Inflammatory Lung Diseases Chemokine Responsiveness In

Infiltrated Neutrophils Acquire Novel Chemokine Receptor Expression and Chemokine Responsiveness in Chronic Inflammatory Lung Diseases This information is current as of September 27, 2021. Dominik Hartl, Susanne Krauss-Etschmann, Barbara Koller, Peter L. Hordijk, Taco W. Kuijpers, Florian Hoffmann, Andreas Hector, Ernst Eber, Veronica Marcos, Iris Bittmann, Oliver Eickelberg, Matthias Griese and Dirk Roos

J Immunol 2008; 181:8053-8067; ; Downloaded from doi: 10.4049/jimmunol.181.11.8053 http://www.jimmunol.org/content/181/11/8053 http://www.jimmunol.org/ References This article cites 66 articles, 16 of which you can access for free at: http://www.jimmunol.org/content/181/11/8053.full#ref-list-1

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists by guest on September 27, 2021

• Fast Publication! 4 weeks from acceptance to publication

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2008 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

Inﬁltrated Neutrophils Acquire Novel Chemokine Receptor Expression and Chemokine Responsiveness in Chronic Inﬂammatory Lung Diseases

Dominik Hartl,1*§ Susanne Krauss-Etschmann,*‡ Barbara Koller,* Peter L. Hordijk,¶ Taco W. Kuijpers,¶ʈ Florian Hoffmann,* Andreas Hector,* Ernst Eber,# Veronica Marcos,* Iris Bittmann,† Oliver Eickelberg,§ Matthias Griese,* and Dirk Roos¶

Various inflammatory diseases are characterized by tissue infiltration of neutrophils. Chemokines recruit and activate leukocytes, but neutrophils are traditionally known to be restricted in their chemokine receptor (CR) expression repertoire. Neutrophils undergo phenotypic and functional changes under inflammatory conditions, but the mechanisms regulating CR expression of infiltrated neutrophils at sites of chronic inflammation are poorly defined. Here we show that infiltrated neutrophils from patients Downloaded from with chronic inflammatory lung diseases and rheumatoid arthritis highly express CR on their surface that are absent or only marginally expressed on circulating neutrophils, i.e., CCR1, CCR2, CCR3, CCR5, CXCR3, and CXCR4, as measured by flow cytometry, immunohistochemistry, and confocal microscopy. The induction of CR surface expression on infiltrated neutrophils was functionally relevant, because receptor activation by chemokine ligands ex vivo modulated neutrophil effector functions such as respiratory burst activity and bacterial killing. In vitro studies with isolated neutrophils demonstrated that the surface expression of CR was differentially induced in a cytokine-mediated, protein synthesis-dependent manner (CCR1, CCR3), through http://www.jimmunol.org/ Toll-like (CXCR3) or NOD2 (CCR5) receptor engagement, through neutrophil apoptosis (CCR5, CXCR4), and/or via mobilization of intracellular CD63؉ granules (CXCR3). CR activation on infiltrated neutrophils may represent a key mechanism by which the local inflammatory microenvironment fine-tunes neutrophil effector functions in situ. Since the up-regulation of CR was exclusively found on infiltrated neutrophils at inflammatory sites in situ, the targeting of these G protein-coupled receptors may have the potential to site-specifically target neutrophilic inflammation. The Journal of Immunology, 2008, 181: 8053–8067.

eutrophils provide the ﬁrst and most potent cellular line of family, in particular CXCR1 and CXCR2 (12). Except for CXCR1/

innate host defense (1, 2). Leukocytes migrate to sites of CXCR2 ligands, the majority of chemokines has been suggested to by guest on September 27, 2021 N inﬂammation via chemokines (3), which act through seven- have no functional effect on human neutrophils (13). Evidence from transmembrane domain G protein-coupled receptors termed chemo- animal models, however, suggests that under inﬂammatory conditions kine receptors. Seven CXC (CXCR1–7), 10 CCR (CCR1–10), 1 neutrophils undergo phenotypic changes driven by the surrounding

CX3CR (CX3CR1), and 1 CR (XCR1) chemokine receptor have been microenvironment (1, 14), enabling them to expand their chemokine identified so far (4). Chemokines can be divided into inflammatory receptor expression pattern and respond to chemokines that are func- and homeostatic chemokines (5). Inflammatory chemokines are ex- tionally inactive under resting conditions (15–18). Studies with iso- pressed in inflamed tissues and are critical for attracting effector leu- lated human neutrophils have further demonstrated that GM-CSF, kocytes, whereas homeostatic chemokines maintain physiological IFN-␥, or TNF-␣ are capable of priming neutrophils for migration to traffic and immune surveillance by leukocytes (5). CC chemokines, mediated via up-regulation of CCR1 and CCR3 ex- In contrast to lymphocytes, monocytes and eosinophils (6, 7), hu- pression and/or via a CCR5-mediated mechanism (8, 19–21). How- man neutrophils are traditionally known to express only a very limited ever, the chemokine receptor expression and functionality of infil- number of chemokine receptors (8–10). While CC chemokines trated neutrophils at sites of chronic inflammation and the underlying mainly interact with lymphocytes, macrophages, and monocytes (11), mechanisms regulating chemokine receptor expression on infiltrated neutrophils express predominantly receptors of the CXC or CX3C neutrophils are poorly understood. We investigated whether infiltrating neutrophils in human inflammatory diseases gain a new chemokine receptor expression *Childrens’ Hospital and †Institute of Pathology, Ludwig-Maximilians-University, profile and whether this has functional consequences. Therefore, Munich, Germany; ‡Clinical Cooperation Group “Pediatric Immune Regulation” and we analyzed the expression and function of a broad variety of §Comprehensive Pneumology Center, Helmholtz Center Munich, German Research Center for Environmental Health, Munich, Germany; ¶Sanquin Research and Land- chemokine receptors on neutrophils directly isolated from sites 2 steiner Laboratory and ʈEmma Children’s Hospital, Academic Medical Centre, Uni- of inflammation, i.e., from bronchoalveolar lavage fluid (BALF) versity of Amsterdam, Amsterdam, The Netherlands; and #Paediatric Department, Respiratory and Allergic Disease Division, Medical University of Graz, Austria Received for publication June 11, 2008. Accepted for publication September 2 Abbreviations used in this paper: BALF, bronchoalveolar lavage fluid; SF, synovial 24, 2008. fluid; RA, rheumatoid arthritis; PAF, platelet-activating factor; CHX. cycloheximide; LTA, lipoteichoic acid; poly(I:C), polyinosine-polycytidylic acid; PGN, peptidogly- The costs of publication of this article were defrayed in part by the payment of page can; MDP, muranyl peptide; Pam CSK , Pam CysSerLys ; CF, cystic fibrosis; charges. This article must therefore be hereby marked advertisement in accordance 3 4 3 4 COPD, cystic obstructive pulmonary disease; FEV1, forced expiratory volume in 1 s; with 18 U.S.C. Section 1734 solely to indicate this fact. MFI, mean fluorescence intensity; PI, propidium iodide; FSC, forward scatter; SSC, 1 Address correspondence and reprint requests to Dr. Dominik Hartl, Childrens’ Hos- side scatter; LY, Lucifer Yellow; DHR, dihydrorhodamine 123; CytB, cytochalasin B. pital, Ludwig-Maximilians-University, Lindwurmstrasse 2a, D-80337 Munich, Ger- many. E-mail address: [email protected] Copyright © 2008 by The American Association of Immunologists, Inc. 0022-1767/08/$2.00 www.jimmunol.org 8054 CHEMOKINE RECEPTORS ON INFILTRATED NEUTROPHILS

Table I. Patient characteristicsa

CF COPD Asthma RA Controls

No. 10 10 11 10 10 Age (years) 24 Ϯ 562Ϯ 441Ϯ 860Ϯ 12 23 Ϯ 8 Sex (male/female) 5/5 4/6 5/6 6/4 6/4 Ϯ Ϯ Ϯ FEV1 (% predicted) 74 18 71 18 79 14 ND ND Forced vital capacity (% predicted) 82 Ϯ 17 81 Ϯ 16 86 Ϯ 12 ND ND No. using inhaled corticosteroids (␮g/day) 0 3 (700 Ϯ 180) 8 (1000 Ϯ 290) 0 0 Neutrophils (%) in BALF/SF 63 Ϯ 13 27 Ϯ 921Ϯ 11 74 Ϯ 13 5 Ϯ 2

