Int.J.Curr.Microbiol.App.Sci (2017) 6(11): 2837-2844

International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 6 Number 11 (2017) pp. 2837-2844 Journal homepage: http://www.ijcmas.com

Original Research Article https://doi.org/10.20546/ijcmas.2017.611.335

Molecular Identification and Characterization of Virus Associated with Murda Complex Disease in Chilli (Cv. Byadgi Dabbi)

M. Abdul Kareem* and A.S. Byadgi

Department of Plant Pathology, University of Agricultural Sciences, Dharwad - 580 005, Karnataka, India *Corresponding author

ABSTRACT

Chilli (Capsicum annuum L.) is an important crop grown worldwide for its use as spice K e yw or ds and vegetable. Murda complex is the most destructive syndrome causing substantial economic losses in chilli production. Severe leaf curling, leaf distortion, vein banding, Chilli, Murda reduced leaf size and stunted growth are typical symptoms of the viral infection. Chilli is complex, Leaf curl, Virus, CVMV, known to be infected by many viruses and association of Geminivirus with murda complex GBNV, ToLCV, is under question as the complex disease doesn’t associate with whiteflies. For a reliable TMV, CMV, Byadgi identification of virus associated with murda complex disease in chilli (Cv. Byadgi Dabbi), Dabbi . gene specific primer pairs were designed for Potyvirus (CVMV), Geminivirus (ToLCV), Article Info Tospovirus (GBNV) , TMV and CMV. Upon amplification by PCR using CVMV gene specific primers, ~531 bp size amplicon was amplified in all diseased samples of chilli and Accepted: no amplification was obtained in healthy samples of chilli. However, no amplification was 20 September 2017 found with ToLCV, GBNV, TMV and CMV gene specific primer pairs. Thus, the Available Online: 10 November 2017 investigation focused on molecular identification, convincingly revealed Chilli veinal mottle virus (Potyvirus) association with the chilli murda complex.

Introduction

Chilli (Capsicum annuum L.) is an important India is a major producer, exporter and crop grown worldwide for its use as spice and consumer of chilli. India contributes around vegetable. It is an indispensable spice used as 25 per cent of world chilli production. India is basic ingredient in a great variety of cuisines the largest producer of chilli crop, which is all over the world. Chilli belongs to Capsicum grown over an area of 7.44 lakh hectares with (2n=24) a new world genus belonging to an annual production of 14.53 lakh tonnes Solanaceae family. It is an excellent source of with the productivity of 1953 kg/ha (Anon., vitamins C, A, B-complex and E. It contains 2015). The important states growing chilli are seven times more vitamin C than orange. Andhra Pradesh, Karnataka, Orissa, Chilli is a fascinating spice, as it has got two Maharashtra, West Bengal, Rajasthan and important commercial qualities; some Tamil Nadu. Karnataka ranks second in area varieties are famous for red colour because of with 1.14 lakh hectares and Production of the pigment capsanthin, others are known for 1.29 lakh tonnes with the productivity of 1129 biting pungency attributed by capsaicin. kg/ha of dry chilli after Andhra Pradesh

