Cryptococcus Neoformans Gene Involved in Mammalian Pathogenesis Identified by a Caenorhabditis Elegans Progeny-Based Approach

Cryptococcus neoformans Gene Involved in Mammalian Pathogenesis Identified by a Caenorhabditis elegans Progeny-Based Approach

The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters

Citation Tang, R. J., J. Breger, A. Idnurm, K. J. Gerik, J. K. Lodge, J. Heitman, S. B. Calderwood, and E. Mylonakis. 2005. “Cryptococcus Neoformans Gene Involved in Mammalian Pathogenesis Identified by a Caenorhabditis Elegans Progeny-Based Approach.” Infection and Immunity73 (12): 8219–25. doi:10.1128/ IAI.73.12.8219-8225.2005.

Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:41542713

Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA INFECTION AND IMMUNITY, Dec. 2005, p. 8219–8225 Vol. 73, No. 12 0019-9567/05/$08.00ϩ0 doi:10.1128/IAI.73.12.8219–8225.2005 Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Cryptococcus neoformans Gene Involved in Mammalian Pathogenesis Identiﬁed by a Caenorhabditis elegans Progeny-Based Approach Robin J. Tang,1 Julia Breger,1 Alexander Idnurm,2 Kimberly J. Gerik,3 Jennifer K. Lodge,3,4 Joseph Heitman,2,6,7,8 Stephen B. Calderwood,1,5 and Eleftherios Mylonakis1* Division of Infectious Diseases, Massachusetts General Hospital, Boston, Massachusetts 021141; Department of Molecular Genetics and Microbiology,2 Division of Infectious Diseases,6 Department of Medicine,7 and Howard Hughes Medical Institute,8 Duke University Medical Center, Durham, North Carolina 27710; Edward A. Doisy Department of Biochemistry and Molecular Biology3 and Department of Molecular Microbiology and Immunology,4 Saint Louis University School of Medicine, Saint Louis, Missouri 63104; and Department of Microbiology and Molecular

Genetics, Harvard Medical School, Boston, Massachusetts 021145 Downloaded from

Received 2 August 2005/Returned for modiﬁcation 10 September 2005/Accepted 21 September 2005

Caenorhabditis elegans can serve as a substitute host for the study of microbial pathogenesis. We found that mutations in genes of the fungal pathogen Cryptococcus neoformans involved in mammalian virulence allow C. elegans to produce greater numbers of progeny than when exposed to wild-type fungus. We used this property to screen a library of C. neoformans mutants for strains that permit larger C. elegans brood sizes. In this screen, we identiﬁed a gene homologous to Saccharomyces cerevisiae ROM2. C. neoformans rom2 mutation resulted in a defect in mating and growth defects at elevated temperature or in the presence of cell wall or hyperosmolar stresses. An effect of the C. neoformans rom2 mutation in virulence was conﬁrmed in a murine inhalation http://iai.asm.org/ infection model. We propose that a screen for progeny-permissive mutants of microorganisms can serve as a high-throughput method for identifying novel loci related to mammalian pathogenesis.

The nematode Caenorhabditis elegans is emerging as a sub- as frozen stocks or on yeast-peptone-dextrose (YPD; Difco) agar plates and stitute host for elucidating important mechanisms of fungal grown in YPD. C. neoformans cultures were grown at 30°C unless otherwise Cryptococcus laurentii C. and bacterial pathogenesis, thanks to genetic tractability, ana- specified. cultures were grown at 25°C. The standard elegans strain N2 Bristol was maintained at 15°C and propagated on Escherichia tomical simplicity, and the availability of extensive genetic and coli. genomic resources (23, 35). The C. elegans killing assay used in C. elegans killing assays were performed as previously described (24, 25) with on October 12, 2019 by guest previous studies entails observing a synchronized population of minor modifications. C. neoformans strains were inoculated into 2 ml of YPD and ␮ nematodes for kinetics of death on a lawn of the microbe being grown at 30°C for 24 h; 10 l of the culture was spread on 35-mm tissue-culture ϳ plates (Falcon) containing brain heart infusion (BHI) agar (Difco). The plates studied. Living and dead worms are counted at 24-h inter- were incubated at 30°C for 48 h and then at 25°C for an additional 24 h. Of note vals, and the LT50, or time for 50% of the nematodes to die, is is that by incubating the plates for an extra day at 30°C, killing of C. elegans was calculated (1, 7, 10, 15, 24, 38). This killing assay has been used faster than what we reported in the past (24, 25). Ampicillin was added to the to study effectively gram-negative (1, 15, 38) and gram-positive medium to prevent growth of E. coli OP50 that might have been carried over on C. elegans (10) bacteria, as well as the human pathogenic fungus Crypto- transfer of worms to the yeast-containing plates. animals at the L4 developmental stage were transferred from a lawn of E. coli OP50 on nematode coccus neoformans (24, 25). growth medium to a lawn of the yeast to be tested on BHI medium, incubated at Interestingly, C. elegans does not produce a sustainable 25°C, and examined for viability at 24-h intervals with a Nikon SMZ645 dissect- brood of progeny in the presence of C. neoformans or some ing microscope. Three plates with ϳ50 L4 larval C. elegans nematodes per plate ϳ other pathogens (10, 25, 38). We hypothesized that a screen of were used for each strain. Every 24 h, living and dead worms were counted, with living worms being transferred to a fresh, identical lawn of C. neoformans to brood size would circumvent the need for labor-intensive man- allow observation of the original worm without obstruction by progeny. ual assessment for living versus dead nematodes. The aim of Quantification of C. elegans progeny. Lawns for the quantification of C. elegans this study was to investigate the role of the C. neoformans progeny assays were prepared as detailed above for the killing assays. The only virulence factors (such as capsule and melanin and their reg- difference is that C. laurentii plates were incubated at 25°C throughout the C. neoformans ulatory pathways) in C. elegans progeny production. Also, we experiment (i.e., were not placed at 30°C as was initially done with plates). The reason for the different temperature is that ϳ25°C is the optimal evaluate the hypothesis that brood size can be used effectively temperature for C. laurentii growth (25). However, special care was taken to as a facile marker for virulence in the C. elegans-C. neoformans ensure that the C. neoformans and C. laurentii lawns were similar in size and system. Of note is that no progeny-based screen has been thickness. reported previously. Nematodes were placed on lawns of C. neoformans or C. laurentii on BHI agar at 25°C and transferred to a new, identical lawn every ϳ24 h throughout the MATERIALS AND METHODS reproductive period. After removal of the parent nematode, each lawn was Strains and media. The C. neoformans strains used in these experiments are spread face down on a 100-mm tissue-culture plate (Falcon) with nematode summarized in Table 1 or described in the text. Yeast cultures were maintained growth medium agar and E. coli strain OP50. Care was taken not to intermingle OP50 bacteria with C. neoformans or C. laurentii. Numbers reported are the total progeny produced over the first 72 h of egg laying. No unhatched eggs were seen. Approximately 20 to 25 wild-type C. elegans N2 nematodes were used per group, * Corresponding author. Mailing address: Massachusetts General and only nematodes that survived all 3 days of the experiment were included. Hospital, Gray-Jackson 504, 55 Fruit Street, Boston, MA 02114. Viable progeny was defined as a first-stage (or older) larva. Also, to compare Phone: (617) 726-3811. Fax: (617) 726-7416. E-mail: emylonakis progeny production between strain ATCC 208820 (2e-tuc4) that produces lac- @partners.org. case and strain ATCC 208819 (2e-tu4) that is laccase negative we grew these

