A Dissertation Entitled a Role for Interferon Stimulated Gene 12A (Isg12a) in Vesicular Stomatitis Virus Antiviral Responses By

A Dissertation

entitled

A Role for Interferon Stimulated Gene 12a (ISG12a) in

Vesicular Stomatitis Virus Antiviral Responses

Kuladeep Reddy Sudini

Submitted to the Graduate Faculty as partial fulfillment of the requirements for the

Doctor of Philosophy Degree in Biology

______Dr. Douglas Leaman, Committee Chair

______Dr. Mark Wooten, Committee Member

______Dr. William Taylor, Committee Member

______Dr. Deborah Chadee, Committee Member

______Dr. Max Funk, Committee Member

______Dr. Patricia Komuniecki, Dean College of Graduate Studies

The University of Toledo

December 2012

This document is copyrighted material. Under copyright law, no parts of this document may be reproduced without the expressed permission of the author. An Abstract of

A Role for Interferon Stimulated Gene 12a (ISG12a) in Vesicular Stomatitis Virus Antiviral Responses

Kuladeep Reddy Sudini

Submitted to the Graduate Faculty as partial fulfillment of the requirements for the Doctor of Philosophy Degree in Biology

The University of Toledo

December 2012

Interferons (IFN) are a family of cytokines characterized initially as antiviral proteins, but which have subsequently been implicated as protective molecules in malignant, inflammatory and immune disorders. The direct or indirect effects of IFN are mediated by a subset of genes known collectively as IFN stimulated genes (ISG), which are up regulated by IFNs via intracellular signaling cascade. The functions of some proteins encoded by ISGs are well described, but many other IFN induced proteins remained poorly characterized. Certain IFN induced proteins are characterized into different groups according to their amino acid sequence similarities, including the ISG12 group (6-

16, ISG12a), 1-8 group (9-27/Leu13, 1-8U, and 1-8D), and ISG15. These IFN-induced genes are abundantly and widely expressed and induced mainly by type I IFNs. ISG12a encodes a predicted 11.5 kDa hydrophobic protein. Former studies from our laboratory have implicated ISG12a as a mitochondrial protein. Transient ISG12a expression augmented etoposide induced apoptosis by destabilizing the mitochondrial membrane.

Knockdown of ISG12a prevented the sensitization to etoposide induced apoptosis and also decreased the ability of IFN-β pretreatment to sensitize cells to etoposide.

iii In the present study, we assessed the function of ISG12a in cellular response to vesicular stomatitis virus (VSV) infection. We developed a conditional expression system for

ISG12a using a modified Tet-on system. Interestingly, ISG12a expressing cells were protected from VSV when compared to control cells, and knocking down the ectopic protein with siRNA resulted in the loss of protection. Virus yield was reduced by ISG12a by approximately 105-fold and VSV mRNA expression was downregulated in ISG12 induced cells, suggesting a block in viral replication. To further analyze whether ISG12a blocks viral replication by upregulating IFN or other IFN regulated proteins, we performed RT PCR and affymetrix gene array studies on ISG12a expressing cells.

Importantly, neither IFN nor IFN regulated genes were induced upon ISG12a expression, suggesting that ISG12a blocks viral replication in a different manner. To identify whether

ISG12a inhibits VSV internalization, viral entry and binding assays were performed and viral genomic RNA was measured. VSV RNA levels were similar in control and ISG12a induced cells, suggesting that viral replication was blocked after internalization. To analyze whether ISG12a blocked endosomal release of viral particles into the cytoplasm, cells were treated with chloroquine (an inhibitor of endosome acidification) after VSV infection at different time intervals. VSV-G mRNA and protein levels were dramatically reduced in ISG12a induced cells in combination with chloroquine, suggesting that

ISG12a probably blocks VSV replication at an early stage, either prior to or concomitant with endosomal release. Future studies will be focused on role of ISG12a in regulating mitochondrial function and whether this impacts viral replication.

I would like to dedicate this work to my father; Mr. Goverdhan Sudini and mother Mrs.

Swayam Prabha whose constant encouragement, blessings and prayers helped me achieve this huge milestone in my life. I would also like to dedicate this work to my brother,

Sumandeep Sudini for his endless love and support which kept me constantly motivated

Acknowledgements

I am grateful to my advisor Dr. Douglas W. Leaman for guiding me through every step of acquiring this degree. His encouragement and constant support during last four years of my graduate study helped me to focus into the various aspects of my projects.

I thank my advisory committee; Dr. Deborah Chadee, Dr. William Taylor, Dr. Mark

Wooten and Dr. Max Funk for their guidance, valuable time, suggestions and helpful discussions about my project.

A special thanks to Dr. Sunil Patil, Adam Pore and Mrs. Wanda Pore for their help in difficult times during my stay in Toledo.

I would like to express my sincere gratitude towards my present and past lab members:

Adam Pore, Qi Ke, Dr. Boren Lin, Dave Velliquette, Nikki, Aileen, Tyler, Robert, Dan and Julia for making it a fun environment to work in the lab and always trying to help each other out. I would also like to thank my friends Lindsay, Katie, Tina, Saurab,

Kristina and Mohan for their constant support and love.

Table of Contents

Abstract ...... iii

Acknowledgements ...... vi

Table of Contents ...... vii

List of Tables ...... x

List of Figures ...... xi

List of Abbreviations ...... xiii

List of Symbols ...... xv

1 Introduction

1.1 Introduction to viruses ...... 1

1.1.1 Viral pathogenesis ...... 2

1.2 Host immune responses to viral infections ...... 2

1.3 Cellular antiviral responses ...... 5

1.3.1 Toll like receptors ...... 5

1.3.1.1TLR3 Signaling ...... 6

1.3.2 Retinoid acid inducible gene I like (RLR) receptors ...... 8

1.3.2.1 RLR signaling ...... 9

1.4 Interferons and classification ...... 11

1.4.1 Type I IFN signaling ...... 12

1.5 Interferon stimulated genes ...... 16

vii 1.5.1 Antiviral ISGs ...... 16

1.6 Viral evasion mechanisms of the host immune responses ...... 20

1.7 Vesicular Stomatitis virus ...... 21

1.8 Interferon stimulated gene 12a ...... 27

1.9 Significance ...... 29

2 Materials and methods ...... 30

2.1 Cell lines ...... 30

2.2 Cell viability assays ...... 31

2.3 RNA isolation ...... 31

2.4 Real time PCR...... 32

2.5 Transfections ...... 32

2.6 Immunoblotting...... 32

2.7 RNAi ...... 34

2.8 Immunofluorescence ...... 34

2.9 Viral yield assays ...... 35

2.10 Viral entry and binding assays ...... 35

2.11 Measurement of mitochondrial mass ...... 36

2.12 Measurement of ROS production ...... 36

2.13 Plasmid construction ...... 37

2.14 Statistical analysis ...... 37

3 Results ...... 39

3.1 ISG12a protects from VSV induced cytopathicity ...... 39

3.2 ISG12a blocks VSV replication ...... 47

viii 3.3 ISG12a protection does not result from IFN feedback ...... 47

3.4 Identification of VSV replication steps targeted by ISG12a ...... 52

3.4.1 ISG12a does not inhibit VSV-G mediated viral entry ...... 52

3.4.2 Role of ISG12a in preventing viral escape from endosome ...... 58

3.4.3 ISG12a effect on viral primary transcription ...... 62

3.5 Role of ISG12a in mitochondrial function ...... 65

4 Discussion ...... 69

4.1 Future work ...... 76

References ...... 78

A Involvement of Noxa in mediating cellular ER stress responses to lytic infection103

