Histone Modifications Form a Cell-Type-Specific Chromosomal Bar
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
De Novo MEIS2 Mutation Causes Syndromic Developmental Delay with Persistent Gastro-Esophageal Reflux
Journal of Human Genetics (2016) 61, 835–838 & 2016 The Japan Society of Human Genetics All rights reserved 1434-5161/16 www.nature.com/jhg SHORT COMMUNICATION De novo MEIS2 mutation causes syndromic developmental delay with persistent gastro-esophageal reflux Atsushi Fujita1, Bertrand Isidor2,3, Hugues Piloquet4, Pierre Corre5, Nobuhiko Okamoto6, Mitsuko Nakashima1, Yoshinori Tsurusaki1, Hirotomo Saitsu1, Noriko Miyake1 and Naomichi Matsumoto1 MEIS2 aberrations are considered to be the cause of intellectual disability, cleft palate and cardiac septal defect, as MEIS2 copy number variation is often observed with these phenotypes. To our knowledge, only one nucleotide-level change— specifically, an in-frame MEIS2 deletion—has so far been reported. Here, we report a female patient with a de novo nonsense mutation (c.611C4G, p.Ser204*) in MEIS2. She showed severe intellectual disability, moderate motor/verbal developmental delay, cleft palate, cardiac septal defect, hypermetropia, severe feeding difficulties with gastro-esophageal reflux and constipation. By reviewing this patient and previous patients with MEIS2 point mutations, we found that feeding difficulty with gastro-esophageal reflux appears to be one of the core clinical features of MEIS2 haploinsufficiency, in addition to intellectual disability, cleft palate and cardiac septal defect. Journal of Human Genetics (2016) 61, 835–838; doi:10.1038/jhg.2016.54; published online 26 May 2016 INTRODUCTION at the homeodomain may interfere with DNA binding. Moreover, Meis homeobox 2 (MEIS2;alsoknownasMRG1, NM_170677.4) this female patient also presented with various anomalous features encodes a homeobox (HOX) protein belonging to the three amino and developmental abnormalities. Here, we report on another acid loop extension (TALE) superfamily. -
ESRRB Regulates Glucocorticoid Gene Expression in Mice and Patients with Acute Lymphoblastic Leukemia
University of Massachusetts Medical School eScholarship@UMMS Open Access Articles Open Access Publications by UMMS Authors 2020-07-13 ESRRB regulates glucocorticoid gene expression in mice and patients with acute lymphoblastic leukemia Kayleigh M. Gallagher University of Massachusetts Medical School Et al. Let us know how access to this document benefits ou.y Follow this and additional works at: https://escholarship.umassmed.edu/oapubs Part of the Cancer Biology Commons, and the Neoplasms Commons Repository Citation Gallagher KM, Roderick JE, Tan SH, Tan TK, Murphy L, Yu J, Li R, O'Connor K, Zhu LJ, Green MR, Sanda T, Kelliher MA. (2020). ESRRB regulates glucocorticoid gene expression in mice and patients with acute lymphoblastic leukemia. Open Access Articles. https://doi.org/10.1182/bloodadvances.2020001555. Retrieved from https://escholarship.umassmed.edu/oapubs/4285 This material is brought to you by eScholarship@UMMS. It has been accepted for inclusion in Open Access Articles by an authorized administrator of eScholarship@UMMS. For more information, please contact [email protected]. REGULAR ARTICLE ESRRB regulates glucocorticoid gene expression in mice and patients with acute lymphoblastic leukemia Downloaded from https://ashpublications.org/bloodadvances/article-pdf/4/13/3154/1748491/advancesadv2020001555.pdf by UNIV OF MASSACHUSETTS user on 10 August 2020 Kayleigh M. Gallagher,1 Justine E. Roderick,1 Shi Hao Tan,2 Tze King Tan,2 Leonard Murphy,1 Jun Yu,1 Rui Li,1 Kevin W. O’Connor,1 Julie Zhu,1 Michael R. Green,1 Takaomi Sanda,2 and Michelle A. Kelliher1 1Department of Molecular, Cell and Cancer Biology, University of Massachusetts Medical School, Worcester, MA; and 2Cancer Science Institute of Singapore, Center of Translational Medicine, Singapore Synthetic glucocorticoids (GCs), such as dexamethasone and prednisone, remain key Key Points components of therapy for patients with lymphoid malignancies. -