2837

Int.J.Curr.Microbiol.App.Sci (2017) 6(11): 2837-2844

(Anon., 2013). In Karnataka, northern these, 22 are found to occur naturally, while Karnataka is an important chilli growing area the rest are known to infect on artificial and it is highly concentrated in the districts infection (Raju, 2010). Chilli leaf curl locally like Dharwad, Gadag, Haveri, Koppal, known as murda is a most destructive disease Bellary, Raichur, Kalaburagi and Belagavi. of chilli in India. Murda in chilli is known to be very complex disease caused by agents like India is the only country where many varieties thrips, mites and viruses (Puttarudraiah, of chilli with different quality factors are 1959). grown and it earns tremendous foreign exchange by the export of chilli, oleoresin (of Chilli murda is a complex associated with low, medium or high pungency) and chilli thrips, mites and virus. Curling of leaves is powder. Among different chilli cultivars one of the symptoms of the murda and hence Byadgi, a local land race is the most popular the disease is referred as chilli leaf curl based variety known for its mild pungency, fruit on symptoms. But the true leaf curl is caused colour, aroma, oleoresin content and other by Geminivirus and spreads through characteristics. These properties have made it whiteflies. Though chilli is known to be an exportable produce across the globe. As infected by many viruses but association of per the estimates, the export of chilli from Geminivirus with murda complex is under India was 3.47 lakh tonnes, which earned a question as the complex disease does not foreign exchange of rupees 3,997 crores associate with whiteflies. Hence, the (Spices Board of India, 2015-16). There is lot association of the virus/viruses in the disease of demand for these chillies both in domestic complex is not clearly understood. and international market. Nearly 75 per cent of Byadgi chillies sold in the market are Materials and Methods exported in either direct or indirect forms mostly to European, American and Middle Leaf samples of chilli plants showing typical East countries. Thus, India earns nearly Rs. symptoms of murda complex (Fig. 1) were 4000 crore worth foreign exchange every collected from open fields UAS campus, year. Hence, there is lot of scope for Dharwad region of Karnataka, India. Total improving the production and productivity of RNA was isolated from diseased and healthy these chillies in order to expand the export samples of chilli. Subsequently cDNA was market. Unfortunately, the production synthesized from the RNA using oligo dT potential of Byadgi chilli varieties is very low primer and reverse transcriptase enzyme. The (700 to 800 kg/ha) as they are highly cDNA was used as a template for susceptible to major pests and diseases. amplification of Potyvirus (CVMV), Besides lack of high yielding varieties, non- Tospovirus (GBNV), TMV and CMV using adoption of integrated nutrient and pest gene specific primers. Similarly, DNA from management practices by the farmers is also virus infected and healthy samples of chilli responsible for poor productivity and plants was isolated and used as template for production in the state. amplification of Geminivirus (ToLCV) using gene specific primers. Chilli suffers from a large number of viral, fungal and bacterial diseases. It is highly Characterization of virus coat protein gene susceptible to a large number of viruses through natural and artificial infection. Chilli Cloning of virus coat protein gene (CP) was is known to be affected by 42 viruses. Of done in pTZ57R/T vector by using Inst T/A

2838

Int.J.Curr.Microbiol.App.Sci (2017) 6(11): 2837-2844 cloning kit. The clone was further confirmed the most important virus of chilli pepper by PCR amplification using gene specific throughout the country (Krishnareddy et al., primers and also by restriction analysis using 2004). restriction enzymes Xba I and Bam HI. Supporting to the above study, three left over The clone carrying the gene was sequenced chilli fields (previously infected with murda using M13F/R primers employing primer complex) with bare stems and free from walking technique at Merck Specialties sucking pests giving new flushes showed Private Ltd., Bangalore. Thus obtained systemic dark green mottle, vein banding, sequences were subjected to analysis using necrotic ringspots, leaf distortion and reduced BLAST algorithm available at leaf size alone in all leaves. When these http://www.ncbi.nlm.nih.gov. leaves diagnosed for CVMV through RT-PCR using the same above degenerate primers, all Results and Discussion samples showed fairly a thick amplicon of the predicted size (1.2 kbp), which implicits that PCR analysis of murda complex infected the virus remained in its native form in stems chilli plants for Potyvirus (CVMV) and systemically infected the new flush (Pradeep, 2011). A set of specific primers were designed to amplify the coat protein gene of Potyvirus PCR analysis of murda complex infected (CVMV). Upon amplification by PCR, ~531 chilli plants for Geminivirus (ToLCV) bp size amplicon was amplified in all diseased samples of chilli and no amplification was Upon amplification by PCR, 1000 bp size obtained in healthy samples of chilli. It was amplicon was obtained in ToLCV infected clear from the results that the Potyvirus Tomato and Ageratum samples. But, the same (CVMV) is associated with chilli murda sized band was missing in chilli samples complex (Fig. 2). showing typical symptoms of murda complex disease on several repeats of the experiment. This finding is in agreement with Ravi et al., It was clear from the results that no specific (1997) who compared the N-terminal association of Geminivirus (ToLCV) is sequence of PVBV CP with all the potyviral involved with the chilli murda complex (Fig. CP sequences and observed the DAG 3). sequence conserved in all aphid-transmitted Potyviruses in the N-terminal sequence of the This finding is not in agreement with Khan et PVBV CP. Similar observations of conserved al., (2006); Senanayake et al., (2007); and DAG motif was also made by Tsai et al., Shafiq et al., (2010) who reported Tomato (2008) in all ChiVMV isolates including leaf curl New Delhi virus, Chilli leaf curl Indian isolate. Vector-virus relationship virus and Pepper leaf curl Lahore virus are revealed that among the insects, only aphids, the viruses accountable for chilli leaf curl in Aphis gossypii and Myzus persicae were able India. The facts with the disagreement are to transmit the virus from diseased to healthy mentioned below, chilli seedlings and virus was identified as Potyvirus. However, thrips, mites and In North India the incidence of whitefly in whitefly failed to transmit the virus from chilli crop starts in the month of July and diseased to healthy seedlings (Gundannavar, continues up to fourth week of November. 2006). Chilli veinal mottle virus (CVMV) is Hence, the presence of whitefly vector