Materials and methods ...... 108

Results ...... 112

Discussion ...... 120

List of Tables

1 Viral PAMPs detected by different TLRs ...... 7

2 Examples of ISGs conferring antiviral responses ...... 19

3 Primers for PCR analysis ...... 33

4 Primers for cloning ...... 38

List of Figures

1 Integration of innate and adaptive immune recognition ...... 4

2 Innate immune signaling against RNA viruses ...... 10

3 Mammalian detection and type I IFN response pathway ...... 15

4 VSV genome organization ...... 24

5 VSV replication cycle ...... 25

6 ISG12a protects cells from viral cytopathicity ...... 43

7 Knockdown of ISG12a expression restores VSV induced cytopathicity ...... 46

8 ISG12a blocks VSV replication ...... 49

9 ISG12a protection does not require IFN feedback ...... 51

10 ISG12a restricts viral expression during first round of replication...... 55

11 ISG12a does not prevent VSV entry into the cells ...... 57

12 ISG12a delays VSV escape from endosome ...... 61

13 ISG12a effect on primary transcription ...... 64

14 Role of ISG12a in mitochondrial function...... 68

15 Role of ISG12a mitochondrial localization in antiviral responses ...... 77

16 Noxa null cells resist virus induced cytopathicity ...... 127

17 Viral replication in Wt and Noxa -/- cells ...... 130

18 Role of ER stress response in Noxa mode of action ...... 134

19 Inhibition of ER stress response blocks Noxa upregulation and viral CPE ...... 137

xi 20 Noxa mechanism of action in MG132/dsRNA treated A375 cells ...... 139

21 EMCV replication in Wt and Noxa -/- cells ...... 141

22 Induction of ATF4, activation of caspase 12 and expression of PUMA and Bim in

Wt and Noxa -/- cells ...... 143

23 Combinatorial effects of various stimuli on Noxa and CHOP expression and

Cellular apoptosis...... 145

24 Model of Noxa induction by virus and other stimuli involvement of ER stress

response ...... 147

25 Mouse ISG12 expression in different organs ...... 148

xii

List of Abbreviations

ATCC...... American Type Culture Collection

CARD...... Caspase Activation and Recruitment Domain CHX...... Cyclohexamide CPE ...... Cytopathic effect

DAPI...... 4',6-diamidino-2-phenylindole dNTP...... Deoxyribonucleotide triphosphate dsRNA...... Double stranded ribonucleic acid DOX...... Doxycycline DEX...... Dexamethasone DMEM...... Dulbecco’s modified eagle medium DTT...... Dithiothreitol

EDTA...... Ethylenediaminetetraacetic acid EMCV...... Encephalo myocarditis virus

FBS ...... Fetal bovine serum

G...... Glycoprotein GAPDH...... Glyceralde 3 phosphate dehydrogenase GAS...... Gamma activated sequence h...... hours HCV...... Hepatitis C virus HIV...... Human immunodeficiency virus

IFN...... Interferon IFNAR...... Interferon alpha receptor IRF...... Interferon regulatory factor

ISG...... Interferon- stimulated gene ISGF3...... Interferon-stimulated gene factor 3

JAK ...... Janus Kinase 1

xiii L...... Large polymerase protein

M...... Matrix protein MAVS...... Mitochondrial antiviral signaling MDA5...... Melanoma differentiation-associated gene-5 MHC...... Major histocompatibility complex min ...... minute(s)

N...... Nucleoprotein protein NDV...... New Castle disease virus

P...... Phosphoprotein PAMP...... Pathogen associated molecular pattern PBS...... Phosphate buffered saline PCR ...... Polymerase chain reaction PMSF...... Phenylmethyl sulfonyl fluoride Poly IC...... Polyinosinic polycytidylic acid PRR...... Pattern recognition receptor

RIG-I...... Retinoic acid inducible gene 1 RLH...... RIG-I-like helicase

SDS-PAGE...... Sodium dodecyl sulfate polyacrylamide gel electrophoresis ssRNA...... Single-stranded ribonucleic acid SD...... Standard deviation SOCS...... Suppressor of cytokine signaling STATs...... Signal transducers and activators of transcription

TCA...... Trichloroacetic acid TBST...... Tris-buffered saline Tween-20 TBEV...... Tick borne encephalitis virus TRITC...... Tetramethyl rhodamine isothiocynate Tyk2...... Tyrosine Kinase 2

VSV...... Vesicular Stomatitis virus

xiv

List of Symbols

α ...... Alpha β ...... Beta γ ...... Gamma δ ...... Delta ε ...... Epsilon κ...... Kappa ω ...... Omega µ ...... Micro τ ...... Tau

Chapter 1

Introduction

1.1 Introduction to viruses

Viruses are the prototypic obligate intracellular parasites infecting humans, animals and plants. Over the past 1000 years, viral epidemics had profound effects on human health and economic impact. The Spanish flu (1918-1919) was a devastating pandemic that killed an estimated 30-50 million people worldwide (Palese, 2004). More recently, severe acute respiratory syndrome (SARS) outbreak in Hong Kong in late 2002-2003 caused by the SARS coronavirus resulted in 9.6% mortality rate (Fouchier et al., 2003).

Acquired immune deficiency syndrome (AIDS), caused by Human immunodeficiency virus (HIV), continuous to spread rapidly across continents, despite decades of intensive efforts to develop a vaccine or cure. According to UNAIDS published statistics, at the end of 2010, around 34 million people were living with AIDS worldwide and 1.8 million had died. Rhinoviruses that cause common cold lead to large economic losses due to decreased productivity (Simmonds, 2001). Flaviviruses, which are transmitted by mosquitoes, are posing a big challenge to the human population. Outbreak of neurological disease caused by West Nile virus, dengue hemorrhagic fever and Japanese encephalitis are continuous threats to humans (Petersen et al., 2005). However, despite 1

the threat, that there are no vaccines for flaviviruses and these viruses are often resistant to antiviral drugs. Thus, it is important to understand viral pathogenesis and host viral interactions that will help in identifying druggable targets to treat these diseases or prevent viral spread.

1.1.1 Viral pathogenesis:

Viral pathogenesis is a process by which viral replication leads to disease. Common sites for virus entry are the mucosal lining of respiratory, alimentary, urinogenital tracts, skin and outer surface of the eye. Following entry into the host, virus completing their replication cycle can remain localized at a particular site or spread to other tissues.

Replication cycle times differ with each virus. Usually, the disease occurs after virus starts to damage the cells directly or due to toxic substances released from infected tissues that augment the host immune responses (Fields, 1983). Viruses such as influenza or measles are cytolytic and destroy the cells in which they multiply whereas retroviruses bud from the membrane without lysis, leading to persistent infections (Flint et al., 2000).

After completing the replication, viruses use different routes for shedding. For example,

HIV sheds through semen and blood, rabies through saliva, herpes viruses through either milk, urinary or genital tract (Baron, 1996).