8219 8220 TANG ET AL. INFECT.IMMUN.

TABLE 1. C. neoformans strains used in this study

Mean progeny production per nematode Ϯ SE Strain Relevant characteristics or phenotype (reference) Reference(s) or source (P value compared to parent strain, when relevant) H99 ATCC 208821 Serotype A; clinical isolate; genome sequence determined 2.38 Ϯ 1.77 33 KN99␣ Congenic H99 mating parent, MAT␣ 1.69 Ϯ 0.48 30 H99 pka1 PKA1 encodes the major cyclic AMP (cAMP)-dependent 4.35 Ϯ 0.99 (no difference) 8 protein kinase catalytic subunit; mutant is attenuated in mammalian models (8), C. elegans (25), and Galleria mellonella (26) H99 pka1 ϩ PKA1 Complementation of the pka1 mutant with wild-type 1.82 Ϯ 0.62 (no difference) 8 PKA1 restored virulence in mammals (8), C. elegans (25), and G. mellonella (26) H99 ras1 ras1 mutant is avirulent in a rabbit model of cryptococcal 13.50 Ϯ 3.04 (P ϭ 0.0001) 2 meningitis (2) and G. mellonella (26) and hypovirulent Downloaded from in Drosophila melanogaster (4) and C. elegans (25) H99 ras1 ϩ RAS1 Complementation of the ras1 mutant with wild-type RAS1 4.18 Ϯ 2.00 (no difference) 2 restored virulence in mammalian (2) and invertebrate (4, 25, 26) hosts H99 cap59 CAP59 is essential for capsule formation (27, 28); mutant 5.90 Ϯ 2.02 (P ϭ 0.0044) 27, 28 is avirulent in mammals, Acanthamoeba castellanii (37), and G. mellonella (26) and hypovirulent in C. elegans (25) and D. melanogaster (4) ATCC 208820 (2e-tuc4) Serotype D; MAT␣ CNLAC1/laccase positive 4.50 Ϯ 1.49 36 ATCC 208819 (2e-tu4) Serotype D; MAT␣ cnlac1/laccase negative; hypovirulent 7.80 Ϯ 2.65 (no difference) 36 in mice (36), C. elegans (25), and G. mellonella (26) http://iai.asm.org/ KN99␣ rom2 KN99␣ϩrom2::NAT 17.06 Ϯ 2.28 (P ϭ 0.0001) Present report KN99␣ rom2 ϩ ROM2 MAT␣ product of rom2::NAT ϩ ROM2-NEO 3.79 Ϯ 1.34 (no difference) Present report KN99a rom2 MATa product of KN99␣ rom2 ϫ KN99a NDa Present report

a ND, not done.

