DOCSLIB.ORG

Causal Dynamical Modelling Predicts Novel Regulatory Genes of FOXP3 in Human Regulatory T Cells

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Causal Dynamical Modelling Predicts Novel Regulatory Genes of FOXP3 in Human Regulatory T Cells bioRxiv preprint doi: https://doi.org/10.1101/2020.02.13.943688; this version posted February 14, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Causal dynamical modelling predicts novel regulatory genes of FOXP3 in human regulatory T cells Rucha Sawlekar∗†, Stefano Magni∗†, Christophe Capelle∗‡, Alexandre Baron‡, Ni Zeng‡, Laurent Mombaerts†, Zuogong Yue§, Ye Yuan¶, Feng Q. He‖‡, and Jorge Gonçalvesk†∗∗ Abstract Keywords: regulatory T cells, FOXP3, dynami- cal modelling, humans, time-series analysis, network Regulatory T cells (Tregs), characterized as a inference, gene regulatory network, transcriptomic CD4+CD25+FOXP3+ subset of T cells, are vi- data, system identification, causal network. tal to the induction of immune tolerance and the maintenance of immune homeostasis. While target Regulatory T cells (Tregs) are key players of the genes of Treg master regulator FOXP3 have been immune system, which in turn plays a crucial role in identified, the upstream regulatory machinery of a wide range of diseases. It is well established that FOXP3 still remains largely unknown. Here we dy- the transcription factor FOXP3 is a master regula- namically model causal relationships among genes tor of Tregs. However, genes regulating FOXP3 are from available time-series genome-scale datasets, to still largely unknown and identifying them may be predict direct or indirect regulatory genes of FOXP3 vital for developing new immunotherapeutics. This in human primary Tregs. From the whole genome, paper computationally screens the whole genome for we selected five top ranked candidates for further ex- potential regulators of FOXP3, and then experimen- perimental validation. Following knockdown, three tally validates them. Overall, the paper illustrates out of the five candidates indeed showed significant how the combination of genome-wide time-series effects on the mRNA expression of FOXP3. Fur- data with dynamical modelling can identify a small ther experiments showed that one out of these three set of relevant causal interactions. predicted candidates, namely nuclear receptor bind- ing factor 2 (NRBF2), also affected FOXP3 protein Tregs perform immunosuppression of self-reactive expression. These results open new doors to iden- lymphocytes to induce immunological self-tolerance tify potential new mechanisms of immune related and maintain homeostasis [Josefowicz et al., 2012; diseases. Kenneth et al., 2012; Li et al., 2015]. Tregs are involved in different types of diseases, such as au- ∗These authors contributed equally to this work. toimmune diseases [Dejaco et al., 2006; Fehérvari †Luxembourg Centre for Systems Biomedicine, Univer- and Sakaguchi, 2004; Sakaguchi et al., 2006], cancer sity of Luxembourg, 6 Avenue Du Swing, L-4367 Belvaux, [Franchina et al., 2018; Shang et al., 2015; Tanaka Luxembourg. ‡Luxembourg Institute of Health, 29 Rue Henri Koch, and Sakaguchi, 2017], infectious diseases [Joosten L-4354 Esch- Sur-Alzette, Luxembourg. and Ottenhoff, 2008; Stephen-Victor et al., 2017], §University of New South Wales, Kensington NSW 2052, neurodegenerative diseases [Baruch et al., 2015; He Australia. and Balling, 2013] and others [Cools et al., 2007]. ¶School of Artificial Intelligence and Automation, Huazhong University of Science and Technology, Wuhan The transcription factor FOXP3 has been shown 430074, China. to play a decisive role for the development and func- ‖Co-corresponding authors of this work. Emails: [email protected], [email protected]. tion of Tregs [Ziegler, 2006]. This gene is expressed ∗∗Department of Plant