a Results are expressed as means Ϯ SD. of patients with chronic inflammatory lung diseases and from sy- year (23). All COPD patients suffered from chronic bronchitis with sputum novial fluid (SF) of patients with rheumatoid arthritis (RA). Our production for at least 3 mo during 2 successive years. According to the results indicate that infiltrated neutrophils display a novel chemo- Global Initiative for Chronic Obstructive Lung Disease stage classification, these patients had COPD stage II (24). All COPD patients were current kine receptor expression profile and migrate to the respective che- smokers or had smoked previously. Five COPD patients used inhaled bron- mokines. Furthermore, chemokine activation of isolated infiltrated chodilators. All COPD patients were clinically stable at least 2 mo before neutrophils resulted in a modulation of neutrophil effector func- the study, as indicated by lack of self-reported change in symptoms over Downloaded from tionality ex vivo. Several components of the inflammatory micro- the preceding 2 mo, and none reported a change in airway symptoms in the 2 mo before the study. The asthma group included five male and six female environment, in particular cytokines, TLR ligands, NOD2 ligands, patients with allergic asthma. Inclusion criteria were recurrent episodes of and apoptosis, were found to differentially induce the chemokine wheezing and objective evidence of asthma as indicated by ␤2 agonist- receptor expression on neutrophils via protein neosynthesis or reversible airflow obstruction (Ն12% improvement in FEV1% predicted), granule mobilization. These studies suggest inducible chemokine bronchial hyperresponsiveness (exercise challenge), and Ն20% intraday Ͼ receptors on neutrophils as functional and site-specific therapeutic peak flow variability, elevated total serum IgE ( 150 kU/ml), and/or the presence of specific IgE (RAST class Ͼ2). The RAST was performed for http://www.jimmunol.org/ targets in chronic inflammatory diseases. 40 inhalation and food allergens. All asthma patients used inhaled bronchodilators. Spirometry and flow volume curves were performed in all Materials and Methods patients according to the American Thoracic Society guidelines (25). Ten Reagents patients with RA (six males, four females) were included in the study. RA was diagnosed according to American College of Rheumatology criteria Recombinant human IL-8, TNF-␣, IL-1␤, IFN-␥, and GM-CSF were from (26). All RA patients had at least one swollen knee joint and had active PeproTech. PMA, platelet-activating factor (PAF), fMLP, cytochalasin B, rheumatic disease, with a mean (ϮSD) serum C-reactive protein level of AMD3100, cycloheximide (CHX), LPS (from Escherichia coli serotype 39 Ϯ 23 mg/L and an ESR of 51 Ϯ 18 mm/hour. Ten age-matched healthy 0111:B4), lipoteichoic acid (LTA) from Staphylococcus aureus, and zy- subjects were selected as the control group (six males, four females; mean mosan A (Saccharomyces cerevisiae) were from Sigma-Aldrich. Purified age). These subjects were all nonsmokers, had no suspected or proven pul- flagellin (Salmonella typhimurium) was from Alexis. Nonmethylated CpG monary disease, and were free of respiratory tract infections. The control sub- by guest on September 27, 2021 motif-containing DNA (CpG) (GGTGCATCGATGCAGGGGGG) was jects underwent minor surgical interventions and bronchoalveolar lavage was from Invitrogen. R848 (resiquimod hydrochloride) was from GL Synthesis. performed before the surgical procedure. The study was approved by the in- Polyinosine-polycytidylic acid (poly(I:C); dsRNA) was from Pharmacia. stitutional review board of the Medical Faculty, Ludwig-Maximilians Univer- Peptidoglycan (PGN; from S. aureus) was from InvivoGen. Muramyl sity (Munich, Germany). Written informed consent was obtained from all pa- dipeptide (MDP) was from Calbiochem. Pam3CysSerLys4 (Pam3CSK4) tients and healthy control subjects before enrollment. was from EMC Microcollections. Human serum albumin and fibronectin were obtained from Sanquin. RPMI 1640 was from Life Technologies. Bronchoalveolar lavage Recombinant human CCL2, CCL4, CCL11, CCL15, CXCL11, and Bronchoscopy and bronchoalveolar lavage (4 ϫ 1 ml of 0.9% (w/v) CXCL12 were from R&D Systems. Mouse anti-human CCR1 and mouse NaCl/kg body weight) were performed as described previously (27). The anti-human CCR3 blocking Abs were from MBL International. A mouse obtained BALF was filtered through two layers of sterile gauze. The first anti-human CCR5-blocking Ab was from Sigma-Aldrich. A mouse anti- fraction of BALF was used because it contains higher percentages of neu- human CCR2-blocking Ab was from Abcam. A mouse anti-human trophils compared with the pooled fraction (28). The sample processing CXCR3-blocking Ab was from Lifespan Biosciences. All reagents, buffers, was performed immediately on ice. After centrifugation (200 ϫ g, 10 min), and media were free of LPS (Ͻ0.01 ng/ml) by Limulus assay the supernatant was stored at Ϫ80°C until analysis. The cell pellet was (Sigma-Aldrich). resuspended in 5 ml of PBS and used for preparation of cytospin slides and Patients flow cytometry. The group of chronic lung diseases comprised patients with cystic fibrosis Immunohistochemistry (CF), chronic obstructive pulmonary disease (COPD) and asthma (Table I). Paraffin-embedded, 5-␮m-thick lung tissue sections of three COPD pa- The CF group included five male and five female patients. Inclusion criteria tients were stained. Slides were deparaffinized through a series of xylene for CF patients were the diagnosis of CF by clinical symptoms and positive baths and rehydrated through graded alcohols. The sections were then im- sweat tests or disease-inducing mutations, forced expiratory volume in 1 s mersed in methanol containing 0.3% hydrogen peroxide for 20 min to (FEV ) Ͼ25% of predicted value, and being on stable concomitant therapy 1 block endogenous peroxidase activity and incubated in 2.5% blocking se- at least 2 wk before the study. The CF patients had moderate to severe rum to reduce nonspecific binding. Sections were incubated overnight at symptoms of the disease, as defined by the activity and physical exami- 4°C with primary mouse anti-CCR1, anti-CCR2, anti-CCR3, anti-CCR5, nation criteria of the scoring system of Shwachman and Kulczycki (22). anti-CXCR3, or anti-CXCR4 Abs (R&D Systems) at dilutions of 1/1000. Six CF patients inhaled recombinant human DNase and four patients in- The sections were then incubated with secondary anti-mouse Abs and un- haled bronchodilators. None of the CF patients received inhaled or sys- derwent standard avidin-biotin immunohistochemical staining according to temic corticosteroids or had signs of a severe systemic infection within 2 the manufacturer’s recommendations (Vector Laboratories). Diaminobenzi- mo before the study. All CF patients were clinically stable at least 2 mo dine was used as a chromogen and hematoxylin was used for counterstaining. before the study, as indicated by lack of self-reported change in symptoms over the preceding 2 mo, and none reported a change in airway symptoms Synovial fluid in the 2 mo before the study. The COPD group included four male and six female patients. Inclusion criteria were the clinical diagnosis of COPD, SF was obtained from patients with RA who presented with arthritis of the defined in accordance with American Thoracic Society criteria as a Ͼ2- knee for diagnostic or therapeutic arthrocentesis. SF leukocytes were dif- year history of daily cough productive of phlegm for at least 3 mo of the ferentiated routinely by light microscopy after Jenner-Giemsa staining. The Journal of Immunology 8055

RA-SF were centrifuged at 4°C (3 min; 2000 ϫ g) and the cell-free su- Chemotaxis pernatants were stored at –80°C until use. Neutrophil chemotaxis was analyzed as described by a modified method of Flow cytometry De Gendt et al. (32). In brief, isolated neutrophils were labeled with 4 ␮g/ml calcein-acetomethylester in HEPES medium for 45 min at 37°C The following mAbs were used: CD16-allophycocyanin mouse IgG1, before the start of the assay. After labeling, the cells were washed twice CCR1-PE mouse IgG2b, CCR2-PE mouse IgG2b, CCR3-PE rat IgG2a, and resuspended in HBSS (106/ml). Calcein-labeled neutrophils (0.5 ϫ 106 CCR4-PE IgG2b, CCR5-PE mouse IgG2b, CXCR3-FITC mouse IgG1 (all cells) were placed in the upper compartment and CCL2, CCL4, CCL11, R&D Systems) and CD63-PE mouse IgG1, CD66b-PE mouse IgG2a, CCL15, CXCL11, or CXCL12 (each 100 nM) were placed in the lower CD35-PE mouse IgG1, CD15-FITC mouse IgM, and CXCR4-PE mouse compartment of a Transwell filter system (3.0-␮m pore size, 12-mm di- IgG2a (all from BD Pharmingen). Mouse IgG1-allophycocyanin, mouse IgG1- ameter; Costar). The Transwells were incubated for 60 min at 37°C. The PE, rat IgG2a-PE, mouse IgM-FITC, mouse IgG1-CyChrome, mouse IgG2a- percentage of cell migration was calculated by cell fluorescence, i.e., the PE, and mouse IgG2b-PE (Immunotech) were used as isotype controls and amount of fluorescence in each of the compartments was measured and were subtracted from the respective specific Ab staining. The results were related to the fluorescence of the total input (set at 100%). expressed as mean fluorescence intensity (MFI). Calculations were performed with CellQuest analysis software (BD Biosciences). Chemokinesis Neutrophils from peripheral blood, BALF, or SF were preincubated for Chemokinesis was evaluated as described previously by Schweizer and co- 30 min at 4°C with 20% (v/v) serum to prevent nonspecific binding via Fc workers (33). In brief, Transwell chambers were used to discriminate chemo- receptors. Afterward, neutrophils were incubated with mAbs for 40 min, kinesis from chemotaxis. We added the chemokines CCL2, CCL3, CCL4, washed two times, and analyzed by flow cytometry as described previously CCL11, CXCL11, or CXCL12 at different concentrations either in the (29). Neutrophils were identified by their light scatter properties and the lower, the upper, or both compartments of a Transwell chamber and expression of CD15 and CD16. Propidium iodide (PI, 5 ␮g/ml; Sigma- FITC analyzed the resulting migratory capacity of COPD BALF-isolated neu-

␮ Downloaded from Aldrich) and Annexin V (5 g/ml; Boehringer Mannheim) were used trophils. Cell migration was analyzed via checkerboard analysis. When to discriminate viable leukocytes (annexin VϪPIϪ) from apoptotic (an- ϩ Ϫ ϩ ϩ migration was induced only with chemokines in the lower chamber, nexin V PI ) and necrotic (annexin V PI ) leukocytes. These gates were gradient-dependent migration (“chemotaxis”) was assumed. When cell used to analyze 10,000 neutrophils in blood, BALF, or SF from each sam- migration was also observed with chemokines in the upper-only or up- ple. The gating of neutrophils vs eosinophils and macrophages was opti- per plus lower chambers present, nondirected/gradient-independent mi- mized before the study. For some experiments, neutrophils were perme- gration (“chemokinesis”) was assumed. abilized before being subjected to flow cytometry. Washed cells were fixed and permeabilized with the IntraPrep intracellular staining kit (Beckman Effect of BALF, SF, and cytokines on chemokine receptor http://www.jimmunol.org/ Coulter) and incubated for 20 min according to the manufacturer’s expression of neutrophils instructions. Neutrophils were isolated from peripheral blood of healthy controls (2 ϫ Confocal microscopy 106/ml). Thereupon, neutrophils were incubated for6hat37°C with cell- free BALF supernatant, cell-free SF supernatant, GM-CSF (100 ng/ml), Neutrophils isolated from BALF of COPD patients were washed twice, IL-8 (72 aa, 50 ng/ml), TNF-␣ (50 ng/ml), IL-1␤ (100 ng/ml), IFN-␥ (1000 resuspended in 100 ␮l of HBSS, and fixed in an equal volume of 4% (v/v) U/ml), or the combination of GM-CSF (10 ng/ml), TNF-␣ (100 ng/ml), and paraformaldehyde for 30 min. Cells were permeabilized with an equal vol- IFN-␥ (1000 U/ml). The doses of these agents were chosen based on ex- ume of cold 0.1% (w/v) Triton X-100 for 2 min on ice. After washing and periments before the study, showing maximal activation of human neutro- resuspending in 100 ␮l of HBSS, neutrophils were incubated with an op- phils without affecting cell viability. To examine whether the induction of timal concentration of anti-CCR1 mouse IgG2b, anti-CCR2 mouse IgG2b, chemokine receptor expression on neutrophils is dependent on protein syn- by guest on September 27, 2021 anti-CCR3 mouse IgG2b, anti-CCR5 mouse IgG2b, anti-CXCR3 mouse thesis, the effect of CHX (2 ␮g/ml) pretreatment was analyzed. After the IgG1 and anti-CXCR4 IgG2a (R&D Systems) or the respective isotype incubation period, neutrophils were washed twice with ice-cold PBS, in- controls. After staining with anti-mouse Alexa Fluor 555 along with Con cubated with CCR1, CCR2, CCR3, CCR5, CXCR3, and CXCR4 Abs for A (lectin that binds to cell membranes) conjugated to Alexa Fluor 488, 40 min (see above), washed two times with PBS, and analyzed by flow confocal laser-scanning microscopy was performed with the Leica TCS NT cytometry as described above. laser system, including a Leica DM IRB microscope with ϫ63 objectives. Cross-talk between the green and red channel was avoided by use of se- ␣-Defensin release quential scanning. Luminosity analysis was performed with SigmaScan Pro ␣ software. -Defensins were quantified in cell-free supernatants by sandwich ELISA with anti-human ␣-defensin mAb, anti-human ␣-defensin polyclonal Ab, ␣ Neutrophil isolation HRP-conjugated rabbit anti-goat IgG, and recombinant human -defensin-1 as described previously (34). Neutrophils were isolated from peripheral blood according to standard pro- cedures (30). Venous blood was drawn and neutrophils were isolated im- Phagocytosis mediately by density gradient centrifugation over isotonic Percoll accord- Neutrophils were isolated from peripheral blood and BALF of COPD pa- ing to the manufacturer’s instructions (Pharmacia). After lysis of the tients and SF of RA patients. Chemokine receptors were blocked by pre- erythrocytes, the neutrophils were harvested, washed twice with HBSS treatment of neutrophils with anti-CCR1-, anti-CCR2-, anti-CCR3-, anti- (Sigma-Aldrich) containing 20 mM HEPES (Sigma- Aldrich) and 0.1% CCR5-, anti-CXCR3-blocking Abs (each 10 ␮g/ml) or AMD3100 (3 ␮M) (w/v) BSA (Sigma-Aldrich), and resuspended in HBSS, 20 mM HEPES, 6 for 30 min. P. aeruginosa bacteria were incubated with the fluorescent and 0.1% (w/v) BSA at a cell concentration of 10 /ml. The purity of the ligand Lucifer Yellow (LY) for 60 min at room temperature. After preop- Ն neutrophil suspensions was 98%, as assessed by microscopic examina- sonization (60 min, 37°C, 20% pooled fresh C5a-depleted human serum), tion of Pappenheim cytospin preparations. Cell viability was confirmed by the bacteria (2 ϫ 107/ml) in the HBSS-gel were incubated at 37°C for 2 h Ն trypan blue dye exclusion ( 95%). with neutrophils (2 ϫ 106/ml) in the absence or presence of CCL2, CCL4, Neutrophils from BALF and SF were isolated as described previously CCL11, CCL15, CXCL11, or CXCL12 (each 100 nM). Thereafter, the (31). The obtained BALF and SF cells were washed twice with sterile neutrophils were separated from the free bacteria by three centrifugations HBSS and were then resuspended in 10 ml of HBSS. These cells were at 200 ϫ g for 5 min. The LY fluorescence of the isolated neutrophils was layered onto a Percoll gradient (40 and 50% (w/v) solutions in saline) and analyzed by flow cytometry. centrifuged for 20 min at 400 ϫ g to remove macrophages, epithelial cells, and lymphocytes. Then, the neutrophils were recovered from the interface Respiratory burst of the 50 and 40% phases. The purity of the neutrophil suspensions was Ն98%, as assessed by May-Gru¨nwald-Giemsa staining. Cell viability was The respiratory burst of isolated neutrophils was analyzed by flow cytom- confirmed by trypan blue dye exclusion (Ն95%). etry. Dihydrorhodamine 123 (DHR, Molecular Probes) was dissolved in DMSO at a concentration of 500 pM. After washing, aliquots (1 ml) of the 6 Chemokines and cytokines in BALF and SF isolated neutrophils (2 ϫ 10 /ml) were incubated with DHR for 20 min at 37°C. After several washings to remove unincorporated DHR, neutrophils Levels of CCL2, CCL4, CCL11, CCL15, CXCL11, CXCL12, TNF-␣, were treated with CCL3, CCL2, CCL11, CCL5, CXCL11, or CXCL12 GM-CSF, and IFN-␥ were determined in BALF and SF by a sandwich (each 100 nM) for 30 min at 37°C to activate the CCR1, CCR2, CCR3, ELISA (R&D Systems) according to the manufacturer’s instructions. CCR5, CXCR3, or CXCR4 function. After the chemokine stimulation, 8056 CHEMOKINE RECEPTORS ON INFILTRATED NEUTROPHILS Downloaded from http://www.jimmunol.org/ by guest on September 27, 2021

