Cyclin D2–Cyclin-Dependent Kinase 4/6 Is Required for Efficient Proliferation and Tumorigenesis Following Apc Loss

Published OnlineFirst August 24, 2010; DOI: 10.1158/0008-5472.CAN-10-0315 Published OnlineFirst on October 5, 2010 as 10.1158/0008-5472.CAN-10-0315

Tumor and Stem Cell Biology Cancer Research Cyclin D2–Cyclin-Dependent Kinase 4/6 Is Required for Efficient Proliferation and Tumorigenesis following Apc Loss

Alicia M. Cole1, Kevin Myant1, Karen R. Reed2, Rachel A. Ridgway1, Dimitris Athineos1, Gijs R. Van den Brink3, Vanesa Muncan3,4, Hans Clevers4, Alan R. Clarke5, Peter Sicinski5, and Owen J. Sansom1

Abstract Inactivation of the Apc gene is recognized as the key early event in the development of sporadic colorectal cancer (CRC), where its loss leads to constitutive activation of β-catenin/T-cell factor 4 signaling and hence transcription of Wnt target genes such as c-Myc. Our and other previous studies have shown that although cyclin D1 is required for adenoma formation, it is not immediately upregulated following Apc loss within the intestine, suggesting that proliferation following acute Apc loss may be dependent on another D-type cyclin. In this study, we investigated the expression and functional relevance of cyclin D2 following Apc loss in the intestinal epithelium. Cyclin D2 is upregulated immediately following Apc loss, which corresponded with a significant increase in cyclin-dependent kinase 4 (CDK4) and hyperphosphorylated Rb levels. Deficiency of cyclin D2 resulted in a reduction in enterocyte proliferation and crypt size within Apc-deficient intestinal Min/+ epithelium. Moreover, cyclin D2 dramatically reduced tumor growth and development in Apc mice. Im- portantly, cyclin D2 knockout did not affect proliferation of normal enterocytes, and furthermore, CDK4/6 Min/+ inhibition also suppressed the proliferation of adenomatous cells and not normal cells from Apc mice. Taken together, these results indicate that cyclin D–CDK4/6 complexes are required for the efficient proliferation of cells with deregulated Wnt signaling, and inhibiting this complex may be an effective chemopreven- tative strategy in CRC. Cancer Res; 70(20); 8149–58. ©2010 AACR.

Introduction to the stabilization of β-catenin and consequently to the deregulation of the Wnt pathway through the activation of The Apc gene encodes the adenomatous polyposis coli tu- T-cell factor/lymphoid enhancer factor target genes (2, 3). mor suppressor protein, the germline mutation of which Previous studies have shown that acute loss of the Apc characterizes familial adenomatous polyposis, an autosomal gene within the murine intestinal epithelium in vivo leads syndrome characterized by multiple colorectal adenoma (1). to a “crypt progenitor cell–like phenotype” (4, 5), which is Inactivation of the Apc gene is recognized as a key early event characterized by an increase in proliferation of intestinal en- in the development of sporadic colorectal cancers (CRC), terocytes with reduced intestinal differentiation and migra- with up to 80% of CRC having mutations in the Apc gene. tion. Coincident with the onset of this crypt progenitor The major tumor suppressor function of Apc is thought to cell–like phenotype is the accumulation of nuclear β-catenin be as a negative regulator of Wnt signaling, where it forms and the transcription of Wnt target genes such as c-Myc and part of the β-catenin destruction complex, comprising axin, CD44. The upregulation of c-Myc following Apc loss is critical glycogen synthase kinase 3β, and CK1. Mutations in Apc lead to all the phenotypes observed, with double Apc c-Myc knockout intestines showing proliferation at equivalent levels to wild-type (Wt) intestines (6). Authors' Affiliations: 1Beatson Institute of Cancer Research, Glasgow, Previous studies have shown that cyclin D–cyclin-dependent United Kingdom; 2School of Biosciences, Cardiff, United Kingdom; 3Leiden University Medical Center, Leiden, the Netherlands; 4Hubrecht kinase 4/6 (CDK4/6) complexes may be essential down- Laboratorium, Utrecht, the Netherlands; and 5Department of Cancer stream mediators of c-Myc–dependent proliferation (7, 8). Biology, Dana-Farber Cancer Institute, and Department of Pathology, Consistent with this, depending on cellular context, CDK4, Harvard Medical School, Boston, Massachusetts cyclin D1, and cyclin D2 have all been proposed to be tran- Note: Supplementary data for this article are available at Cancer scriptional targets of c-Myc (9). Therefore, these studies pre- Research Online (http://cancerres.aacrjournals.org/). dict that Apc-deficient cells may be dependent on high levels Corresponding Author: Owen J. Sansom, Beatson Institute of Cancer – Research, Switchback Road, Garscube Estate, Glasgow G61 1BD, of cyclin D CDK4/6 complexes. Pertinently, cyclin D1 has United Kingdom. Phone: 44-141-3303656; Fax: 44-141-9426521; E-mail: been proposed to be a canonical Wnt target gene (10, 11) [email protected]. and thus would provide a ready mechanism to elevate prolif- doi: 10.1158/0008-5472.CAN-10-0315 eration following Apc loss. However, we and others have ©2010 American Association for Cancer Research. shown that cyclin D1 is not upregulated immediately following

www.aacrjournals.org 8149

Cole et al.