Sciences, University of Cambridge, specifically in CD4+CD25+ Tregs [Hori et al., 2003; Downing Street, Cambridge CB2 3EA, United Kingdom. Rudensky, 2011]. Altered expression of FOXP3 has 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.13.943688; this version posted February 14, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. been found in various types of autoimmune diseases 13601 transcripts left, corresponding to 7826 genes. [Liu et al., 2013] and tumors [Cunha et al., 2012; A gene can correspond to multiple transcripts, each Martin et al., 2010; Szylberg et al., 2016]. Genetic measured by a separate probe set; from now on mutations in FOXP3 result in autoimmunity and in- for simplicity we will only use the term transcripts flammatory syndromes, both in humans and in mice and omit the term probe set. The role of the com- [Fontenot et al., 2003; Khattri et al., 2003; Mayer putational modelling was to reduce this number et al., 2014; Mercer and Unutmaz, 2009]. Most of to 5 genes, reflecting our available experimental the experimental evidence indicates that FOXP3 resources for validation. deficiency is responsible for IPEX (immunodysreg- Existing models capture known regulations of ulation polyendocrinopathy enteropathy X-linked) genes by FOXP3 [Carbo et al., 2013, 2015; Hong syndrome which is a rare disease caused by dysfunc- et al., 2011; van den Ham and de Boer, 2008], so they tion of Tregs [Bennett et al., 2001]. were not useful in finding novel regulators of FOXP3. Target genes of FOXP3 have been identified Hence, we need to fit new models from data that through intensive studies [Marson et al., 2007; Zheng capture causality, i.e. that identify those genes that et al., 2007; Zheng and Rudensky, 2007]. Meanwhile, cause changes in FOXP3. Here, we take advantage progress in high-throughput technical developments, of a relatively large number of available time-series such as ChIP-seq and ChIP-Chip, have started to Tregs samples to fit dynamical models. In particular, illuminate genetic and epigenetic mechanisms reg- ordinary differential equations are mathematical ab- ulating expression or protein stability of FOXP3 stractions that capture both dynamics and causality, [Chen et al., 2013; Floess et al., 2007; Fu et al., and help build testable hypotheses in experiments. 2012; Gao et al., 2015; Miyara and Sakaguchi, 2007; Our models take as inputs the time-series expression Schmidt et al., 2012]. The majority of known up- values of the whole genome, i.e. each of the 13601 stream regulators of the expression of FOXP3 are transcripts left after pre-processing of the data, and general regulatory genes, e.g. those controlling in- FOXP3 as the single output (target). terleukin signaling pathways (IL2, IL4, IL6 and so There is always a trade-off on the choice of model on) and cell surface receptors (TGFB) [Lal and complexity. With rich data, models can be complex, Bromberg, 2009]. Those genes tend to regulate a providing detailed information of mechanisms of ac- large number of genes far beyond FOXP3, which tion. However, with limited data, complex models might cause significant unwanted side effects when can easily overfit and introduce bias, resulting in being targeted. large numbers of false negatives. In our case, with More specific upstream genes regulating FOXP3 only a single time-series experiment and limited are still largely unknown. Identifying these regula- resources for validation, we consider the simplest tors of FOXP3 may be crucial for developing new dynamical model: first-order linear time-invariant immunotherapeutics against autoimmune and other (LTI) systems, a well established modelling strat- related diseases. Unbiased experimental screening egy [Dalchau, 2012; Herrero et al., 2012; Mombaerts of the whole genome for such upstream regulators et al., 2019b, 