FIGURE 2. Chemokine receptor expression on pulmonary neutrophils. Chemokine receptor expression on pulmonary neutrophils was assessed by FIGURE 1. Neutrophil gating. Neutrophils in BALF or SF were gated ac- flow cytometry (left column), immunohistochemistry (middle column), and cording to the following method (as shown here for BAL cells). First, gran- confocal microscopy (right column). Flow cytometry: representative his- ulocytes were gated based on their light scatter characteristics (FSC/SSC; up- tograms are shown of neutrophils from BALF of a representative patient per panel). Gran, Granulocytes; AMs, alveolar macophages; Lyc, with COPD and a representative control subject (Control) and from pe- lymphocytes. The granulocyte region was further differentiated by means of ripheral blood (Blood) of a control subject. Isotype expression overlapped the leukocyte surface markers CD16 and CD15 (lower panel). Combining the with the specific expression in peripheral blood. Immunohistochemistry: low high FSC/SSCandCD15/CD16gatingstrategy,neutrophils(PMN)(FSC CD15 representative sections of lung tissue from three COPD patients are shown. high high low CD16 ) were differentiated from alveolar macrophages (FSC CD15 Diaminobenzidine was used as chromogen and hematoxylin for counter- intermed low intermed low CD16 ) and eosinophils (Eos) (FSC CD15 CD16 ). staining. Black arrows mark chemokine receptor-expressing neutrophils. Confocal microscopy: Neutrophils isolated from BALF from COPD patients were fixed in paraformaldehyde and permeabilized with Triton fMLP (1 ␮M) was added for 5 min at 37°C. Afterward, the reactions were X-100. After washing, the neutrophils were incubated with mouse anti- stopped by transferring the sample tubes onto ice, and cells were immediately analyzed on the flow cytometer as described previously (35). Where CXCR3, anti-CXCR4, anti-CCR1, anti-CCR2, anti-CCR3, or anti-CCR5 indicated, neutrophils were pretreated for 30 min with anti-CCR1-, anti- or the respective isotype controls. After staining with anti-mouse Alexa CCR2-, anti-CCR3-, anti-CCR5-, anti-CXCR3-blocking mAbs (each 10 Fluor 555 along with Con A conjugated to Alexa Fluor 488, confocal ␮g/ml) or AMD3100 (3 ␮M). Background MFI from a control tube with- laser-scanning microscopy was performed with ϫ63 objectives. Red color out stimulation was subtracted from the MFI of the stimulated cells. Re- represents chemokine receptors and green color shows Con A (membrane sults are expressed as the MFI of the total neutrophil population. Each and cytoplasm staining). complete experiment was conducted three times. Bacterial killing For bacterial killing, a modified method according to Berger et al. (36) was used. A clinical isolate of a mucoid P. aeruginosa from a CF (neutrophils/bacteria) in the absence or presence of CCL2, CCL4, patient’s sputum was subcultured overnight, grown to stationary phase, CCL11, CCL15, CXCL11, or CXCL12 (each 100 nM). Aliquots of each washed, and preopsonized by incubation for 60 min at 37°C in 20% mixture were removed immediately and after 30, 60, 90, and 120 min pooled, fresh C5a-depleted human serum. After washing two times in of incubation at 37°C. P. aeruginosa colonies at each time interval were PBS, the opsonized P. aeruginosa bacteria were resuspended in 1 ml of counted by serial dilution in distilled water and quantitative spread a mixture of HBSS-gel and tryptic soy broth (Difco Laboratories). Af- plating and were expressed as CFU per ml. At 60 min, anti-CXCR3- terward, neutrophils isolated from BALF of a patient with COPD were blocking Abs (each 10 ␮g/ml) or AMD3100 (3 ␮M) were added to the mixed with preopsonized bacteria (2 ϫ 107 bacteria/ml) at a ratio of 1:5 CXCL12- or CXCL11-treated aliquots. The Journal of Immunology 8057 Downloaded from http://www.jimmunol.org/ by guest on September 27, 2021

FIGURE 3. A, Neutrophil chemokine receptor expression in peripheral blood, BALF, and SF. Chemokine receptor expression levels on neutrophils from peripheral blood of healthy controls (Ⅺ) or patients with lung diseases (white hatched bars), from BALF of healthy controls (u) or patients with lung diseases (gray hatched bars) and from peripheral blood and SF of patients with RA (f). Receptor expression on neutrophils was analyzed by flow cytometry. The upper panel shows the surface expression levels of chemokine receptors, the lower panel shows percentages of chemokine receptor-expressing .p Ͻ 0.05: vs neutrophils in peripheral blood. B, Chemokines in bronchoalveolar lavage and synovial fluid ,ء .neutrophils. Bars represent means Ϯ SEM Levels of human CCL2, CCL3, CCL4, CCL5, CCL11, CXCL11, and CXCL12 were quantified in BALF of healthy controls, in BALF of patients with lung p Ͻ 0.05 vs BALF from healthy controls. C, Neutrophil ,ء .diseases, and in SF of patients with RA by sandwich ELISA. Bars represent means Ϯ SEM chemokine receptor expression in BALF from patients with chronic inflammatory lung diseases. Chemokine receptor expression levels on neutrophils in BALF of healthy controls and patients with CF, COPD, or allergic asthma. Receptor expression on neutrophils was analyzed by flow cytometry. Bars .p Ͻ 0.05 vs neutrophils in peripheral blood ,ء .represent means Ϯ SEM 8058 CHEMOKINE RECEPTORS ON INFILTRATED NEUTROPHILS

FIGURE 4. Chemokine receptors on inﬁltrated neutrophils are functional. A, Chemotaxis. Neutrophils were isolated from peripheral blood and BALF of COPD patients and SF of RA patients. Chemokine receptors were blocked by pretreatment of neutrophils with anti-CCR1-, anti- CCR2-, anti-CCR3-, anti-CCR5-, anti-CXCR3-blocking Abs (each 10 ␮g/ml) or AMD3100 (3 ␮M) for 30 min. Neutrophils (0.5 ϫ 106 cells) were labeled with calcein and were placed in the upper compartment of a Transwell ﬁlter system. CCL2, CCL3, CCL4, CCL11, CXCL11, or

CXCL12 (each at 100 nM) were placed in the lower com- Downloaded from partment. The Transwells were incubated for 60 min at 37°C. The percent cell migration was calculated by flow cytometry, i.e., the amount of fluorescence in each of these compartments was measured and related to the fluorescence of the total input (set at 100%). Bars represent the means Ϯ SEM of independent experiments with cells from /p Ͻ 0.05 Ab-treated vs non- http://www.jimmunol.org ,ء .three different donors treated neutrophils. B, Chemokinesis. B shows dose-dependent migratory responses of BALF-isolated neutrophils from COPD patients (n ϭ 3). Chemotaxis was analyzed with the respective chemokines (CCL2, CCL3, CCL4, CCL11, CXCL11, or CXCL12 at the indicated concentrations) present in the lower compartment of the Transwell chamber (lower). Chemokinesis was analyzed with chemokines present in both compartments (both) or just in the Ͻ ء upper compartment (upper) of the chamber. , p 0.05 by guest on September 27, 2021 lower chamber vs upper chamber or both chambers.