Identification of GA-Binding Protein Transcription Factor Alpha Subunit
International Journal of Molecular Sciences Article Identification of GA-Binding Protein Transcription Factor Alpha Subunit (GABPA) as a Novel Bookmarking Factor Shunya Goto 1, Masashi Takahashi 1, Narumi Yasutsune 1, Sumiki Inayama 1, Dai Kato 2, Masashi Fukuoka 3, Shu-ichiro Kashiwaba 1 and Yasufumi Murakami 1,2,* 1 Department of Biological Science and Technology, Faculty of Industrial Science and Technology, Tokyo University of Science, 6-3-1 Niijuku, Katsushika-ku, Tokyo 125-8585, Japan; [email protected] (S.G.); [email protected] (M.T.); [email protected] (N.Y.); [email protected] (S.I.); [email protected] (S.K.) 2 Order-MadeMedical Research Inc., 208Todai-Kashiwa VP, 5-4-19 Kashiwanoha, Kashiwa-shi, Chiba-ken 277-0882, Japan; [email protected] 3 Department of Molecular Pharmacology, National Institute of Neuroscience, National Center of Neurology and Psychiatry, Tokyo 187-8551, Japan; [email protected] * Correspondence: [email protected]; Tel.: +81-3-5876-1717 (ext. 1919); Fax: +81-3-5876-1470 Received: 7 February 2019; Accepted: 27 February 2019; Published: 4 March 2019 Abstract: Mitotic bookmarking constitutes a mechanism for transmitting transcriptional patterns through cell division. Bookmarking factors, comprising a subset of transcription factors (TFs), and multiple histone modifications retained in mitotic chromatin facilitate reactivation of transcription in the early G1 phase. However, the specific TFs that act as bookmarking factors remain largely unknown. Previously, we identified the “early G1 genes” and screened TFs that were predicted to bind to the upstream region of these genes, then identified GA-binding protein transcription factor alpha subunit (GABPA) and Sp1 transcription factor (SP1) as candidate bookmarking factors. -
Bioinformatics Identi Cation of Prognostic Factors Associated With
Bioinformatics Identication of Prognostic Factors Associated with Breast Cancer Ying Wei Sichuan University https://orcid.org/0000-0001-8178-4705 Shipeng Zhang College of Pharmacy, North Sichuan Medical College Li Xiao West China School of Basic Medical Sciences and Forensic Medicine Jing Zou West China School of Basic Medical Sciences and Forensic Medicine Yingqing Fu West China School of Basic Medical Sciences and Forensic Medicine Yi Ye West China School of Basic Medical Sciences and Forensic Medicine Linchuan Liao ( [email protected] ) West China School of Basic Medical Sciences and Forensic Medicine https://orcid.org/0000-0003-3700-8471 Research Keywords: Breast cancer, Differentially expressed genes, miRNAs, Transcription factors, Bioinformatic analysis Posted Date: December 2nd, 2020 DOI: https://doi.org/10.21203/rs.3.rs-117477/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/23 Abstract Background: Breast cancer (BRCA) remains one of the most common forms of cancer and is the most prominent driver of cancer-related death among women. The mechanistic basis for BRCA, however, remains incompletely understood. In particular, the relationships between driver mutations and signaling pathways in BRCA are poorly characterized, making it dicult to identify reliable clinical biomarkers that can be employed in diagnostic, therapeutic, or prognostic contexts. Methods: First, we downloaded publically available BRCA datasets (GSE45827, GSE42568, and GSE61304) from the Gene Expression Omnibus (GEO) database. We then compared gene expression proles between tumor and control tissues in these datasets using Venn diagrams and the GEO2R analytical tool. We further explore the functional relevance of BRCA-associated differentially expressed genes (DEGs) via functional and pathway enrichment analyses using the DAVID tool, and we then constructed a protein-protein interaction network incorporating DEGs of interest using the Search Tool for the Retrieval of Interacting Genes (STRING) database. -
Detailed Review Paper on Retinoid Pathway Signalling