Apc loss and genetic deletion of cyclin D1 makes no effect on injected with BrdUrd 2 hours before euthanasia. Five hun- the immediate phenotype (including levels of proliferation). dred cells per adenoma were scored to give an average level Cyclin D1 is, however, upregulated at later stages following of proliferation per adenoma, and multiple tumors per Apc loss, required for efficient adenoma formation (12), and acts mouse were scored until a consistent running mean for each Min/+ as a modifier of disease severity in the Apc mouse (13, 14). mouse was obtained. At least three mice were scored per Cyclin D2 is normally expressed at the base of the intesti- genotype. nal crypt, where there are the highest levels of Wnt signaling (15). Studies have shown that cyclin D2 is overexpressed in Immunohistochemistry 53% of colon tumors and that overexpression of cyclin D2 Primary antibodies used for immunohistochemistry were as may be related to a higher tumor-node-metastasis (TNM) follows: β-catenin (1:50; Transduction Laboratories), BrdUrd stage of tumor (16). Mechanistically, it has been suggested (1:500; BD Biosciences), cyclin D1 (1:100; Novocastra), and cy- that cyclin D2 is a direct c-Myc target gene (7), implying clin D2 (1:200; Santa Cruz Biotechnology). Immunohistochem- that cyclin D2 levels should be deregulated following Apc istry was performed on formalin-fixed intestinal sections. mutation. Here, we show that cyclin D2 is rapidly deregulated following Apc loss, where it plays a functional role to Epithelial extractions, quantitative PCR, and promote proliferation and tumorigenesis. immunoblotting To obtain a population of cells enriched for epithelial cells, Materials and Methods an epithelial extraction protocol based on that of Bjerknes and Cheng (21) was performed (see ref. 22). Quantitative Mouse experiments PCR was performed as previously described on epithelial ex- All experiments were performed under the UK Home tractions (6). At least three different epithelial extractions Office guidelines. The alleles used for this study were as were used per genotype. fl 580S − − follows: c-Myc (17), AhCre, Apc (4, 18), Cyclin D2 / , and The primers used for this study were as follows: cyclin D2, cyclin D1 (19). For precise details of mouse genetic back- CTACCGACTTCAAGTTTGCC (forward) and GCTTTGAGA- grounds for each experiments and Cre inductions regime, CAATCCACATCAG (reverse); CDK4, AATGTTGTACGGCT- see Supplementary Materials and Methods. GATGGA (forward) and AGAAACTGACGCATTAGATCCT (reverse). CDK4/6 inhibitor treatment Opticon Monitor analysis software (version 2.03, MJ Re- PD0332991 was obtained from Pfizer, and mice were trea- search) was used to calibrate and run the reaction. ted with 150 mg/kg/d by gavage or vehicle (lactic acid buffer, For immunoblotting, primary antibodies and conditions pH 4.0). This regime was comparable with the previous used to probe blots were anti–cyclin D2 (1:1,000), pRb in vivo studies (20). (1:1,000; Cell Signaling), CDK4 (1:200), and mouse anti–β- actin (1:5,000; Sigma). Appropriate horseradish peroxidase– Assaying apoptosis, mitosis, and crypt size in vivo conjugated secondary anti-rabbit or anti-mouse antibodies Apoptosis, crypt size, and mitotic index were scored from were used (Amersham Biosciences). Western blot analysis H&E-stained sections as previously described (4). For each was performed using standard protocols (see 22). analysis, 25 full crypts were scored from at least three mice of each genotype. Apoptosis was independently confirmed by Results immunohistochemical staining with an antibody against active caspase-3 (1:750; R&D Systems). Deletion of Apc leads to an upregulation of cyclin D2 and CDK4 Tumor scoring First, we wished to assess whether cyclin D2 was upregu- For cohort and time point analyses, the entire intestine lated following Apc loss in vivo. We have previously deleted and colon were removed and flushed with water. Both intes- Apc in the intestinal epithelium using Cre-lox technology. 580S tine and colon were mounted “en face” and fixed overnight in Here, mice carrying an inducible knockout Apc allele Apc fl methacarn. Lesions were then scored macroscopically. Intes- (from here on referred to as Apc ) are intercrossed to mice tines were then wound into a “Swiss” roll, which were subse- carrying the AhCre transgene, which yields near constitutive quently embedded in paraffin, sectioned at 10 μm, and inducible Cre recombinase expression within the intestinal stained with H&E before microscopic analysis. epithelium following exposure to β-naphthoflavone (18). Fours days following Cre induction, these mice develop a ro- Assaying proliferation in vivo bust phenotype, crypts become hyperplastic, and β-catenin To examine levels of proliferation, mice were injected accumulates within the nucleus of cells. Our previous micro- with 250 μL of bromodeoxyuridine (BrdUrd; Amersham array analysis suggested that cyclin D2 is immediately upre- Biosciences) 2 hours before being sacrificed. Immunohisto- gulated following Apc loss in vivo (4). To confirm this, we chemical staining for BrdUrd was then performed using an performed in situ hybridization on Wt and Apc-deficient anti-BrdUrd antibody (1:500; BD Biosciences). At least three intestine 4 days following Apc gene deletion (four mice of mice were used for each genotype and time point. For each genotype). A clear upregulation of cyclin D2 mRNA scoring of proliferation within ApcMin/+ tumors, mice were was observed, suggesting that cyclin D2 is transcriptionally

