Number 8 August 2014

Atlas of Genetics and Cytogenetics in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Volume 18 - Number 8 August 2014

The PDF version of the Atlas of Genetics and Cytogenetics in Oncology and Haematology is a reissue of the original articles published in collaboration with the Institute for Scientific and Technical Information (INstitut de l’Information Scientifique et Technique - INIST) of the French National Center for Scientific Research (CNRS) on its electronic publishing platform I-Revues. Online and PDF versions of the Atlas of Genetics and Cytogenetics in Oncology and Haematology are hosted by INIST-CNRS. Atlas of Genetics and Cytogenetics in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Scope

The Atlas of Genetics and Cytogenetics in Oncology and Haematology is a peer reviewed on-line journal in open access, devoted to genes, cytogenetics, and clinical entities in cancer, and cancer-prone diseases. It presents structured review articles (“cards”) on genes, leukaemias, solid tumours, cancer-prone diseases, and also more traditional review articles (“deep insights”) on the above subjects and on surrounding topics. It also present case reports in hematology and educational items in the various related topics for students in Medicine and in Sciences.

Editorial correspondance

Jean-Loup Huret Genetics, Department of Medical Information, University Hospital F-86021 Poitiers, France tel +33 5 49 44 45 46 or +33 5 49 45 47 67 [email protected] or [email protected]

Staff Mohammad Ahmad, Mélanie Arsaban, Marie-Christine Jacquemot-Perbal, Vanessa Le Berre, Anne Malo, Carol Moreau, Catherine Morel-Pair, Laurent Rassinoux, Alain Zasadzinski. Philippe Dessen is the Database Director, and Alain Bernheim the Chairman of the on-line version (Gustave Roussy Institute – Villejuif – France).

The Atlas of Genetics and Cytogenetics in Oncology and Haematology (ISSN 1768-3262) is published 12 times a year by ARMGHM, a non profit organisation, and by the INstitute for Scientific and Technical Information of the French National Center for Scientific Research (INIST-CNRS) since 2008.

The Atlas is hosted by INIST-CNRS (http://www.inist.fr)

http://AtlasGeneticsOncology.org

OPEN ACC ESS JOURNAL INIST -CNRS

Editor Jean-Loup Huret (Poitiers, France) Editorial Board

Sreeparna Banerjee (Ankara, Turkey) Solid Tumours Section Alessandro Beghini (Milan, Italy) Genes Section Anne von Bergh (Rotterdam, The Netherlands) Genes / Leukaemia Sections Judith Bovée (Leiden, The Netherlands) Solid Tumours Section Vasantha Brito-Babapulle (London, UK) Leukaemia Section Charles Buys (Groningen, The Netherlands) Deep Insights Section Anne Marie Capodano (Marseille, France) Solid Tumours Section Fei Chen (Morgantown, West Virginia) Genes / Deep Insights Sections Antonio Cuneo (Ferrara, Italy) Leukaemia Section Paola Dal Cin (Boston, Massachussetts) Genes / Solid Tumours Section Brigitte Debuire (Villejuif, France) Deep Insights Section François Desangles (Paris, France) Leukaemia / Solid Tumours Sections Enric Domingo-Villanueva (London, UK) Solid Tumours Section Ayse Erson (Ankara, Turkey) Solid Tumours Section Richard Gatti (Los Angeles, California) Cancer-Prone Diseases / Deep Insights Sections Ad Geurts van Kessel (Nijmegen, The Netherlands) Cancer-Prone Diseases Section Oskar Haas (Vienna, Austria) Genes / Leukaemia Sections Anne Hagemeijer (Leuven, Belgium) Deep Insights Section Nyla Heerema (Colombus, Ohio) Leukaemia Section Jim Heighway (Liverpool, UK) Genes / Deep Insights Sections Sakari Knuutila (Helsinki, Finland) Deep Insights Section Lidia Larizza (Milano, Italy) Solid Tumours Section Lisa Lee-Jones (Newcastle, UK) Solid Tumours Section Edmond Ma (Hong Kong, China) Leukaemia Section Roderick McLeod (Braunschweig, Germany) Deep Insights / Education Sections Cristina Mecucci (Perugia, Italy) Genes / Leukaemia Sections Fredrik Mertens (Lund, Sweden) Solid Tumours Section Konstantin Miller (Hannover, Germany) Education Section Felix Mitelman (Lund, Sweden) Deep Insights Section Hossain Mossafa (Cergy Pontoise, France) Leukaemia Section Stefan Nagel (Braunschweig, Germany) Deep Insights / Education Sections Florence Pedeutour (Nice, France) Genes / Solid Tumours Sections Elizabeth Petty (Ann Harbor, Michigan) Deep Insights Section Susana Raimondi (Memphis, Tennesse) Genes / Leukaemia Section Mariano Rocchi (Bari, Italy) Genes Section Alain Sarasin (Villejuif, France) Cancer-Prone Diseases Section Albert Schinzel (Schwerzenbach, Switzerland) Education Section Clelia Storlazzi (Bari, Italy) Genes Section Sabine Strehl (Vienna, Austria) Genes / Leukaemia Sections Nancy Uhrhammer (Clermont Ferrand, France) Genes / Cancer-Prone Diseases Sections Dan Van Dyke (Rochester, Minnesota) Education Section Roberta Vanni (Montserrato, Italy) Solid Tumours Section Franck Viguié (Paris, France) Leukaemia Section José Luis Vizmanos (Pamplona, Spain) Leukaemia Section Thomas Wan (Hong Kong, China) Genes / Leukaemia Sections Adriana Zamecnikova (Kuwait) Leukaemia Section

Atlas Genet Cytogenet Oncol Haematol. 2014 18(8) Atlas of Genetics and Cytogenetics in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Volume 18, Number 8, August 2014

Table of contents

Gene Section

ABCC11 (ATP-binding cassette, sub-family C (CFTR/MRP), member 11) 540 Akimitsu Yamada, Kazuaki Takabe, Krista P Terracina, Takashi Ishikawa, Itaru Endo DGKA (diacylglycerol kinase, alpha 80kDa) 545 Isabel Merida, Antonia Avila-Flores EPAS1 (Endothelial PAS Domain Protein 1) 550 Sofie Mohlin, Arash Hamidian, Daniel Bexell, Sven Påhlman, Caroline Wigerup INGX (inhibitor of growth family, X-linked, pseudogene) 556 Audrey Mouche, Rémy Pedeux MIR107 (MicroRNA 107) 559 Priyanka Sharma, Rinu Sharma MYO1A (myosin IA) 565 Diego Arango del Corro, Rocco Mazzolini NR1H4 (nuclear receptor subfamily 1, group H, member 4) 571 Oscar Briz, Elisa Herraez, Jose JG Marin PRND (Prion Protein 2 (Dublet)) 576 Gabriele Giachin, Giuseppe Legname WNT1 (wingless-type MMTV integration site family, member 1) 581 Irini Theohari, Lydia Nakopoulou EGR1 (Early Growth Response 1) 584 Young Han Lee HDAC2 (histone deacetylase 2) 594 Hyun Jin Bae, Suk Woo Nam PF4 (platelet factor 4) 598 Katrien Van Raemdonck, Paul Proost, Jo Van Damme, Sofie Struyf

Leukaemia Section t(9;13)(p12;q21) PAX5/DACH1 605 Jean-Loup Huret t(X;9)(q21;p13) PAX5/DACH2 608 Jean-Loup Huret

Deep Insight Section

Th17 cells: inflammation and regulation 611 Kazuya Masuda, Tadamitsu Kishimoto

Atlas Genet Cytogenet Oncol Haematol. 2014 18(8) Atlas of Genetics and Cytogenetics in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Case Report Section

T-cell acute lymphoblastic leukemia with t(7;14)(p15;q11.2)/HOXA-TCRA/D 624 and biallelic deletion of CDKN2A. Case report and literature review Jonathon Mahlow, Salah Ebrahim, Anwar N Mohamed

Atlas Genet Cytogenet Oncol Haematol. 2014 18(8) Atlas of Genetics and Cytogenetics in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Gene Section Review

ABCC11 (ATP-binding cassette, sub-family C (CFTR/MRP), member 11) Akimitsu Yamada, Kazuaki Takabe, Krista P Terracina, Takashi Ishikawa, Itaru Endo Department of Breast and Oncological Surgery, Yokohama City University School of Medicine, Kanagawa, Japan (AY, IE), Department of Surgery, Virginia Commonwealth University, Richmond, Virginia, USA (AY, KT, KPT), Department of Breast and Thyroid Surgery, Yokohama City University Medical Center, Yokohama, Kanagawa, Japan (TI)

Published in Atlas Database: December 2013 Online updated version : http://AtlasGeneticsOncology.org/Genes/ABCC11ID538ch16q12.html DOI: 10.4267/2042/54005 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2014 Atlas of Genetics and Cytogenetics in Oncology and Haematology

genes were classified into the multidrug resistant- Abstract associated protein (MRP) family. Review on ABCC11, with data on DNA/RNA, on Description the protein encoded and where the gene is implicated. The ABCC11 gene is encoded by a 68 kb gene consisting of 30 exons (Yabuuchi et al., 2001). According to the August 2013, NCBI database, Identity there are three ABCC11 variants. Variant 1 consists Other names: EWWD, MRP8, WW of 4576 bp (NM_032583.3) while variant 2 consists of 4862 bp (NM_033151.3). Both variant 1 and 2 HGNC (Hugo): ABCC11 genes encode an ABCC11 protein (isoform a) Location: 16q12.1 consisting of 1382 amino acids. Variant 3 (isoform b) consists of 4462 bp (NM_145186.2) and encodes DNA/RNA a protein consisting of 1344 amino acids. This variant 3 lacks an alternate in-frame exon compared Note to variant 1, resulting in a shorter protein (isoform In 2001, three research groups independently b), compared to isoform a. cloned two novel ATP-binding cassette transporters named ABCC11 and ABCC12 from the cDNA Transcription library of human adult liver (Bera et al., 2001; Transcript analyses suggest that human ABCC11 Tammur et al., 2001; Yabuuchi et al., 2001). These mRNA is ubiquitously expressed in human adult two genes have been found to be located at human and fetal tissues (Tammur et al., 2001; Yabuuchi et chromosome 16q12.1. Phylogenetic analysis al., 2001). ABCC11 mRNA has been detected in determined that ABCC11 and ABCC12 are derived several tissues including breast, testis, liver, by duplication, and are closely related to the placenta, and brain (Bera et al., 2001; Tammur et ABCC5 gene (Tammur et al., 2001). ABCC11 has al., 2001; Yabuuchi et al., 2001). Transcripts of overall 42% identity and 51% similarity with the ABCC11 genes have been observed in cell lines of MRP5 sequence and the predicted amino acid carcinoma and adenocarcinoma originating from sequences of gene products show high similarity to breast, lung, colon and prostate (Yabuuchi et al., those of ABCC5 (Bera et al., 2001). Thus these two 2001).

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 540 ABCC11 (ATP-binding cassette, sub-family C (CFTR/MRP), member 11) Yamada A, et al.

Schematic illustration of ABCC11 protein structure. ABCC11 has a total of 12 transmembrane (TM) regions and two intracellular ATP-binding cassettes.

or vacuolar localization is detected in the cerumen Protein apocrine glands of people homozygous for the SNP Note variant (Toyoda et al., 2009). ABCC11, a plasma membrane ATP-binding When ABCC11 wild type protein was transfected cassette transporter, has been implicated in the drug exogenously into Madin-Darby canine kidney cells resistance of breast cancer due to its ability to stain II (MDCK II) cells, the protein was found to confer resistance to fluoropyrimidines (5-FU), and be preferentially sorted to the apical membrane of to efflux methotrexate, and has been found to be these polarized cells, a finding with a known expressed in breast cancer tumors. One of the single association to axonal localization within the neuron nucleotide polymorphisms (SNPs) of this gene, (Bortfeld et al., 2006). 538G>A, determines wet vs. dry earwax type and it Function also likely has a key role in the function of ceruminous apocrine glands. ABCC11 has been identified as an efflux pump for variety of lipophilic anions including the cyclic Description nucleotides cAMP and cGMP, glutathione The calculated molecular weight of the protein conjugates such as leukotriene C 4 (LTC 4) and S- encoded by the ORF is about 150 kDa. The N- (2,4-dinitrophenyl)-glutathione (DNP-SG), steroid linked glycosylated form of ABCC11 is 180 kDa sulfates such as estrone 3-sulfate (E 13S) and (Toyoda et al., 2009). dehydroepiandrosterone 3-sulfate (DHEAS), Structure: ABCC11 is a full transporter and has two glucuronides such as estradiol 17-β-D-glucuronide conserved nucleotide binding domains and 12 (E 217 βG), the monoanionic bile acids glycocholate putative transmembrane domains (Kruh et al., and taurocholate, as well as folic acid and its analog 2007). methotrexate (MTX) (Guo et al., 2003; Chen et al., Expression 2005; Bortfeld et al., 2006). ABCC11 is directly involved in 5-FU resistance by ABCC11 wild type protein with Gly180 is the efflux transport of the active metabolite 5- expressed in the cerumen gland, which is one of the fluoro-2'-deoxyuridine 5'-monophosphate (FdUMP) apocrine glands (Toyoda et al., 2009). ABCC11 has (Oguri et al., 2007). also been identified as an axonal protein of the ABCC11 polymorphisms have strong associations central nervous system and peripheral nervous with earwax type (Yoshiura et al., 2006), axillary system (Bortfeld et al., 2006). osmidrosis (Yabuuchi et al., 2001; Nakano et al., Localisation 2009; Toyoda et al., 2009; Inoue et al., 2010; ABCC11 wild type with Gly180 is an N-linked Martin et al., 2010), and apocrine colostrum glycosylated protein, which is localized within secretion from mammary gland (Miura et al., 2007). intracellular granules and large vacuoles as well as Human earwax type is determined by a single at the luminal membrane of secretory cells in the nucleotide polymorphism (SNP), 538G>A cerumen apocrine gland. (re17822931; Gly180Alg), in ABCC11 (Yoshiura As opposed to the wild type, the SNP variant et al., 2006; Toyoda et al., 2009). Arg180 lacks N-linked glycosylation and readily The G/G and G/A genotypes correspond to the wet undergoes proteosomal degradation, most probably type of earwax, whereas A/A corresponds to the dry via ubiquitination. As a consequence, no granular type (Toyoda et al., 2009).

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 541 ABCC11 (ATP-binding cassette, sub-family C (CFTR/MRP), member 11) Yamada A, et al.

Frequencies of this allele are known to vary dramatically depending on ethnicity. For example, Implicated in in Mongoloid populations in Asia, the frequency of Breast cancer the 538A allele is predominantly high, whereas the frequency of this allele is low among Caucasians Note and Africans. Consequently, earwax type also Several studies have reported that ABCC11 mRNA varies between populations (Yoshiura et al., 2006). is highly expressed in breast tumors and breast In addition to its association with earwax type, the cancer cell lines (Bera et al., 2001; Yabuuchi et al., ABCC11 wild type (G/G and G/A) allele is also 2001; Bièche et al., 2004; Park et al., 2006, Szakács intimately associated with axillary osmidrosis, and et al., 2004). several studies have already concluded that the ABCC11 expression is regulated directly or genotype at ABCC11 538G>A would be a useful indirectly by estrogen receptor α, and the prolonged biomarker for the diagnosis of axillary osmidrosis exposure of breast cancer cells to tamoxifen has (Yabuuchi et al., 2001; Nakano et al., 2009; Toyoda been associated with up-regulation of ABCC11 et al., 2009; Inoue et al., 2010; Martin et al., 2010). (Honorat et al., 2008). Axillary osmidrosis patients (538G/G homozygote In a study by Park et al., the mRNA of ABCC11 or G/A heterozygote) have significantly more was shown to be increased in the breast tumors of numerous and larger-sized axillary apocrine glands patients with residual disease compared to those compared to those with A/A homozygote. who have achieved a complete response from Lastly, there is a strong association between human neoadjuvant chemotherapy. earwax-type according to 538G>A and apocrine However, ABCC11, in the analysis, was not found colostrum secretion from the mammary gland. In a to be the ABCC transporter protein most predictive study in 225 Japanese women, the frequency of of failure of neoadjuvant chemotherapy (Park et al., women without colostrum among dry-type women 2006). was significantly higher than that among wet-type A tissue microarray analysis of 281 breast cancer women and the measurable colostrum volume in samples revealed that high expression of ABCC11 dry type women was significantly smaller than that in breast cancer is associated with aggressive found in wet-type women (Miura et al., 2007). subtypes such as HER2 type or triple negative type, and is associated with low disease free survival Homology (Yamada et al., 2013). The mechanism underlying No gene orthologous to human ABCC11 has been this association with breast cancer patients' survival found in mammals except for primates (Shimizu et remains unknown. al., 2003). Leukemia Note Mutations Some of the histone deacetylase inhibitors such as Note SAHA are known to induce the expression of ABC More than 10 non-synonymous single-nucleotide transporters including the ABCC11 gene to make polymorphisms (SNPs) have been reported in the acute myeloid leukemia (AML) cells resistant to a ABCC11 gene, including R19H, G180R, A317E, broad-spectrum of drugs (Hauswald et al., 2009). T546M, R630W, V648I, V687I, K735R, M970V, The efflux of the nucleoside analogue cytosine and H1344R. There is also a rare deletion mutation, arabinoside (AraC) metabolite by ABCC11 is one ∆27 (Toyoda et al., 2008; Toyoda et al., 2009). of the mechanisms contributing to resistance of Among those SNPs, one SNP (rs17822931; AML. The expression of ABCC11 WT is an 538G>A, Gly180Arg) located on exon 4 is thought important factor affecting AML patient survival to be a clinically important polymorphism (Guo et al., 2009). described as above. Paroxysmal kinesigenic Further, the wild type allele of the ABCC11 gene choreoathetosis (PKC) and infantile (G/G or G/A) is associated with breast cancer risk convulsions with paroxysmal in the Japanese population (Ota et al., 2010). However, this has not been found to be the case in choreoathetosis (ICCA). women of European or Caucasian descent (Beesley Note et al., 2011; Lang et al., 2011). ABCC11 and ABCC12 have been mapped to a Thus it remains controversial whether the 518G region harboring genes for paroxysmal kinesigenic allele contributes to a risk factor of breast cancer or choreoathetosis (PKC) (Tomita et al., 1999), and not. infantile convulsions with paroxysmal A deletion mutation, ∆27, has also been linked to choreoathetosis (ICCA) (Lee et al., 1998). The two the formation of dry-type earwax (Ishikawa et al., genes were thought to be represent positional 2012). candidates for this disorder; however, it has since

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 542 ABCC11 (ATP-binding cassette, sub-family C (CFTR/MRP), member 11) Yamada A, et al.

been reported that ABCC11 has been ruled out as Szakács G, Annereau JP, Lababidi S, Shankavaram U, the cause of PKC (Du et al., 2008). Arciello A, Bussey KJ, Reinhold W, Guo Y, Kruh GD, Reimers M, Weinstein JN, Gottesman MM. Predicting drug sensitivity and resistance: profiling ABC transporter genes Breakpoints in cancer cells. Cancer Cell. 2004 Aug;6(2):129-37 Note Chen ZS, Guo Y, Belinsky MG, Kotova E, Kruh GD. Transport of bile acids, sulfated steroids, estradiol 17-beta- ABCC11 is in a relatively early stage of D-glucuronide, and leukotriene C4 by human multidrug investigation. The SNP (538G>A) in the ABCC11 resistance protein 8 (ABCC11). Mol Pharmacol. 2005 gene determines both ear wax phenotype and Feb;67(2):545-57 axillary osmidrosis and plays a key role in the Bortfeld M, Rius M, König J, Herold-Mende C, Nies AT, function of apocrine glands. Though ABCC11 Keppler D. Human multidrug resistance protein 8 transports a variety of organic anions, the (MRP8/ABCC11), an apical efflux pump for steroid sulfates, is an axonal protein of the CNS and peripheral endogenous natural substrates for this transporter nervous system. Neuroscience. 2006;137(4):1247-57 have not yet been identified that might explain the association between ABCC11 expression in breast Park S, Shimizu C, Shimoyama T, Takeda M, Ando M, Kohno T, Katsumata N, Kang YK, Nishio K, Fujiwara Y. cancer and poor prognosis. Gene expression profiling of ATP-binding cassette (ABC) transporters as a predictor of the pathologic response to References neoadjuvant chemotherapy in breast cancer patients. Breast Cancer Res Treat. 2006 Sep;99(1):9-17 Lee WL, Tay A, Ong HT, Goh LM, Monaco AP, Szepetowski P. Association of infantile convulsions with Yoshiura K, Kinoshita A, Ishida T, Ninokata A, Ishikawa T, paroxysmal dyskinesias (ICCA syndrome): confirmation of Kaname T, Bannai M, Tokunaga K, Sonoda S, Komaki R, linkage to human chromosome 16p12-q12 in a Chinese Ihara M, Saenko VA, Alipov GK, Sekine I, Komatsu K, family. Hum Genet. 1998 Nov;103(5):608-12 Takahashi H, Nakashima M, Sosonkina N, Mapendano CK, Ghadami M, Nomura M, Liang DS, Miwa N, Kim DK, Tomita Ha, Nagamitsu S, Wakui K, Fukushima Y, Yamada Garidkhuu A, Natsume N, Ohta T, Tomita H, Kaneko A, K, Sadamatsu M, Masui A, Konishi T, Matsuishi T, Aihara Kikuchi M, Russomando G, Hirayama K, Ishibashi M, M, Shimizu K, Hashimoto K, Mineta M, Matsushima M, Takahashi A, Saitou N, Murray JC, Saito S, Nakamura Y, Tsujita T, Saito M, Tanaka H, Tsuji S, Takagi T, Nakamura Niikawa N. A SNP in the ABCC11 gene is the determinant Y, Nanko S, Kato N, Nakane Y, Niikawa N. Paroxysmal of human earwax type. Nat Genet. 2006 Mar;38(3):324-30 kinesigenic choreoathetosis locus maps to chromosome 16p11.2-q12.1. Am J Hum Genet. 1999 Dec;65(6):1688-97 Kruh GD, Guo Y, Hopper-Borge E, Belinsky MG, Chen ZS. ABCC10, ABCC11, and ABCC12. Pflugers Arch. 2007 Bera TK, Lee S, Salvatore G, Lee B, Pastan I. MRP8, a Feb;453(5):675-84 new member of ABC transporter superfamily, identified by EST database mining and gene prediction program, is Miura K, Yoshiura K, Miura S, Shimada T, Yamasaki K, highly expressed in breast cancer. Mol Med. 2001 Yoshida A, Nakayama D, Shibata Y, Niikawa N, Masuzaki Aug;7(8):509-16 H. A strong association between human earwax-type and apocrine colostrum secretion from the mammary gland. Tammur J, Prades C, Arnould I, Rzhetsky A, Hutchinson Hum Genet. 2007 Jun;121(5):631-3 A, Adachi M, Schuetz JD, Swoboda KJ, Ptácek LJ, Rosier M, Dean M, Allikmets R. Two new genes from the human Oguri T, Bessho Y, Achiwa H, Ozasa H, Maeno K, Maeda ATP-binding cassette transporter superfamily, ABCC11 H, Sato S, Ueda R. MRP8/ABCC11 directly confers and ABCC12, tandemly duplicated on chromosome 16q12. resistance to 5-fluorouracil. Mol Cancer Ther. 2007 Gene. 2001 Jul 25;273(1):89-96 Jan;6(1):122-7 Yabuuchi H, Shimizu H, Takayanagi S, Ishikawa T. Du T, Feng B, Wang X, Mao W, Zhu X, Li L, Sun B, Niu N, Multiple splicing variants of two new human ATP-binding Liu Y, Wang Y, Chen B, Cai X, Liu Y. Localization and cassette transporters, ABCC11 and ABCC12. Biochem mutation detection for paroxysmal kinesigenic Biophys Res Commun. 2001 Nov 9;288(4):933-9 choreoathetosis. J Mol Neurosci. 2008 Feb;34(2):101-7 Guo Y, Kotova E, Chen ZS, Lee K, Hopper-Borge E, Honorat M, Mesnier A, Vendrell J, Guitton J, Bieche I, Belinsky MG, Kruh GD. MRP8, ATP-binding cassette C11 Lidereau R, Kruh GD, Dumontet C, Cohen P, Payen L. (ABCC11), is a cyclic nucleotide efflux pump and a ABCC11 expression is regulated by estrogen in MCF7 resistance factor for fluoropyrimidines 2',3'-dideoxycytidine cells, correlated with estrogen receptor alpha expression in and 9'-(2'-phosphonylmethoxyethyl)adenine. J Biol Chem. postmenopausal breast tumors and overexpressed in 2003 Aug 8;278(32):29509-14 tamoxifen-resistant breast cancer cells. Endocr Relat Cancer. 2008 Mar;15(1):125-38 Shimizu H, Taniguchi H, Hippo Y, Hayashizaki Y, Aburatani H, Ishikawa T. Characterization of the mouse Toyoda Y, Hagiya Y, Adachi T, Hoshijima K, Kuo MT, Abcc12 gene and its transcript encoding an ATP-binding Ishikawa T. MRP class of human ATP binding cassette cassette transporter, an orthologue of human ABCC12. (ABC) transporters: historical background and new Gene. 2003 May 22;310:17-28 research directions. Xenobiotica. 2008 Jul;38(7-8):833-62 Bièche I, Girault I, Urbain E, Tozlu S, Lidereau R. Guo Y, Köck K, Ritter CA, Chen ZS, Grube M, Jedlitschky Relationship between intratumoral expression of genes G, Illmer T, Ayres M, Beck JF, Siegmund W, Ehninger G, coding for xenobiotic-metabolizing enzymes and benefit Gandhi V, Kroemer HK, Kruh GD, Schaich M. Expression from adjuvant tamoxifen in estrogen receptor alpha- of ABCC-type nucleotide exporters in blasts of adult acute positive postmenopausal breast carcinoma. Breast Cancer myeloid leukemia: relation to long-term survival. Clin Res. 2004;6(3):R252-63 Cancer Res. 2009 Mar 1;15(5):1762-9

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 543 ABCC11 (ATP-binding cassette, sub-family C (CFTR/MRP), member 11) Yamada A, et al.

Hauswald S, Duque-Afonso J, Wagner MM, Schertl FM, Anticancer Res. 2010 Dec;30(12):5189-94 Lübbert M, Peschel C, Keller U, Licht T. Histone deacetylase inhibitors induce a very broad, pleiotropic Beesley J, Johnatty SE, Chen X, Spurdle AB, Peterlongo anticancer drug resistance phenotype in acute myeloid P, Barile M, Pensotti V, Manoukian S, Radice P, Chenevix- leukemia cells by modulation of multiple ABC transporter Trench G. No evidence for an association between the genes. Clin Cancer Res. 2009 Jun 1;15(11):3705-15 earwax-associated polymorphism in ABCC11 and breast cancer risk in Caucasian women. Breast Cancer Res Nakano M, Miwa N, Hirano A, Yoshiura K, Niikawa N. A Treat. 2011 Feb;126(1):235-9 strong association of axillary osmidrosis with the wet earwax type determined by genotyping of the ABCC11 Lang T, Justenhoven C, Winter S, Baisch C, Hamann U, gene. BMC Genet. 2009 Aug 4;10:42 Harth V, Ko YD, Rabstein S, Spickenheuer A, Pesch B, Brüning T, Schwab M, Brauch H. The earwax-associated Toyoda Y, Sakurai A, Mitani Y, Nakashima M, Yoshiura K, SNP c.538G>A (G180R) in ABCC11 is not associated with Nakagawa H, Sakai Y, Ota I, Lezhava A, Hayashizaki Y, breast cancer risk in Europeans. Breast Cancer Res Treat. Niikawa N, Ishikawa T. Earwax, osmidrosis, and breast 2011 Oct;129(3):993-9 cancer: why does one SNP (538G>A) in the human ABC transporter ABCC11 gene determine earwax type? FASEB Ishikawa T, Toyoda Y, Yoshiura K, Niikawa N. J. 2009 Jun;23(6):2001-13 Pharmacogenetics of human ABC transporter ABCC11: new insights into apocrine gland growth and metabolite Inoue Y, Mori T, Toyoda Y, Sakurai A, Ishikawa T, Mitani secretion. Front Genet. 2012;3:306 Y, Hayashizaki Y, Yoshimura Y, Kurahashi H, Sakai Y. Correlation of axillary osmidrosis to a SNP in the ABCC11 Yamada A, Ishikawa T, Ota I, Kimura M, Shimizu D, gene determined by the Smart Amplification Process Tanabe M, Chishima T, Sasaki T, Ichikawa Y, Morita S, (SmartAmp) method. J Plast Reconstr Aesthet Surg. 2010 Yoshiura K, Takabe K, Endo I. High expression of ATP- Aug;63(8):1369-74 binding cassette transporter ABCC11 in breast tumors is associated with aggressive subtypes and low disease-free Martin A, Saathoff M, Kuhn F, Max H, Terstegen L, Natsch survival. Breast Cancer Res Treat. 2013 Feb;137(3):773- A. A functional ABCC11 allele is essential in the 82 biochemical formation of human axillary odor. J Invest Dermatol. 2010 Feb;130(2):529-40 This article should be referenced as such: Ota I, Sakurai A, Toyoda Y, Morita S, Sasaki T, Chishima Yamada A, Takabe K, Terracina KP, Ishikawa T, Endo I. T, Yamakado M, Kawai Y, Ishidao T, Lezhava A, Yoshiura ABCC11 (ATP-binding cassette, sub-family C K, Togo S, Hayashizaki Y, Ishikawa T, Ishikawa T, Endo I, (CFTR/MRP), member 11). Atlas Genet Cytogenet Oncol Shimada H. Association between breast cancer risk and Haematol. 2014; 18(8):540-544. the wild-type allele of human ABC transporter ABCC11.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 544 Atlas of Genetics and Cytogenetics in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Gene Section Review

DGKA (diacylglycerol kinase, alpha 80kDa) Isabel Merida, Antonia Avila-Flores Department of Immunology and Oncology, National Center for Biotechnology (CNB/CSIC). Darwin 3, Campus Autonoma/CSIC, Madrid 28049, Spain (IM, AAF)

Published in Atlas Database: December 2013 Online updated version : http://AtlasGeneticsOncology.org/Genes/DGKAID40299ch12q13.html DOI: 10.4267/2042/54006 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2014 Atlas of Genetics and Cytogenetics in Oncology and Haematology

as a negative regulator of Ras-MAPK pathway in T Abstract lymphocytes. Review on DGKA, with data on DNA/RNA, on the DGKA has a dual role in cancer; it exhibits protein encoded and where the gene is implicated. properties similar to a tumor suppressor and has also a positive role in the maintenance of cancerous Identity states. DGKA function might be crucial in the genesis and Other names: DAGK, DAGK1, DGK-alpha development of several pathologies. HGNC (Hugo): DGKA Location: 12q13.2 DNA/RNA Local order Note GSTP1-WIBG-DGKA -PMEL-CDK2. DGKA gene is highly expressed in thymus, spleen, Note testis and lung (Sanjuan et al., 2001). DGKA Diacylglycerol kinase alpha (DGKA) is a lipid displays alternative splicing; numerous splice kinase that phosphorylates the lipid diacylglycerol variants are predicted, including truncated forms of (DAG), transforming it into phosphatidic acid (PA). the protein as well as RNAs with introns retained DGKA is classified as a type I DGK, characterized (Martínez-Moreno et al., 2012). The expression of by possessing EF-hand motifs, which allow calcium some of these transcripts might be related to certain mediated regulation. DGKA has been characterized pathologies (Batista et al., 2013).

Figure 1. The DGKA gene is located at chromosome 12. It contains 24 exons and the translation initiator ATG is located at Exon 2.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 545 DGKA (diacylglycerol kinase, alpha 80kDa) Merida I, Avila-Flores A

Figure 2. Putative regulatory elements in the DGKA gene. Transcription initiation sites are indicated (arrows). The +1 position was assigned in the Inr element. Putative binding sites for transcription factors are indicated by rectangles; FoxO sites are gray (Adapted from Martinez-Moreno et al., 2012).

Transcription phosphatidylinositols and activates different proteins like mTOR or atypical PKCs. The DGKA gene encodes a protein of 80 KDa. Presence of regulatory regions in the gene was early Description suggested to restrain the expression of DGKA to - The diacylglycerol kinases (DGK) are a family of certain tissues (Fujikawa et al., 1993). signaling proteins that modulate diacylglycerol DGKA gene displays alternative use of promoter levels by catalyzing its conversion to phosphatidic regions, in homology with the mouse gene at least acid (Merida et al., 2008). DGK belongs to a two alternative promoters likely exist. superfamily that also includes the recently The regulatory gene region contain several binding identified bacterial DgkB as well as the sphingosine motifs for transcription factors including FoxO, kinase (SPK) and ceramide kinase (CERK) p53, Egr, Smad, etc, which allow the coupling of families. Proteins in this superfamily share a DGKA expression with several signaling pathways. common catalytic domain (DAGKc: Pfam00781). Identification of DGKA as a gene regulated by - In addition to the catalytic region, all DGK family FoxO has contributed to explain its transcriptional members have at least two protein kinase C-like downregulation in response to antigen stimulation type 1 (C1) domains that, except for the first C1 and interleukin 2 (IL2) (Martinez-Moreno et al., domain in DGKB and DGKG, lack the key residues 2012). that define a canonical phorbol ester/DAG-binding C1 domain (Shindo et al., 2003). Protein - Mammals express ten DGK isoforms grouped into Note five subtypes; each DGK subtype has distinct The protein encoded by the DGKA gene (2.7.1.107) regulatory motifs that suggest the existence of belongs to the eukaryotic diacylglycerol kinase diverse regulatory mechanisms and/or participation family. in different signaling complexes. It attenuates the second messenger diacylglycerol, - Diacylglycerol Kinase alpha (DGKA) together that activates C1-containing proteins like members with the beta (DGKB) and gamma (DGKG) of the classical and novel PKCs, PKD, RasGRP and isoforms represent the type I DGK, whose signature chimaerin families. is the presence at the N-terminal region of a It also produces phosphatidic acid, another lipid recoverin-like domain (RVH) and a tandem of EF mediator that participates in the resynthesis of hand motifs, characteristic of Ca 2+ -binding proteins.

Figure 3. Distribution of conserved and specific regions in DGKA. C1, conserved protein kinase C-type 1 regions. Y218, Tyrosine phosphorylated by c-Abl. Y335, Tyrosine phosphorylated by Src and Lck. PPP Pro-rich region proposed to interact with Src.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 546 DGKA (diacylglycerol kinase, alpha 80kDa) Merida I, Avila-Flores A

Expression role in enzyme activation and receptor-induced - DGKA is the only DGK isoform particularly membrane localization, as shown by enhanced enriched in the thymus and peripheral T activity and constitutive plasma membrane localization of a mutant lacking this region lymphocytes. DGKA levels are tightly coupled to 2+ the differentiation and proliferation state of T (Sanjuan et al., 2001). In addition to Ca lymphocytes. Quiescent, naïve T lymphocytes generation, activation of Tyr kinases is required for express high levels of DGKA that decrease rapidly membrane stabilization of DGKA (Sanjuan et al., in response to antigenic and IL2-derived signals 2001). Tyr335 in the human sequence, located at (Martinez-Moreno et al., 2012). DGKA was the hinge between the C1 and the catalytic domains, identified as an anergy-induced gene (Macian et al., was recently identified as an Lck-dependent DGKA 2002). Anergy represents an unresponsive state in T phosphorylation site in T lymphocytes (Merino et cells that is vital in immune system homeostasis al., 2008). and constitutes a means for avoiding response to - Membrane localization of DGKA in non-T cells self and thus, for preventing autoimmunity. Tumors requires Src-family tyrosine kinase activity and also induce anergic-non responsive states in T cells. involves the association of DGKA with Src via a In agreement with this finding, DGKA- proline-rich sequence (Baldanzi et al., 2008). overexpressing lymphocytes are "anergic" and no DGKA membrane localization and activation is longer respond to antigenic stimuli (Zha et al., required for cell motility, proliferation and 2006). On the contrary, T cells from DGKA angiogenesis, acting as a rheostat that sets the deficient mice are resistant to anergy induction thresholds required for growth factor-induced (Olenchock et al., 2006). migratory signals. - Recent studies have characterized miR-297 as a - Recent reports have suggested nuclear localization highly cytotoxic microRNA expressed in for DGKA following serum starvation and glioblastoma, with minimal cytotoxicity to normal demonstrated that DGKA relocates back to the astrocytes. DGKA is shown to be a miR-297 target cytosol in response to serum re-addition. Serum- with a critical role in miR-297 toxicity. These induced export requires c-Abl mediated Tyr-218 studies identify miR-297 as a novel and physiologic phosphorylation (Matsubara et al., 2012). regulator of cancer cell survival, largely through Function targeting of DGKA (Kefas et al., 2013). - The best characterized function for DGKA as a Localisation negative modulator of diacylglycerol-based - DGKA is a cytosolic enzyme that translocates to signaling has been demonstrated in T lymphocytes. the membrane to phosphorylate diacylglycerol. The DGKA acts as a "switch-off" signal for Ras N-terminal region of DGKA, encompassing the activation, mediated by localization to the Ca 2+ regulatory elements has a negative regulatory membrane of Ras-GRP1 a GDP-exchanger for Ras

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 547 DGKA (diacylglycerol kinase, alpha 80kDa) Merida I, Avila-Flores A

with a DAG-binding domain (Sanjuan et al., 2001; Glioblastoma Sanjuan et al., 2003). Note - Contrary to its negative contribution to T cell Recent studies have described DGKA as an responses, high DGKA expression in tumors important component of malignant transformation appears to have a positive role in neoplastic in glioblastoma (Dominguez et al., 2013). transformation. Impaired DGKA activity through siRNA targeting DGKA-dependent PA generation contributes to or the use of small-molecule inhibitors induced melanoma survival through activation of the NFKB caspase-mediated apoptosis in glioblastoma cells, pathway (Yanagisawa et al., 2007). but lacked toxicity in noncancerous cells. - DGKA mediated PA generation has been reported to participate in tumor migration and invasion. Lung cancer Generation of PA downstream of DGKA is Note essential to facilitate the Rab coupling protein (RCP)- mediated integrin recycling that is required Survival trees in a study involving the expression for tumor cell invasion (Rainiero et al., 2012). profiles of 3588 genes in 211 lung adenocarcinoma patients identified DGKA as a marker for good Mutations survival in a group of advanced-stage patients with remarkably good survival outcome (Berrar et al., Note 2005). V379I mutation in DGKA identified as a putative X-linked proliferative disease driver mutation for pancreatic cancer. Note Implicated in Studies have reported DGKA inhibition by the adaptor protein SAP (Baldanzi et al., 2011). Loss- Lymphoma of-function SAP mutations cause X-linked lymphoproliferative disease (XLP), an immune Note disorder characterized by a deregulated immune DGKA was found to be constitutively activated in response to Epstein-Barr virus, susceptibility to nucleophosmin/anaplastic lymphoma kinase (NPM lymphoma and defective antibody production. / ALK) fusion in malignant lymphomas, where Impaired regulation of DGKA activity in SAP- inhibition of DGKA significantly reduced tumor deficient lymphocytes may contribute to their growth (Bacchiocchi et al., 2005). defective TCR-induced responses, suggesting that Melanoma pharmacological inhibition of DGKA could be Note useful in the treatment of certain manifestations of DGKA has been implicated in suppression of TNF- XLP. alpha induced apoptosis of human melanoma cells CD8 tumor infiltrates via NF-KB (Yanagisawa et al., 2005). Note Hepatocellular carcinoma DGKA was found to be more highly expressed in Note CD8-tumor infiltrates T cells (TILs) in renal DGKA is absent in hepatocytes but it is expressed carcinoma that in circulating CD8 cells (Prinz et al., in different hepatocellular carcinoma cell lines. 2012). DGKA is found expressed in cancerous tissue but Low dose treatment of TILs with IL2 reduced not in the adjacent non-cancerous hepatocytes. DGKA protein levels, improved stimulation- High DGKA expression associates with high Ki67 induced ERK and AKT phosphorylation, and expression and a high rate of HCC recurrence increased the number of degranulating CD8-TILs. (p=0.033) following surgery. DGKA inhibition could be a novel strategy to In multivariate analyses, high DGKA expression is enhance anti-tumor CD8 T cells response and may found as an independent factor for determining help prevent inactivation of adoptively transferred HCC recurrence after surgery (Takeishi et al., T cells improving therapeutic efficacy. 2012). Localized aggressive periodontitis Pancreatic carcinoma (LAP) Note Note Using CHASM (Cancer-specific High-throughput Localized aggressive periodontitis (LAP) is a Annotation of Somatic Mutations) V379I mutation familial disorder characterized by destruction of the in DGKA was found as a putative driver mutation supporting structures of dentition. for pancreatic cancer (Carter et al., 2010). Microarray and kinetic-PCR analysis revealed

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 548 DGKA (diacylglycerol kinase, alpha 80kDa) Merida I, Avila-Flores A

diminished RNA expression of DGKA in Mérida I, Avila-Flores A, Merino E. Diacylglycerol kinases: neutrophils from LAP patients compared with at the hub of cell signalling. Biochem J. 2008 Jan 1;409(1):1-18 asymptomatic individuals (Gronert et al., 2004). Merino E, Avila-Flores A, Shirai Y, Moraga I, Saito N, Mérida I. Lck-dependent tyrosine phosphorylation of References diacylglycerol kinase alpha regulates its membrane Fujikawa K, Imai S, Sakane F, Kanoh H. Isolation and association in T cells. J Immunol. 2008 May characterization of the human diacylglycerol kinase gene. 1;180(9):5805-15 Biochem J. 1993 Sep 1;294 ( Pt 2):443-9 Carter H, Samayoa J, Hruban RH, Karchin R. Prioritization Sanjuán MA, Jones DR, Izquierdo M, Mérida I. Role of of driver mutations in pancreatic cancer using cancer- diacylglycerol kinase alpha in the attenuation of receptor specific high-throughput annotation of somatic mutations signaling. J Cell Biol. 2001 Apr 2;153(1):207-20 (CHASM). Cancer Biol Ther. 2010 Sep 15;10(6):582-7 Macián F, García-Cózar F, Im SH, Horton HF, Byrne MC, Baldanzi G, Pighini A, Bettio V, Rainero E, Traini S, Rao A. Transcriptional mechanisms underlying lymphocyte Chianale F, Porporato PE, Filigheddu N, Mesturini R, Song tolerance. Cell. 2002 Jun 14;109(6):719-31 S, Schweighoffer T, Patrussi L, Baldari CT, Zhong XP, van Blitterswijk WJ, Sinigaglia F, Nichols KE, Rubio I, Parolini Sanjuán MA, Pradet-Balade B, Jones DR, Martínez-A C, O, Graziani A. SAP-mediated inhibition of diacylglycerol Stone JC, Garcia-Sanz JA, Mérida I. T cell activation in kinase α regulates TCR-induced diacylglycerol signaling. J vivo targets diacylglycerol kinase alpha to the membrane: Immunol. 2011 Dec 1;187(11):5941-51 a novel mechanism for Ras attenuation. J Immunol. 2003 Mar 15;170(6):2877-83 Martínez-Moreno M, García-Liévana J, Soutar D, Torres- Ayuso P, Andrada E, Zhong XP, Koretzky GA, Mérida I, Shindo M, Irie K, Masuda A, Ohigashi H, Shirai Y, Ávila-Flores A. FoxO-dependent regulation of Miyasaka K, Saito N. Synthesis and phorbol ester binding diacylglycerol kinase α gene expression. Mol Cell Biol. of the cysteine-rich domains of diacylglycerol kinase (DGK) 2012 Oct;32(20):4168-80 isozymes. DGKgamma and DGKbeta are new targets of tumor-promoting phorbol esters. J Biol Chem. 2003 May Matsubara T, Ikeda M, Kiso Y, Sakuma M, Yoshino K, 16;278(20):18448-54 Sakane F, Merida I, Saito N, Shirai Y. c-Abl tyrosine kinase regulates serum-induced nuclear export of diacylglycerol Gronert K, Kantarci A, Levy BD, Clish CB, Odparlik S, kinase α by phosphorylation at Tyr-218. J Biol Chem. 2012 Hasturk H, Badwey JA, Colgan SP, Van Dyke TE, Serhan Feb 17;287(8):5507-17 CN. A molecular defect in intracellular lipid signaling in human neutrophils in localized aggressive periodontal Prinz PU, Mendler AN, Masouris I, Durner L, Oberneder R, tissue damage. J Immunol. 2004 Feb 1;172(3):1856-61 Noessner E. High DGK-α and disabled MAPK pathways cause dysfunction of human tumor-infiltrating CD8+ T cells Bacchiocchi R, Baldanzi G, Carbonari D, Capomagi C, that is reversible by pharmacologic intervention. J Colombo E, van Blitterswijk WJ, Graziani A, Fazioli F. Immunol. 2012 Jun 15;188(12):5990-6000 Activation of alpha-diacylglycerol kinase is critical for the mitogenic properties of anaplastic lymphoma kinase. Rainero E, Caswell PT, Muller PA, Grindlay J, McCaffrey Blood. 2005 Sep 15;106(6):2175-82 MW, Zhang Q, Wakelam MJ, Vousden KH, Graziani A, Norman JC. Diacylglycerol kinase α controls RCP- Berrar D, Sturgeon B, Bradbury I, Downes CS, Dubitzky dependent integrin trafficking to promote invasive W. Survival trees for analyzing clinical outcome in lung migration. J Cell Biol. 2012 Jan 23;196(2):277-95 adenocarcinomas based on gene expression profiles: identification of neogenin and diacylglycerol kinase alpha Takeishi K, Taketomi A, Shirabe K, Toshima T, Motomura expression as critical factors. J Comput Biol. 2005 T, Ikegami T, Yoshizumi T, Sakane F, Maehara Y. Jun;12(5):534-44 Diacylglycerol kinase alpha enhances hepatocellular carcinoma progression by activation of Ras-Raf-MEK-ERK Olenchock BA, Guo R, Carpenter JH, Jordan M, Topham pathway. J Hepatol. 2012 Jul;57(1):77-83 MK, Koretzky GA, Zhong XP. Disruption of diacylglycerol metabolism impairs the induction of T cell anergy. Nat Batista EL Jr, Kantarci AI, Hasturk H, Van Dyke TE. Immunol. 2006 Nov;7(11):1174-81 Alternative Splicing Generates a Diacylglycerol Kinase α (DGK α) Transcript That Acts as a Dominant Negative Zha Y, Marks R, Ho AW, Peterson AC, Janardhan S, Modulator of Superoxide Production in Localized Brown I, Praveen K, Stang S, Stone JC, Gajewski TF. T Aggressive Periodontitis. J Periodontol. 2013 Oct 30; cell anergy is reversed by active Ras and is regulated by diacylglycerol kinase-alpha. Nat Immunol. 2006 Dominguez CL, Floyd DH, Xiao A, Mullins GR, Kefas BA, Nov;7(11):1166-73 Xin W, Yacur MN, Abounader R, Lee JK, Wilson GM, Harris TE, Purow BW. Diacylglycerol kinase α is a critical Yanagisawa K, Yasuda S, Kai M, Imai S, Yamada K, signaling node and novel therapeutic target in glioblastoma Yamashita T, Jimbow K, Kanoh H, Sakane F. and other cancers. Cancer Discov. 2013 Jul;3(7):782-97 Diacylglycerol kinase alpha suppresses tumor necrosis factor-alpha-induced apoptosis of human melanoma cells Kefas B, Floyd DH, Comeau L, Frisbee A, Dominguez C, through NF-kappaB activation. Biochim Biophys Acta. Dipierro CG, Guessous F, Abounader R, Purow B. A miR- 2007 Apr;1771(4):462-74 297/hypoxia/DGK-α axis regulating glioblastoma survival. Neuro Oncol. 2013 Dec;15(12):1652-63 Baldanzi G, Cutrupi S, Chianale F, Gnocchi V, Rainero E, Porporato P, Filigheddu N, van Blitterswijk WJ, Parolini O, This article should be referenced as such: Bussolino F, Sinigaglia F, Graziani A. Diacylglycerol kinase-alpha phosphorylation by Src on Y335 is required Merida I, Avila-Flores A. DGKA (diacylglycerol kinase, for activation, membrane recruitment and Hgf-induced cell alpha 80kDa). Atlas Genet Cytogenet Oncol Haematol. motility. Oncogene. 2008 Feb 7;27(7):942-56 2014; 18(8):545-549.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 549 Atlas of Genetics and Cytogenetics in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Gene Section Review

EPAS1 (Endothelial PAS Domain Protein 1) Sofie Mohlin, Arash Hamidian, Daniel Bexell, Sven Påhlman, Caroline Wigerup Lund University, Center for Translational Cancer Research, Department of Laboratory Medicine, Medicon Village, Building 404, C3, SE-223 81 Lund, Sweden (SM, AH, DB, SP, CW)

Published in Atlas Database: December 2013 Online updated version : http://AtlasGeneticsOncology.org/Genes/EPAS1ID44088ch2p21.html DOI: 10.4267/2042/54007 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2014 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Abstract Transcription Review on EPAS1, with data on DNA/RNA, on the Transcript length: The gene is comprised of 16 protein encoded and where the gene is implicated. exons, constituting one main transcript of 5184 base pairs. Identity Pseudogene Other names: ECYT4, HIF2A, HLF, MOP2, None described. PASD2, bHLHe73 HGNC (Hugo): EPAS1 Protein Location: 2p21 Description Local order: RPL26P15 - RPL36AP14 - The HIF-2α protein is 870 amino acids long and uncharacterized LOC101926974 - EPAS1 - consists of a basic-helix-loop-helix domain, two uncharacterized LOC101805491 - TMEM247 - PER-ARNT-SIM domains (A and B), an oxygen- ATP6V1E2. dependent degradation domain (ODDD) and two transcriptional-activation domains (N-TAD and C- DNA/RNA TAD). Two proline residues (P 405 in ODDD and P531 in N-TAD) and an asparaginyl residue (N 847 in Description C-TAD) are subjected to hydroxylation during Genomic size: Starts at 46524541 and ends at physiologic oxygen tensions, regulating the stability 46613842. and activity of the HIF-2α protein.