strains in the presence of L-DOPA (3,4-dihydroxyphenylalanine) (100 ␮g/ml) and incubation times differed because growth rates differed under different condi- added L-DOPA (100 ␮g/ml) to the BHI medium (25). tions, but incubation was continued until a growth defect appeared or was plainly Identification and construction of mutant strains. Random mutants of C. not forthcoming. All in vitro assays were performed at 25°C, 30°C, and 37°C. In on October 12, 2019 by guest neoformans were generated using biolistic insertion of a plasmid containing the all studies, results at 25°C and 30°C were similar unless otherwise specified. URA5 gene into the strain F99 (MAT␣ ura5) (9, 40). In mutants permitting Murine models of virulence. Experiments with mice were performed as pre- significant brood production, DNA flanking the insertion was identified using viously described (24). Wild-type 8-week-old female ICR/CD1 mice (Charles arbitrary primed PCR and compared to the H99 genome database at Duke River Laboratories, Wilmington, MA) were used in all studies. In brief, C. University. Gene prediction was performed with the FGENESH algorithm, and neoformans strains were grown at 30°C with shaking overnight in YPD to late-log predicted genes were compared to the GenBank database. A disruption allele for phase. The yeast cells were centrifuged and washed in phosphate-buffered saline. the ROM2 gene was constructed by overlap PCR to replace most of the coding The concentration of yeast cells in the inoculum was evaluated before inocula- region with a cassette conferring resistance to nourseothricin. Primers (all 5Ј-3Ј) tion by use of a hemocytometer and confirmed by plating serial dilutions and JOHE13032 (TCCTCTATCATCCCATCTAG) and JOHE13033 (GCTTATGT enumerating CFU. Mice were anesthetized by intraperitoneal injection of tri- GAGTCCTCCCGTTGTTGGATTGCTGCTG) and primers JOHE13034 (CT bromoethyl alcohol (Aldrich, Milwakee, WI) (400 mg/kg of body weight) and CGTTTCTACATCTCTTGTCATGACGCACCACCAG) and JOHE13035 (G suspended by the incisors on a silk thread. A 50-␮l volume of the inoculum (1.0 ATGACGAATTTGCTTTACTAG) were used to amplify the flanks of the ϫ 106 yeast cells of either the rom2 mutant the parental strain KN99␣ or the ROM2 gene from KN99␣ DNA, and primers JOHE8677 (GAAGAGATGTAG reconstituted strain KN99␣ rom2 ϩ ROM2) was slowly pipetted into the nares AAACGAG) and JOHE11866 (GGGAGGACTCACATAAGC) were used to with continued suspension for 10 min. The murine protocols were approved by amplify the NAT cassette. Equimolar amounts of the three products were mixed, the Massachusetts General Hospital Committee on Research, Subcommittee on and primers JOHE13032 and JOHE13035 were used to amplify a contiguous Research Animal Care, and special attention was given to minimize suffering of fragment; this fragment was transformed into strain KN99␣ (MAT␣) by use of a the mice. biolistic apparatus. Disruption of ROM2 was confirmed with PCR and Southern Evaluation of tissue burden. Following euthanasia, we harvested the lungs blot hybridization. Only strains containing a single insertion were used. The rom2 from mice 12 days after administration of a cryptococcal inoculum by nasal mutation was crossed to strain KN99a, and basidiospore progeny were selected inhalation. Tissues were weighed and homogenized in sterile phosphate-buffered to identify a rom2 MATa strain. To reconstitute ROM2, a wild-type copy of saline by use of a Tissue Tearor (model 398; Biospec Products Inc., Racine, WI). ROM2 was amplified with primers JOHE13031 (ACCTATCATCTCGCTGA Then, serial dilutions were plated on YPD agar containing 100 ␮g/ml ampicillin, TCC) and JOHE13036 (GAGAAGGATACTGAAAAGGC) and cloned into a 100 ␮g/ml streptomycin, and 45 ␮g/ml kanamycin. CFU of C. neoformans were plasmid conferring resistance to neomycin, which was introduced into the rom2 counted after growth at 30°C for 72 h. mutant with Agrobacterium-mediated transformation followed by selection on Statistical analysis. Survival assays in mice and nematodes were repeated neomycin-containing media (MediaTech, Inc., Herndon, VA). three times, and each experiment independently gave statistically significant In vitro evaluation of cryptococcal strains. Capsule production was assessed by results. The figures and the P values provided herein are each from one repre- exclusion of India ink following growth for 48 h at 30°C in low-iron media sentative experiment. Murine and C. elegans killing curves were plotted and containing 56 ␮M EDDHA. Measurement of the capsule size (diameter of the estimation of differences in survival (log-rank and Wilcoxon tests) analyzed with edge of the capsule to the cell wall and cell diameter) was evaluated on an the Kaplan-Meier method performed using STATA 6 statistical software (Stata, Olympus BX51 microscope using Olympus Microsoft software. Melanin produc- College Station, TX). The same software program was used for the statistical tion was assessed by growth on L-DOPA-containing minimal medium agar for 7 analysis of the CFU from murine organs and comparison of progeny production days at 30°C. For the mating assays, strains were each crossed by mixing strains (Mann-Whitney and Kruskal-Wallis tests). Plotting and statistical evaluation of and incubating on V8 media at 25°C in the dark for 14 days. For the study of the CFU data were done using Microcal Origin (OriginLab Corporation, Northamp- growth on cell wall and osmolar and other stressors (such as caffeine and NaCl), ton, MA). A P value of less than 0.05 was considered to be significant. VOL. 73, 2005 PROGENY-BASED SCREEN IN C. ELEGANS 8221