8150 Cancer Res; 70(20) October 15, 2010 Cancer Research

Cyclin D2 and Intestinal Tumorigenesis

activated (Fig. 1A). To investigate protein levels, we per- As cyclin D2 and CDK4 have previously been shown to formed immunohistochemistry and immunoblotting for be transcriptionally targets of the key Wnt target gene cyclin D2 and found it to be clearly deregulated (Fig. 1B c-Myc, we investigated whether their overexpression follow- and C). β-Catenin was localized to the nucleus of all Apc- ing Apc loss was c-Myc dependent. Analysis by QRT-PCR deficient cells (Supplementary Fig. S1A and B), suggesting (from epithelial extractions) showed significant reduction fl/fl that every cell with high β-catenin had cyclin D2 expression in cyclin D2 and CDK4 mRNA levels in AhCre+ Apc fl/fl fl/fl (Supplementary Fig. S1C and D). c-Myc compared with AhCre+ Apc c-Myc+/+ intestinal Our previous microarray analysis also suggested that enterocytes (Fig. 1D; ref. 6). To test whether this led to a CDK4 was upregulated. This was confirmed by quantitative functional reduction in CDK4 activity, we analyzed phos- reverse transcription-PCR (QRT-PCR) and immunoblotting phorylated pRb levels and found this to be significantly re- fl/fl fl/fl performed on intestinal epithelial extracts, which showed a duced in AhCre+ Apc c-Myc compared with AhCre+ fl/fl significant upregulation of CDK4 levels following Apc loss Apc c-Myc+/+ intestinal enterocytes (Fig. 1E). Importantly, (Fig. 1D and E). To assess if this upregulation of CDK4 led neither cyclin D2 nor CDK4 levels were downregulated by + to an increased activity, we assessed whether there was in- QRT-PCR, in mice where only c-Myc was deleted (AhCre fl/fl creased levels of phosphorylated (and therefore inhibited) Myc ), suggesting that the induction of hyperproliferation pRbS807/811 following Apc loss by immunoblotting. Figure following Apc loss, but not normal proliferation, may be 1E showed a marked induction of phosphorylated pRb dependent on the cyclin D2–CDK4 (Myc versus Wt and following Apc loss. CDK4, 0.9; cyclin D2, 2.2; n = 3).

Figure 1. Cyclin D2 is upregulated immediately following loss of Apc and is c-Myc dependent. A, in situ hybridization (ISH) for cyclin D2 on Wt and AhCre+ Apcfl/fl crypts at day 4 after induction. Note strong upregulation of cyclin D2 in AhCre+ Apcfl/fl crypts. Scale bar, 20 μm. B, immunohistochemistry (IHC) for cyclin D2 showing high upregulation of cyclin D2 in AhCre+ Apcfl/fl crypts. Scale bar, 20 μm. C, immunoblotting for cyclin D2 shows strong upregulation of protein from intestinal epithelial cells extracts of AhCre+ Apcfl/fl mice compared with Wt. D, QRT-PCR showing a significant upregulation of both cyclin D2 (4.292; P = 0.004) and CDK4 (2.194; P = 0.005) following loss of Apc. Note a decrease in expression of both cyclin D2 (0.193; P = 0.01) and CDK4 (0.32; P = 0.004) in AhCre+ Apcfl/fl Mycfl/fl, illustrating that the upregulation of both cyclin D2 and CDK4 is c-Myc dependent. E, immunoblotting for CDK4, cyclin D2, and pRb in Wt, AhCre+ Apcfl/fl, and AhCre+ Apcfl/fl Mycfl/fl 4 d following Cre induction.

www.aacrjournals.org Cancer Res; 70(20) October 15, 2010 8151

Cole et al.

Cyclin D2 deficiency reduces crypt size and test; n = 5). Once again, no effect of cyclin D2 deficiency alone − − proliferation in Apc-deficient intestinal crypts was observed (Fig. 2B, AhCre+ Apc+/+ Cyclin D2 / versus We next wanted to test the functional importance of cyclin AhCre+ Apc+/+ Cyclin D2+/+; P = 0.1914, Mann-Whitney U test; − − D2 upregulation. Therefore, we intercrossed Cyclin D2 / mice n = 5). No differences were observed in the other phenotypes fl/fl to AhCre+ Apc mice and analyzed the intestinal phenotype associated with Apc loss (apoptosis, migration, and differen- 4 days following Apc deletion. Although cyclin D2 deficiency tiation; data not shown). Cyclin D2 deficiency did not affect alone had no effect on crypt size in mice (AhCre+ Apc+/+ β-catenin accumulation or localization following Apc loss, − − Cyclin D2 / ; Fig. 2A; P = 1.00, Mann-Whitney U test; n = 5), displaying that cyclin D2 is downstream of Wnt signaling cyclin D2 deficiency significantly reduced the crypt size of (Fig. 2D). fl/fl − − AhCre+ Apc Cyclin D2 / mice when compared with fl/fl AhCre+ Apc Cyclin D2+/+ mice (Fig. 2A and C; P = 0.01, Cyclin D2 deficiency leads to a dramatic reduction of Mann-Whitney U test; n = 5). To investigate whether this tumor burden within the ApcMin/+ mouse was due to reduced proliferation, we examined BrdUrd incor- Given the reduced crypt size and proliferation observed in fl/fl − − fl/fl − − poration and found that AhCre+ Apc Cyclin D2 / mice had AhCre+ Apc Cyclin D2 / mice, we next wished to assess if significantly reduced proliferation compared with AhCre+ this was functionally relevant for tumor formation. First, fl/fl Apc Cyclin D2+/+ mice (Fig. 2B; P = 0.04, Mann-Whitney U we examined whether cyclin D2 was overexpressed in the