2016; Müller et al., 2019]. Moreover, is almost impossible with current experimental ap- to scale the method to the whole genome, we built proaches. However, such tasks can be efficiently a large number of simple pairwise models (one per performed computationally. This is the goal of this transcript), testing whether each transcript on its work. own could regulate FOXP3. A model associated The models trained in this work are based on with a particular transcript is given by microarray data of the whole-genome mRNA ex- dFOXP3(t) pression in isolated human Tregs [He et al., 2012]. = a · FOXP3(t)+ b · transcript(t) . Tregs from two different donors were stimulated at dt time zero with anti-CD3/-CD28/IL2, and measure- The left-hand side of the equation is the derivative ments were taken at time zero followed by sampling of FOXP3 expression over time, i.e. the rate of every twenty minutes over a period of six hours (19 change of the concentration of FOXP3. Finally, time points in total). After the pre-processing of we searched for parameters a, b that best fitted the the data, as outlined in column 1 of Fig. 1a and data. This procedure was repeated for all 13601 described in Supplementary Section 1.1, there were transcripts. Given the simplicity of the models, 2 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.13.943688; this version posted February 14, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. a System Identification: Pre-processing 2 Time delay and 1 of data All-2-one 3 ranking Time-series data All-2-one All-2-one with input time delays, d FOXP t [ 3]( ) a FOXP t b u t
Load more

Recommended publications
  • Viewed Under 23 (B) Or 203 (C) fi M M Male Cko Mice, and Largely Unaffected Magni Cation; Scale Bars, 500 M (B) and 50 M (C)
    BRIEF COMMUNICATION www.jasn.org Renal Fanconi Syndrome and Hypophosphatemic Rickets in the Absence of Xenotropic and Polytropic Retroviral Receptor in the Nephron Camille Ansermet,* Matthias B. Moor,* Gabriel Centeno,* Muriel Auberson,* † † ‡ Dorothy Zhang Hu, Roland Baron, Svetlana Nikolaeva,* Barbara Haenzi,* | Natalya Katanaeva,* Ivan Gautschi,* Vladimir Katanaev,*§ Samuel Rotman, Robert Koesters,¶ †† Laurent Schild,* Sylvain Pradervand,** Olivier Bonny,* and Dmitri Firsov* BRIEF COMMUNICATION *Department of Pharmacology and Toxicology and **Genomic Technologies Facility, University of Lausanne, Lausanne, Switzerland; †Department of Oral Medicine, Infection, and Immunity, Harvard School of Dental Medicine, Boston, Massachusetts; ‡Institute of Evolutionary Physiology and Biochemistry, St. Petersburg, Russia; §School of Biomedicine, Far Eastern Federal University, Vladivostok, Russia; |Services of Pathology and ††Nephrology, Department of Medicine, University Hospital of Lausanne, Lausanne, Switzerland; and ¶Université Pierre et Marie Curie, Paris, France ABSTRACT Tight control of extracellular and intracellular inorganic phosphate (Pi) levels is crit- leaves.4 Most recently, Legati et al. have ical to most biochemical and physiologic processes. Urinary Pi is freely filtered at the shown an association between genetic kidney glomerulus and is reabsorbed in the renal tubule by the action of the apical polymorphisms in Xpr1 and primary fa- sodium-dependent phosphate transporters, NaPi-IIa/NaPi-IIc/Pit2. However, the milial brain calcification disorder.5 How- molecular identity of the protein(s) participating in the basolateral Pi efflux remains ever, the role of XPR1 in the maintenance unknown. Evidence has suggested that xenotropic and polytropic retroviral recep- of Pi homeostasis remains unknown. Here, tor 1 (XPR1) might be involved in this process. Here, we show that conditional in- we addressed this issue in mice deficient for activation of Xpr1 in the renal tubule in mice resulted in impaired renal Pi Xpr1 in the nephron.