1 1 Detailed Review Paper on Retinoid Pathway Signalling 2 December 2020 3 2 4 Foreword 5 1. Project 4.97 to develop a Detailed Review Paper (DRP) on the Retinoid System 6 was added to the Test Guidelines Programme work plan in 2015. The project was 7 originally proposed by Sweden and the European Commission later joined the project as 8 a co-lead. In 2019, the OECD Secretariat was added to coordinate input from expert 9 consultants. The initial objectives of the project were to: 10 draft a review of the biology of retinoid signalling pathway, 11 describe retinoid-mediated effects on various organ systems, 12 identify relevant retinoid in vitro and ex vivo assays that measure mechanistic 13 effects of chemicals for development, and 14 Identify in vivo endpoints that could be added to existing test guidelines to 15 identify chemical effects on retinoid pathway signalling. 16 2. This DRP is intended to expand the recommendations for the retinoid pathway 17 included in the OECD Detailed Review Paper on the State of the Science on Novel In 18 vitro and In vivo Screening and Testing Methods and Endpoints for Evaluating 19 Endocrine Disruptors (DRP No 178). The retinoid signalling pathway was one of seven 20 endocrine pathways considered to be susceptible to environmental endocrine disruption 21 and for which relevant endpoints could be measured in new or existing OECD Test 22 Guidelines for evaluating endocrine disruption. Due to the complexity of retinoid 23 signalling across multiple organ systems, this effort was foreseen as a multi-step process. -
Hierarchical Looping of Zigzag Nucleosome Chains in Metaphase Chromosomes
Hierarchical looping of zigzag nucleosome chains in metaphase chromosomes Sergei A. Grigoryeva,1, Gavin Bascomb, Jenna M. Buckwaltera, Michael B. Schuberta, Christopher L. Woodcockc, and Tamar Schlickb,d,1 aDepartment of Biochemistry and Molecular Biology, Milton S. Hershey Medical Center, Pennsylvania State University College of Medicine, Hershey, PA 17033; bDepartment of Chemistry and Courant Institute of Mathematical Sciences, New York University, New York, NY 10012; cBiology Department, University of Massachusetts, Amherst, MA 01003; and dNYU-ECNU Center for Computational Chemistry, NYU Shanghai, Shanghai 200062, China Edited by Michael Levitt, Stanford University School of Medicine, Stanford, CA, and approved December 22, 2015 (received for review September 14, 2015) The architecture of higher-order chromatin in eukaryotic cell nuclei is However, evidence for 30-nm fibers in interphase nuclei of living largely unknown. Here, we use electron microscopy-assisted nucleo- cells has been controversial (reviewed in refs. 9 and 10). For exam- some interaction capture (EMANIC) cross-linking experiments in ple, whereas a distinct 30-nm fiber architecture is observed in ter- combination with mesoscale chromatin modeling of 96-nucleosome minally differentiated cells (11, 12), neither continuous nor periodic arrays to investigate the internal organization of condensed chroma- 30-nm fibers are observed in the nuclei of proliferating cells (13–15). tin in interphase cell nuclei and metaphase chromosomes at nucleo- However, zigzag features of the chromatin fibers are well supported somal resolution. The combined data suggest a novel hierarchical by nucleosome interaction mapping in vitro (16) and in vivo (15). looping model for chromatin higher-order folding, similar to rope For chromatin architecture within metaphase chromosomes, flaking used in mountain climbing and rappelling. -
Chip Validated H4k5ac (Clone RM140) Antibody with Positive and Negative Primer Sets