2839

Int.J.Curr.Microbiol.App.Sci (2017) 6(11): 2837-2844 population throughout the crop period al., (2017) and Meena et al., (2013) from resulting in occurrence of Geminivirus. Rajasthan College of Agriculture, Udaipur, Whereas in parts of North Karnataka the who reported that the incidence of whitefly incidence of whitefly in chilli crop starts from (Bemisia tabaci) commenced in last week of third week of September which results in non- July and touched its peak in second week of occurrence of Geminivirus. These findings are September and continue up to fourth week of confirmed with the results obtained by Arti et November.

A. Upward Curling B. Downward curling and petiole elongation

C. Stunting, reduced leaf size D. Vein banding and leaf distortion Fig.1 Typical symptoms of murda complex in chilli (Cv. Byadgi Dabbi)

2840

Int.J.Curr.Microbiol.App.Sci (2017) 6(11): 2837-2844

Lane M: 100 bp ladder, Lane 1: Healthy chilli sample, Lane 2-5: Diseased chilli sample and Lane NC: No template control Fig.2 PCR analysis of murda complex infected chilli plants for CVMV

Lane M: 100 bp ladder, Lane 1: Diseased chilli sample, Lane M: 100 bp ladder, Lane 1: Diseased chilli sample, Lane 2: Diseased tomato sample, Lane 3: Diseased Lane 2: Diseased ground nut sample and ageratum sample and Lane NC: No template control Lane NC: No template control Fig.3 PCR analysis of murda complex infected Fig.4 PCR analysis of murda complex infected chilli plants for ToLCV chilli plants for GBNV

Lane M: 100 bp ladder, Lane 1: Diseased chilli sample, Lane M: 100 bp ladder, Lane 1: Diseased chilli sample, Lane 2: Diseased tobacco sample and Lane 2: Diseased banana sample and Lane NC: No template control Lane NC: No template control Fig.5 PCR analysis of murda complex infected Fig.6 PCR analysis of murda complex infected chilli plants for TMV chilli plants for CMV