    [Show full text]
  • CCDC109B (MCUB) (NM 017918) Human Untagged Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC327798 CCDC109B (MCUB) (NM_017918) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: CCDC109B (MCUB) (NM_017918) Human Untagged Clone Tag: Tag Free Symbol: MCUB Synonyms: CCDC109B Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >OriGene SC327798 ORF sequence for NM_017918, the custom clone sequence may differ by one or more nucleotides ATGTTGTCAACAGTTGGTTCATTCCTTCAGGACCTACAAAATGAAGATAAGGGTATCAAAACTGCAGCCA TCTTCACAGCAGATGGCAACATGATTTCAGCTTCTACCTTGATGGATATTTTGCTAATGAATGATTTTAA ACTTGTCATTAATAAAATAGCATATGATGTGCAGTGTCCAAAGAGAGAAAAACCAAGTAATGAGCACACT GCTGAGATGGAACACATGAAATCCTTGGTTCACAGACTATTTACAATCTTGCATTTAGAAGAGTCTCAGA AAAAGAGAGAGCACCATTTACTGGAGAAAATTGACCACCTGAAGGAACAGCTGCAGCCCCTTGAACAGGT GAAAGCTGGAATAGAAGCTCATTCGGAAGCCAAAACCAGTGGACTCCTGTGGGCTGGATTGGCACTGCTG TCCATTCAGGGTGGGGCACTGGCCTGGCTCACGTGGTGGGTGTACTCCTGGGATATCATGGAGCCAGTTA CATACTTCATCACATTTGCAAATTCTATGGTCTTTTTTGCATACTTTATAGTCACTCGACAGGATTATAC TTACTCAGCTGTTAAGAGTAGGCAATTTCTTCAGTTCTTCCACAAGAAATCAAAGCAACAGCACTTTGAT GTGCAGCAATACAACAAGTTAAAAGAAGACCTTGCTAAGGCTAAAGAATCCCTGAAACAGGCGCGTCATT CTCTCTGTTTGCAAATGCAAGTAGAAGAACTCAATGAAAAGAATTAA Restriction Sites: SgfI-MluI ACCN: NM_017918 OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point
    [Show full text]
  • Autism Multiplex Family with 16P11.2P12.2 Microduplication Syndrome in Monozygotic Twins and Distal 16P11.2 Deletion in Their Brother
    European Journal of Human Genetics (2012) 20, 540–546 & 2012 Macmillan Publishers Limited All rights reserved 1018-4813/12 www.nature.com/ejhg ARTICLE Autism multiplex family with 16p11.2p12.2 microduplication syndrome in monozygotic twins and distal 16p11.2 deletion in their brother Anne-Claude Tabet1,2,3,4, Marion Pilorge2,3,4, Richard Delorme5,6,Fre´de´rique Amsellem5,6, Jean-Marc Pinard7, Marion Leboyer6,8,9, Alain Verloes10, Brigitte Benzacken1,11,12 and Catalina Betancur*,2,3,4 The pericentromeric region of chromosome 16p is rich in segmental duplications that predispose to rearrangements through non-allelic homologous recombination. Several recurrent copy number variations have been described recently in chromosome 16p. 16p11.2 rearrangements (29.5–30.1 Mb) are associated with autism, intellectual disability (ID) and other neurodevelopmental disorders. Another recognizable but less common microdeletion syndrome in 16p11.2p12.2 (21.4 to 28.5–30.1 Mb) has been described in six individuals with ID, whereas apparently reciprocal duplications, studied by standard cytogenetic and fluorescence in situ hybridization techniques, have been reported in three patients with autism spectrum disorders. Here, we report a multiplex family with three boys affected with autism, including two monozygotic twins carrying a de novo 16p11.2p12.2 duplication of 8.95 Mb (21.28–30.23 Mb) characterized by single-nucleotide polymorphism array, encompassing both the 16p11.2 and 16p11.2p12.2 regions. The twins exhibited autism, severe ID, and dysmorphic features, including a triangular face, deep-set eyes, large and prominent nasal bridge, and tall, slender build. The eldest brother presented with autism, mild ID, early-onset obesity and normal craniofacial features, and carried a smaller, overlapping 16p11.2 microdeletion of 847 kb (28.40–29.25 Mb), inherited from his apparently healthy father.