Representation of the EPAS1/HIF2A protein with its specific domains specified. Critical hydroxylation sites are indicated.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 550 EPAS1 (Endothelial PAS Domain Protein 1) Mohlin S, et al.

Phosphorylation of HIF-2α at T 844 has been recent report, HIF-2α was further shown to protect reported as necessary for its transcriptional human hematopoietic stem/progenitor cells from activation function (Gradin et al., 2002). endoplasmic reticulum (ER) stress-induced Expression apoptosis and to enhance the long-term repopulating ability of these cells (Rouault-Pierre et In adult human tissue, HIF-2α protein is mainly al., 2013). expressed in cells experiencing low oxygen levels, and the HIF-2α mRNA has been shown to be Homology predominantly expressed in highly vascularized HIF-2α is part of the basic helix-loop-helix-PAS tissues (Tian et al., 1997). During human family of proteins and is structurally related to the embryonic and fetal development, HIF-2α is HIF-1α and HIF-3α subunits. While HIF-3α is transiently but specifically expressed in cells of the believed to negatively regulate the other two alpha developing sympathetic nervous system (SNS) subunits (Makino et al., 2001; Maynard et al., (Nilsson et al., 2005; Mohlin et al., 2013). In 2007), HIF-1α and HIF-2α share both sequence embryonic and adult mouse tissue, the expression similarity and target genes. However, despite 48% of HIF-2α mRNA is more or less restricted to primary amino acid sequence homology between endothelial cells (Tian et al., 1997; Jain et al., HIF-1α and HIF-2α (Tian et al., 1997), it is 1998). In a zebrafish model, the HIF-2α transcript is becoming increasingly evident that these two expressed early in brain tissue and blood vessels, proteins also function at distinct sites and during and later on HIF-2α replaces HIF-1α transcription differential cellular conditions. in the notochord (Rojas et al., 2007). Mutations Localisation HIF-2α is part of a transcriptional complex and is Germinal hence localized mainly in the nucleus upon hypoxic Functional mutations in human EPAS1 are induction. However, HIF-2α protein can also be associated with variations in hemoglobin and red detected in the cytoplasm, at hypoxic conditions blood cell concentration (Percy et al., 2008b; Beall and foremost at more physiological oxygen et al., 2010; Yi et al., 2010). Percy et al. described a conditions, as demonstrated in cultured cells in gain of function mutation in a family with high vitro and in tumor specimens in vivo (Holmquist- hemoglobin concentrations and erythrocytosis Mengelbier et al., 2006). These findings were (Percy et al., 2008b). Similar mutations, all recently strengthened by the demonstration of a role associated with small amino acid substitutions for HIF-2α as part of an oxygen-regulated leading to protein stabilization, have been reported translation initiation complex and presence of HIF- in other clinical cases (Gale et al., 2008; Martini et 2α in the cellular polysome fraction (Uniacke et al., al., 2008; Percy et al., 2008a; van Wijk et al., 2012). 2010). In contrast, EPAS1 mutations associated Function with a loss of function and low hemoglobin concentrations have been described in healthy At lower oxygen tensions, the hydroxylation of individuals living at high altitudes. Extensive HIF-2α by prolyl hydroxylases (PHDs) and Factor analysis of genome-wide sequence variations and Inhibiting HIF (FIH) is prevented, and the HIF-2α exome sequencing in Tibetans have shown that subunit relocates to the nucleus where it forms a EPAS1 is a key gene mutated in Tibetan transcriptional complex together with its binding populations (Beall et al., 2010; Simonson et al., partner ARNT (also known as HIF-1β) and co- 2010; Yi et al., 2010; Peng et al., 2011). The factors such as p300 and CBP. By binding to functional consequence of EPAS1 SNPs associated hypoxia response elements (HREs) in the promoter with low hemoglobin concentrations is described as of target genes, the HIF complex initiates adaptation to low oxygen without elevated red transcription of numerous genes involved in a blood cell production, thereby avoiding high blood variety of tumorigenic cellular processes, including viscosity creating cardiovascular risks. angiogenesis, invasion and metastasis, growth, dedifferentiation, and apoptosis (Semenza, 2003). Somatic As mentioned under the Localization section, HIF- Several studies have recently identified the first 2α has also been demonstrated to be part of a mutations in any of the HIF alpha subunits in hypoxia-regulated translation initiation complex. cancer. Somatic gain-of-function mutations in exon Hypoxia induces HIF-2α to form a complex 12 of the EPAS1 gene in two patients with together with RNA-binding protein RBM4 and cap- paraganglioma and associated erythrocytosis results binding eIF4E2, and this complex is then recruited in an amino acid substitution in proximity to the to a wide variety of mRNAs, promoting active PHD hydroxylation site and increased protein half- translation at polysomes (Uniacke et al., 2012). In a life and HIF-2α activity (Zhuang et al., 2012).

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 551 EPAS1 (Endothelial PAS Domain Protein 1) Mohlin S, et al.

Additional mutations in EPAS1 have also been Neuroblastoma identified in patients with paraganglioma and Note pheochromocytoma without associated In the childhood tumor neuroblastoma, HIF-2α erythrocytosis (Comino-Mendez et al., 2013), and positive tumor cells have been identified in a in patients with somatostatinoma and perivascular niche, suggesting a non-hypoxic driven paraganglioma (Yang et al., 2013). expression (Pietras et al., 2008). The HIF-2α positive cells display an immature tumor stem cell- Implicated in like phenotype and their presence in neuroblastoma Renal clear cell carcinoma specimens correlate to poor overall survival (Holmquist-Mengelbier et al., 2006; Noguera et al., Note 2009). In neuroblastoma cell lines, HIF-2α is The predominant loss of von Hippel Lindau in clear expressed at hypoxic conditions (1% oxygen) and cell renal cell carcinoma (ccRCC), results in at near end-capillary physiological oxygen levels defective targeting of HIF-α proteins for (5% oxygen) (Jogi et al., 2002; Holmquist- degradation at normoxia (Gnarra et al., 1994). Mengelbier et al., 2006). At prolonged hypoxic Therefore, both HIF-1α and HIF-2α accumulate conditions, HIF-2α is continuously expressed in irrespective of oxygen levels in VHL-defective contrast to its homologue HIF-1α. In addition, cells and are abundantly expressed in cells of overexpression of HIF-2α in a mouse ccRCC origin (Krieg et al., 2000). neuroblastoma cell line promoted in vivo tumor For unknown reasons, the expression of HIF-2α is angiogenesis, while mutant HIF-2α cells formed more prominent than that of HIF-1α in RCC cell tumors that were highly necrotic (Favier et al., lines and tumors and HIF-1α expression is often 2007). lost in RCC cell lines (Maxwell et al., 1999; Krieg et al., 2000). Glioma Regulation of HIF target genes in RCC cell lines Note are more dependent on HIF-2α than on HIF-1α and Knockdown of HIF-2α expression can reduce silencing of HIF-2α in VHL-deficient cells suppress vascularization but accelerate tumor growth of tumor growth, suggesting an important role for human glioblastoma cells pointing to a role for HIF-2α in renal carcinoma (Kondo et al., 2003; HIF-2α as a tumor suppressor in glioblastoma Carroll et al., 2006). (Acker et al., 2005). In contrast, recent work has Paraganglioma/pheochromocytoma focused on HIF-2α as a putative glioblastoma cancer stem cell (CSC) marker. Specifically, HIF- Note 2α protein expression co-localizes with CD133 in a Paraganglioma and pheochromocytoma derive from fraction of tumor cells (McCord et al., 2009) and the chromaffin cell lineage of the sympathetic with cancer stem cell markers in glioma specimens nervous system, and notably, genes involved in the (Li et al., 2009). Glioblastoma putative CSCs hypoxic response (e.g. VHL and SDH genes) are respond to hypoxia by induction of HIF2-α (Li et frequently mutated in these tumors (Neumann et al., al., 2009; Seidel et al., 2010), and inhibiting HIF2-α 2002). Recently, somatic mutations in the EPAS1 in glioblastoma CSCs decreases self-renewal, gene itself were discovered in two paraganglioma proliferation and survival in vitro and tumor- patients, describing the first cases of EPAS1 initiating capacity in vivo (Li et al., 2009). In mutations in any cancer type (Zhuang et al., 2012). addition, elevated HIF2A mRNA levels are These gain-of-function mutations lead to increased associated with poor prognosis in glioma patients protein half-life and HIF-2α activity, in turn (Li et al., 2009). resulting in up-regulation of HIF-2α downstream target genes, presumably explaining the clinical Breast cancer presentation in these patients. In a follow-up study, Note two additional EPAS1 mutations were discovered HIF-2α is expressed and associates with high in patients presenting with polycythemia and vascular density, high c-erbB-2 expression and somatostatinoma or paraganglioma (Yang et al., extensive nodal metastasis in breast cancer 2013). These novel mutations lead to disruption of (Giatromanolaki et al., 2006). In a slightly larger the ODD domain-PHD2 interaction and thereby study, HIF-2α was associated with ABCG2 result in less ubiquitination and higher activity of expression, histology grade and Ki67 expression in the HIF-2α protein. In another study, 7 out of 41 invasive ductal carcinoma (Xiang et al., 2012). examined patients with pheochromocytoma or Importantly, in two separate breast cancer cohorts, paraganglioma presented with somatic EPAS1 HIF-2α correlate to reduced recurrence-free mutations, and interestingly, three of these cases survival, breast-cancer specific survival and were also accompanied by an exclusive gain of presence of distal metastasis (Helczynska et al., chromosome 2p (Comino-Mendez et al., 2013). 2008).

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 552 EPAS1 (Endothelial PAS Domain Protein 1) Mohlin S, et al.

Acute myeloid leukemia levels (Compernolle et al., 2002). The latter mice are embryonically lethal due to respiratory distress Note syndrome and cardiac failure (Compernolle et al., Knockdown of HIF-2α in CD34+ acute myeloid 2002). HIF-2α is also important in normal leukemia (AML) cells reduce engraftment ability in hematopoiesis, as demonstrated by creating adult irradiated mice (Rouault-Pierre et al., 2013). The HIF2A knockout mice by crossing of heterozygous HIF-2α deficient cells are more susceptible to 129S6/SvEvTac EPAS1 and heterozygous apoptosis as a result of increased ROS and ER- C57BL/6J EPAS1 knockout mice (Scortegagna et induced stress indicating that HIF-2α is important al., 2003b). These adult HIF2A deficient mice for AML cell survival. suffer from cardiac hypertrophy, hepatomegaly, Other tumor types oxidative stress and pancytopenia (Scortegagna et Note al., 2003a). In summary, HIF2A knockout studies Expression of the HIF-2α protein has also been demonstrate important roles for HIF-2α in reported in other solid tumor types including catecholamine synthesis, reactive oxygen species colorectal cancer (Yoshimura et al., 2004), prostate (ROS) homeostasis and vascular remodeling during cancer (Boddy et al., 2005), non-small cell lung development. cancer (Giatromanolaki et al., 2001), squamous cell head-and-neck cancer (Koukourakis et al., 2002), References nodular malignant melanoma (Giatromanolaki et Gnarra JR, Tory K, Weng Y, Schmidt L, Wei MH, Li H, Latif al., 2003) and endometrial adenocarcinoma F, Liu S, Chen F, Duh FM. Mutations of the VHL tumour (Sivridis et al., 2002). suppressor gene in renal carcinoma. Nat Genet. 1994 May;7(1):85-90 Inflammation Tian H, McKnight SL, Russell DW. Endothelial PAS Note domain protein 1 (EPAS1), a transcription factor selectively expressed in endothelial cells. Genes Dev. 1997 Jan Sites of inflammation are often hypoxic due to 1;11(1):72-82 vascular damage and large infiltration of cells. In order to operate under this condition, cells of the Jain S, Maltepe E, Lu MM, Simon C, Bradfield CA. Expression of ARNT, ARNT2, HIF1 alpha, HIF2 alpha and innate immunity adapt by expressing the HIF Ah receptor mRNAs in the developing mouse. Mech Dev. proteins (Fang et al., 2009; Imtiyaz and Simon, 1998 Apr;73(1):117-23 2010). HIF-2α has been directly coupled to the Maxwell PH, Wiesener MS, Chang GW, Clifford SC, Vaux regulation of proinflammatory cytokine expression EC, Cockman ME, Wykoff CC, Pugh CW, Maher ER, in activated macrophages (Fang et al., 2009; Ratcliffe PJ. The tumour suppressor protein VHL targets Imtiyaz et al., 2010). hypoxia-inducible factors for oxygen-dependent Furthermore, HIF-2α has been detected in bone proteolysis. Nature. 1999 May 20;399(6733):271-5 marrow-derived macropahges (BMDMs) and tumor Krieg M, Haas R, Brauch H, Acker T, Flamme I, Plate KH. associated macrophages (TAMs) of various human Up-regulation of hypoxia-inducible factors HIF-1alpha and HIF-2alpha under normoxic conditions in renal carcinoma cancers (Talks et al., 2000). Importantly, HIF-2α is cells by von Hippel-Lindau tumor suppressor gene loss of essential for TAM migration into tumor lesions function. Oncogene. 2000 Nov 16;19(48):5435-43 (Imtiyaz et al., 2010), which in turn will promote Peng J, Zhang L, Drysdale L, Fong GH. The transcription progression and metastasis of tumor cells (Pollard, factor EPAS-1/hypoxia-inducible factor 2alpha plays an 2004). important role in vascular remodeling. Proc Natl Acad Sci Disease U S A. 2000 Jul 18;97(15):8386-91 Erythrocytosis, see section on germinal mutations. Talks KL, Turley H, Gatter KC, Maxwell PH, Pugh CW, Ratcliffe PJ, Harris AL. The expression and distribution of Development the hypoxia-inducible factors HIF-1alpha and HIF-2alpha in normal human tissues, cancers, and tumor-associated Note macrophages. Am J Pathol. 2000 Aug;157(2):411-21 The four available HIF2A knockout mice display Giatromanolaki A, Koukourakis MI, Sivridis E, Turley H, substantial differences in phenotype, presumably Talks K, Pezzella F, Gatter KC, Harris AL. Relation of due to strain background. The first knockout mouse hypoxia inducible factor 1 alpha and 2 alpha in operable was created on a 129/SvJ background, and resulted non-small cell lung cancer to angiogenic/molecular profile in embryonic lethality due to circulatory failure of tumours and survival. Br J Cancer. 2001 Sep 14;85(6):881-90 during midgestation (Tian et al., 1997). Two of the following knockout studies demonstrated a role for Makino Y, Cao R, Svensson K, Bertilsson G, Asman M, Tanaka H, Cao Y, Berkenstam A, Poellinger L. Inhibitory HIF-2α in vascular development. HIF2A deficient PAS domain protein is a negative regulator of hypoxia- embryos from an ICR/129Sv background die in inducible gene expression. Nature. 2001 Nov utero and display severe post-vasculogenic defects 29;414(6863):550-4 (Peng et al., 2000), while HIF2A deficient mice on Compernolle V, Brusselmans K, Acker T, Hoet P, Tjwa M, 129/Sv x Swiss background display lowered VEGF Beck H, Plaisance S, Dor Y, Keshet E, Lupu F, Nemery B,

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 553 EPAS1 (Endothelial PAS Domain Protein 1) Mohlin S, et al.

Dewerchin M, Van Veldhoven P, Plate K, Moons L, Collen Acker T, Diez-Juan A, Aragones J, Tjwa M, Brusselmans D, Carmeliet P. Loss of HIF-2alpha and inhibition of VEGF K, Moons L, Fukumura D, Moreno-Murciano MP, Herbert impair fetal lung maturation, whereas treatment with VEGF JM, Burger A, Riedel J, Elvert G, Flamme I, Maxwell PH, prevents fatal respiratory distress in premature mice. Nat Collen D, Dewerchin M, Jain RK, Plate KH, Carmeliet P. Med. 2002 Jul;8(7):702-10 Genetic evidence for a tumor suppressor role of HIF- 2alpha. Cancer Cell. 2005 Aug;8(2):131-41 Gradin K, Takasaki C, Fujii-Kuriyama Y, Sogawa K. The transcriptional activation function of the HIF-like factor Boddy JL, Fox SB, Han C, Campo L, Turley H, Kanga S, requires phosphorylation at a conserved threonine. J Biol Malone PR, Harris AL. The androgen receptor is Chem. 2002 Jun 28;277(26):23508-14 significantly associated with vascular endothelial growth factor and hypoxia sensing via hypoxia-inducible factors Jögi A, Øra I, Nilsson H, Lindeheim A, Makino Y, HIF-1a, HIF-2a, and the prolyl hydroxylases in human Poellinger L, Axelson H, Påhlman S. Hypoxia alters gene prostate cancer. Clin Cancer Res. 2005 Nov expression in human neuroblastoma cells toward an 1;11(21):7658-63 immature and neural crest-like phenotype. Proc Natl Acad Sci U S A. 2002 May 14;99(10):7021-6 Nilsson H, Jögi A, Beckman S, Harris AL, Poellinger L, Påhlman S. HIF-2alpha expression in human fetal Koukourakis MI, Giatromanolaki A, Sivridis E, Simopoulos paraganglia and neuroblastoma: relation to sympathetic C, Turley H, Talks K, Gatter KC, Harris AL. Hypoxia- differentiation, glucose deficiency, and hypoxia. Exp Cell inducible factor (HIF1A and HIF2A), angiogenesis, and Res. 2005 Feb 15;303(2):447-56 chemoradiotherapy outcome of squamous cell head-and- neck cancer. Int J Radiat Oncol Biol Phys. 2002 Aug Carroll VA, Ashcroft M. Role of hypoxia-inducible factor 1;53(5):1192-202 (HIF)-1alpha versus HIF-2alpha in the regulation of HIF target genes in response to hypoxia, insulin-like growth Neumann HP, Bausch B, McWhinney SR, Bender BU, factor-I, or loss of von Hippel-Lindau function: implications Gimm O, Franke G, Schipper J, Klisch J, Altehoefer C, for targeting the HIF pathway. Cancer Res. 2006 Jun Zerres K, Januszewicz A, Eng C, Smith WM, Munk R, 15;66(12):6264-70 Manz T, Glaesker S, Apel TW, Treier M, Reineke M, Walz MK, Hoang-Vu C, Brauckhoff M, Klein-Franke A, Klose P, Giatromanolaki A, Sivridis E, Fiska A, Koukourakis MI. Schmidt H, Maier-Woelfle M, Peçzkowska M, Szmigielski Hypoxia-inducible factor-2 alpha (HIF-2 alpha) induces C, Eng C. Germ-line mutations in nonsyndromic angiogenesis in breast carcinomas. Appl pheochromocytoma. N Engl J Med. 2002 May Immunohistochem Mol Morphol. 2006 Mar;14(1):78-82 9;346(19):1459-66 Holmquist-Mengelbier L, Fredlund E, Löfstedt T, Noguera Sivridis E, Giatromanolaki A, Gatter KC, Harris AL, R, Navarro S, Nilsson H, Pietras A, Vallon-Christersson J, Koukourakis MI. Association of hypoxia-inducible factors Borg A, Gradin K, Poellinger L, Påhlman S. Recruitment of 1alpha and 2alpha with activated angiogenic pathways and HIF-1alpha and HIF-2alpha to common target genes is prognosis in patients with endometrial carcinoma. Cancer. differentially regulated in neuroblastoma: HIF-2alpha 2002 Sep 1;95(5):1055-63 promotes an aggressive phenotype. Cancer Cell. 2006 Nov;10(5):413-23 Giatromanolaki A, Sivridis E, Kouskoukis C, Gatter KC, Harris AL, Koukourakis MI. Hypoxia-inducible factors Favier J, Lapointe S, Maliba R, Sirois MG. HIF2 alpha 1alpha and 2alpha are related to vascular endothelial reduces growth rate but promotes angiogenesis in a growth factor expression and a poorer prognosis in nodular mouse model of neuroblastoma. BMC Cancer. 2007 Jul malignant melanomas of the skin. Melanoma Res. 2003 26;7:139 Oct;13(5):493-501 Maynard MA, Evans AJ, Shi W, Kim WY, Liu FF, Ohh M. Kondo K, Kim WY, Lechpammer M, Kaelin WG Jr. Dominant-negative HIF-3 alpha 4 suppresses VHL-null Inhibition of HIF2alpha is sufficient to suppress pVHL- renal cell carcinoma progression. Cell Cycle. 2007 Nov defective tumor growth. PLoS Biol. 2003 Dec;1(3):E83 15;6(22):2810-6 Scortegagna M, Ding K, Oktay Y, Gaur A, Thurmond F, Rojas DA, Perez-Munizaga DA, Centanin L, Antonelli M, Yan LJ, Marck BT, Matsumoto AM, Shelton JM, Wappner P, Allende ML, Reyes AE. Cloning of hif-1alpha Richardson JA, Bennett MJ, Garcia JA. Multiple organ and hif-2alpha and mRNA expression pattern during pathology, metabolic abnormalities and impaired development in zebrafish. Gene Expr Patterns. 2007 homeostasis of reactive oxygen species in Epas1-/- mice. Jan;7(3):339-45 Nat Genet. 2003a Dec;35(4):331-40 Gale DP, Harten SK, Reid CD, Tuddenham EG, Maxwell Scortegagna M, Morris MA, Oktay Y, Bennett M, Garcia PH. Autosomal dominant erythrocytosis and pulmonary JA. The HIF family member EPAS1/HIF-2alpha is required arterial hypertension associated with an activating HIF2 for normal hematopoiesis in mice. Blood. 2003b Sep alpha mutation. Blood. 2008 Aug 1;112(3):919-21 1;102(5):1634-40 Helczynska K, Larsson AM, Holmquist Mengelbier L, Semenza GL. Targeting HIF-1 for cancer therapy. Nat Rev Bridges E, Fredlund E, Borgquist S, Landberg G, Påhlman Cancer. 2003 Oct;3(10):721-32 S, Jirström K. Hypoxia-inducible factor-2alpha correlates to distant recurrence and poor outcome in invasive breast Pollard JW. Tumour-educated macrophages promote cancer. Cancer Res. 2008 Nov 15;68(22):9212-20 tumour progression and metastasis. Nat Rev Cancer. 2004 Jan;4(1):71-8 Martini M, Teofili L, Cenci T, Giona F, Torti L, Rea M, Foà R, Leone G, Larocca LM. A novel heterozygous Yoshimura H, Dhar DK, Kohno H, Kubota H, Fujii T, Ueda HIF2AM535I mutation reinforces the role of oxygen S, Kinugasa S, Tachibana M, Nagasue N. Prognostic sensing pathway disturbances in the pathogenesis of impact of hypoxia-inducible factors 1alpha and 2alpha in familial erythrocytosis. Haematologica. 2008 colorectal cancer patients: correlation with tumor Jul;93(7):1068-71 angiogenesis and cyclooxygenase-2 expression. Clin Cancer Res. 2004 Dec 15;10(24):8554-60 Percy MJ, Beer PA, Campbell G, Dekker AW, Green AR,

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 554 EPAS1 (Endothelial PAS Domain Protein 1) Mohlin S, et al.

Oscier D, Rainey MG, van Wijk R, Wood M, Lappin TR, Percy MJ, Bierings M, Lee FS. Erythrocytosis associated McMullin MF, Lee FS. Novel exon 12 mutations in the with a novel missense mutation in the HIF2A gene. HIF2A gene associated with erythrocytosis. Blood. 2008a Haematologica. 2010 May;95(5):829-32 Jun 1;111(11):5400-2 Yi X, Liang Y, Huerta-Sanchez E, Jin X, Cuo ZX, Pool JE, Percy MJ, Furlow PW, Lucas GS, Li X, Lappin TR, Xu X, Jiang H, Vinckenbosch N, Korneliussen TS, Zheng McMullin MF, Lee FS. A gain-of-function mutation in the H, Liu T, He W, Li K, Luo R, Nie X, Wu H, Zhao M, Cao H, HIF2A gene in familial erythrocytosis. N Engl J Med. 2008b Zou J, Shan Y, Li S, Yang Q, Asan, Ni P, Tian G, Xu J, Liu Jan 10;358(2):162-8 X, Jiang T, Wu R, Zhou G, Tang M, Qin J, Wang T, Feng S, Li G, Huasang, Luosang J, Wang W, Chen F, Wang Y, Pietras A, Gisselsson D, Ora I, Noguera R, Beckman S, Zheng X, Li Z, Bianba Z, Yang G, Wang X, Tang S, Gao Navarro S, Påhlman S. High levels of HIF-2alpha highlight G, Chen Y, Luo Z, Gusang L, Cao Z, Zhang Q, Ouyang W, an immature neural crest-like neuroblastoma cell cohort Ren X, Liang H, Zheng H, Huang Y, Li J, Bolund L, located in a perivascular niche. J Pathol. 2008 Kristiansen K, Li Y, Zhang Y, Zhang X, Li R, Li S, Yang H, Mar;214(4):482-8 Nielsen R, Wang J, Wang J. Sequencing of 50 human Fang HY, Hughes R, Murdoch C, Coffelt SB, Biswas SK, exomes reveals adaptation to high altitude. Science. 2010 Harris AL, Johnson RS, Imityaz HZ, Simon MC, Fredlund Jul 2;329(5987):75-8 E, Greten FR, Rius J, Lewis CE. Hypoxia-inducible factors Peng Y, Yang Z, Zhang H, Cui C, Qi X, Luo X, Tao X, Wu 1 and 2 are important transcriptional effectors in primary T, Ouzhuluobu, Basang, Ciwangsangbu, Danzengduojie, macrophages experiencing hypoxia. Blood. 2009 Jul Chen H, Shi H, Su B. Genetic variations in Tibetan 23;114(4):844-59 populations and high-altitude adaptation at the Himalayas. Li Z, Bao S, Wu Q, Wang H, Eyler C, Sathornsumetee S, Mol Biol Evol. 2011 Feb;28(2):1075-81 Shi Q, Cao Y, Lathia J, McLendon RE, Hjelmeland AB, Uniacke J, Holterman CE, Lachance G, Franovic A, Jacob Rich JN. Hypoxia-inducible factors regulate tumorigenic MD, Fabian MR, Payette J, Holcik M, Pause A, Lee S. An capacity of glioma stem cells. Cancer Cell. 2009 Jun oxygen-regulated switch in the protein synthesis 2;15(6):501-13 machinery. Nature. 2012 May 6;486(7401):126-9 McCord AM, Jamal M, Shankavaram UT, Lang FF, Xiang L, Liu ZH, Huan Q, Su P, Du GJ, Wang Y, Gao P, Camphausen K, Tofilon PJ. Physiologic oxygen Zhou GY. Hypoxia-inducible factor-2a is associated with concentration enhances the stem-like properties of ABCG2 expression, histology-grade and Ki67 expression CD133+ human glioblastoma cells in vitro. Mol Cancer in breast invasive ductal carcinoma. Diagn Pathol. 2012 Res. 2009 Apr;7(4):489-97 Mar 27;7:32 Noguera R, Fredlund E, Piqueras M, Pietras A, Beckman Zhuang Z, Yang C, Lorenzo F, Merino M, Fojo T, Kebebew S, Navarro S, Påhlman S. HIF-1alpha and HIF-2alpha are E, Popovic V, Stratakis CA, Prchal JT, Pacak K. Somatic differentially regulated in vivo in neuroblastoma: high HIF- HIF2A gain-of-function mutations in paraganglioma with 1alpha correlates negatively to advanced clinical stage and polycythemia. N Engl J Med. 2012 Sep 6;367(10):922-30 tumor vascularization. Clin Cancer Res. 2009 Dec 1;15(23):7130-6 Comino-Méndez I, de Cubas AA, Bernal C, Álvarez-Escolá C, Sánchez-Malo C, Ramírez-Tortosa CL, Pedrinaci S, Beall CM, Cavalleri GL, Deng L, Elston RC, Gao Y, Knight Rapizzi E, Ercolino T, Bernini G, Bacca A, Letón R, Pita G, J, Li C, Li JC, Liang Y, McCormack M, Montgomery HE, Alonso MR, Leandro-García LJ, Gómez-Graña A, Inglada- Pan H, Robbins PA, Shianna KV, Tam SC, Tsering N, Pérez L, Mancikova V, Rodríguez-Antona C, Mannelli M, Veeramah KR, Wang W, Wangdui P, Weale ME, Xu Y, Xu Robledo M, Cascón A. Tumoral EPAS1 (HIF2A) mutations Z, Yang L, Zaman MJ, Zeng C, Zhang L, Zhang X, Zhaxi explain sporadic pheochromocytoma and paraganglioma P, Zheng YT. Natural selection on EPAS1 (HIF2alpha) in the absence of erythrocytosis. Hum Mol Genet. 2013 associated with low hemoglobin concentration in Tibetan Jun 1;22(11):2169-76 highlanders. Proc Natl Acad Sci U S A. 2010 Jun 22;107(25):11459-64 Mohlin S, Hamidian A, Påhlman S. HIF2A and IGF2 expression correlates in human neuroblastoma cells and Imtiyaz HZ, Simon MC. Hypoxia-inducible factors as normal immature sympathetic neuroblasts. Neoplasia. essential regulators of inflammation. Curr Top Microbiol 2013 Mar;15(3):328-34 Immunol. 2010;345:105-20 Rouault-Pierre K, Lopez-Onieva L, Foster K, Anjos-Afonso Imtiyaz HZ, Williams EP, Hickey MM, Patel SA, Durham F, Lamrissi-Garcia I, Serrano-Sanchez M, Mitter R, AC, Yuan LJ, Hammond R, Gimotty PA, Keith B, Simon Ivanovic Z, de Verneuil H, Gribben J, Taussig D, Rezvani MC. Hypoxia-inducible factor 2alpha regulates HR, Mazurier F, Bonnet D. HIF-2α protects human macrophage function in mouse models of acute and tumor hematopoietic stem/progenitors and acute myeloid inflammation. J Clin Invest. 2010 Aug;120(8):2699-714 leukemic cells from apoptosis induced by endoplasmic Seidel S, Garvalov BK, Wirta V, von Stechow L, Schänzer reticulum stress. Cell Stem Cell. 2013 Nov 7;13(5):549-63 A, Meletis K, Wolter M, Sommerlad D, Henze AT, Nistér M, Yang C, Sun MG, Matro J, Huynh TT, Rahimpour S, Reifenberger G, Lundeberg J, Frisén J, Acker T. A hypoxic Prchal JT, Lechan R, Lonser R, Pacak K, Zhuang Z. Novel niche regulates glioblastoma stem cells through hypoxia HIF2A mutations disrupt oxygen sensing, leading to inducible factor 2 alpha. Brain. 2010 Apr;133(Pt 4):983-95 polycythemia, paragangliomas, and somatostatinomas. Simonson TS, Yang Y, Huff CD, Yun H, Qin G, Blood. 2013 Mar 28;121(13):2563-6 Witherspoon DJ, Bai Z, Lorenzo FR, Xing J, Jorde LB, Prchal JT, Ge R. Genetic evidence for high-altitude This article should be referenced as such: adaptation in Tibet. Science. 2010 Jul 2;329(5987):72-5 Mohlin S, Hamidian A, Bexell D, Påhlman S, Wigerup C. van Wijk R, Sutherland S, Van Wesel AC, Huizinga EG, EPAS1 (Endothelial PAS Domain Protein 1). Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8):550-555.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 555 Atlas of Genetics and Cytogenetics in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Gene Section Short Communication

INGX (inhibitor of growth family, X-linked, pseudogene) Audrey Mouche, Rémy Pedeux INSERM U917, Microenvironnement et Cancer, Rennes, France and Universite de Rennes 1, Rennes, France (AM, RP), Etablissement Francais du Sang, Rennes, France (RP)

Published in Atlas Database: December 2013 Online updated version : http://AtlasGeneticsOncology.org/Genes/INGXID40976chXq13.html DOI: 10.4267/2042/54008 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2014 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Abstract Description The sex chromosome linked INGX gene, homolog Review on INGX, with data on DNA/RNA, on the to ING1 has been cloned for the first time by Jäger protein encoded and where the gene is implicated. et al., 1999. The five human ING genes and the pseudogene Identity INGX have been mapped to six different Other names: ING1-like, ING2 chromosomes. In addition, ING genes are located close to the HGNC (Hugo): INGX telomeric region except for ING3 and INGX. This Location: Xq13.1 gene has been localised on the human X chromosome at locus Xq13.1 close to the DNA/RNA centromeric region (He et al., 2005). Transcription INGX gene has three transcripts and a unique exon. The sequence of this exon shares 72% of identity with exon 2 of ING1. RT-PCR analysis shows that INGX mRNA is expressed in normal tissue (brain, colon, testis, kidney, liver and breast). However, some tumor cell lines like melanoma or breast cancer showed a loss of INGX mRNA (Jäger et al., 1999). Pseudogene INGX is the pseudogene of ING1 (He et al., 2005). Protein Description The amino acid sequence alignment of human ING proteins revealed several conserved regions: a leucine-zipper-like-region (LZL), a novel conserved region (NCR), a nuclear localization signal (NLS), Chromosomal localization of the INGX gene in Homo a plant homeo domain (PHD) and a polybasic sapiens. region (PBR).

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 556 INGX (inhibitor of growth family, X-linked, pseudogene) Mouche A, Pedeux R

A schematic representation of the different domain of ING1b, ING2 and INGX protein.

Amino acid sequences alignment of ING1b, ING2 and INGX. Plant homeo domain (PHD) is indicated by box.

The ING proteins are characterized by the presence Homology of a highly conserved PHD in their C-terminal part. In databanks, INGX is also referred as ING1-like. This domain is commonly found in proteins involved in chromatin modification (Bienz, 2006; Mellor, 2006). Implicated in ING proteins are characterized by their PHD Melanoma and breast cancer domain which is highly conserved. The longest ORF in INGX gene is only 129 bp length and Note would encode a predicted amino acid sequence of Several studies have shown that ING proteins are 42 amino acids, but there is no report about an involved in critical cellular processes such as INGX protein produced from a transcript. This senescence, apoptosis, DNA repair, growth INGX sequence has a high homology degree with regulation, cell migration (for review, Guérillon et the PHD amino acid sequence. INGX protein would al., 2013). In tumor, ING expression is mostly lost have a partial PHD domain (He et al., 2005). at mRNA level (For review: Guérillon et al., 2013 and Ythier et al., 2008). Jäger et al., 1999 have Localisation shown a loss of INGX mRNA in some tumor cell At present, there is no proof about the existence of lines like melanoma or breast cancer. the production of an INGX protein. Moreover, the predicted protein would not have a nuclear References localization sequence (NLS) like the other members Jäger D, Stockert E, Scanlan MJ, Güre AO, Jäger E, Knuth of the ING family. It could thus be located in the A, Old LJ, Chen YT. Cancer-testis antigens and ING1 cytoplasm unlike the other ING proteins (for tumor suppressor gene product are breast cancer review, Guérillon et al., 2013). antigens: characterization of tissue-specific ING1 transcripts and a homologue gene. Cancer Res. 1999 Dec Function 15;59(24):6197-204 The tumor suppressor ING genes are lost or He GH, Helbing CC, Wagner MJ, Sensen CW, Riabowol misregulated in different types of human tumors. K. Phylogenetic analysis of the ING family of PHD finger Unfortunately, few data about INGX are available. proteins. Mol Biol Evol. 2005 Jan;22(1):104-16 We actually know that INGX, unlike the other ING, Bienz M. The PHD finger, a nuclear protein-interaction is highly truncated. So it would be interesting to domain. Trends Biochem Sci. 2006 Jan;31(1):35-40 determine if it has the potential to act in a dominant Mellor J. It takes a PHD to read the histone code. Cell. negative manner (He et al., 2005). 2006 Jul 14;126(1):22-4

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 557 INGX (inhibitor of growth family, X-linked, pseudogene) Mouche A, Pedeux R

Ythier D, Larrieu D, Brambilla C, Brambilla E, Pedeux R. Guérillon C, Bigot N, Pedeux R. The ING tumor The new tumor suppressor genes ING: genomic structure suppressor genes: status in human tumors. Cancer Lett. and status in cancer. Int J Cancer. 2008 Oct 2014 Apr 1;345(1):1-16 1;123(7):1483-90 This article should be referenced as such: Guérillon C, Larrieu D, Pedeux R. ING1 and ING2: multifaceted tumor suppressor genes. Cell Mol Life Sci. Mouche A, Pedeux R. INGX (inhibitor of growth family, X- 2013 Oct;70(20):3753-72 linked, pseudogene). Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8):556-558.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 558 Atlas of Genetics and Cytogenetics in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Gene Section Review

MIR107 (MicroRNA 107) Priyanka Sharma, Rinu Sharma Research Scholar, University School of Biotechnology, Guru Gobind Singh Indraprastha University, New Delhi-110078, India (PS), University School of Biotechnology, Guru Gobind Singh Indraprastha University, Sector 16 C Dwarka, New Delhi-110078, India (RS)

Published in Atlas Database: December 2013 Online updated version : http://AtlasGeneticsOncology.org/Genes/MIR107ID51325ch10q23.html DOI: 10.4267/2042/54009 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2014 Atlas of Genetics and Cytogenetics in Oncology and Haematology

and miR107 which reside in three homologous Abstract PANK genes - PANK3, PANK2 and PANK1 Review on MIR107, with data on DNA/RNA and respectively. miR-103 is in a PANK gene intron but where the gene is implicated. miR-107 is located intergenically (Finnerty et al., 2010). Identity Transcription Other names: MIRN107, miR-107 hsa-miR-107 is a product of gene HGNC (Hugo): MIR107 ENSG00000198997 and has 1 transcript Location: 10q23.31 ENST00000362127 of 87 bp. Precursor miRNA transcribed by this gene is of 81 base pairs DNA/RNA (location: complement (91352504..91352584) on DNA and 1:81 on RNA) while mature miRNA is of Description 23 bp transcribed from sequence located at (91352513..91352535)bp on minus strand of DNA miR-107 is located on the 10 th chromosome. miR- and 50:72 bp on RNA. Transcript is intron-less. 107 gene is of 87 bp and starts from 91352500 bp from pter and ends at 91352586 bp from pter on Pseudogene minus strand. Total number of exon present is one Paralogs: hsa-miR-107 has two paralogs: and coding exon is 0. 1) hsa-miR-103-1 HGNC: 31490 miR-107 paralogs include miR-103(1), miR103(2) 2) hsa-miR-103-2 HGNC: 31491

Figure 1.

Table 1. Overlapping transcripts.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 559 MIR107 (MicroRNA 107) Sharma P, Sharma R

Table 2.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 560 MIR107 (MicroRNA 107) Sharma P, Sharma R

cell-cell adhesion and epithelial marker expression. Protein miR-103/107 expression was increased in the Note presence of hypoxia, thereby potentiating DAPK No protein product. and KLF4 downregulation and hypoxia-induced motility and invasiveness (Chen et al., 2012). Mutations Esophageal cancer Note Oncogenesis SNP Circulating and tissue miR-107 was found to be 1) rs377494950 downregulated in esophageal cancer tissues and GCAACACTGTAAAGAAGCTGAAAGCA[A/G] sera samples as compared to matched non- GAGAATATCGAATATTGCAAGTCGA malignant tissues and healthy controls respectively AllelePos=51; totalLen=101; snpclass=1; (Sharma et al., 2013). alleles='A/G'. (NCBI dbSNP) Gastric cancer 2) rs199975460 CCCTGTACAATGCTGCTTGAACTCCA[C/T]G Prognosis CCACAAGGCAACACTGTAAAGAAG miR-107 expression in gastric cancer tissues was AllelePos=101; totalLen=201; snpclass=1; demonstrated as an independent prognostic factor alleles='C/T'. (NCBI dbSNP) for overall survival rates (OS) and disease-free - SNP Loc relative to pre-miR 40 survival rates (DFS). OS and DFS of patients with - Primary miRNA Eenergy: -29.6 kcal/mol high miR-107 expression were significantly worse - SNP-miRNA Eenergy: -30.3kcal/mol than those of patients with low miR-107 expression - ∆∆ G: -0.7kcal/mol (microRNA-related Single (Inoue et al., 2012). Nucleotide Polymorphims) Oncogenesis For miRNA-107 NCBI Reference Sequence Its ectopic expression reduced both mRNA and NR_029524.1 (Contig NT_030059.13) following protein expression levels of CDK6, inhibited 56 SNPs have been reported in dbSNP (NCBI proliferation, blocked invasion of gastric cancer dbSNP). cells and also induced G1 cell cycle arrest (Feng et al., 2012). miR-107 expression showed significant Implicated in association with depth of tumor invasion, lymph node metastasis and stage. Moreover, significant Breast cancer inverse correlation was found between miR-107 Oncogenesis and DICER1 mRNA (Inoue et al., 2012) and it was miR-107 was reported to be over expressed in demonstrated that miR107 regulates tumor invasion malignant tissues from patients with advanced and metastasis in gastric cancer by targeting breast cancer, and its expression showed an inverse DICER1 (Li et al., 2011). correlation with let-7 expression in tumors and in Glioma cancer cell lines Ectopic expression of miR-107 in human cancer cell lines led to destabilization of Oncogenesis mature let-7, increased expression of let-7 targets, miR-107 inhibited proliferation of Glioma cells and increased malignant phenotypes (Chen et al., (Chen et al., 2013a), downregulated expression of 2011). CDK6 and notch-2 and also inhibited glioma cell migration and invasion by modulating notch-2 Colon cancer expression (Chen et al., 2013b). He et al., (2013) Oncogenesis reported that upregulation of miR-107 suppressed P53-induced miR-107 inhibited HIF-1 and tumor glioma cell growth through directly targeting angiogenesis in colon cancer specimens. SALL4, leading to the activation of FADD/caspase- Furthermore, overexpression of miR-107 in tumor 8/caspase-3/caspase-7 signaling pathway of cell cells suppresses tumor angiogenesis, tumor growth, apoptosis. and tumor VEGF expression in mice (Yamakuchi et Head and neck squamous cell al., 2010). carcinoma Colorectal cancer Oncogenesis Oncogenesis microRNA-107 functions as a candidate tumor- miR-103/107 targeted the known metastasis suppressor gene in head and neck squamous cell suppressors death-associated protein kinase carcinoma by downregulation of protein kinase C ε. (DAPK) and Krüppel-like factor 4 (KLF4) in Treatment with miR-107 significantly blocked cell colorectal cancer cells, resulting in increased cell proliferation, DNA replication, colony formation motility and cell-matrix adhesion and decreased and invasion in head and neck squamous cell

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 561 MIR107 (MicroRNA 107) Sharma P, Sharma R

carcinoma (HNSCC) cell lines (Datta et al., 2012). - Type: Cytoband, Source: UCSC, Length: Moreover, Lipid-based nanoparticle delivery of 3300000, Stain: gpos75 (Database of Genomic Pre-miR-107 inhibits the tumorigenicity of HNSCC Variants) (Piao et al., 2012). Hypoxia and angiogenesis B-cell chronic lymphocytic leukemia Note Oncogenesis miR-107 mediates p53 regulation of hypoxic Down-regulation of miRNA-107 due to epigenetic signaling and tumor angiogenesis in colon cancer. It transcriptional silencing results in overexpression regulates hypoxia signaling by suppressing of its target gene PLAG1 (pleomorphic adenoma expression of hypoxia inducible factor-1β (HIF-1β). gene 1), a well known oncogenic transcription Moreover, overexpression of miR-107 in tumor factor (Pallasch, 2009). cells suppresses tumor angiogenesis, tumor growth and tumor VEGF expression in mice (Yamakuchi et Lung cancer al., 2010). Oncogenesis Metabolism MiR-107 suppressed cell proliferation in human non-small cell lung cancer cell lines (Takahashi et Note al., 2009) and induced G1 cell cycle arrest. miR-107 has been implicated in metabolism of cellular lipids (Wilfred et al., 2007) and in Neuroblastoma regulation of insulin sensitivity. Caveolin-1, a Oncogenesis critical regulator of insulin receptor has been miR-103 and miR-107 regulate CDK5R1 identified as a direct target of miR-103/107 expression and their overexpression, as well as (Trajkovski et al., 2011). Human CYP2C8, a CDK5R1 silencing, caused a reduction in migration member of CYP2C subfamily of cytochrome P450 ability of neuroblastoma cells (Moncini et al., enzymes is also post-transcriptionally regulated by 2011). microRNAs 103 and 107 in human liver (Zhang et al., 2012). Pancreatic cancer Alzheimer's Oncogenesis Lee et al. (2009) reported that epigenetic silencing Note of miR-107 regulates CDK6 expression in Expression of miR-107 decreases early in pancreatic cancer. Alzheimer's disease and may accelerate disease progression through regulation of beta-site amyloid Pituitary adenomas precursor protein-cleaving enzyme 1 (Wang et al., Oncogenesis 2008). Moreover, miR-107 expression tended to miR-107 is overexpressed in Pituitary adenomas correlate in a negative fashion with neuritic and may act as tumor suppressor. Pituitary tumor plaque(NPs) and neurofibrillary tangle (NFTs) suppressor gene AIP (aryl hydrocarbon receptor- (Nelson and Wang, 2010) microRNAs-107/miR- interacting protein) is a miR-107 target and both 103 represse translation of actin-binding protein may have roles in tumorigenesis (Trivellin et al., cofilin, and their reduced levels are associated with 2012). Recent studies have demonstrated regulation elevated cofilin protein levels and formation of rod- of miR-107 by P53 tumor suppressor. like structures in a transgenic mouse model of Prostate cancer Alzheimer's disease (Yao et al., 2010). Oncogenesis Brain injury and neurodegenerative Multiple members of the miR-107 gene group disease repress mitogen and growth factor granulin (GRN) Note protein levels when transfected into prostate cancer miR-107 contributes to regulation of cells (Wang et al., 2010a). GRN is dysregulated via granulin/progranulin with implications for miR-15/107 gene group in multiple human cancers, traumatic brain injury and neurodegenerative which may provide a potential common therapeutic disease (Wang et al., 2010b). target. Schizophrenia Various cancers Note Cytogenetics Increased levels of miR-107 contribute to the - Entrez Gene cytogenetic band: 10q23.31 marked loss of cortical CHRM1 in schizophrenia - Ensembl cytogenetic band: 10q23.31 which may be a differentiating pathophysiology - HGNC cytogenetic band: 10q23.31 (Scarr et al., 2013).