1.2 Host immune responses to viral infection:

Humans are exposed to different viruses, but in most cases the infections are cleared with minimal tissue damage. Host immune responses consist of innate and adaptive systems that function together in viral clearance. The innate immune system recognizes the invading virus immediately through germ line encoded receptors that recognize the 2

molecular patterns of pathogen (Medzhitov et al., 2000). Interferons (IFNs) are the predominant cytokines secreted within hours by virus infected cells. IFNs then induce an antiviral state in both infected and neighboring uninfected cells (Isaacs and Lindenmann,

1957). Apart from IFN secretion, complement (serum proteins) and natural killer cells play an important role in eliminating viral infected cells (Barrington et al., 2001; Biron et al., 2001). IFNs also establish an effective adaptive immune response by upregulating the expression of class I MHC molecules (Lindahl et al., 1976; Epperson et al., 1992). In contrast to innate immunity, the adaptive immune system responds to pathogens 5-7 days after infection, recognizing and destroying pathogens through production of antibody and cytotoxic T cells (Medzhitov et al., 1998). The viral antigens are captured by antigen presenting cells (APC) and presented to naïve T cells that are primed and differentiated into CD8+ cytotoxic T cell and CD4+T helper (Th) cells (Fearon et al., 1996; Kadowaki et al., 2000). CD4+ Th cells are further divided into CD4+ Th1 and Th2. Th1 assist in the proliferation and differentiation of cytotoxic T cells whereas Th2 facilitate the differentiation of B cells into plasma cells that secrete antibodies to neutralize and target viral antigens for efficient phagocytosis (Constant et al., 1997; Liu et al., 1991). Adaptive immunity establishes a memory cell population of T and B cells to respond rapidly against reinfection with the same antigen (Fridman et al., 1993; Crotty et al., 2004).

Fig 1: Integration of innate and adaptive immune recognition. An invading pathogen is detected by the innate immune system, resulting in the production of cytokines and stimulators of inflammation. Molecules of the invading microbe and the effector molecules of the innate immune system interact with the adaptive immune system, causing clonal expansion of lymphocytes that either produce antibodies (B cells) or differentiate into cytotoxic T cells that recognize the invading microbe and the infected cells. Adapted and modified from Fearon et al., 1996.

1.3 Cellular antiviral immune responses:

In response to invading virus, the viral associated molecular patterns such as single or double stranded RNA or DNA are recognized by pattern recognition receptors (PRRs)

(Janeway and Medzhitov, 2002). Three classes of PRRs are known to recognize and sense viral nucleic acid components, namely the Toll like receptors (TLRs), the cytosolic retinoic acid inducible gene I (RIG- I) like receptors (RLR) and nucleotide oligomerization domain (NLR) like receptors (Wilkins et al., 2010; Harton et al., 2002;

Inohara et al., 2001). TLRs and RLRs predominantly lead to the secretion of IFN, whereas NLR activation leads to synthesis of mature IL-1β through cleavage by caspase

1 (Benedict et al., 2005; Kanneganti et al., 2006).

1.3.1 Toll like receptors (TLRs):

Drosophila Toll is involved in dorsoventral polarization and antimicrobial resistance

(Morisato etal., 1994; Lemaitre et. al., 1996). The related vertebrate TLRs consists of an extracellular domain containing leucine rich repeat (LRR) motifs and cytoplasmic domain homologous to Interleukin 1 receptor, termed Toll/IL-1R (TIR) domain (Takeda et al., 2003). Approximately thirteen TLRs are identified in mice and ten in humans

(Akira and Takeda, 2004). Among these, five TLRs (TLR 3, 4, 5, 7 and 9) are involved in

IFN responses in response to viral infection (Table 1) (Kawai et al., 2009). TLR 1, 2, 4, 5 and 6 are localized on the cell membrane and TLR 3, 5, 7 and 9 reside in the endosomal compartment, where they detect viral or bacterial nucleic acids that enter through endocytosis (Akira and Takeda, 2004). TLR signaling is either Myeloid differentiation factor (MyD88) -dependent or- independent. TLR 4, 5, 7 and 9 signaling is MyD88- 5

dependent whereas TLR3 signaling is MyD88-independent (McGettrick et al., 2004;

Yamamoto et al., 2003). Following exposure to LPS, ssRNA and CpG containing DNA,

MyD88 will form a complex with IL-1 receptor associated kinase 4 (IRAK-4), IRAK1,

TRAF3, TRAF6 and IRF7 and this complex will be recruited to TLRs leading to the induction of IFNs and other cytokines (West et al., 2006).

1.3.1.1 TLR3 signaling

TLR3 is expressed in dendritic cells, epithelial cells, fibroblasts and mast cells, among others. Following stimulation with dsRNA or viral RNA in the endosomal compartment,

TLR3 activates the signaling cascade through the TIR domain containing adaptor TRIF

(Yamamoto et al., 2003) which then associates with TRAF3 and TRAF6 (Hacker et al.,

2006). TRAF3 recruits and activates two IKK related kinases, TANK binding kinase

(TBK1) and inducible IKK (IKKi). TBK1 and IKKi activate and phosphorylate IRF3 and IRF7, which then translocate into the nucleus and bind to interferon stimulated response element (ISRE) to induce type 1 IFNs (Fitzgerald et al., 2003; Honda et al.,

2005; Sato et al., 2000). TRIF interacts with TRAF6 and also with a kinase receptor interacting protein 1 (RIP 1) through RIP 1homotypic interaction motif (RHIM) present on the C-terminus to activate NFkB (Akira et al., 2006). TLR3 signaling has been implicated in antiviral responses to respiratory syncytial virus, influenza, West Nile and cytomegalovirus (Rudd et al., 2005; Hoebee et al., 2003; Wang et al., 2004). However,

TLR3-/- mice still exhibit antiviral responses to LCMV, MCMV, reo virus (Edelmann et al., 2004), suggesting that other pathways are activated in addition to TLR3 signaling.

Examples of different viral PAMPs detected by TLRs are presented in Table 1. 6

Table 1: Viral PAMPs detected by different TLRs

PRR Nonviral PAMPs Viral PAMP Virus Reference (examples) Lipopeptide Virion HSV Kurt-jones et al.,2004

Peptidoglycan HA Measles Bieback et al., 2002

Lipotechoic acid B and H HCMV Boehme et al., 2006; TLR2 glycoprotein Compton etal., 2003

Env MMTV Rassa et al., 2003

Core, NS3 HCV Dolganiuc et al., 2004

InfluenzaA Guillot L et al., 2005

TLR3 Poly(I:C) Endosomal West Nile Wang et al., 2004 dsRNA Rhinovirus Hewson et al., 2005

ENV MMTV Burzyn et al., 2004 TLR4 LPS F RSV Kurt-Jones et al., 2000

imiquimod, ssRNA VSV Lund et al., 2004 TLR7 resiquimod

imiquimod, ssRNA HIV Heil et al., 2004 TLR8 resiquimod

HSV-2 Lund etal., 2003 TLR9 CpG DNA Unmethylated DNA MCMV Tabeta et al., 2004

1.3.2 Retinoid acid inducible gene I like (RLR) receptors:

RLRs are the cytosolic receptors consisting of three members, RIG-I (also known as