www.chromatrap.com Clywedog Rd South Wrexham Industrial Estate Wrexham LL13 9XS, United Kingdom Tel: +44 (0) 1978 666239/40 Email: [email protected] ChIP Validated H4K5ac (Clone RM140) Antibody with Positive and Negative Primer Sets Catalogue no: 900029 Chromatrap®’s ChIP Validated H4K5ac Antibody with Positive Primer Set provides a complete set of tools to assist with a successful ChIP assay. Including: H4K5ac antibody, control rabbit IgG, and positive primer set. The ChIP Validated H4K5ac Antibody with Positive Primer Set is not suitable for use with non-human species. Background: Histone 4 (H4) is one of the five core histone proteins, comprising the protein component of chromatin. H4 is ubiquitous within chromosomes and can be found bound to most gene sequences throughout the genome. Acetylation of lysine 5 on histone 4 (H4K5ac) is associated with open chromatin and active gene transcription. H4K5ac has been shown to have roles in epigenetic bookmarking, a process where genetic information is passed onto daughter cells during cell division. A rabbit IgG is included in this Antibody Primer Set as a negative control for the ChIP experiment. The H4K5ac positive primer set recognises the promoter of the GAPDH gene, associated with active transcription and is a suitable target for this antibody. Suggested Usage: Component Suggested Dilution Figure H4K5ac 2:1 (antibody: chromatin) 1 Rabbit IgG 2:1 (antibody: chromatin) 1 Positive Primer Set Dilute from 4M (provided) to 1M working concentration Please note: Optimal dilutions should be determined by the user. These volumes are stated as guidelines only. Advancements in Epigenetics *This product is for research use only. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Ftsk Actively Segregates Sister Chromosomes in Escherichia Coli
FtsK actively segregates sister chromosomes in Escherichia coli Mathieu Stoufa,b, Jean-Christophe Meilea,b, and François Corneta,b,1 aLaboratoire de Microbiologie et de Génétique Moléculaires, Centre National de la Recherche Scientifique, F-31000, Toulouse, France; and bUniversité Paul Sabatier, Université de Toulouse, F-31000, Toulouse, France Edited by Nancy E. Kleckner, Harvard University, Cambridge, MA, and approved May 23, 2013 (received for review March 6, 2013) Bacteria use the replication origin-to-terminus polarity of their cir- with the divisome, is also required (13, 14). FtsK acts in a region cular chromosomes to control DNA transactions during the cell cy- about 400 kb long (15) and translocates DNA toward dif.Trans- cle. Segregation starts by active migration of the region of origin location is oriented by recognition of the FtsK-orienting polar followed by progressive movement of the rest of the chromo- sequences (KOPS) DNA motifs that are preferentially oriented somes. The last steps of segregation have been studied extensively toward dif, particularly in the ter region (4, 16–18). Upon reaching in the case of dimeric sister chromosomes and when chromosome the dif site, FtsK activates XerCD-mediated recombination that organization is impaired by mutations. In these special cases, the resolves chromosome dimers. The oriented translocation activity divisome-associated DNA translocase FtsK is required. FtsK pumps of FtsK also is strictly required when chromosome organization is chromosomes toward the dif chromosome dimer resolution site impaired by mutations, for instance by inactivation of the MukBEF using polarity of the FtsK-orienting polar sequence (KOPS) DNA complex (19, 20) or in strains carrying important asymmetry of the motifs. -
PCAF-Dependent Epigenetic Changes Promote Axonal Regeneration in the Central Nervous System
ARTICLE Received 13 Dec 2013 | Accepted 27 Feb 2014 | Published 1 Apr 2014 DOI: 10.1038/ncomms4527 PCAF-dependent epigenetic changes promote axonal regeneration in the central nervous system Radhika Puttagunta1,*, Andrea Tedeschi2,*, Marilia Grando So´ria1,3, Arnau Hervera1,4, Ricco Lindner1,3, Khizr I. Rathore1, Perrine Gaub1,3, Yashashree Joshi1,3,5, Tuan Nguyen1, Antonio Schmandke1, Claudia J. Laskowski2, Anne-Laurence Boutillier6, Frank Bradke2 & Simone Di Giovanni1,4 Axonal regenerative failure is a major cause of neurological impairment following central nervous system (CNS) but not peripheral nervous system (PNS) injury. Notably, PNS injury triggers a coordinated regenerative gene expression programme. However, the molecular link between retrograde signalling and the regulation of this gene expression programme that leads to the differential regenerative capacity remains elusive. Here we show through systematic epigenetic studies that the histone acetyltransferase p300/CBP-associated factor (PCAF) promotes acetylation of histone 3 Lys 9 at the promoters of established key regeneration-associated genes following a peripheral but not a central axonal injury. Furthermore, we find that extracellular signal-regulated kinase (ERK)-mediated retrograde signalling is required for PCAF-dependent regenerative gene reprogramming. Finally, PCAF is necessary for conditioning-dependent axonal regeneration and also singularly promotes regeneration after spinal cord injury. Thus, we find a specific epigenetic mechanism that regulates axonal regeneration of CNS axons, suggesting novel targets for clinical application. 