2841

Int.J.Curr.Microbiol.App.Sci (2017) 6(11): 2837-2844

The primers designed and used

Sl. Annealing Virus Primer Sequence No. Temperature Potyvirus F AGCATGGAGAGAGCGACATT 1. 61 (CVMV) R TGGTGACGTTCCATTCTCAA Geminivirus F AGGGATTGCATTGGGGTTGTTAG 2. 52 (ToLCV) R GCGATACACAAATGCTTCCTGGAC Tospovirus F ATGTCTAMCGTYAAGCAVCTHAMCG 3. 52 (GBNV) R TTACAMTTCCARMGAAGKRCHAG F GACCTGACAAAAATGGAGAAGATCT 4. TMV 61 R GAAAGCGGACAGAAACCCGCTG F ACCGCGGGTCTTATTATGGT 5. CMV 57 R ACGGATTCAAACTGGGAGCA

The symptoms observed on chilli in North India especially in Northern parts of India are upward curling, puckering, vein Karnataka. clearing, reduced size of leaves, stunting, veinal distortion and swelling of veins and PCR analysis of murda complex infected veinlets. Whereas in South India especially in chilli plants for Tospovirus (GBNV) North Karnataka the symptoms observed are systemic dark green mottle, vein banding, Upon amplification by PCR, ~831 bp size reduced leaf size and distortion, fewer and amplicon was obtained in GBNV infected smaller fruits. These findings are confirmed groundnut sample. No amplification was with the results obtained by Senanayake et al., found both in diseased and healthy chilli (2007) who reported the characteristic field samples. It was clear from the results that no symptoms of Geminivirus are upward curling, specific association of Tospovirus (GBNV) is puckering, vein clearing, reduced size of involved with the chilli murda complex (Fig. leaves and stunting. Severely affected plants 4). were stunted and produced no fruit. The virus from field samples from Narwa village PCR analysis of murda complex infected (Jodhpur district of Rajasthan) was chilli plants for TMV transmitted by whitefly (Bemisia tabaci) to 50–100% of chilli test plants. Upon amplification by PCR, ~421 bp size amplicon was obtained in TMV infected Moreover, there are no reports of above tobacco sample. No amplification was found mentioned isolates or strains of viruses on both in diseased and healthy chilli samples. It chilli in Southern India as whole. Therefore, was clear from the results that no specific these findings reveal Geminivirus existence is association of TMV is involved with the chilli missing in the causative agents group that murda complex (Fig. 5). produce murda complex in Byadgi chilli. PCR analysis of murda complex infected Conclusively, chilli leaf curl produced by chilli plants for CMV Geminivirus reported by several workers in Northern parts of India is different from Upon amplification by PCR, ~382 bp size murda syndrome observed locally in South amplicon was obtained in CMV infected