DDX58), Melanoma differentiation associated gene 5 (MDA5, also known as IFIH1) and laboratory of genetics and physiology-2 (LGP2). RIG-I and MDA5 both contain two N terminal caspase recruitment domains (CARD) and a DexD/H helicase domain that unwinds dsRNA by its ATPase activity. LGP2 does not contain a CARD domain and its role was suggested to negatively regulate RIG-I signaling (Saito et al., 2007). The C terminus of RIG-I consists of a repressor domain (RD) that inhibits the self-association of

RIG-I (Saito et al., 2007). Even though RIG-I and MDA5 share structural homology and both activate IFN responses following dsRNA recognition, they specifically detect different ligands to trigger innate immune responses following viral infection. However, studies with MDA5-/- mice showed that Poly IC is recognized by MDA5 and not RIG-I

(Gitlin et al., 2006; Kato et al., 2006). In contrast, RIG-I specifically recognizes the 5’ triphosphate of uncapped RNA, thus discriminating between viral and host RNAs

(Hornung et al., 2006; Plumet et al., 2007). The biological role of RIG-I and MDA5 were identified when RIG -/- cells exhibited reduced type 1 IFN responses and were susceptible to VSV, Sendai, hepatitis C virus, NDV and West Nile virus (Kato et al.,

2005; Foy et al., 2005; Sumpter et al., 2005; Fredericksen et al., 2006). In contrast

MDA5-/- mice are more susceptible to picornaviruses, but had normal or only slightly reduced responses to other types (Kato et al., 2006).

1.3.2.1 RLR signaling:

Activated RIG-I and MDA5 interact with an adaptor protein mitochondrial antiviral signaling protein (MAVS, also designated as IPS-1, VISA, CARDIF), via CARD-CARD interaction (Kawai et al., 2005; Seth et al., 2005; Xu et al., 2005; Meylan et al., 2005).

MAVS is localized on the outer mitochondrial membrane and interacts with TRAF2,

TRAF3, TRAF6 and RIP1, leading to the activation of NFkB and IRF signaling (Xu et al., 2005; Saha et al., 2006; Kawai et al., 2005). Studies suggested that, IFN production by MAVS deficient cells infected with Sendai virus was reduced as compared to controls

(Sun et al., 2006). However, their studies also showed that IFN levels were similar between wild type and MAVS -/- mice when infected with VSV, suggesting that other cell types like plasmacytoid dendritic cells (pDCs) preferentially use TLRs over RLR signaling in contributing to IFN responses (Sun et al., 2006).

Fig 2: Innate immune signaling against RNA viruses. Virus derived dsRNA will initiate two signaling pathways (TLR-3 and RLR). RIG-I and MDA5 recognize 5’ triphosphate RNA and dsRNA from RNA viruses and interact with MAVS. Both these pathways converge at the point of transcriptional activation of NF-kB or IRF3, resulting in the production of pro-inflammatory cytokines and type I IFNs.

1.4 Interferons and classification:

Interferons are the predominant cytokines induced during viral infection, and were named based on their ability to interfere with viral replication (Isaacs and Lindenmann., 1957).

IFNs are secreted by cells following exposure to virus and act upon neighboring cells to inhibit viral replication. In addition to imparting antiviral responses, IFNs also play a role in inhibiting cell proliferation, angiogenesis and modulating the immune system (Stark.,

1998; Indraccolo., 2010). IFNs were classified into three types, Type I, II, III based on their sequence homology and the receptor complex used for signaling (Levy et al., 2001;

Goodbourn et al., 2000). Type I IFNs were classified into IFNα (further divided into 13 subtypes), IFNβ, IFNε, IFNκ, IFNδ, IFNτ and IFNω (Roberts et al., 1998; Pestka et al.,

2004). With the exception of IFNδ and IFNτ, all other types of IFNs are present in humans. Type II IFNs consists of only IFNγ. Unlike IFNα/β that is secreted by most of the cell types, IFNγ is mainly secreted by T cells and natural killer cells (Zhang et al.,

1997; Le Page et al., 2000). IFNγ does not share structural homology with Type I IFNs and it binds to a different cell surface receptor complex. However, its ability to initiate antiviral responses led to its classification as an IFN member (Yu et al., 1996). Because of similarities in signaling pathways activated, type I and II IFNs do activate partially overlapping repertoires of responsive genes (Pestka et al., 2004). Type III IFN consist of

IFNλ (Kotenko et al., 2003), subdivided into IFNλ1, IFNλ2, and IFNλ3 which are also called Interleukin-29 (IL-29), IL-28A and IL-28B, respectively. Recent evidence suggests that IFNλ is structurally similar to the IL-10 family members but functionally acts as IFN by contributing to antiviral responses (Gad et al., 2009).

1.4.1 Type 1 IFN signaling

IFNα is predominantly secreted by leukocytes, plasmacytoid dendritic cells in particular, while IFNβ (fibroblast IFN) is secreted by many cell types (Siegal et al., 1999). As described earlier, TLRs and RLRs are activated following exposure to viral PAMPs leading to the activation of transcription factors NFkB and IRFs. IRF family members play an important role in regulating immune cell function. The mammalian IRF family consists of nine members (IRF1-9), although only IRF1, 3, 5 and 7 are implicated as positive regulators of type I IFN genes (Taniguchi et al., 2001). However, IRF1-/- or

IRF5-/- mouse embryonic fibroblasts (MEFs) exhibited normal IFNα/β mRNA induction in response to New castle Disease Virus (NDV), which suggests that these two transcription factors are not essential for type I IFN gene activation (Matsuyama et al.,

1993; Reis et al., 1994; Takaoka et al., 2005). However, IRF3 -/- MEFs exhibited reduced

IFN levels after infection with NDV, HSV, VSV and EMCV (Sato et al., 2000; Honda et al., 2005). IRF3 and IRF7 are required for optimal type I IFN responses following RNA virus infections (Sato et al., 2000; Levy et al., 2002). IRF3 normally resides in the cytoplasm in a latent form that is phosphorylated in response to viral infection, then translocates to the nucleus leading to induction of IFNβ (Sato et al., 1998).

Phosphorylated IRF3 can homodimerize or heterodimerize with IRF7 and interacts with coactivators such as cyclic AMP responsive element binding protein (CBP)/P300 to form a holocomplex that binds to type I IFN gene regulatory sequences (Yoneyama et al.,

1998; Sato et al., 1998). Basal constitutive IRF7 expression is lower than IRF3, but it is important nevertheless. Studies suggest that IRF3 activates IFNβ while IRF7 activates both IFNα and β (Marie et al., 1998; Sato et al., 2000). MEFS from IRF7-/- mice were 12

more severely impaired in type I IFN responses to VSV and EMCV than in IRF3-/- mice infection (Honda et al., 2005). This suggests that IRF7 is an ISG induced by type I IFNs that amplifies the IFN response by inducing the transcription of IFNα/β, thereby activating a positive feedback loop.

Secreted IFNα/β binds to a cell surface receptor complex known as the IFN alpha receptor (IFNAR). The IFNAR complex consists of two subunits, IFNAR1and IFNAR2C that may present as a heterotetramer (Uze et al., 1990; Novick et al., 1994; Domanski et al., 1995). Binding to the receptor complex results in the activation and transphosphorylation of receptor associated protein tyrosine kinases, Tyk2 and JAK1 that leads to the phosphosphorylation of tyrosine 466 on the cytoplasmic tail of IFNAR1

(Colamonici et al., 1994; Gauzzi et al., 1996; Krishnan et al., 1996; Darnell et al., 1994).