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 562 MIR107 (MicroRNA 107) Sharma P, Sharma R

Table 3. LOH and homozygous deletion on chromosome 10q (10q22-10q23) in primary hepatocellular carcinoma (Zhu et al., 2004). See Supplementary Table S1.

Yamakuchi M, Lotterman CD, Bao C, Hruban RH, Karim B, Breakpoints Mendell JT, Huso D, Lowenstein CJ. P53-induced microRNA-107 inhibits HIF-1 and tumor angiogenesis. See Table 3. Proc Natl Acad Sci U S A. 2010 Apr 6;107(14):6334-9 Yao J, Hennessey T, Flynt A, Lai E, Beal MF, Lin MT. References MicroRNA-related cofilin abnormality in Alzheimer's disease. PLoS One. 2010 Dec 16;5(12):e15546 Zhu GN, Zuo L, Zhou Q, Zhang SM, Zhu HQ, Gui SY, Wang Y. Loss of heterozygosity on chromosome 10q22- Chen PS, Su JL, Cha ST, Tarn WY, Wang MY, Hsu HC, 10q23 and 22q11.2-22q12.1 and p53 gene in primary Lin MT, Chu CY, Hua KT, Chen CN, Kuo TC, Chang KJ, hepatocellular carcinoma. World J Gastroenterol. 2004 Jul Hsiao M, Chang YW, Chen JS, Yang PC, Kuo ML. miR- 1;10(13):1975-8 107 promotes tumor progression by targeting the let-7 microRNA in mice and humans. J Clin Invest. 2011 Wilfred BR, Wang WX, Nelson PT. Energizing miRNA Sep;121(9):3442-55 research: a review of the role of miRNAs in lipid metabolism, with a prediction that miR-103/107 regulates Li X, Zhang Y, Shi Y, Dong G, Liang J, Han Y, Wang X, human metabolic pathways. Mol Genet Metab. 2007 Zhao Q, Ding J, Wu K, Fan D. MicroRNA-107, an Jul;91(3):209-17 oncogene microRNA that regulates tumour invasion and metastasis by targeting DICER1 in gastric cancer. J Cell Wang WX, Rajeev BW, Stromberg AJ, Ren N, Tang G, Mol Med. 2011 Sep;15(9):1887-95 Huang Q, Rigoutsos I, Nelson PT. The expression of microRNA miR-107 decreases early in Alzheimer's Moncini S, Salvi A, Zuccotti P, Viero G, Quattrone A, disease and may accelerate disease progression through Barlati S, De Petro G, Venturin M, Riva P. The role of miR- regulation of beta-site amyloid precursor protein-cleaving 103 and miR-107 in regulation of CDK5R1 expression and enzyme 1. J Neurosci. 2008 Jan 30;28(5):1213-23 in cellular migration. PLoS One. 2011;6(5):e20038 Lee KH, Lotterman C, Karikari C, Omura N, Feldmann G, Trajkovski M, Hausser J, Soutschek J, Bhat B, Akin A, Habbe N, Goggins MG, Mendell JT, Maitra A. Epigenetic Zavolan M, Heim MH, Stoffel M. MicroRNAs 103 and 107 silencing of MicroRNA miR-107 regulates cyclin-dependent regulate insulin sensitivity. Nature. 2011 Jun kinase 6 expression in pancreatic cancer. Pancreatology. 8;474(7353):649-53 2009;9(3):293-301 Chen HY, Lin YM, Chung HC, Lang YD, Lin CJ, Huang J, Pallasch CP, Patz M, Park YJ, Hagist S, Eggle D, Claus R, Wang WC, Lin FM, Chen Z, Huang HD, Shyy JY, Liang JT, Debey-Pascher S, Schulz A, Frenzel LP, Claasen J, Chen RH. miR-103/107 promote metastasis of colorectal Kutsch N, Krause G, Mayr C, Rosenwald A, Plass C, cancer by targeting the metastasis suppressors DAPK and Schultze JL, Hallek M, Wendtner CM. miRNA deregulation KLF4. Cancer Res. 2012 Jul 15;72(14):3631-41 by epigenetic silencing disrupts suppression of the oncogene PLAG1 in chronic lymphocytic leukemia. Blood. Datta J, Smith A, Lang JC, Islam M, Dutt D, Teknos TN, 2009 Oct 8;114(15):3255-64 Pan Q. microRNA-107 functions as a candidate tumor- suppressor gene in head and neck squamous cell Takahashi Y, Forrest AR, Maeno E, Hashimoto T, Daub carcinoma by downregulation of protein kinase C ɛ. CO, Yasuda J. MiR-107 and MiR-185 can induce cell cycle Oncogene. 2012 Sep 6;31(36):4045-53 arrest in human non small cell lung cancer cell lines. PLoS One. 2009 Aug 18;4(8):e6677 Inoue T, Iinuma H, Ogawa E, Inaba T, Fukushima R. Clinicopathological and prognostic significance of Finnerty JR, Wang WX, Hébert SS, Wilfred BR, Mao G, microRNA-107 and its relationship to DICER1 mRNA Nelson PT. The miR-15/107 group of microRNA genes: expression in gastric cancer. Oncol Rep. 2012 evolutionary biology, cellular functions, and roles in human Jun;27(6):1759-64 diseases. J Mol Biol. 2010 Sep 24;402(3):491-509 Piao L, Zhang M, Datta J, Xie X, Su T, Li H, Teknos TN, Nelson PT, Wang WX. MiR-107 is reduced in Alzheimer's Pan Q. Lipid-based nanoparticle delivery of Pre-miR-107 disease brain neocortex: validation study. J Alzheimers inhibits the tumorigenicity of head and neck squamous cell Dis. 2010;21(1):75-9 carcinoma. Mol Ther. 2012 Jun;20(6):1261-9 Wang WX, Kyprianou N, Wang X, Nelson PT. Trivellin G, Butz H, Delhove J, Igreja S, Chahal HS, Dysregulation of the mitogen granulin in human cancer Zivkovic V, McKay T, Patócs A, Grossman AB, Korbonits through the miR-15/107 microRNA gene group. Cancer M. MicroRNA miR-107 is overexpressed in pituitary Res. 2010a Nov 15;70(22):9137-42 adenomas and inhibits the expression of aryl hydrocarbon receptor-interacting protein in vitro. Am J Physiol Wang WX, Wilfred BR, Madathil SK, Tang G, Hu Y, Endocrinol Metab. 2012 Sep 15;303(6):E708-19 Dimayuga J, Stromberg AJ, Huang Q, Saatman KE, Nelson PT. miR-107 regulates granulin/progranulin with Zhang SY, Surapureddi S, Coulter S, Ferguson SS, implications for traumatic brain injury and Goldstein JA. Human CYP2C8 is post-transcriptionally neurodegenerative disease. Am J Pathol. 2010b regulated by microRNAs 103 and 107 in human liver. Mol Jul;177(1):334-45 Pharmacol. 2012 Sep;82(3):529-40

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 563 MIR107 (MicroRNA 107) Sharma P, Sharma R

Chen L, Chen XR, Zhang R, Li P, Liu Y, Yan K, Jiang XD. Scarr E, Craig JM, Cairns MJ, Seo MS, et al.. Decreased MicroRNA-107 inhibits glioma cell migration and invasion cortical muscarinic M1 receptors in schizophrenia are by modulating Notch2 expression. J Neurooncol. 2013a associated with changes in gene promoter methylation, Mar;112(1):59-66 mRNA and gene targeting microRNA. Transl Psychiatry. 2013 Feb 19;3:e230 Chen L, Zhang R, Li P, Liu Y, Qin K, Fa ZQ, Liu YJ, Ke YQ, Jiang XD. P53-induced microRNA-107 inhibits Sharma P, Saraya A, Gupta P, Sharma R. Decreased proliferation of glioma cells and down-regulates the levels of circulating and tissue miR-107 in human expression of CDK6 and Notch-2. Neurosci Lett. 2013b esophageal cancer. Biomarkers. 2013 Jun;18(4):322-30 Feb 8;534:327-32 This article should be referenced as such: He J, Zhang W, Zhou Q, Zhao T, Song Y, Chai L, Li Y. Low-expression of microRNA-107 inhibits cell apoptosis in Sharma P, Sharma R. MIR107 (MicroRNA 107). Atlas glioma by upregulation of SALL4. Int J Biochem Cell Biol. Genet Cytogenet Oncol Haematol. 2014; 18(8):559-564. 2013 Sep;45(9):1962-73

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 564 Atlas of Genetics and Cytogenetics in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Gene Section Review

MYO1A (myosin IA) Diego Arango del Corro, Rocco Mazzolini Group of Molecular Oncology, CIBBIM-Nanomedicine, Vall d'Hebron University Hospital Research Institute, 08035 Barcelona, Spain (DAdC, RM)

Published in Atlas Database: December 2013 Online updated version : http://AtlasGeneticsOncology.org/Genes/MYO1AID47246ch12q13.html DOI: 10.4267/2042/54010 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2014 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Abstract Note Orientation: minus strand. Review on MYO1A, with data on DNA/RNA, on the protein encoded and where the gene is DNA/RNA implicated. Description Identity There are several transcripts described for MYO1A. Other names: BBMI, DFNA48, MIHC, MYHL The two transcripts better characterized contain 28 HGNC (Hugo): MYO1A and 29 exons spanning over 21 kb and both code for an identical protein of 1043 amino acids. Location: 12q13.3

Figure 1. Diagram of DNA/RNA.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 565 MYO1A (myosin IA) Arango del Corro D, Mazzolini R

Figure 2. Protein structure of MYO1A.

brush border of the enterocytes. Protein MYO1A forms a spiral array of bridges that links Description the microvillar actin core to the membrane (Chantret et al., 1988; West et al., 1988; Beaulieu et The protein encoded by the MYOSIN-IA gene al., 1990). belongs to the myosin superfamily. Here, Myosin-1a plays a critical role in maintaining Like all myosin-1 isoforms, MYO1A contain these the brush border composition, structure, and three core domains (figure 2): an N-terminal motor regulating the microvillar membrane tension (Tyska domain that coordinates ATP hydrolysis with actin et al., 2005; Nambiar et al., 2009), Myo1a also binding and force generation; a central neck region plays a role in powering the release of vesicles from made up of varying numbers of IQ motifs, which the tips of the microvilli (McConnell et al., 2009). bind calmodulin or calmodulin-like proteins; and a tail region, which includes a highly basic C- terminal tail homology 1 (TH1) domain that is responsible for membrane binding (Coluccio and Bretscher, 1990; Krendel and Mooseker, 2005; McConnell and Tyska, 2010; Nambiar et al., 2010). Expression Myo1a is highly expressed in the enterocytes that line the mucosa of the small intestine (Matsudaira and Burgess, 1979; Skowron and Mooseker, 1999). Expression of MYO1A has also been observed at relatively high levels in gastric epithelium when compared to other organs such as endometrium, myometrium, ovary and prostate (figure 3). In tumor samples, MYO1A mRNA expression in human gastric adenocarcinomas is comparable to intestinal adenocarcinomas, and significantly higher than in other tumor types (Mazzolini et al., 2013) (figure 4). Myo1a transcripts are also present in rodent inner ear at low level (Dumont et al., 2002). Localisation Myo1a localizes to the cellular membrane through to the C-terminal tail domain. In the enterocytes that line the mucosa of the small intestine, MYO1A localizes to the apical brush border membrane (Matsudaira and Burgess, 1979; Collins and Borysenko, 1984; Skowron and Mooseker, 1999) (figure 5). Figure 3. Relative MYO1A mRNA levels in human normal tissues. MYO1A mRNA levels in human normal and tumor Function samples were obtained from a collection of 667 normal human samples from different tissues (Gene Expression Myosin Ia (MYO1A) is a major component of the Omnibus: GSE7307) and 10000 normal and tumor samples cytoskeleton that underlies and supports the apical from GeneSapiens.org (Kilpinen et al., 2008).

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 566 MYO1A (myosin IA) Arango del Corro D, Mazzolini R

Figure 4. Relative MYO1A mRNA levels in human tumors of different origin. Box-whisker plot of the gene's expression in cancer tissues. The bottom of the box is the 25th percentile of the data, the top of the box is the 75th percentile, and the vertical red line is the median. The whiskers extend to 1.5 times the interquartile range from the edges of the box, and any data points beyond this are considered outliers, marked by hollow circles. Filled grey bars are gastrointestinal carcinomas.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 567 MYO1A (myosin IA) Arango del Corro D, Mazzolini R

Figure 5. MYO1A localizes to the apical membrane of intestinal epithelial cells. MYO1A-GFP was transfected into the colon cancer cell line Caco-2. The image was taken by confocal microscopy and represents an orthogonal stuck of a monolayer of cells. (A) Actin staining with rhodamine-phalloidin shows the apical and baso-lateral membtanes of the cells. (B) EGFP-MYO1A localizing in the apical membrane. (C) Overlay (modified from Mazzolini et al., 2012).

instable colorectal cancer cell lines; 31,3% (42 of Mutations 134) in primary colon tumors; 46,8% (22/47) in Germinal gastric microsatellite-instable primary tumors. No mutations were observed in the matching healthy The following germinal mutations have been intestinal mucosa. reported in eight unrelated patients coming from All the mutations observed were insertions or central and southern Italy and affected by deletions in an A8 microsatellite tract located in sensorineural bilateral hearing loss of variable exon 28. The most frequent mutation is the deletion degree: one nonsense mutation, one trinucleotide of one A (MYO1A A7MUT ). All the mutations found insertion leading to an additional amino acid, and appeared to be heterozygous as the wild type allele six missense mutations (Donaudy et al., 2003) was also visible in all cases (figure 6, panel A). The (table 1). MYO1A A7MUT mutation causes sub-cellular Somatic mislocalization (figure 6, panel B) and decreased Mazzolini et al. reported frequent frame-shift stability of Myosin-1a (Mazzolini et al., 2012; somatic mutations in colorectal and gastric cancer. Mazzolini et al., 2013). Additional mutations have These mutations were found with the following been found in colorectal tumors without frequencies: 44,4% (16 of 36) in microsatellite- microsatellite instability (TCGA; figure 6, panel C).

Table 1. MYO1A mutations related to sensorineural bilateral hearing loss (Donaudy et al., 2003).

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 568 MYO1A (myosin IA) Arango del Corro D, Mazzolini R

Figure 6. Somatic mutations of MYO1AA7MUT. (A) Frameshift mutations in the A8 track in Exon 28 of MYO1A. (B) Co- transfection of wild type EGFP-MYO1Awt and mutant ERFP-MYO1AA7MUT demonstrated that the mutant protein mislocalized to the cytoplasm of undifferentiated Caco2 cells (modified from Mazzolini et al., 2012). (C) Localization of additional mutations found in colorectal tumors without microsatellite instability.

and overall survival compared with patients with Implicated in high MYO1A (logrank test P = 0.004 and P = Colorectal cancer 0.009, respectively). The median time-to-disease recurrence in patients Note with low MYO1A was 1 y, compared with >9 y in The brush border protein Myosin Ia (MYO1A) has the group of patients with high MYO1A. These been demonstrated to be important for polarization results identified MYO1A as a tumor-suppressor and differentiation of colon cancer cells and is gene in colorectal cancer and demonstrate that the frequently inactivated in colorectal tumors by loss of structural brush border proteins involved in genetic and epigenetic mechanisms. Mazzolini et al. cell polarity are important for tumor development reported MYO1A frame-shift mutations in 32% (37 (Mazzolini et al., 2012). of 116) of the colorectal tumors with microsatellite instability. Evidence of promoter methylation was Gastric cancer observed in a significant proportion of colon cancer Note cell lines and primary colorectal tumors. Frame-shift somatic mutations have been reported The loss of polarization/differentiation resulting in 46,8% (22/47) of gastric microsatellite-instable from MYO1A inactivation is associated with higher primary tumors. Frequent MYO1A promoter tumor growth in soft agar and in a xenograft model. hypermethylation was also found in gastric tumors In addition, the progression of genetically and (Mazzolini et al., 2013). carcinogen initiated intestinal tumors was significantly accelerated in Myo1a knockout mice Endometrial cancer compared with Myo1a wild-type animals. Note Moreover, MYO1A tumor expression was found to Rare mutations have been reported in 6,2% (3/48) be an independent prognostic factor for colorectal of endometrial microsatellite-instable primary cancer patients. Patients with low MYO1A tumor tumors (Mazzolini et al., 2013). The low frequency protein levels had significantly shorter disease-free of this mutation in endometrial tumor is likely to

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 569 MYO1A (myosin IA) Arango del Corro D, Mazzolini R

reflect the background mutation rate occurring in O, Bell RE, Melchionda S, Zelante L, Avraham KB, endometrial MSI tumors. Gasparini P. Multiple mutations of MYO1A, a cochlear- expressed gene, in sensorineural hearing loss. Am J Hum Nonsyndromic hearing loss Genet. 2003 Jun;72(6):1571-7 Note Krendel M, Mooseker MS. Myosins: tails (and heads) of functional diversity. Physiology (Bethesda). 2005 MYO1A, which is located within the DFNA48 Aug;20:239-51 locus, was the first myosin I family member found to be involved in causing deafness and may be a Tyska MJ, Mackey AT, Huang JD, Copeland NG, Jenkins NA, Mooseker MS. Myosin-1a is critical for normal brush major contributor to autosomal dominant-hearing border structure and composition. Mol Biol Cell. 2005 loss. Several mutations in the MYO1A gene were May;16(5):2443-57 found to be associated with hearing loss (table 1) Kilpinen S, Autio R, Ojala K, Iljin K, Bucher E, Sara H, (Donaudy et al., 2003). In particular, the Pisto T, Saarela M, Skotheim RI, Björkman M, Mpindi JP, substitution E385D has been characterized to Haapa-Paananen S, Vainio P, Edgren H, Wolf M, Astola J, disrupt the mechanochemical coupling and Nees M, Hautaniemi S, Kallioniemi O. Systematic subcellular targeting of Myosin-1a (Yengo et al., bioinformatic analysis of expression levels of 17,330 human genes across 9,783 samples from 175 types of 2008). healthy and pathological tissues. Genome Biol. 2008;9(9):R139 References Yengo CM, Ananthanarayanan SK, Brosey CA, Mao S, Tyska MJ. Human deafness mutation E385D disrupts the Matsudaira PT, Burgess DR. Identification and mechanochemical coupling and subcellular targeting of organization of the components in the isolated microvillus myosin-1a. Biophys J. 2008 Jan 15;94(2):L5-7 cytoskeleton. J Cell Biol. 1979 Dec;83(3):667-73 McConnell RE, Higginbotham JN, Shifrin DA Jr, Tabb DL, Collins JH, Borysenko CW. The 110,000-dalton actin- and Coffey RJ, Tyska MJ. The enterocyte microvillus is a calmodulin-binding protein from intestinal brush border is a vesicle-generating organelle. J Cell Biol. 2009 Jun myosin-like ATPase. J Biol Chem. 1984 Nov 29;185(7):1285-98 25;259(22):14128-35 Nambiar R, McConnell RE, Tyska MJ. Control of cell Chantret I, Barbat A, Dussaulx E, Brattain MG, Zweibaum membrane tension by myosin-I. Proc Natl Acad Sci U S A. A. Epithelial polarity, villin expression, and enterocytic 2009 Jul 21;106(29):11972-7 differentiation of cultured human colon carcinoma cells: a survey of twenty cell lines. Cancer Res. 1988 Apr McConnell RE, Tyska MJ. Leveraging the membrane - 1;48(7):1936-42 cytoskeleton interface with myosin-1. Trends Cell Biol. 2010 Jul;20(7):418-26 West AB, Isaac CA, Carboni JM, Morrow JS, Mooseker MS, Barwick KW. Localization of villin, a cytoskeletal Nambiar R, McConnell RE, Tyska MJ. Myosin motor protein specific to microvilli, in human ileum and colon and function: the ins and outs of actin-based membrane in colonic neoplasms. Gastroenterology. 1988 protrusions. Cell Mol Life Sci. 2010 Apr;67(8):1239-54 Feb;94(2):343-52 Mazzolini R, Dopeso H, Mateo-Lozano S, Chang W, Beaulieu JF, Weiser MM, Herrera L, Quaroni A. Detection Rodrigues P, Bazzocco S, Alazzouzi H, Landolfi S, and characterization of sucrase-isomaltase in adult human Hernández-Losa J, Andretta E, Alhopuro P, Espín E, colon and in colonic polyps. Gastroenterology. 1990 Armengol M, Tabernero J, Ramón y Cajal S, Kloor M, Jun;98(6):1467-77 Gebert J, Mariadason JM, Schwartz S Jr, Aaltonen LA, Mooseker MS, Arango D. Brush border myosin Ia has Coluccio LM, Bretscher A. Mapping of the microvillar tumor suppressor activity in the intestine. Proc Natl Acad 110K-calmodulin complex (brush border myosin I). Sci U S A. 2012 Jan 31;109(5):1530-5 Identification of fragments containing the catalytic and F- actin-binding sites and demonstration of a calcium ion Mazzolini R, Rodrigues P, Bazzocco S, Dopeso H, Ferreira dependent conformational change. Biochemistry. 1990 AM, Mateo-Lozano S, Andretta E, Woerner SM, Alazzouzi Dec 18;29(50):11089-94 H, Landolfi S, Hernandez-Losa J, Macaya I, Suzuki H, Ramón y Cajal S, Mooseker MS, Mariadason JM, Gebert Skowron JF, Mooseker MS. Cloning and characterization J, Hofstra RM, Reventós J, Yamamoto H, Schwartz S Jr, of mouse brush border myosin-I in adult and embryonic Arango D. Brush border myosin Ia inactivation in gastric intestine. J Exp Zool. 1999 Feb 15;283(3):242-57 but not endometrial tumors. Int J Cancer. 2013 Apr Dumont RA, Zhao YD, Holt JR, Bähler M, Gillespie PG. 15;132(8):1790-9 Myosin-I isozymes in neonatal rodent auditory and vestibular epithelia. J Assoc Res Otolaryngol. 2002 This article should be referenced as such: Dec;3(4):375-89 Arango del Corro D, Mazzolini R. MYO1A (myosin IA). Donaudy F, Ferrara A, Esposito L, Hertzano R, Ben-David Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8):565- 570.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 570 Atlas of Genetics and Cytogenetics in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Gene Section Review

NR1H4 (nuclear receptor subfamily 1, group H, member 4) Oscar Briz, Elisa Herraez, Jose JG Marin Laboratory of Experimental Hepatology and Drug Targeting (HEVEFARM), Biomedical Research Institute of Salamanca (IBSAL), University of Salamanca, Salamanca, Spain and National Institute of Health, Carlos III, Center for the Study of Liver and Gastrointestinal Diseases (CIBERehd), Madrid, Spain (OB, EH, JJGM), Department of Physiology and Pharmacology, University of Salamanca, Campus Miguel de Unamuno E.D. S-09, 37007 - Salamanca, Spain (JJGM)

Published in Atlas Database: December 2013 Online updated version : http://AtlasGeneticsOncology.org/Genes/NR1H4ID46032ch12q23.html DOI: 10.4267/2042/54011 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2014 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Abstract Transcription 4 alternatively spliced transcript variants encoding Review on NR1H4, with data on DNA/RNA, on the different isoforms have been described for this protein encoded and where the gene is implicated. gene. Variants 3 and 4 contain an alternate 5'-terminal Identity exon resulting in isoforms FXR α2 longer than FXR α1, coding by variants 2 and 5, with a distinct Other names: BAR, FXR, HRR-1, HRR1, RIP14 N-terminus due to translation initiation from an HGNC (Hugo): NR1H4 alternate in-frame start codon in the exon 3. Location: 12q23.1 Use of an alternate in-frame donor splice site at exon 5 results in FXR α1(-) and FXR α2(-) variants DNA/RNA that miss a 4 amino acid segment compared to FXR α1(+) and FXR α2(+) isoforms. Description Pseudogene In humans, FXR is encoded by the NR1H4 gene, A pseudogene of FXR has been located on consisted of 11 exons and 10 introns. chromosome 1 (1p13.1-1p13.3) (Pseudogene.org).

A. NR1H4 gene structure. Schematic representation of the NR1H4 gene into 11 exons showing the alternative splicing and the start triplets that generate the 4 known isoforms. These have been classified according to the difference in the initial region of mRNA ( α1 and α2) and the presence (+) or absence (-) of a 12-bp insert in the exon 5.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 571 NR1H4 (nuclear receptor subfamily 1, group H, member 4) Briz O, et al.

B. NCBI reference sequences for FXR variants and isoforms. Variants 1 and 6, and variants 2 and 5 encode the same isoforms.

intestine, kidney and adrenal gland (Huber et al., Protein 2002). Lower FXR levels can be detected in other Note organs forming the gastrointestinal tract, pancreas, FXR is a ligand-activated transcription factor breast and endothelial cells. belonging to the nuclear receptor superfamily. The liver predominantly expresses FXR α1(+/-), whereas FXR α2(+/-) are the most abundant Description isoforms in kidney and intestine. In all cases, the FXR shares the typical structure of other nuclear proportion of FXR α(1/2)(+) and FXR α(1/2)(-) receptors, including the N-terminal DNA binding isoforms is approximately 50% (Vaquero et al., domain (DBD) and the C-terminal ligand binding 2013b). domain (LBD) (Modica et al., 2010). DBD contains two zinc fingers motifs involved in Localisation DNA binding and dimerization with RXR α. When activated FXR translocates to the nucleus. Hinge region connects the DBD with the LBD, and Function contains the insert of the amino acid sequence MYTG in the FXR α1/2(+) isoforms. Binding of bile acids, the natural ligands of FXR, to Ligand-independent (AF-1) and -dependent (AF-2) the receptor leads its translocation to the cell transactivation domains involved in the interaction nucleus, formation of a heterodimer RXR α and with co-repressors and co-activators are located in binding to FXR response elements on DNA, which N- and C-termini, respectively. activates the transcription of its target genes. Among FXR target genes are those encoding most Expression of the proteins involved in bile acid metabolism and FXR is expressed at high levels in the liver, small transport (Modica et al., 2010).

FXR isoforms. Schematic representation of FXR isoforms classified based on the presence of the exons 1 and 2 (FXR α1) or 3 (FXR α2) in the initial region of the mRNA and the presence (+) or the absence (-) of the amino acid sequence MYTG in exon 5. AF1 and AF2: ligand-independent and -dependent transactivation domains, respectively; DBD: DNA binding domain; H: hinge region; LBD: ligand binding domain.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 572 NR1H4 (nuclear receptor subfamily 1, group H, member 4) Briz O, et al.

Definition, nomenclature, and allelic frequency of clinically relevant NR1H4 genetic variants. MAF refers to the frequency at which the less common allele occurs in a given population according to the NCBI SNP database. Nucleotide positions refer to the ORF of the NM_005123 sequence. Amino acid positions refer to the NP_005114 (FXR α1(-)) or NP_001193921 (FXR α2(-)) proteins. AF-1, ligand-independent transactivation domain.

Additional target genes have recently been and lipid metabolism (Heni et al., 2013). c.1A>G described to be involved in FXR-mediated and c.518T>C are two rare mutations in the coding regulation of several body functions, such as sequence of FXR whose consequence is a reduction prevention of hepatic and intestinal carcinogenesis, of the function of the protein. Both predispose to liver regeneration, intestinal barrier, attenuation of intrahepatic cholestasis of pregnancy (Van Mil et adverse effects of cholestasis, prevention of al., 2007).Implicated in gallstone formation, and chemoprotection (Vaquero et al., 2013a). Some of the effects of FXR are Hepatocellular carcinoma and mediated by the induction of the small heterodimer cholangiocarcinoma partner (SHP), a negative regulator encoded by the Note NR0B2 gene. This transcription factor interacts FXR is reduced in liver cancer suggesting that FXR with other nuclear receptors blocking its activation. is rather working as a tumour suppressor. Knockout Glucocorticoids are able to directly activate FXR mice for FXR spontaneously developed liver but they also antagonize the expression of FXR and tumours after several months. A potential its target genes (Rosales et al., 2013). contribution of FXR in tumour suppression can be Homology attributed to its anti-fibrogenic properties in liver. It has also been proposed a role of FXR in prevention DBD domain is a highly conserved domain, of hepatocarcinogenesis by inhibiting the whereas LBD domain is moderately conserved in expression of gankyrin (PSMD10), which is sequence and highly conserved in structure between activated in liver cancer and modifies the the various nuclear receptors (Modica et al., 2010). expression of tumour suppressor genes, including According to sequence homology NR1H4 has been Rb, p53, C/EBP α, HNF4 α, and p16. included into the liver-X-receptor-like group of genes belonging to the thyroid hormone receptor- Colon cancer like subfamily of nuclear receptors, together with Note NR1H2 (liver X receptor-β) and NR1H3 (liver X Emerging evidences support an important role for receptor-α). FXR in intestinal carcinogenesis. FXR mRNA expression is decreased in colonic polyps, and even Mutations more pronounced in colonic adenocarcinoma. Even Note before carcinomas have formed, FXR loss led to The presence of missense mutations in the NR1H4 extensive mucosal infiltration of neutrophils and gene is unusual, suggesting an important role of this macrophages along with increased TNF-α mRNA gene in the maintenance of organ function and expression and nuclear β-catenin accumulation. cellular homeostasis. FXR deficiency led to increased susceptibility to tumour development by promoting WTN-β-catenin Somatic signalling through TNF-α released by infiltrated c.-1G>T is a common variation resulting in reduced macrophages. In contrast to this indirect translation efficiency (Marzolini et al., 2007) that oncosupressive role of FXR, by maintaining might predispose to inflammatory bowel diseases intestinal epithelium integrity, FXR also carries out (Attinkara et al., 2012) and intrahepatic cholestasis a direct oncosupressor activity. Thereby, several of pregnancy (Van Mil et al., 2007). c.-189- data suggest that FXR activation enhances 1174G>A and c.-190+7064C>T are intronic SNP apoptosis and inhibits cell proliferation by that have been associated with an altered glucose increasing the expression of proapoptotic genes

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 573 NR1H4 (nuclear receptor subfamily 1, group H, member 4) Briz O, et al.

including p21, BAK1, FADD, and repressing that represses hepatic CYP7A1 expression, and antiapoptotic genes, such as BCL-2. hence down-regulation of bile acid synthesis. Chemoresistance Disease Note Cholestasis, which is characterized by the accumulation of bile acids in liver and is associated Ligand-dependent and independent activation of with reduced detoxification capacity. FXR and/or its signalling pathway is involved in the chemoprotective response of liver cells. Cirrhosis This is due in part to changes in the expression of Note several genes (ABCB4, TCEA2, CCL14, CCL15 FXR is expressed in hepatic stellate cells, and its and KRT13) accounting for different MOC, mainly activation reduces the expression of extracellular these involved in drug efflux (MOC-1b), DNA matrix proteins by these cells, preventing liver repair (MOC-4) and cell survival (MOC-5b). fibrosis. Moreover, this characteristic is shared by healthy and tumour cells, and hence may play an important Disease role in enhancing the chemoprotection of healthy Cirrhosis is a result of advanced liver disease that is hepatocytes against genotoxic compounds and characterized by replacement of liver tissue by reducing the response of liver tumour cells to fibrosis and regenerative nodules, leading loss of certain pharmacological treatments. liver function. Disease Cholelithiasis The development of chemoresistance depends on Note the expression of the genes involved in a variety of FXR prevents gallstone formation by up-regulation mechanisms of chemoresistance (MOC), which are of ABC proteins accounting for canalicular present in both healthy tissues, where they are secretion of bile acids (BSEP) and phospholipids involved in the defence against the chemical stress (MDR3), resulting in enhanced mixed micelle caused by potentially toxic compounds, and in formation capability and, hence prevention of cancer cells, where they account for the poor cholesterol crystallization in bile. response to antitumour drugs. Disease Cholestasis Cholelithiasis is a pathological situation Note characterized by presence in the gallbladder, of FXR has a crucial role in maintaining bile acid stones, a crystalline concretion formed by accretion homeostasis, especially during cholestasis. Upon of bile components. activation by enhanced bile acid levels FXR Hepatic regeneration mediates responses that partially protect the hepatocyte from the deleterious effect of Note accumulation of toxic bile acids. FXR participates in bile acid-induced liver repair by FXR inhibits bile acid synthesis in liver, through promoting regeneration through regulation of the down-regulation of key enzymes in bile acid FoxM1b expression, a Forkhead Box transcription biosynthesis, such as CYP7A1 and CYP8B1. It also factor, which regulates cell cycle progression diminishes bile acid uptake by hepatocytes by during liver regeneration. Moreover, FXR helps repressing the expression of Na +-taurocholate restoration of organ homeostasis. cotransporting polypeptide or NTCP (gene symbol Disease SLC10A1), and increases bile acid efflux by Liver regeneration after loss of hepatic tissue is an inducing the expression of ABC proteins at the adaptive response to repair injury consisting of canalicular membrane, such as including BSEP induction of proliferative factors that activate the (ABCB11) and MDR3 (ABCB4) involved in bile quiescent hepatocytes, followed by re- acid-dependent phospholipid secretion. FXR up- establishment of normal liver size and renewed regulates the phase II enzymes uridine 5'- hepatocyte quiescence. diphosphate-glucuronosyltransferase 2B4 (UGT2B4) and sulphotransferase 2A1 (SULT2A1), Intestinal diseases which glucuronidate or sulphate bile acids to render Note them more hydrophilic, less biologically active, and FXR plays an important role in the protection more easily to be eliminated from the body. In the against bacterial overgrowth and the maintenance intestine FXR-induced reduction of bile acid uptake of intestinal barrier function, and it has recently by enterocytes due to transcriptional repression of been involved in the pathogenesis of idiopathic ASBT (SLC10A2), which enhances bile acid faecal inflammatory bowel disease. FXR activation in the loss. Moreover, FXR increases the transcription of intestinal tract decreases the production of FGF19 in the ileum, triggering a signalling pathway proinflammatory cytokines such as IL1-β, IL-2, IL-

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 574 NR1H4 (nuclear receptor subfamily 1, group H, member 4) Briz O, et al.

6, tumour necrosis factor-alpha (TNF-α) and sensor FXR identified in intrahepatic cholestasis of interferon-gamma (IFN-γ), thus contributing to a pregnancy. Gastroenterology. 2007 Aug;133(2):507-16 reduction of inflammation and epithelial Modica S, Gadaleta RM, Moschetta A. Deciphering the permeability. In addition, intestinal FXR activation nuclear bile acid receptor FXR paradigm. Nucl Recept induces the expression of genes with antibacterial Signal. 2010 Nov 19;8:e005 properties involved in enteroprotection and Attinkara R, Mwinyi J, Truninger K, Regula J, Gaj P, prevention of bacterial translocation in the intestinal Rogler G, Kullak-Ublick GA, Eloranta JJ. Association of genetic variation in the NR1H4 gene, encoding the nuclear tract, including angiogenin, carbonic anhydrase 12 bile acid receptor FXR, with inflammatory bowel disease. or inducible nitric oxide synthase. BMC Res Notes. 2012 Aug 28;5:461 Disease Heni M, Wagner R, Ketterer C, Böhm A, Linder K, Intestinal bacterial proliferation and translocation, Machicao F, Machann J, Schick F, Hennige AM, Stefan N, chronic diarrhoea and inflammatory bowel disease. Häring HU, Fritsche A, Staiger H. Genetic variation in NR1H4 encoding the bile acid receptor FXR determines fasting glucose and free fatty acid levels in humans. J Clin Breakpoints Endocrinol Metab. 2013 Jul;98(7):E1224-9 Note Rosales R, Romero MR, Vaquero J, Monte MJ, Requena P, Martinez-Augustin O, Sanchez de Medina F, Marin JJ. NR1H4 gene is not involved in breakpoint regions. FXR-dependent and -independent interaction of glucocorticoids with the regulatory pathways involved in References the control of bile acid handling by the liver. Biochem Pharmacol. 2013 Mar 15;85(6):829-38 Huber RM, Murphy K, Miao B, Link JR, Cunningham MR, Rupar MJ, Gunyuzlu PL, Haws TF, Kassam A, Powell F, Vaquero J, Briz O, Herraez E, Muntané J, Marin JJ. Hollis GF, Young PR, Mukherjee R, Burn TC. Generation Activation of the nuclear receptor FXR enhances of multiple farnesoid-X-receptor isoforms through the use hepatocyte chemoprotection and liver tumor of alternative promoters. Gene. 2002 May 15;290(1-2):35- chemoresistance against genotoxic compounds. Biochim 43 Biophys Acta. 2013a Oct;1833(10):2212-9 Marzolini C, Tirona RG, Gervasini G, Poonkuzhali B, Vaquero J, Monte MJ, Dominguez M, Muntané J, Marin JJ. Assem M, Lee W, Leake BF, Schuetz JD, Schuetz EG, Differential activation of the human farnesoid X receptor Kim RB. A common polymorphism in the bile acid receptor depends on the pattern of expressed isoforms and the bile farnesoid X receptor is associated with decreased hepatic acid pool composition. Biochem Pharmacol. 2013b Oct target gene expression. Mol Endocrinol. 2007 1;86(7):926-39 Aug;21(8):1769-80 This article should be referenced as such: Van Mil SW, Milona A, Dixon PH, Mullenbach R, Geenes VL, Chambers J, Shevchuk V, Moore GE, Lammert F, Briz O, Herraez E, Marin JJG. NR1H4 (nuclear receptor Glantz AG, Mattsson LA, Whittaker J, Parker MG, White R, subfamily 1, group H, member 4). Atlas Genet Cytogenet Williamson C. Functional variants of the central bile acid Oncol Haematol. 2014; 18(8):571-575.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 575 Atlas of Genetics and Cytogenetics in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Gene Section Review

PRND (Prion Protein 2 (Dublet)) Gabriele Giachin, Giuseppe Legname Laboratory of Prion Biology, Department of Neuroscience, Scuola Internazionale Superiore di Studi Avanzati (SISSA), via Bonomea 265, Trieste, Italy (GG, GL)

Published in Atlas Database: December 2013 Online updated version : http://AtlasGeneticsOncology.org/Genes/PRNDID44172ch20p13.html DOI: 10.4267/2042/54012 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2014 Atlas of Genetics and Cytogenetics in Oncology and Haematology

This gene was discovered in transgenic (Tg) mice Abstract where the Prnp gene was ablated (Prnp 0/0 mice Review on PRND, with data on DNA/RNA, on the strains) resulting in a diseased phenotype protein encoded and where the gene is implicated. characterized by loss of Purkinje cells in the cerebellum. Identity Interestingly, Prnp deletion in these mouse lines resulted in the formation of a chimeric Prnd Other names: DOPPEL, DPL, PrPLP, dJ1068H6.4 transcript under the control of the strong Prnp HGNC (Hugo): PRND promoter. Thus, these studies have shown that only Location: 20p13 the ectopic expression of Dpl, rather than the absence of the Prnp gene, caused neurodegeneration Local order: PRND lies 27 kb downstream the (Li et al., 2000). human prion protein gene (PRNP). PRNP starts at 4702556 and ends at 4709106 bps. Description Note: PRND and PRNP genes form the prion gene The PRND gene includes two exons separated by complex and are regulated by their own promoter. one intron. Exon 2 encodes for the Doppel protein. Doppel is an acronym derived from downstream prion protein-like gene (Moore et al., 2001). PRNP Transcription and PRND are believed to arise through duplication Prnd RNA transcription has been reported in of a single ancestral gene (Mastrangelo and different tissues of adult wild-type (WT) mice Westaway, 2001). including testis, heart, spleen and skeletal muscle (Li et al., 2000). In neonatal mice up to 3 weeks, DNA/RNA Prnd RNA has been detected in brain blood vessel endothelial cells (Li et al., 2000). Note The Prnd gene was originally identified in mice Pseudogene during DNA sequencing of the cosmid clone Prnd pseudogenes have been identified in non- isolated from the I/LnJ inbred mice strain (Lee et mammalian organisms as Anolis (lizard) and al., 1998). Xenopus (frog) (Harrison et al., 2010).

Schematic structural representation of the human PRN locus on chromosome 20p13 containing PRNP, PRND and the putative testis-specific prion protein (PRNT) genes.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 576 PRND (Prion Protein 2 (Dublet)) Giachin G, Legname G

Schematic representation of the PRND gene. Exon 1 starts at 4705556 bp and ends at 4702615 bp. Exon 2 containing the Doppel open reading frame (ORF) starts at 4705187 bp and ends at 4709106 bp. The sequence surrounding the splice acceptor site is shown with intronic nucleotides in lower case, exonic nucleotides in capital letters and Met start codon ATG underlined.

lymphocytes, granulocytes and dendritic cells Protein (Cordier-Dirikoc et al., 2008). Note Localisation Doppel tertiary structure has a fold similar to that of Doppel is attached to the cell membrane through its C the cellular prion protein, PrP (encoded by PRNP GPI anchor (Silverman et al., 2000). A study has or Prnp genes) although it shares approximately shown Doppel localization in detergent-resistant C 25% of aminoacidic sequence identity with PrP . membranes or lipid rafts (Caputo et al., 2010). Description Function The immature form of human Doppel includes 176 The Doppel expression in spermatozoa and Sertoli residues with two N- and C-terminal signal peptides cells infers a role in spermatogenesis. Male Tg mice cleaved during protein maturation. The mature knock-out for Prnd were sterile, clearly indicating sequence includes 126 amino acids spanning from that Doppel plays a role in male reproduction as residues 27 to 152, with a molecular weight of critical regulator of spermatogenesis and sperm-egg approximately 14.5 kDa. Tryptic digestion and interaction (Behrens et al., 2002). Doppel may mass spectroscopy studies have identified two enhance in vitro ovine spermatozoa fertilizing distinct disulfide bridges (Cys109-Cys143 and ability (Pimenta et al., 2012). Cys95-Cys148) which strongly stabilize the Doppel Doppel has been implicated in early testis folding (Baillod et al., 2013; Silverman et al., 2000; differentiation (Kocer et al., 2007). The detection of Whyte et al., 2003). PNGase F digestion and Prnd mRNA in brain blood vessel endothelial cells immunoblots have reported two N-linked might indicate a possible role in the development of glycosylation sites at codons 99 and 111. The GPI brain blood vessels (Li et al., 2000). The anchor targets the protein at the extracellular observation that Doppel is expressed with PrP C in B membrane. NMR structures of recombinant human lymphocytes, granulocytes and dendritic cells and mouse Dopple have been solved (Luhrs et al., argues for a role in cell-cell interaction in the 2003; Mo et al., 2001). The NMR structures of the immunosystem (Cordier-Dirikoc et al., 2008). N-terminal murine and ovine signal peptides Several evidence showed that Doppel is able to (residues 1-30) have also been determined coordinate in vitro the binding of copper ions with (Papadopoulos et al., 2006). The human Doppel high affinity (Cereghetti et al., 2004; La Mendola et NMR structure features a short flexible N-terminal al., 2010; Qin et al., 2003). segment comprising residues 24-51 and a globular domain including four α-helices ( α1: residues 72- Mutations 80; α2a: residues 101-115; α2b: residues 117-121; α3: residues 127-141) and a short two-stranded Note anti-parallel β-sheet ( β1: residues 58-60; β2: Different polymorphic variants have been identified residues 88-90) (Luhrs et al., 2003). in PRND. The effect of polymorphisms in Doppel Expression function and their implication in the diseases have not been fully clarified. Under physiological conditions Doppel is mostly expressed in testis and, in particular, in Germinal spermatozoa and Sertoli cells (Behrens et al., 2002; S6I, S22P, T26P, H31R, P56L, F70L, L149S, Peoc'h et al., 2002). Additionally, Doppel is T174M (Clark et al., 2003; Moore et al., 1999; expressed with PrP C in spleen cells, notably B Peoc'h et al., 2000; Schroder et al., 2001).