Effect of TLR/NOD2 activation on chemokine receptor Statistical analysis expression of neutrophils Experiments were performed in duplicates and repeated at least three times. For parametric data, means Ϯ SEM are given and the two-sided t test The effect of the TLR/NOD2 ligands LPS (100 ng/ml; TLR4), Pam3CSK4 (10 ␮g/ml; an artificial triacylated lipopeptide; TLR1/2), PGN (10 ␮g/ml; performed. A p Ͻ 0.05 was regarded as significant (SPSS statistical pro- TLR2/NOD2), MDP (10 ␮g/ml; a component of PGN that binds to gram, version 11.5) (38). NOD2), LTA (10 ␮g/ml; TLR2), R-848 (10 ␮g/ml; a ssRNA analog; TLR7/8), poly(I:C) (50 ␮g/ml; a dsRNA analog; TLR3), CpG-DNA (100 ␮g/ml; TLR9), flagellin (1 ␮g/ml; TLR5), and zymosan (50 ␮g/ml; Results TLR2/6) was assessed on CCR1, CCR2, CCR3, CCR5, CXCR3, or CXCR4 expression on neutrophils. The doses of these agents were chosen Chemokine receptor expression on infiltrated neutrophils based on experiments before the study showing maximal activation of hu- We gated infiltrated pulmonary and synovial neutrophils based man neutrophils without affecting cell viability. Since the response to TLR agonists has been found to be enhanced by GM-CSF pretreatment (37), on their light scatter (FSC/SCC) characteristics and based on neutrophils isolated from peripheral blood of healthy controls were prein- positive expression of CD16 and CD15 (Fig. 1). This combined cubated with 50 ng/ml recombinant human GM-CSF for 90 min and then approach was able to differentiate neutrophils (FSClowCD15high treated with the TLR ligands for6hat37°C. After the incubation period, CD16high) from alveolar macrophages (FSChighCD15low neutrophils were washed twice with ice-cold PBS, incubated with CCR1, CD16intermed) and infiltrated eosinophils (FSClowCD15intermed CCR2, CCR3, CCR5, CXCR3, and CXCR4 Abs for 40 min (see above), low washed two times with PBS, and analyzed by flow cytometry as described CD16 ). We stained these neutrophils for a broad variety above. of CC and CXC chemokine receptors (CCR1–CCR5, CXCR1–4). The Journal of Immunology 8059

FIGURE 5. Neutrophil effector functions. A, Respi- ratory burst. Neutrophils were isolated from peripheral blood and BALF of COPD patients and SF of RA patients. Chemokine receptors were blocked by pretreatment of neutrophils with chemokine receptor-blocking Abs (each 10 ␮g/ml) for 30 min. Neutrophils were loaded with DHR and were treated with CCL3, CCL2, CCL11, CCL5, CXCL11, or CXCL12 (each 100 nM) for 30 min at 37°C to activate the CCR1, CCR2, CCR3, CCR5, CXCR3, or CXCR4 function. After the chemokine stimulation, fMLP (1 ␮M) was added for 5 min at 37°C. Afterward, the reactions were stopped by transferring the sample tubes onto ice, and cells were immediately analyzed on the flow cytometer as described previously (35). Background MFI from a control tube without fMLP was subtracted from the MFI of the fMLP-stimulated cells. Results are expressed as the Downloaded from p Ͻ 0.05 vs ,ء .MFI of the total neutrophil population neutrophils from peripheral blood. B, Phagocytosis. Neutrophils were isolated from peripheral blood and BALF of COPD patients and SF of RA patients. Che- mokine receptors were blocked by pretreatment of neutrophils with chemokine receptor-blocking Abs (each ␮ 10 g/ml) for 30 min. P. aeruginosa bacteria were in- http://www.jimmunol.org/ cubated with the fluorescent ligand LY for 60 min at room temperature. After preopsonization, the bacteria (2 ϫ 107/ml) in HBSS-gel were incubated at 37°C for 2 h with neutrophils (2 ϫ 106/ml) in the presence of the CCL2, CCL3, CCL4, CCL11, CXCL11, or CXCL12 (each 100 nM). After the incubation period, the neutrophils were separated from the free bacteria by three centrifugations at 200 ϫ g for 5 min. The LY fluorescence of the isolated neutrophils was analyzed by flow cytom- p Ͻ 0.05 vs neutrophils from peripheral blood. by guest on September 27, 2021 ,ء .etry C, ␣-Defensin release. Neutrophils were isolated from peripheral blood and BALF of COPD patients and SF of RA patients. Chemokine receptors were blocked by pretreatment of neutrophils with chemokine receptor- blocking Abs (each 10 ␮g/ml) or AMD3100 (3 ␮M) for 30 min. Afterward, neutrophils were incubated with CCL2, CCL3, CCL4, CCL11, CXCL11, or CXCL12 (each at 100 nM) for 1 h. ␣-defensins were quantified in cell-free supernatants by sandwich ELISA with anti- human ␣-defensin mAb, anti-human ␣-defensin polyclonal Ab, HRP-conjugated rabbit anti-goat IgG, and -p Ͻ 0.05 vs neu ,ء .recombinant human ␣-defensin-1 trophils from peripheral blood. Treating neutrophils with isotype control Abs instead of blocking Abs had no effect on respiratory burst, phagocytosis, or ␣-defensin release (data not shown).

To confirm the cellular identity and to avoid false-positive find- 3A, upper panel). In contrast, BALF neutrophils from patients ings through contamination by non-neutrophils, we used immu- with chronic lung diseases as well as SF neutrophils from pa- nohistochemistry and confocal microscopy (Fig. 2). These stud- tients with RA had high surface expression levels of CCR1, ies consistently demonstrated that infiltrated pulmonary and CCR2, CCR3, CCR5, CXCR3, and CXCR4. These differences synovial neutrophils expressed CCR1, CCR2, CCR3, CCR5, in chemokine receptor expression on infiltrated neutrophils CXCR3, and CXCR4, which were absent or marginally ex- were consistent when calculating either surface expression pressed on peripheral blood neutrophils (Figs. 2 and 3A, upper (MFI; Fig. 3A, upper panel) or percentages of chemokine re- panel). Neutrophils in BALF from healthy controls expressed ceptor-positive neutrophils (Fig. 3A, lower panel). Patients with low to intermediate levels of CCR1, CXCR3, and CXCR4 but chronic lung diseases or RA had lower percentages of infiltrated expressed no detectable CCR2, CCR3, CCR4, or CCR5 (Fig. CXCR1ϩ neutrophils compared with healthy controls or 8060 CHEMOKINE RECEPTORS ON INFILTRATED NEUTROPHILS Downloaded from

FIGURE 6. Bacterial killing. A, A clinical isolate of a mucoid P. aeruginosa from a CF patient’s sputum was subcultured overnight, grown to stationary phase, washed, and preopsonized by incubation for 60 min at 37°C in 20% pooled, fresh C5a-depleted human serum. After washing two times in PBS, the opsonized P. aeruginosa bacteria were resuspended in 1 ml of a mixture of HBSS-gel and tryptic soy broth. Afterward, neutrophils isolated from BALF of a patient with COPD were mixed with preopsonized bacteria (2 ϫ 107 bacteria/ml) at a ratio of 1:5 (neutrophils/bacteria) in the absence or presence of CCL2, CCL4, CCL11, CCL15, CXCL11, or CXCL12 (each 100 nM). Aliquots of each mixture were removed after 0, 30, 60, 90, and 120 min of incubation at 37°C. P. aeruginosa colonies at each time interval were counted by serial dilution in distilled water and quantitative spread plating and were expressed http://www.jimmunol.org/ as CFU per ml. B, After 60 min, anti-CXCR3-blocking Abs (10 ␮g/ml) or AMD3100 (3 ␮M) were added to the CXCL11- or CXCL12-treated aliquots. Treating neutrophils with isotype control Abs instead of blocking Abs had no effect on bacterial killing (data not shown). Bars represent the means Ϯ SEM of three independent experiments with cells from different donors.

compared with peripheral blood. In BALF or SF, lower per- control Abs had no effect on chemokine-induced cell migration centages of infiltrated CXCR2ϩ neutrophils were found com- (data not shown). Since the migratory capacity of the ex vivo- pared with peripheral blood. isolated cells was relatively low compared with the capacity of These increased receptor expressions on BALF and SF freshly isolated neutrophils toward CXCR1/CXCR2 chemo- by guest on September 27, 2021 neutrophils were paralleled by increased levels of the corre- kines, we investigated whether the observed “chemotactic” ef- sponding chemokine ligands CCL2, CCL3, CCL4, CCL11, fect was indeed gradient-dependent migration (chemotaxis) or CCL15, CXCL11, and CXCL12 in BALF and SF (Fig. 3B). could in fact be nondirected, gradient-independent migration CCR4 was not expressed on blood, BALF, or SF neutrophils. (chemokinesis). Therefore, we performed studies to discrimi- When the expression levels on BALF neutrophils were com- nate both mechanisms using a similar method as described pre- pared among patients with CF, COPD, and allergic asthma, viously (33). For this purpose, we added the chemokines CCL2, asthmatics had the highest CCR3 and the lowest CCR5 and CCL3, CCL4, CCL11, CXCL11, or CXCL12 at different con- CXCR3 expression levels (Fig. 3C). CF patients had lower centrations either in the lower, the upper, or in both compart- CXCR4 expression levels and the highest CXCR3 expression ments of a Transwell chamber and analyzed the resulting mi- compared with the other patient groups. Comparing patients gratory capacity of COPD BALF-isolated neutrophils (Fig. 4B). with and without inhaled corticosteroids, we did not find sta- The migratory responses of all chemokines were dose-depen- tistically significant differences (data not shown). These results dently induced with chemokines in the lower compartment of indicate that 1) infiltrated neutrophils express novel chemokine the chamber. When this chemoattractant was present in both receptors at sites of inflammation that are not present on pe- compartments or just in the upper compartment of the chamber, ripheral blood neutrophils, 2) the induction of chemokine re- no significant migratory responses were observed anymore, ceptor expression is accompanied by increased levels of their suggesting gradient-dependent chemotaxis. corresponding chemokines, and 3) that different inflammatory diseases show distinct chemokine receptor expression patterns. Induced chemokine receptors modulate neutrophil effector Induced chemokine receptors confer functional chemokine functions responsiveness To examine whether activation of the chemokine receptors on neu- To examine whether the chemokine receptors expressed on in- trophils from BALF and SF also modulated antibacterial effector filtrated neutrophils in BALF and SF were functional, migration functions by neutrophils, respiratory burst, phagocytosis, and bac- of BALF/SF-isolated neutrophils upon stimulation with their terial killing capacity of BALF/SF isolated neutrophils upon stim- respective chemokine ligands was analyzed ex vivo (Fig. 4). ulation with their respective chemokines were analyzed. Although Neutrophils isolated from BALF and SF migrated to their re- CCL2, CCL3, and CXCL11 treatment enhanced the respiratory spective ligands, whereas neutrophils isolated from peripheral burst of COPD BALF-isolated neutrophils toward fMLP stimula- blood did not or only at a very low level. Ab blocking of the tion, CXCL12 decreased the respiratory burst capacity (Fig. 5A). respective chemokine receptors largely abrogated the chemo- Incubation with chemokines along with PMA gave similar results kine-induced neutrophil chemotaxis (Fig. 4A), whereas isotype (data not shown). Similarly, CCL2, CCL3, and CXCL11 treatment The Journal of Immunology 8061 Downloaded from http://www.jimmunol.org/ by guest on September 27, 2021