Phosphorylation of tyrosine 466 provides a docking site for STAT2’s Src homology domain 2 (SH2) domain, leading to STAT2 phosphorylation on tyrosine 690, which recruits STAT1 to the receptor complex. STAT1 is in turn phosphorylated on tyrosine

701 leading to the formation of STAT1/STAT2 heterodimer via reciprocal phosphotyrosine/Src homology 2 domain interactions (Stark et al., 1998). Phosphorylated

STAT1/STAT2 heterodimer leaves the receptor and associates with IRF9 (p48) to form the heterotrimeric transcription factor IFN stimulated gene factor 3 (ISGF3) (Darnell et al., 1994). Once formed, ISGF3 translocates into the nucleus and binds to IFN stimulated response element (ISRE) leading to expression of type I IFN stimulated genes (ISGs)

(Darnell et al., 1994). IRF9-/- mice showed severe defects in inducing type 1 IFN regulated genes in response to viral infections, suggesting that complete ISGF3 was

required for expression of most ISGs (Bluyssen et al., 1995). STAT1/2 heterodimer or

STAT1 homodimers can form and induce expression of other genes by binding to IFNγ activated sequences (GAS) (Stark et al., 1998). JAK-STAT signaling is also negatively regulated by host cellular proteins. One such class includes the suppressors of cytokine signaling, which bind to and/or degrade phosphorylated JAKs and prevent the recruitment of STATs (Alexander, 2002). SHP1 and SHP2 protein tyrosine phosphatases suppress IFN signaling by catalyzing JAK dephosphosphorylation (David et al., 1995;

You et al., 1999). Additionally, UBP43, a type I IFN inducible cysteine protease was shown to interact with IFNAR2, blocking the interaction between JAK1 and the receptor

(Malakhova et al., 2006). Overall, however, induction of ISGs is one of the most robust and tightly regulated mammalian gene regulatory systems identified to date.

Fig 3: Mammalian detection and Type I IFN response pathway: Viruses and replicative intermediates like ds and ssRNA are detected by TLRs and RIGI/MDA5.

NFkB and IRFs are activated leading to the induction of IFN α/β and other pro- inflammatory cytokines. Released IFN binds to IFN receptor in an autocrine and paracrine manner, leading to the induction of Type I ISGs through JAK-STAT signaling

1.5. Interferon Stimulated genes (ISGs):

IFNs regulate physiological responses through the induction of ISGs (Stark et al., 1998).

Approximately 400-500 ISGs were identified by oligonucleotide array (Der et al., 1998).

Most ISGs are induced within 2 h and their expression levels peak at 8-16 h and then decline to basal levels even in the continuous presence of IFN (Leaman et al., 2003).

However for some ISGs, including ISG12a, the transcript levels continue to accumulate beyond 96 h following IFN treatment (Rosebeck et al., 2008). Putative biological functions of many ISGs have been identified, but many others remain uncharacterized.

1.5.1 Antiviral ISGs:

Among different ISGs identified, only a few have well characterized antiviral function with a defined mechanism of action. Among these are the ds RNA dependent protein kinase R (PKR), 2’-5’ oligo adenylate synthetase (2’-5’ OAS) and Myxovirus resistance

1 (MX1) GTPases (Haller et al., 2007; Hovanessian et al., 2007; Sadler et al., 2008). The functions of other ISGs are described, but with little mechanistic understanding. PKR is a serine threonine kinase that dimerizes and autophosphorylates in response to dsRNA binding (Galabru et al., 1987; Bevilacqua et al., 1996). Activated PKR in turn phosphorylates eukaryotic initiation factor 2 alpha (eIF2α), thereby inhibiting its activity and suppressing protein synthesis (Thomis et al., 1993). PKR-/- cells have severely impaired antiviral responses with respect to VSV, Semliki virus and reovirus (Stojdl et al., 2000; Barry et al., 2009; Stewart et al., 2003).

2’-5’ OAS is another IFN induced gene that is activated in response to dsRNA binding.

Once activated, 2-5 OAS catalyzes the synthesis of 5’- triphosphorylated, 2’-5’ linked oligoadenylates from ATP (Kubota et al., 2004; Silverman., 1994). These 2-5A oligomers bind to and activate an endoribonuclease, RNase L, that targets RNA for degradation

(Kubota et al., 2004; Silverman., 1994). RNase L cleaves single stranded RNA after UU and UA dinucleotides (Wreschner et al., 1981). Although its actions are indiscriminate, this function leads to viral RNA cleavage as well. RNase L -/- mice were susceptible to disease progression in response EMCV (Zhou et al., 1998). RNase L activation also inhibited vaccinia and reovirus infections, implicating its broad antiviral responses

(Guerra et al., 1997; Nilsen et al., 1982). However, RNA degraded by RNase L is able to activate other PRRs, suggesting that RNase L deficient cells exhibit low IFN levels due to reduced signaling via PRRs (Malathi et al., 2007).

Mx proteins are a group of large GTPases that were identified when inbred mouse strains with mutations in the Mx locus on chromosome 6 were found to be sensitive to influenza virus infection (Haller et al., 1979). The Mx family includes Mx1 and Mx2 in mice and

MxA, MxB in humans. Human MxA protected IFNAR -/- mice against Thogoto,

LaCrosse and Semliki viral infections, suggests that Mx does not require the activity of other IFN induced proteins to confer antiviral responses (Hefti et al., 1999). Mx proteins inhibit an early step of viral life cycle, soon after host cell entry or before genome amplification by recognizing viral components such as nucleocapsid (Haller et al., 2002).

Interestingly, mice triply deficient in PKR, RNase L and Mx exhibit only weak antiviral responses against EMCV infection. However, upon IFN treatment, triple deficient

fibroblasts still mount antiviral responses against VSV and EMCV infection, suggesting the existence of other antiviral ISGs or alternate innate immune pathways in sensing viral infections (Zhou et al., 1999). Examples of additional antiviral ISGs are presented in

Table 2.

Table 2: Examples of ISGs conferring antiviral responses

ISG Viruses inhibited Reference

IFN induced transmembrane Influenza, SARS, West Nile and Brass et al., 2009; proteins 1, 2, 3 Dengue (inhibition of viral entry) Huang et al., 2011 (IFITM 1, 2, 3) Tripartite Sendai, VSV (Upregulate IFN levels by Gack et al., 2007 motifs25 ubiquitinating RIG-I) (TRIM25) TRIM79α LGTV, TBEV (Interacts and induces Taylor et al., 2011 lysosomal degradation of viral RNA polymerase NS5) Phospholipid VSV, EMCV ( augment IFN response) Dong et al., 2004 scramblase (PLSCR1) Guanylate VSV, EMCV Anderson et al., 1999 binding protein- 1 (GBP-1) ISG20 HIV type 1 and VSV Espert et al., 2005; Espert et al., 2003 IFN induced VSV Fensterl et al., 2012 tetratricopeptide repeat 2 (IFIT2) Influenza A and HCV (disrupts the Wang et al., 2007; Viperin formation of lipid rafts or interacts with Helbig et al., 2011 NS5A )