RESULTS ilarly at 25°C (data not shown). Of note is that at 37°C, the rom2 mutant demonstrated a temperature-sensitive pheno- Abrogation of brood production is associated with C. neo- type, and a delay in growth. Interestingly, the high-temperature formans genes involved in pathogenesis. First we quantified C. growth defect was corrected by the addition of 1 M sorbitol to elegans progeny produced over 3 days in the presence of wild- the media. Of note is that in spite of the delay in growth in type C. neoformans and a ras1 mutant of C. neoformans that YPD media, it finally reaches a concentration similar to that of was previously found to be attenuated in C. elegans (25) and the wild type even at 37°C (Fig. 1A) and that there was no C. laurentii mammalian (2) killing. The nonpathogenic strain increased lysis associated with the rom2 mutant, as noted using ATCC 76483 was used as a control. Both C. laurentii and the the BCIP (5-bromo-4-chloro-3-indolyl phosphate; Sigma) col- hypovirulent ras1 mutant of C. neoformans allowed C. elegans orimetric assay (data not shown). to produce greater numbers of viable progeny than did the Melanin and capsule production were not affected by the ␣ wild-type C. neoformans KN99 or the reconstituted strain rom2 deletion (data not shown), while mating was significantly ϩ ϭ H99 ras1 RAS1 (Table 1; P 0.0001 and 0.0456, respec- impaired (Fig. 1B). Basidiospore production and hyphal pro- tively). Levels of progeny production by the strain H99 and the jection were markedly diminished when MAT␣ and MATa Downloaded from ␣ isogenic strain KN99 were similar. In addition to the RAS1 rom2 mutants were crossed, but the phenotype of the recon- signaling cascade, a second regulatory pathway that involves stituted strain KN99␣ rom2 ϩ ROM2 was similar to that of the the G-alpha protein–cyclic AMP–protein kinase A signaling wild type. Of note is that the mating defect was less pro- pathway has been described for C. neoformans. Interestingly, a nounced when we mated the rom2 mutant with the KN99 C. neoformans pka1 mutant that displays attenuated virulence partner but did not revert to wild-type mating even with the in mice (8) and C. elegans killing (25) did not allow progeny addition of osmotic stabilizer to the media (data not shown). production that was statistically different from that by nema- The finding that a C. neoformans rom2 deletion mutant todes exposed to wild-type C. neoformans (Table 1). exhibits a defect in mating and a growth defect that can be In order to dissect the role of the major cryptococcal viru- suppressed by addition of the osmotic stabilizer sorbitol sug- http://iai.asm.org/ lence factors (capsule and melanin production) in progeny gests that in C. neoformans ROM2 may play a role in the production, we studied C. elegans brood production in the formation or structure of the cell wall, similar to findings with presence of an acapsular strain with a mutation involving gene S. cerevisiae (32). In order to evaluate this hypothesis we ex- CAP59 that is needed for capsule formation and a strain with amined the sensitivity of the C. neoformans rom2 mutant to cell a mutation involving the enzyme laccase that is essential for wall and osmolar stressors. melanin production. Progeny production in the presence of the First we examined the sensitivity of KN99␣ rom2 to caffeine, acapsular strain was significantly higher than the progeny pro- a phosphodiesterase inhibitor that has been used to screen for duction on lawns of wild-type C. neoformans (average Ϯ stan- yeast mutants with altered cell wall proteins and/or structure on October 12, 2019 by guest dard error of 1.68 Ϯ 0.4 for the KN99␣ group and 5.9 Ϯ 2.0 for (6). In S. cerevisiae, deletion of ROM2 renders cells sensitive to the H99 cap59 group; P ϭ 0.0044). However, nematodes ex- caffeine (32). Cells of KN99␣, KN99␣ rom2, and KN99␣ rom2 posed to the acapsular strain cap59 made significantly less ϩ ROM2 were grown on solid media containing caffeine. Plates progeny compared to the nematodes exposed to ras1 (5.9 Ϯ 2.0 were incubated at 25°C, 30°C, or 37°C. KN99␣ rom2 demon- for H99 cap59 compared to 17.06 Ϯ 2.28 for KN99␣ rom2 and strated sensitivity to 7 mM caffeine that was apparent at all 13.5 Ϯ 3.04 for H99 ras1; in both cases, P Ͻ 0.01). There was temperatures tested (Fig. 2 and data not shown). Of note, at no difference in progeny production between the strain ATCC 37°C, 7 mM caffeine entirely inhibited growth of the mutant. 208820 (2e-tuc4) that produces laccase and strain ATCC The reconstituted strain, KN99␣ rom2 ϩ ROM2, grew similarly 208819 (2e-tu4) that is laccase negative (data not shown). to the wild type under all conditions, and no significant differ- AC.elegans progeny-based screen. Based on the finding that ence between the rom2 mutant, the wild type, and the recon- some virulence factors of C. neoformans can cause abrogation stituted strain was seen on YPD containing 3 mM caffeine. of brood production in C. elegans, we investigated whether KN99␣ rom2 was also hypersensitive to 1.5 M NaCl at 25°C screening for brood production can be used to identify novel and 30°C, giving rise to very sparse colonies of tiny size (Fig. 2). factors involved in C. neoformans pathogenesis in mammals. Growth of the strain KN99␣ rom2 ϩ ROM2 in 1.5 M NaCl was We screened a library of ϳ1,500 random C. neoformans mu- similar to the wild-type growth. Of note, at 37°C all three tants for strains that permitted a C. elegans brood to develop strains (the wild type, rom2 mutant, and reconstituted strain) on lawns of these mutants, a phenotype we termed “progeny failed to grow in the presence of 1.5 M NaCl; as a consequence, permissive.” We isolated three such mutants, a rate similar to it was not possible to determine the relative sensitivity of that seen with existing screens utilizing killing of C. elegans by KN99␣ rom2 to 1.5 M NaCl at this temperature. pathogens (10, 21, 24). Genetic analysis of one mutant strain A C. neoformans rom2 mutant is hypovirulent in C. elegans revealed that the disrupted locus encoded a homolog of Sac- and mice. Strain KN99␣ rom2 permitted significantly higher charomyces cerevisiae Rom2p. S. cerevisiae Rom2p is a guanyl- numbers of C. elegans progeny to develop than did the wild- nucleotide exchange factor for Rho1p and is required for yeast type yeast. More specifically, the KN99␣ rom2 mutant allowed cell integrity under conditions of heat and osmolar stress (5, 31, significantly more progeny than KN99␣ or KN99␣ rom2 ϩ 32). ROM2 (P Ͻ 0.0001 and P ϭ 0.0004, respectively; Table 1). Evaluation of a C. neoformans rom2 mutant in vitro. A mu- Moreover, the KN99␣ rom2 mutant was significantly attenu- tant lacking all but the last 18 codons of the ROM2 locus grew ated in virulence in C. elegans and demonstrated an impaired similarly to the wild-type yeast at 30°C, but it demonstrated ability to survive passage through the nematode grinder organ reduced growth at 37°C (Fig. 1A). All three strains grew sim- (Fig. 3). 8222 TANG ET AL. INFECT.IMMUN. Downloaded from http://iai.asm.org/

FIG. 1. Growth and mating phenotype. (A) Growth of C. neoformans strains in YPD broth was assessed by plating on YPD agar. There was no difference in growth of KN99␣ rom2 at 30°C compared to that seen with KN99␣; however, at 37°C, a signiﬁcant temperature-sensitive growth phenotype is seen in KN99␣ rom2. (B) Hyphal processes at the edge of the mating mixture are seen microscopically (left panels) and macroscopically (right panels). on October 12, 2019 by guest