FIGURE 7. Induction of chemokine receptor expression on neutrophils in vitro. A, Effect of BALF, SF, and proinflammatory cytokines on chemokine receptor expression of neutrophils. Neutrophils were isolated from peripheral blood of healthy controls (2 ϫ 106/ml). Thereupon, neutrophils were incubated for6hat37°C with cell-free BALF supernatant, cell-free SF supernatant, GM-CSF (10 ng/ml), IL-8 (500 ng/ml), TNF-␣ (100 ng/ml), IL-1␤ (100 ng/ml), IFN-␥ (500 U/ml), or the combination of GM-CSF (10 ng/ml), TNF-␣ (100 ng/ml), and IFN-␥ (500 U/ml). To examine whether the induction of chemokine receptor expression on neutrophils is dependent on protein synthesis, the effect of CHX (2 ␮g/ml) pretreatment was analyzed. After the incubation period, neutrophils were washed twice with ice-cold PBS, incubated with Abs, and analyzed by flow cytometry as described above. Bars represent the means Ϯ SEM of independent experiments with p Ͻ 0.05 vs buffer-treated neutrophils. B, Effect of long-term incubation and cytokine stimulation on chemokine ,ء .cells from three different healthy control donors receptor expression of neutrophils. Neutrophils were isolated from peripheral blood of healthy controls (2 ϫ 106/ml) and were incubated in serum-free HBSS for 0, 12, or 24 h at 37°C with or without CHX (2 ␮g/ml) pretreatment. After the incubation period, neutrophils were washed twice with ice-cold PBS, incubated with Abs for 40 min (see above), washed two times with PBS, and analyzed by flow cytometry as described above. In parallel, annexin V staining was performed. Bars p Ͻ 0.05 vs buffer-treated neutrophils. C, Annexin V. Peripheral ,ء .represent the means Ϯ SEM of independent experiments with cells from three different donors blood neutrophils were in vitro cultured for 24 h. After the incubation period, neutrophils were incubated with Abs against CCR5 or CXCR4 along with annexin V(upper panel). BALF neutrophils were stained with CCR5, CXCR4, and/or annexin V directly after isolation (lower panel). increased the phagocytosis of P. aeruginosa (Fig. 5B) by neutro- these changes finally modulate the bacterial killing capacity of phils, whereas CCL2, CCL3, CCL11, and CXCL11 stimulated the neutrophils, we incubated BALF-isolated neutrophils with these ␣-defensin release by neutrophils (Fig. 5C). To investigate how chemokines (Fig. 6). CXCL11 induced the strongest bacterial

Table II. Cytokine levelsa

CF (n ϭ 10) COPD (n ϭ 10) Asthma (n ϭ 11) RA (n ϭ 10) Controls (n ϭ 10)

TNF-␣ (pg/ml) 493 Ϯ 272 312 Ϯ 143 185 Ϯ 77 265 Ϯ 118 Not detectable GM-CSF (pg/ml) 547 Ϯ 302 390 Ϯ 187 273 Ϯ 146 322 Ϯ 226 29 Ϯ 14 IFN-␥ (pg/ml) 54 Ϯ 25 43 Ϯ 39 18 Ϯ 17 39 Ϯ 28 Not detectable

a Results are expressed as means Ϯ SD. 8062 CHEMOKINE RECEPTORS ON INFILTRATED NEUTROPHILS Downloaded from http://www.jimmunol.org/ by guest on September 27, 2021

FIGURE 8. Effect of Toll-like/NOD2 receptor ligands on chemokine receptor expression of neutrophils. Neutrophils (106/ml) from the blood of healthy controls were preincubated with 50 ng/ml recombinant human GM-CSF for 90 min and were then incubated for6hat37°C in HBSS with 100 ng/ml LPS, ␮ ␮ ␮ ␮ ␮ ␮ ␮ ␮ ␮ 10 g/ml Pam3CSK4,10 g/ml LTA, 10 g/ml PGN, 10 g/ml MDP, 10 g/ml R-848, 50 g/ml poly(I:C), 100 g/ml CpG, 1 g/ml flagellin, or 50 g/ml zymosan A. After the incubation period, neutrophils were incubated with CCR1, CCR2, CCR3, CCR5, CXCR3, or CXCR4 Abs and analyzed by flow .p Ͻ 0.05 vs HBSS-treated neutrophils ,ء .cytometry. The means Ϯ SEM of five independent experiments with cells from different donors are shown

killing capacity, while CXCL12 attenuated bacterial killing (Fig. Cytokines differentially regulate chemokine receptor expression 6A). Blocking of CXCR3 or CXCR4 reversed these effects (Fig. on neutrophils 6B). These data indicate that chemokine receptor-expressing neutrophils in BALF are activated by their ligands, which results in an Peripheral blood isolated neutrophils were incubated for 6 h with enhanced antibacterial capacity. pooled cell-free BALF supernatant from CF patients, pooled cell- To examine which factors account for the induction of chemo- free SF supernatant from RA patients. or with proinflammatory kine receptor surface expression on infiltrating neutrophils, we per- cytokines that are typically found in BALF/SF of patients with formed three approaches to mimic the inflammatory microenvi- chronic lung diseases or RA (Fig. 7A). Both BALF and SF induced ronment infiltrated neutrophils are faced with: 1) proinflammatory significant up-regulation of CXCR3 Ͼ CCR1 Ͼ CCR3 surface cytokines, 2) long-term neutrophil culture/apoptosis, and 3) TLR/ expressions on neutrophils. Further analyses revealed that GM- NOD2 activation. CSF and mainly IFN-␥-induced CCR1 expression, IFN-␥-induced The Journal of Immunology 8063 Downloaded from http://www.jimmunol.org/ by guest on September 27, 2021

FIGURE 9. CXCR3 expression in neutrophils. A, Confocal microscopy. Neutrophils were isolated from peripheral blood of healthy controls (2 ϫ 106/ml). Where indicated, neutrophils were permeabilized with an equal volume of cold 0.1% (w/v) Triton X-100. Neutrophils were stained with rabbit anti-CXCR3 Abs, anti-rabbit-Ig Alexa Fluor 555, and Con A conjugated to Alexa Fluor 488. Confocal laser-scanning microscopy was performed with the Leica TCS NT laser system using a Leica DM IRB microscope. Red color represents CXCR3 receptors and green color Con A. B, Mobilization of intracellular CXCR3 expression. Neutrophils (2 ϫ 106/ml) were incubated in a shaking water bath at 37°C before addition of the (priming) agents CytB (5 ␮g/ml, 5 min) or PAF (1 ␮mol/L, 2 min) and further stimulation with fMLP (1 ␮mol/L). After the incubation time, the CXCR3 surface expression was analyzed by flow cytometry. Green line histogram: isotype control; blue-filled histogram: CXCR3 surface expression. C, Coexpression of CXCR3 and CD63. Neutrophils were isolated and stimulated with CytB plus fMLP or PAF plus fMLP as described above and were costained with CXCR3, CD63, and CD66b. Where indicated, isotype controls were used instead of the specific Abs.