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 577 PRND (Prion Protein 2 (Dublet)) Giachin G, Legname G

A) Primary sequence alignment between human PrP C (GenBank: BAG32277.1) and human Doppel (NCBI Reference Sequence: NP_036541.2). B) Secondary structure motives of human PrP C and Doppel. Highlighted: signal peptides, N-linked glycosylation sites (CHO), disulfide bridges (S-S) and Glycosylphosphatidylinisotol (GPI) anchor. C) Tertiary NMR structures of Doppel (pdb id 1LG4) and PrP C (2LSB).

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 578 PRND (Prion Protein 2 (Dublet)) Giachin G, Legname G

Implicated in Abnormal Doppel expression levels in human astrocytomas and other Ectopic Doppel expression non-glial brain tumor specimens associated with Purkinje cell Note neurodegeneration in transgenic Doppel is aberrantly expressed in astrocytic tumors mouse models. where it displays cytoplasmic, nuclear and Note lysosomal localization and molecular properties Beside its role in male reproductive system, Doppel (i.e. altered glycosilation pattern) different from has attracted interest for its neurotoxic properties Doppel as normally expressed in testis (Azzalin et when ectopically expressed in the brain of Tg mice al., 2006; Azzalin et al., 2008; Comincini et al., knock-out for the prion protein gene (Prnp 0/0 mice). 2006; Comincini et al., 2004; Comincini et al., In these mice, denoted as Ngsk PrP -/-, the Doppel- 2007; Rognoni et al., 2010; Sbalchiero et al., 2008). encoding exon was expressed as chimeric mRNA due to the intergenic splicing taking place between References Prnp and Prnd. Lee IY, Westaway D, Smit AF, Wang K et al.. Complete As a result, Prnd became abnormally regulated genomic sequence and analysis of the prion protein gene under the control of Prnp promoter and ectopically region from three mammalian species. Genome Res. 1998 expressed in the brain and, in particular, in neurons Oct;8(10):1022-37 and glial cells (Li et al., 2000). Moore RC, Lee IY, Silverman GL et al.. Ataxia in prion Similar non-physiological Doppel expression was protein (PrP)-deficient mice is associated with upregulation of the novel PrP-like protein doppel. J Mol Biol. 1999 Oct reported in other Tg mouse lines knock-out for Prnp 1;292(4):797-817 such as Rcm0 and Zrch mice (Moore et al., 2001; Rossi et al., 2001). Li A, Sakaguchi S, Atarashi R, Roy BC et al.. Identification of a novel gene encoding a PrP-like protein expressed as Doppel expression in the brain is neurotoxic and chimeric transcripts fused to PrP exon 1/2 in ataxic mouse causes Purkinje cell degeneration in these mouse line with a disrupted PrP gene. Cell Mol Neurobiol. 2000 models. Doppel neurotoxicity is antagonized by the Oct;20(5):553-67 C PrP N-terminal domain (Atarashi et al., 2003; Peoc'h K, Guérin C, Brandel JP et al.. First report of Yamaguchi et al., 2004). polymorphisms in the prion-like protein gene (PRND): The neuroprotective PrP C role against ectopic implications for human prion diseases. Neurosci Lett. 2000 Doppel expression has been reported also in human Jun 2;286(2):144-8 neuronal SH-SY5Y cells (Li et al., 2009) Silverman GL, Qin K, Moore RC, Yang Y et al.. Doppel is confirming the dominant-negative effects of the an N-glycosylated, glycosylphosphatidylinositol-anchored C protein. Expression in testis and ectopic production in the PrP N-terminal region (Yoshikawa et al., 2008). brains of Prnp(0/0) mice predisposed to Purkinje cell loss. The molecular mechanisms leading to Doppel- J Biol Chem. 2000 Sep 1;275(35):26834-41 induced neurodegeneration in Purkinje and granular Mastrangelo P, Westaway D. The prion gene complex cells are still controversial. encoding PrP(C) and Doppel: insights from mutational An earlier study has reported that the chimeric form analysis. Gene. 2001 Sep 5;275(1):1-18 of Doppel fused to a Fc domain binds specifically Mo H, Moore RC, Cohen FE, Westaway D et al.. Two granule cells and causes neurodegeneration, raising different neurodegenerative diseases caused by proteins the possibility that these specific cells expressed a with similar structures. Proc Natl Acad Sci U S A. 2001 still unidentified protein that mediates the Doppel- Feb 27;98(5):2352-7 induced neurotoxicity (Legname et al., 2002). Moore RC, Mastrangelo P, Bouzamondo E et al.. Doppel- Oxidative stress may play a role in Doppel-induced induced cerebellar degeneration in transgenic mice. Proc neuronal death since NOS activity is induced by Natl Acad Sci U S A. 2001 Dec 18;98(26):15288-93 Doppel in vitro and in vivo (Cui et al., 2003; Wong Rossi D, Cozzio A, Flechsig E et al.. Onset of ataxia and et al., 2001). Purkinje cell loss in PrP null mice inversely correlated with Two independent groups have reported that BAX Dpl level in brain. EMBO J. 2001 Feb 15;20(4):694-702 contributes to Doppel-induced apoptosis (Didonna Schröder B, Franz B, Hempfling P, Selbert M et al.. et al., 2012; Heitz et al., 2007) and that BCL-2 Polymorphisms within the prion-like protein gene (Prnd) and their implications in human prion diseases, antagonizes Doppel neurotoxicity (Heitz et al., Alzheimer's disease and other neurological disorders. Hum 2008). Genet. 2001 Sep;109(3):319-25 Another work has observed that ectopic Doppel Wong BS, Liu T, Paisley D, Li R, Pan T et al.. Induction of expression in the brain elicits neurodegeneration HO-1 and NOS in doppel-expressing mice devoid of PrP: through the binding of two metalloproteinase implications for doppel function. Mol Cell Neurosci. 2001 namely the alpha-1-inhibitor-3 ( α1I3) and the Apr;17(4):768-75 alpha-2-macroglobin ( α2M) (Benvegnu et al., Behrens A, Genoud N et al.. Absence of the prion protein 2009). homologue Doppel causes male sterility. EMBO J. 2002

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 579 PRND (Prion Protein 2 (Dublet)) Giachin G, Legname G

Jul 15;21(14):3652-8 Kocer A, Gallozzi M, Renault L, Tilly G et al.. Goat PRND expression pattern suggests its involvement in early sex Legname G, Nelken P, Guan Z, Kanyo ZF, DeArmond SJ, differentiation. Dev Dyn. 2007 Mar;236(3):836-42 Prusiner SB. Prion and doppel proteins bind to granule cells of the cerebellum. Proc Natl Acad Sci U S A. 2002 Azzalin A, Sbalchiero E, Barbieri G, Palumbo S, Muzzini C, Dec 10;99(25):16285-90 Comincini S. The doppel (Dpl) protein influences in vitro migration capability in astrocytoma-derived cells. Cell Peoc'h K, Serres C, Frobert Y, Martin C et al.. The human Oncol. 2008;30(6):491-501 "prion-like" protein Doppel is expressed in both Sertoli cells and spermatozoa. J Biol Chem. 2002 Nov Cordier-Dirikoc S, Zsürger N, Cazareth J, Ménard B, 8;277(45):43071-8 Chabry J. Expression profiles of prion and doppel proteins and of their receptors in mouse splenocytes. Eur J Atarashi R, Nishida N et al.. Deletion of N-terminal Immunol. 2008 Aug;38(8):2131-41 residues 23-88 from prion protein (PrP) abrogates the potential to rescue PrP-deficient mice from PrP-like Heitz S, Gautheron V, Lutz Y, Rodeau JL et al.. BCL-2 protein/doppel-induced Neurodegeneration. J Biol Chem. counteracts Doppel-induced apoptosis of prion-protein- 2003 Aug 1;278(31):28944-9 deficient Purkinje cells in the Ngsk Prnp(0/0) mouse. Dev Neurobiol. 2008 Feb 15;68(3):332-48 Clark HF, Gurney AL, Abaya E, Baker K et al.. The secreted protein discovery initiative (SPDI), a large-scale Sbalchiero E, Azzalin A, Palumbo S et al.. Altered cellular effort to identify novel human secreted and distribution and sub-cellular sorting of doppel (Dpl) protein transmembrane proteins: a bioinformatics assessment. in human astrocytoma cell lines. Cell Oncol. Genome Res. 2003 Oct;13(10):2265-70 2008;30(4):337-47 Cui T, Holme A, Sassoon J, Brown DR. Analysis of doppel Yoshikawa D, Yamaguchi N, Ishibashi D et al.. Dominant- protein toxicity. Mol Cell Neurosci. 2003 May;23(1):144-55 negative effects of the N-terminal half of prion protein on neurotoxicity of prion protein-like protein/doppel in mice. J Lührs T, Riek R, Güntert P, Wüthrich K. NMR structure of Biol Chem. 2008 Aug 29;283(35):24202-11 the human doppel protein. J Mol Biol. 2003 Mar 7;326(5):1549-57 Benvegnù S, Franciotta D, Sussman J et al.. Prion protein paralog doppel protein interacts with alpha-2- Qin K, Coomaraswamy J et al.. The PrP-like protein macroglobulin: a plausible mechanism for doppel-mediated Doppel binds copper. J Biol Chem. 2003 Mar neurodegeneration. PLoS One. 2009 Jun 18;4(6):e5968 14;278(11):8888-96 Caputo A, Sarnataro D, Campana V, Costanzo M, Negro Whyte SM, Sylvester ID, Martin SR, Gill AC et al.. Stability A, Sorgato MC, Zurzolo C. Doppel and PrPC co- and conformational properties of doppel, a prion-like immunoprecipitate in detergent-resistant membrane protein, and its single-disulphide mutant. Biochem J. 2003 domains of epithelial FRT cells. Biochem J. 2009 Dec Jul 15;373(Pt 2):485-94 23;425(2):341-51 Cereghetti GM, Negro A et al.. Copper(II) binding to the Li P, Dong C, Lei Y, Shan B, Xiao X et al.. Doppel-induced human Doppel protein may mark its functional diversity cytotoxicity in human neuronal SH-SY5Y cells is from the prion protein. J Biol Chem. 2004 Aug antagonized by the prion protein. Acta Biochim Biophys 27;279(35):36497-503 Sin (Shanghai). 2009 Jan;41(1):42-53 Comincini S, Facoetti A, Del Vecchio I et al.. Differential Harrison PM, Khachane A, Kumar M. Genomic expression of the prion-like protein doppel gene (PRND) in assessment of the evolution of the prion protein gene astrocytomas: a new molecular marker potentially involved family in vertebrates. Genomics. 2010 May;95(5):268-77 in tumor progression. Anticancer Res. 2004 May- Jun;24(3a):1507-17 La Mendola D, Magrì A, Campagna T et al.. A doppel alpha-helix peptide fragment mimics the copper(II) Yamaguchi N, Sakaguchi S et al.. Doppel-induced Purkinje interactions with the whole protein. Chemistry. 2010 Jun cell death is stoichiometrically abrogated by prion protein. 1;16(21):6212-23 Biochem Biophys Res Commun. 2004 Jul 9;319(4):1247- 52 Rognoni P, Chiarelli LR, Comincini S et al.. Biochemical signatures of doppel protein in human astrocytomas to Azzalin A, Del Vecchio I, Ferretti L, Comincini S. The support prediction in tumor malignancy. J Biomed prion-like protein Doppel (Dpl) interacts with the human Biotechnol. 2010;2010:301067 receptor for activated C-kinase 1 (RACK1) protein. Anticancer Res. 2006 Nov-Dec;26(6B):4539-47 Didonna A, Sussman J, Benetti F, Legname G. The role of Bax and caspase-3 in doppel-induced apoptosis of Comincini S, Chiarelli LR, Zelini P et al.. Nuclear mRNA cerebellar granule cells. Prion. 2012 Jul 1;6(3):309-16 retention and aberrant doppel protein expression in human astrocytic tumor cells. Oncol Rep. 2006 Dec;16(6):1325-32 Pimenta J, Dias FM, Marques CC et al.. The prion-like protein Doppel enhances ovine spermatozoa fertilizing Papadopoulos E, Oglecka K, Mäler L et al.. NMR solution ability. Reprod Domest Anim. 2012 Apr;47(2):196-202 structure of the peptide fragment 1-30, derived from unprocessed mouse Doppel protein, in DHPC micelles. Baillod P, Garrec J, Tavernelli I, Rothlisberger U. Prion Biochemistry. 2006 Jan 10;45(1):159-66 versus doppel protein misfolding: new insights from replica-exchange molecular dynamics simulations. Comincini S, Ferrara V, Arias A et al.. Diagnostic value of Biochemistry. 2013 Nov 26;52(47):8518-26 PRND gene expression profiles in astrocytomas: relationship to tumor grades of malignancy. Oncol Rep. This article should be referenced as such: 2007 May;17(5):989-96 Giachin G, Legname G. PRND (Prion Protein 2 (Dublet)). Heitz S, Lutz Y, Rodeau JL, Zanjani H et al.. BAX Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8):576- contributes to Doppel-induced apoptosis of prion-protein- 580. deficient Purkinje cells. Dev Neurobiol. 2007 Apr;67(5):670-86

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 580 Atlas of Genetics and Cytogenetics in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Gene Section Short Communication

WNT1 (wingless-type MMTV integration site family, member 1) Irini Theohari, Lydia Nakopoulou 1st Department of Pathology, Medical School, University of Athens, Athens, Greece (IT, LN)

Published in Atlas Database: December 2013 Online updated version : http://AtlasGeneticsOncology.org/Genes/WNT1ID462ch12q13.html DOI: 10.4267/2042/54013 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2014 Atlas of Genetics and Cytogenetics in Oncology and Haematology

transmembrane receptors. Abstract In some developmental processes, is also a ligand Review on WNT1, with data on DNA/RNA, on the for the coreceptor RYK, thus triggering Wnt protein encoded and where the gene is implicated. signaling. Identity Localisation Other names: BMND16, INT1, OI15 Secreted, extracellular space, extracellular matrix. HGNC (Hugo): WNT1 Function Location: 12q13.12 Probable developmental protein. May be a signaling molecule important in CNS DNA/RNA (central nervous system) development. Description Is likely to signal over only few cell diameters. Has a role in osteoblast function and bone The WNT1 gene spans a genomic region of 4161 development. bases on plus strand. The DNA of WNT1 consists of 4 exons and the coding sequence starts in the first exon. Mutations Transcription Somatic The WNT1 gene has one protein coding transcript There are several WNT1 mutations identified which consists of 370 amino acids. related with osteogenesis imperfecta. Several confirmed somatic mutations of the WNT1 Protein gene have also been reported, according to COSMIC, which are associated with carcinomas of Description the endometrium, lung, large intestine, prostate and Ligand for members of the frizzled family of seven kidney.

Genomic location of WNT1 gene at chromosome 12 (plus strand).

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 581 WNT1 (wingless-type MMTV integration site family, member 1) Theohari I, Nakopoulou L

favorable prognosis of patients with stage II breast Implicated in cancer (Mylona et al., 2013). Esophageal cancer Basal cell carcinoma of head and Note neck It has been shown, in cell cultures of esophageal Note cancer, that WNT1 results in cytoplasmic Overexpression of WNT1 has been positively accumulation of beta-catenin and activates TCF- associated with cytoplasmic beta-catenin (Lo Muzio dependent transcription (Mizushima et al., 2002). et al., 2002). Overexpression of mRNA and protein levels of WNT1 have been positively associated with lymph Sarcoma node metastasis, advanced pathological stage and Note prognosis of patients with esophageal squamous WNT1 blockade by either monoclonal antibody or cell carcinoma (Lv et al., 2012). siRNA induces cell death in sarcoma cells (Mikami Breast cancer et al., 2005). Note Non-small cell lung cancer (NSCLC) WNT1 has been shown to be markedly elevated in Note grade I tumors, but declined as tumor grade The expression of WNT1 has been positively declined (Wong et al., 2002). Ectopic expression of correlated with c-Myc, cyclin D1, VEGF-A, MMP- WNT1, triggers the DNA damage response (DDR) 7, Ki-67 and intratumoral microvessel density and and an ensuing cascade of events resulting in has been found to negatively influence patients' tumorigenic conversion of primary human survival (Huang et al., 2008). WNT1 mammary epithelial cells. WNT1-transformed cells overexpression has been positively associated with have high telomerase activity and compromised p53 the Ki-67 proliferation index and c-Myc and has and Rb function, grow as spheres in suspension, been found to exert an unfavorable impact on and in mice form tumors that closely resemble patients' survival (Nakashima et al., 2008). WNT1 medullary carcinomas of the breast (Ayyanan et al., expression has been found to be an independent 2006). siRNA anti-WNT1 has been shown to prognostic factor of poor survival (Xu et al., 2011). induce apoptosis in human breast cancer cell lines (Wieczorek et al., 2008). WNT1 immunoreactivity Gastric cancer has been found to be inversely related to Note histological grade, Ki-67 and p53, positively to , The expression levels of WNT1 are positively HER-2 and caspase-3 and has been correlated with correlated with tumor size, tumor invasive depth,

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 582 WNT1 (wingless-type MMTV integration site family, member 1) Theohari I, Nakopoulou L

lymph node metastasis, pTNM stage and negatively Lefort K, Mandinova A, Raffoul W, Fiche M, Dotto GP, influences patients' 5-year survival rate (Zhang and Brisken C. Increased Wnt signaling triggers oncogenic conversion of human breast epithelial cells by a Notch- Xue, 2008). dependent mechanism. Proc Natl Acad Sci U S A. 2006 Neuroblastoma Mar 7;103(10):3799-804 Note Huang CL, Liu D, Ishikawa S, Nakashima T, Nakashima N, Yokomise H, Kadota K, Ueno M. Wnt1 overexpression Knockdown of endogenous WNT1 expression promotes tumour progression in non-small cell lung results in cell death and inhibits cell growth (Zhang cancer. Eur J Cancer. 2008 Nov;44(17):2680-8 et al., 2009). Nakashima T, Liu D, Nakano J, Ishikawa S, Yokomise H, Osteogenesis imperfecta (OI) Ueno M, Kadota K, Huang CL. Wnt1 overexpression associated with tumor proliferation and a poor prognosis in Note non-small cell lung cancer patients. Oncol Rep. 2008 This disease is a heritable bone fragiility disorder Jan;19(1):203-9 that is usually due to dominant mutations in Wieczorek M, Paczkowska A, Guzenda P, Majorek M, COL1A1 or COL1A2 and is characterized by Bednarek AK, Lamparska-Przybysz M. Silencing of Wnt-1 reduced bone mass and recurrent fractures. Genetic by siRNA induces apoptosis of MCF-7 human breast cancer cells. Cancer Biol Ther. 2008 Feb;7(2):268-74 variations in WNT1 define the bone mineral density quantitative trait locus 16 (BMND16) Zhang H, Xue Y. Wnt pathway is involved in advanced gastric carcinoma. Hepatogastroenterology. 2008 May- [MIM:615221]. Variance in bone mineral density Jun;55(84):1126-30 influences bone mass, contributes to size determination in the general population, and is a Zhang L, Li K, Lv Z, Xiao X, Zheng J. The effect on cell growth by Wnt1 RNAi in human neuroblastoma SH-SY5Y susceptibility factor for osteoporotic fractures. The cell line. Pediatr Surg Int. 2009 Dec;25(12):1065-71 disease is caused by mutations affecting the gene of Xu X, Sun PL, Li JZ, Jheon S, Lee CT, Chung JH. WNT1 (Fahiminiya et al., 2013; Faqeih et al., 2013; Aberrant Wnt1/ β-catenin expression is an independent Laine et al., 2013; Pyott et al., 2013). poor prognostic marker of non-small cell lung cancer after Osteoporosis (OSTEOP) surgery. J Thorac Oncol. 2011 Apr;6(4):716-24 Lv J, Cao XF, Ji L, Zhu B, Wang DD, Tao L, Li SQ. Note Association of β-catenin, Wnt1, Smad4, Hoxa9, and Bmi-1 A systemic skeletal disorder characterized by with the prognosis of esophageal squamous cell decreased bone mass and deterioration of bone carcinoma. Med Oncol. 2012 Mar;29(1):151-60 microarchitecture without alteration in the Fahiminiya S, Majewski J, Mort J, Moffatt P, Glorieux FH, composition of bone. The result is fragile bones and Rauch F. Mutations in WNT1 are a cause of osteogenesis an increased risk of fractures, even after minimal imperfecta. J Med Genet. 2013 May;50(5):345-8 trauma. Osteoporosis is a chronic condition of Faqeih E, Shaheen R, Alkuraya FS. WNT1 mutation with multifactorial etiology and is usually clinically recessive osteogenesis imperfecta and profound silent until a fracture occurs. Disease susceptibility neurological phenotype. J Med Genet. 2013 Jul;50(7):491- 2 is associated with variations affecting the gene of WNT1 (Keupp et al., 2013; Laine et al., 2013). Keupp K, Beleggia F, Kayserili H, Barnes AM, Steiner M, Semler O, Fischer B, Yigit G, Janda CY et al.. Mutations in WNT1 cause different forms of bone fragility. Am J Hum References Genet. 2013 Apr 4;92(4):565-74 Lo Muzio L, Pannone G, Staibano S, Mignogna MD, Laine CM, Joeng KS, Campeau PM, Kiviranta R, Grieco M, Ramires P, Romito AM, De Rosa G, Piattelli A. Tarkkonen K, Grover M, Lu JT, Pekkinen M, Wessman M, WNT-1 expression in basal cell carcinoma of head and Heino TJ, Nieminen-Pihala V, Aronen M et al.. WNT1 neck. An immunohistochemical and confocal study with mutations in early-onset osteoporosis and osteogenesis regard to the intracellular distribution of beta-catenin. imperfecta. N Engl J Med. 2013 May 9;368(19):1809-16 Anticancer Res. 2002 Mar-Apr;22(2A):565-76 Mylona E, Vamvakaris I, Giannopoulou I, Theohari I, Mizushima T, Nakagawa H, Kamberov YG, Wilder EL, Papadimitriou C, Keramopoulos A, Nakopoulou L. An Klein PS, Rustgi AK. Wnt-1 but not epidermal growth factor immunohistochemical evaluation of the proteins Wnt1 and induces beta-catenin/T-cell factor-dependent transcription glycogen synthase kinase (GSK)-3β in invasive breast in esophageal cancer cells. Cancer Res. 2002 Jan carcinomas. Histopathology. 2013 May;62(6):899-907 1;62(1):277-82 Pyott SM, Tran TT, Leistritz DF, Pepin MG, Mendelsohn Wong SC, Lo SF, Lee KC, Yam JW, Chan JK, Wendy NJ, Temme RT, Fernandez BA, Elsayed SM, Elsobky E, Hsiao WL. Expression of frizzled-related protein and Wnt- Verma I, Nair S, Turner EH, Smith JD, Jarvik GP, Byers signalling molecules in invasive human breast tumours. J PH. WNT1 mutations in families affected by moderately Pathol. 2002 Feb;196(2):145-53 severe and progressive recessive osteogenesis imperfecta. Am J Hum Genet. 2013 Apr 4;92(4):590-7 Mikami I, You L, He B, Xu Z, Batra S, Lee AY, Mazieres J, Reguart N, Uematsu K, Koizumi K, Jablons DM. Efficacy of This article should be referenced as such: Wnt-1 monoclonal antibody in sarcoma cells. BMC Cancer. 2005 May 24;5:53 Theohari I, Nakopoulou L. WNT1 (wingless-type MMTV integration site family, member 1). Atlas Genet Cytogenet Ayyanan A, Civenni G, Ciarloni L, Morel C, Mueller N, Oncol Haematol. 2014; 18(8):581-583.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 583 Atlas of Genetics and Cytogenetics in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Gene Section Review

EGR1 (Early Growth Response 1) Young Han Lee Department of Biological Sciences, Konkuk University, 120 Neungdong-ro, Gwangjin-gu, Seoul, South Korea (YHL)

Published in Atlas Database: January 2014 Online updated version : http://AtlasGeneticsOncology.org/Genes/EGR1ID496ch5q31.html DOI: 10.4267/2042/54014 This article is an update of : Bandyopadhyay R, Baron V. EGR1 (early growth response 1). Atlas Genet Cytogenet Oncol Haematol 2011;15(2):150-158.

the Ternary Complex Factor, which binds to the Abstract SREs. Review on EGR1, with data on DNA/RNA, on the The promoter also contains several SP1 consensus protein encoded and where the gene is implicated. sequences; a putative AP-1 binding site (not conserved); at least one functional CRE (cAMP Identity regulatory element). EGR1 regulates its own transcription by binding to functional EBS (EGR1 Other names: AT225, G0S30, KROX-24, NGFI- binding sites). A functional NFkB (p65/RelA) A, TIS8, ZIF-268, ZNF225 binding site is contained in the EGR1 promoter that HGNC (Hugo): EGR1 allows NF-kB to increase EGR1 transcription in Location: 5q31.2 response to UV (ultra-violet) irradiation. EGR1 is a target of ETS transcription factors that are involved DNA/RNA in hematopoiesis, angiogenesis and neoplasia. Finally, EGR1 promoter contains two ATF5 Note (activating transcription factor 5) consensus The gene is conserved in chimpanzee, dog, cow, sequences at a conserved promoter position and is mouse, rat, chicken, and zebrafish. induced by ATF5 in cancer cell lines. Description Genomic size 3824 bp; 2 exons; + strand of Protein chromosome 5. Description Transcription The protein contains 543 amino acids. Its predicted mRNA size: 3132, ORF 271-1902 (1632 nt coding molecular weight is 57.5 kDa, however the protein sequence). migrates at an apparent molecular weight of 75-85 Rare occurrence of splice variants (2 variants have kDa in SDS-PAGE. It has a very short half-life of been described in the brain). ~30 minutes to 1 hour. The EGR1 promoter contains five SREs (serum EGR1 contains a highly conserved DNA-binding response elements). Increased transcription in domain composed of three Cys2-His2 type zinc- response to growth factors or stress is most fingers that bind to the prototype target sequence commonly mediated by transcription factors of the GCG(G/T)GGGCG; a nuclear localization signal Elk-1/SAP-1/SAP-2 family, which are activated by that requires amino acids 361-419 (zinc fingers 2 MAP-Kinase family (mitogen activated protein and 3) and amino acids 315-330; two activator kinase). Elk-1 associates with CBP (CREB binding domains; a repressor domain between amino acids protein) and SRF (serum response factor) to form 281-314.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 584 EGR1 (Early Growth Response 1) Lee YH

Figure 1.

EGR1 binds to regulatory proteins called NAB-1 that EGR1 activity is transient, before the protein is (NGFA-I binding protein) and NAB2 through its degraded. It should be noted that deregulated repressor domain. expression of NAB proteins in disease may Post-translational modifications include contribute to alteration of EGR1 function. For phosphorylation, acetylation, ubiquitination and example, elevated expression of NAB2 in sumoylation (figure 1). endothelial cells reduces angiogenesis, whereas loss Expression of NAB2 in prostate cancer contributes to increased EGR1 activity. Ubiquitous. Exhibits a distinct expression pattern in EGR1 has various neurocognitive functions. It is the brain. Constitutive protein expression is low in involved in the regulation of neuronal activity and many tissues. EGR1 expression is very rapidly and may control neuronal plasticity. EGR1 controls strongly induced by growth factors and mitogens, tissue repair, wound healing, liver regeneration, cytokines, environmental and mechanical stresses, atherosclerosis, fibrosis, and other inflammation or as well as DNA damage (hpr). stress-related responses. It is considered a key Localisation master regulator in cardiovascular pathology by Nuclear. Occasional cytoplasmic localization promoting atherosclerosis, intimal thickening observed in cancer cells. following vascular injury, ischemia, allograft rejection and cardiac hypertrophy. Finally, EGR1 Function regulates cell response to hypoxia, promotes the EGR1 is an early response transcription factor with formation of new blood vessels from the pre- DNA binding activity that activates the existing vasculature, and triggers tumor transcription of several hundred genes. Depending angiogenesis. on the cell type and the stimulus, EGR1 induces the In cancer, EGR1 is traditionally considered a tumor expression of growth factors, growth factor suppressor. However, accumulating evidence now receptors, extracellular matrix proteins, proteins indicates that it can act both as a tumor suppressor involved in the regulation of cell growth or and as a tumor promoter, depending on the context. differentiation, and proteins involved in apoptosis, EGR1 protects normal cells from transformation by growth arrest, and stress responses. inducing apoptosis or growth arrest upon DNA EGR1 can compete with transcription factor SP1, damage. A strong evidence for EGR1 pro-apoptotic which is involved in the constitutive expression of function is that EGR1 -/- mouse embryo fibroblasts housekeeping genes and other regulatory genes. are resistant to apoptosis induced by ionizing Because the consensus sequence for SP1 and EGR1 radiation. Although EGR1-deficient mice do not binding overlaps, EGR1 often displaces SP1 from spontaneously develop tumors, they display gene promoters. accelerated tumor growth in a two-step EGR1 transcriptional activity is inhibited by direct carcinogenesis model of skin cancer. As an interaction with the proteins NAB1 and NAB2. example, UV-B radiation of keratinocytes induces Their expression is also inducible, albeit delayed EGR1 expression through activation of NFkB compared to EGR1 induction. NAB1 and NAB2 (p65/RelA), which mediates apoptosis and acts as a impose an early negative feedback and thus ensure protection mechanism against the tumorigenic

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 585 EGR1 (Early Growth Response 1) Lee YH

effect of UV. These observations support the notion mitogens. Alternatively, overexpression of that EGR1 participates in the suppression of DNA phospholipase D in glioma cells attenuates damage-induced tumors. mitogen-induced EGR1 expression through EGR1 is involved in the chemopreventive or activation of PI3-kinase. antiproliferative effect of natural compounds such On the other hand, EGR1 overexpression in some as curcumin, genistein, isoflavone, green tea cancer types directly promotes cancer progression extracts, and others. It also mediates the anti- and tumor growth by increasing the expression and proliferative effects of NSAIDs (non-steroid anti- secretion of growth factors and cytokines, inflammatory drug) and of other chemotherapeutic extracellular matrix proteins (Barbolina et al., 2007; agents such as cisplatin. Shin et al., 2010) and proteases. Egr-1 mediates In many cancer cells, EGR1 is induced by radiation, growth factor-induced downregulation of E- chemotherapeutic drugs, steroids and anti- cadherin by inducing an E-cadherin transcription inflammatory drugs, and is required for the growth repressor, Snail or Slug, which contributes to tumor arrest or apoptotic effect of these treatments. Lack invasion (Grotegut et al., 2006; Cheng et al., 2013). of EGR1 response confers chemoresistance. This Mechanisms that can cause EGR1 overexpression may be exploited by restoring EGR1 expression in tumor cells include p53 mutations (observed in through gene therapy to increase the efficacy of gliomas and prostate cancer). Mutant p53 radiotherapy of chemotherapy. upregulates EGR1 in prostate cancer cells by At later stages of cancer EGR1 tumor suppressor activating ERK (extracellular regulated kinase) function is impaired by the frequent inactivation, in through undefined mechanism. Constitutive human tumors, of two major tumor suppressor activation of the ERK pathway in tumor cells targets of EGR1 (namely PTEN and TP53). In appears to be a consistent cause of EGR1 addition, EGR1 induction by growth factors or expression and is often due to genetic defects stress is blocked in some types of cancer cells affecting upstream regulators of the ERK pathway. ("resistance" to induction). This has been described For example, a mutation of EGFR (epidermal in fibrosarcoma, prostate cancer, colon cancer, and growth factor receptor) commonly found in lung RAS-transformed cells. Several mechanisms are cancer cells causes EGR1 overexpression and involved. For example, RAS-induced activation through activation of the ERK pathway. transformation of fibroblasts results in the aberrant Similarly, a mutation of B-RAF present in a high constitutive activation of PI3-kinase (phosphatidyl percentage of melanoma results in constitutive inositol 3-kinase), which causes degradation of SRF activation of ERK and up-regulation of EGR1. and prevents Elk-1-mediated induction of EGR1. In colon cancer cells, it is the mutational activation of Homology Wnt-1 that prevents the SRF-mediated induction of Three other family members: EGR2, EGR3 and EGR1 and other early genes in response to EGR4 (see figure 2).

Figure 2. Image designed by Melody W Lin.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 586 EGR1 (Early Growth Response 1) Lee YH

Conversely, EGR1 antisense accelerates cell growth Mutations and colony formation. Note EGR1 expression is upregulated in human diffuse Mutations in the EGR1 gene have not been found; large B cell lymphoma because of constitutively altered expression level is the most common active ERK and JNK (Jun N-terminal kinase) contributor to tumorigenesis. pathways and promotes cancer cells survival. Chromosome loss/deletions: Overexpression of EGR1 (both mRNA and protein) - The long arm of chromosome 5 in which EGR1 is is observed in gastric cancer and in prostate cancer. located is consistently deleted in myelodysplastic It is also seen in the "normal" tissue adjacent to the syndrome (MDS) and acute myeloid leukemia tumors, but it is not expressed in the normal tissues (AML). Loss of chromosome 5 or deletion in 5q is from healthy patients. The mRNA expression is the most common karyotypic abnormality in MDS, higher in metastatic cases of gastric cancer. EGR1 occurring in 10% of new MDS/AML patients and is much higher expressed in cervical cancer tissues in 40% of patients with therapy-related MDS or than in the normal cervix. AML. Mice lacking at least one allele of EGR1 Leukemia develop symptoms similar to that of MDS after they Note are exposed to a carcinogen (i.e. mono- or bi-allelic loss of EGR1 accelerates the development of pre- In myeloblastic leukemia, upregulation of oncogene leukemic disorders). E2F-1 blocks the myeloid terminal differentiation - Loss of 5q is consistently associated with estrogen program, resulting in proliferation of immature receptor-negative (ER -) breast carcinoma and is cells in the presence of interleukin-6. EGR1 seen in 86% of breast carcinomas carriers of abrogates the E2F-1-driven block in myeloid BRCA1 (breast cancer 1) and BRCA2 mutations. terminal differentiation, decreases the tumorigenic Fluorescence in situ hybridization confirmed the potential of leukemia cells in vivo and their association of EGR1 loss with ER - breast aggressiveness. EGR1 also abrogates the block in carcinoma; loss of EGR1 correlated with high terminal myeloid differentiation imparted by grade. oncogenic c-myc. - In mouse model with a deletion of chromosome 5, Fibrosarcoma loss of Tp53 activity in cooperation with EGR1 and Note adenomatous polyposis coli (APC) Human fibrosarcoma cells express almost no EGR1 haploinsufficiency, accelerates the development of and are "resistant" to EGR1 induction in response AML (Stoddart et al., 2013). to growth factors or stress. Forced expression of EGR1 inhibits cell growth and suppresses xenograft Implicated in tumor growth in athymic mice. Conversely, Various cancers silencing EGR1 using antisense increases the transformed character of these cells. Note The effect of EGR1 in HT-1080 fibrosarcoma cells EGR1 (protein and/or mRNA) is downregulated in is mediated by increased secretion of active colon cancer, lung cancer, esophageal carcinoma, TGFbeta-1 (transforming growth factor-beta1), a astrocytomas, glioblastomas, breast cancer, direct target of EGR1. TGFbeta-1 strongly inhibits compared to non-cancer tissue. EGR1 expression is cell growth in an autocrine mechanism. Further, sharply decreased in leiomyoma compared to EGR1 regulates cell adhesion and migration normal myometrium (reduction in 100% of through increased secretion of fibronectin and tumors). plasminogen activator inhibitor-1 (PAI-1). Transfection of EGR1 into myometrial cells Although fibronectin is a direct target of EGR1, decreases cell proliferation. PAI-1 increase is mediated by EGR1-induced In some types of cancers EGR1 expression is high TGFbeta-1. in the adjacent tissue of the tumors, but low in the tumor cells. In esophageal carcinoma, EGR1 Lung cancer expression is higher in the dysplastic tissue, Note whereas no expression is detected in the tumor EGR1 (RNA and protein) is expressed at higher tissue. This may reflect the existence of a reactive levels in human normal lung tissue adjacent to non- stroma, and possibly inflammation. small cell lung cancer (NSCLC), and is Early observations indicated that in v-sis- downregulated in the tumor tissue compared with transformed NIH-3T3 cells, transfection of EGR1 normal lung. Also downregulated in human lung inhibits colony formation and growth in soft agar. It adenocarcinomas and lung squamous cell also delays tumorigenicity in nude mice. carcinomas.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 587 EGR1 (Early Growth Response 1) Lee YH

High expression of EGR1 in NSCLC patients Hepatocellular carcinoma (liver correlates with high PTEN expression. Low levels cancer) of EGR1 after surgical resection are associated with poor outcome. Note While one study reports EGR1 overexpression, Brain cancer another one describes the downregulation of EGR1 (astrocytoma/glioblastoma/neuroblas expression in hepatocellular carcinoma. In the latter toma) study, re-expression of EGR1 decreased cell growth Note and tumorigenicity in nude mice. There are arguments in favor of a pro-tumorigenic EGR1 mRNA and protein are strongly suppressed function: HGF (hepatocyte growth factor), a in astrocytomas and glioblastomas compared to cytokine involved in the progression of normal brain. Downregulation correlates with grade hepatocarcinoma, up-regulates EGR1 and increases in human tissue, or with the presence of wild-type cell scattering and migration through EGR1- p53 in cell cultures. mediated up-regulation of snail. HGF also increases Tumors or primary cell lines that exhibit higher angiogenesis through up-regulation of EGR1- EGR1 expression contain p53 mutations. EGR1 mediated VEGF (vascular endothelial growth induces growth arrest of glioma cells mediated by factor) and interleukin 8. Of note, EGR1 is crucial increased secretion of TGF-beta1, PAI-1 and for the proliferation of hepatocytes and plays an fibronectin. EGR1 expression is induced by important role in liver regeneration: liver hypoxia in glioblastoma multiforme and up- regeneration following partial hepatectomy is regulates tissue factor that promotes plasma impaired in EGR1-null mice. clotting. Two EGR1 mRNA variants are detected in Skin cancer/melanoma astrocytomas, one that contains N-methyl-D- Note aspartate-receptor (NMDA-R)-responsive element. EGR1 expression is decreased in basal cell An increase in the expression of this EGR1 variant carcinoma (BCC) and squamous cell carcinoma is seen in astrocytoma cells following NMDA (SCC) but is elevated in psoriasis. EGR1 inhibits stimulation. EGR1 expression is restricted to tumor the growth of benign and malignant epidermal cells cells expressing NMDA-R, is up-regulated in in vitro. astrocytomas compared with normal brain, and is A single topical treatment with the tumor promoter associated with enhanced patient survival. TPA in a multistage carcinogenesis model induces In neuroblastoma cells, re-expression of EGR1 EGR1 mRNA expression both epidermis and induces apoptosis, whereas EGR1 antisense dermis of the mice. Primary papillomas and increases cell viability. The apoptotic activity of the carcinomas generated in these animals contain high EGR1 is mediated by activation of p73 (a member EGR1 mRNA compared with normal epidermis. of the p53 family). EGR1-null mice reveal an accelerated development Breast cancer of skin tumors in the multistage carcinogenesis model compared to EGR1+ mice. Note On the other hand, EGR1 may contribute to cancer Breast cancer cell lines and clinical cancer tissues progression in melanoma. The HGF receptor c-Met exhibit reduced EGR1 expression while normal induces EGR1 activation via the Ras/ERK1/2 mammary tissues express high levels. EGR1 is also pathway in melanoma cells, which in turn induces downregulated in experimentally induced rat fibronectin expression and its extracellular mammary tumors. Downregulation of gelsolin, assembly. Fibronectin promotes migration and which is an indicator of breast cancer, is correlated invasiveness of melanomas and is associated with with suppression of EGR1. metastatic potential. Some studies have shown that re-expression of About 60% of melanoma contain an activating EGR1 inhibits human tumor cell growth and mutation in the B-RAF gene. In these cells, suppresses tumorigenicity in mice. However, two constitutive up-regulation of EGR1 caused by other studies found that EGR1 silencing decreases activation of RAF/ERK signaling results in high breast cancer cell proliferation, migration, and fibronectin levels and increases invasiveness. growth of xenograft tumors in nude mice. In estrogen receptor-positive breast cancer cell Prostate cancer lines, EGR1 expression is induced by estrogen Note through activation of RAF-1 kinase, the MAP- EGR1 mRNA is expressed at higher levels in kinase pathway, and Elk-1/SRF. prostate tumors compared with normal tissues and

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 588 EGR1 (Early Growth Response 1) Lee YH

correlates with Gleason score (a measure of prostate Another study, however, shows overexpression of cancer stage). EGR1 expression in the primary EGR1 in esophageal tumor tissues and constitutive tumor correlates with complete control of the local expression in esophageal cancer cell lines. tumor by radiation, whereas in post-irradiated tissue EGR1 silencing inhibits cell proliferation through EGR1 expression correlates with treatment failure. G2/M cell cycle block. On the other hand, forced NAB2 is down-regulated in clinical primary stable expression of EGR1 into esophageal carcinoma. Thus, upregulation of EGR1 and loss of carcinoma cells also decreases cell proliferation in NAB2 both determine the high level of EGR1 vitro and tumor growth in vivo. activity in human prostate tumors. EGR1 knock-out mice crossed with transgenic Cervical cancer mouse models of prostate cancer show significantly Note impaired tumor growth compared to Egr +/+ mice The melanoma growth stimulatory activity/Growth- and increased survival. Although it does not prevent regulated oncogene α (MGSA/GRO α), which is tumor initiation, EGR1 deficiency delays the designated as a CXC chemokine ligand 1 (CXCL1), progression of prostate carcinoma. EGR1 is also plays an important role in the regulation of overexpressed in the tumors of the transgenic mice, inflammation and the progression of tumor whereas NAB2 expression is decreased. development through stimulation of angiogenesis Silencing of EGR1 in prostate cancer cells and metastasis. EGR1 mediates ERK and JNK decreases cell proliferation in vitro, and injection of MAPKs-dependent GRO α transcription in response EGR1 antisense in vivo delays the occurrence of to TNF α stimulation in HeLa cervix cancer cells prostate cancer. Alternatively, forced expression of (Shin et al., 2013). EGR1 in non-cancer cells increases proliferation in vitro. References EGR1 up-regulation in prostate cell lines is due to Lim RW, Varnum BC, Herschman HR. Cloning of mutation of the TP53 gene. EGR1 is also up- tetradecanoyl phorbol ester-induced 'primary response' regulated by SV40-T antigen, a viral oncogene that sequences and their expression in density-arrested Swiss is used very often to immortalize non-transformed 3T3 cells and a TPA non-proliferative variant. Oncogene. cells. In human prostate cancer cells EGR1 1987;1(3):263-70 stimulates the production of many growth factors Milbrandt J. A nerve growth factor-induced gene encodes and cytokines that are involved in the progression a possible transcriptional regulatory factor. Science. 1987 Nov 6;238(4828):797-9 of prostate cancer and of proteins involved in metastasis. Christy BA, Lau LF, Nathans D. A gene activated in mouse A crosstalk between EGR1 and the androgen 3T3 cells by serum growth factors encodes a protein with "zinc finger" sequences. Proc Natl Acad Sci U S A. 1988 receptor (AR) may explain the particular role of Nov;85(21):7857-61 EGR1 in prostate cancer. EGR1 physically interacts Lemaire P, Revelant O, Bravo R, Charnay P. Two mouse with AR in hormone-sensitive prostate cancer cells genes encoding potential transcription factors with identical and the complex binds to the promoter of DNA-binding domains are activated by growth factors in endogenous targets of AR. Forcing EGR1 activity cultured cells. Proc Natl Acad Sci U S A. 1988 in hormone-sensitive cancer cells increases Jul;85(13):4691-5 proliferation in vitro. It enhances tumor growth in Sukhatme VP, Cao XM, Chang LC, Tsai-Morris CH, mice upon castration (which mimics hormone Stamenkovich D, Ferreira PC, Cohen DR, Edwards SA, therapy in human patients): EGR1 may be involved Shows TB, Curran T. A zinc finger-encoding gene coregulated with c-fos during growth and differentiation, in the acquisition of resistance to hormone therapy. and after cellular depolarization. Cell. 1988 Apr 8;53(1):37- Esophageal carcinoma 43 Note Gashler AL, Swaminathan S, Sukhatme VP. A novel repression module, an extensive activation domain, and a According to some reports, the expression of EGR1 bipartite nuclear localization signal defined in the (mRNA and protein) is high in pre-cancerous immediate-early transcription factor Egr-1. Mol Cell Biol. human lesions of the esophagus and in dysplastic 1993 Aug;13(8):4556-71 tissue adjacent to esophageal carcinoma, but is very Le Beau MM, Espinosa R 3rd, Neuman WL, Stock W, low in cancer tissue. The number of apoptotic cells Roulston D, Larson RA, Keinanen M, Westbrook CA. in EGR1-positive tumors is higher than in EGR1 Cytogenetic and molecular delineation of the smallest commonly deleted region of chromosome 5 in malignant negative tumors, suggesting that EGR1 promotes myeloid diseases. Proc Natl Acad Sci U S A. 1993 Jun apoptosis. In addition, EGR1 is up-regulated in the 15;90(12):5484-8 tumors of patients treated by irradiation compared Huang RP, Darland T, Okamura D, Mercola D, Adamson to the tumor tissue of non-irradiated patients, and ED. Suppression of v-sis-dependent transformation by the EGR1 expression level seems to correlate with transcription factor, Egr-1. Oncogene. 1994 better prognosis. May;9(5):1367-77