Interestingly, the rom2 mutant was also avirulent in an in- observed for any of the mice that received KN99␣ rom2, inhalation infection model in mice (Fig. 4) and was considerably cluding a total of 22 mice that were kept for 120 days postin- impaired in establishing infection in murine lung tissue (Fig. oculation. 5). Of note, experiments were performed in triplicate and a total of 32 mice received KN99␣ rom2. No death or illness was DISCUSSION In this report we present the novel observation that some, but not all, mutations in C. neoformans genes involved in mammalian virulence allow C. elegans to produce greater numbers of progeny than when exposed to wild-type fungus. This progeny-permissive phenotype can be used to screen collections of C. neoformans mutants to identify genes involved in mammalian infection. The ﬁrst gene identiﬁed using this approach is a gene homologous to Saccharomyces cerevisiae ROM2.InC. neoformans a rom2 mutant demonstrated a defect in mating and in growth at 37°C, as well as susceptibility to cell wall and osmolar stressors. Interestingly, ROM2 was essential for full virulence in an inhalation murine model of infection, suggest- ing that this screen is useful for elucidating pathogenesis in mammalian hosts. This study extends previous work by describing a new technique, the progeny screen, for using the C. elegans to study FIG. 2. C. neoformans rom2 demonstrated a growth defect in the presence of caffeine and NaCl. From left to right in each row, 104,103, host-pathogen interactions and builds upon previous work to 102, and 101 cells of C. neoformans KN99␣ (top rows), KN99␣ rom2 create invertebrate model host systems (1, 15, 21–25, 37). The (middle rows), or KN99␣ rom2 ϩ ROM2 (bottom rows) were plated on theory that a common, fundamental set of molecular mecha- YPD agar containing 3 mM caffeine, 7 mM caffeine, or 1.5 M NaCl; nisms is employed by pathogens against a widely divergent YPD agar with no antagonists was used as a control. All plates were incubated at 30°C until growth reached levels comparable to 24 h of array of metazoan hosts has been supported by the discovery of growth on the control plate. These times were 4 days for 3 mM substantial commonality between virulence factors required caffeine, 14 days for 7 mM caffeine, and 5 days for 1.5 M NaCl. for disease in mice and in killing of C. elegans (10, 21–24). VOL. 73, 2005 PROGENY-BASED SCREEN IN C. ELEGANS 8223

A C. elegans screen using the progeny-permissive phenotype can allow identiﬁcation of fungal genes relevant for both nematode and mammalian pathogenesis. A screen for the ability of microbes to affect C. elegans progeny may be a valuable and economical technique for dissecting mechanisms of host- pathogen interactions. Screening for a progeny-permissive phenotype is much simpler than the existing killing assay—an especially valuable feature for studying pathogens with slower killing kinetics, such as C. neoformans. Fewer worms per microbial lawn are required, and surveillance need only occur once around days 3 and 5. Also, screening for the progeny- permissive phenotype may also facilitate automated screens in C. elegans. Current automated systems of C. elegans screening

have limitations in distinguishing living worms from dead, a Downloaded from function that must be performed with very high accuracy and consistency for a killing assay screen to be effective. In addition, some microbial pathogens, such as Enterococcus faecium, fail to kill C. elegans but still inhibit progeny production (10, 22). While the C. elegans killing assay cannot be used to study such organisms, a screen for production of nematode progeny in the presence of pathogen may prove useful. The progeny screen does have obvious limitations. The ﬁrst is the unavoidable difference between nematodes and mam- http://iai.asm.org/ mals. The use of invertebrate model hosts for modeling microbial pathogenesis is based on the hypothesis that there exists, for some pathogens, a set of fundamental virulence traits whose involvement in pathogenicity is broadly conserved across host phyla. However, it is therefore likely that some C. neoformans factors needed for pathogenesis in humans may not be employed against C. elegans and might consequently be

overlooked by screens in C. elegans. Conversely, some C. neo- on October 12, 2019 by guest formans traits may be involved in the interaction with C. elegans but not involved in human infection; these traits might come through a screen in the C. elegans pathosystem, such as the progeny screen, but would not be clinically relevant. A second problem is the fact that attenuated-virulence and progeny-permissive phenotypes, despite the aforementioned logical connection, are empirically distinct from one another. For example, PKA1 and melanin production that were involved in killing of the nematode (25) did not affect progeny production. Additionally, the quantification of progeny for the experiment requires some experience. For example, the opaque quality of cryptococcal lawns makes it difficult to quantify brood size. As noted above, the attenuated killing and the decrease in brood size do not always overlap. On the basis of the finding that among the three mutants that allow significantly higher progeny production (cap59, rom2, and ras1), two (cap59 and

FIG. 3. C. neoformans interaction with C. elegans. (A) Kaplan- Meier killing curves demonstrating survival of C. elegans N2 animals feeding on C. neoformans mutants with disruption in the rom2 mutant, the parental strain KN99␣, or the reconstituted strain KN99␣ rom2 ϩ ROM2. P is Ͻ0.001 for the rom2 mutant compared to the parental and the reconstituted strains. (B) Survival of various strains of C. neoformans that passed through the grinder organ of C. elegans. Signiﬁcantly fewer cells of KN99␣ rom2 (middle panel) remain intact compared with KN99␣ (top panel) or KN99␣ rom2 ϩ ROM2 (bottom panel) results. White arrowheads point to the pharyngeal grinder organ. Black arrows indicate the intestinal lumen. 8224 TANG ET AL. INFECT.IMMUN.