CCR3 expression, and the combination of GM-CSF, TNF-␣, and and CCR3 expressions but had no effect on CXCR3 up- or CXCR4 IFN-␥ were the most potent stimulators of CCR1 and CCR3 sur- down-regulation, suggesting differential involvement of protein face expression. In contrast to CCR1 and CCR3, CXCR4 surface neosynthesis. These studies indicate that proinflammatory cyto- expression was decreased after treatment with these proinflamma- kines differentially modulate chemokine receptor expression on tory cytokines. Neither cytokine alone nor cytokines in combina- neutrophils. Although CCR1 and CCR3 expressions are induced, tion had a significant effect on CCR2, CCR5, or CXCR3 surface CXCR4 expression is decreased upon cytokine stimulation. The expression on neutrophils. To evaluate whether the BALF stimulatory effect of BALF/SF on CXCR3 surface expression re- (CXCR3)- or cytokine (CCR1, CCR3)-elicited up-regulation or mained elusive. These data demonstrate that proinflammatory cy- down-regulation (CXCR4) of chemokine receptor expressions tokines, in particular GM-CSF, TNF-␣, and IFN-␥, differentially were dependent on protein neosynthesis, we used CHX. CHX pre- induce chemokine receptor expression on neutrophils. Therefore, treatment almost completely prevented the up-regulation of CCR1 we quantitated these cytokines in BALFs and SFs from the 8064 CHEMOKINE RECEPTORS ON INFILTRATED NEUTROPHILS included patients and control subjects and found markedly in- Neutrophils store CXCR3 in azurophil granules creased levels of GM-CSF, TNF-␣, and IFN-␥ in all chronic dis- Since the Pam3CSK4-induced up-regulation of CXCR3 surface ex- ease conditions (Table II). pression occurred already after 30–60 min of TLR stimulation and was not prevented by CHX (data not shown), we hypothesized that CXCR3 might be stored intracellularly in neutrophils and does not Neutrophil apoptosis/senescence induces CCR5 and CXCR4 require de novo receptor synthesis. Confocal microscopy of per- surface expression meabilized neutrophils revealed that CXCR3 was stored intracel- Since inflammatory neutrophils are long-lived compared with cir- lularly in resting neutrophils in a granular staining pattern (Fig. culating neutrophils (1, 14, 39), we hypothesized that apoptosis/ 9A). The role of the microfilament and cytoskeletal apparatus in senescence modulates chemokine receptor expression on neutro- this process was evaluated with CytB, an inhibitor of microfila- phils. Our experiments showed that long-term culture of peripheral ment functions, as described previously by us (42). Flow cytomet- blood-isolated neutrophils induced CCR5 and CXCR4 surface ex- ric studies showed that stimulation of granule release with CytB pression after 12 h and most pronounced after 24 h of incubation (Fig. plus fMLP, releasing primary and specific granules as well as se- 7B). Up-regulation of CCR5 and CXCR4 expression was largely pre- cretory vesicles, strongly up-regulated CXCR3 surface expression vented by CHX pretreatment. To test whether the induction of CCR5 on neutrophils, whereas PAF plus fMLP, releasing only specific and CXCR4 expression might be due to apoptosis, we assessed an- granules and secretory vesicles, did not induce CXCR3 surface nexin V expression on cultured neutrophils (Fig. 7, B and C). After expression (Fig. 9B). Further costainings with CD63, a marker for 12 h and more strongly after 24 h, the cultured neutrophils underwent azurophil granules, CD66b, a marker for specific granules, or ϩ Downloaded from apoptosis (Fig. 7B). Although the majority of CCR5 neutrophils CD35, a marker for secretory vesicles, demonstrated coexpression ϩ ϩ were annexin V , CXCR4 neutrophils consisted of two almost of CXCR3 with CD63, but not with CD66b (Fig. 9C) or with equal populations of annexin Vϩ and annexin VϪ cells (Fig. 7C), CD35 (data not shown). Stimulation with Pam3CSK4 also resulted suggesting that CXCR4 surface induction cannot be solely explained in release of CD63ϩ granules associated with CXCR3 up-regula- by apoptotic membrane changes. The induction of CCR5 and CXCR4 tion on the cell surface (data not shown). These findings indicate expression on the surface of neutrophils was completely (CCR5) or that CXCR3 is stored in azurophil granules in neutrophils. partially (CXCR4) inhibited by zVAD-fmk, a general apoptosis in- http://www.jimmunol.org/ hibitor (data not shown), suggesting a direct involvement of apoptosis in the up-regulation of CCR5 on neutrophils. In contrast to 24-h cul- ϩ ϩ Discussion tured peripheral blood-derived neutrophils, CCR5 and CXCR4 The present study provides evidence in humans that the inflam- neutrophils in BALF from patients with COPD were mostly nonapop- Ϫ matory microenvironment induces a novel chemokine receptor totic (annexin V ), indicating that factors in BALF might protect the repertoire on infiltrated neutrophils that expands their functional neutrophils from apoptosis. When viewed in combination, these stud- responsiveness to surrounding chemokines. Distinct mechanisms ies demonstrate that long-term incubation induces CCR5 and CXCR4 were found to induce chemokine receptor expression on neutro- surface expression on neutrophils, effects that were dependent phils, mediated via TLR/NOD2 activation, cytokine stimulation, or by guest on September 27, 2021 (CCR5) or partially dependent (CXCR4) on apoptosis. neutrophil senescence/apoptosis. After induction of chemokine receptors in chronic lung diseases in situ, activation of the receptors differentially modulated neutrophil effector responses. Since the Toll-like and NOD2 receptor activation up-regulate CCR5 and up-regulation of chemokine receptors was exclusively found on CXCR3 surface expression on neutrophils infiltrated neutrophils at inflammatory sites, the targeting of these Next, we investigated whether TLR or NOD2 ligands, which are chemokine receptors may have the potential to site-specifically abundantly present in CF and COPD airway fluids (40, 41), mod- target neutrophilic inflammation. ulate chemokine receptor expression on isolated neutrophils. We In contrast to eosinophils, human neutrophils are traditionally treated neutrophils with TLR agonists plus GM-CSF, since GM- known to express a very restricted pattern of CXC chemokine CSF was previously found to generally enhance the effect of TLR receptors (13) and are unresponsive to CC chemokines (6, 7). Data ligands on neutrophils (37). We found that among all chemokine obtained from animal models, however, suggest that under inflam- receptors analyzed, only the surface expression of CCR5 and matory conditions neutrophils are able to respond to chemokines CXCR3 were significantly affected by treatment with TLR ligands that are functionally inactive under resting conditions and express (Fig. 8). The TLR2/NOD2 ligands PGN and MDP induced CCR5 chemokine receptors that are absent on quiescent neutrophils (14, expression, while the TLR1/TLR2 ligand Pam3CSK4 up-regulated 18, 43–46). In particular, CCL2 was found to elicit neutrophil CXCR3 surface expression on neutrophils. The up-regulation of transendothelial migration in adjuvant-induced vasculitis in rats, CCR5 or CXCR3 surface expression after NOD2/TLR stimulation whereas neutrophils from naive animals did not respond to the was not due to apoptosis or cell death as assessed by annexin V chemokine (18). Consistent with the functional response, increased and PI staining (data not shown). GM-CSF slightly enhanced the expression levels of CCR1 and CCR2 were detected on neutrophils effect of PGN, MDP, or Pam3CSK4 on CCR5 and CXCR3 expres- from adjuvant-immunized animals, while both receptors were ab- sion, respectively. GM-CSF up-regulated CCR1 expression on sent on naive neutrophils. The potential role of CC chemokine neutrophils, as also shown above, but TLR ligands alone had no receptors in neutrophil recruitment is further corroborated by the effect on CCR1 expression. finding that murine neutrophils during sepsis, following cecal li- No effects were found of apoptotic bystander cells (apoptotic T gation and puncture, bind and respond to CCL2 and CCL3, asso- cells, neutrophils, or macrophages) on chemokine receptor expres- ciated with increased mRNA expressions of CCR1, CCR2, and sion of isolated neutrophils in vitro (data not shown). CCR5 in neutrophils (44). In a murine ischemia-reperfusion When viewed in combination, these studies demonstrate that model, genetic knockout of CCR1, CCR2, or CCR5 impaired neu- conditions typically present in the inflammatory microenvironment trophil migration to postischemic tissue through effects on intra- (cytokines, long-term culture and TLR ligands) differentially mod- vascular adherence and transmigration (47). Neutralization of ulate the chemokine receptor expression on neutrophils. CCL3 in murine models of LPS-induced lung injury attenuated The Journal of Immunology 8065 pulmonary neutrophil influx (45, 46), and neutrophils from inflam- treatment. This finding is consistent with previous reports by Bruhl matory exudates migrated to CCL3 (43). Previous studies with et al. (50) and Nagase et al. (51) demonstrating that CXCR4 on peripheral blood-isolated human neutrophils found that GM-CSF neutrophils is internalized through the action of proinflammatory and TNF-␣ primed neutrophils for migration to CCL3 via a CCR5- cytokines. We found that long-term culture up-regulated CCR5 dependent mechanism (19, 21). However, the expression and func- and CXCR4 surface expression in a protein synthesis-dependent tional role of chemokine receptors on infiltrated neutrophils in hu- manner, whereas no effect on CCR1, CCR2, CCR3, or CXCR3 man inflammatory diseases has not been investigated so far. Our was observed. Interestingly, after 24 h of culture, CCR5ϩ neutro- data provide evidence that neutrophils at the pulmonary and sy- phils were mainly annexin Vϩ, while CXCR4ϩ neutrophils were novial site of inflammation express CCR1, CCR2, CCR3, CCR5, only partially apoptotic. In striking contrast, CCR5ϩ and CXCR4ϩ CXCR3, and CXCR4, which are absent or only marginally ex- infiltrated neutrophils in BALF were almost completely annexin pressed on peripheral blood neutrophils. The expression pattern of VϪ, suggesting that factors in vivo preserve neutrophil viability these chemokine receptors was inversely related to the expression but allow the up-regulation of CCR5 and CXCR4. G-CSF and characteristics found for conventional CXCR1 and CXCR2 recep- GM-CSF are well known to promote neutrophil survival (52, 53). tors on neutrophils, which were highly expressed on circulating Given this fact, we speculate that the high levels of G-CSF and cells but were decreased on infiltrated neutrophils. Although GM-CSF present in BALF of patients with chronic lung diseases CXCR2ϩ neutrophils were less frequently found in BALF/SF ϩ (54) may protect neutrophils from apoptosis in situ. compared with peripheral blood in general, CXCR1 neutrophils CCR5 has been found previously to be expressed on apoptotic were more specifically reduced in BALF from patients with murine neutrophils and to play a role in sequestering CCR5 ligands chronic lung diseases compared with BALF from healthy controls, during resolution of inflammation in murine peritonitis (55). This Downloaded from which is in line with previously published results on CXCR1/ finding in mice is in line with our observation in human neutro- CXCR2 (48). phils that CCR5 expression was induced by apoptosis in vitro. The Since the expression of these chemokine receptors in situ was functional significance of CCR5 on neutrophils remains to be es- associated with high amounts of the respective chemokine ligands tablished, but based on our findings and the data from the latter in the inflammatory microenvironment, a physical interaction of murine study, we speculate that CCR5, induced on human neutro- these chemokines with chemokine receptor-expressing neutrophils phils upon apoptosis, may similarly sequester CCR5 ligands in http://www.jimmunol.org/ is probable. This interaction has functional consequences, since we situ. Several pieces of evidence in our data, however, suggest that found that infiltrated neutrophils are capable of responding to these apoptosis may not be the only factor that induces and regulates chemokines. Chemokine receptor-expressing neutrophils isolated CCR5 and CXCR4 expression on infiltrated human neutrophils: 1) from BALF or SF of patients with chronic lung diseases or RA CCR5 and CXCR4 expressions were mainly found on nonapop- migrated to their respective chemokine ligands ex vivo. Because totic BALF neutrophils in situ; 2) infiltrated pulmonary neutro- the migratory capacity of these isolated cells was relatively low, phils, in contrast to in vitro generated apoptotic neutrophils (55, we performed studies to discriminate chemotaxis from chemoki- 56), were capable of migrating to CCR5 (CCL4) and CXCR4 nesis. These studies confirmed that the observed chemokine-in-

(CXCL12) ligands, which is in line with previous reports on neu- by guest on September 27, 2021 duced cell migration was indeed gradient-dependent chemotaxis. trophil migration to CCR5 (21) and CXCR4 (50) ligands; and 3) The ligand activation of chemokine receptor-expressing neutro- TLR1/2/NOD2 activation induced CCR5 surface expression inde- phils isolated from BALF of patients with COPD resulted in mod- pendently from apoptosis. To further elucidate the effect of the ulation of antibacterial neutrophil effector responses. Specifically, the proinflammatory chemokines CCL2, CCL3, and CXCL11 en- pulmonary microenvironment on chemokine receptor expression hanced antibacterial neutrophil responses, whereas the homeostatic on neutrophils, we treated isolated neutrophils with several TLR chemokine CXCL12 suppressed fMLP-induced respiratory burst ligands that are abundantly present in chronic bacterial lung dis- and bacterial killing capacity by neutrophils. Regarding the com- eases such as CF and COPD lung disease (41). These studies plex situation in vivo, chemokines produced at sites of inflamma- showed that CCR5 and CXCR3 up-regulation were susceptible tion may have a synergistic effect on local neutrophil responses as toward TLR/NOD2 receptor activation. Although TLR2/NOD2 li- shown previously for the cooperation between IL-8 and other che- gands (57) induced TLR5 surface expression, TLR1/TLR2 activa- mokines in vitro (49). tion strongly up-regulated CXCR3 surface expression on neutro- To unravel which factors induce the novel chemokine receptor phils. These findings suggest that the encounter of neutrophils with expression on infiltrated neutrophils, we mimicked in vitro several bacterial pathogens modulates their chemokine receptor expres- conditions characteristic for the inflammatory microenvironment, sion pattern. in particular proinflammatory cytokines, long-term survival, and CXCR3, which shares an amino acid homology with CXCR1 contact with pathogens resulting in activation of TLR/NOD recep- and CXCR2 of 50–60% (58), is traditionally known to be ex- tors on neutrophils. These studies demonstrated that CCR1, CCR3, pressed on activated Th1 lymphocytes associated with chronic in- CCR5, CXCR3, and CXCR4 surface expressions were induced via flammatory diseases and has not been described to be expressed on different mechanisms. CCR1 and CCR3 were up-regulated through neutrophils so far (59). Our study demonstrates that CXCR3 sur- cytokines, CCR5 via NOD2 activation and apoptosis, CXCR3 face expression was present on infiltrated neutrophils in inflam- through TLR1/TLR2 activation, and CXCR4 in part via apoptosis. matory human diseases in situ. We further found that CXCR3 was GM-CSF and IFN-␥ up-regulated CCR1- and IFN-␥-induced stored in intracellular granules in resting neutrophils and exocyto- CCR3 expression, which is in line with two previous studies show- sis experiments demonstrated that the appearance of CXCR3 sur- ing that GM-CSF and IFN-␥ induce mRNA expression of CCR1 face expression was paralleled by translocation of intracellular ϩ and CCR3 in neutrophils in vitro (8, 20). We extend these findings CD63 neutrophil granules to the cell surface. Together with the by showing an effect of these cytokines on protein levels of CCR1 fact that CytB plus fMLP, but not PAF plus fMLP, up-regulated and CCR3 and further demonstrate that the combination of GM- CXCR3 surface expression, these findings indicate that CXCR3 is CSF, TNF-␣, and IFN-␥ is the most potent inducer of CCR1 and stored in azurophil granules in neutrophils. This is the first dem- CCR3 expression. In contrast to all other chemokine receptors an- onstration (to the best of our knowledge) that neutrophils store a alyzed, CXCR4 was down-regulated by proinflammatory cytokine chemokine receptor in primary granules. 8066 CHEMOKINE RECEPTORS ON INFILTRATED NEUTROPHILS