Figure 2. Cyclin D2 deficiency reduces proliferation following Apc loss. A, box plot showing that cyclin D2 deficiency does not affect crypt size in Wt crypts (P = 1.00, Mann-Whitney U test; n = 5). However, following Apc loss, cyclin D2 deficiency does significantly decrease crypt size (P = 0.01, Mann-Whitney U test; n = 5). B, box plot showing that cyclin D2 deficiency does not affect proliferation in Wt crypts (P = 0.1914, Mann-Whitney U test). However, following Apc loss, deletion of cyclin D2 does significantly decrease proliferation levels (P = 0.04, Mann-Whitney U test; n = 5). C, H&E staining showing crypt size. Black bars highlight crypt size. Crypts have a single-cell crypt-villus axis in Wt mice, whereas AhCre+ Apcfl/fl–deficient crypts are much larger. Double mutant AhCre+ Apcfl/fl Cyclin D2−/− mice have smaller crypts compared with AhCre+ Apcfl/fl mice. D, immunohistochemistry for β-catenin. Wt intestinal crypts only have a small subset of enterocytes with nuclear β-catenin at the base of the crypt (arrowed inset). Both AhCre+ Apcfl/fl and AhCre+ Apcfl/fl Cyclin D2−/− intestinal crypts have enterocytes throughout with nuclear β-catenin (red arrows). Scale bars, 20 μm.

8152 Cancer Res; 70(20) October 15, 2010 Cancer Research

Cyclin D2 and Intestinal Tumorigenesis

Figure 3. Cyclin D2 deficiency reduces tumorigenesis in the ApcMin/+ mouse. A, cyclin D2 immunohistochemistry performed on intestinal polyp (black arrow) from ApcMin/+ mouse showing increased expression of cyclin D2 compared with surrounding normal epithelium (red arrow). Inset shows nuclear staining of cyclin D2. B, Kaplan-Meier survival plot showing that ApcMin/+ Cyclin D2−/− mice (green line) survive significantly longer than ApcMin/+ mice (black line; P < 0.001, log-rank test; n ≥ 20). Heterozygosity for Cyclin D2 (red line) did not affect survival compared with ApcMin/+ mice (P = 0.2516, log-rank test; n ≥ 20). C, box plot showing that ApcMin/+ Cyclin D2−/− mice have a significantly smaller tumor burden in the small intestine than ApcMin/+ mice (P < 0.001, Mann-Whitney U test; n ≥ 20) when taken at a time point of 110 d. Heterozygosity for Cyclin D2 did not affect total tumor burden compared with ApcMin/+ mice (P = 0.58, Mann-Whitney U test; n ≥ 20). D, box plot showing that ApcMin/+ Cyclin D2−/− mice have significantly less tumors in the small intestine than ApcMin/+ mice (P < 0.001, Mann-Whitney U test; n > 20) when taken at a time point of 110 d. Heterozygosity for Cyclin D2 did not affect total tumor number compared with ApcMin/+ mice (P = 0.2451, Mann-Whitney U test). E, box plot showing that ApcMin/+ Cyclin D2−/− mice have a significantly smaller average tumor size than ApcMin/+ mice (P < 0.001, Mann-Whitney U test; n ≥ 20). Similarly to tumor burden, heterozygous deletion for cyclin D2 did not affect average tumor size compared with those of ApcMin/+ mice (P = 0.1452, Mann-Whitney U test; n ≥ 20).

Min/+ Min/+ Apc adenomas and found this to be the case (Fig. 3A). To were similar to those in Apc Cyclin D2+/+ mice, confirm- investigate the importance of cyclin D2 for tumor formation ing that mice were being euthanized at the same stage of − − Min/+ and survival, we crossed Cyclin D2 / mice to the Apc disease. model of intestinal tumorigenesis. Two studies were per- To ensure that the increased life span was due to delayed formed. First, to determine the effect of cyclin D2 on survival, tumorigenesis, we aged a second cohort to a time point of Min/+ Min/+ Min/+ a cohort containing Apc Cyclin D2+/+ mice (n =29), 110 days (Apc ,n=30;Apc Cyclin D2+/+ mice (n = Min/+ − Min/+ Min/+ − Min/+ − − Apc Cyclin D2+/ mice (n = 26), and Apc Cyclin 29), Apc Cyclin D2+/ , n = 30; Apc Cyclin D2 / , n = − − Min/+ − − D2 / mice (n = 21) was aged until showing signs of intestinal 23). Apc Cyclin D2 / mice displayed a significant reduc- illness. This included paling feet, starry coats, and hunching. tion in total tumor burden (Fig. 3C; P ≤ 0.001, Mann-Whitney Figure 3B shows that deletion of cyclin D2 significantly in- U test; P ≤ 0.01, Bonferroni correction), number, and size Min/+ − − creased the survival of Apc Cyclin D2 / mice when com- (Fig. 3D and E; P ≤ 0.001, Mann-Whitney U test; P ≤ 0.01, Min/+ pared with Apc Cyclin D2+/+ mice (P < 0.001, log-rank Bonferroni correction). As tumor size and number were re- test). Heterozygous deletion of cyclin D2 did not significantly duced, this would suggest that cyclin D2 deficiency was affect survival (P = 0.2516, log-rank test). At death, tumor suppressing both tumor initiation and progression. Heterozy- Min/+ − − burden of Apc Cyclin D2 / mice (Supplementary Fig. S2; gous deletion of cyclin D2 did not affect total tumor number P = 0.08, Mann-Whitney U test) and average tumor size (Fig. 3D; P = 0.2451, Mann-Whitney U test) or average tumor (Supplementary Fig. S2; P = 0.1788, Mann-Whitney U test) size (Fig. 3E; P = 0.1452, Mann-Whitney U test).

www.aacrjournals.org Cancer Res; 70(20) October 15, 2010 8153

Cole et al.