    [Show full text]
  • Gpr161 Anchoring of PKA Consolidates GPCR and Camp Signaling
    Gpr161 anchoring of PKA consolidates GPCR and cAMP signaling Verena A. Bachmanna,1, Johanna E. Mayrhofera,1, Ronit Ilouzb, Philipp Tschaiknerc, Philipp Raffeinera, Ruth Röcka, Mathieu Courcellesd,e, Federico Apeltf, Tsan-Wen Lub,g, George S. Baillieh, Pierre Thibaultd,i, Pia Aanstadc, Ulrich Stelzlf,j, Susan S. Taylorb,g,2, and Eduard Stefana,2 aInstitute of Biochemistry and Center for Molecular Biosciences, University of Innsbruck, 6020 Innsbruck, Austria; bDepartment of Chemistry and Biochemistry, University of California, San Diego, CA 92093; cInstitute of Molecular Biology, University of Innsbruck, 6020 Innsbruck, Austria; dInstitute for Research in Immunology and Cancer, Université de Montréal, Montreal, QC, Canada H3C 3J7; eDépartement de Biochimie, Université de Montréal, Montreal, QC, Canada H3C 3J7; fOtto-Warburg Laboratory, Max Planck Institute for Molecular Genetics, 14195 Berlin, Germany; gDepartment of Pharmacology, University of California, San Diego, CA 92093; hInstitute of Cardiovascular and Medical Sciences, University of Glasgow, Glasgow, G12 8QQ, United Kingdom; iDepartment of Chemistry, Université de Montréal, Montreal, QC, Canada H3C 3J7; and jInstitute of Pharmaceutical Sciences, Pharmaceutical Chemistry, University of Graz, 8010 Graz, Austria Contributed by Susan S. Taylor, May 24, 2016 (sent for review February 18, 2016; reviewed by John J. G. Tesmer and Mark von Zastrow) Scaffolding proteins organize the information flow from activated G accounts for nanomolar binding affinities to PKA R subunit dimers protein-coupled receptors (GPCRs) to intracellular effector cascades (12, 13). Moreover, additional components of the cAMP signaling both spatially and temporally. By this means, signaling scaffolds, such machinery, such as GPCRs, adenylyl cyclases, and phosphodiester- as A-kinase anchoring proteins (AKAPs), compartmentalize kinase ases, physically interact with AKAPs (1, 5, 11, 14).
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • GABPA Is a Master Regulator of Luminal Identity and Restrains Aggressive Diseases in Bladder Cancer
    Cell Death & Differentiation (2020) 27:1862–1877 https://doi.org/10.1038/s41418-019-0466-7 ARTICLE GABPA is a master regulator of luminal identity and restrains aggressive diseases in bladder cancer 1,2,3 3,4 5 2,5 5 3 5 5 Yanxia Guo ● Xiaotian Yuan ● Kailin Li ● Mingkai Dai ● Lu Zhang ● Yujiao Wu ● Chao Sun ● Yuan Chen ● 5 6 3 1,2 1,2 3,7 Guanghui Cheng ● Cheng Liu ● Klas Strååt ● Feng Kong ● Shengtian Zhao ● Magnus Bjorkhölm ● Dawei Xu 3,7 Received: 3 June 2019 / Revised: 20 November 2019 / Accepted: 21 November 2019 / Published online: 4 December 2019 © The Author(s) 2019. This article is published with open access Abstract TERT promoter mutations occur in the majority of glioblastoma, bladder cancer (BC), and other malignancies while the ETS family transcription factors GABPA and its partner GABPB1 activate the mutant TERT promoter and telomerase in these tumors. GABPA depletion or the disruption of the GABPA/GABPB1 complex by knocking down GABPB1 was shown to inhibit telomerase, thereby eliminating the tumorigenic potential of glioblastoma cells. GABPA/B1 is thus suggested as a cancer therapeutic target. However, it is unclear about its role in BC. Here we unexpectedly observed that GABPA ablation 1234567890();,: 1234567890();,: inhibited TERT expression, but robustly increased proliferation, stem, and invasive phenotypes and cisplatin resistance in BC cells, while its overexpression exhibited opposite effects, and inhibited in vivo metastasizing in a xenograft transplant model. Mechanistically, GABPA directly activates the transcription of FoxA1 and GATA3, key transcription factors driving luminal differentiation of urothelial cells. Consistently, TCGA/GEO dataset analyses show that GABPA expression is correlated positively with luminal while negatively with basal signatures.