In contrast to inflammatory chemokine receptors, the homeo- determination of CCR1 expression on various types of leukocytes. J. Leukocyte static chemokine receptor CXCR4 regulates basal trafficking of Biol. 60: 658–666. 10. Zhang, S., B. S. Youn, J. L. Gao, P. M. Murphy, and B. S. Kwon. 1999. Dif- immune cells (60). Inducible surface expression of CXCR4 on ferential effects of leukotactin-1 and macrophage inflammatory protein-1 ␣ on human neutrophils has been described previously (50, 51, 61), and neutrophils mediated by CCR1. J. Immunol. 162: 4938–4942. neutrophils in SF from patients with inflammatory joint diseases 11. Olson, T. S., and K. Ley. 2002. Chemokines and chemokine receptors in leuko- ϩ cyte trafficking. Am. J. Physiol. 283: R7–R28. were CXCR4 (62), which is consistent with our findings. High 12. Baggiolini, M. 1993. Chemotactic and inflammatory cytokines: CXC and CC levels of the CXCR4 ligand CXCL12 have been found in SF from proteins. Adv. Exp. Med. Biol. 351: 1–11. RA patients (63), where CXCL12 is suggested to contribute to the 13. Baggiolini, M., B. Dewald, and B. Moser. 1997. Human chemokines: an update. Annu. Rev. Immunol. 15: 675–705. accumulation of leukocytes (64, 65). In vitro, CXCL12 was found 14. Yamashiro, S., H. Kamohara, J. M. Wang, D. Yang, W. H. Gong, and to mediate desensitization of SF-/fMLP-activated respiratory burst T. Yoshimura. 2001. Phenotypic and functional change of cytokine-activated neutrophils: inflammatory neutrophils are heterogeneous and enhance adaptive in neutrophils (66). The role of the CXCL12-CXCR4 axis in lung immune responses. J. Leukocyte Biol. 69: 698–704. diseases is less clear. Our study is the first to show that infiltrated 15. Solomkin, J. S., R. C. Bass, H. S. Bjornson, C. J. Tindal, and G. F. Babcock. neutrophils in chronic lung diseases highly express CXCR4 on 1994. Alterations of neutrophil responses to tumor necrosis factor ␣ and interleukin-8 following human endotoxemia. Infect. Immun. 62: 943–947. their surface and are surrounded by high levels of CXCL12 in the 16. Wagner, J. G., and R. A. Roth. 1999. Neutrophil migration during endotoxemia. airway microenvironment. We further show that CXCL12 via J. Leukocyte Biol. 66: 10–24. CXCR4 dampens the respiratory burst activity by pulmonary neu- 17. Bless, N. M., M. Huber-Lang, R. F. Guo, R. L. Warner, H. Schmal, B. J. Czermak, T. P. Shanley, L. D. Crouch, A. B. Lentsch, V. Sarma, et al. 2000. trophils. Further evidence on the role of CXCR4 in lung disease Role of CC chemokines (macrophage inflammatory protein-1 ␤, monocyte che- comes from a study in a mouse model of allergic asthma, demon- moattractant protein-1, RANTES) in acute lung injury in rats. J. Immunol. 164: strating a beneficial effect of the CXCR4 antagonist AMD3100 on 2650–2659. Downloaded from 18. Johnston, B., A. R. Burns, M. Suematsu, T. B. Issekutz, R. C. Woodman, and pulmonary inflammation (67). Another murine study found that P. Kubes. 1999. Chronic inflammation upregulates chemokine receptors and in- senescent CXCR4high neutrophils preferentially home to the bone duces neutrophil migration to monocyte chemoattractant protein-1. J. Clin. In- marrow in a CXCR4-dependent manner, suggesting a role for vest. 103: 1269–1276. 19. Montecucco, F., S. Steffens, F. Burger, A. Da Costa, G. Bianchi, M. Bertolotto, CXCR4 on neutrophils for the clearance of senescent neutrophils F. Mach, F. Dallegri, and L. Ottonello. 2008. Tumor necrosis factor-␣ (TNF-␣) (61). Despite these intriguing findings, further studies are required induces integrin CD11b/CD18 (Mac-1) up-regulation and migration to the CC chemokine CCL3 (MIP-1␣) on human neutrophils through defined signalling to fully understand the functional significance of CXCR4 on in- http://www.jimmunol.org/ pathways. Cell. Signal. 20: 557–568. filtrated neutrophils in chronic inflammatory diseases. 20. Cheng, S. S., J. J. Lai, N. W. Lukacs, and S. L. Kunkel. 2001. Granulocyte- In summary, our data indicate that infiltrating neutrophils ac- macrophage colony stimulating factor up-regulates CCR1 in human neutrophils. quire a novel chemokine receptor expression repertoire and func- J. Immunol. 166: 1178–1184. 21. Ottonello, L., F. Montecucco, M. Bertolotto, N. Arduino, M. Mancini, tional chemokine responsiveness, enabling them to adapt to A. Corcione, V. Pistoia, and F. Dallegri. 2005. CCL3 (MIP-1␣) induces in vitro chronic inflammatory conditions. These data demonstrate that che- migration of GM-CSF-primed human neutrophils via CCR5-dependent activation mokine receptors on neutrophils are not only involved in cell mi- of ERK 1/2. Cell. Signal. 17: 355–363. 22. Shwachman, H., and L. L. Kulczycki. 1958. Long-term study of 105 patients with gration, but specifically modulate cellular effector functions at the cystic fibrosis. Am. J. Dis. Child. 96: 6–15. site of inflammation. Inducible chemokine receptors on infiltrated 23. 1995. Standards for the diagnosis and care of patients with chronic obstructive

pulmonary disease: American Thoracic Society. Am. J. Respir. Crit. Care Med. by guest on September 27, 2021 neutrophils provide a novel site-specific target to modulate neu- 152: S77–121. trophilic inflammation in chronic lung disease. 24. Pauwels, R. A., A. S. Buist, P. M. Calverley, C. R. Jenkins, and S. S. Hurd. 2001. Global strategy for the diagnosis, management, and prevention of chronic obstructive pulmonary disease: NHLBI/WHO Global Initiative for Chronic Ob- Acknowledgments structive Lung Disease (GOLD) Workshop summary. Am. J. Respir. Crit. Care We thank Andrew D. Luster and Benjamin D. Medoff, Center for Immunology Med. 163: 1256–1276. and Inflammatory Diseases, Massachusetts General Hospital, Harvard Univer- 25. American Thoracic Society. 1995. Standardization of Spirometry: 1994 update. Am. J. Respir. Crit. Care Med. 152: 1107–1136. sity, for helpful discussions. We thank Nikolaus Rieber, University Childrens’ 26. Arnett, F. C., S. M. Edworthy, D. A. Bloch, D. J. McShane, J. F. Fries, Hospital, Munich, Germany, for critical revisions of this manuscript. N. S. Cooper, L. A. Healey, S. R. Kaplan, M. H. Liang, H. S. Luthra, et al. 1988. The American Rheumatism Association 1987 revised criteria for the classification of rheumatoid arthritis. Arthritis Rheum. 31: 315–324. Disclosures 27. Griese, M., J. Felber, K. Reiter, P. Strong, K. Reid, B. H. Belohradsky, G. Jager, The authors have no financial conflict of interest. and T. Nicolai. 2004. Airway inflammation in children with tracheostomy. Pe- diatr. Pulmonol. 37: 356–361. 28. Reinhardt, N., C. I. U. Chen, D. Loppow, T. Schink, I. Kleinau, R. A. Jorres, References U. Wahn, H. Magnussen, and K. P. Paul. 2003. Cellular profiles of induced 1. Dallegri, F., and L. Ottonello. 1997. Tissue injury in neutrophilic inflammation. sputum in children with stable cystic fibrosis: comparison with BAL. Eur. Respir. Inflamm. Res. 46: 382–391. J. 22: 497–502. 2. Nathan, C. 2006. Neutrophils and immunity: challenges and opportunities. Nat. 29. Alexis, N., J. Soukup, A. Ghio, and S. Becker. 2000. Sputum phagocytes from Rev. Immunol. 6: 173–182. healthy individuals are functional and activated: A flow cytometric comparison 3. Moser, B., M. Wolf, A. Walz, and P. Loetscher. 2004. Chemokines: multiple with cells in bronchoalveolar lavage and peripheral blood. Clin. Immunol. 97: levels of leukocyte migration control. Trends Immunol. 25: 75–84. 21–32. 4. Rossi, D., and A. Zlotnik. 2000. The biology of chemokines and their receptors. 30. Mul, F. P. J., A. E. M. Zuurbier, H. Janssen, J. Calafat, S. van Wetering, Annu. Rev. Immunol. 18: 217–242. P. S. Hiemstra, D. Roos, and P. L. Hordijk. 2000. Sequential migration of neu- 5. Moser, B., and P. Loetscher. 2001. Lymphocyte traffic control by chemokines. trophils across monolayers of endothelial and epithelial cells. J. Leukocyte Biol. Nat. Immunol. 2: 123–128. 68: 529–537. 6. Schweizer, R. C., B. A. Welmers, J. A. Raaijmakers, P. Zanen, J. W. Lammers, 31. Pang, G., R. Clancy, M. Cong, M. Ortega, R. Zhigang, and G. Reeves. 2000. and L. Koenderman. 1994. RANTES- and interleukin-8-induced responses in Influenza virus inhibits lysozyme secretion by sputum neutrophils in subjects normal human eosinophils: effects of priming with interleukin-5. Blood 83: with chronic bronchial sepsis 13. Am. J. Respir. Crit. Care Med. 161: 718–722. 3697–3704. 32. De Gendt, C. M., L. S. De Clerck, C. H. Bridts, and W. J. Stevens. 1996. The use 7. Ulfman, L. H., J. Alblas, C. W. van Aalst, J. J. Zwaginga, and L. Koenderman. of calcein acetomethylester (AM)-labelled polymorphonuclear cells in a polycar- 2005. Differences in potency of CXC chemokine ligand 8-, CC chemokine ligand bonate filter chemotaxis assay. Clin. Chim. Acta 249: 189–195. 11-, and C5a-induced modulation of integrin function on human eosinophils. 33. Schweizer, R. C., B. A. Kessel-Welmers, R. A. Warringa, T. Maikoe, J. Immunol. 175: 6092–6099. J. A. Raaijmakers, J. W. Lammers, and L. Koenderman. 1996. Mechanisms in- 8. Bonecchi, R., N. Polentarutti, W. Luini, A. Borsatti, S. Bernasconi, M. Locati, volved in eosinophil migration. Platelet-activating factor-induced chemotaxis and C. Power, A. Proudfoot, T. N. C. Wells, C. Mackay, et al. 1999. Up-regulation interleukin-5-induced chemokinesis are mediated by different signals. J. Leuko- of CCR1 and CCR3 and induction of chemotaxis to CC chemokines by IFN-␥ in cyte Biol. 59: 347–356. human neutrophils. J. Immunol. 162: 474–479. 34. Jan, M. S., Y. H. Huang, B. Shieh, R. H. Teng, Y. P. Yan, Y. T. Lee, K. K. Liao, 9. Su, S. B., N. Mukaida, J. Wang, H. Nomura, and K. Matsushima. 1996. Prepa- and C. Li. 2006. CC chemokines induce neutrophils to chemotaxis, degranula- ration of specific polyclonal antibodies to a C-C chemokine receptor, CCR1, and tion, and ␣-defensin release. J. Acquired Immune. Defic. Syndr. 41: 6–16. The Journal of Immunology 8067