We next investigated levels of β-catenin and proliferation been shown to selectively inhibit CDK4/6 in vivo (20). The Min/+ Min/+ − − within adenomas from Apc and Apc Cyclin D2 / use of an inhibitor also allowed us to treat established tu- Min/+ mice at a time point of 110 days. Figure 4A (and Supplemen- mors. Thus, we identified Apc mice that had developed tary Fig. S3) shows strong nuclear staining of β-catenin with- a tumor burden (at ∼80 days) and treated these mice with a Min/+ Min/+ − − in the polyps of Apc and Apc Cyclin D2 / mice. daily gavage of 150 mg/kg of inhibitor for 5 days. At the end Immunohistochemical staining for cyclin D2 shows a com- of the treatment regime, mice were injected with BrdUrd and plete ablation of protein from both the colonic epithelium intestines were harvested 2 hours later. Analysis of BrdUrd Min/+ − − and polyps from Apc Cyclin D2 / mice (Fig. 4B). Impor- incorporation showed a strong reduction in the levels of pro- Min/+ − − tantly, polyps from Apc Cyclin D2 / mice were signifi- liferation in the PD0332991-treated tumors compared with Min/+ cantly less proliferative than Apc mice as scored vehicle-treated tumors (Fig. 5A–C). Indeed, adenoma prolif- through total number of BrdUrd-positive cells per 500 tumor eration was inhibited to comparable levels that are observed cells (Fig. 4C and D; P = 0.04, Mann-Whitney U test; n =3 in cyclin D2 knockout tumors. Importantly, no effect on mouse per genotype, at least five tumors per mouse). normal intestinal enterocyte proliferation was observed (Fig. 5A–C). Hence, this suggests that Apc-deficient cells CDK4/6 inhibition suppresses proliferation within are dependent on cyclin D–CDK4/6 complexes for efficient established ApcMin/+ mouse adenomas proliferation. Given recent studies showing that cyclin D proteins can affect processes without cell cycle control (22), it remains Combination of cyclin D2 deficiency with cyclin D1 theoretically possible that cyclin D2 was affecting the prolif- haploinsufficiency further reduces tumor burden eration of cells via a CDK-independent mechanism. There- Previous studies have suggested that there may be com- fore, we wanted to assess whether inhibition of CDK4/6 pensation between the different cyclin D family members. could specifically reduce the proliferation of Apc-deficient To investigate this, we examined the expression of cyclin cells in vivo. To achieve this, we used a novel small-molecule D1 in the cyclin D2 knockout intestines following Apc loss. pharmacologic inhibitor of CDK4/6, PD0332991, which has Immunohistochemical staining for cyclin D1 failed to reveal

Figure 4. Cyclin D2 deficiency reduces proliferation rates in adenomas from the ApcMin/+ mouse. A, immunohistochemistry for β-catenin showing high levels of nuclear β-catenin in adenomas from both ApcMin/+ and ApcMin/+ Cyclin D2−/− mice. Black arrows point to adenomatous cells with increased nuclear (and cytoplasmic) β-catenin; red arrows point to neighboring Wt cells with only cytoplasmic staining. B, immunohistochemistry for cyclin D2 showing loss of all nuclear staining in adenomas from ApcMin/+ Cyclin D2−/− mice. Note that cytoplasmic staining remains, suggesting that this is nonspecific staining. C, box plot showing a significant reduction in proliferation in adenomas arising from ApcMin/+ Cyclin D2−/− compared with ApcMin/+ mice (P = 0.04, Mann-Whitney U test; n = 3). From each mouse, at least five adenomas were scored, and at least three mice per genotype were used. D, immunohistochemistry for BrdUrd showing higher BrdUrd incorporation within tumors from ApcMin/+ mice compared with those from ApcMin/+ Cyclin D2−/− mice. Black arrows show areas of adenomas in the ApcMin/+ Cyclin D2−/− mice that lack BrdUrd incorporation. Red arrows show high proliferation in normal epithelium. Scale bars, 20 μm.

8154 Cancer Res; 70(20) October 15, 2010 Cancer Research

Cyclin D2 and Intestinal Tumorigenesis

Figure 5. CDK4/6 inhibition suppresses proliferation in established adenomas from ApcMin/+ mice. A, box plot showing no change in intestinal enterocyte proliferation when ApcMin/+ mice are treated with 150 mg/kg of PD0332991 daily for 5 d (P = 0.76, Mann-Whitney U test; n = 5). B, box plot showing a significant reduction in proliferation in tumors arising from these ApcMin/+ mice treated with PD0332991 when compared with vehicle-treated mice (P = 0.01, Mann-Whitney U test; n = 5 mice, five adenomas per mouse). C, immunohistochemistry for BrdUrd showing lower levels of BrdUrd incorporation within adenomas from ApcMin/+ mice (black arrows) when compared with the surrounding normal tissues (red arrows). Scale bar, 20 μm.