    [Show full text]
  • Identification of BBX Proteins As Rate-Limiting Co-Factors of HY5
    1 Identification of BBX proteins as rate-limiting co-factors of HY5. 2 Katharina Bursch1, Gabriela Toledo-Ortiz2, Marie Pireyre3, Miriam Lohr1, Cordula Braatz1, Henrik 3 Johansson1* 4 1. Institute of Biology/Applied Genetics, Dahlem Centre of Plant Sciences (DCPS), Freie Universität 5 Berlin, Albrecht-Thaer-Weg 6. D-14195 Berlin, Germany. 6 2. Lancaster Environment Centre, Lancaster University, Lancaster LA1 4YQ, UK 7 3. Department of Botany and Plant Biology, Section of Biology, Faculty of Sciences, University of 8 Geneva, 30 Quai E. Ansermet, 1211 Geneva 4, Switzerland 9 *E-mail [email protected] 10 Abstract 11 As a source of both energy and environmental information, monitoring the incoming light is crucial for 12 plants to optimize growth throughout development1. Concordantly, the light signalling pathways in 13 plants are highly integrated with numerous other regulatory pathways2,3. One of these signal 14 integrators is the bZIP transcription factor HY5 which holds a key role as a positive regulator of light 15 signalling in plants4,5. Although HY5 is thought to act as a DNA-binding transcriptional regulator6,7, the 16 lack of any apparent transactivation domain8 makes it unclear how HY5 is able to accomplish its many 17 functions. Here, we describe the identification of three B-box containing proteins (BBX20, 21 and 22) 18 as essential partners for HY5 dependent modulation of hypocotyl elongation, anthocyanin 19 accumulation and transcriptional regulation. The bbx202122 triple mutant mimics the phenotypes of 20 hy5 in the light and its ability to suppress the cop1 mutant phenotype in darkness. Furthermore, 84% 21 of genes that exhibit differential expression in bbx202122 are also HY5 regulated, and we provide 22 evidence that HY5 requires the B-box proteins for transcriptional regulation.
    [Show full text]
  • Effects of Rapamycin on Social Interaction Deficits and Gene
    Kotajima-Murakami et al. Molecular Brain (2019) 12:3 https://doi.org/10.1186/s13041-018-0423-2 RESEARCH Open Access Effects of rapamycin on social interaction deficits and gene expression in mice exposed to valproic acid in utero Hiroko Kotajima-Murakami1,2, Toshiyuki Kobayashi3, Hirofumi Kashii1,4, Atsushi Sato1,5, Yoko Hagino1, Miho Tanaka1,6, Yasumasa Nishito7, Yukio Takamatsu7, Shigeo Uchino1,2 and Kazutaka Ikeda1* Abstract The mammalian target of rapamycin (mTOR) signaling pathway plays a crucial role in cell metabolism, growth, and proliferation. The overactivation of mTOR has been implicated in the pathogenesis of syndromic autism spectrum disorder (ASD), such as tuberous sclerosis complex (TSC). Treatment with the mTOR inhibitor rapamycin improved social interaction deficits in mouse models of TSC. Prenatal exposure to valproic acid (VPA) increases the incidence of ASD. Rodent pups that are exposed to VPA in utero have been used as an animal model of ASD. Activation of the mTOR signaling pathway was recently observed in rodents that were exposed to VPA in utero, and rapamycin ameliorated social interaction deficits. The present study investigated the effect of rapamycin on social interaction deficits in both adolescence and adulthood, and gene expressions in mice that were exposed to VPA in utero. We subcutaneously injected 600 mg/kg VPA in pregnant mice on gestational day 12.5 and used the pups as a model of ASD. The pups were intraperitoneally injected with rapamycin or an equal volume of vehicle once daily for 2 consecutive days. The social interaction test was conducted in the offspring after the last rapamycin administration at 5–6 weeks of ages (adolescence) or 10–11 weeks of age (adulthood).