inability of the strain KN99␣ rom2 to survive ingestion by C. elegans that involves passage through the grinder organ that disrupts the cells with tooth-like projections (Fig. 3). The temperature-sensitive phenotype is probably more important in the loss of virulence in mammals; however, it is likely that the cell wall defect is also important for the loss of virulence in mammals. The phenotype of the C. neoformans rom2 mutant reported in this work has interesting similarities to that of Rom2p mutants of S. cerevisiae (detailed in references 6, 17, and 32). In S. cerevisiae, Rom2p is the Rho1 GTP/GDP exchange factor. The Rho1-protein kinase C pathway is known as the cellular integrity pathway for its role in cell wall biosynthesis and mating

FIG. 4. Kaplan-Meier killing curves of C. neoformans in a murine (32). Pkc1p protein directly activates a mitogen-activated pro- Downloaded from inhalational infection model. Survival of mice after inoculation of 1.0 ϫ 106 yeast cells of the rom2 mutant (n ϭ 10), the parental strain tein kinase (MAP kinase) cascade consisting of the MAP ki- KN99␣ (n ϭ 9), or the reconstituted strain KN99␣ rom2 ϩ ROM2 (n nase kinase kinase Bck1p, the redundant MAP kinase kinase ϭ 9). P is Ͻ0.001 for the rom2 mutant compared to the parental and pair, Mkk1p and Mkk2p, and the MAP kinase Slt2p/Mpk1p. reconstituted strains. As noted above, the pathway is activated by the GDP/GTP exchange factor Rom2p, via Rho1p (3, 5, 12, 20). This pathway is involved in the maintenance of cell integrity, being respon- rom2) are unable to survive ingestion by the nematode (Fig. 3 sible for expression of several cell wall genes (FKS1, MNN1, and reference 25), it appears that a screen for progeny may CSD1) and activated by cell wall-perturbing compounds (11, provide a unique way to identify genes associated with crypto- 13). The pathway is also required for growth at elevated tem- http://iai.asm.org/ coccal capsule and cell wall formation and structure. However, peratures (16–18) and is involved in cell wall rearrangements further study is necessary in order to determine whether the in response to hyperosmotic conditions (41). decrease in brood size is a result only of energy deprivation In both S. cerevisiae and C. neoformans ROM2 is associated because the nematodes are unable to grind the yeast cells or with growth at higher temperatures, resistance to the cell wall whether it is part of a more extensive host-pathogen interac- stressor caffeine, and resistance to osmotic stresses caused by tion. NaCl. Additionally, the growth phenotype caused by rom2 mu- Our ﬁndings suggest that in C. neoformans ROM2 plays a tation in both S. cerevisiae and C. neoformans is corrected by