fl/fl Min/+ − Min/+ an upregulation of cyclin D1 levels in AhCre+ Apc Cyclin clin D1+/+, Apc Cyclin D2+/+ Cyclin D1+/ , Apc Cyclin − − − − Min/+ − − − D2 / –deficient intestinal epithelium, with only a small sub- D2 / Cyclin D1+/+,andApc Cyclin D2 / Cyclin D1+/ set of cells showing high levels of nuclear cyclin D1 (Supple- were generated (at least 10 per group) and aged 110 days. mentary Fig. S4). Cyclin D1 expression was also comparable In agreement with the findings of Hulit and colleagues (13), Min/+ Min/+ − − in adenomas from Apc and Apc Cyclin D2 / mice we saw a significant suppression of tumorigenesis in the Min/+ − (Supplementary Fig. S4). Mice lacking both cyclins D1 and Apc Cyclin D2+/+ Cyclin D1+/ animals (P =0.006, D2 die shortly after birth, which precludes analysis of double Mann-Whitney U test; n = 10; P ≤ 0.01, Bonferroni correc- knockout intestines. However, as studies have shown that cy- tion; Fig. 6A). Again, we saw a significant reduction in tumor- Min/+ − − clin D1 heterozygosity can slow intestinal tumorigenesis in igenesis in the Apc Cyclin D2 / Cyclin D1+/+ animals (P = Min/+ the Apc mouse, this allowed us to assess if suppression 0.005, Mann-Whitney U test; n = 10; P ≤ 0.01, Bonferroni Min/+ − − − of tumorigenesis by cyclins D1 and D2 was epistatic, additive, correction). Importantly, Apc Cyclin D2 / Cyclin D1+/ or cooperative. Therefore, we backcrossed cyclin D1 mice to knockout animals showed a further reduction in tumorigen- Min/+ − − C57Bl6J mice for five generations and then intercrossed these esis when compared with Apc Cyclin D2 / Cyclin D1+/+ +/− − − Min/+ − animals with ApcMin Cyclin D2 / animals. Cohorts of and Apc Cyclin D2+/+ Cyclin D1+/ intestines, definitively Min/+ Min/+ − Apc Cyclin D2+/+ mice (n = 29), Apc Cyclin D2+/ Cy- showing that cyclins D1 and D2 are not epistatic (Fig. 6A).

www.aacrjournals.org Cancer Res; 70(20) October 15, 2010 8155

Cole et al.

Figure 6. Cyclin D1 haploinsufficiency further suppresses tumorigenesis and tumor proliferation when combined with cyclin D2 deficiency. A, box plot showing that ApcMin/+ Cyclin D2−/− Cyclin D1+/− (Min D2−/− D1+/−) mice have a significantly smaller tumor burden in the small intestine than ApcMin/+ Cyclin D2−/− Cyclin D1+/+ (Min D2−/− D1+/+) and ApcMin/+ Cyclin D2+/+ Cyclin D1+/− (Min D2+/+ D1+/−) mice (P < 0.001, Mann-Whitney U test; n ≥ 10) when taken at a time point of 110 d. B, immunohistochemistry for BrdUrd showing lower levels of BrdUrd incorporation within adenomas (black arrows) compared with surrounding normal tissue (red arrows). C, box plot showing a significant reduction in proliferation in tumors arising in ApcMin/+ Cyclin D2−/− Cyclin D1+/− compared with ApcMin/+ Cyclin D2−/− Cyclin D1+/+ mice (P = 0.01, Mann-Whitney U test; n = 10). D, box plot showing equivalent levels of proliferation in normal small intestinal ApcMin/+ Cyclin D2−/− Cyclin D1+/− compared with ApcMin/+ Cyclin D2+/+ Cyclin D1+/+ mice (P ≤ 0.5, Mann-Whitney U test; n = 5).

Instead, the data were most consistent with an additive effect a positive relation has also been reported between overex- of cyclin D1 haploinsufficiency and cyclin D2 knockout. pression of cyclin D2 and higher TNM stage of tumor, sug- Finally, to assess whether the reduction of tumorigenesis cor- gesting that overexpression of cyclin D2 correlates to a high related with reduced proliferation, we examined BrdUrd la- metastatic degree of tumor (16). Min/+ beling within the rare adenomas that formed within Apc There has been some debate over the role of cyclin D1 as a − − − Cyclin D2 / Cyclin D1+/ mice and observed a further reduc- Wnt target gene in CRC. Our previous studies have shown tion of proliferation within the tumors of these mice com- that cyclin D1 is not immediately upregulated following Min/+ − − pared with Apc Cyclin D2 / Cyclin D1+/+ mice (Fig. 6B Apc loss in the murine intestinal epithelium, and our data and C). No effect in normal small intestinal proliferation shown here suggest that unlike cyclin D1, cyclin D2 can rates was observed (Fig. 6D). reduce the level of proliferation of intestinal enterocytes immediately following Apc loss. However, it has been clearly Min/+ Discussion shown that cyclin D1 is upregulated in adenomas of Apc mouse and cyclin D1 deficiency can suppress tumorigenesis In this study, we have shown that cyclin D2 is required for (12–14). Thus, our finding that cyclin D2 loss can also efficient proliferation and tumorigenesis following Apc loss. suppress tumorigenesis is important, as there is still expres- This finding is particular pertinent to human CRC, as previ- sion of cyclin D1 within these adenomas that cannot com- ous studies have shown that overexpression of cyclin D2 has pletely compensate for the lack of cyclin D2. This is in been reported to be the most considerable aberration among contrast to normal intestinal epithelium, which shows no de- G1-phase regulators in human colonic polyps (23). Moreover, fect in proliferation in the absence of cyclin D2, highlighting