35. vanPelt, L. J., R. vanZwieten, R. S. Weening, D. Roos, A. J. Verhoeven, and 53. Yasui, K., Y. Sekiguchi, M. Ichikawa, H. Nagumo, T. Yamazaki, A. Komiyama, B. G. J. M. Bolscher. 1996. Limitations on the use of dihydrorhodamine 123 for and H. Suzuki. 2002. Granulocyte macrophage-colony stimulating factor delays flow cytometric analysis of the neutrophil respiratory burst. J. Immunol. Methods neutrophil apoptosis and primes its function through Ia-type phosphoinositide 191: 187–196. 3-kinase. J. Leukocyte Biol. 72: 1020–1026. 36. Berger, M., R. U. Sorensen, M. F. Tosi, D. G. Dearborn, and G. Doring. 1989. 54. Hartl, D., M. Griese, M. Kappler, G. Zissel, D. Reinhardt, C. Rebhan, Complement receptor expression on neutrophils at an inflammatory site, the D. J. Schendel, and S. Krauss-Etschmann. 2006. Pulmonary TH2 response in Pseudomonas-infected lung in cystic-fibrosis. J. Clin. Invest. 84: 1302–1313. Pseudomonas aeruginosa-infected patients with cystic fibrosis. J. Allergy Clin. 37. Hayashi, F., T. K. Means, and A. D. Luster. 2003. Toll-like receptors stimulate Immunol. 117: 204–211. human neutrophil function. Blood 102: 2660–2669. 55. Ariel, A., G. Fredman, Y. P. Sun, A. Kantarci, T. E. Van Dyke, A. D. Luster, and 38. Motulsky, H. 1995. Intuitive Biostatistics. Oxford Univ. Press, New York. C. N. Serhan. 2006. Apoptotic neutrophils and T cells sequester chemokines 39. Witko-Sarsat, V., P. Rieu, B. Descamps-Latscha, P. Lesavre, and during immune response resolution through modulation of CCR5 expression. L. Halbwachs-Mecarelli. 2000. Neutrophils: molecules, functions, and patho- Nat. Immunol. 7: 1209–1216. physiological aspects. Lab. Invest. 80: 617–653. 56. Wolach, B., L. J. van der Laan, N. A. Maianski, A. T. Tool, R. van Bruggen, 40. Davis, P. B., M. Drumm, and M. W. Konstan. 1996. Cystic fibrosis. D. Roos, and T. W. Kuijpers. 2007. Growth factors G-CSF and GM-CSF differ- Am. J. Respir. Crit. Care Med. 154: 1229–1256. entially preserve chemotaxis of neutrophils aging in vitro. Exp. Hematol. 35: 41. Parameswaran, G. I., and T. F. Murphy. 2007. Infections in chronic lung diseases. 541–550. Infect. Dis. Clin. North Am. 21: 673–695, viii. 57. Kelsall, B. 2005. Getting to the guts of NOD2. Nat. Med. 11: 383–384. 42. Kuijpers, T. W., A. T. J. Tool, C. E. Vanderschoot, L. A. Ginsel, 58. Marchese, A., M. Heiber, T. Nguyen, H. H. Heng, V. R. Saldivia, R. Cheng, J. J. M. Onderwater, D. Roos, and A. J. Verhoeven. 1991. Membrane-surface P. M. Murphy, L. C. Tsui, X. Shi, and P. Gregor. 1995. Cloning and chromo- antigen expression on neutrophils: a reappraisal of the use of surface-markers for somal mapping of three novel genes, GPR9, GPR10, and GPR14, encoding re- neutrophil activation. Blood 78: 1105–1111. ceptors related to interleukin 8, neuropeptide Y, and somatostatin receptors. 43. Gao, J. L., T. A. Wynn, Y. Chang, E. J. Lee, H. E. Broxmeyer, S. Cooper, Genomics 29: 335–344. H. L. Tiffany, H. Westphal, J. Kwon-Chung, and P. M. Murphy. 1997. Impaired 59. Qin, S., J. B. Rottman, P. Myers, N. Kassam, M. Weinblatt, M. Loetscher, host defense, hematopoiesis, granulomatous inflammation, and type 1-type 2 cy- A. E. Koch, B. Moser, and C. R. Mackay. 1998. The chemokine receptors tokine balance in mice lacking CC chemokine receptor 1. J. Exp. Med. 185:

CXCR3 and CCR5 mark subsets of T cells associated with certain inflammatory Downloaded from 1959–1968. reactions. J. Clin. Invest. 101: 746–754. 44. Speyer, C. L., H. Gao, N. J. Rancilio, T. A. Neff, G. B. Huffnagle, J. V. Sarma, 60. Bleul, C. C., M. Farzan, H. Choe, C. Parolin, I. Clark-Lewis, J. Sodroski, and and P. A. Ward. 2004. Novel chemokine responsiveness and mobilization of T. A. Springer. 1996. The lymphocyte chemoattractant SDF-1 is a ligand for neutrophils during sepsis. Am. J. Pathol. 165: 2187–2196. LESTR/fusin and blocks HIV-1 entry. Nature 382: 829–833. 45. Shanley, T. P., H. Schmal, H. P. Friedl, M. L. Jones, and P. A. Ward. 1995. Role of macrophage inflammatory protein-1␣ (MIP-1␣) in acute lung injury in rats. 61. Martin, C., P. C. E. Burdon, G. Bridger, J. C. Gutierrez-Ramos, T. J. Williams, J. Immunol. 154: 4793–4802. and S. M. Rankin. 2003. Chemokines acting via CXCR2 and CXCR4 control the 46. Standiford, T. J., S. L. Kunkel, N. W. Lukacs, M. J. Greenberger, J. M. Danforth, release of neutrophils from the bone marrow and their return following senes- ␣ cence. Immunity 19: 583–593. R. G. Kunkel, and R. M. Strieter. 1995. Macrophage inflammatory protein-1 http://www.jimmunol.org/ mediates lung leukocyte recruitment, lung capillary leak, and early mortality in 62. Bruhl, H., K. Wagner, H. Kellner, M. Schattenkirchner, D. Schlondorff, and murine endotoxemia. J. Immunol. 155: 1515–1524. M. Mack. 2001. Surface expression of CC- and CXC-chemokine receptors on 47. Reichel, C. A., A. Khandoga, H. J. Anders, D. Schlondorff, B. Luckow, and leucocyte subsets in inflammatory joint diseases. Clin. Exp. Immunol. 126: F. Krombach. 2006. Chemokine receptors Ccr1, Ccr2, and Ccr5 mediate neutro- 551–559. phil migration to postischemic tissue. J. Leukocyte Biol. 79: 114–122. 63. Kanbe, K., K. Takagishi, and Q. Chen. 2002. Stimulation of matrix metallopro- 48. Hartl, D., P. Latzin, P. Hordijk, V. Marcos, C. Rudolph, M. Woischnik, tease 3 release from human chondrocytes by the interaction of stromal cell-de- S. Krauss-Etschmann, B. Koller, D. Reinhardt, A. A. Roscher, et al. 2007. Cleav- rived factor 1 and CXC chemokine receptor 4. Arthritis Rheum. 46: 130–137. age of CXCR1 on neutrophils disables bacterial killing in cystic fibrosis lung 64. Nanki, T., K. Hayashida, H. S. El Gabalawy, S. Suson, K. Shi, H. J. Girschick, S. Yavuz, and P. E. Lipsky. 2000. Stromal cell-derived factor-1-CXC chemokine disease. Nat. Med. 13: 1423–1430. ϩ 49. Gouwy, M., S. Struyf, J. Catusse, P. Proost, and J. Van Damme. 2004. Synergy receptor 4 interactions play a central role in CD4 T cell accumulation in rheu- between proinflammatory ligands of G protein-coupled receptors in neutrophil matoid arthritis synovium. J. Immunol. 165: 6590–6598.

activation and migration. J. Leukocyte Biol. 76: 185–194. 65. Matthys, P., S. Hatse, K. Vermeire, A. Wuyts, G. Bridger, G. W. Henson, by guest on September 27, 2021 50. Bruhl, H., C. D. Cohen, S. Linder, M. Kretzler, D. Schlondorff, and M. Mack. E. De Clercq, A. Billiau, and D. Schols. 2001. AMD3100, a potent and specific 2003. Post-translational and cell type-specific regulation of CXCR4 expression antagonist of the stromal cell-derived factor-1 chemokine receptor CXCR4, in- by cytokines. Eur. J. Immunol. 33: 3028–3037. hibits autoimmune joint inflammation in IFN-␥ receptor-deficient mice. J. Im- 51. Nagase, H., M. Miyamasu, M. Yamaguchi, M. Imanishi, N. H. Tsuno, munol. 167: 4686–4692. K. Matsushima, K. Yamamoto, Y. Morita, and K. Hirai. 2002. Cytokine-medi- 66. Lenoir, M., B. Djerdjouri, and A. Perianin. 2004. Stroma cell-derived factor 1␣ ated regulation of CXCR4 expression in human neutrophils. J. Leukocyte Biol. mediates desensitization of human neutrophil respiratory burst in synovial fluid 71: 711–717. from rheumatoid arthritic patients. J. Immunol. 172: 7136–7143. 52. Saba, S., G. Soong, S. Greenberg, and A. Prince. 2002. Bacterial stimulation of 67. Lukacs, N. W., A. Berlin, D. Schols, R. T. Skerlj, and G. J. Bridger. 2002. epithelial G-CSF and GM-CSF expression promotes PMN survival in CF air- AMD3100, a CxCR4 antagonist, attenuates allergic lung inflammation and air- ways. Am. J. Respir. Cell Mol. Biol. 27: 561–567. way hyperreactivity. Am. J. Pathol. 160: 1353–1360.