the main genetic actors in the human. Hum. Reprod. Update 21, 455–485 (2015).

105. He, X. et al. Novel homozygous CFAP69 mutations in humans and mice cause severe

asthenoteratospermia with multiple morphological abnormalities of the sperm flagella. J.

Med. Genet. jmedgenet-2018-105486 (2018). doi:10.1136/jmedgenet-2018-105486

106. Satish Tammana, T. V., Tammana, D., Diener, D. R. & Rosenbaum, J. Centrosomal protein

CEP104 (Chlamydomonas FAP256) moves to the ciliary tip during ciliary assembly. J. Cell

Sci. 126, 5018–5029 (2013).

124

Frederick Naison Dong 2914 Cresmont Avenue | Baltimore, MD 21211 [email protected] | (678) 628-9295 EDUCATION Johns Hopkins University (Baltimore, MD) 2018 Ph.D. in Biology

Cornell University, College of Arts and Sciences (Ithaca, NY) 2014 B.A. in Biological Sciences, cum laude; B.A. in Music RESEARCH EXPERIENCE Johns Hopkins University Ph.D. Candidate (Advisor: Dr. Haiqing Zhao) 2015 – present • Established a new line of research in male reproductive biology in a chemical senses laboratory to enable investigation of a gene expressed in both systems. - Discovered CFAP69 is necessary for male mouse fertility using a knockout mouse model. - Currently investigating the mechanism of CFAP69 fuonction by proximity proteomics. - Determined CFAP69 is required for human male fertility in collaboration with Dr. Charles Coutton. - Published a joint first-author research article detailing the role of CFAP69 in spermatogenesis. • Helped identify CFAP69 as the first protein to slow down instead of speed up olfactory transduction kinetics. • Helped determine lamin B1 is required for normal olfactory sensory neuron differentiation in adult mice. Cornell University Honors Thesis Candidate (Advisor: Dr. Robin Davisson) 2012 – 2014 • Discovered a correlation between brain oxidative stress and hypertension in mice. - Composed an undergraduate thesis earning honors at graduation. - Co-authored a research article on stresses in the brain and the development of hypertension. • Investigated brain endoplasmic reticulum stress as a risk factor for non-alcoholic fatty liver disease in mice. Research Assistant (Advisor: Dr. Wojciech Pawlowski) 2012 • Investigated the existence of meiotic crossover homeostasis in a maize mutant strain with reduced double strand break frequency during meiosis. Emory University Research Assistant (Advisor: Dr. Xiaodong Sun) Summer 2011 • Investigated the effect of cytoplasmic translocation of the nuclear tumor suppressor ATBF1 on the morphology and proliferation of a prostate cancer cell line.

125 TEACHING AND VOLUNTEERING Johns Hopkins University Research Mentor 2015 – present • Mentor in BioREU program for students with limited research opportunities. - Guided an undergraduate from the U.S. Virgin Islands through formulating questions and designing experiments to address the expression pattern of an essential gene in the male reproductive system • Mentor for undergraduate research assistants - Led 2 undergraduates in purification and study of an essential male fertility protein - Trained students to formulate and test research hypotheses. - Delegated research tasks according to prior experience, providing training when needed. - Contributed to group presentations of results to the Johns Hopkins research community. TEACHING AND VOLUNTEERING (CONT’D) Johns Hopkins University Teaching Assistant 2015 – present • Courses: Introduction to the Human Brain, Genetics, Developmental Biology Lab, Genetics Lab - Designed, led, and troubleshot undergraduate practical lab classes - Held office hours and review sessions LABORATORY AND TECHNICAL EXPERTISE • Cell culture, transfection, and virus production • Molecular biology and cloning • Light, fluorescence, and electron microscopy • Recombinant protein expression and purification • Next-generation sequencing analysis • Mouse husbandry and survival surgery AWARDS AND HONORS • David S. Bruce Outstanding Undergraduate Research Abstract Award Recipient 2014 • Phi Beta Kappa Honor Society Member 2014 • Cornell University Tanner Dean Scholar 2010 – 2014 - ~30 undergraduates showing outstanding intellectual potential selected annually • Cornell Asian Alumni Association Scholarship Recipient 2013 • Annual Ellen Gussman Adelson Prize Recipient for outstanding solo piano performance 2012 - Awarded to one student annually • Louie Scholar, Kim and Harold Louie Family Foundation 2010 PUBLICATIONS AND PRESENTATIONS Peer-reviewed Research Articles • Dong FN, Amiri-Yekta A, Martinez G et al. (2018). Absence of CFAP69 causes male infertility due to multiple morphological abnormalities of the flagella in human and mouse. American Journal of Human Genetics.

126 • Talaga AK, Dong FN, Reisert J, and Zhao H. (2017). Cilia- and flagella-associated protein 69 regulates olfactory transduction kinetics in mice. Journal of Neuroscience • Gigante CM, Dibattista M, Dong FN, Zheng X, et al. (2017). Lamin B1 is required for mature neuron-specific gene expression during olfactory sensory neuron differentiation. Nature Communications. • Young CN, Li A, Dong FN, Horwath JA, Clark CG, Davisson RL. (2015). Endoplasmic reticulum and oxidant stress mediate nuclear-factor-κB activation in the subfornical organ during angiotensin II hypertension. American Journal of Physiology – Cell Physiology • Sun X, Li J, Dong FN & Dong JT. (2014). Characterization of nuclear localization and SUMOylation of the ATBF1 transcription factor in epithelial cells. Plos One. Abstracts • Dong FN, Young CN, Davisson RL. (2014). Early surge in oxidative stress in the brain subfornical organ during angiotensin-II-induced hypertension. FASEB J. • Horwath JA, Dong FN, Butler SD, Mark AL, Davisson RL, Young CN. (2014). Brain endoplasmic reticulum stress mediates the development of non-alcoholic fatty liver disease. Hypertension Conference Presentations • Dong FN and Zhao H. CFAP69 is required for sperm head and flagellum development in mice. Presented at the American Society of Andrology Testis Workshop 2017, Miami, FL. • Dong FN, Young CN, and Davisson RL. Interaction between oxidative and endoplasmic reticulum stress in the brain subfornical organ during angiotensin-II-induced hypertension. Presented at Experimental Biology 2014, San Diego, CA.

127