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 589 EGR1 (Early Growth Response 1) Lee YH

Huang RP, Liu C, Fan Y, Mercola D, Adamson ED. Egr-1 D. The transcription factor EGR-1 suppresses negatively regulates human tumor cell growth via the DNA- transformation of human fibrosarcoma HT1080 cells by binding domain. Cancer Res. 1995 Nov 1;55(21):5054-62 coordinated induction of transforming growth factor-beta1, fibronectin, and plasminogen activator inhibitor-1. J Biol Levin WJ, Press MF, Gaynor RB, Sukhatme VP, Boone Chem. 1999 Feb 12;274(7):4400-11 TC, Reissmann PT, Figlin RA, Holmes EC, Souza LM, Slamon DJ. Expression patterns of immediate early Okumura K, Shirasawa S, Nishioka M, Sasazuki T. transcription factors in human non-small cell lung cancer. Activated Ki-Ras suppresses 12-O-tetradecanoylphorbol- The Lung Cancer Study Group. Oncogene. 1995 Oct 13-acetate-induced activation of the c-Jun NH2-terminal 5;11(7):1261-9 kinase pathway in human colon cancer cells. Cancer Res. 1999 May 15;59(10):2445-50 Muthukkumar S, Nair P, Sells SF, Maddiwar NG, Jacob RJ, Rangnekar VM. Role of EGR-1 in thapsigargin- Horrigan SK, Arbieva ZH, Xie HY, Kravarusic J, Fulton NC, inducible apoptosis in the melanoma cell line A375-C6. Naik H, Le TT, Westbrook CA. Delineation of a minimal Mol Cell Biol. 1995 Nov;15(11):6262-72 interval and identification of 9 candidates for a tumor suppressor gene in malignant myeloid disorders on 5q31. Russo MW, Sevetson BR, Milbrandt J. Identification of Blood. 2000 Apr 1;95(7):2372-7 NAB1, a repressor of NGFI-A- and Krox20-mediated transcription. Proc Natl Acad Sci U S A. 1995 Jul Liu C, Yao J, Mercola D, Adamson E. The transcription 18;92(15):6873-7 factor EGR-1 directly transactivates the fibronectin gene and enhances attachment of human glioblastoma cell line Sells SF, Muthukumar S, Sukhatme VP, Crist SA, U251. J Biol Chem. 2000 Jul 7;275(27):20315-23 Rangnekar VM. The zinc finger transcription factor EGR-1 impedes interleukin-1-inducible tumor growth arrest. Mol Riggs PK, Rho O, DiGiovanni J. Alteration of Egr-1 mRNA Cell Biol. 1995 Feb;15(2):682-92 during multistage carcinogenesis in mouse skin. Mol Carcinog. 2000 Apr;27(4):247-51 Ahmed MM, Venkatasubbarao K, Fruitwala SM, Muthukkumar S, Wood DP Jr, Sells SF, Mohiuddin M, Svaren J, Ehrig T, Abdulkadir SA, Ehrengruber MU, Rangnekar VM. EGR-1 induction is required for maximal Watson MA, Milbrandt J. EGR1 target genes in prostate radiosensitivity in A375-C6 melanoma cells. J Biol Chem. carcinoma cells identified by microarray analysis. J Biol 1996 Nov 15;271(46):29231-7 Chem. 2000 Dec 8;275(49):38524-31 Liu C, Adamson E, Mercola D. Transcription factor EGR-1 Abdulkadir SA, Carbone JM, Naughton CK, Humphrey PA, suppresses the growth and transformation of human HT- Catalona WJ, Milbrandt J. Frequent and early loss of the 1080 fibrosarcoma cells by induction of transforming EGR1 corepressor NAB2 in human prostate carcinoma. growth factor beta 1. Proc Natl Acad Sci U S A. 1996 Oct Hum Pathol. 2001a Sep;32(9):935-9 15;93(21):11831-6 Abdulkadir SA, Qu Z, Garabedian E, Song SK, Peters TJ, Svaren J, Sevetson BR, Apel ED, Zimonjic DB, Popescu Svaren J, Carbone JM, Naughton CK, Catalona WJ, NC, Milbrandt J. NAB2, a corepressor of NGFI-A (Egr-1) Ackerman JJ, Gordon JI, Humphrey PA, Milbrandt J. and Krox20, is induced by proliferative and differentiative Impaired prostate tumorigenesis in Egr1-deficient mice. stimuli. Mol Cell Biol. 1996 Jul;16(7):3545-53 Nat Med. 2001b Jan;7(1):101-7 Thigpen AE, Cala KM, Guileyardo JM, Molberg KH, Ahmed MM, Chendil D, Lele S, Venkatasubbarao K, Dey McConnell JD, Russell DW. Increased expression of early S, Ritter M, Rowland RG, Mohiuddin M. Early growth growth response-1 messenger ribonucleic acid in prostatic response-1 gene: potential radiation response gene adenocarcinoma. J Urol. 1996 Mar;155(3):975-81 marker in prostate cancer. Am J Clin Oncol. 2001 Oct;24(5):500-5 Huang RP, Fan Y, de Belle I, Niemeyer C, Gottardis MM, Mercola D, Adamson ED. Decreased Egr-1 expression in Calogero A, Arcella A, De Gregorio G, Porcellini A, human, mouse and rat mammary cells and tissues Mercola D, Liu C, Lombari V, Zani M, Giannini G, Gagliardi correlates with tumor formation. Int J Cancer. 1997a Jul FM, Caruso R, Gulino A, Frati L, Ragona G. The early 3;72(1):102-9 growth response gene EGR-1 behaves as a suppressor gene that is down-regulated independent of ARF/Mdm2 Huang RP, Fan Y, Ni Z, Mercola D, Adamson ED. but not p53 alterations in fresh human gliomas. Clin Reciprocal modulation between Sp1 and Egr-1. J Cell Cancer Res. 2001 Sep;7(9):2788-96 Biochem. 1997b Sep 15;66(4):489-99 Das A, Chendil D, Dey S, Mohiuddin M, Mohiuddin M, Nair P, Muthukkumar S, Sells SF, Han SS, Sukhatme VP, Milbrandt J, Rangnekar VM, Ahmed MM. Ionizing radiation Rangnekar VM. Early growth response-1-dependent down-regulates p53 protein in primary Egr-1-/- mouse apoptosis is mediated by p53. J Biol Chem. 1997 Aug embryonic fibroblast cells causing enhanced resistance to 8;272(32):20131-8 apoptosis. J Biol Chem. 2001 Feb 2;276(5):3279-86 Robinson L, Panayiotakis A, Papas TS, Kola I, Seth A. Virolle T, Adamson ED, Baron V, Birle D, Mercola D, ETS target genes: identification of egr1 as a target by RNA Mustelin T, de Belle I. The Egr-1 transcription factor differential display and whole genome PCR techniques. directly activates PTEN during irradiation-induced Proc Natl Acad Sci U S A. 1997 Jul 8;94(14):7170-5 signalling. Nat Cell Biol. 2001 Dec;3(12):1124-8 Eid MA, Kumar MV, Iczkowski KA, Bostwick DG, Tindall Wu MY, Chen MH, Liang YR, Meng GZ, Yang HX, Zhuang DJ. Expression of early growth response genes in human CX. Experimental and clinicopathologic study on the prostate cancer. Cancer Res. 1998 Jun 1;58(11):2461-8 relationship between transcription factor Egr-1 and Pratt MA, Satkunaratnam A, Novosad DM. Estrogen esophageal carcinoma. World J Gastroenterol. 2001 activates raf-1 kinase and induces expression of Egr-1 in Aug;7(4):490-5 MCF-7 breast cancer cells. Mol Cell Biochem. 1998 Bae MH, Jeong CH, Kim SH, Bae MK, Jeong JW, Ahn MY, Dec;189(1-2):119-25 Bae SK, Kim ND, Kim CW, Kim KR, Kim KW. Regulation Liu C, Yao J, de Belle I, Huang RP, Adamson E, Mercola of Egr-1 by association with the proteasome component

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 590 EGR1 (Early Growth Response 1) Lee YH

C8. Biochim Biophys Acta. 2002 Oct 21;1592(2):163-7 Virolle T, Krones-Herzig A, Baron V, De Gregorio G, Adamson ED, Mercola D. Egr1 promotes growth and Hao MW, Liang YR, Liu YF, Liu L, Wu MY, Yang HX. survival of prostate cancer cells. Identification of novel Transcription factor EGR-1 inhibits growth of Egr1 target genes. J Biol Chem. 2003 Apr hepatocellular carcinoma and esophageal carcinoma cell 4;278(14):11802-10 lines. World J Gastroenterol. 2002 Apr;8(2):203-7 Yang SZ, Abdulkadir SA. Early growth response gene 1 Kobayashi D, Yamada M, Kamagata C, Kaneko R, Tsuji N, modulates androgen receptor signaling in prostate Nakamura M, Yagihashi A, Watanabe N. Overexpression carcinoma cells. J Biol Chem. 2003 Oct 10;278(41):39906- of early growth response-1 as a metastasis-regulatory 11 factor in gastric cancer. Anticancer Res. 2002 Nov- Dec;22(6C):3963-70 Calogero A, Lombari V, De Gregorio G, Porcellini A, Ucci S, Arcella A, Caruso R, Gagliardi FM, Gulino A, Lanzetta McDoniels-Silvers AL, Nimri CF, Stoner GD, Lubet RA, G, Frati L, Mercola D, Ragona G. Inhibition of cell growth You M. Differential gene expression in human lung by EGR-1 in human primary cultures from malignant adenocarcinomas and squamous cell carcinomas. Clin glioma. Cancer Cell Int. 2004 Jan 7;4(1):1 Cancer Res. 2002 Apr;8(4):1127-38 Chen CC, Lee WR, Safe S. Egr-1 is activated by 17beta- Pambuccian CA, Oprea GM, Lakatua DJ. Reduced estradiol in MCF-7 cells by mitogen-activated protein expression of early growth response-1 gene in leiomyoma kinase-dependent phosphorylation of ELK-1. J Cell as identified by mRNA differential display. Gynecol Oncol. Biochem. 2004 Nov 15;93(5):1063-74 2002 Mar;84(3):431-6 Knapska E, Kaczmarek L. A gene for neuronal plasticity in Tice DA, Soloviev I, Polakis P. Activation of the Wnt the mammalian brain: Zif268/Egr-1/NGFI-A/Krox- pathway interferes with serum response element-driven 24/TIS8/ZENK? Prog Neurobiol. 2004 Nov;74(4):183-211 transcription of immediate early genes. J Biol Chem. 2002 Feb 22;277(8):6118-23 Liao Y, Shikapwashya ON, Shteyer E, Dieckgraefe BK, Hruz PW, Rudnick DA. Delayed hepatocellular mitotic Wu MY, Liang YR, Wu XY, Zhuang CX. Relationship progression and impaired liver regeneration in early growth between Egr-1 gene expression and apoptosis in response-1-deficient mice. J Biol Chem. 2004 Oct esophageal carcinoma and precancerous lesions. World J 8;279(41):43107-16 Gastroenterol. 2002 Dec;8(6):971-5 Mitchell A, Dass CR, Sun LQ, Khachigian LM. Inhibition of Baron V, De Gregorio G, Krones-Herzig A, Virolle T, human breast carcinoma proliferation, migration, Calogero A, Urcis R, Mercola D. Inhibition of Egr-1 chemoinvasion and solid tumour growth by DNAzymes expression reverses transformation of prostate cancer targeting the zinc finger transcription factor EGR-1. Nucleic cells in vitro and in vivo. Oncogene. 2003a Jul Acids Res. 2004;32(10):3065-9 3;22(27):4194-204 Shin SY, Kim CG, Hong DD, Kim JH, Lee YH. Implication Baron V, Duss S, Rhim J, Mercola D. Antisense to the of Egr-1 in trifluoperazine-induced growth inhibition in early growth response-1 gene (Egr-1) inhibits prostate human U87MG glioma cells. Exp Mol Med. 2004 Aug tumor development in TRAMP mice. Ann N Y Acad Sci. 31;36(4):380-6 2003b Dec;1002:197-216 Shozu M, Murakami K, Segawa T, Kasai T, Ishikawa H, Davis S, Bozon B, Laroche S. How necessary is the Shinohara K, Okada M, Inoue M. Decreased expression of activation of the immediate early gene zif268 in synaptic early growth response-1 and its role in uterine leiomyoma plasticity and learning? Behav Brain Res. 2003 Jun growth. Cancer Res. 2004 Jul 1;64(13):4677-84 16;142(1-2):17-30 Wu MY, Zhuang CX, Yang HX, Liang YR. Expression of Fahmy RG, Dass CR, Sun LQ, Chesterman CN, Egr-1, c-fos and cyclin D1 in esophageal cancer and its Khachigian LM. Transcription factor Egr-1 supports FGF- precursors: An immunohistochemical and in situ dependent angiogenesis during neovascularization and hybridization study. World J Gastroenterol. 2004 Feb tumor growth. Nat Med. 2003 Aug;9(8):1026-32 15;10(4):476-80 Krones-Herzig A, Adamson E, Mercola D. Early growth Yu J, de Belle I, Liang H, Adamson ED. Coactivating response 1 protein, an upstream gatekeeper of the p53 factors p300 and CBP are transcriptionally crossregulated tumor suppressor, controls replicative senescence. Proc by Egr1 in prostate cells, leading to divergent responses. Natl Acad Sci U S A. 2003 Mar 18;100(6):3233-8 Mol Cell. 2004 Jul 2;15(1):83-94 Lucerna M, Mechtcheriakova D, Kadl A, Schabbauer G, Ferraro B, Bepler G, Sharma S, Cantor A, Haura EB. Schäfer R, Gruber F, Koshelnick Y, Müller HD, Issbrücker EGR1 predicts PTEN and survival in patients with non- K, Clauss M, Binder BR, Hofer E. NAB2, a corepressor of small-cell lung cancer. J Clin Oncol. 2005 Mar EGR-1, inhibits vascular endothelial growth factor- 20;23(9):1921-6 mediated gene induction and angiogenic responses of endothelial cells. J Biol Chem. 2003 Mar Gaggioli C, Deckert M, Robert G, Abbe P, Batoz M, 28;278(13):11433-40 Ehrengruber MU, Ortonne JP, Ballotti R, Tartare-Deckert S. HGF induces fibronectin matrix synthesis in melanoma Pignatelli M, Luna-Medina R, Pérez-Rendón A, Santos A, cells through MAP kinase-dependent signaling pathway Perez-Castillo A. The transcription factor early growth and induction of Egr-1. Oncogene. 2005 Feb response factor-1 (EGR-1) promotes apoptosis of 17;24(8):1423-33 neuroblastoma cells. Biochem J. 2003 Aug 1;373(Pt 3):739-46 Krones-Herzig A, Mittal S, Yule K, Liang H, English C, Urcis R, Soni T, Adamson ED, Mercola D. Early growth Recio JA, Merlino G. Hepatocyte growth factor/scatter response 1 acts as a tumor suppressor in vivo and in vitro factor induces feedback up-regulation of CD44v6 in via regulation of p53. Cancer Res. 2005 Jun melanoma cells through Egr-1. Cancer Res. 2003 Apr 15;65(12):5133-43 1;63(7):1576-82

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 591 EGR1 (Early Growth Response 1) Lee YH

Ronski K, Sanders M, Burleson JA, Moyo V, Benn P, Fang R, Tartare-Deckert S. Tumor-derived fibronectin is involved M. Early growth response gene 1 (EGR1) is deleted in in melanoma cell invasion and regulated by V600E B-Raf estrogen receptor-negative human breast carcinoma. signaling pathway. J Invest Dermatol. 2007 Cancer. 2005 Sep 1;104(5):925-30 Feb;127(2):400-10 Thyss R, Virolle V, Imbert V, Peyron JF, Aberdam D, Joslin JM, Fernald AA, Tennant TR, Davis EM, Kogan SC, Virolle T. NF-kappaB/Egr-1/Gadd45 are sequentially Anastasi J, Crispino JD, Le Beau MM. Haploinsufficiency activated upon UVB irradiation to mediate epidermal cell of EGR1, a candidate gene in the del(5q), leads to the death. EMBO J. 2005 Jan 12;24(1):128-37 development of myeloid disorders. Blood. 2007 Jul 15;110(2):719-26 Baron V, Adamson ED, Calogero A, Ragona G, Mercola D. The transcription factor Egr1 is a direct regulator of Liu J, Liu YG, Huang R, Yao C, Li S, Yang W, Yang D, multiple tumor suppressors including TGFbeta1, PTEN, Huang RP. Concurrent down-regulation of Egr-1 and p53, and fibronectin. Cancer Gene Ther. 2006 gelsolin in the majority of human breast cancer cells. Feb;13(2):115-24 Cancer Genomics Proteomics. 2007 Nov-Dec;4(6):377-85 Grotegut S, von Schweinitz D, Christofori G, Lehembre F. Yu J, Baron V, Mercola D, Mustelin T, Adamson ED. A Hepatocyte growth factor induces cell scattering through network of p73, p53 and Egr1 is required for efficient MAPK/Egr-1-mediated upregulation of Snail. EMBO J. apoptosis in tumor cells. Cell Death Differ. 2007 2006 Aug 9;25(15):3534-45 Mar;14(3):436-46 Ke J, Gururajan M, Kumar A, Simmons A, Turcios L, Akutagawa O, Nishi H, Kyo S, Terauchi F, Yamazawa K, Chelvarajan RL, Cohen DM, Wiest DL, Monroe JG, Higuma C, Inoue M, Isaka K. Early growth response-1 Bondada S. The role of MAPKs in B cell receptor-induced mediates downregulation of telomerase in cervical cancer. down-regulation of Egr-1 in immature B lymphoma cells. J Cancer Sci. 2008 Jul;99(7):1401-6 Biol Chem. 2006 Dec 29;281(52):39806-18 An J, Guo RF, Zhang L, Geng PL, Lü YY. [Alteration of Khachigian LM. Early growth response-1 in cardiovascular early growth response 1 expression in gastroenterological pathobiology. Circ Res. 2006 Feb 3;98(2):186-91 cancers and its biological significance]. Zhonghua Yi Xue Za Zhi. 2008 May 27;88(20):1384-9 Rong Y, Hu F, Huang R, Mackman N, Horowitz JM, Jensen RL, Durden DL, Van Meir EG, Brat DJ. Early Arora S, Wang Y, Jia Z, Vardar-Sengul S, Munawar A, growth response gene-1 regulates hypoxia-induced Doctor KS, Birrer M, McClelland M, Adamson E, Mercola expression of tissue factor in glioblastoma multiforme D. Egr1 regulates the coordinated expression of numerous through hypoxia-inducible factor-1-independent EGF receptor target genes as identified by ChIP-on-chip. mechanisms. Cancer Res. 2006 Jul 15;66(14):7067-74 Genome Biol. 2008;9(11):R166 Sato H, Yazawa T, Suzuki T, Shimoyamada H, Okudela K, Choi BH, Kim CG, Bae YS, Lim Y, Lee YH, Shin SY. p21 Ikeda M, Hamada K, Yamada-Okabe H, Yao M, Kubota Y, Waf1/Cip1 expression by curcumin in U-87MG human Takahashi T, Kamma H, Kitamura H. Growth regulation via glioma cells: role of early growth response-1 expression. insulin-like growth factor binding protein-4 and -2 in Cancer Res. 2008 Mar 1;68(5):1369-77 association with mutant K-ras in lung epithelia. Am J Pathol. 2006 Nov;169(5):1550-66 Gibbs JD, Liebermann DA, Hoffman B. Egr-1 abrogates the E2F-1 block in terminal myeloid differentiation and Shin SY, Bahk YY, Ko J, Chung IY, Lee YS, Downward J, suppresses leukemia. Oncogene. 2008 Jan 3;27(1):98-106 Eibel H, Sharma PM, Olefsky JM, Kim YH, Lee B, Lee YH. Suppression of Egr-1 transcription through targeting of the Lu S, Becker KA, Hagen MJ, Yan H, Roberts AL, Mathews serum response factor by oncogenic H-Ras. EMBO J. LA, Schneider SS, Siegelmann HT, MacBeth KJ, Tirrell 2006 Mar 8;25(5):1093-103 SM, Blanchard JL, Jerry DJ. Transcriptional responses to estrogen and progesterone in mammary gland identify Wu MY, Wu XY, Li QS, Zheng RM. Expression of Egr-1 networks regulating p53 activity. Endocrinology. 2008 gene and its correlation with the oncogene proteins in non- Oct;149(10):4809-20 irradiated and irradiated esophageal squamous cell carcinoma. Dis Esophagus. 2006;19(4):267-72 Eisenmann KM, Dykema KJ, Matheson SF, Kent NF, DeWard AD, West RA, Tibes R, Furge KA, Alberts AS. 5q- Yang SZ, Eltoum IA, Abdulkadir SA. Enhanced EGR1 myelodysplastic syndromes: chromosome 5q genes direct activity promotes the growth of prostate cancer cells in an a tumor-suppression network sensing actin dynamics. androgen-depleted environment. J Cell Biochem. 2006 Apr Oncogene. 2009 Oct 1;28(39):3429-41 15;97(6):1292-9 Gitenay D, Baron VT. Is EGR1 a potential target for Ahn BH, Park MH, Lee YH, Min do S. Phorbol myristate prostate cancer therapy? Future Oncol. 2009 acetate-induced Egr-1 expression is suppressed by Sep;5(7):993-1003 phospholipase D isozymes in human glioma cells. FEBS Lett. 2007 Dec 22;581(30):5940-4 Hoffman MW, Janney S, Batanian JR. Cryptic deletion of EGR1 in association with a novel balanced Barbolina MV, Adley BP, Ariztia EV, Liu Y, Stack MS. t(5;22)(q31;q11.2) in a patient with myelodysplastic Microenvironmental regulation of membrane type 1 matrix syndrome. Cancer Genet Cytogenet. 2009 Jun;191(2):106- metalloproteinase activity in ovarian carcinoma cells via 8 collagen-induced EGR1 expression. J Biol Chem. 2007 Feb 16;282(7):4924-31 Lee KH, Kim JR. Hepatocyte growth factor induced up- regulations of VEGF through Egr-1 in hepatocellular Fang M, Wee SA, Ronski K, Fan H, Tao S, Lin Q. carcinoma cells. Clin Exp Metastasis. 2009;26(7):685-92 Evidence of EGR1 as a differentially expressed gene among proliferative skin diseases. Genomic Med. Li G, Li W, Angelastro JM, Greene LA, Liu DX. 2007;1(1-2):75-85 Identification of a novel DNA binding site and a transcriptional target for activating transcription factor 5 in Gaggioli C, Robert G, Bertolotto C, Bailet O, Abbe P, c6 glioma and mcf-7 breast cancer cells. Mol Cancer Res. Spadafora A, Bahadoran P, Ortonne JP, Baron V, Ballotti 2009 Jun;7(6):933-43

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 592 EGR1 (Early Growth Response 1) Lee YH

Maegawa M, Arao T, Yokote H, Matsumoto K, Kudo K, cancer cell lines. Oncol Rep. 2010 Apr;23(4):1159-65 Tanaka K, Kaneda H, Fujita Y, Ito F, Nishio K. EGFR mutation up-regulates EGR1 expression through the ERK Sauer L, Gitenay D, Vo C, Baron VT. Mutant p53 initiates a pathway. Anticancer Res. 2009 Apr;29(4):1111-7 feedback loop that involves Egr-1/EGF receptor/ERK in prostate cancer cells. Oncogene. 2010 May 6;29(18):2628- Mittelbronn M, Harter P, Warth A, Lupescu A, Schilbach K, 37 Vollmann H, Capper D, Goeppert B, Frei K, Bertalanffy H, Weller M, Meyermann R, Lang F, Simon P. EGR-1 is Shin SY, Kim JH, Baker A, Lim Y, Lee YH. Transcription regulated by N-methyl-D-aspartate-receptor stimulation factor Egr-1 is essential for maximal matrix and associated with patient survival in human high grade metalloproteinase-9 transcription by tumor necrosis factor astrocytomas. Brain Pathol. 2009 Apr;19(2):195-204 alpha. Mol Cancer Res. 2010 Apr;8(4):507-19 Wang B, Khachigian LM, Esau L, Birrer MJ, Zhao X, Cheng JC, Chang HM, Leung PC. Egr-1 mediates Parker MI, Hendricks DT. A key role for early growth epidermal growth factor-induced downregulation of E- response-1 and nuclear factor-kappaB in mediating and cadherin expression via Slug in human ovarian cancer maintaining GRO/CXCR2 proliferative signaling in cells. Oncogene. 2013 Feb 21;32(8):1041-9 esophageal cancer. Mol Cancer Res. 2009 May;7(5):755- Shin SY, Lee JM, Lim Y, Lee YH. Transcriptional 64 regulation of the growth-regulated oncogene α gene by Yu J, Zhang SS, Saito K, Williams S, Arimura Y, Ma Y, Ke early growth response protein-1 in response to tumor Y, Baron V, Mercola D, Feng GS, Adamson E, Mustelin T. necrosis factor α stimulation. Biochim Biophys Acta. 2013 PTEN regulation by Akt-EGR1-ARF-PTEN axis. EMBO J. Oct;1829(10):1066-74 2009 Jan 7;28(1):21-33 Stoddart A, Fernald AA, Wang J, Davis EM, Karrison T, Zagurovskaya M, Shareef MM, Das A, Reeves A, Gupta S, Anastasi J, Le Beau MM. Haploinsufficiency of del(5q) Sudol M, Bedford MT, Prichard J, Mohiuddin M, Ahmed genes, Egr1 and Apc, cooperate with Tp53 loss to induce MM. EGR-1 forms a complex with YAP-1 and upregulates acute myeloid leukemia in mice. Blood. 2014 Feb Bax expression in irradiated prostate carcinoma cells. 13;123(7):1069-78 Oncogene. 2009 Feb 26;28(8):1121-31 This article should be referenced as such: Parra E, Ferreira J. The effect of siRNA-Egr-1 and camptothecin on growth and chemosensitivity of breast Lee YH. EGR1 (Early Growth Response 1). Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8):584-593.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 593 Atlas of Genetics and Cytogenetics in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Gene Section Review

HDAC2 (histone deacetylase 2) Hyun Jin Bae, Suk Woo Nam Department of Pathology, College of Medicine and Functional RNomics Research Center, The Catholic University of Korea, Banpo-dong, Seocho-gu, Seoul, Korea (HJB, SWN)

Published in Atlas Database: January 2014 Online updated version : http://AtlasGeneticsOncology.org/Genes/HDAC2ID40803ch6q22.html DOI: 10.4267/2042/54015 This article is an update of : Ropero S, Esteller M. HDAC2 (histone deacetylase 2). Atlas Genet Cytogenet Oncol Haematol 2010;14(10): 966-969.

Abstract Pseudogene No pseudogene has been described. Review on HDAC2, with data on DNA/RNA, on the protein encoded and where the gene is Protein implicated. Description Identity There are two proteins variants of 488 and 582 aa due to distinct pre-mRNA splicing events. Other names: EC 3.5.1.98, HD2, RPD3, YAF1 The N-terminal tail of the protein contains the HGNC (Hugo): HDAC2 catalytic domain that comprises most of the protein. Location: 6q21 The N-terminal domain also has a HDAC association domain (HAD) essential for homo- and DNA/RNA heterodimerization. A coiled-coil domain essential for protein-protein Description interactions is present at the C-terminal tail. It also The HDAC2 gene is composed of 14 exons that contains three phosphorylation sites at Ser394, span 35.029 bp of genomic DNA. Ser422 and Ser424, and two S-nitrosylation sites at Cys262 and Cys274. Transcription Expression The length of the transcribed mRNA is about 6659 bp. Widely expressed.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 594 HDAC2 (histone deacetylase 2) Bae HJ, Nam SW

Localisation HDAC2 is also a key regulator of nervous system function acting as a repressor of synaptic plasticity Nucleus. genes that regulates learning and memory Function formation. HDAC2-deficient mouse have enhanced HDAC2 belongs to class I histone deacetylases that memory formation. also comprise HDAC1, HDAC3 and HDAC8. Homology HDAC2 acts as a transcriptional repressor through the desacetylation of lysine residues present at the The histone deacetylase domain of HDAC2 is N-terminal tail of histone proteins (H2A, H2B, H3 highly homologous to other class I HDACs and H4). HDAC2 heterodimerise with HDAC1, but (HDAC1, HDAC3 and HDAC8) showing the the heterodimer cannot bind to DNA, so they have greater homology with HDAC1. This domain is to be recruited by transcription factors such as also highly conserved between species (from yeast YY1, SP1/SP3, the tumor suppressor genes p53 and to human). BRCA1. HDAC2 can also be tethered to DNA as a part of the multiprotein corepressor complexes Mutations CoREST, mSin3 and NuRD. These complexes are Germinal targeted to specific genomic sequences by interactions with sequence-specific transcription No germinal mutations have been found. factors. For example, the HDAC2/HDAC1 Somatic containing Sin3-SAP corepressor complex is recruited by E2F family of transcription factors to HDAC2 is mutated in sporadic tumors with repress transcription. HDAC2 containing microsatellite instability and in tumors arising in complexes are also implicated in gene transcription- individuals with hereditary non-polyposis colorectal regulation mediated by nuclear receptors. These carcinoma. This mutation consists in a deletion of a complexes also contain other epigenetic modifier nine adenines repeat present in Exon1 that produce genes, such as methyl-binding proteins (MeCp2), a truncated and inactive form of the protein. The the DNA methyl transferases DNMT1, DNMT3A expression of the mutant form of HDAC2 induces and DNMT3B, the histone methyl transferases resistance to the proapoptotic and antiproliferative SUVAR39H1 and G9a and histone demethylases effects of HDAC inhibitors. The lack of HDAC2 (LSD1), providing another way by which HDAC2 expression and function produces the up-regulation regulates gene expression and chromatin of tumor-growth promoting genes. remodelling. HDAC2 also regulates gene expression through the Implicated in deacetylation of specific transcription factors that includes STAT3 and SMAD7. Various cancers HDAC2 is a key regulator of genes regulating cell Note cycle, apoptosis, cell adhesion and migration. The deregulation of HDAC2 expression and Together with HDAC1, HDAC2 regulates the activity has been linked to cancer development. transcription of genes implicated in haematopoiesis, HDAC2 is overexpressed in different tumor types epithelial cell differentiation, heart development including colon, gastric, cervical, prostate and neurogenesis. Montgomery et al. (2007) find carcinoma, non-small cell lung cancer, and that HDAC2 and HDAC1 double-null mice show hepatocellular carcinoma. HDAC2 overexpression an uncontrolled ventricular proliferation, while is implicated in cancer partly through its aberrant Trivedi and collegues (2007) show the lack of recruitment and consequent silencing of tumor cardiac hypertrophy in HDAC2 mutant mice. suppressor genes. The repression of the tumor

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 595 HDAC2 (histone deacetylase 2) Bae HJ, Nam SW

suppressor gene WAF1 ID: 139> is associated with Consequently, HDAC2 inhibition led to the down- histone hypoacetylation at the promoter region and regulation of E2F/DP1 target genes through a can be reversed by the treatment with HDAC reduction in phosphorylation status of pRb protein. inhibitors. Gastric cancer Prognosis Note HDAC2 expression is correlated with poor HDAC2 is aberrantly up-regulated in gastric prognosis and advanced stage disease in colorectal, cancers. prostate, gastric and hepatocellular carcinomas. HDAC2 inactivation significantly reduced cell Colon cancer motility, cell invasion, clonal expansion, and tumor growth. HDAC2 knockdown-induced G(1)-S cell Note (INK4a) There are a number of studies showing HDAC2 cycle arrest and restored activity of p16 and overexpression in colon cancer. the proapoptotic factors. The increase of HDAC2 expression has been found Lung cancer at the protein and mRNA level indicating that Note HDAC2 overexpression is due to transcriptional HDAC2 is highly up-regulated in lung cancer. activation. HDAC2 inactivation resulted in regression of tumor These studies indicate that in this tumor type cell growth and activation of cellular apoptosis via HDAC2 transcription is regulated by beta-catenin- p53 and Bax activation and Bcl2 suppression. TCF-myc signaling pathway that is deregulated in In cell cycle regulation, HDAC2 inactivation colon cancer. caused induction of p21 WAF1/CIP1 expression, and HDAC2 overexpression is correlated with poor simultaneously suppressed the expressions of cyclin prognosis and advanced stage disease in colorectal E2, cyclin D1, and CDK2, respectively. carcinoma. Consequently, this led to the hypophosphorylation However, Ropero et al., found an inactivating of pRb protein in G1/S transition and thereby mutation of HDAC2 in colon cancers with inactivated E2F/DP1 target gene transcriptions of microsatellite instability. A549 cells. HDAC2 directly regulated p21 WAF1/CIP1 Breast cancer expression in a p53-independent manner. Note Chronic obstructive pulmonary Different studies show an important role of HDAC2 disease (COPD) in breast cancer. HDAC2 Knockdown induces senescence in breast Note cancer cells. Reduced HDAC2 activity and expression is found Moreover the loss of HDAC2 activity potentiates in chronic obstructive pulmonary disease (COPD). the apoptotic effect of tamoxifen in The reduced activity of HDAC2 produces the estrogen/progesterone positive breast cancer cells. upregulation of genes implicated in the inflammatory response and resistance to Prostate cancer corticosteroids in COPD. Note Weichert et al., found that HDAC2 was strongly References expressed in more than 70% of prostate cancer Yang WM, Inouye C, Zeng Y, Bearss D, Seto E. cases analyzed. Transcriptional repression by YY1 is mediated by The increase in HDAC2 expression was associated interaction with a mammalian homolog of the yeast global with enhanced tumor cell proliferation and poor regulator RPD3. Proc Natl Acad Sci U S A. 1996 Nov prognosis in prostate cancer suggesting HDAC2 as 12;93(23):12845-50 a novel prognostic factor in this tumor type. Nan X, Ng HH, Johnson CA, Laherty CD, Turner BM, Eisenman RN, Bird A. Transcriptional repression by the Hepatocellular carcinoma methyl-CpG-binding protein MeCP2 involves a histone deacetylase complex. Nature. 1998 May Note 28;393(6683):386-9 HDAC2 regulated cell cycle and disruption of Doetzlhofer A, Rotheneder H, Lagger G, Koranda M, HDAC2 caused G1/S arrest in cell cycle. Kurtev V, Brosch G, Wintersberger E, Seiser C. Histone In G1/S transition, targeted-disruption of HDAC2 deacetylase 1 can repress transcription by binding to Sp1. selectively induced the expression of (INK4A) ID: Mol Cell Biol. 1999 Aug;19(8):5504-11 (WAF1/Cip1) 146> and p21 , and simultaneously Yarden RI, Brody LC. BRCA1 interacts with components of suppressed the expression of cyclin D1, CDK4 and the histone deacetylase complex. Proc Natl Acad Sci U S CDK2. A. 1999 Apr 27;96(9):4983-

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 596 HDAC2 (histone deacetylase 2) Bae HJ, Nam SW

Fuks F, Burgers WA, Brehm A, Hughes-Davies L, 2007 Aug 13;26(37):5541-52 Kouzarides T. DNA methyltransferase Dnmt1 associates with histone deacetylase activity. Nat Genet. 2000 Biçaku E, Marchion DC, Schmitt ML, Münster PN. Jan;24(1):88-91 Selective inhibition of histone deacetylase 2 silences progesterone receptor-mediated signaling. Cancer Res. Juan LJ, Shia WJ, Chen MH, Yang WM, Seto E, Lin YS, 2008 Mar 1;68(5):1513-9 Wu CW. Histone deacetylases specifically down-regulate p53-dependent gene activation. J Biol Chem. 2000 Jul Nott A, Watson PM, Robinson JD, Crepaldi L, Riccio A. S- 7;275(27):20436-43 Nitrosylation of histone deacetylase 2 induces chromatin remodelling in neurons. Nature. 2008 Sep Fuks F, Burgers WA, Godin N, Kasai M, Kouzarides T. 18;455(7211):411-5 Dnmt3a binds deacetylases and is recruited by a sequence-specific repressor to silence transcription. Ropero S, Ballestar E, Alaminos M, Arango D, Schwartz S EMBO J. 2001 May 15;20(10):2536-44 Jr, Esteller M. Transforming pathways unleashed by a HDAC2 mutation in human cancer. Oncogene. 2008 Jun Rayman JB, Takahashi Y, Indjeian VB, Dannenberg JH, 26;27(28):4008-12 Catchpole S, Watson RJ, te Riele H, Dynlacht BD. E2F mediates cell cycle-dependent transcriptional repression in Weichert W, Röske A, Gekeler V, Beckers T, Stephan C, vivo by recruitment of an HDAC1/mSin3B corepressor Jung K, Fritzsche FR, Niesporek S, Denkert C, Dietel M, complex. Genes Dev. 2002 Apr 15;16(8):933-47 Kristiansen G. Histone deacetylases 1, 2 and 3 are highly expressed in prostate cancer and HDAC2 expression is Vaute O, Nicolas E, Vandel L, Trouche D. Functional and associated with shorter PSA relapse time after radical physical interaction between the histone methyl prostatectomy. Br J Cancer. 2008 Feb 12;98(3):604-10 transferase Suv39H1 and histone deacetylases. Nucleic Acids Res. 2002 Jan 15;30(2):475-81 Yang XJ, Seto E. The Rpd3/Hda1 family of lysine deacetylases: from bacteria and yeast to mice and men. Zhu P, Martin E, Mengwasser J, Schlag P, Janssen KP, Nat Rev Mol Cell Biol. 2008 Mar;9(3):206-18 Göttlicher M. Induction of HDAC2 expression upon loss of APC in colorectal tumorigenesis. Cancer Cell. 2004 Barnes PJ. Role of HDAC2 in the pathophysiology of May;5(5):455-63 COPD. Annu Rev Physiol. 2009;71:451-64 Huang BH, Laban M, Leung CH, Lee L, Lee CK, Salto- Brunmeir R, Lagger S, Seiser C. Histone deacetylase Tellez M, Raju GC, Hooi SC. Inhibition of histone HDAC1/HDAC2-controlled embryonic development and deacetylase 2 increases apoptosis and p21Cip1/WAF1 cell differentiation. Int J Dev Biol. 2009;53(2-3):275-89 expression, independent of histone deacetylase 1. Cell Guan JS, Haggarty SJ, Giacometti E, Dannenberg JH, Death Differ. 2005 Apr;12(4):395-404 Joseph N, Gao J, Nieland TJ, Zhou Y, Wang X, Ropero S, Fraga MF, Ballestar E, Hamelin R, Yamamoto Mazitschek R, Bradner JE, DePinho RA, Jaenisch R, Tsai H, Boix-Chornet M, Caballero R, Alaminos M, Setien F, LH. HDAC2 negatively regulates memory formation and Paz MF, Herranz M, Palacios J, Arango D, Orntoft TF, synaptic plasticity. Nature. 2009 May 7;459(7243):55-60 Aaltonen LA, Schwartz S Jr, Esteller M. A truncating Weichert W. HDAC expression and clinical prognosis in mutation of HDAC2 in human cancers confers resistance human malignancies. Cancer Lett. 2009 Aug 8;280(2):168- to histone deacetylase inhibition. Nat Genet. 2006 76 May;38(5):566-9 Noh JH, Jung KH, Kim JK, Eun JW, Bae HJ, Xie HJ, Montgomery RL, Davis CA, Potthoff MJ, Haberland M, Chang YG, Kim MG, Park WS, Lee JY, Nam SW. Aberrant Fielitz J, Qi X, Hill JA, Richardson JA, Olson EN. Histone regulation of HDAC2 mediates proliferation of deacetylases 1 and 2 redundantly regulate cardiac hepatocellular carcinoma cells by deregulating expression morphogenesis, growth, and contractility. Genes Dev. of G1/S cell cycle proteins. PLoS One. 2011;6(11):e28103 2007 Jul 15;21(14):1790-802 Jung KH, Noh JH, Kim JK, Eun JW, Bae HJ, Xie HJ, Ropero S, Esteller M. The role of histone deacetylases Chang YG, Kim MG, Park H, Lee JY, Nam SW. HDAC2 (HDACs) in human cancer. Mol Oncol. 2007 Jun;1(1):19- overexpression confers oncogenic potential to human lung 25 cancer cells by deregulating expression of apoptosis and Saleque S, Kim J, Rooke HM, Orkin SH. Epigenetic cell cycle proteins. J Cell Biochem. 2012 Jun;113(6):2167- regulation of hematopoietic differentiation by Gfi-1 and Gfi- 77 1b is mediated by the cofactors CoREST and LSD1. Mol Kim JK, Noh JH, Eun JW, Jung KH, Bae HJ, Shen Q, Kim Cell. 2007 Aug 17;27(4):562-72 MG, Chang YG, Kim SJ, Park WS, Lee JY, Borlak J, Nam Trivedi CM, Luo Y, Yin Z, Zhang M, Zhu W, Wang T, Floss SW. Targeted inactivation of HDAC2 restores p16INK4a T, Goettlicher M, Noppinger PR, Wurst W, Ferrari VA, activity and exerts antitumor effects on human gastric Abrams CS, Gruber PJ, Epstein JA. Hdac2 regulates the cancer. Mol Cancer Res. 2013 Jan;11(1):62-73 cardiac hypertrophic response by modulating Gsk3 beta activity. Nat Med. 2007 Mar;13(3):324-31 This article should be referenced as such: Xu WS, Parmigiani RB, Marks PA. Histone deacetylase Bae HJ, Nam SW. HDAC2 (histone deacetylase 2). Atlas inhibitors: molecular mechanisms of action. Oncogene. Genet Cytogenet Oncol Haematol. 2014; 18(8):594-597.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 597 Atlas of Genetics and Cytogenetics in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Gene Section Review

PF4 (platelet factor 4) Katrien Van Raemdonck, Paul Proost, Jo Van Damme, Sofie Struyf Laboratory of Molecular Immunology, Rega Institute for Medical Research, Department of Microbiology and Immunology, KU Leuven, Leuven, Belgium (KVR, PP, JVD, SS)

Published in Atlas Database: January 2014 Online updated version : http://AtlasGeneticsOncology.org/Genes/PF4ID41693ch4q13.html DOI: 10.4267/2042/54016 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2014 Atlas of Genetics and Cytogenetics in Oncology and Haematology

epithelial and mesangial cells and also tumor cells Abstract and involve classical chemokine receptors as well Review on PF4, with data on DNA/RNA, on the as glycosaminoglycans (GAG). Its most prominent protein encoded and where the gene is implicated. activity is inhibition of angiogenesis and, consequently, of tumor growth and metastasis. Identity The general biology of CXCL4 has been reviewed elaborately by different groups (Aidoudi and Other names: CXCL4, PF-4, SCYB4 Bikfalvi, 2010; Kasper and Petersen, 2011; HGNC (Hugo): PF4 Vandercappellen et al., 2011). Location: 4q13.3 DNA/RNA Note The platelet factor CXCL4 is a rather atypical Note chemokine because its leukocyte chemoattractant The CXCL4 gene is located in the CXC chemokine activity is not that prominent. However, CXCL4 gene cluster on chromosome 4q, in close proximity influences a large range of processes via interaction of its variant gene PF-4var/PF-4alt/CXCL4L1. The with a diversity of cellular receptors. These gene and mRNA for CXCL4 are 1300 and 855 bp receptors are expressed on leukocytes, endothelial, in length, respectively.

Figure 1. Structure of the human CXCL4 gene. This figure schematically depicts the structure of the human CXCL4 gene as described in the NCBI database (NM_002619). Lines represent the introns, whereas rectangular exons are coloured blue, yellow and green to represent the non-coding domains, the signal peptide and the mature protein, respectively. Grey numbers indicate the basepair numbering in the CXCL4 mRNA. Red numbers apply to the amino acids encoded.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 598 PF4 (platelet factor 4) Van Raemdonck K, et al.

Description mediate the effects of CXCL4 on monocytes and neutrophils and pass intracellular The CXCL4 mRNA is encoded by three exons as signals to tyrosine kinases of the Src family, depicted in figure 1. members of the MAP kinase family and monomeric Alternative splicing of the gene has not been GTPases. CXCL4 also has high affinity for heparin reported. and heparan sulphate. Transcription Through its ability to bind and neutralize heparin, The CXCL4 mRNA is predominantly present in CXCL4 influences blood coagulation. More so, the platelets, but has also been detected in monocytes, interaction of CXCL4 with heparan sulphate T cells, T cell clones, human aortic smooth muscle proteoglycans on endothelial cells is responsible for cells, the colorectal adenocarcinoma cell line HCT- the rapid clearance of CXCL4 from the circulation 8. and prevents degradation of the chemokine. Besides binding to GAG, CXCL4 has also been Pseudogene described to bind several growth factors, such as None. VEGF and FGF-2, and other chemokines, including CCL2/MCP-1 and possibly CXCL12/SDF-1 Protein (Carlson et al., 2012). This heteromultimerisation, sequestering Note angiogenic proteins, explains at least in part the CXCL4 precursor: 101 amino acids (aa), 10844.9 anti-angiogenic effect of CXCL4. Da; CXCL4 mature: 70 aa, 7765.2 Da; Heteromer formation of CXCL4 with Alternatively spliced signal peptide CXCL4: 74 aa, CCL5/RANTES also affects monocyte recruitment 8141.5 Da. Several NH 2-terminally truncated (Koenen et al., 2009), and possibly atherogenesis. forms. Although proteoglycans are mostly considered to be Description "co- receptors", the high affinity of CXCL4 for CXCL4 is a member of the CXC chemokine family GAG was for a long time thought to mediate most, of chemoattractant cytokines. CXCL4 is a non-ELR if not all, of its biological functions since no GPCR CXC chemokine, meaning that it lacks the sequence for CXCL4 was identified. glutamic acid-leucine-arginine just in front of the However, Lasagni et al. identified a splice variant of CXCR3, which was named CXCR3B, as a two NH 2-terminally located conserved cysteine residues. functional GPCR for CXCL4. Currently, CXCL4 is known to activate both Expression CXCR3A and CXCR3B (Figure 2). CXCL4 is stored in secretory granules and released In general, proliferative and positive migratory in response to protein kinase C activation. For effects are supposed to be mediated by CXCR3A, example, in platelets the CXCL4 protein is stored in whereas inhibition of chemotaxis, anti-proliferative the alpha-granules and released upon activation by and apoptotic effects are postulated to be provoked e.g. thrombin as a homotetramer bound to via CXCR3B. chrondroitin-4-sulphate on a carrier protein. Homology Therefore, CXCL4 is present at high concentrations in thrombi and concentrations in serum reach levels CXCL4 is most closely related to its variant of 10 µg/ml. CXCL4 protein has also been detected CXCL4L1, a non-allelic variant found only in in mast cells by immunohistochemistry, and is primates. In men, mature proteins only differ in 3 released by monocytes (100 ng/ml), activated T amino acids. cells, cultured microglia (1 ng/ml) and the colorectal adenocarcinoma cell line HCT-8 (0.5 Mutations ng/ml). Finally, prostate cancer cell lines DU-145 Note and PC-3 were shown to express CXCL4. CXCL4 appears to behave as a tumor suppressor Localisation gene. In multiple myeloma, CXCL4 is frequently Secreted or stored in intracellular granules. silenced as a consequence of promoter hypermethylation (Cheng et al., 2007). Function Furthermore, a subclass of acute lymphoblastic The first extracellular molecules binding CXCL4 leukemia patients exhibits a common translocation were identified to be chrondroitin-sulphate- with a breakpoint distal to the CXCL4 gene (Arthur containing proteoglycans (Figure 2). These GAG et al., 1982; Griffin et al., 1987).