1 Laboratory for NeuroRegeneration and Repair, Center for Neurology, Hertie Institute for Clinical Brain Research, University of Tu¨bingen, 72076 Tu¨bingen, Germany. 2 Department of Axonal Growth and Regeneration, German Center for Neurodegenerative Disease, 53175 Bonn, Germany. -
Ccnf (NM 007634) Mouse Tagged ORF Clone – MR210593 | Origene
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MR210593 Ccnf (NM_007634) Mouse Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Ccnf (NM_007634) Mouse Tagged ORF Clone Tag: Myc-DDK Symbol: Ccnf Synonyms: CycF; Fbxo1 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 Ccnf (NM_007634) Mouse Tagged ORF Clone – MR210593 ORF Nucleotide >MR210593 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGGAGCGGCGGTGTGATCCATTGTAGGTGTGCCAAGTGTTTCTGTTATCCTACTAAACGAAGAATCA AAAGAAGACCCAGAAACTTAACCATCTTGAGTCTCCCAGAAGATGTACTCTTTCATATCCTGAAATGGCT TTCTGTTGGGGACATCCTTGCTGTCCGAGCTGTCCACTCCCACCTCAAGTACCTGGTGGACAACCATGCC AGTGTGTGGGCATCCGCCAGCTTCCAGGAGCTGTGGCCTTCTCCACAGAACCTGAAGCTCTTTGAAAGGG CTGCTGAAAAGGGAAATTTTGAAGCTGCTGTGAAGTTGGGGATTGCCTACCTCTACAATGAAGGCCTGTC TGTGTCAGATGAGGCCTGCGCAGAAGTGAACGGCTTGAAGGCCTCTCGCTTCTTCAGCATGGCTGAGAGA CTGAATACGGGTTCTGAGCCCTTCATTTGGCTCTTCATCCGCCCACCGTGGTCAGTGTCCGGAAGCTGCT GCAAGGCTGTGGTTCATGACAGCCTCCGAGCGGAGTGTCAGTTACAGAGAAGTCATAAAGCTTCCATACT ACACTGCTTGGGAAGGGTGCTAAATCTTTTTGAGGACGAAGAGAAAAGGAAGCAGGCGCGTAGCCTTTTG -
Mithramycin Represses Basal and Cigarette Smoke–Induced Expression of ABCG2 and Inhibits Stem Cell Signaling in Lung and Esophageal Cancer Cells
Cancer Therapeutics, Targets, and Chemical Biology Research Mithramycin Represses Basal and Cigarette Smoke–Induced Expression of ABCG2 and Inhibits Stem Cell Signaling in Lung and Esophageal Cancer Cells Mary Zhang1, Aarti Mathur1, Yuwei Zhang1, Sichuan Xi1, Scott Atay1, Julie A. Hong1, Nicole Datrice1, Trevor Upham1, Clinton D. Kemp1, R. Taylor Ripley1, Gordon Wiegand2, Itzak Avital2, Patricia Fetsch3, Haresh Mani6, Daniel Zlott4, Robert Robey5, Susan E. Bates5, Xinmin Li7, Mahadev Rao1, and David S. Schrump1 Abstract Cigarette smoking at diagnosis or during therapy correlates with poor outcome in patients with lung and esophageal cancers, yet the underlying mechanisms remain unknown. In this study, we observed that exposure of esophageal cancer cells to cigarette smoke condensate (CSC) led to upregulation of the xenobiotic pump ABCG2, which is expressed in cancer stem cells and confers treatment resistance in lung and esophageal carcinomas. Furthermore, CSC increased the side population of lung cancer cells containing cancer stem cells. Upregulation of ABCG2 coincided with increased occupancy of aryl hydrocarbon receptor, Sp1, and Nrf2 within the ABCG2 promoter, and deletion of xenobiotic response elements and/or Sp1 sites markedly attenuated ABCG2 induction. Under conditions potentially achievable in clinical settings, mithramycin diminished basal as well as CSC- mediated increases in AhR, Sp1, and Nrf2 levels within the ABCG2 promoter, markedly downregulated ABCG2, and inhibited proliferation and tumorigenicity of lung and esophageal cancer cells. Microarray analyses revealed that mithramycin targeted multiple stem cell–related pathways in vitro and in vivo. Collectively, our findings provide a potential mechanistic link between smoking status and outcome of patients with lung and esophageal cancers, and support clinical use of mithramycin for repressing ABCG2 and inhibiting stem cell signaling in thoracic malignancies.