significant role in growth at high temperature, in mating, and the addition of the osmotic stabilizer sorbitol. In addition to on October 12, 2019 by guest in maintaining the stability of the cell wall in the presence of ROM2 reported here, homologs to S. cerevisiae genes of the cell wall and osmolar stressors. The growth defect cannot ac- Rho1-protein kinase C pathway have been identified in C. count for the phenotype of the rom2 mutant in the C. elegans neoformans. These genes also demonstrated a role in cell wall system, as nematode experiments are conducted at 25°C. Also, maintenance and stress response. Such genes include FKS1, the defect in mating also can not account for the hypovirulence which encodes a subunit of glucan synthase (39), and C. neo- of rom2 in the C. elegans pathosystem, as mating is not asso- formans MPK1, which is needed for growing at 37°C, virulence ciated with killing of the nematode in C. neoformans var. grubii in a murine model, and resistance to inhibitors of enzymes (29). It is more likely that the sensitivity of the C. neoformans required for cell wall biosynthesis (14). rom2 mutant to osmotic and other stresses may explain the In addition to its clinical significance (34), C. neoformans is an ideal model organism for other pathogenic fungi, being easily cultured in the laboratory and benefiting from abundant genetic and genomic resources (19). C. elegans is a powerful tool for investigating conserved mechanisms of C. neoformans virulence against metazoans. The fact that C. elegans reduces brood size as a response to interactions with C. neoformans may serve as a useful marker in dissecting these mechanisms. This approach may allow development of better-defined screens of much higher throughput than are currently feasible. ACKNOWLEDGMENTS Financial support was provided by a K08 award (AI63084-01) from National Institutes of Health and a New Scholar Award in Global Infectious Diseases of the Ellison Medical Foundation to E.M. ADDENDUM IN PROOF FIG. 5. The C. neoformans rom2 mutant is less successful than The recent observation (K. J. Gerik, M. J. Donlin, C. E. ␣ KN99 in establishing infection in lung tissue of mice infected by Soto, A. M. Banks, I. R. Banks, M. A. Maligie, C. P. Selitren- inhalational challenge. Wild-type mice were inoculated through the 58: left nostril with 7.0 ϫ 105 cells of C. neoformans KN99␣, KN99␣ rom2, nikoff, and J. K. Lodge, Mol. Microbiol. 393–408, 2005) that or KN99␣ rom2 ϩ ROM2. Four mice per cohort were sacrificed 12 a different rom2 mutant shows no temperature or caffeine days postinfection. sensitivity reflects differences in the assay used in their study VOL. 73, 2005 PROGENY-BASED SCREEN IN C. ELEGANS 8225 and the one used in our study, including solid versus liquid Mitchell, M. Pertea, F. R. Riggs, S. L. Salzberg, J. E. Schein, A. Shvartsbeyn, H. Shin, M. Shumway, C. A. Specht, B. B. Suh, A. Tenney, T. R. Utterback, medium and the use of 1 mM caffeine versus 7 mM caffeine. B. L. Wickes, J. R. Wortman, N. H. Wye, J. W. Kronstad, J. K. Lodge, We have done a side-by-side comparison of these two inde- J. Heitman, R. W. Davis, C. M. Fraser, and R. W. Hyman. 2005. The genome pendent and distinct mutants in the same conditions and found of the basidiomycetous yeast and human pathogen Cryptococcus neoformans. Science 307:1321–1324. that they have similar phenotypes, including wild-type growth 20. Lorberg, A., H. P. Schmitz, U. Gengenbacher, and J. J. Heinisch. 2003. at 37°C on solid medium, impaired growth and 37°C in liquid KlROM2 encodes an essential GEF homologue in Kluyveromyces lactis. Yeast medium, sensitivity to 1.5 M NaCl, and importantly, the pro- 20:611–624. 21. Mahajan-Miklos, S., M. W. Tan, L. G. Rahme, and F. M. Ausubel. 1999. duction of increased Caenorhabditis progeny. Molecular mechanisms of bacterial virulence elucidated using a Pseudomo- nas aeruginosa-Caenorhabditis elegans pathogenesis model. Cell 96:47–56. REFERENCES 22. Moy, T., E. Mylonakis, S. B. Calderwood, and F. M. Ausubel. 2004. Cyto- 1. Aballay, A., and F. M. Ausubel. 2002. Caenorhabditis elegans as a host for the toxicity from hydrogen peroxide produced by Enterococcus faecium. Infect. study of host-pathogen interactions. Curr. Opin. Microbiol. 5:97–101. Immun. 72:4512–4520. 2. Alspaugh, J. A., L. M. Cavallo, J. R. Perfect, and J. Heitman. 2000. RAS1 23. Mylonakis, E., and A. Aballay. 2005. Worms and flies as genetically tractable regulates filamentation, mating and growth at high temperature of Crypto- animal models to study host-pathogen interactions. Infect. Immun. 73:3833– coccus neoformans. Mol. Microbiol. 36:352–365. 3841. Downloaded from 3. Angeles de la Torre-Ruiz, M., J. Torres, J. Arino, and E. Herrero. 2002. Sit4 24. Mylonakis, E., A. Idnurm, R. Moreno, J. El Khoury, J. B. Rottman, F. M. is required for proper modulation of the biological functions mediated by Ausubel, J. Heitman, and S. B. Calderwood. 2004. Cryptococcus neoformans Pkc1 and the cell integrity pathway in Saccharomyces cerevisiae. J. Biol. Kin1 protein kinase homologue, identified through a Caenorhabditis elegans Chem. 277:33468–33476. screen, promotes virulence in mammals. Mol. Microbiol. 54:407–419. 4. Apidianakis, Y., L. G. Rahme, J. Heitman, F. M. Ausubel, S. B. Calderwood, 25. Mylonakis, E., F. M. Ausubel, J. R. Perfect, J. Heitman, and S. B. Calder- and E. Mylonakis. 2004. Challenge of Drosophila melanogaster with Crypto- wood. 2002. Killing of Caenorhabditis elegans by Cryptococcus neoformans as coccus neoformans and role of the innate immune response. Eukaryot. Cell a model of yeast pathogenesis. Proc. Natl. Acad. Sci. USA 99:15675–15680. 3:413–419. 26. Mylonakis, E., R. Moreno, J. El Khoury, A. Idnurm, J. Heitman, S. B. 5. Bickle, M., P. A. Delley, A. Schmidt, and M. N. Hall. 1998. Cell wall integrity Calderwood, F. M. Ausubel, and A. Diener. 2005. Galleria mellonella as a modulates RHO1 activity via the exchange factor ROM2. EMBO J. 17:2235– model system to study Cryptococcus neoformans pathogenesis. Infect. Im- 2245. mun. 73:3842–3850. 6. Chai, B., J. M. Hsu, J. Du, and B. C. Laurent. 2002. Yeast RSC function is 27. Nelson, R. T., B. A. Pryor, and J. K. Lodge. 2003. Sequence length required required for organization of the cellular cytoskeleton via an alternative for homologous recombination in Cryptococcus neoformans. Fungal Genet. http://iai.asm.org/ PKC1 pathway. Genetics 161:575–584. Biol. 38:1–9. 7. Couillault, C., N. Pujol, J. Reboul, L. Sabatier, J.-F. Guichou, Y. Kohara, 28. Nelson, R. T., J. Hua, B. Pryor, and J. K. Lodge. 2001. Identification of and J. J. Ewbank. 2004. TLR-independent control of innate immunity in virulence mutants of the fungal pathogen Cryptococcus neoformans using Caenorhabditis elegans by the TIR domain adaptor protein TIR-1, an or- signature-tagged mutagenesis. Genetics 157:935–947. tholog of human SARM. Nat. Immunol. 5:488–494. 29. Nielsen, K., G. M. Cox, A. P. Litvintseva, E. Mylonakis, S. D. Malliaris, D. K. 8. D’Souza, C. A., J. A. Alspaugh, C. Yue, T. Harashima, G. M. Cox, J. R. Benjamin, Jr., S. S. Giles, T. G. Mitchell, A. Casadevall, J. R. Perfect, and Perfect, and J. Heitman. 2001. Cyclic AMP-dependent protein kinase con- J. Heitman. 2005. Cryptococcus neoformans ␣ strains preferentially dissem- trols virulence of the fungal pathogen Cryptococcus neoformans. Mol. Cell. inate to the central nervous system during infection. Infect. Immun. 73:4922– Biol. 21:3179–3191. 4933. 9. Edman, J. C., and K. J. Kwon-Chung. 1990. Isolation of the URA5 gene from 30. Nielsen, K., G. M. Cox, P. Wang, D. L. Toffaletti, J. R. Perfect, and J. Heit-