8156 Cancer Res; 70(20) October 15, 2010 Cancer Research

Cyclin D2 and Intestinal Tumorigenesis

that Apc-deficient intestinal enterocytes are somewhat de- PD0332991 can cause a reduction in proliferation of the more pendent on high cyclin D2 levels. This finding is reinforced aggressive mouse models of CRC that have recently been by our experiments analyzing the effect of cyclin D1 heterozy- developed (28, 29). It will also be interesting to evaluate its gosity in the context of cyclin D2 genetic knockout. The find- effect in combination with conventional chemotherapeutics ing that a further reduction in tumorigenesis was observed such as 5-fluorouracil. suggests that the roles that cyclins D1 and D2 play in intestinal Our previous studies have shown that c-Myc deletion res- tumorigenesis are distinct. These data therefore support the cues all the phenotypes following Apc loss and thus blocks notion of complementary but distinguishable roles for cyclins tumor formation, and indeed, heterozygosity for c-Myc also D1 and D2 in normal development and cancer. Combined de- strongly suppresses tumorigenesis. Although this makes letion of cyclins D1 and D2 results in death in the first 3 weeks c-Myc an excellent target, given the difficulty in targeting a of life due to hypoplastic cerebellum (24), suggesting some transcription factor such as c-Myc, it may be a more effica- compensation between D-type cyclins. Given the dramatic cious strategy to inhibit in combination several pathways suppression of tumorigenesis in the cyclin D1 heterozygous, downstream of Apc loss, where drugs are already available. cyclin D2 knockout mice, it is therefore tempting to speculate It is interesting to note in this study that expression of cyclin that Apc-deficient epithelium would be unable to proliferate D2 and CDK4 following Apc loss was c-Myc dependent, illus- in the absence of both cyclins D1 and D2. trating that the upregulation of these cyclin D2–CDK4 com- Apc deletion within the intestinal epithelium leads to a plexes is key for c-Myc–dependent proliferation following crypt progenitor cell–like phenotype of hyperproliferation, Apc loss. This raises the possibility that cancer cell cycles failed differentiation, and failed migration. In this study, we may be more dependent on cyclin D–CDK4/6 complexes show that reduction of just one of these phenotypes, hyper- than normal cells. Recent studies have suggested that this proliferation can strongly suppress tumorigenesis. This may be the case in intestinal epithelial cells, as although de- raised the possibility that other strategies such as inhibiting letion of E2F1-3 suppressed the proliferation induced follow- CDK4/6 complexes (which we have shown are upregulated ing pRb loss, there was no effect on normal intestinal following Apc loss) may also suppress tumorigenesis. Impor- proliferation (30). tantly, unlike cyclin D2, there are small-molecule kinase in- Taken together, these results indicate the important pro- hibitors to these complexes currently under preclinical liferative role that cyclin D–CDK4/6 complexes play follow- development and in phase I trials. In this study, we have used ing Wnt activation in driving tumor formation. Moreover, pyridopyrimidine (PD0332991), which selectively inhibits this raises the possibility that inhibition of cyclin D–CDK4/ CDK4 and CDK6 and is currently in phase I clinical trials 6 may be useful in those individuals with a high risk of CRC. for mantle cell lymphoma and in phase II to III clinical trials for multiple myeloma and hormone receptor–positive ad- Disclosure of Potential Conflicts of Interest vanced breast cancer (25, 26). This inhibitor suppressed pro- Min/+ liferation within preformed adenomas from Apc mice No potential conflicts of interest were disclosed. but had no effect on the normal intestinal epithelium. This therefore suggests a clear therapeutic window for the use of Grant Support this inhibitor in Apc-deficient tumors. Of interest to our study, PD0332991 was shown to cause regression of tumors Cancer Research UK and R01 CA083688 and CA108420 (P. Sicinski). P. Sicinski is a Scholar of the Leukemia and Lymphoma Society. in mice with a human CRC xenograft (27). However, despite We thank Biological Services Unit histology and Roger Brisewitz. this finding, PD0332991 has not yet begun clinical trial test- The costs of publication of this article were defrayed in part by the payment ing for CRC (reviewed in ref. 26). One question that remains of page charges. This article must therefore be hereby marked advertisement in is whether this selectivity for Apc-deficient cells will remain accordance with 18 U.S.C. Section 1734 solely to indicate this fact. in more advanced tumors where there are numerous other Received 01/26/2010; revised 06/26/2010; accepted 07/26/2010; published mutations. It will be thus of interest to assess whether OnlineFirst 08/24/2010.

References 1. Kinzler KW, Nilbert MC, Su LK, et al. Identification of FAP locus 7. Bouchard C, Thieke K, Maier A, et al. Direct induction of cyclin D2 by genes from chromosome-5Q21. Science 1991;253:661–5. Myc contributes to cell cycle progression and sequestration of p27. 2. Kinzler KW, Vogelstein B. Lessons from hereditary colorectal cancer. EMBO J 1999;18:5321–33. Cell 1996;87:159–70. 8. Eilers M. Control of cell proliferation by myc family genes. Mol Cells 3. Bienz M, Clevers H. Linking colorectal cancer to Wnt signaling. Cell 1999;9:1–6. 2000;103:311–20. 9. Haas K, Staller P, Geisen C, Bartek J, Eilers M, Moroy T. Mutual re- 4. Sansom OJ, Reed KR, Hayes AJ, et al. Loss of Apc in vivo immedi- quirement of CDK4 and Myc in malignant transformation: evidence ately perturbs Wnt signaling, differentiation, and migration. Genes for cyclin D1/CDK4 and p16(INK4A) as upstream regulators of Myc. Dev 2004;18:1385–90. Oncogene 1997;15:179–92. 5. Andreu P, Colnot S, Godard C, et al. Crypt-restricted proliferation 10. Tetsu O, McCormick F. β-Catenin regulates expression of cyclin D1 and commitment to the Paneth cell lineage following Apc loss in in colon carcinoma cells. Nature 1999;398:422–6. the mouse intestine. Development 2005;132:1443–51. 11. Shtutman M, Zhurinsky J, Simcha I, et al. The cyclin D1 gene is a 6. Sansom OJ, Meniel VS, Muncan V, et al. Myc deletion rescues Apc target of the β-catenin/LEF-1 pathway. Proc Natl Acad Sci U S A deficiency in the small intestine. Nature 2007;446:676–9. 1999;96:5522–7.