1.6 Viral evasion mechanisms of the host immune responses

In order to survive and replicate in host cells, viruses have evolved and adapted different strategies to evade or minimize the host immune responses (Vossen et al., 2002). Viruses often encode IFN antagonists that target IFN gene expression or IFN regulated protein products to inhibit host antiviral responses (Garcia-Sastre et al., 2006). For example, NS1 protein encoded by Influenza A virus was the first IFN antagonist to be identified. NS1 binds to dsRNA and sequesters it from the cytosolic sensor RIG I, thereby blocking IFN induction (Garcia-Sastre et al., 1998). NS1 also inhibits TRIM25α mediated RIG-I

CARD ubiquitination, thereby further suppressing the downstream signaling (Gack et al.,

2009). HCV uses a serine protease, NS3/4A, to interact with MAVS, cleaving it at Cys-

508 resulting in release of the N-terminal fragment of MAVS to inhibit IFN responses (Li et al., 2005). NS3 also inhibits cellular antiviral responses by interacting with TBK1 and inhibiting its association with IRF3, thus blocking IRF3 activation (Otsuka et al., 2005).

Ebola virus VP35 protein blocks IRF3 activation by sequestering dsRNA, while the related Marburg virus uses matrix protein VP40 to antagonize JAK1 tyrosine phosphorylation (Cardenas et al., 2006; Valmas et al., 2010). Other viral proteins that bind to dsRNA and antagonize IFN responses include E3L of Vaccinia and σ3 of reovirus

(Chang et al., 1993; Imani et al., 1988). V protein of Sendai virus binds to MDA5, but also targets STATs for proteasomal degradation to inhibit IFN signaling (Andrejeva et al., 2004; Horvath, 2004). Thus, it is clear that viruses must oppose the innate immune response to survive.

1.7 Vesicular Stomatitis virus (VSV):

VSV is a negative sense single stranded RNA virus, within the genus vesiculovirus. VSV infects cattle, pigs and is transmitted by insects such as sandflies and blackflies. VSV infection is characterized by vesicular lesions on the surface of tongue, gums and lips

(Rodriguez, 2002). VSV can also infect humans who are in close proximity with the cattle as evidenced by the presence of VSV antibodies in their blood samples. However, human infection is not severe, producing only non-fatal influenza like symptoms in diseased persons (Tesh et.al, 1969). Common serotypes of VSV found are Indiana (IN) and New Jersey (NJ).

VSV virion

VSV is a bullet shaped virus of approximately 180 nm length and 75 nm diameter. It has a non-segmented, negative strand RNA genome of 11,161 nucleotides (nt) encoding five genes and leader and trailer regulatory sequences arranged in the order: 3’ (leader)-N-P-

M-G-L-(trailer) 5’ (Iverson et. al, 1981 and 1982). The outermost layer of the viral coat consists of glycoprotein (G) dispersed within a lipid membrane that is derived from infected cells. The inner layer is lined by Matrix protein (M) and the interior nucleocapsid, consists of the viral genomic RNA complexed with nucleoprotein (N), phosphoprotein (P) and large polymerase (L) protein (Banerjee et al., 1977).

Adsorption:

VSV glycoprotein adheres to unknown cellular receptors present on the host cell membrane. Initially, it was suggested that phosphatidyl serine was the cell receptor for 21

VSV attachment, but subsequent studies showed that it likely plays only a secondary role in attachment and uptake (Schlegel et.al., 1983; Coil and Miller., 2004). VSV enters the cells by clathrin mediated endocytosis (Cureton et al., 2009). The coated vesicles enter the early endosomes where they lose their coat and are presented to multi vesicular bodies. In late endosome, where the pH drops below 6.5, G protein undergoes a conformational change and fuses with the endosomal membrane. The viral contents are released into the cytoplasm via a “back fusion” event by multivesicular bodies that release viral RNA into cytoplasm (Le Blanc et al., 2005).

Transcription:

Upon release of uncoated virus into the cytosol, VSV undergoes primary transcription.

Transcription is both sequential and polar, i.e the production of viral mRNAs decreases by the genes distance from the 3’promoter, leading to mRNA products in descending order N>P>M>G>L (Abraham et al., 1976; Ball et al., 1976; Iverson et. al., 1981 and

1982). The RNA transcriptase complex consisting of L and P together also uses host cellular factors such as HSP60 and EF-1αβγ to transcribe a small nucleotide leader RNA at the 3’end of the genome (Qanungo et al., 2004). A stop signal, (3’AUAC(U7) 5’) between each gene causes a pause, during which polyadenylation occurs to produce poly

A tail (Stillman et. al., 1997). When transcription is stalled, 30% of the polymerase slips off and this leads to reduction of the transcription of subsequent genes (Iverson et.al.,

1981). L protein methylates the 5’guanine M7 and 2’O-adenosine position and the mRNAs are translated by cellular ribosomes to synthesize viral proteins (Testa and

Banerjee, 1977). 22

Genome Replication: Accumulation of N proteins in the cytoplasm switches the polymerase activity from transcription to replication (Wertz et al., 1987). During replication, the polymerase ignores the stop signals and makes full length positive strand

RNA genomic copies. Full length negative strand is transcribed from this positive strand template for packaging into mature virus. Replication differs from transcription in that synthesis of new proteins is needed for replication (Wertz et al., 1973). N and P proteins interact with polymerase complex after transcription to displace L. N-P-L complex will then start replication at the 3’end of the full length genome (Banerjee, 1987)

Assembly and budding:

Full length genomic RNA is associated with N, P, L in the cytoplasm forming a loosely coiled ribonucleocapsid (RNP). G protein will travel through endoplasmic reticulum and golgi, where it is glycosylated and binds to the cell membrane (Doms et al., 1993; Spiro et al., 2001). M associates and tightly coils the RNP for packaging. After condensation of

RNP by M, the virus buds from the cell with a portion of host cell membrane, with G protein integration, forming a viral envelope (Robison et al., 2000).

FIG 4: VSV genome organization. Polymerase enters the genome at 3’ site and initiates mRNA synthesis at the first gene start site. At each gene junction, polymerase pauses and polyadenylates the upstream transcript. It then initiates and caps the downstream transcript. Approximately 30% of the polymerase fails to transcribe the downstream gene.

Fig 5: VSV replication cycle.1) virus binds to a cellular receptor and enters via receptor mediated endocytosis. 2) G protein (orange) fuses with the late endosomal membrane, uncoats and release the nucleocapsid (violet) into cytosol. 3) Negative strand RNA is copied into five subgenomic mRNAs by the L and P proteins (yellow and blue). 4) N, P,

M and L proteins are translated by free cytoplasmic ribosomes. 5) G mRNA is translated by the ribosomes bound to the endoplasmic reticulum. 6) N, P, L proteins starts viral replication by synthesizing positive strand copy of genomic RNA. 7) Positive strands will serves as template for progeny negative strand genomic RNA. 8) Some negative strand

RNA molecules will again start viral mRNA synthesis. 9) G mRNA is translated to G protein, which enters the golgi cycle. 10) G protein is glycosylated and embedded in the plasma membrane. 11 and 12) M protein and the progeny nucleocapsid are transported to the membrane 13) Associates with G protein at the membrane, initiates assembly and progeny virions bud off and infect another cell.