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 599 PF4 (platelet factor 4) Van Raemdonck K, et al.

Figure 2. Signaling pathways activated by CXCL4. A complex signaling network lies at the basis of the functional diversity of CXCL4. This network integrates several cascades initiated by different cellular receptors, including the G-protein-coupled receptors (GPCR) CXCR3A (Gi) and CXCR3B (Gs). CXCL4 also displays an exceptional high affinity for the glycosaminoglycans chains on membrane-embedded proteoglycans, hypothesized to initiate signaling cascades of their own (Kasper and Petersen, 2011). The schematic network depicted here represents a selection of prominent CXCL4-activated pathways and provides insight into the complexity of CXCL4 signaling, yet does not provide an exhaustive list of all signaling molecules implicated. Target cells for CXCL4 include leukocytes (neutrophils, monocytes, activated T cells, dendritic cells, NK cells and mast cells), endothelial cells, airway epithelial cells, hepatic stellate cells, mesangial cells and vascular pericytes.

1987). More recently, decreased serum levels of Implicated in CXCL4 have also been suggested to serve as a marker for pediatric ALL (Shi et al., 2009). In Leukemia and myeloma multiple myeloma CXCL4 was effectively Prognosis identified as a tumor suppressor gene, frequently Serum proteome profiling revealed decreased serum silenced as a consequence of promoter levels of CXCL4 as a biomarker for advanced hypermethylation (Cheng et al., 2007). myelodysplastic syndrome (MDS), often progressing to acute myeloid leukemia (AML) Osteosarcoma (Aivado et al., 2007). Other studies have Disease corroborated involvement of CXCL4 over the The platelet-associated CXCL4 expression was course of MDS and AML and have recognized the found to be elevated shortly after implantation of chemokine as a prognostic, therapy-associated human osteosarcoma in mice (Cervi et al., 2008). It marker indicative of response to therapy, blood has been proposed as a biomarker of early tumor count recovery and eventual clinical outcome (Bai growth. Alternatively, another recent study et al., 2013; Chen et al., 2010; Kim et al., 2008). described plasma levels of CXCL4 to be elevated in Oncogenesis pediatric osteosarcoma patients (Li et al., 2011). Evidence in acute lymphoblastic leukemia (ALL), Prognosis showing a common translocation amongst a Not only were plasma levels of CXCL4 in pediatric subclass of patients, with a breakpoint in 4q21 osteosarcoma patients shown to be significantly which was later shown to be distal to the CXCL4 higher than those in controls, survival analysis gene, suggested the involvement of CXCL4 in ALL further revealed that higher circulating levels of tumorigenesis (Arthur et al., 1982; Griffin et al., CXCL4 were associated with a poorer outcome (Li

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 600 PF4 (platelet factor 4) Van Raemdonck K, et al.

et al., 2011). CXCL4 may prove to be a promising invasiveness of prostate cancer cells marked by a prognostic factor in osteosarcoma patients in the change in their CXCR3 expression pattern. future. However, CXCL4 levels have been described Liposarcoma previously to be significantly decreased in the sera of all metastatic prostate carcinoma patients Disease compared to healthy individuals, as well as The platelet-associated CXCL4 expression, unlike compared to localized prostate carcinoma patients its soluble plasma counterpart, was found to be (Lam et al., 2005). elevated shortly after implantation of human liposarcoma in mice (Cervi et al., 2008). It has been Endometriosis-associated ovarian proposed as a biomarker of early tumor growth. cancer (EAOC) Mammary adenocarcinoma Oncogenesis Both clear cell and endometrioid types of ovarian Disease cancers occasionally develop on the bases of The platelet-associated CXCL4 expression, unlike endometriosis. its soluble plasma counterpart, was found to be These endometriosis-associated ovarian cancers elevated shortly after implantation of human (EAOC) are characterized by infiltration of mammary adenocarcinoma in mice (Cervi et al., CXCL4-depleted tumor-associated macrophages, 2008). It has been proposed as a biomarker of early whereas in contrast, in pre-existing endometriosis tumor growth. CXCL4 is strongly expressed by CD68+ infiltrating Pancreatic adenocarcinoma macrophages (Furuya et al., 2012). Macrophage CXCL4 expression is thus associated Prognosis with EAOC disease state and pre-malignant lesions. Discovery of a cancer-associated reduction of CXCL4 serum concentrations lead to the Metastatic carcinoma identification of CXCL4 as a discriminating marker Disease in pancreatic cancer (Fiedler et al., 2009). Analysis of platelet content in a heterogeneous Potential of CXCL4 as a diagnostic marker was group of patients with newly diagnosed metastatic shortly after confirmed (Poruk et al., 2010). disease (including colorectal cancer, renal cell Moreover, serum CXCL4 was also identified as a cancer, malignant fibrous histiocytoma, strong independent predictor of survival in this leiomyosarcoma and peripheral neuroectodermal study, where decreased survival is associated with cancer) a significant reduction in CXCL4 platelet elevated CXCL4 levels. concentrations was observed (Wiesner et al., 2010). Finally, as a prognostic marker, CXCL4 may prove Simultaneously, however, CXCL4 was upregulated to be valuable in identifying patients at risk of in cancer patient plasma. complications and thus may benefit from prophylactic antithrombotic therapy (Poruk et al., Chemotherapy-induced 2010). thrombocytopenia (CIT) Colorectal cancer Prognosis CXCL4 may be a useful biomarker predicting the Disease risk of thrombocytopenia developing with Platelet content of CXCL4 in 35 patients with colon chemotherapy (CIT) (Lambert et al., 2012). cancer was shown to be significantly increased Patients with low steady-state platelet CXCL4 when compared to 84 age-matched healthy controls levels would better tolerate chemotherapy, whereas (Peterson et al., 2012). high concentrations may be an indication for CIT Though not thought to be clinically relevant, a and predict the need for a platelet transfusion. change in CXCL4 platelet levels was identified as a predictor of colorectal carcinoma which could Hepatitis and liver fibrosis potentially enable early diagnosis of disease. Disease CXCL4 expression is enhanced in the liver of Prostate cancer patients with advanced hepatitis C virus-induced Prognosis fibrosis or nonalcoholic steatohepatitis and Cxcl4 Recent in vitro research has evidenced that knock-out mice had significantly reduced particular prostate tumor cells, namely DU-145 and histological and biochemical liver damage in an in PC-3 cells, exhibit a shift in CXCR3 splice variant vivo model for fibrotic liver disease (Zaldivar et al., presentation (Wu et al., 2012). 2010). In combination with the reported elevated tumor In vitro, recombinant mouse CXCL4 stimulated CXCL4 expression in vitro, these data suggest proliferation and chemotaxis of hepatic stellate CXCL4 might promote in vitro migration and cells.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 601 PF4 (platelet factor 4) Van Raemdonck K, et al.

Malaria complication of anticoagulant heparin therapy in which patients having developed antibodies against Disease CXCL4/heparin complexes, are at risk for venous Acute Plasmodium falciparum infection, causing as well as arterial thrombosis, despite low platelet malaria characterized by especially high morbidity counts (Rauova et al., 2010). and mortality, leads to elevated plasma levels of Heparin is thought to act as an adjuvant integral to platelet-specific proteins, including CXCL4 (Essien immunogenesis, whereas the HIT antibody and Ebhota, 1983). On the one hand CXCL4 exerts recognizes antigenic epitopes within CXCL4 and a protective, antimalarial effect. Upon binding of thus the presence of CXCL4 is essential to the platelets to infected red blood cells, locally released clinical manifestations caused by circulating CXCL4 in particular instigates killing of antibodies (Prechel and Walenga, 2013). intraerythrocytic P. falciparum parasites (Love et al., 2012; McMorran et al., 2013). The protective Rheumatoid arthritis function of blood platelets and CXCL4 is Prognosis dependent on the Duffy-antigen receptor Increased levels of CXCL4 have been reported in (Fy/DARC) on the erythrocytes. On the other hand, the synovial fluid of patients with rheumatoid CXCL4 mediates the pathogenesis of cerebral arthritis (Erdem et al., 2007). malaria (CM), a serious complication of P. However, especially elevated plasma levels of falciparum infection (Wilson et al., 2011). CXCL4 CXCL4 in particular subsets of patients may be is believed to promote a pro-inflammatory associated with clinical manifestation of environment and to contribute to disruption of the rheumatoid arthritis, such as the occurrence of blood-brain barrier. cutaneous vasculitis, and also correlate to a non- Prognosis response to anti-TNF α therapy (Trocme et al., Wilson et al. have suggested a prominent role for 2009; Yamamoto et al., 2002). CXCL4 in the pathogenesis of fatal CM and Proliferative diabetic retinopathy identified this chemokine as a potential prognostic biomarker for CM mortality (Wilson et al., 2011). (PDR) Acquired immunodeficiency Disease Early on an association was recognized between syndrome (AIDS) diabetes and PDR on the one hand and elevated Disease plasma levels of coagulation factors, such as Auerback et al. have identified CXCL4 as a unique CXCL4, on the other hand (Ek et al., 1982; Roy et broad-spectrum inhibitor of HIV-1 (Auerbach et al., al., 1988). 2012). Recent clinical studies have not only confirmed Through binding of the external viral envelope elevated CXCL4 levels in the vitreous fluid of PDR glycoprotein, gp120, CXCL4 interferes with the patients but also a correlation between vitreous earliest events in the viral infectious cycle, namely CXCL4 concentration and PDR clinical disease attachment and entry, and consequently reduces activity (Nawaz et al., 2013). replication of different phenotypic variants of HIV- Vitreous levels of CXCL4 are significantly higher 1 in CD4+ T cells and macrophages. In parallel, both in PDR with active neovascularisation and in another study found activated platelets to release PDR without traction retinal detachment. antiviral factors which suppress HIV-1 infection of T cells and confirmed CXCL4 to be a key player in Inflammatory bowel disease (IBD) this first line of defense against HIV-1 (Tsegaye et Disease al., 2013). Already in 1987, plasma CXCL4 concentrations Prognosis were shown to be increased in patients with IBD Preliminary results reported by Auerback and disease (Simi et al., 1987). colleagues suggest a correlation between higher CXCL4 was later on identified as a biomarker for serum levels of CXCL4 in HIV-1-infected patients IBD using proteomic serum profiling (Meuwis et and a less advanced clinical stage (Auerbach et al., al., 2007). 2012). Though originally controversial, plasma CXCL4 levels were confirmed to be positively correlated to Heparin-induced thrombocytopenia disease activity in Crohn's disease (Vrij et al., (HIT) 2000). Disease Prognosis Heparin is widely used as anti-coagulant during Similar to their predictive role in rheumatoid invasive vascular surgery and to treat thrombo- arthritis, high CXCL4 plasma levels are indicative embolic pathology. HIT is a rare (1-5%), paradoxal of non-responsiveness to anti-TNF α antibody

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 602 PF4 (platelet factor 4) Van Raemdonck K, et al.

(infliximab) treatment in Crohn's disease (Meuwis bowel disease and giant cell arteritis. Eur J Clin Invest. et al., 2008). 2000 Mar;30(3):188-94 Yamamoto T, Chikugo T, Tanaka Y. Elevated plasma Atherosclerosis levels of beta-thromboglobulin and platelet factor 4 in Disease patients with rheumatic disorders and cutaneous vasculitis. The proatherogenic role of CXCL4 has been Clin Rheumatol. 2002 Nov;21(6):501-4 established in a variety of mostly preclinical studies Pitsilos S, Hunt J, Mohler ER, Prabhakar AM, Poncz M, (e.g. Sachais et al., 2007). Dawicki J, Khalapyan TZ, Wolfe ML, Fairman R, Mitchell M, Carpenter J, Golden MA, Cines DB, Sachais BS. CXCL4, released by activated platelets at injury Platelet factor 4 localization in carotid atherosclerotic sites, presumably promotes the progression of plaques: correlation with clinical parameters. Thromb atherosclerotic lesions through different Haemost. 2003 Dec;90(6):1112-20 mechanisms. Lam YW, Mobley JA, Evans JE, Carmody JF, Ho SM. These include recruiting and arresting peripheral Mass profiling-directed isolation and identification of a monocytes at the lesion site and consequently stage-specific serologic protein biomarker of advanced facilitating their differentiation into macrophages prostate cancer. Proteomics. 2005 Jul;5(11):2927-38 and concordant polarization as well as inhibiting Aivado M, Spentzos D, Germing U, Alterovitz G, Meng XY, degradation of LDL-R while increasing uptake and Grall F, Giagounidis AA, Klement G, Steidl U, Otu HH, Czibere A, Prall WC, Iking-Konert C, Shayne M, Ramoni esterification of ox-LDL in macrophages (Aidoudi MF, Gattermann N, Haas R, Mitsiades CS, Fung ET, and Bikfalvi, 2010; Gleissner, 2012). Libermann TA. Serum proteome profiling detects The histological distribution of CXCL4 was also myelodysplastic syndromes and identifies CXC chemokine shown to be associated with the location and grade ligands 4 and 7 as markers for advanced disease. Proc of vascular lesions (Pitsilos et al., 2003). Staining Natl Acad Sci U S A. 2007 Jan 23;104(4):1307-12 of macrophages for CXCL4 correlated with Cheng SH, Ng MH, Lau KM, Liu HS, Chan JC, Hui AB, Lo symptomatic atherosclerotic disease. KW, Jiang H, Hou J, Chu RW, Wong WS, Chan NP, Ng HK. 4q loss is potentially an important genetic event in MM Moreover, proinflammatory heteromer formation of tumorigenesis: identification of a tumor suppressor gene CXCL4 with another platelet chemokine regulated by promoter methylation at 4q13.3, platelet CCL5/RANTES has emerged as an additional factor 4. Blood. 2007 Mar 1;109(5):2089-99 regulatory mechanism, enhancing monocyte Erdem H, Pay S, Musabak U, Simsek I, Dinc A, Pekel A, recruitment and thereby contributing to the disease Sengul A. Synovial angiostatic non-ELR CXC chemokines progression (Koenen et al., 2009). in inflammatory arthritides: does CXCL4 designate chronicity of synovitis? Rheumatol Int. 2007 Recently, a linkage study described an association Aug;27(10):969-73 between CXCL4 and platelet activation in human patients, thus linking this chemokine to the clinical Meuwis MA, Fillet M, Geurts P, de Seny D, Lutteri L, Chapelle JP, Bours V, Wehenkel L, Belaiche J, Malaise M, manifestation of atherosclerosis (Bhatnagar et al., Louis E, Merville MP. Biomarker discovery for 2012). inflammatory bowel disease, using proteomic serum profiling. Biochem Pharmacol. 2007 May 1;73(9):1422-33 References Sachais BS, Turrentine T, Dawicki McKenna JM, Rux AH, Rader D, Kowalska MA. Elimination of platelet factor 4 Arthur DC, Bloomfield CD, Lindquist LL, Nesbit ME Jr. (PF4) from platelets reduces atherosclerosis in C57Bl/6 Translocation 4; 11 in acute lymphoblastic leukemia: and apoE-/- mice. Thromb Haemost. 2007 clinical characteristics and prognostic significance. Blood. Nov;98(5):1108-13 1982 Jan;59(1):96-9 Cervi D, Yip TT, Bhattacharya N, Podust VN, Peterson J, Ek I, Thunell S, Blombäck M. Enhanced in vivo platelet Abou-Slaybi A, Naumov GN, Bender E, Almog N, Italiano activation in diabetes mellitus. Scand J Haematol. 1982 JE Jr, Folkman J, Klement GL. Platelet-associated PF-4 as Aug;29(2):185-91 a biomarker of early tumor growth. Blood. 2008 Feb Essien EM, Ebhota MI. Platelet secretory activities in acute 1;111(3):1201-7 malaria (Plasmodium falciparum) infection. Acta Haematol. Kim JY, Song HJ, Lim HJ, Shin MG, Kim JS, Kim HJ, Kim 1983;70(3):183-8 BY, Lee SW. Platelet factor-4 is an indicator of blood count Griffin CA, Emanuel BS, LaRocco P, Schwartz E, Poncz recovery in acute myeloid leukemia patients in complete M. Human platelet factor 4 gene is mapped to 4q12----q21. remission. Mol Cell Proteomics. 2008 Feb;7(2):431-41 Cytogenet Cell Genet. 1987;45(2):67-9 Meuwis MA, Fillet M, Lutteri L, Marée R, Geurts P, de Simi M, Leardi S, Tebano MT, Castelli M, Costantini FM, Seny D, Malaise M, Chapelle JP, Wehenkel L, Belaiche J, Speranza V. Raised plasma concentrations of platelet Merville MP, Louis E. Proteomics for prediction and factor 4 (PF4) in Crohn's disease. Gut. 1987 characterization of response to infliximab in Crohn's Mar;28(3):336-8 disease: a pilot study. Clin Biochem. 2008 Aug;41(12):960- 7 Roy MS, Podgor MJ, Rick ME. Plasma fibrinopeptide A, beta-thromboglobulin, and platelet factor 4 in diabetic Fiedler GM, Leichtle AB, Kase J, Baumann S, Ceglarek U, retinopathy. Invest Ophthalmol Vis Sci. 1988 Felix K, Conrad T, Witzigmann H, Weimann A, Schütte C, Jun;29(6):856-60 Hauss J, Büchler M, Thiery J. Serum peptidome profiling revealed platelet factor 4 as a potential discriminating Vrij AA, Rijken J, Van Wersch JW, Stockbrügger RW. Peptide associated with pancreatic cancer. Clin Cancer Platelet factor 4 and beta-thromboglobulin in inflammatory Res. 2009 Jun 1;15(11):3812-9

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 603 PF4 (platelet factor 4) Van Raemdonck K, et al.

Koenen RR, von Hundelshausen P, Nesmelova IV, 4 as a broad-spectrum HIV-1 inhibitor. Proc Natl Acad Sci Zernecke A, Liehn EA, Sarabi A, Kramp BK, Piccinini AM, U S A. 2012 Jun 12;109(24):9569-74 Paludan SR, Kowalska MA, Kungl AJ, Hackeng TM, Mayo KH, Weber C. Disrupting functional interactions between Bhatnagar P, Lu X, Evans MK, Laveist TA, Zonderman AB, platelet chemokines inhibits atherosclerosis in Carter DL, Arking DE, Fletcher CA. Genetic variants in hyperlipidemic mice. Nat Med. 2009 Jan;15(1):97-103 platelet factor 4 modulate inflammatory and platelet activation biomarkers. Circ Cardiovasc Genet. 2012 Aug Shi L, Zhang J, Wu P, Feng K, Li J, Xie Z, Xue P, Cai T, 1;5(4):412-21 Cui Z, Chen X, Hou J, Zhang J, Yang F. Discovery and identification of potential biomarkers of pediatric acute Furuya M, Tanaka R, Miyagi E, Kami D, Nagahama K, lymphoblastic leukemia. Proteome Sci. 2009 Mar 16;7:7 Miyagi Y, Nagashima Y, Hirahara F, Inayama Y, Aoki I. Impaired CXCL4 expression in tumor-associated Trocmé C, Marotte H, Baillet A, Pallot-Prades B, Garin J, macrophages (TAMs) of ovarian cancers arising in Grange L, Miossec P, Tebib J, Berger F, Nissen MJ, Juvin endometriosis. Cancer Biol Ther. 2012 Jun;13(8):671-80 R, Morel F, Gaudin P. Apolipoprotein A-I and platelet factor 4 are biomarkers for infliximab response in rheumatoid Gleissner CA. Macrophage Phenotype Modulation by arthritis. Ann Rheum Dis. 2009 Aug;68(8):1328-33 CXCL4 in Atherosclerosis. Front Physiol. 2012;3:1 Aidoudi S, Bikfalvi A. Interaction of PF4 (CXCL4) with the Lambert MP, Reznikov A, Grubbs A, Nguyen Y, Xiao L, vasculature: a role in atherosclerosis and angiogenesis. Aplenc R, Rauova L, Poncz M. Platelet factor 4 platelet Thromb Haemost. 2010 Nov;104(5):941-8 levels are inversely correlated with steady-state platelet counts and with platelet transfusion needs in pediatric Chen C, Bowen DT, Giagounidis AA, Schlegelberger B, leukemia patients. J Thromb Haemost. 2012 Haase S, Wright EG. Identification of disease- and Jul;10(7):1442-6 therapy-associated proteome changes in the sera of patients with myelodysplastic syndromes and del(5q). Love MS, Millholland MG, Mishra S, Kulkarni S, Freeman Leukemia. 2010 Nov;24(11):1875-84 KB, Pan W, Kavash RW, Costanzo MJ, Jo H, Daly TM, Williams DR, Kowalska MA, Bergman LW, Poncz M, Poruk KE, Firpo MA, Huerter LM, Scaife CL, Emerson LL, DeGrado WF, Sinnis P, Scott RW, Greenbaum DC. Boucher KM, Jones KA, Mulvihill SJ. Serum platelet factor Platelet factor 4 activity against P. falciparum and its 4 is an independent predictor of survival and venous translation to nonpeptidic mimics as antimalarials. Cell thromboembolism in patients with pancreatic Host Microbe. 2012 Dec 13;12(6):815-23 adenocarcinoma. Cancer Epidemiol Biomarkers Prev. 2010 Oct;19(10):2605-10 Peterson JE, Zurakowski D, Italiano JE Jr, Michel LV, Connors S, Oenick M, D'Amato RJ, Klement GL, Folkman Rauova L, Hirsch JD, Greene TK, Zhai L, Hayes VM, J. VEGF, PF4 and PDGF are elevated in platelets of Kowalska MA, Cines DB, Poncz M. Monocyte-bound PF4 colorectal cancer patients. Angiogenesis. 2012 in the pathogenesis of heparin-induced thrombocytopenia. Jun;15(2):265-73 Blood. 2010 Dec 2;116(23):5021-31 Wu Q, Dhir R, Wells A. Altered CXCR3 isoform expression Wiesner T, Bugl S, Mayer F, Hartmann JT, Kopp HG. regulates prostate cancer cell migration and invasion. Mol Differential changes in platelet VEGF, Tsp, CXCL12, and Cancer. 2012 Jan 11;11:3 CXCL4 in patients with metastatic cancer. Clin Exp Metastasis. 2010 Mar;27(3):141-9 Bai J, He A, Zhang W, Huang C, Yang J, Yang Y, Wang J, Zhang Y. Potential biomarkers for adult acute myeloid Zaldivar MM, Pauels K, von Hundelshausen P, Berres ML, leukemia minimal residual disease assessment searched Schmitz P, Bornemann J, Kowalska MA, Gassler N, by serum peptidome profiling. Proteome Sci. 2013;11:39 Streetz KL, Weiskirchen R, Trautwein C, Weber C, Wasmuth HE. CXC chemokine ligand 4 (Cxcl4) is a Carlson J, Baxter SA, Dréau D, Nesmelova IV. The platelet-derived mediator of experimental liver fibrosis. heterodimerization of platelet-derived chemokines. Hepatology. 2010 Apr;51(4):1345-53 Biochim Biophys Acta. 2013 Jan;1834(1):158-68 Kasper B, Petersen F. Molecular pathways of platelet McMorran BJ, Burgio G, Foote SJ. New insights into the factor 4/CXCL4 signaling. Eur J Cell Biol. 2011 Jun- protective power of platelets in malaria infection. Commun Jul;90(6-7):521-6 Integr Biol. 2013 May 1;6(3):e23653 Li Y, Flores R, Yu A, Okcu MF, Murray J, Chintagumpala Nawaz MI, Van Raemdonck K, Mohammad G, Kangave D, M, Hicks J, Lau CC, Man TK. Elevated expression of CXC Van Damme J, Abu El-Asrar AM, Struyf S. Autocrine chemokines in pediatric osteosarcoma patients. Cancer. CCL2, CXCL4, CXCL9 and CXCL10 signal in retinal 2011 Jan 1;117(1):207-17 endothelial cells and are enhanced in diabetic retinopathy. Exp Eye Res. 2013 Apr;109:67-76 Vandercappellen J, Van Damme J, Struyf S. The role of the CXC chemokines platelet factor-4 (CXCL4/PF-4) and Prechel MM, Walenga JM. Emphasis on the Role of PF4 in its variant (CXCL4L1/PF-4var) in inflammation, the Incidence, Pathophysiology and Treatment of Heparin angiogenesis and cancer. Cytokine Growth Factor Rev. Induced Thrombocytopenia. Thromb J. 2013 Apr 5;11(1):7 2011 Feb;22(1):1-18 Solomon Tsegaye T, Gnirß K, Rahe-Meyer N, Kiene M, Wilson NO, Jain V, Roberts CE, Lucchi N, Joel PK, Singh Krämer-Kühl A, Behrens G, Münch J, Pöhlmann S. Platelet MP, Nagpal AC, Dash AP, Udhayakumar V, Singh N, activation suppresses HIV-1 infection of T cells. Stiles JK. CXCL4 and CXCL10 predict risk of fatal cerebral Retrovirology. 2013 May 1;10:48 malaria. Dis Markers. 2011;30(1):39-49 This article should be referenced as such: Auerbach DJ, Lin Y, Miao H, Cimbro R, Difiore MJ, Gianolini ME, Furci L, Biswas P, Fauci AS, Lusso P. Van Raemdonck K, Proost P, Van Damme J, Struyf S. PF4 Identification of the platelet-derived chemokine CXCL4/PF- (platelet factor 4). Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8):598-604.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 604 Atlas of Genetics and Cytogenetics in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Leukaemia Section Short Communication t(9;13)(p12;q21) PAX5/DACH1 Jean-Loup Huret Genetics, Dept Medical Information, University of Poitiers, CHU Poitiers Hospital, F-86021 Poitiers, France (JLH)

Published in Atlas Database: January 2014 Online updated version : http://AtlasGeneticsOncology.org/Anomalies/t0913p12q21ID1560.html DOI: 10.4267/2042/54017 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2014 Atlas of Genetics and Cytogenetics in Oncology and Haematology

nucleotide. Abstract Involved in B-cell differentiation. Short communication on t(9;13)(p12;q21) Entry of common lymphoid progenitors into the B PAX5/DACH1, with data on clinics, and the genes cell lineage depends on E2A, EBF1, and PAX5; implicated. activates B-cell specific genes and repress genes involved in other lineage commitments. Clinics and pathology Activates the surface cell receptor CD19 and repress FLT3. Disease Pax5 physically interacts with the RAG1/RAG2 B-cell acute lymphoblastic leukemia (B-ALL) complex, and removes the inhibitory signal of the lysine-9-methylated histone H3, and induces V-to- Epidemiology DJ rearrangements. Only one case to date, a 5-year old boy with a Genes repressed by PAX5 expression in early B CD10+ ALL (Nebral et al., 2009). cells are restored in their function in mature B cells and plasma cells, and PAX5 repressed (Fuxa et al., Prognosis 2004; Johnson et al., 2004; Zhang et al., 2006; The patient was noted at an intermediate risk, Cobaleda et al., 2007; Medvedovic et al., 2011). reached complete remission, and was alive at 23 DACH1 months+. Location Genes involved and 13q21.33 DNA/RNA proteins 2 splice transcript variants. PAX5 Protein 708 and 760 amino acids (aa). From N-term to C- Location term (for the 760 aa form), contains a Poly-Ala (aa 9p13.2 61-68), three Poly-Gly (aa 74-89; aa 92-103; aa Protein 116-123), a Poly-Ser (aa 142-165), a Dachshund 391 amino acids; from N-term to C-term, PAX5 domain motif N (aa 191-277), an interaction region contains: a paired domain (aa: 16-142); an with SIX6 (14q23.1) and HDAC3 (5q31) (aa 191- octapeptide (aa: 179-186); a partial homeodomain 386), two Poly-Ala (aa 327-335; aa 469-472), a (aa: 228-254); a transactivation domain (aa: 304- Dachshund Domain motif C (aa 618-698), an 359); and an inhibitory domain (aa: 359-391). interaction region with SIN3A (15q24.2) and Lineage-specific transcription factor; recognizes the SIN3B (19p13.11),(aa 629-708), and a Coiled coil concensus recognition sequence domain (aa 632-720) (Swiss-Prot). GNCCANTGAAGCGTGAC, where N is any

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 605 t(9;13)(p12;q21) PAX5/DACH1 Huret JL

PAX5/DACH1 fusion protein.

DACH1 is a tumor suppressor. DACH1 regulated in advanced-stage ovarian cancers, and downregulates EGFR (7p11.2), CCND1 (11q13), inhibited TGF-beta signaling in these cancers ESR1 (6q25.1) and AR (Xq12), and also TGFB1 associated with TGFb resistance (Purcell et al., (19q13.2), through interaction with SMAD4 2005). (18q21.2) and NCOR1 (17p11.2). DACH1 DACH1 is frequently methylated in hepatocellular coprecipitates the histone deacetylase proteins carcinoma and DACH1 expression is regulated by (HDAC1, HDAC2, and NCOR1). DACH1 promoter hypermethylation. transcriptionally represses JUN (1p32.1), and FOS Down-regulation of DACH1 is a novel mechanism (14q24.3), and DACH1 inhibits DNA synthesis and for gaining resistance to the TGFB1 (19q13.2) cellular proliferation (Wu et al., 2007). antiproliferative signaling (Zhu et al., 2013). DACH1 is involved in the PAX-EYA-SIX-DACH DACH1 is also frequently methylated in human regulatory pathway (eyeless (PAX6), sine oculis colorectal cancer and methylation of DACH1 may (SIX1, SIX2, SIX3, SIX4, SIX5, SIX6), eyes serve as detective and prognostic marker in absent (EYA1, EYA2, EYA3, EYA4), and colorectal cancer (Yan et al., 2013). DACH1 dachshund (DACH1-2)). CREBBP (16p13.3) is regulates FGF2 (4q27)-mediated tumor-initiating involved in this process. activity of glioma cells and inhibits formation of DACH1 is involved in the development of the tumor-initiating spheroids of glioma cells neocortex and the hippocampus, is expressed by (Watanabe et al., 2011). neural stem cells during early neurogenesis, and also in adult neurogenesis following brain ischemia Result of the chromosomal (Honsa et al., 2013). DACH1 inhibits breast cancer cellular proliferation via cyclin D1 (Nan et al., anomaly 2009). DACH1 suppresses epithelial-mesenchymal transition via repression of cytoplasmic Hybrid gene translational induction of SNAI2 (8q11.21) by Description inactivating YBX1 (1p34.2). DACH1 blockes Fusion of PAX5 exon 5 to DACH1 exon 5. YBX1-induced mammary tumor growth (Wu et al., 2014). DACH1 expression appears to be predictive Fusion protein of good prognosis in oestrogen receptor (ER) Description positive breast cancer (Powe et al., 2014). DACH1 585 amino acids. The predicted fusion protein inhibites prostate cancer cellular DNA synthesis contains the DNA binding paired domain of PAX5 and growth (Wu et al., 2009). DACH1, BMP7 (the 201 N-term aa) and the DACHbox-C of (20q13.31), and MECOM (EVI1, 3q26.2) were up- DACH1 (the 384 C-term aa).

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 606 t(9;13)(p12;q21) PAX5/DACH1 Huret JL

References Popov VM, Wu K, Zhou J, Powell MJ, Mardon G, Wang C, Pestell RG. The Dachshund gene in development and Fuxa M, Skok J, Souabni A, Salvagiotto G, Roldan E, hormone-responsive tumorigenesis. Trends Endocrinol Busslinger M. Pax5 induces V-to-DJ rearrangements and Metab. 2010 Jan;21(1):41-9 locus contraction of the immunoglobulin heavy-chain gene. Genes Dev. 2004 Feb 15;18(4):411-22 Medvedovic J, Ebert A, Tagoh H, Busslinger M. Pax5: a master regulator of B cell development and Johnson K, Pflugh DL, Yu D, Hesslein DG, Lin KI, Bothwell leukemogenesis. Adv Immunol. 2011;111:179-206 AL, Thomas-Tikhonenko A, Schatz DG, Calame K. B cell- specific loss of histone 3 lysine 9 methylation in the V(H) Watanabe A, Ogiwara H, Ehata S, Mukasa A, Ishikawa S, locus depends on Pax5. Nat Immunol. 2004 Aug;5(8):853- Maeda D, Ueki K, Ino Y, Todo T, Yamada Y, Fukayama M, 61 Saito N, Miyazono K, Aburatani H. Homozygously deleted gene DACH1 regulates tumor-initiating activity of glioma Purcell P, Oliver G, Mardon G, Donner AL, Maas RL. cells. Proc Natl Acad Sci U S A. 2011 Jul Pax6-dependence of Six3, Eya1 and Dach1 expression 26;108(30):12384-9 during lens and nasal placode induction. Gene Expr Patterns. 2005 Dec;6(1):110-8 Honsa P, Pivonkova H, Anderova M. Focal cerebral ischemia induces the neurogenic potential of mouse Zhang Z, Espinoza CR, Yu Z, Stephan R, He T, Williams Dach1-expressing cells in the dorsal part of the lateral GS, Burrows PD, Hagman J, Feeney AJ, Cooper MD. ventricles. Neuroscience. 2013 Jun 14;240:39-53 Transcription factor Pax5 (BSAP) transactivates the RAG- mediated V(H)-to-DJ(H) rearrangement of immunoglobulin Yan W, Wu K, Herman JG, Brock MV, Fuks F, Yang L, genes. Nat Immunol. 2006 Jun;7(6):616-24 Zhu H, Li Y, Yang Y, Guo M. Epigenetic regulation of DACH1, a novel Wnt signaling component in colorectal Cobaleda C, Schebesta A, Delogu A, Busslinger M. Pax5: cancer. Epigenetics. 2013 Dec;8(12):1373-83 the guardian of B cell identity and function. Nat Immunol. 2007 May;8(5):463-70 Zhu H, Wu K, Yan W, Hu L, Yuan J, Dong Y, Li Y, Jing K, Yang Y, Guo M. Epigenetic silencing of DACH1 induces Wu K, Liu M, Li A, Donninger H, Rao M, Jiao X, Lisanti loss of transforming growth factor-β1 antiproliferative MP, Cvekl A, Birrer M, Pestell RG. Cell fate determination response in human hepatocellular carcinoma. Hepatology. factor DACH1 inhibits c-Jun-induced contact-independent 2013 Dec;58(6):2012-22 growth. Mol Biol Cell. 2007 Mar;18(3):755-67 Powe DG, Dhondalay GK, Lemetre C, Allen T, Habashy Nan F, Lü Q, Zhou J, Cheng L, Popov VM, Wei S, Kong B, HO, Ellis IO, Rees R, Ball GR. DACH1: its role as a Pestell RG, Lisanti MP, Jiang J, Wang C. Altered classifier of long term good prognosis in luminal breast expression of DACH1 and cyclin D1 in endometrial cancer. cancer. PLoS One. 2014;9(1):e84428 Cancer Biol Ther. 2009 Aug;8(16):1534-9 Wu K, Chen K, Wang C, Jiao X, Wang L, Zhou J, Wang J, Nebral K, Denk D, Attarbaschi A, König M, Mann G, Haas Li Z, Addya S, Sorensen PH, Lisanti MP, Quong A, Ertel A, OA, Strehl S. Incidence and diversity of PAX5 fusion Pestell RG. Cell fate factor DACH1 represses YB-1- genes in childhood acute lymphoblastic leukemia. mediated oncogenic transcription and translation. Cancer Leukemia. 2009 Jan;23(1):134-43 Res. 2014 Feb 1;74(3):829-39

Wu K, Katiyar S, Witkiewicz A, Li A, McCue P, Song LN, This article should be referenced as such: Tian L, Jin M, Pestell RG. The cell fate determination factor dachshund inhibits androgen receptor signaling and Huret JL. t(9;13)(p12;q21) PAX5/DACH1. Atlas Genet prostate cancer cellular growth. Cancer Res. 2009 Apr Cytogenet Oncol Haematol. 2014; 18(8):605-607. 15;69(8):3347-55

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 607 Atlas of Genetics and Cytogenetics in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Leukaemia Section Short Communication t(X;9)(q21;p13) PAX5/DACH2 Jean-Loup Huret Genetics, Dept Medical Information, University of Poitiers, CHU Poitiers Hospital, F-86021 Poitiers, France (JLH)

Published in Atlas Database: January 2014 Online updated version : http://AtlasGeneticsOncology.org/Anomalies/tX09q21p13ID1595.html DOI: 10.4267/2042/54018 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2014 Atlas of Genetics and Cytogenetics in Oncology and Haematology

GNCCANTGAAGCGTGAC, where N is any Abstract nucleotide. Involved in B-cell differentiation. Short communication on t(X;9)(q21;p13) Entry of common lymphoid progenitors into the B PAX5/DACH2, with data on clinics, and the genes cell lineage depends on E2A, EBF1, and PAX5; implicated. activates B-cell specific genes and repress genes involved in other lineage commitments. Clinics and pathology Activates the surface cell receptor CD19 and repress FLT3. Disease Pax5 physically interacts with the RAG1/RAG2 Acute lymphoblastic leukemia (ALL) complex, and removes the inhibitory signal of the lysine-9-methylated histone H3, and induces V-to- Epidemiology DJ rearrangements. Only one case to date, a 4-year old boy with a pre-B Genes repressed by PAX5 expression in early B ALL (Coyaud et al., 2010). cells are restored in their function in mature B cells Prognosis and plasma cells, and PAX5 repressed (Fuxa et al., 2004; Johnson et al., 2004; Zhang et al., 2006; No data. Cobaleda et al., 2007; Medvedovic et al., 2011). Cytogenetics DACH2 Cytogenetics morphological Location Xq21.2 The t(X;9)(q21;p13) was the sole abnormality. DNA/RNA Genes involved and 7 splice transcript variants. Protein proteins 599 amino acids and shorter forms; from N-term to PAX5 C-term, contains a Poly-Gly (amino acids (aa) 56- 61), a Dachshund domain motif N (aa 69-155), Location which interact with HDAC3 (histone deacetylase 3, 9p13.2 5q31), NCOR1 (nuclear receptor corepressor 1, Protein 17p11.2), and SIX6 (SIX homeobox 6, 14q23.1), a 391 amino acids; from N-term to C-term, PAX5 Poly-Ala (aa 350-353), a Dachshund Domain motif contains: a paired domain (aa: 16-142); an C, which interact with EYA2 (eyes absent homolog octapeptide (aa: 179-186); a partial homeodomain 2 (Drosophila), 20q13.1), and a Coiled coil domain (aa: 228-254); a transactivation domain (aa: 304- (aa 459-554) (Swiss-Prot). 359); and an inhibitory domain (aa: 359-391). DACH2 is a transcriptional repressor of MYOG Lineage-specific transcription factor; recognizes the (myogenin, 1q32.1). concensus recognition sequence

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 608 t(X;9)(q21;p13) PAX5/DACH2 Huret JL

PAX5/DACH2 fusion protein.

PAX3 (paired box gene 3, 2q36.1) and DACH2 Fusion protein positively regulate each other, and support the existence of a PAX3/SIX1/EYA2/LBX1/DACH2 Description network in regulating the myogenic differentiation 587 amino acids. The predicted fusion protein program (Mennerich and Braun, 2001; Kardon et contains the DNA binding paired domain of PAX5 al., 2002). (the 201 N-term aa) and the DACHbox-C of Histone deacetylase (HDAC4) activity, imported DACH2 (the 386 C-term aa). into the nucleus, suppresses DACH2 gene expression in denervated muscle (Tang and References Goldman, 2006; Cohen et al., 2007). Mennerich D, Braun T. Activation of myogenesis by the DACH2 represses SIX1 (SIX homeobox 1, homeobox gene Lbx1 requires cell proliferation. EMBO J. 14q23.1), and SIX1 overexpression has been 2001 Dec 17;20(24):7174-83 described in gliomas. Kardon G, Heanue TA, Tabin CJ. Pax3 and Dach2 positive DACH1 (13q22) and DACH2 are required for regulation in the developing somite. Dev Dyn. 2002 Müllerian duct development. DACH2 is abundantly Jul;224(3):350-5 expressed in fallopian tubes, and it has been Bione S, Rizzolio F, Sala C, Ricotti R, Goegan M, Manzini implicated in premature ovarian failure syndrome MC, Battaglia R, Marozzi A, Vegetti W, Dalprà L, (Bione et al., 2004; Suzumori et al., 2007). In Crosignani PG, Ginelli E, Nappi R, Bernabini S, Bruni V, Torricelli F, Zuffardi O, Toniolo D. Mutation analysis of two ovarian cancer, DACH2 is expressed, and a candidate genes for premature ovarian failure, DACH2 and significantly reduced overall survival was found for POF1B. Hum Reprod. 2004 Dec;19(12):2759-66 tumours expressing high levels of DACH2 in the Fuxa M, Skok J, Souabni A, Salvagiotto G, Roldan E, subgroup of serous carcinoma, but not in other Busslinger M. Pax5 induces V-to-DJ rearrangements and subgroups (Nodin et al., 2012). locus contraction of the immunoglobulin heavy-chain gene. Genes Dev. 2004 Feb 15;18(4):411-22 Result of the chromosomal Johnson K, Pflugh DL, Yu D, Hesslein DG, Lin KI, Bothwell AL, Thomas-Tikhonenko A, Schatz DG, Calame K. B cell- anomaly specific loss of histone 3 lysine 9 methylation in the V(H) locus depends on Pax5. Nat Immunol. 2004 Aug;5(8):853- Hybrid gene 61 Description Tang H, Goldman D. Activity-dependent gene regulation in Fusion of PAX5 exon 5 to DACH2 exon 3. skeletal muscle is mediated by a histone deacetylase (HDAC)-Dach2-myogenin signal transduction cascade.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 609 t(X;9)(q21;p13) PAX5/DACH2 Huret JL

Proc Natl Acad Sci U S A. 2006 Nov 7;103(45):16977-82 Quelen C, Bousquet M, Mugneret F, Talmant P, Pages MP, Lefebvre C, Penther D, Lippert E, Nadal N, Taviaux S, Zhang Z, Espinoza CR, Yu Z, Stephan R, He T, Williams Poppe B, Luquet I, Baranger L, Eclache V, Radford I, Barin GS, Burrows PD, Hagman J, Feeney AJ, Cooper MD. C, Mozziconacci MJ, Lafage-Pochitaloff M, Antoine-Poirel Transcription factor Pax5 (BSAP) transactivates the RAG- H, Charrin C, Perot C, Terre C, Brousset P, Dastugue N, mediated V(H)-to-DJ(H) rearrangement of immunoglobulin Broccardo C. Wide diversity of PAX5 alterations in B-ALL: genes. Nat Immunol. 2006 Jun;7(6):616-24 a Groupe Francophone de Cytogenetique Hematologique Cobaleda C, Schebesta A, Delogu A, Busslinger M. Pax5: study. Blood. 2010 Apr 15;115(15):3089-97 the guardian of B cell identity and function. Nat Immunol. Medvedovic J, Ebert A, Tagoh H, Busslinger M. Pax5: a 2007 May;8(5):463-70 master regulator of B cell development and Cohen TJ, Waddell DS, Barrientos T, Lu Z, Feng G, Cox leukemogenesis. Adv Immunol. 2011;111:179-206 GA, Bodine SC, Yao TP. The histone deacetylase HDAC4 Nodin B, Fridberg M, Uhlén M, Jirström K. Discovery of connects neural activity to muscle transcriptional dachshund 2 protein as a novel biomarker of poor reprogramming. J Biol Chem. 2007 Nov 16;282(46):33752- prognosis in epithelial ovarian cancer. J Ovarian Res. 2012 9 Jan 27;5(1):6 Suzumori N, Pangas SA, Rajkovic A. Candidate genes for premature ovarian failure. Curr Med Chem. This article should be referenced as such: 2007;14(3):353-7 Huret JL. t(X;9)(q21;p13) PAX5/DACH2. Atlas Genet Coyaud E, Struski S, Prade N, Familiades J, Eichner R, Cytogenet Oncol Haematol. 2014; 18(8):608-610.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 610 Atlas of Genetics and Cytogenetics in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Deep Insight Section

Th17 cells: inflammation and regulation Kazuya Masuda, Tadamitsu Kishimoto Laboratory of Immune Regulation, Osaka University, World Premier International (WPI) Immunology Frontier Research Center (IFReC), 3-1 Yamadaoka, Suita, Osaka 565-0871, Japan (KM, TK)

Published in Atlas Database: February 2014 Online updated version : http://AtlasGeneticsOncology.org/Deep/Th17CellsID20132.html DOI: 10.4267/2042/54019 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2014 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Abstract IL-17-producing CD4 + T cells (Th17 cells) are understood to be a distinct lineage of CD4 + T helper (Th) cells, which play an important role in the host defense, tissue inflammation and autoimmunity. The identification of Th17 cells collapsed the concept of the previously held Th1/Th2 paradigm in infection and autoimmunity. Recent studies have provided new information on the role of Th17 cells in different autoimmune diseases and the mechanisms of Th17 cell differentiation. Th17 cells contribute to the exacerbation of autoimmune disease, whereas they possess a protective aspect against microbes such as bacteria and fungi. This suggests that Th17 cells can be broadly categorized as pathogenic or non-pathogenic. Naïve CD4 + T cells can differentiate into Th17 cells in synergy with IL-6 and TGF-β, while TGF-β induces regulatory T cells (iTreg), which appear to be mutually exclusive to Th17 cells. Here we describe the detail molecular mechanism of Th17 cell differentiation, including recently identified molecules, and discuss different roles of Th17 cells in infection, inflammation and autoimmunity in a cytokine milieu.