    [Show full text]
  • Epigenetics Page 1
    Epigenetics esiRNA ID Gene Name Gene Description Ensembl ID HU-13237-1 ACTL6A actin-like 6A ENSG00000136518 HU-13925-1 ACTL6B actin-like 6B ENSG00000077080 HU-14457-1 ACTR1A ARP1 actin-related protein 1 homolog A, centractin alpha (yeast) ENSG00000138107 HU-10579-1 ACTR2 ARP2 actin-related protein 2 homolog (yeast) ENSG00000138071 HU-10837-1 ACTR3 ARP3 actin-related protein 3 homolog (yeast) ENSG00000115091 HU-09776-1 ACTR5 ARP5 actin-related protein 5 homolog (yeast) ENSG00000101442 HU-00773-1 ACTR6 ARP6 actin-related protein 6 homolog (yeast) ENSG00000075089 HU-07176-1 ACTR8 ARP8 actin-related protein 8 homolog (yeast) ENSG00000113812 HU-09411-1 AHCTF1 AT hook containing transcription factor 1 ENSG00000153207 HU-15150-1 AIRE autoimmune regulator ENSG00000160224 HU-12332-1 AKAP1 A kinase (PRKA) anchor protein 1 ENSG00000121057 HU-04065-1 ALG13 asparagine-linked glycosylation 13 homolog (S. cerevisiae) ENSG00000101901 HU-13552-1 ALKBH1 alkB, alkylation repair homolog 1 (E. coli) ENSG00000100601 HU-06662-1 ARID1A AT rich interactive domain 1A (SWI-like) ENSG00000117713 HU-12790-1 ARID1B AT rich interactive domain 1B (SWI1-like) ENSG00000049618 HU-09415-1 ARID2 AT rich interactive domain 2 (ARID, RFX-like) ENSG00000189079 HU-03890-1 ARID3A AT rich interactive domain 3A (BRIGHT-like) ENSG00000116017 HU-14677-1 ARID3B AT rich interactive domain 3B (BRIGHT-like) ENSG00000179361 HU-14203-1 ARID3C AT rich interactive domain 3C (BRIGHT-like) ENSG00000205143 HU-09104-1 ARID4A AT rich interactive domain 4A (RBP1-like) ENSG00000032219 HU-12512-1 ARID4B AT rich interactive domain 4B (RBP1-like) ENSG00000054267 HU-12520-1 ARID5A AT rich interactive domain 5A (MRF1-like) ENSG00000196843 HU-06595-1 ARID5B AT rich interactive domain 5B (MRF1-like) ENSG00000150347 HU-00556-1 ASF1A ASF1 anti-silencing function 1 homolog A (S.
    [Show full text]
  • Ribosomal RNA‑Depleted RNA Sequencing Reveals the Pathogenesis of Refractory Mycoplasma Pneumoniae Pneumonia in Children
    MOLECULAR MEDICINE REPORTS 24: 761, 2021 Ribosomal RNA‑depleted RNA sequencing reveals the pathogenesis of refractory Mycoplasma pneumoniae pneumonia in children FENG HUANG1,2*, HUIFENG FAN1*, DIYUAN YANG1, JUNSONG ZHANG3, TINGTING SHI1, DONGWEI ZHANG1 and GEN LU1 1Department of Respiration, Guangzhou Women and Children's Medical Center, Guangzhou Medical University, Guangzhou, Guangdong 510120; 2Institute of Human Virology, Zhongshan School of Medicine, Sun Yat‑sen University; 3Guangdong Provincial People's Hospital, Guangdong Academy of Medical Sciences, Guangzhou, Guangdong 510080, P.R. China Received April 17, 2020; Accepted May 28, 2021 DOI: 10.3892/mmr.2021.12401 Abstract. Pneumonia caused by Mycoplasma pneumoniae in the NRMPP and RMPP comparative groups were primarily (M. pneumoniae) is a major cause of community‑acquired enriched in ‘herpes simplex virus 1 infection’, ‘viral carcinogen‑ pneumonia in children. In some cases, M. pneumoniae pneu‑ esis’ and ‘RNA transport’. In the present study, a comprehensive monia (MPP) can develop into refractory MPP (RMPP), which analysis of the differences between the NRMPP and RMPP shows no clinical or radiological response to macrolides, and cases was performed based on rRNA‑depleted RNA‑sequencing can progress to severe and complicated pneumonia. However, techniques, and the selected genes and circRNAs may be closely the pathogenesis of RMPP remains poorly understood. The associated with the complex pathogenesis of RMPP. present study aimed to identify target genes that could be used as biomarkers for the clinical diagnosis of early‑stage RMPP Introduction through high‑throughput sequencing technology. The differences in long non‑coding (lnc)RNAs, mRNAs and circular (circ)RNAs Mycoplasma pneumoniae (M. pneumoniae) is one of the were examined between whole‑blood samples from two patients main pathogens that cause respiratory tract infections in with non‑refractory MPP (NRMPP), two patients with RMPP humans (1,2).