1.8 Interferon stimulated gene 12a (ISG12a):

ISG12a was originally cloned as an estrogen induced gene, designated P27 (Rasmussen et.al, 1993). ISG12a shared approximately 33% amino acid identity with 6-16

(G1P3), another member of the ISG12 family and both are induced upon IFN α and dsRNA treatment (Parker and Porter., 2004; Gjermandsen et.al., 2000). However,

ISG12a is induced by dsRNA only in IFN responsive cells, demonstrating that it is only

IFN inducible (Rosebeck and Leaman, 2008). Three human and mouse ISG12 genes

(designated a, b, c and a, b1, b2) are found on chromosome 14 and 12, respectively 6-16, on the other hand, is found only in humans (Parker and Porter, 2004). Among members of the human ISG12 family, only 6-16 and ISG12a are IFN inducible whereas in mouse, all ISG12 genes are IFN inducible (parker et al., 2004; Gjermandsen et al., 2000). ISG12a encodes a putative 122 amino acid protein of 11.5 Kda that consists of mitochondrial targeting sequence and three putative transmembrane domains. Only putative transmembrane domains 2 and 3 are present in ISG12b and C and bioinformatics tools predict them to be secreted proteins. Alternative splice variants of ISG12 have been identified and the one lacking exon 2 (designated ISG12-S) expression is found to be higher than full length ISG12a in blood and cervical cytobrush material in healthy women (Smidt et al., 2003). However, the functional significance of this and other splice variants are unclear. The functional role(s) of ISG12 family members in immunity or other processes is still uncertain. Studies from our lab suggested that ISG12a localized to the mitochondrial membrane and augmented etoposide induced apoptosis (Rosebeck and

Leaman, 2008). Similar observations were made for mouse ISG12b2 (Lu and Liao,

2011). Recently, a study suggested that mouse ISG12 localized on the inner nuclear 27

envelope was upregulated in vasculature injury and responsible for vascular pathologies by interacting and altering the transcriptional activities of nuclear receptors such as

NR4A1 (Papac-Milicevic et al., 2012). Their study highlighted that ISG12-/- mice were protected from restenosis and ISG12/NR4A1 double deficient mice exhibited the disease, suggesting the importance of NR4A1 in vascular pathologies. G1P3 (6-16), an antiapoptotic protein, blocks mitochondrial mediated apoptosis by depolarizing the mitochondrial membrane potential in gastric cancer and human myeloma cells (Tahara et al., 2005; Cheriyath et. al., 2007). G1P3, which is closely related to ISG12a, is robustly induced by type 1 IFNs in all cell types, senescent cells in particular and counteracts the proapoptotic effects of 5-fluorouracil, serum deprivation or cyclohexamide treatment

(Kelly et al., 1985; Leaman et al., 2005; Tahara et al., 2005). G1P3 was the first non BH3 containing mitochondrial targeted ISG that inhibits apoptosis. Constitutive expression of

G1P3 in RPMI 8226 cells suppressed TNF-apoptosis inducing ligand (TRAIL) induced apoptosis and knocking it down, sensitized the cells to IFN-α2b induced apoptosis

(Cheriyath et al., 2007). Studies suggest that G1P3 possibly inhibit apoptosis through interacting with calcium and integrin binding protein (CIB/KIP/calmyrin) that binds to presenilin-2 (Tahara et al., 2005). Overall, these studies suggest that G1P3 is crucial for antagonizing IFN pro-apoptotic effects. Another group demonstrated that the expression of murine ISG12b1 protected neonatal mice from lethal viral encephalitis infection, implicating ISG12 as a potentially important antiviral protein (Labrada et al., 2002).

ISG12b1 was also implicated as an adipose tissue expressed gene, where it downregulated mitochondrial biogenesis and inhibited adipocyte differentiation (Li et al.,

2009; Ohgaki et al., 2007). Recently, a role for ISG12b2 role in regulating dengue virus induced cell death has been identified (Lu et al., 2011).

1.9 Significance:

The goal of this project is to understand the role of human ISG12a in cellular antiviral responses. ISG12a was implicated in our gene array studies as an ISG strongly induced in all cell types and localized at mitochondrial membrane. We hypothesized that ISG12a influences the ability of cells inhibit viral infections by impacting mitochondrial function.

We also focused on understanding the role of endogenous ISG12a in IFN dependent mitochondrial responses and in antiviral effects. Our work provides evidence about the mechanistic role of ISG12a in innate immune responses.

Chapter 2

Materials and Methods

2.1 Cell lines

HT1080, U3A, U4A, A375, L929 and 293 cells were cultured in Dulbecco’s Modified

Eagle medium (DMEM) supplemented with 10% FCS (Invitrogen), 100 U/ml Penicillin and 100 U/ml Streptomycin (Invitrogen). 1 µg/ml Puromycin and 100 µg/ml hygromycin

(Sigma-Aldrich, MO, USA) were added to the medium for culturing HT1080 conditional expressing cells stably transfected with rtTA vector and then with pTRE2hyg plasmids encoding either pcDNA3.1 or ISG12a. To generate conditional expressing cells, HT1080 and 293 cells were stably transfected with rtTA vector (pAdapt.hrtTA-VP16-GR-

IRESeGFP) which encodes a glucocorticoid receptor and puromycin resistance gene.

Individual clones resistant for Puromycin were selected and cultured. ISG12a myc-his cDNA was cut from pcDNA3.1-ISG12a and cloned into the pTRE2 hyg plasmid. The resulting pTREhyg-ISG12myc his plasmid was transfected into rtTA stable cell line and individual clones resistant to Puromycin and hygromycin were selected and added to a separate well in a 24 well plate and cultured. Control cells were transfected with pTREhyg-pcDNA3.1. Individual clones resistant to puromycin and hygromycin were expanded and screened for ISG12a expression induced by doxycycline and 30

dexamethasone. Conditional expression cells were made by our lab member Dr. Boren

Lin.

2.2 Cell viability assays:

Cells were seeded in a 12 well plate and treated with 4 μg/ml doxycycline and 100 nM dexamethasone (dox/dex) the following day for 24 h. Cells were infected with VSV at indicated m.o.i for 12-16 h. Surviving cells were gently washed with PBS and fixed with

10% trichloroacetic acid (Sigma) for 1 h at 4 oC. Cells were then stained with 0.4% sulforhodamine B (ICN Biomedicals) at room temperature for 1 h, and the plates were washed with 1% acetic acid and air dried. Dye was eluted in 10 mM unbuffered TRIS

(Fisher) and the absorbance read at 490 nm on a Spectromax microplate reader

(Molecular Devices). Absorbance data were used to calculate percentage of viable cells relative to control cultures.

2.3 RNA isolation:

Total cellular RNA was isolated using Trizol reagent (Invitrogen) and was reverse transcribed using Moloney murine leukemia virus reverse transcriptase (Fisher

Scientific). For cDNA synthesis, 1 μg of RNA was incubated with 1 μg of random hexamer primer and heated at 70 oC for 10 min and quickly chilled on ice. 10 mM dNTPs, 40 U/μl ribonuclease inhibitor (Fisher Scientific) and 200 U/μl reverse transcriptase was added and incubated at 42 oC for 1 h. The cDNA was used as a template for PCR amplification (25–30 cycles: 30 s at 94 °C, 30 s at 52 °C and 60 s at 72 °C) and the products were analyzed on 1% agarose gel.