Cryptococcus neoformans var. neoformans and its use as a selective marker man. 2003. Sexual cycle of Cryptococcus neoformans var. grubii and virulence on October 12, 2019 by guest for transformation. Mol. Cell. Biol. 10:4538–4544. of congenic a and ␣ isolates. Infect. Immun. 71:4831–4841. 10. Garsin, D. A., C. D. Sifri, E. Mylonakis, X. Qin, K. V. Singh, B. E. Murray, 31. Ozaki, K., K. Tanaka, H. Imamura, T. Hihara, T. Kameyama, H. Nonaka, H. S. B. Calderwood, and F. M. Ausubel. 2001. A simple model host for iden- Hirano, Y. Matsuura, and Y. Takai. 1996. Rom1p and Rom2p are GDP/ tifying Gram-positive virulence factors. Proc. Natl. Acad. Sci. USA. 98: GTP exchange proteins (GEPs) for the Rho1p small GTP binding protein in 10892–10897. Saccharomyces cerevisiae. EMBO J. 15:2196–2207. 11. Gustin, M. C., J. Albertyn, M. Alexander, and K. Davenport. 1998. MAP 32. Park, J. I., E. J. Collinson, C. M. Grant, and I. W. Dawes. 2005. Rom2p, the kinase pathways in the yeast Saccharomyces cerevisiae. Microbiol. Mol. Biol. Rho1 GTP/GDP exchange factor of Saccharomyces cerevisiae, can mediate Rev. 62:1264–1300. stress responses via the Ras-cAMP pathway. J. Biol. Chem. 280:2529–2535. 12. Heinisch, J. J., A. Lorberg, H. P. Schmitz, and J. J. Jacoby. 1999. The protein 33. Perfect, J. R., S. D. R. Lang, and D. T. Durack. 1980. Chronic cryptococcal kinase C-mediated MAP kinase pathway involved in the maintenance of meningitis: a new experimental model in rabbits. Am. J. Pathol. 101:177–194. cellular integrity in Saccharomyces cerevisiae. Mol. Microbiol. 32:671–680. 34. Perfect, J. R., and A. Casadevall. 2002. Cryptococcosis. Infect. Dis. Clin. N 13. Klis, F. M., P. Mol, K. Hellingwerf, and S. Brul. 2002. Dynamics of cell wall Am. 16:837–874. structure in Saccharomyces cerevisiae. FEMS Microbiol. Rev. 26:239–256. 35. Pradel, E., and J. J. Ewbank. 2004. Genetic models in pathogenesis. Annu. 14. Kraus, P. R., D. S. Fox, G. M. Cox, and J. Heitman. 2003. The Cryptococcus Rev. Genet. 38:347–363. neoformans MAP kinase Mpk1 regulates cell integrity in response to anti- 36. Salas, S. D., J. E. Bennett, K. J. Kwon-Chung, J. R. Perfect, and P. R. fungal drugs and loss of calcineurin function. Mol. Microbiol. 48:1377–1387. Williamson. 1996. Effect of the laccase gene CNLAC1, on virulence of 15. Kurz, C. L., S. Chauvet, E. Andres, M. Aurouze, I. Vallet, G. P. Michel, M. Cryptococcus neoformans. J. Exp. Med. 184:377–386. Uh, J. Celli, A. Filloux, S. De Bentzmann, I. Steinmetz, J. A. Hoffmann, B. B. 37. Steenbergen, J. N., H. A. Shuman, and A. Casadevall. 2001. Cryptococcus Finlay, J. P. Gorvel, D. Ferrandon, and J. J. Ewbank. 2003. Virulence factors neoformans interactions with amoebae suggest an explanation for its viru- of the human opportunistic pathogen Serratia marcescens identiﬁed by in vivo lence and intracellular pathogenic strategy in macrophages. Proc. Natl. screening. EMBO J. 22:1451–1460. Acad. Sci. USA 98:15245–15250. 16. Lee, K. S., and D. E. Levin. 1992. Dominant mutations in a gene encoding a 38. Tan, M. W., S. Mahajan-Miklos, and F. M. Ausubel. 1999. Killing of Cae- putative protein kinase (BCK1) bypass the requirement for a Saccharomyces norhabditis elegans by Pseudomonas aeruginosa used to model mammalian cerevisiae protein kinase C homolog. Mol. Cell. Biol. 12:172–182. bacterial pathogenesis. Proc. Natl. Acad. Sci. USA 96:715–720. 17. Levin, D. E. 2005. Cell wall integrity signaling in Saccharomyces cerevisiae. 39. Thompson, J. R., C. M. Douglas, W. Li, C. K. Jue, B. Pramanik, X. Yuan, Microbiol. Mol. Biol. Rev. 69:262–291. T. H. Rude, D. L. Toffaletti, J. R. Perfect, and M. Kurtz. 1999. A glucan 18. Levin, D. E., F. O. Fields, Kunisawa, J. M. Bishop, and J. Thorner. 1990. A synthase FKS1 homolog in Cryptococcus neoformans is single copy and en- candidate protein kinase C gene, PKC1, is required for the S. cerevisiae cell codes an essential function. J. Bacteriol. 181:444–453. cycle. Cell 62:213–224. 40. Wang, P., M. E. Cardenas, G. M. Cox, J. R. Perfect, and J. Heitman. 2001. 19. Loftus, B. J., E. Fung, P. Roncaglia, D. Rowley, P. Amedeo, D. Bruno, J. Two cyclophilin A homologs with shared and distinct functions important for Vamathevan, M. Miranda, I. J. Anderson, J. A. Fraser, J. E. Allen, I. E. growth and virulence of Cryptococcus neoformans. EMBO Rep. 2:511–518. Bosdet, M. R. Brent, R. Chiu, T. L Doering, M. J. Donlin, C. A. D’Souza, 41. Wojda, I., R. Alonso-Monge, J. P. Bebelman, W. H. Mager, and M. Siderius. D. S. Fox, V. Grinberg, J. Fu, M. Fukushima, B. J. Haas, J. C. Huang, G. 2003. Response to high osmotic conditions and elevated temperature in Janbon, S. J. Jones, H. L. Koo, M. I. Krzywinski, J. K. Kwon-Chung, K. B. Saccharomyces cerevisiae is controlled by intracellular glycerol and involves Lengeler, R. Maiti, M. A. Marra, R. E. Marra, C. A. Mathewson, T. G. coordinate activity of MAP kinase pathways. Microbiology 149:1193–1204.

Editor: A. Casadevall