    [Show full text]
  • Downloaded Using the R Package Cgdsr [40] and Were Used
    Cai et al. BMC Medical Genomics (2020) 13:33 https://doi.org/10.1186/s12920-020-0695-0 RESEARCH ARTICLE Open Access Specific chromatin landscapes and transcription factors couple breast cancer subtype with metastatic relapse to lung or brain Wesley L. Cai1, Celeste B. Greer1,2, Jocelyn F. Chen1, Anna Arnal-Estapé1,3, Jian Cao1,3,4, Qin Yan1,3,5,6*† and Don X. Nguyen1,3,5,6,7*† Abstract Background: Few somatic mutations have been linked to breast cancer metastasis, whereas transcriptomic differences among primary tumors correlate with incidence of metastasis, especially to the lungs and brain. However, the epigenomic alterations and transcription factors (TFs) which underlie these alterations remain unclear. Methods: To identify these, we performed RNA-seq, Chromatin Immunoprecipitation and sequencing (ChIP-seq) and Assay for Transposase-Accessible Chromatin using sequencing (ATAC-seq) of the MDA-MB-231 cell line and its brain (BrM2) and lung (LM2) metastatic sub-populations. We incorporated ATAC-seq data from TCGA to assess metastatic open chromatin signatures, and gene expression data from human metastatic datasets to nominate transcription factor biomarkers. Results: Our integrated epigenomic analyses found that lung and brain metastatic cells exhibit both shared and distinctive signatures of active chromatin. Notably, metastatic sub-populations exhibit increased activation of both promoters and enhancers. We also integrated these data with chromosome conformation capture coupled with ChIP-seq (HiChIP) derived enhancer-promoter interactions to predict enhancer-controlled pathway alterations. We found that enhancer changes are associated with endothelial cell migration in LM2, and negative regulation of epithelial cell proliferation in BrM2. Promoter changes are associated with vasculature development in LM2 and homophilic cell adhesion in BrM2.
    [Show full text]
  • HMGB1 in Health and Disease R
    Donald and Barbara Zucker School of Medicine Journal Articles Academic Works 2014 HMGB1 in health and disease R. Kang R. C. Chen Q. H. Zhang W. Hou S. Wu See next page for additional authors Follow this and additional works at: https://academicworks.medicine.hofstra.edu/articles Part of the Emergency Medicine Commons Recommended Citation Kang R, Chen R, Zhang Q, Hou W, Wu S, Fan X, Yan Z, Sun X, Wang H, Tang D, . HMGB1 in health and disease. 2014 Jan 01; 40():Article 533 [ p.]. Available from: https://academicworks.medicine.hofstra.edu/articles/533. Free full text article. This Article is brought to you for free and open access by Donald and Barbara Zucker School of Medicine Academic Works. It has been accepted for inclusion in Journal Articles by an authorized administrator of Donald and Barbara Zucker School of Medicine Academic Works. Authors R. Kang, R. C. Chen, Q. H. Zhang, W. Hou, S. Wu, X. G. Fan, Z. W. Yan, X. F. Sun, H. C. Wang, D. L. Tang, and +8 additional authors This article is available at Donald and Barbara Zucker School of Medicine Academic Works: https://academicworks.medicine.hofstra.edu/articles/533 NIH Public Access Author Manuscript Mol Aspects Med. Author manuscript; available in PMC 2015 December 01. NIH-PA Author ManuscriptPublished NIH-PA Author Manuscript in final edited NIH-PA Author Manuscript form as: Mol Aspects Med. 2014 December ; 0: 1–116. doi:10.1016/j.mam.2014.05.001. HMGB1 in Health and Disease Rui Kang1,*, Ruochan Chen1, Qiuhong Zhang1, Wen Hou1, Sha Wu1, Lizhi Cao2, Jin Huang3, Yan Yu2, Xue-gong Fan4, Zhengwen Yan1,5, Xiaofang Sun6, Haichao Wang7, Qingde Wang1, Allan Tsung1, Timothy R.
    [Show full text]