1- Introduction led to the expression of master transcription factor T-box (Tbx21, T-bet). + CD4 T cells play a pivotal role in host defense, but In Th2 cells, IL-4 enhanced Stat6 signaling, which are also recognized to have pathogenic roles such as upregulated the transcriptional factor GATA3. in autoimmunity, asthma, cancer and allergic T-bet inhibited Th2 differentiation by attenuating responses (Zhu et al., 2010). the function of GATA3, whereas GATA3 On activation by co-stimulatory molecules and contributed to the repression of Th1 cell lineage. + particular cytokines, naïve CD4 T cells can More recently, IL-17-producing T (Th17) cells, as a differentiate into the distinct lineage of T helper third of T cell lineages, have been identified (Th) cells with different immunological functions, (Harrington et al., 2005; Park et al., 2005). including Th1, Th2, Th17 cells, and regulatory T Although it was initially demonstrated that IL-23 cells (Treg). drives Th17 cell polarization via Stat3 activation in Th1 cell polarization was driven by IL-12 and IFN- the absence of IFN-γ, it was generally assumed that γ, and Th1 cells, which produced IFN-γ, elicited the effect of IL-23 was limited in effector and cell-mediated immunity against intracellular memory CD4 + T cells (Oppmann et al., 2000; pathogen, whereas Th2 cells, which secreted IL-4, Aggarwal et al., 2003; Langrish et al., 2005). IL-5, and IL-13 (Abbas et al., 1996), were induced Subsequently, the synergy between TGF-β and IL-6 by IL-4, and involved in immune responses against has been shown to efficiently induce the extracellular parasites such as helminthes and development of Th17 cells through Smad and Stat3 nematodes (Pearce et al., 2002). pathway, respectively (Bettelli et al., 2006; Th1 and Th2 cells were shown to be mutually Veldhoen et al., 2006). In contrast, TGF-β alone exclusive (Hwang et al., 2005). In Th1 cells, IL-12 converted naïve CD4 +CD25 - T cells into activated Stat4 and induced IFN production, which CD4 +CD25 + regulatory T cells (Chen et al., 2003).

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 611 Th17 cells: inflammation and regulation Masuda K, Kishimoto T

The immunopathogenesis of infection, played an important role in Th17 cell differentiation autoimmunity, and allergy has been extensively (Ciofani et al., 2012; Yosef et al., 2013). attributed to the concept of Th1/Th2 paradigm. BATF, which is a basic leucine zipper (b-Zip) However, it has been recently reported that CIA and transcription factor of the AP-1 protein family, EAE are exacerbated rather than improved under contributed to the generation of Th17 cells inhibition of Th1 cell-inducing condition such as (Schraml et al., 2009). It has recently been reported deficiency of IFN-γR, IL-12 p35 or Stat1 (Iwakura that BATF is a multifunctional transcriptional and Ishigame, 2006). Cua et al. has demonstrated factor, in which BATF is also required for the that IL-23 rather than IL-12 influences the critical generation of T follicular helper (Tfh) cells but not pathogenic effect on autoimmunity such as EAE. Th1 cells and Treg cells (Betz et al., 2010; Ise et al., Subsequently, by the same group, it has been shown 2011). More recently, BATF in cooperation with that IL-23 promotes the development and expansion IRF-4, which is also essential for the development of effector CD4 + T cells, which highly produce IL- of both Th2 and Th17 cells (Brüstle et al., 2009), 17, and IL-17 secreted from activated CD4 + T cells has been shown to be involved in the induction of play an important role in various autoimmune the IL10 , IL-17a , and IL-21 genes in T cells diseases (Langrich et al., 2005). (Glasmacher et al., 2012; Li et al., 2012; Tussiwand The balance between Th17 and Treg cells is an et al., 2012; Murphy et al., 2013). Although it is important factor involved in the pathogenesis of still not clear whether the BATF gene is directly autoimmunity. Sakaguchi et al. initially regulated by Stat3 activation, recent studies have demonstrated that a population of CD4 +CD25 + T shown that IL-6 activates the function of cells derived from the thymus, known as nTreg, BATF/IRF4 complex (Koch et al., 2013). exhibited the inhibitory effect in immunity. TGF-β1 More recently, our group has also identified a key is required for the differentiation of both Treg and molecule, AT-rich interactive domain 5a (Arid5a), Th17 cells, whereas IL-6 suppresses Treg cell which is induced under Th17 cell-polarizing population and drives the development of Th17 condition. Arid5a deficiency inhibits the cells. This suggests a dichotomy between these differentiation of Th17 cells (unpublished data). cells (Bettelli et al., 2007). However, it still remains Our previous report has shown that Arid5a to be understood how IL-6 in combination with positively controls IL-6 mRNA through its 3'- TGF-β drives Th17 cell differentiation, and which untranslated region (UTR). IL-6 serum level in cytokine milieu makes Th17 cells "pathogenic" in Arid5a deficient mice was dramatically reduced vivo. In this review, we discuss the mechanism of after LPS injection compared to WT mice, and EAE Th17 cell differentiation, its plasticity and was also ameliorated, in which the frequency of pathogenicity in immune regulation, and its link Th17 cell population was inhibited, whereas that of with inflammatory disease and autoimmunity. Th1 cells was enhanced, but not Treg cells (Masuda 2- Regulation of Th17 polarization et al., 2013). IL-21 and IL-23 signaling The mechanism of Th17 differentiation has been IL-21 or IL-23 as well as IL-6 enhanced Stat3 extensively studied with respect to the activation in Th17 cells via IL-21R or IL-23R transcriptional regulation. Betteli et al. found that (Muranski et al., 2013). IL-21 has been shown to IL-6 but not IL-23 was a potent inducer for Th17 have pleiotropic effects on T cells and B cells cell differentiation in combination with TGF-β1. It (Leonard et al., 2005). IL-21 independent of IL-6 was initially shown that retinoic acid (RA)-related was able to drive naïve T cells into Th17 cells in orphan receptor γ thymus (Ror γt) was an essential the presence of TGF-β1 (Chen et al., 2007). transcriptional factor for identifying a distinct Nonetheless, IL-6 activates IL-21 expression in + lineage of CD4 T cells (Th17 cells), which naïve CD4 + T cells via Stat3 activation and IL-21 constitutively produced IL-17 in the lamina propria production is amplified under Th17 cell-inducing of the small intestine (Ivanov et al., 2006). condition through an autocrine-loop (Zhou et al., IL-6 signaling 2007; Nurieva et al., 2007). IL-6 mainly activates Stat3 via the Jak-Stat IL-23 is a heterodimeric cytokine composed of p19 pathway (Kishimoto, 2005). The role of Stat3 in and p40 subunits. IL-23 binds to IL-23R composed Th17 cell differentiation was extensively analyzed of IL-12R β1 and IL23R subunits (Parham et al., by chromatin immunoprecipitation and massive 2002), and mainly activates Stat3 through the Jak- parallel sequencing (ChIP-Seq), in which STAT3 stat pathway (Cesare et al., 2009). It was initially bound to the promoter of cytokine and reported that IL-23 contributed to the proliferation transcriptional genes including the Rorc , IL-17 , IL- of effector CD4 + T cells (Oppmann et al., 2000). 17F , Ahr and IL-21 genes. Possibly Stat3 also Subsequently, Parham et al. found that naïve CD4 + interacted with the BATF , IRF4 , and c-Maf genes T cells did not respond to IL-23, and express little (Durant et al., 2010). These transcriptional factors or no IL-23R.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 612 Th17 cells: inflammation and regulation Masuda K, Kishimoto T

Figure 1. Pathogenic Th17 cells were induced by different patterns of cytokines or a chemical, and displayed a unique character in the expression of possible master regulators and chemokine receptors, respectively. Naïve CD4 + T cells differentiate into Th17 cells, which mainly express Ror γt, in the presence of IL-6 and TGF-β1. The Th17 cells primarily produce IL-17, and secret IL-10. IL-23 drives the expansion and proliferation of Th17 cells, and activated Th17 cells secret IL-17, IL-22, and GM-CSF as well as TGF-β3, whereas the production of IL-10 is inhibited in such a pathogenic Th17 cells. A recent study has shown that sodium chloride is a strong enhancer of Th17 cells. The high salt-induced Th17 cells display highly pathogenic, and produce GM-CSF, TNF-α, and IL-2 as well as IL-9. Moreover, it has been reported that there is a direct pathway for the generation of pathogenic Th17 cells in the presence of IL-6 and TGF-β3. In the Th17 cells, the expression of GM-CSF, IL-23R, and Tbx21 is highly upregulated, while IL-10 expression is critically attenuated. These pathogenic Th17 cells commonly express Ror γt, T-bet, and IL-23 R. The Th17 cells under high-salt conditions express serum glucocorticoid kinase 1 (SGK1) downstream of IL-23R signaling, which critically contributes to the induction of pathogenic Th17 cells. Activated Th17 cells also express some chemokine receptors, including CCR4, CCR6 and CCR10. However, it still remains to be elucidated what kinds of key molecules could become master regulators in such a pathogenic Th17 cells.

Rather, IL-23R was induced in the process of Th17 TGF-β signaling polarization, and Th17 cell differentiation was Transforming growth factor β (TGF-β) has complex promoted by IL-23 (Betteli et al., 2006; Mangan et roles in cell growth and development (O'Kane and al., 2006; Veldhoen et al., 2006). Of note, IL-23 is Ferguson, 1997). TGF-β as well as IL-10 negatively one of the most important cytokines, which convert regulates immune responses including autoimmune the Th17 cells differentiated from naïve CD4 + T disease and inflammation (Letterio and Roberts, cells exposed to IL-6 and TGF-β1 into the 1998; Moore et al., 2001). It is currently understood "pathogenic" Th17 (Figure 1). It has been that there are at least three mammalian TGF-β confirmed that Th17 cells induced by IL-6 and isoforms (TGF-β1, 2, and 3). TGF-β is an essential TGF-β in the absence of IL-23 are not sufficient to factor for the generation of CD4 + CD25 + regulatory induce EAE (McGeachy et al., 2007), in which IL- T cells (iTreg), which express the forkhead/winged 23 diminished the expression of IL-10 produced helix transcription factor Foxp3 (Chen et al., 2003; from such "non-pathogenic" Th17 cells. This result Batteli et al., 2006; Hori et al., 2003). Notably, IL-2 suggests that IL-10 is a key molecule, which is required for the generation of iTreg (Zheng SG et distinguishes pathogenic Th17 from non-pathogenic al., 2007), whereas IL-2 signaling via Stat5 inhibits types (Figure 2). Consistent with this, Lee et al. and the differentiation of Th17 cells in vivo and in vitro Kleinewietfeld et al. have demonstrated that IL-10 by ameliorating IL-6 signaling pathway (Liao et al., expression in pathogenic Th17 is suppressed 2011; Chen et al., 2011; Laurence et al., 2007). compared to non-pathogenic ones. Furthermore, IL- The TGF-β superfamily activates not only Smad- 23 upregulated the Tbx-21 gene (encode T-bet) in dependent but also Smad-independent pathways pathogenic Th17 (Lee et al., 2012; Yang et al., (Derynck and Zhang, 2003). TGF β1 and TGF β3 2009; Kleinewietfeld et al., 2013). However, it bind type II receptors on T cells, which leads to the must be further investigated which molecules are activation of Smad1, 2, 3 and 5, although Smad2 critical for the generation and stability of and Smad3 are activated in a different way from the pathogenic Th17 under IL-23 signaling or other activation of Smad1 and Smad5 (Derynck and pathways (Figure 1). Zhang, 2003). As mentioned above, TGF β1

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 613 Th17 cells: inflammation and regulation Masuda K, Kishimoto T

induced the differentiation of Th17 cells in the natural ligands or toxic dioxins such as TCDD, Ahr presence of IL-6, although the Th17 cells did not functions as a transcriptional factor. Our group and show the pathogenicity in autoimmunity possibly two other groups found that Ahr is induced under due to the elevation of IL-10 production Th17 cell polarizing condition, and involved in (McGeachy et al., 2007). Of note, c-Maf, which is autoimmunity including EAE and CIA (Kimura et induced by TGF-β signaling (Rutz et al., 2011), al., 2008; Veldhoen et al., 2008; Quintanna et al., contributes to the generation of "non-pathogenic" 2008; Nakahama et al., 2011). Recently, our group Th17 cells, in which the expressions of Rora, also has shown the role of miR132/212 cluster Runx1, IL-1R1, Ccl6 and TNF-α are suppressed, induced by Ahr in the differentiation of Th17 cells whereas the expressions of IL-10, IL-9, Lif and (Nakahama et al., 2013). Although it still remains CTLA-4 are enhanced (Ciofani et al., 2012; Xu et to be understood how Ahr drives Th17 cell al., 2009), although it initially has been reported polarization in vivo, we have recently detailed role that c-Maf is required for the differentiation of of Ahr in immune responses, including the possible Th17 cells (Bauquet, 2009, Nat.Immunol.). Such mechanism of Ahr for Th17 cell differentiation recent data may shed light on the question of how (Nguyen et al., 2013). This was a unique Th17 cells switches from pathogenic into non- demonstration linking environment and pathogenic and vice versa in infection and autoimmunity. Recently, as an environmental factor autoimmunity (Figure 1), because non-pathogenic involved in autoimmunity, it has been reported that Th17 cells produce more IL-10 than pathogenic high salt diet might lead to autoimmunity, in which Th17 cells (McGeachy et al., 2007; Lee et al., sodium chloride accelerates EAE through induction 2012). of Th17 cells (Kleinewietfeld et al., 2013). In contrast, Lee et al. have recently shown that Retinoic acid (RA), a vitamin A metabolite, has TGF-β3 directly drives naïve CD4 + T cells into been shown to mediate reciprocal Th17 and Treg "pathogenic" Th17 cell in the presence of IL-6 (Lee cell differentiation (Mucida et al., 2007). RA with et al., 2012). In this report, TGF-β3-induced Th17 TGF-β contributed to stabilization of Treg cells, cells highly expressed T-bet and IL-23R, and the and negatively regulates Th17 cell differentiation expression of IL-10 was suppressed compared with (Takahashi et al., 2012). In contrast, RA promoted those of TGF-β1-induced Th17 cells (Figure 1). effector T cells via retinoic acid receptor α (Rora) TGF-β activated Smad1 and Smad5 rather than in vivo. Thus, RA controls a dichotomy between Smad2 and Smad3. These results suggest that Treg and Th17 cells in a concentration-dependent Smad1 and Smad5 pathway might be important for manner. the generation of pathogenic Th17 but not non- The mammalian target of rapamycin (mTOR) pathogenic cells. Further investigation of the signaling is involved in the maintenance and molecular mechanism of TGF-β3 signaling is able proliferation of Th17 cells (Chi et al., 2012). mTOR to lead to immunotherapy specifically targeting signaling is activated by TCR and/or IL-1β pathogenic Th17 cells. stimulation via Myd88 (Powell et al., 2012; Chang As mentioned above, IL-2 is a potent suppressor of et al., 2013), in which IRF4 expression was Th17 cell generation. TGF-β1 inhibited IL-2 regulated (Yao et al., 2013). As mentioned above, mediated Stat5 signaling (Bright et al., 1997), and the complex of BATF and IRF4 is essential for the also attenuated the expression of T-bet and generation of Th17 cells. BATF is rapidly induced GATA3, which resulted in elimination of Th1 or by TCR stimulation, and then BATF and IRF4 Th2 differentiation (Carsten et al., 2007). It has plays a synergistic role in setting the initial been also reported that TGF-β1 produced from transcriptional program, including chromatin CD4 + effector T cells, including Th17 cells, is remodeling and cooperation in accessibility of the essential for the differentiation and stabilization of transcriptional factors to target genes such as the Th17 cells (Gutcher et al., 2011). Thus, it seems IL-17 gene (Ciofani et al., 2012). that TGF-β1 is essential for initial Th17 IL-27 (a member of the IL-12 family of cytokines) polarization in vitro and in vivo. In contrast, it has signaling contributes to inhibition of Th17 been reported that TGF-β signaling is not necessary differentiation (Pot et al., 2011). IL-27 binds to a for the generation of pathogenic Th17 cells. Rather, receptor complex composed of WSX1 (IL-27R) and TGF-β1 inhibited the generation of pathogenic gp130, and in turn activates both Stat1 and Stat3. Th17 cells (Ghoreschi et al., 2010). IL-27 also induces IL-10 expression in CD4 + T Aryl hydrocarbon receptor (Ahr) signaling and cells, whereas IL-27 inhibits IL-17, IL-22, and GM- other signaling pathways CSF expression through suppression of Ror γt Aryl hydrocarbon receptor (Ahr) is a key factor for activation. Thus, IL-27 is a potent negative the development of Th17 and Th22 cells. Ahr, regulator of Th17 cell polarization. which normally resides in the cytoplasm, is a Taken together, a large number of transcriptional ligand-activated transcriptional factor. On factors control Th17 cell differentiation, in which a recognizing products of tryptophan metabolism as balance between the activation of Stat3 and other

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 614 Th17 cells: inflammation and regulation Masuda K, Kishimoto T

Stat families (Stat1, 4, 5, and 6) may be an et al., 2008). Infante-Duarte et al. suggested that important factor for driving Th17 cell effector CD4 + T cells primed by B. burgdorferi differentiation. Moreover, it is for future studies to highly produced IL-17 in inflammatory lesions, and decipher the molecular circuits and regulatory such cell-types were distinct from Th1 and Th2 cell networks in the differentiation of CD4 + T cells and types (Infante-Duarte et al., 2000). Following this the plasticity between different T cell lineages, initial demonstration, Ye at al. reported that IL-17 especially Th17 and Treg cells. A recent new secreted from CD4 + T cells protected against strategy for identifying regulatory networks Klebsiella pneumonia for host defense. controlling Th17 cell differentiation and the Role of IL-22 in Th17 cells plasticity have shown the existence of novel factors IL-22 as well as IL-17 plays a critical role in host including the Mina , Fas , Pou2af1 , Tsc22d3 , and defense and protecting against tissue damage. IL-22 Fosl2 genes and dynamism among key signaling is transmitted through a heterodimeric transcriptional regulators (Ciofani et al., 2012; receptor complex composed of IL-10R2 and IL- Yosef et al., 2013). 22R1 (Kotenko et al., 2001; Xie et al., 2000). IL- 22R is mainly expressed in epithelial tissues, 3- Role of Th17 cells in including keratinocytes, hepatocytes, and intestinal inflammation and respiratory epithelial cells, but not in immune It has been established that Th17 cells are critically cells (Aggawal et al., 2001; Ouyang et al., 2008; involved in the pathogenesis of autoimmunity, gut Rutz et al., 2013). The biological functions of IL-22 inflammation, tissue inflammation and cancer, are known to be protective against infection and whereas Th17 cells contributes to protection against inflammation because IL-22 contributes to tissue a variety of bacteria and fungi. Emerging data on maintenance, repair, and wound healing through the Th17-mediated diseases suggest that different types expression of anti-microbial, antiapototic proteins of IL-17-producing T cells exist in vivo, which and proteins involved in cell proliferation via IL- might be divided into pathogenic or non-pathogenic 22R in intestinal epithelial cells and goblet cells Th17 cells. (Rutz et al., 2013). Th17 cells produce IL-17 (IL-17A), IL-17F, IL- IL-22 plays a protective role against bacterial 17A/F heterodimers, IL-21, IL-22, and GM-CSF as infections. Neutralizing IL-22 secreted by the Th17 well as other chemokines such as CXC cytokines lineage led to the failure to clear pathogen from (Korn et al., 2009). In an early study, IL-17A and infected lung by K. pneumonia , and in turn the IL-22 secreted from activated T cells were early death of infected animals (Aujla et al., 2007). recognized as pro-inflammatory cytokines In this report, IL-17A produced from Th17 cells (Dumoutier et al., 2000a; Yao et al., 1995, Ouyang synergized with IL-22 to protect against bacteria.

Figure 2. The plasticity between Th17 cells and Treg, and various types of Th17 cells expanded by IL-23. TGF-β1 is required for the initial Th17 differentiation in the presence of IL-6. The Th17 cells produce IL-17 and IL-10. TGF-β1 also induces iTreg. In general, the plasticity of Th17 and Treg cells is tightly regulated in normal condition. However, once an antigen induces inflammation, macrophages and dendritic cells produce IL-23. IL-23 can convert non-pathogenic Th17 cells into pathogenic ones. In contrast, IL-23 can inhibit the generation of Treg cells. IL-23-induced Th17 cells convert different cytokine- producing Th17 cells. IL-6 synergized with IL-1 and IL-23 emerges IL-22 and IFN-γ- producing Th17 cells. IL-6 alone is enough to induce IL-22-producing T cells. IL-23 alone also promoted IFN-γ-producing T cells.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 615 Th17 cells: inflammation and regulation Masuda K, Kishimoto T

The coexpression of both IL-17 and IL-22 in Th17 types of effector Th17 cells reside in inflammatory cells are important for expression of antimicrobial lesions (Figure 2), a growing number of reports peptides, as mentioned above. have shown that IL-17 and IL-23 critically The expression pattern of IL-17 and IL-22 in CD4 + contribute to the pathogenesis of RA, in which IL- T cells, however, varies according to a cytokine 17A and IL-17F play an important role in joint milieu. IL-6 and/or IL-23 induced IL-22 expression inflammation and bone erosion. Arthritis associated in vitro in the absence of TGF-β (Qu et al., 2013). with psoriasis (psoriatic arthritis) is also dependent In contrast, TGF-β inhibited the expression of IL-22 on Th17 cells activated by IL-23 (Maeda et al., (Zheng Y et al., 2007), whereas TGF-β is essential 2012). for the differentiation of Th17 in the presence of IL- The elevation of IL-23 and IL-17 were detected in 6 (Figure 2). Moreover, IL-6 deficiency did not synovial fluid, synovial tissues and sera of RA affect the frequency of IL-22 cell population in vivo patients but not of osteoarthritis (Alfadhli, 2013). (Zenewicz et al., 2008). These results suggest that IL-23 is also pivotal for the onset of EAE (Cua et IL-22 is produced by not only Th17 cells but also al., 2003). IL-23 or IL-23R deficient mice were other immune cells. Therefore, not all Th17 cells resistant to EAE (Awasthi et al., 2009). IL-17A and might play a protective role for host defense IL-17F double knockout mice showed critical through IL-22 production. reduction of the development of EAE, whereas the Likewise, although IL-22 played a protective role in effect of IL-17F on EAE development is less than infection by various kinds of bacteria, including C. that of IL-17A in mice (Ishigame et al., 2007). rodentium , M. tuberculosis , and Salmonera More recently, Kang et al. has reported that IL-17 is typhimurium , the sources of IL-22 was assumed to involved in perturbation of the maturation of be not from Th17 cells (Zheng et al., 2008; Schulz oligodendrocyte lineage cells, which might lead to et al., 2008; Dhiman et al., 2009). Moreover, NK inflammation and neurodegeneration in MS. cells as well as CD4 + T cells are involved in Pathogenic Th17 cells produce GM-CSF (Figure 1), protection against IBD by IL-22, whereas IL-17A which is an important cytokine for induction of IL- contributed to exacerbation of IBD (Zenewicz et al., 23 in dendritic cells (McGeachy et al., 2011). It has 2008). In contrast, IL-22 produced from effector been reported that neutralizing GM-CSF at the Th17 cells contributed to promotion of CD-like effector stage results in suppression of the further experimental colitis (Yen et al., 2006; Strober et al., development of EAE (El-Behi et al., 2011). Thus, 2007). In line with these reports, Ahern et al. has GM-CSF is also required for the maintenance and demonstrated that IL-23 promotes intestinal expansion of Th17 cells possibly through the inflammation through directly enhancing the enhancement of IL-23. development of effector Th17 cells, which secret Th17 cells in host defense IL-17, IFN-γ and possibly IL-22 (Figure 2). Th17 cells were increased at the mucosal sites after Moreover, IL-22-expressing Th17 cells transferred infection (Happel et al., 2005; Mangan et al., 2006). into IL-22 deficient host mice provided protection So far, it has been demonstrated that Th17 cells are against hepatitis, whereas IL-17 had no apparent involved in protection against a variety of bacteria role in liver inflammation (Zenewicz et al., 2007). such as Candida albicans , Staphylococcus aureus , However, Xu et al. and Nagata et al. have shown Citrobacter rodentium , Salmonella and Bordetella that IL-17 is required for the development of pertusis (Peck and Mellins, 2010). However, the hepatitis. Although these reports appear to be role of IL-17 and Th17 cells in protection against contradictory, CD4 + T cells, which dominantly Asperillus fumigatus and other fungi are diverse produce IL-22 rather than IL-17, might be and controversial (Muranski et al., 2013). One of protective against hepatitis, whereas IL-23-induced the reasons is that the inflammatory milieu for the Th17 cells might have the pathogenicity in liver generation of Th17 cells is different in infection by inflammation. In agreement with this, Zheng Y et different types of fungi, in which macrophages and al. has reported that the production of IL-17 and IL- dendritic cells recognize different kinds of fungal 22 from Th17 cells is differentially controlled, and pattern recognition receptors (PRRs) such as Th17 cells enhanced by IL-23, which produce IL- Dectin-1, Dectin-2, Mincle and MR, and produce 22, are essential for dermal inflammation and inflammatory cytokines for Th17 polarization, acanthosis. including IL-6, IL-1β, TNF-α and IL-23 as well as IL-23/Th17 axis GM-CSF (Wüthrich et al., 2012). Zielinski et al. The IL-23/Th17 axis is clearly involved in various has reported that by eliciting different cytokines autoimmune diseases, including rheumatoid respectively, C. albicans and S. aureus prime arthritis, multiple sclerosis, psoriasis, and IBD different types of IL-17-producing T cells "Th17" (Iwakura and Ishigame, 2006). IL-23 plays an cells that produce IFN-γ or IL-10 respectively, important role in the maintenance and expansion of which might be significant for answering the Th17 cells, and makes Th17 cells "pathogenic" question of what makes pathogenic or non- (Figure1). As mentioned above, although different pathogenic Th17 cells.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 616 Th17 cells: inflammation and regulation Masuda K, Kishimoto T

Th17 cells in cancer differentiation. Zheng has indicated that IL-6 can The role of Th17 cells in cancer displays convert nTregs into Th17 cells, and other CD4 + T complexity in various types of tumor immunity. cells (Zheng, 2013). It is notable that IL-6 plays a Although it seems that the pathogenic role of IL-23- critical role in conversion of Foxp3+ CD4 + T cells induced Th17 cells has been consistently into pathogenic Th17 cells in autoimmune arthritis documented in autoimmunity, Th17 cells in cancer (Komatsu et al., 2014). Th17 cell expansion is also display both anti-tumorigenic and pro-tumorigenic regulated by TGF β1 secreted from Th17 cells itself functions (Zou and Restifo, 2010). Administration but not Treg cells (Gutcher et al., 2011). Rather, it of IL-23 and IL-23-producing dendritic cells, has seems that high concentration of TGF-β reduces been reported to inhibit tumor growth (Kaiga et al., Th17 cell populations (Zhou et al., 2008). 2007; Hu et al., 2006), whereas IL-23 has been The concentration of TGF-β1 is one of the shown to promote tumor incidence and growth important factors, which drives or inhibits the (Langowski et al., 2006). The role of IL-17 in differentiation of Th17 cells (Zhou et al., 2008). tumor immunity is also controversial, although the High levels of TGF-β1 inhibited Th17 cell source of IL-17 is not only Th17 cells, but also differentiation and enhanced the development of other types of T cells, including CD8 + T cells iTreg through high expression of Foxp3. In such a (known as Tc17 cells) and Ror γt+ Foxp3 + T cells cytokine milieu, Foxp3 induced by TGF-β (Li and Boussiotis, 2013). IL-17 enhanced tumor interacted with Ror γt, and in turn antagonized the growth through the promotion of tumor function of Ror γt in CD4 + T cells, in which the vasculization, especially in some immune-deficient expression of IL-23R, IL-22 and IL-17 was mice (Zou and Restio, 2010). In contrast, in repressed (Zhou and Littmann, 2009). In contrast, at immunocompetent mice, IL-17 played a protective low concentrations, TGF-β1 was helpful for the role against tumor growth (Benchetrit et al., 2002; generation of Th17 cells in synergy with IL-6 or IL- Kryczek et al., 2009; Hirahata et al., 2001). 21 (Zhou et al., 2008), although it is still not clear Although Th17 cells are present in tumor how IL-6 or IL-21 overcomes the inhibitory effect microenvironment, the number of Th17 cells of Foxp3 on Ror γt function. Runx-1 controls the represents a minor population of effector T cells differentiation of Th17 cells thorough binding both (Kryczek et al., 2007), suggesting that the Foxp3 and Ror γt (Zhang et al., 2008). The frequency of Th17 cell population is tightly interaction of Runx-1 with Ror γt promoted the regulated in tumor immunity. The number of Treg transcription of the IL-17 gene, whereas Foxp3 and Th17 cells inversely correlates in the same inhibited Ror γt- and Runx-1-induced IL-17 tumor (Zou and Restifo, 2010). It has also been expression by binding to Runx-1 (Zhang et al., reported that, in the microenvironment of ulcerative 2008), suggesting that the role of Runx-1 is also coloitis (UC) and associated colon cancer, not only dependent on the concentration of TGF-β1. + + Th17 cells but also IL-17 Foxp3 T cells are 4- Therapy (treatment of Th17- detected (Kryczek et al., 2011). Thus, the character of IL-17-producing CD4 + T cells might be dependent autoimmunity) classified more precisely in the context of tumor A great number of recent studies have revealed that immunity. the biology of Th17 cells in mice is broadly Balance between Th17 cells and Treg in common with phenomena in humans (Tesmer et al., autoimmunity 2008; Jong et al., 2010). Th17 cells in humans play It seems that there is no doubt that Treg cells play a an important role in the pathogenesis of rheumatoid critical suppressive role in immune responses in arthritis, psoriasis, asthma, inflammatory bowel vitro and in vivo (Shevach et al., 2009; Vignali et disease (IBD) and transplantation rejection. al., 2008). Treg cells are a potent inducer of IL-10 Accordingly, blocking pro-inflammatory cytokines, and TGF-β1, resulting in suppression of effector T including IL-6, IL-1β, IL-23, and IL-17 as well as cell functions. However, the balance between Th17 GM-CSF, will lead to the abatement of tissue and Treg cells in vivo is dependent on the context inflammation, gut inflammation and autoimmunity. of inflammatory disease. The existence of Treg Several anti-IL-17A monoclonal antibodies, cells does not always suppress the function of Th17 including secukinumab and ixekizumab, and anti- cells. Treg promoted Th17 cell development IL-17A receptor monoclonal antibody, brodalumab through IL-2 regulation rather than control of have been treated to patients in the process of phase TGF β1 (Pandiyan et al., 2011; Chen et al., 2011). II clinical trials (Kellner et al., 2013). Secukinumab IL-2 is a critical cytokine in deciding a dichotomy is most likely to be clinically efficacious in RA. An between Th17 and Treg cells. Treg cells induced by anti-IL-1β monoclonal antibody, gevokizumab is IL-2 combined with TGF-β or all-trans retinoic currently being investigated in a Phase â…¡ clinical acid, were resistant to Th17 cells (Muchida et al., program. An anti-IL-12/IL-23 monoclonal 2007; Zheng et al., 2008; Zhou et al., 2010). antibody, usutekinumab has been demonstrated the Conversely, IL-6 is a strong inducer of Th17 cells high efficacy in the treatment of patients with

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 617 Th17 cells: inflammation and regulation Masuda K, Kishimoto T

psoriasis (Krueger et al., 2007). An anti-GM-CSF dramatically improved since the original concept of monoclonal antibody, mavrilimumab for treatment a Th1/Th2 paradigm. However, emerging data on of rheumatoid arthritis has shown promising results Th17 cells have revealed that IL-17-producing under phase II clinical trial (Burmester et al., 2013). CD4 + T cells are not simple cell population. Th17 In the future, emerging data will establish the cells are classified into pathogenic or non- efficacy of these monoclonal antibodies against pathogenic ones. IL-23 is a critical factor, which several autoimmune diseases such as rheumatoid enhances the pathogenecity of Th17 cells. Recent arthritis. data suggests that TGF-β3 and sodium chloride as IL-6 is involved in the initial differentiation of well as IL-23 are involved in the generation of Th17 cells (Betteli et al., 2006). In mice, blockade pathogenic Th17 cells. In contrast, TGF β1 secreted of IL-6 pathway has been shown to result in a from Treg cells inhibits the conversion into decrease of the frequency of Th17 cell population pathogenic Th17 cells by attenuating IL-23 (Nowell et al., 2009; Serada et al., 2009). A production from activated macrophages and humanized anti-IL-6 receptor antibody dendritic cells, whereas TGF-β1 is essential for the (Tocilizumab, TCZ) displayed a remarkable initial induction of Th17 cells. Moreover, the protective effect in patients with rheumatoid concentration of TGF β1 is essential for the arthritis as well as Castleman's disease and juvenile plasticity of Th17 and Treg cells. Taken together, idiopathic arthritis (Genovese et al., 2008; Tanaka Th17 cells play a pathogenic or protective role in et al., 2012). Although the biological effect of TCZ infection and inflammatory disease in an antigen- on human autoimmune disease is complex (Tanaka dependent manner. Consequently, to identify which et al., 2013), Samon et al. have demonstrated TCZ molecules and signaling pathways are critical for affects the IL-6/Th17 axis in patients with the generation of pathogenic Th17 cells, will lead to rheumatoid arthritis, in which the ratio of Th17 the development of more efficacious therapeutic cells to Treg cells was significantly reduced. drugs for Th17 cell-dependent inflammatory Therefore, administration of IL-6 blockade (TCZ) disease. might be highly efficacious against not only such diseases as mentioned above, but also Th17 cell- References dependent diseases, including IBD and psoriasis, Sakaguchi S, Sakaguchi N, Asano M, Itoh M, Toda M. and cancer. Immunologic self-tolerance maintained by activated T cells On the contrary, although elevation of IL-6 level in expressing IL-2 receptor alpha-chains (CD25). Breakdown inflammatory lesions leads to the exacerbation of of a single mechanism of self-tolerance causes various autoimmunity, it remains to be understood why IL- autoimmune diseases. J Immunol. 1995 Aug 1;155(3):1151-64 6 is overproduced in autoimmune disease such as rheumatoid arthritis. A recent report has shown that Yao Z, Fanslow WC, Seldin MF, Rousseau AM, Painter posttranscriptional regulation of IL-6 production is SL, Comeau MR, Cohen JI, Spriggs MK. Herpesvirus Saimiri encodes a new cytokine, IL-17, which binds to a essential for immune homeostasis. Zc3h12a (known novel cytokine receptor. Immunity. 1995 Dec;3(6):811-21 as Regnase-1, MCPIP) constitutively degrades level Abbas AK, Murphy KM, Sher A. Functional diversity of of IL-6 mRNA trough binding to its 3'UTR, helper T lymphocytes. Nature. 1996 Oct whereas Zc3h12a deficiency led to spontaneous 31;383(6603):787-93 autoimmunity (Matsushita et al., 2009). Moreover, Bright JJ, Kerr LD, Sriram S. TGF-beta inhibits IL-2- our recent study has shown that Arid5a controls IL- induced tyrosine phosphorylation and activation of Jak-1 6 level in vivo through stabilization of IL-6 mRNA. and Stat 5 in T lymphocytes. J Immunol. 1997 Jul Arid5a deficient mice are resistant to EAE, in 1;159(1):175-83 which the frequency of Th17 cell population is O'Kane S, Ferguson MW. Transforming growth factor beta dramatically reduced (Masuda et al, 2013, PNAS). s and wound healing. Int J Biochem Cell Biol. 1997 Notably, Arid5a counteracted the destabilization Jan;29(1):63-78 effect of Zc3h12a (Masuda et al., 2013). Letterio JJ, Roberts AB. Regulation of immune responses Consequently, imbalance between Arid5a and by TGF-beta. Annu Rev Immunol. 1998;16:137-61 Zc3h12a in vivo might be involved in Dumoutier L, Louahed J, Renauld JC. Cloning and autoimmunity. Given that administration of TCZ is characterization of IL-10-related T cell-derived inducible efficacious against several autoimmune diseases, factor (IL-TIF), a novel cytokine structurally related to IL-10 the monoclonal antibody targeting Arid5a might be and inducible by IL-9. J Immunol. 2000 Feb 15;164(4):1814-9 also clinically useful. Concluding remarks Infante-Duarte C, Horton HF, Byrne MC, Kamradt T. + Microbial lipopeptides induce the production of IL-17 in Th Since IL-17-producing CD4 T cells have been cells. J Immunol. 2000 Dec 1;165(11):6107-15 shown to be involved in various types of inflammatory diseases, our understanding of the Oppmann B, Lesley R, Blom B, Timans JC, Xu Y, Hunte B, Vega F, Yu N, Wang J, Singh K, Zonin F, Vaisberg E, pathogenesis of such diseases as rheumatoid Churakova T, Liu M, Gorman D, Wagner J, Zurawski S, Liu arthritis, multiple sclerosis, and psoriasis, has been Y, Abrams JS, Moore KW, Rennick D, de Waal-Malefyt R,

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 618 Th17 cells: inflammation and regulation Masuda K, Kishimoto T

Hannum C, Bazan JF, Kastelein RA. Novel p19 protein Happel KI, Dubin PJ, Zheng M, Ghilardi N, Lockhart C, engages IL-12p40 to form a cytokine, IL-23, with biological Quinton LJ, Odden AR, Shellito JE, Bagby GJ, Nelson S, activities similar as well as distinct from IL-12. Immunity. Kolls JK. Divergent roles of IL-23 and IL-12 in host defense 2000 Nov;13(5):715-25 against Klebsiella pneumoniae. J Exp Med. 2005 Sep 19;202(6):761-9 Xie MH, Aggarwal S, Ho WH, Foster J, Zhang Z, Stinson J, Wood WI, Goddard AD, Gurney AL. Interleukin (IL)-22, a Harrington LE, Hatton RD, Mangan PR, Turner H, Murphy novel human cytokine that signals through the interferon TL, Murphy KM, Weaver CT. Interleukin 17-producing receptor-related proteins CRF2-4 and IL-22R. J Biol Chem. CD4+ effector T cells develop via a lineage distinct from 2000 Oct 6;275(40):31335-9 the T helper type 1 and 2 lineages. Nat Immunol. 2005 Nov;6(11):1123-32 Aggarwal S, Xie MH, Maruoka M, Foster J, Gurney AL. Acinar cells of the pancreas are a target of interleukin-22. J Hwang ES, Szabo SJ, Schwartzberg PL, Glimcher LH. T Interferon Cytokine Res. 2001 Dec;21(12):1047-53 helper cell fate specified by kinase-mediated interaction of T-bet with GATA-3. Science. 2005 Jan 21;307(5708):430-3 Kotenko SV, Izotova LS, Mirochnitchenko OV, Esterova E, Dickensheets H, Donnelly RP, Pestka S. Identification of Kishimoto T. Interleukin-6: from basic science to medicine- the functional interleukin-22 (IL-22) receptor complex: the -40 years in immunology. Annu Rev Immunol. 2005;23:1- IL-10R2 chain (IL-10Rbeta ) is a common chain of both the 21 IL-10 and IL-22 (IL-10-related T cell-derived inducible factor, IL-TIF) receptor complexes. J Biol Chem. 2001 Jan Langrish CL, Chen Y, Blumenschein WM, Mattson J, 26;276(4):2725-32 Basham B, Sedgwick JD, McClanahan T, Kastelein RA, Cua DJ. IL-23 drives a pathogenic T cell population that Moore KW, de Waal Malefyt R, Coffman RL, O'Garra A. induces autoimmune inflammation. J Exp Med. 2005 Jan Interleukin-10 and the interleukin-10 receptor. Annu Rev 17;201(2):233-40 Immunol. 2001;19:683-765 Leonard WJ, Spolski R. Interleukin-21: a modulator of Ye P, Rodriguez FH, Kanaly S, Stocking KL, Schurr J, lymphoid proliferation, apoptosis and differentiation. Nat Schwarzenberger P, Oliver P, Huang W, Zhang P, Zhang Rev Immunol. 2005 Sep;5(9):688-98 J, Shellito JE, Bagby GJ, Nelson S, Charrier K, Peschon JJ, Kolls JK. Requirement of interleukin 17 receptor Park H, Li Z, Yang XO, Chang SH, Nurieva R, Wang YH, signaling for lung CXC chemokine and granulocyte colony- Wang Y, Hood L, Zhu Z, Tian Q, Dong C. A distinct lineage stimulating factor expression, neutrophil recruitment, and of CD4 T cells regulates tissue inflammation by producing host defense. J Exp Med. 2001 Aug 20;194(4):519-27 interleukin 17. Nat Immunol. 2005 Nov;6(11):1133-41 Benchetrit F, Ciree A, Vives V, Warnier G, Gey A, Sautès- Bettelli E, Carrier Y, Gao W, Korn T, Strom TB, Oukka M, Fridman C, Fossiez F, Haicheur N, Fridman WH, Tartour Weiner HL, Kuchroo VK. Reciprocal developmental E. Interleukin-17 inhibits tumor cell growth by means of a pathways for the generation of pathogenic effector TH17 T-cell-dependent mechanism. Blood. 2002 Mar and regulatory T cells. Nature. 2006 May 15;99(6):2114-21 11;441(7090):235-8 Parham C, Chirica M, Timans J, Vaisberg E, Travis M, Hu J, Yuan X, Belladonna ML, Ong JM, Wachsmann- Cheung J, Pflanz S, Zhang R, Singh KP, Vega F, To W, Hogiu S, Farkas DL, Black KL, Yu JS. Induction of potent Wagner J, O'Farrell AM, McClanahan T, Zurawski S, antitumor immunity by intratumoral injection of interleukin Hannum C, Gorman D, Rennick DM, Kastelein RA, de 23-transduced dendritic cells. Cancer Res. 2006 Sep Waal Malefyt R, Moore KW. A receptor for the 1;66(17):8887-96 heterodimeric cytokine IL-23 is composed of IL-12Rbeta1 Ivanov II, McKenzie BS, Zhou L, Tadokoro CE, Lepelley A, and a novel cytokine receptor subunit, IL-23R. J Immunol. Lafaille JJ, Cua DJ, Littman DR.. The orphan nuclear 2002 Jun 1;168(11):5699-708 receptor RORgammat directs the differentiation program of Pearce EJ, MacDonald AS. The immunobiology of proinflammatory IL-17+ T helper cells. Cell. 2006 Sep schistosomiasis. Nat Rev Immunol. 2002 Jul;2(7):499-511 22;126(6):1121-33. Aggarwal S, Ghilardi N, Xie MH, de Sauvage FJ, Gurney Iwakura Y, Ishigame H.. The IL-23/IL-17 axis in AL. Interleukin-23 promotes a distinct CD4 T cell activation inflammation. J Clin Invest. 2006 May;116(5):1218-22. state characterized by the production of interleukin-17. J Langowski JL, Zhang X, Wu L, Mattson JD, Chen T, Smith Biol Chem. 2003 Jan 17;278(3):1910-4 K, Basham B, McClanahan T, Kastelein RA, Oft M.. IL-23 Chen W, Jin W, Hardegen N, Lei KJ, Li L, Marinos N, promotes tumour incidence and growth. Nature. 2006 Jul McGrady G, Wahl SM. Conversion of peripheral 27;442(7101):461-5. Epub 2006 May 10. CD4+CD25- naive T cells to CD4+CD25+ regulatory T Mangan PR, Harrington LE, O'Quinn DB, Helms WS, cells by TGF-beta induction of transcription factor Foxp3. J Bullard DC, Elson CO, Hatton RD, Wahl SM, Schoeb TR, Exp Med. 2003 Dec 15;198(12):1875-86 Weaver CT.. Transforming growth factor-beta induces Cua DJ, Sherlock J, Chen Y, Murphy CA, Joyce B, development of the T(H)17 lineage. Nature. 2006 May Seymour B, Lucian L, To W, Kwan S, Churakova T, 11;441(7090):231-4. Epub 2006 Apr 30. Zurawski S, Wiekowski M, Lira SA, Gorman D, Kastelein Veldhoen M, Hocking RJ, Atkins CJ, Locksley RM, RA, Sedgwick JD. Interleukin-23 rather than interleukin-12 Stockinger B.. TGFbeta in the context of an inflammatory is the critical cytokine for autoimmune inflammation of the cytokine milieu supports de novo differentiation of IL-17- brain. Nature. 2003 Feb 13;421(6924):744-8 producing T cells. Immunity. 2006 Feb;24(2):179-89. Derynck R, Zhang YE. Smad-dependent and Smad- Yen D, Cheung J, Scheerens H, Poulet F, McClanahan T, independent pathways in TGF-beta family signalling. McKenzie B, Kleinschek MA, Owyang A, Mattson J, Nature. 2003 Oct 9;425(6958):577-84 Blumenschein W, Murphy E, Sathe M, Cua DJ, Kastelein Hori S, Nomura T, Sakaguchi S. Control of regulatory T RA, Rennick D.. IL-23 is essential for T cell-mediated cell development by the transcription factor Foxp3. colitis and promotes inflammation via IL-17 and IL-6. J Clin Science. 2003 Feb 14;299(5609):1057-61 Invest. 2006 May;116(5):1310-6.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 619 Th17 cells: inflammation and regulation Masuda K, Kishimoto T