www.aacrjournals.org Cancer Res; 70(20) October 15, 2010 8157

Cole et al.

12. Sansom OJ, Reed KR, van de Wetering M, et al. Cyclin D1 is not an 22. Bienvenu F, Jirawatnotai S, Elias JE, et al. Transcriptional role of immediate target of β-catenin following Apc loss in the intestine. cyclin D1 in development revealed by a genetic-proteomic screen. J Biol Chem 2005;280:28463–7. Nature 2010;463:374–8. 13. Hulit J, Wang CG, Li ZP, et al. Cyclin D1 genetic heterozygosity reg- 23. Bartkova J, Thullberg M, Slezak P, et al. Aberrant expression of

ulates colonic epithelial cell differentiation and tumor number in Apc G1-phase cell cycle regulators in flat and exophytic adenomas of (Min) mice. Mol Cell Biol 2004;24:7598–611. the human colon. Gastroenterology 2001;120:1680–8. 14. Wilding J, Straub J, Bee J, et al. Cyclin D1 is not an essential target of 24. Santamaria D, Ortega S. Cyclins and CDKS in development and β-catenin signaling during intestinal tumorigenesis, but it may act as cancer: lessons from genetically modified mice. Front Biosci 2006; a modifier of disease severity in multiple intestinal neoplasia (Min) 11:1164–88. mice. Cancer Res 2002;62:4562–5. 25. Baughn LB, Di Liberto M, Wu K, et al. A novel orally active small 15. Yang RY, Bie WJ, Haegebarth A, Tyner AL. Differential regulation of molecule potently induces G(1) arrest in primary myeloma cells and D-type cyclins in the mouse intestine. Cell Cycle 2006;5:180–3. prevents tumor growth by specific inhibition of cyclin-dependent 16. Mermelshtein A, Gerson A, Walfisch S, et al. Expression of D-type kinase 4/6. Cancer Res 2006;66:7661–7. cyclins in colon cancer and in cell lines from colon carcinomas. 26. Lapenna S, Giordano A. Cell cycle kinases as therapeutic targets for Br J Cancer 2005;93:338–45. cancer. Nat Rev Drug Discov 2009;8:547–66. 17. Baena E, Gandarillas A, Vallespinos M, et al. c-Myc regulates cell 27. Fry DW, Harvey PJ, Keller PR, et al. Specific inhibition of cyclin- size and ploidy but is not essential for postnatal proliferation in liver. dependent kinase 4/6 by PD 0332991 and associated antitumor ac- Proc Natl Acad Sci U S A 2005;102:7286–91. tivity in human tumor xenografts. Mol Cancer Ther 2004;3:1427–37. 18. Ireland H, Kemp R, Houghton C, et al. Inducible Cre-mediated con- 28. Marsh V, Winton DJ, Williams GT, et al. Epithelial Pten is dispens- trol of gene expression in the murine gastrointestinal tract: effect of able for intestinal homeostasis but suppresses adenoma develop- loss of β-catenin. Gastroenterology 2004;126:1236–46. ment and progression after Apc mutation. Nat Genet 2008;40: 19. Sicinski P, Donaher JL, Geng Y, et al. Cyclin D2 is an FSH-responsive 1436–44. gene involved in gonadal cell proliferation and oncogenesis. Nature 29. Sansom OJ, Meniel V, Wilkins JA, et al. Loss of Apc allows pheno- 1996;384:470–4. typic manifestation of the transforming properties of an endoge- 20. Wang L, Wang J, Blaser BW, et al. Pharmacologic inhibition of nous K-ras oncogene in vivo. Proc Natl Acad Sci U S A 2006; CDK4/6: mechanistic evidence for selective activity or acquired re- 103:14122–7. sistance in acute myeloid leukemia. Blood 2007;110:2075–83. 30. Chong JL, Wenzel PL, Saenz-Robles MT, et al. E2f1-3 switch from 21. Bjerknes M, Cheng H. Methods for the isolation of intact epithelium activators in progenitor cells to repressors in differentiating cells. from the mouse intestine. Anat Rec 1981;199:565–74. Nature 2009;462:930–4.

8158 Cancer Res; 70(20) October 15, 2010 Cancer Research

Cyclin D2−Cyclin-Dependent Kinase 4/6 Is Required for Efficient Proliferation and Tumorigenesis following Apc Loss

Alicia M. Cole, Kevin Myant, Karen R. Reed, et al.

Cancer Res Published OnlineFirst August 24, 2010.

Updated version Access the most recent version of this article at: doi:10.1158/0008-5472.CAN-10-0315

Supplementary Access the most recent supplemental material at: Material http://cancerres.aacrjournals.org/content/suppl/2010/10/06/0008-5472.CAN-10-0315.DC1

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/early/2010/10/01/0008-5472.CAN-10-0315. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.