2842

Int.J.Curr.Microbiol.App.Sci (2017) 6(11): 2837-2844 banana sample. No amplification was found Aurangabad, Maharashtra, India both in diseased and healthy chilli samples. It (EF213675.1). was clear from the results that no specific association of CMV is involved with the chilli Thus, the present investigation focused on murda complex (Fig. 6). molecular identification and characterization clearly revealed that Chilli veinal mottle virus PCR based cloning is the distinct virus of the genus Potyvirus associated with chilli murda complex. But, The ~531 bp amplicon of CVMV-CP was the role of Tospovirus (GBNV), Geminivirus eluted from preparative gels. pTZ57R/T (ToLCV), TMV and CMV with murda (2886 kb) was used as cloning vector for complex was not realized. cloning the amplified fragments. E. coli DH5 was transformed separately with References molecules using 5 μl of ligation mixture. Plasmid DNA of pTZ57R/T was used as Anonymous, 2013, State Agriculture Profile, positive control. Karnataka State Department of Agriculture, Ministry of Agriculture, The transformed cells were screened for Govt. of India, India, p.9. blue/white assay to identify the recombinants Anonymous, 2015, Pocket Book of carrying the coat protein gene. Agriculture Statistics, Directorate of Economics and Statistics, Ministry of The colonies that appeared white on Luria Agriculture and Farmers Welfare, Govt. agar containing Amp100, X-gal and IPTG of India, p.53. (Isopropyl b-D-thiogalactoside) are Arti, S., Ahir, K. C., Rana, B. S. and Ravi, K., recombinants and the colonies that appeared 2017, Population dynamics of sucking blue in colour are non- recombinants. pests infecting chilli (Capsicum annum L.). J. Entomol. Zool. Studies, 5 (2): The transformed E. coli DH5 clones with 250-252. pTZ57R/T vector carrying CVMV-CP were Gundannavar K. P., 2006, Vector-virus initially confirmed by colony PCR using gene relationship and development of organic specific primers and further confirmed by package for management of chilli (Cv. restriction analysis using Xba I and Bam HI. Byadgi) pests. Ph. D. Thesis, Univ. The recombinant clones of E. coli DH5 with Agric. Sci., Dharwad (India). pTZ57R/T vector carrying CVMV-CP were Khan, M. S., Raj, S. K. and Singh, R., 2006, named as pTAB531. First report of Tomato leaf curl New Delhi virus infecting chilli in India. The CVMV-CP gene cloned in pTZ57R/T Plant Pathol., 55: 289. (pTAB531) was sequenced using M13F/R Krishna Reddy, M., Madhavi Reddy, K., primers at Merck Biosciences Pvt. Ltd, Lakshminarayaa Reddy, C. N., Smitha, Bangalore. These sequences were subjected to R. and Jalali, S., 2004, Molecular homology search analysis using BLASTn and characterization and genetic variability BLASTp algorithms available at http:// of Chilli veinal mottle virus and its www.ncbi.nlm.nih.gov. The homology search reaction on chilli pepper genotypes. revealed that CVMV-CP gene sequence Proceedings of the XII EUCARPIA showed maximum homology of 95 per cent Meeting on Genetics and Breeding, with the reported nucleotide sequences from pp.171-177.

2843

Int.J.Curr.Microbiol.App.Sci (2017) 6(11): 2837-2844

Meena, R. S., Ameta, O. P. and Meena, B. L., Pepper vein banding virus from chilli 2013, Population dynamics of sucking pepper in India. Plant Dis., 81: 673-676. pests and their correlation with weather Senanayake, D. M. J. B., Mandal, B., Lodha, parameters in chilli, Capsicum annum S. and Varma, A., 2007, First report of L. Crop. The Bioscan, 8 (1): 177-180. Chilli leaf curl virus affecting chilli in Pradeep, M., 2011, Molecular India. Plant Pathol., 56 (2): 343. characterization of virus associated with Shafiq Muhammad, Shaheen Asad, Yusuf chilli (Capsicum annuum L.) murda Zafar, Rob, W., Briddon and Shahid complex. M. Sc. (Agri.) Thesis, Univ. Mansoor, 2010, Pepper leaf curl Lahore Agric. Sci., Dharwad (India). virus requires the DNA B component of Puttarudraiah, M., 1959, Short review on the Tomato leaf curl New Delhi virus to leaf curl complex and spray programme cause leaf curl symptoms. Virol. J., 7: for its control. Mysore J. Agric. Sci., 34: 367. 93-95. Tsai, W. S., Huang, Y. C., Zhang, D. Y., Raju, S. G., 2010, Studies on chilli leaf curl Reddy, K., Hidayat, S. H., Srithongchai, complex disease. Ph. D. Thesis, Univ. W., Green, S. K. and Jan, F. J., 2008, Agric. Sci., Dharwad (India). Molecular characterization of the CP Ravi, K. S., Joseph, J., Nagaraju, N., Krishna gene and 31UTR of Chilli veinol mottle Prasad, S., Reddy, H. R., and Savithri, virus from south and southeast Asia. H. S., 1997, Characterization of a Plant Pathol, 57: 408-416.

How to cite this article:

Abdul Kareem, M. and Byadgi, A.S. 2017. Molecular Identification and Characterization of Virus Associated with Murda Complex Disease in Chilli (Cv. Byadgi Dabbi). Int.J.Curr.Microbiol.App.Sci. 6(11): 2837-2844. doi: https://doi.org/10.20546/ijcmas.2017.611.335

2844