Bettelli E, Oukka M, Kuchroo VK.. T(H)-17 cells in the Zhou L, Ivanov II, Spolski R, Min R, Shenderov K, Egawa circle of immunity and autoimmunity. Nat Immunol. 2007 T, Levy DE, Leonard WJ, Littman DR.. IL-6 programs T(H)- Apr;8(4):345-50. (REVIEW) 17 cell differentiation by promoting sequential engagement of the IL-21 and IL-23 pathways. Nat Immunol. 2007 Brustle A, Heink S, Huber M, Rosenplanter C, Stadelmann Sep;8(9):967-74. Epub 2007 Jun 20. C, Yu P, Arpaia E, Mak TW, Kamradt T, Lohoff M.. The development of inflammatory T(H)-17 cells requires Aujla SJ, Chan YR, Zheng M, Fei M, Askew DJ, Pociask interferon-regulatory factor 4. Nat Immunol. 2007 DA, Reinhart TA, McAllister F, Edeal J, Gaus K, Husain S, Sep;8(9):958-66. Epub 2007 Aug 5. Kreindler JL, Dubin PJ, Pilewski JM, Myerburg MM, Mason CA, Iwakura Y, Kolls JK.. IL-22 mediates mucosal host Chen Z, Laurence A, O'Shea JJ.. Signal transduction defense against Gram-negative bacterial pneumonia. Nat pathways and transcriptional regulation in the control of Med. 2008 Mar;14(3):275-81. doi: 10.1038/nm1710. Epub Th17 differentiation. Semin Immunol. 2007 Dec;19(6):400- 2008 Feb 10. 8. doi: 10.1016/j.smim.2007.10.015. Epub 2007 Dec 31. (REVIEW) Genovese MC, McKay JD, Nasonov EL, Mysler EF, da Silva NA, Alecock E, Woodworth T, Gomez-Reino JJ.. Kaiga T, Sato M, Kaneda H, Iwakura Y, Takayama T, Interleukin-6 receptor inhibition with tocilizumab reduces Tahara H.. Systemic administration of IL-23 induces potent disease activity in rheumatoid arthritis with inadequate antitumor immunity primarily mediated through Th1-type response to disease-modifying antirheumatic drugs: the response in association with the endogenously expressed tocilizumab in combination with traditional disease- IL-12. J Immunol. 2007 Jun 15;178(12):7571-80. modifying antirheumatic drug therapy study. Arthritis Krueger GG, Langley RG, Leonardi C, Yeilding N, Guzzo Rheum. 2008 Oct;58(10):2968-80. doi: 10.1002/art.23940. C, Wang Y, Dooley LT, Lebwohl M; CNTO 1275 Psoriasis Kimura A, Naka T, Nohara K, Fujii-Kuriyama Y, Kishimoto Study Group.. A human interleukin-12/23 monoclonal T.. Aryl hydrocarbon receptor regulates Stat1 activation antibody for the treatment of psoriasis. N Engl J Med. 2007 and participates in the development of Th17 cells. Proc Feb 8;356(6):580-92. Natl Acad Sci U S A. 2008 Jul 15;105(28):9721-6. doi: Kryczek I, Wei S, Zou L, Altuwaijri S, Szeliga W, Kolls J, 10.1073/pnas.0804231105. Epub 2008 Jul 7. Chang A, Zou W.. Cutting edge: Th17 and regulatory T cell Nagata T, McKinley L, Peschon JJ, Alcorn JF, Aujla SJ, dynamics and the regulation by IL-2 in the tumor Kolls JK.. Requirement of IL-17RA in Con A induced microenvironment. J Immunol. 2007 Jun 1;178(11):6730-3. hepatitis and negative regulation of IL-17 production in Laurence A, Tato CM, Davidson TS, Kanno Y, Chen Z, mouse T cells. J Immunol. 2008 Dec 1;181(11):7473-9. Yao Z, Blank RB, Meylan F, Siegel R, Hennighausen L, Ouyang W, Kolls JK, Zheng Y.. The biological functions of Shevach EM, O'shea JJ.. Interleukin-2 signaling via T helper 17 cell effector cytokines in inflammation. STAT5 constrains T helper 17 cell generation. Immunity. Immunity. 2008 Apr;28(4):454-67. doi: 2007 Mar;26(3):371-81. 10.1016/j.immuni.2008.03.004. (REVIEW) McGeachy MJ, Bak-Jensen KS, Chen Y, Tato CM, Quintana FJ1, Basso AS, Iglesias AH, Korn T, Farez MF, Blumenschein W, McClanahan T, Cua DJ.. TGF-beta and Bettelli E, Caccamo M, Oukka M, Weiner HL.. Control of IL-6 drive the production of IL-17 and IL-10 by T cells and T(reg) and T(H)17 cell differentiation by the aryl restrain T(H)-17 cell-mediated pathology. Nat Immunol. hydrocarbon receptor. Nature. 2008 May 1;453(7191):65- 2007 Dec;8(12):1390-7. Epub 2007 Nov 11. 71. doi: 10.1038/nature06880. Epub 2008 Mar 23. Mucida D, Park Y, Kim G, Turovskaya O, Scott I, Schulz SM, Kohler G, Schutze N, Knauer J, Straubinger Kronenberg M, Cheroutre H.. Reciprocal TH17 and RK, Chackerian AA, Witte E, Wolk K, Sabat R, Iwakura Y, regulatory T cell differentiation mediated by retinoic acid. Holscher C, Muller U, Kastelein RA, Alber G.. Protective Science. 2007 Jul 13;317(5835):256-60. Epub 2007 Jun immunity to systemic infection with attenuated Salmonella 14. enterica serovar enteritidis in the absence of IL-12 is Nurieva R, Yang XO, Martinez G, Zhang Y, Panopoulos associated with IL-23-dependent IL-22, but not IL-17. J AD, Ma L, Schluns K, Tian Q, Watowich SS, Jetten AM, Immunol. 2008 Dec 1;181(11):7891-901. Dong C.. Essential autocrine regulation by IL-21 in the Serada S, Fujimoto M, Mihara M, Koike N, Ohsugi Y, generation of inflammatory T cells. Nature. 2007 Jul Nomura S, Yoshida H, Nishikawa T, Terabe F, Ohkawara 26;448(7152):480-3. Epub 2007 Jun 20. T, Takahashi T, Ripley B, Kimura A, Kishimoto T, Naka T.. Strober W, Fuss I, Mannon P.. The fundamental basis of IL-6 blockade inhibits the induction of myelin antigen- inflammatory bowel disease. J Clin Invest. 2007 specific Th17 cells and Th1 cells in experimental Mar;117(3):514-21. (REVIEW) autoimmune encephalomyelitis. Proc Natl Acad Sci U S A. 2008 Jul 1;105(26):9041-6. doi: Zenewicz LA, Yancopoulos GD, Valenzuela DM, Murphy 10.1073/pnas.0802218105. Epub 2008 Jun 24. AJ, Karow M, Flavell RA.. Interleukin-22 but not interleukin-17 provides protection to hepatocytes during Tesmer LA, Lundy SK, Sarkar S, Fox DA.. Th17 cells in acute liver inflammation. Immunity. 2007 Oct;27(4):647-59. human disease. Immunol Rev. 2008 Jun;223:87-113. doi: Epub 2007 Oct 4. 10.1111/j.1600-065X.2008.00628.x. (REVIEW) Zheng SG, Wang J, Wang P, Gray JD, Horwitz DA.. IL-2 is Veldhoen M, Hirota K, Westendorf AM, Buer J, Dumoutier essential for TGF-beta to convert naive CD4+CD25- cells L, Renauld JC, Stockinger B.. The aryl hydrocarbon to CD25+Foxp3+ regulatory T cells and for expansion of receptor links TH17-cell-mediated autoimmunity to these cells. J Immunol. 2007 Feb 15;178(4):2018-27. environmental toxins. Nature. 2008 May 1;453(7191):106- 9. doi: 10.1038/nature06881. Epub 2008 Mar 23. Zheng Y, Danilenko DM, Valdez P, Kasman I, Eastham- Anderson J, Wu J, Ouyang W.. Interleukin-22, a T(H)17 Vignali DA, Collison LW, Workman CJ.. How regulatory T cytokine, mediates IL-23-induced dermal inflammation and cells work. Nat Rev Immunol. 2008 Jul;8(7):523-32. doi: acanthosis. Nature. 2007 Feb 8;445(7128):648-51. Epub 10.1038/nri2343. (REVIEW) 2006 Dec 24. Zenewicz LA, Yancopoulos GD, Valenzuela DM, Murphy

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 620 Th17 cells: inflammation and regulation Masuda K, Kishimoto T

AJ, Stevens S, Flavell RA.. Innate and adaptive during Th17 polarization. J Immunol. 2009 May interleukin-22 protects mice from inflammatory bowel 15;182(10):6226-36. doi: 10.4049/jimmunol.0900123. disease. Immunity. 2008 Dec 19;29(6):947-57. doi: 10.1016/j.immuni.2008.11.003. Yang Y, Weiner J, Liu Y, Smith AJ, Huss DJ, Winger R, Peng H, Cravens PD, Racke MK, Lovett-Racke AE.. T-bet Zheng Y, Valdez PA, Danilenko DM, Hu Y, Sa SM, Gong is essential for encephalitogenicity of both Th1 and Th17 Q, Abbas AR, Modrusan Z, Ghilardi N, de Sauvage FJ, cells. J Exp Med. 2009 Jul 6;206(7):1549-64. doi: Ouyang W.. Interleukin-22 mediates early host defense 10.1084/jem.20082584. Epub 2009 Jun 22. against attaching and effacing bacterial pathogens. Nat Med. 2008 Mar;14(3):282-9. doi: 10.1038/nm1720. Epub Zhou L, Littman DR.. Transcriptional regulatory networks in 2008 Feb 10. Th17 cell differentiation. Curr Opin Immunol. 2009 Apr;21(2):146-52. doi: 10.1016/j.coi.2009.03.001. Epub Zhang F, Meng G, Strober W.. Interactions among the 2009 Mar 26. (REVIEW) transcription factors Runx1, RORgammat and Foxp3 regulate the differentiation of interleukin 17-producing T Korn T, Bettelli E, Oukka M, Kuchroo VK.. IL-17 and Th17 cells. Nat Immunol. 2008 Nov;9(11):1297-306. doi: Cells. Annu Rev Immunol. 2009;27:485-517. doi: 10.1038/ni.1663. Epub 2008 Oct 12. 10.1146/annurev.immunol.021908.132710. (REVIEW) Zheng SG, Wang J, Horwitz DA.. Cutting edge: Peck A, Mellins ED.. Precarious balance: Th17 cells in Foxp3+CD4+CD25+ regulatory T cells induced by IL-2 and host defense. Infect Immun. 2010 Jan;78(1):32-8. doi: TGF-beta are resistant to Th17 conversion by IL-6. J 10.1128/IAI.00929-09. Epub 2009 Nov 9. (REVIEW) Immunol. 2008 Jun 1;180(11):7112-6. de Jong E, Suddason T, Lord GM.. Translational mini- Zhou L, Lopes JE, Chong MM, Ivanov II, Min R, Victora review series on Th17 cells: development of mouse and GD, Shen Y, Du J, Rubtsov YP, Rudensky AY, Ziegler SF, human T helper 17 cells. Clin Exp Immunol. 2010 Littman DR.. TGF-beta-induced Foxp3 inhibits T(H)17 cell Feb;159(2):148-58. doi: 10.1111/j.1365- differentiation by antagonizing RORgammat function. 2249.2009.04041.x. Epub 2009 Nov 11. (REVIEW) Nature. 2008 May 8;453(7192):236-40. doi: Zou W, Restifo NP.. T(H)17 cells in tumour immunity and 10.1038/nature06878. Epub 2008 Mar 26. immunotherapy. Nat Rev Immunol. 2010 Apr;10(4):248-56. Awasthi A, Riol-Blanco L, Jager A, Korn T, Pot C, Galileos doi: 10.1038/nri2742. (REVIEW) G, Bettelli E, Kuchroo VK, Oukka M.. Cutting edge: IL-23 Betz BC, Jordan-Williams KL, Wang C, Kang SG, Liao J, receptor gfp reporter mice reveal distinct populations of IL- Logan MR, Kim CH, Taparowsky EJ.. Batf coordinates 17-producing cells. J Immunol. 2009 May multiple aspects of B and T cell function required for 15;182(10):5904-8. doi: 10.4049/jimmunol.0900732. normal antibody responses. J Exp Med. 2010 May Dhiman R, Indramohan M, Barnes PF, Nayak RC, 10;207(5):933-42. doi: 10.1084/jem.20091548. Epub 2010 Paidipally P, Rao LV, Vankayalapati R.. IL-22 produced by Apr 26. human NK cells inhibits growth of Mycobacterium Durant L, Watford WT, Ramos HL, Laurence A, Vahedi G, tuberculosis by enhancing phagolysosomal fusion. J Wei L, Takahashi H, Sun HW, Kanno Y, Powrie F, O'Shea Immunol. 2009 Nov 15;183(10):6639-45. doi: JJ.. Diverse targets of the transcription factor STAT3 10.4049/jimmunol.0902587. Epub 2009 Oct 28. contribute to T cell pathogenicity and homeostasis. Di Cesare A, Di Meglio P, Nestle FO.. The IL-23/Th17 axis Immunity. 2010 May 28;32(5):605-15. doi: in the immunopathogenesis of psoriasis. J Invest 10.1016/j.immuni.2010.05.003. Epub 2010 May 20. Dermatol. 2009 Jun;129(6):1339-50. doi: Ahern PP, Schiering C, Buonocore S, McGeachy MJ, Cua 10.1038/jid.2009.59. Epub 2009 Mar 26. (REVIEW) DJ, Maloy KJ, Powrie F.. Interleukin-23 drives intestinal Kryczek I, Banerjee M, Cheng P, Vatan L, Szeliga W, Wei inflammation through direct activity on T cells. Immunity. S, Huang E, Finlayson E, Simeone D, Welling TH, Chang 2010 Aug 27;33(2):279-88. doi: A, Coukos G, Liu R, Zou W.. Phenotype, distribution, 10.1016/j.immuni.2010.08.010. generation, and functional and clinical relevance of Th17 Zhou X, Kong N, Wang J, Fan H, Zou H, Horwitz D, Brand cells in the human tumor environments. Blood. 2009 Aug D, Liu Z, Zheng SG.. Cutting edge: all-trans retinoic acid 6;114(6):1141-9. doi: 10.1182/blood-2009-03-208249. sustains the stability and function of natural regulatory T Epub 2009 May 21. cells in an inflammatory milieu. J Immunol. 2010 Sep Nowell MA, Williams AS, Carty SA, Scheller J, Hayes AJ, 1;185(5):2675-9. doi: 10.4049/jimmunol.1000598. Epub Jones GW, Richards PJ, Slinn S, Ernst M, Jenkins BJ, 2010 Aug 2. Topley N, Rose-John S, Jones SA.. Therapeutic targeting Ghoreschi K, Laurence A, Yang XP, Tato CM, McGeachy of IL-6 trans signaling counteracts STAT3 control of MJ, Konkel JE, Ramos HL, Wei L, Davidson TS, experimental inflammatory arthritis. J Immunol. 2009 Jan Bouladoux N, Grainger JR, Chen Q, Kanno Y, Watford 1;182(1):613-22. WT, Sun HW, Eberl G, Shevach EM, Belkaid Y, Cua DJ, Schraml BU, Hildner K, Ise W, Lee WL, Smith WA, Chen W, O'Shea JJ.. Generation of pathogenic T(H)17 Solomon B, Sahota G, Sim J, Mukasa R, Cemerski S, cells in the absence of TGF-beta signalling. Nature. 2010 Hatton RD, Stormo GD, Weaver CT, Russell JH, Murphy Oct 21;467(7318):967-71. doi: 10.1038/nature09447. TL, Murphy KM.. The AP-1 transcription factor Batf Zhu J, Yamane H, Paul WE.. Differentiation of effector controls T(H)17 differentiation. Nature. 2009 Jul CD4 T cell populations (*). Annu Rev Immunol. 16;460(7253):405-9. doi: 10.1038/nature08114. Epub 2009 2010;28:445-89. doi: 10.1146/annurev-immunol-030409- Jul 5. 101212. Shevach EM.. Mechanisms of foxp3+ T regulatory cell- Gutcher I, Donkor MK, Ma Q, Rudensky AY, Flavell RA, Li mediated suppression. Immunity. 2009 May;30(5):636-45. MO.. Autocrine transforming growth factor-beta1 promotes doi: 10.1016/j.immuni.2009.04.010. (REVIEW) in vivo Th17 cell differentiation. Immunity. 2011 Mar Xu J, Yang Y, Qiu G, Lal G, Wu Z, Levy DE, Ochando JC, 25;34(3):396-408. doi: 10.1016/j.immuni.2011.03.005. Bromberg JS, Ding Y.. c-Maf regulates IL-10 expression

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 621 Th17 cells: inflammation and regulation Masuda K, Kishimoto T

Chen Y, Haines CJ, Gutcher I, Hochweller K, Th17/Treg cell imbalance in patients with rheumatoid Blumenschein WM, McClanahan T, Hammerling G, Li MO, arthritis. Arthritis Rheum. 2012 Aug;64(8):2499-503. doi: Cua DJ, McGeachy MJ.. Foxp3(+) regulatory T cells 10.1002/art.34477. promote T helper 17 cell development in vivo through regulation of interleukin-2. Immunity. 2011 Mar Ciofani M, Madar A, Galan C, Sellars M, Mace K, Pauli F, 25;34(3):409-21. doi: 10.1016/j.immuni.2011.02.011. Agarwal A, Huang W, Parkurst CN, Muratet M, Newberry KM, Meadows S, Greenfield A, Yang Y, Jain P, Kirigin FK, Pandiyan P, Conti HR, Zheng L, Peterson AC, Mathern Birchmeier C, Wagner EF, Murphy KM, Myers RM, DR, Hernandez-Santos N, Edgerton M, Gaffen SL, Bonneau R, Littman DR.. A validated regulatory network Lenardo MJ.. CD4(+)CD25(+)Foxp3(+) regulatory T cells for Th17 cell specification. Cell. 2012 Oct 12;151(2):289- promote Th17 cells in vitro and enhance host resistance in 303. doi: 10.1016/j.cell.2012.09.016. Epub 2012 Sep 25. mouse Candida albicans Th17 cell infection model. Immunity. 2011 Mar 25;34(3):422-34. doi: Tussiwand R, Lee WL, Murphy TL, Mashayekhi M, 10.1016/j.immuni.2011.03.002. Wumesh KC, Albring JC, Satpathy AT, Rotondo JA, Edelson BT, Kretzer NM, Wu X, Weiss LA, Glasmacher E, McGeachy MJ.. GM-CSF: the secret weapon in the T(H)17 Li P, Liao W, Behnke M, Lam SS, Aurthur CT, Leonard arsenal. Nat Immunol. 2011 Jun;12(6):521-2. doi: WJ, Singh H, Stallings CL, Sibley LD, Schreiber RD, 10.1038/ni.2044. Murphy KM.. Compensatory dendritic cell development mediated by BATF-IRF interactions. Nature. 2012 Oct El-Behi M, Ciric B, Dai H, Yan Y, Cullimore M, Safavi F, 25;490(7421):502-7. doi: 10.1038/nature11531. Epub 2012 Zhang GX, Dittel BN, Rostami A.. The encephalitogenicity Sep 19. of T(H)17 cells is dependent on IL-1- and IL-23-induced production of the cytokine GM-CSF. Nat Immunol. 2011 Li P, Spolski R, Liao W, Wang L, Murphy TL, Murphy KM, Jun;12(6):568-75. doi: 10.1038/ni.2031. Epub 2011 Apr 24. Leonard WJ.. BATF-JUN is critical for IRF4-mediated transcription in T cells. Nature. 2012 Oct Liao W, Lin JX, Wang L, Li P, Leonard WJ.. Modulation of 25;490(7421):543-6. doi: 10.1038/nature11530. Epub 2012 cytokine receptors by IL-2 broadly regulates differentiation Sep 19. into helper T cell lineages. Nat Immunol. 2011 Jun;12(6):551-9. doi: 10.1038/ni.2030. Epub 2011 Apr 24. Lee Y, Awasthi A, Yosef N, Quintana FJ, Xiao S, Peters A, Wu C, Kleinewietfeld M, Kunder S, Hafler DA, Sobel RA, Nakahama T, Kimura A, Nguyen NT, Chinen I, Hanieh H, Regev A, Kuchroo VK.. Induction and molecular signature Nohara K, Fujii-Kuriyama Y, Kishimoto T.. Aryl of pathogenic TH17 cells. Nat Immunol. 2012 hydrocarbon receptor deficiency in T cells suppresses the Oct;13(10):991-9. doi: 10.1038/ni.2416. Epub 2012 Sep 9. development of collagen-induced arthritis. Proc Natl Acad Sci U S A. 2011 Aug 23;108(34):14222-7. doi: Glasmacher E, Agrawal S, Chang AB, Murphy TL, Zeng 10.1073/pnas.1111786108. Epub 2011 Aug 8. W, Vander Lugt B, Khan AA, Ciofani M, Spooner CJ, Rutz S, Hackney J, Nurieva R, Escalante CR, Ouyang W, Xu M, Morishima N, Mizoguchi I, Chiba Y, Fujita K, Kuroda Littman DR, Murphy KM, Singh H.. A genomic regulatory M, Iwakura Y, Cua DJ, Yasutomo K, Mizuguchi J, element that directs assembly and function of immune- Yoshimoto T.. Regulation of the development of acute specific AP-1-IRF complexes. Science. 2012 Nov hepatitis by IL-23 through IL-22 and IL-17 production. Eur 16;338(6109):975-80. doi: 10.1126/science.1228309. Epub J Immunol. 2011 Oct;41(10):2828-39. doi: 2012 Sep 13. 10.1002/eji.201141291. Epub 2011 Aug 31. Powell JD, Pollizzi KN, Heikamp EB, Horton MR.. Rutz S1, Noubade R, Eidenschenk C, Ota N, Zeng W, Regulation of immune responses by mTOR. Annu Rev Zheng Y, Hackney J, Ding J, Singh H, Ouyang W.. Immunol. 2012;30:39-68. doi: 10.1146/annurev-immunol- Transcription factor c-Maf mediates the TGF-beta- 020711-075024. Epub 2011 Nov 29. (REVIEW) dependent suppression of IL-22 production in T(H)17 cells. Nat Immunol. 2011 Oct 16;12(12):1238-45. doi: Wuthrich M, Deepe GS Jr, Klein B.. Adaptive immunity to 10.1038/ni.2134. fungi. Annu Rev Immunol. 2012;30:115-48. doi: 10.1146/annurev-immunol-020711-074958. Epub 2012 Pot C, Apetoh L, Awasthi A, Kuchroo VK.. Induction of Jan 3. (REVIEW) regulatory Tr1 cells and inhibition of T(H)17 cells by IL-27. Semin Immunol. 2011 Dec;23(6):438-45. doi: Tanaka T, Narazaki M, Kishimoto T.. Therapeutic targeting 10.1016/j.smim.2011.08.003. Epub 2011 Sep 3. (REVIEW) of the interleukin-6 receptor. Annu Rev Pharmacol Toxicol. 2012;52:199-219. doi: 10.1146/annurev-pharmtox-010611- Chi H.. Regulation and function of mTOR signalling in T 134715. Epub 2011 Sep 9. (REVIEW) cell fate decisions. Nat Rev Immunol. 2012 Apr 20;12(5):325-38. doi: 10.1038/nri3198. (REVIEW) Tanaka T, Narazaki M, Masuda K, Kishimoto T.. Interleukin-6; pathogenesis and treatment of autoimmune Zielinski CE, Mele F, Aschenbrenner D, Jarrossay D, inflammatory diseases. Inflammation and Regeneration. Ronchi F, Gattorno M, Monticelli S, Lanzavecchia A, 2013 Jan;33(1). Sallusto F.. Pathogen-induced human TH17 cells produce IFN-gamma or IL-10 and are regulated by IL-1beta. AlFadhli S.. The interleukin-23/interleukin-17 axis and the Nature. 2012 Apr 26;484(7395):514-8. doi: role of Treg/Th17 cells in rheumatoid arthritis and joint 10.1038/nature10957. destruction. OA Arthritis 2013 Feb 02;1(1):5. Takahashi H, Kanno T, Nakayamada S, Hirahara K, Chang J, Burkett PR, Borges CM, Kuchroo VK, Turka LA, Sciume G, Muljo SA, Kuchen S, Casellas R, Wei L, Kanno Chang CH.. MyD88 is essential to sustain mTOR Y, O'Shea JJ.. TGF-beta and retinoic acid induce the activation necessary to promote T helper 17 cell microRNA miR-10a, which targets Bcl-6 and constrains the proliferation by linking IL-1 and IL-23 signaling. Proc Natl plasticity of helper T cells. Nat Immunol. 2012 Apr Acad Sci U S A. 2013 Feb 5;110(6):2270-5. doi: 29;13(6):587-95. doi: 10.1038/ni.2286. 10.1073/pnas.1206048110. Epub 2013 Jan 22. Samson M, Audia S, Janikashvili N, Ciudad M, Trad M, Zheng SG.. Regulatory T cells vs Th17: differentiation of Fraszczak J, Ornetti P, Maillefert JF, Miossec P, Bonnotte Th17 versus Treg, are the mutually exclusive? Am J Clin B.. Brief report: inhibition of interleukin-6 function corrects Exp Immunol. 2013 Feb 27;2(1):94-106. Print 2013.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 622 Th17 cells: inflammation and regulation Masuda K, Kishimoto T

Rutz S, Eidenschenk C, Ouyang W.. IL-22, not simply a 2013 Jul 1. Th17 cytokine. Immunol Rev. 2013 Mar;252(1):116-32. doi: 10.1111/imr.12027. (REVIEW) Li L, Boussiotis VA.. The role of IL-17-producing Foxp3+ CD4+ T cells in inflammatory bowel disease and colon Muranski P, Restifo NP.. Essentials of Th17 cell cancer. Clin Immunol. 2013 Aug;148(2):246-53. doi: commitment and plasticity. Blood. 2013 Mar 10.1016/j.clim.2013.05.003. Epub 2013 May 15. (REVIEW) 28;121(13):2402-14. doi: 10.1182/blood-2012-09-378653. Epub 2013 Jan 16. (REVIEW) Burmester GR, Weinblatt ME, McInnes IB, Porter D, Barbarash O, Vatutin M, Szombati I, Esfandiari E, Yosef N, Shalek AK, Gaublomme JT, Jin H, Lee Y, Sleeman MA, Kane CD, Cavet G, Wang B, Godwood A, Awasthi A, Wu C, Karwacz K, Xiao S, Jorgolli M, Gennert Magrini F; EARTH Study Group.. Efficacy and safety of D, Satija R, Shakya A, Lu DY, Trombetta JJ, Pillai MR, mavrilimumab in subjects with rheumatoid arthritis. Ann Ratcliffe PJ, Coleman ML, Bix M, Tantin D, Park H, Rheum Dis. 2013 Sep 1;72(9):1445-52. doi: Kuchroo VK, Regev A.. Dynamic regulatory network 10.1136/annrheumdis-2012-202450. Epub 2012 Dec 12. controlling TH17 cell differentiation. Nature. 2013 Apr 25;496(7446):461-8. doi: 10.1038/nature11981. Epub 2013 Kang Z, Wang C, Zepp J, Wu L, Sun K, Zhao J, Mar 6. Chandrasekharan U, DiCorleto PE, Trapp BD, Ransohoff RM, Li X.. Act1 mediates IL-17-induced EAE pathogenesis Kleinewietfeld M, Manzel A, Titze J, Kvakan H, Yosef N, selectively in NG2+ glial cells. Nat Neurosci. 2013 Linker RA, Muller DN, Hafler DA.. Sodium chloride drives Oct;16(10):1401-8. doi: 10.1038/nn.3505. Epub 2013 Sep autoimmune disease by the induction of pathogenic TH17 1. cells. Nature. 2013 Apr 25;496(7446):518-22. doi: 10.1038/nature11868. Epub 2013 Mar 6. Yao S, Buzo BF, Pham D, Jiang L, Taparowsky EJ, Kaplan MH, Sun J.. Interferon regulatory factor 4 sustains CD8(+) Masuda K, Ripley B, Nishimura R, Mino T, Takeuchi O, T cell expansion and effector differentiation. Immunity. Shioi G, Kiyonari H, Kishimoto T.. Arid5a controls IL-6 2013 Nov 14;39(5):833-45. doi: mRNA stability, which contributes to elevation of IL-6 level 10.1016/j.immuni.2013.10.007. Epub 2013 Nov 7. in vivo. Proc Natl Acad Sci U S A. 2013 Jun 4;110(23):9409-14. doi: 10.1073/pnas.1307419110. Epub Qu N, Xu M, Mizoguchi I, Furusawa J, Kaneko K, 2013 May 15. Watanabe K, Mizuguchi J, Itoh M, Kawakami Y, Yoshimoto T.. Pivotal roles of T-helper 17-related cytokines, IL-17, IL- Kellner H.. Targeting interleukin-17 in patients with active 22, and IL-23, in inflammatory diseases. Clin Dev rheumatoid arthritis: rationale and clinical potential. Ther Immunol. 2013;2013:968549. doi: 10.1155/2013/968549. Adv Musculoskelet Dis. 2013 Jun;5(3):141-52. doi: Epub 2013 Jul 14. (REVIEW) 10.1177/1759720X13485328. Koch S, Mousset S, Graser A, Reppert S, Ubel C, Murphy TL, Tussiwand R, Murphy KM.. Specificity through Reinhardt C, Zimmermann T, Rieker R, Lehr HA, Finotto cooperation: BATF-IRF interactions control immune- S.. IL-6 activated integrated BATF/IRF4 functions in regulatory networks. Nat Rev Immunol. 2013 lymphocytes are T-bet-independent and reversed by Jul;13(7):499-509. doi: 10.1038/nri3470. Epub 2013 Jun subcutaneous immunotherapy. Sci Rep. 2013;3:1754. doi: 21. (REVIEW) 10.1038/srep01754. Nguyen NT, Hanieh H, Nakahama T, Kishimoto T.. The Komatsu N, Okamoto K, Sawa S, Nakashima T, Oh-hora roles of aryl hydrocarbon receptor in immune responses. M, Kodama T, Tanaka S, Bluestone JA, Takayanagi H. Int Immunol. 2013 Jun;25(6):335-43. doi: Pathogenic conversion of Foxp3+ T cells into TH17 cells in 10.1093/intimm/dxt011. Epub 2013 Apr 11. (REVIEW) autoimmune arthritis. Nat Med. 2014 Jan;20(1):62-8. doi: 10.1038/nm.3432. Epub 2013 Dec 22. Nakahama T, Hanieh H, Nguyen NT, Chinen I, Ripley B, Millrine D, Lee S, Nyati KK, Dubey PK, Chowdhury K, This article should be referenced as such: Kawahara Y, Kishimoto T.. Aryl hydrocarbon receptor- mediated induction of the microRNA-132/212 cluster Masuda K, Kishimoto T. Th17 cells: inflammation and promotes interleukin-17-producing T-helper cell regulation. Atlas Genet Cytogenet Oncol Haematol. 2014; differentiation. Proc Natl Acad Sci U S A. 2013 Jul 18(8):611-623. 16;110(29):11964-9. doi: 10.1073/pnas.1311087110. Epub

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 623 Atlas of Genetics and Cytogenetics in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Case Report Section Paper co-edited with the European LeukemiaNet

T-cell acute lymphoblastic leukemia with t(7;14)(p15;q11.2)/HOXA-TCRA/D and biallelic deletion of CDKN2A. Case report and literature review Jonathon Mahlow, Salah Ebrahim, Anwar N Mohamed Cytogenetics Laboratory, Pathology Department, Wayne State University School of Medicine and Detroit Medical Center, Detroit MI, USA (JM, SE, ANM)

Published in Atlas Database: January 2014 Online updated version : http://AtlasGeneticsOncology.org/Reports/t0714p15q11MahlowID100075.html DOI: 10.4267/2042/54020 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2014 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Abstract Note: Peripheral blood showed anemia, thrombocytopenia and leukocytosis. Case report and literature review on T-cell acute lymphoblastic leukemia with Cyto-Pathology t(7;14)(p15;q11.2)/HOXA-TCRA/D and biallelic deletion of CDKN2A. Classification Cytology Clinics Peripheral blood smear showed large L2 Age and sex lymphoblasts with nucleoli, normochromic, 9 years old male patient. normocytic RBCs and markedly decreased Previous history platelets. No preleukemia, no previous malignancy, no inborn Immunophenotype condition of note, no main items. Flow cytometric analysis of peripheral blood Organomegaly demonstrated an abnormal CD45dim circulating No hepatomegaly, splenomegaly, enlarged lymph lymphoblasts (75%) expressing CD2, CD5, CD7, nodes, no central nervous system involvement. CD8, CD10, cytoplasmic CD3, TdT and partially expressing weak CD30. Note Overall, these findings were consistent with T-cell Positive for splenomegaly, bilateral enlarged malignancy. kidneys, large mediastinal mass, extensive lymphadenopathy of intrathoracic, retroperitoneal, Rearranged Ig Tcr cervical, and axillary regions. No rearrangements of TCRB and TCRA/D genes Cerebral spinal fluid negative for malignant cells. by FISH. Electron microscopy Blood Not performed. WBC: 31.6 X 10 9/l Diagnosis HB: 8.6g/dl T-cell acute lymphoblastic leukemia (T-ALL). Platelets: 15 X 10 9/l Blasts: 65% Survival Bone marrow: Dry tap. Date of diagnosis: 09-2013

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 624 T-cell acute lymphoblastic leukemia with t(7;14)(p15;q11.2)/HOXA-TCRA/D and biallelic Mahlow J, et al. deletion of CDKN2A. Case report and literature review

Treatment: Patient was treated with COG- CDKN2A in 79% of cells but four copies of the AALL00434 protocol including vincristine, control CEP-9 in 44% of cells and two copies in the daunorubicin hydrochloride, prednisone, remaining 35% while the normal cells had 2 copies pegaspargase, and intrathecal cytarabine and of each (Figure 2). methotrexate. To verify the results of chromosome analysis with Complete remission: yes respect to t(7;14), confirmatory FISH was Treatment related death: no performed using Signature Genomic DNA probes Relapse: no BAC probes RP11-1132K14/7p15 (orange) Status: Alive. Last follow up: 01-2014 covering the HOXA cluster genes and CTD- 2555K7/14q11.2 (green) laying immediately Survival: 4 months telomeric to the TCRA/D/14q11.2 coding region. Note: In remission; on maintenance chemotherapy The hybridization revealed a fusion pattern; one as of Jan 28, 2014. fusion signal in the pseudodiploid and two fusion signals in the pseudotetraploid cells (Figure 3). Karyotype Array Comparative Genomic Hybridization Sample: Peripheral blood (aCGH) Culture time: 24 and 48hrs unstimulated cultures Genomic DNA was isolated from peripheral blood using a Puregene kit (Gentra Systems, Minneapolis, Banding: GTG MN). The aCGH was performed using a genome Results wide oligonucleotide + single nucleotide 46, polymorphism based microarray containing 180K- XY,del(6)(q14q21),t(7;14)(p15;q11.2),del(9)(p13)[ features (SurePrint G3 GGXChip + SNP v1.0 12]/92,idemx2,[7]/46,XY[1] (Figure 1) 4x180k Agilent Technologies, St Clara, CA). The Other molecular cytogenetics technics microarray slide was scanned by Agilent G2565 Fluorescence in situ hybridization (FISH) CA microarray scanner system with data imported FISH using Vysis LSI BCR/ABL, CDKN2A/CEP-9 to aCGH Analytics Software (Genoglyphix™; and TCRA/D, as well as Cytocell TCRB DNA Signature Genomic Laboratories). The array design probes was performed on peripheral blood and genomic coordinates are based on NCBI build harvested pellet. 37 (hg19). FISH analysis revealed four copies for TCRB/7q34, The aCGH revealed a 33.3Mb terminal monoallelic TRA/D/14q11.2, BCR/22q11.2, and ABL/9q34 in deletion of chromosome 9p13.3->pter, with 1.39 approximately 50% of cells, representing the Mb biallelic deletions in the 9p21.3 region which pseudotetraploid cell line observed by karyotype. spans the CDKN2A gene locus (Figure 4). It also No BCR/ABL gene fusion was detected in any cell detected a large 20.7 Mb interstitial deletion at line. The hybridization with the CDKN2A/CEP9 del(6)(q14.1q16.2) and 1.34 Mb duplication within probe set produced nullisomy (biallelic loss) of the the 4q32.1 region.

Figure 1: G-banded karyotype of the pseudodiploid cell line demonstrating del(6q) (hollow arrow), t(7;14)(p15;q11.2) (thin arrows), and del(9p) (solid arrow).

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 625 T-cell acute lymphoblastic leukemia with t(7;14)(p15;q11.2)/HOXA-TCRA/D and biallelic Mahlow J, et al. deletion of CDKN2A. Case report and literature review

Figure 2: FISH was performed using CDKN2A (orange) and the control CEP 9 (green) DNA probe set. The hybridization revealed biallelic loss of CDKN2A in an abnormal metaphase (long arrow) while the normal diploid interphase cell had two copies of each (short arrow).

Figure 3: FISH of a t(7;14) carrying metaphase cell demonstrating fusion of HOXA-TCRA/D gene regions (thin arrow).

Figure 4: aCGH plot for chromosome 9 showing compound deletions. The light blue region indicates a terminal monoallelic deletion of 33.3 Mb of 9p while dark blue region points to biallelic deletion within the 9p21.3.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 626 T-cell acute lymphoblastic leukemia with t(7;14)(p15;q11.2)/HOXA-TCRA/D and biallelic Mahlow J, et al. deletion of CDKN2A. Case report and literature review

association with other recurrent cytogenetic Comments abnormalities. The deletion CDKN2A/9p21 has The patient here presented with progressive cough been previously shown to accompany the common and neck mass. He was found to have an elevated yet nonspecific finding of del(6q), which was also WBC count with concomitant anemia and present in this case. thrombocytopenia. Assessment of peripheral blood In summary, the t(7;14)(p15;q11.2) translocation is revealed the diagnosis of T-cell acute lymphoblastic extremely rare resulting in an aberrant juxtaposing leukemia (T-ALL). Chromosome analysis showed of HOXA-TCRD genes. Therefore, TCRD/14q11.2 two clones, pseudodiploid and pseudotetraploid, may consider as a new variant partner for activation both exhibiting t(7;14)(p15;q11.2), del(6)(q14q21), of HOXA/7p15 in T-ALL. Although the expression and del(9)(p13) (Figure 1). However, the of HOXA genes was not tested in the present case, pseudotetraploid clone had two copies of these we assume it was upregulated as documented abnormalities indicating it was derived from previously in HOXA-TCRD case and HOXA- duplication of the pseudodiploid clone. FISH TCRB cases. confirmed juxtaposing of HOXA/7p15 and TCRD/14q11.2 genes in the t(7;14) carrying References leukemic cells (Figure 3). Hayashi Y, Raimondi SC, Look AT et al.. Abnormalities of Homeobox (HOX) genes encode transcription the long arm of chromosome 6 in childhood acute factors which act as key regulators in embryonic lymphoblastic leukemia. Blood. 1990 Oct 15;76(8):1626-30 development and normal hematopoiesis. Recently, Garipidou V, Secker-Walker LM. The use of the HOXA gene cluster at chromosome 7p15 has fluorodeoxyuridine synchronization for cytogenetic been described as a new recurrent breakpoint that investigation of acute lymphoblastic leukemia. Cancer occurs in up to 3% of T-ALL. The inv(7)(p15q34) Genet Cytogenet. 1991 Mar;52(1):107-11 and t(7;7)(p15;q34) place HOXA under the control Magli MC, Largman C, Lawrence HJ. Effects of HOX of T-cell specific enhancer of TCRB, leading to homeobox genes in blood cell differentiation. J Cell upregulation of HOXA genes particularly HOXA10 Physiol. 1997 Nov;173(2):168-77 and HOXA11. Another rare translocation is Merup M, Moreno TC, Heyman M et al.. 6q deletions in t(7;14)(p15;q11.2), previously described in a 29- acute lymphoblastic leukemia and non-Hodgkin's year-old patient with T-ALL. The translocation lymphomas. Blood. 1998 May 1;91(9):3397-400 resulted in colocalization of HOXA-TCRD genes, Soulier J, Clappier E et al.. HOXA genes are included in and generalized overexpression of the HOXA genetic and biologic networks defining human acute T-cell leukemia (T-ALL). Blood. 2005 Jul 1;106(1):274-86 genes. However the leukemic clone of this case had also t(10;11)(p14;q21), and expressed CALM- Bergeron J, Clappier E et al.. HOXA cluster deregulation in T-ALL associated with both a TCRD-HOXA and a CALM- AF10 fusion transcript. Therefore, it was concluded AF10 chromosomal translocation. Leukemia. 2006 that the existence of both HOXA-TCRD and Jun;20(6):1184-7 CALM-AF10 in the same leukemic cells may Chiaretti S, Foà R. T-cell acute lymphoblastic leukemia. contribute to the global expression of HOXA genes. Haematologica. 2009 Feb;94(2):160-2 The t(7;14) in a 31-year old female with T-ALL was also cited but not well documented in a Sulong S, Moorman AV, Irving JA et al.. A comprehensive analysis of the CDKN2A gene in childhood acute technical report by Garipidou et al 1991. lymphoblastic leukemia reveals genomic deletion, copy The present case is believed to be the only other number neutral loss of heterozygosity, and association well described case with with specific cytogenetic subgroups. Blood. 2009 Jan t(7;14)(p15;q11.2)/HOXA-TCRD translocation. 1;113(1):100-7 However, our case was lacking t(10;11) which may Bach C, Buhl S, Mueller D et al.. Leukemogenic make the two cases different in clinical presentation transformation by HOXA cluster genes. Blood. 2010 Apr and response to therapy. Biallelic deletion of 8;115(14):2910-8 CDKN2A/9p21 as documented by aCGH and FISH Sherborne AL, Hosking FJ, Prasad RB et al.. Variation in was also found in our case (Figures 2, 4). Deletion CDKN2A at 9p21.3 influences childhood acute lymphoblastic leukemia risk. Nat Genet. 2010 of CDKN2A, tumor suppressor gene, is the most Jun;42(6):492-4 frequent genomic aberration occurs in over 70% of T-ALL which emphasizes the importance of Van Vlierberghe P, Ferrando A. The molecular basis of T cell acute lymphoblastic leukemia. J Clin Invest. 2012 Oct CDKN2A inactivation in the development of this 1;122(10):3398-406 leukemia. A study pooling 907 individual cases of ALL has demonstrated that CDKN2A deletion, This article should be referenced as such: mono- or biallelic, is an independent risk factor for Mahlow J, Ebrahim S, Mohamed AN. T-cell acute the development of ALL irrespective of cell lineage lymphoblastic leukemia with t(7;14)(p15;q11.2)/HOXA- (B or T-cell). However, the prognostic significance TCRA/D and biallelic deletion of CDKN2A. Case report and literature review. Atlas Genet Cytogenet Oncol of CDKN2A deletion in cases of pediatric T-cell Haematol. 2014; 18(8):624-627. ALL is currently unknown due to its frequent

Atlas of Genetics and Cytogenetics in Oncology and Haematology

OPEN ACCESS JOURNA L INIST -CNRS

Instructions to Authors Manuscripts submitted to the Atlas must be submitted solely to the Atlas. Iconography is most welcome: there is no space restriction. The Atlas publishes "cards", "deep insights", "case reports", and "educational items". Cards are structured review articles. Detailed instructions for these structured reviews can be found at: http://AtlasGeneticsOncology.org/Forms/Gene_Form.html for reviews on genes, http://AtlasGeneticsOncology.org/Forms/Leukaemia_Form.html for reviews on leukaemias, http://AtlasGeneticsOncology.org/Forms/SolidTumour_Form.html for reviews on solid tumours, http://AtlasGeneticsOncology.org/Forms/CancerProne_Form.html for reviews on cancer-prone diseases. According to the length of the paper, cards are divided, into "reviews" (texts exceeding 2000 words), "mini reviews" (between), and "short communications" (texts below 400 words). The latter category may not be accepted for indexing by bibliographic databases. Deep Insights are written as traditional papers, made of paragraphs with headings, at the author's convenience. No length restriction. Case Reports in haematological malignancies are dedicated to recurrent -but rare- chromosomes abnormalities in leukaemias/lymphomas. Cases of interest shall be: 1- recurrent (i.e. the chromosome anomaly has already been described in at least 1 case), 2- rare (previously described in less than 20 cases), 3- with well documented clinics and laboratory findings, and 4- with iconography of chromosomes. It is mandatory to use the specific "Submission form for Case reports": see http://AtlasGeneticsOncology.org/Reports/Case_Report_Submission.html. Educational Items must be didactic, give full information and be accompanied with iconography. Translations into French, German, Italian, and Spanish are welcome.

Subscription : The Atlas is FREE !

Corporate patronage, sponsorship and advertising Enquiries should be addressed to [email protected].

Rules, Copyright Notice and Disclaimer Conflicts of Interest: Authors must state explicitly whether potential conflicts do or do not exist. Reviewers must disclose to editors any conflicts of interest that could bias their opinions of the manuscript. The editor and the editorial board members must disclose any potential conflict. Privacy and Confidentiality – Iconography: Patients have a right to privacy. Identifying details should be omitted. If complete anonymity is difficult to achieve, informed consent should be obtained. Property: As "cards" are to evolve with further improvements and updates from various contributors, the property of the cards belongs to the editor, and modifications will be made without authorization from the previous contributor (who may, nonetheless, be asked for refereeing); contributors are listed in an edit history manner. Authors keep the rights to use further the content of their papers published in the Atlas, provided that the source is cited. Copyright: The information in the Atlas of Genetics and Cytogenetics in Oncology and Haematology is issued for general distribution. All rights are reserved. The information presented is protected under international conventions and under national laws on copyright and neighbouring rights. Commercial use is totally forbidden. Information extracted from the Atlas may be reviewed, reproduced or translated for research or private study but not for sale or for use in conjunction with commercial purposes. Any use of information from the Atlas should be accompanied by an acknowledgment of the Atlas as the source, citing the uniform resource locator (URL) of the article and/or the article reference, according to the Vancouver convention. Reference to any specific commercial products, process, or service by trade name, trademark, manufacturer, or otherwise, does not necessarily constitute or imply its endorsement, recommendation, or favouring. The views and opinions of contributors and authors expressed herein do not necessarily state or reflect those of the Atlas editorial staff or of the web site holder, and shall not be used for advertising or product endorsement purposes. The Atlas does not make any warranty, express or implied, including the warranties of merchantability and fitness for a particular purpose, or assumes any legal liability or responsibility for the accuracy, completeness, or usefulness of any information, and shall not be liable whatsoever for any damages incurred as a result of its use. In particular, information presented in the Atlas is only for research purpose, and shall not be used for diagnosis or treatment purposes. No responsibility is assumed for any injury and/or damage to persons or property for any use or operation of any methods products, instructions or ideas contained in the material herein. See also: "Uniform Requirements for Manuscripts Submitted to Biomedical Journals: Writing and Editing for Biomedical Publication - Updated October 2004": http://www.icmje.org.

http://AtlasGeneticsOncology.org