2.4 Real time PCR:

Quantitative real-time PCR studies were performed with the SsoFast Evagreen Supermix master mix (Bio-Rad). For each PCR reaction, 1 μl of RT reaction was combined with

7.5 μl of SsoFast mix, 50 ng of each PCR primer and 6 μl of water. Two-step PCR was run on an Eppendorf Mastercycler® ep Realplex Thermal Cycler (40 cycles: 30 s at 95

°C and 60 s at 62 °C). Samples were normalized to human GAPDH and relative gene expression levels were calculated using ddCT method. Primers used in the studies are listed in Table 3.

2.5 Transfections:

HT1080, U3A or U4A cells were plated on a 12 well plate and transfected using

Lipofectamine (Invitrogen). Plasmid DNA (1 μg) /lipofectamine complex were formed in serum free DMEM and added to cells for 3 h before replacement with complete media.

After 24 h, cells were infected and lysates are prepared for immunoblotting.

2.6 Immunoblotting:

Cells were lysed in lysis buffer (50 mM Tris-HCl (pH 8), 0.5% Triton X 100, 10% glycerol, 0.25 mM EDTA, 50 mM NaCl, 100 μM Na3VO4, 25 mM NaF, 50 mM DTT,

400 μM PMSF) and were incubated on ice for 20 min. Lysates were denatured in 1x sample buffer for 5 min at 100 oC and loaded onto 15% SDS gel and transferred to polyvinylidene difluoride membrane (Millipore). Membranes were blocked in 5% non-fat dry milk for 1 h and then probed with specific antibodies. Beta actin was used as a loading control.

Table 3: Primers for PCR analysis

Primers Sequence Mouse CHOP Sense: 5’CATACACCACCACACCTGAAAG 3’ Antisense:5’CCGTTTCCTAGTTCTTCCTTGC3’ Mouse GAPDH Sense: 5’TTGTCAGCAATGCATCCTGC3’ Antisense:5’TTGCCCACAGCCTTGGCAGC3’ Mouse Noxa Sense: 5’ATGCCCGGGAGAAAGGCGCG3’ Antisense:5’AAATCAAATTCAGAAGATTTCTG3’ Mouse Bim Sense: 5’GCTGGTGGGACCTGTTTCTA3’ Antisense:5’TTCAGTGAGCCATCTTGACG3’ Mouse PUMA Sense: 5’GGTGTCCCCAGTGCGCCTTC3’ Antisense:5’AGGCAGGCATCGTTCACCGC3’ Mouse ISG56 Sense: 5’CTCAGAGCAGGTCCAGTTCC3’ Antisense:5’TCCATCTCAGCACACTCCAG3’ Mouse ATF4 Sense: 5’GTGATCTTTTTGCCCCTCTA3’ Antisense:5’TGTCATTGTCAGAGGGAGTG3’ EMCV Sense: 5’GGCGGTCTTGTCGGTTATG3’ Antisense:5’TCCATTAGGCAGGTTATCC3’ Human GAPDH Sense: 5’AAATCCCATCACCATCTTCC3’ Antisense:5’ATGATCTTGAGGCTGTTGTC3’ Sense: 5’TCTGGCTCTGCCGTAGTTTT3’ Human ISG12a Antisense:5’GAACTTGGTCAATCCGGAGA3’ Human ISG54 Sense: 5’AAGAATTCCTTGGAGAGCAG3’ Antisense:5’CCAGATGATAGTGTACCCGG3’ VSVG Sense: 5’TGATTAAAATGGTGGAACCG3’ Antisense:5’GCTAATCATTGCAAGTGC3’ Sense: 5’TGGGTCACTACTTGTGATTT3’ VSVG genomic RNA Antisense:5’ACATAGCCCTTTGACCTTAT3’ VSV RT 5’TCAGAGCAAGACATCTTCTC3’ Human Noxa Sense: 5’GAGATGCCTGGAAGAAGGC3’ Antisense:5’GGTTCCTGAGCAGAAGAG3’

2.7 RNAi:

Control or ISG12a specific siRNAs were obtained as a pool of four targeting siRNA duplexes (On-Target plus SMART pool; Dharmacon). Briefly, control or ISG12a siRNAs

(50 nM) were mixed in 100 μl serum free media and 1 μl of Lipofectamine RNAiMAX

(Invitrogen) was added to each well and incubated for 20 min. After 20 min, HT1080 control or ISG12a expressing cells (50,000 cells/well) were added to the wells and incubated for 24 h. For efficient knockdown, the cells were trypsinized and again added to the wells containing siRNAs/lipofectamine complex and incubated for another 24 h.

Following day, the cells were induced with dox/dex for 24 h and infected with VSV

(moi=0.1) for 16 h. After the indicated infection time, lysates were prepared for immunoblotting and probed with VSV-G antibody (Sigma Aldrich). Knockdown of

ISG12a was confirmed by using a myc polyclonal antibody (Cell Signaling).

2.8 Immunofluorescence:

For immunofluorescence detection of VSV, control and ISG12a HT1080 cells were seeded on poly-L-lysine coated coverslips for 24 h, pretreated with dox/dex and then infected with VSV (moi=1) for 6 and 9 h. Coverslips were then washed with PBS and fixed with 4% paraformaldehyde in PBS for 15 min, permeabilized with 0.2% Triton X-

100 for 3 min and then blocked with 5% bovine serum albumin (BSA) for 30 min. Cells were incubated with rabbit anti VSV G primary antibody (1:1000 dilution) for 2 h at room temperature, washed three times with PBS and then incubated with TRITC conjugated goat anti-rabbit (Sigma Aldrich) secondary antibody (1:200 dilution) for 1 h

at room temperature. After 1 h incubation, the cells were washed three times with PBS and coverslips were mounted on to glass slides in glycerol. Fluorescent images were captured on an Olympus 1x51 fluorescent microscope.

2.9 Viral yield assays:

HT1080 control and ISG12a conditional expressing cells were plated on a 12 well plate for 24 h, treated with dox/dex for another 24 h and then infected with laboratory stocks of

VSV (Indiana strain) at a moi of 1 or 0.1 for 1 h in serum free media. After 1 h, the cells were washed with PBS and 1 mL of complete media was added. On the subsequent day, the virus-infected media was harvested and centrifuged for 3–4 min at 4000 g. For viral yield assays, the supernatants were used to infect an indicator cell line (L929 murine fibrosarcoma cells) at 1:10 serial dilutions. The next day, L929 cells were fixed in 100% methanol for 10 min and stained with crystal violet for 5 min. Quantified results, plotted on a log scale, represented the dilution at which 50% cell lysis was observed.

2.10 Viral entry and binding assays:

HT1080 control and ISG12a conditional expressing cells were seeded in 12-well plate and cultured in the absence or presence of dox/dex for 24 h. Cells were infected with

VSV (50 pfu/cell) for 1 h on ice to allow attachment but block virus entry. After 1 h infection, cells were washed with cold PBS and RNA was extracted to measure the amount of cell-bound virus. For viral entry into cells via endocytosis, virus infected media was aspirated after 1 h of binding on ice, cells were washed with PBS, prewarmed medium was added, and the cells were incubated for another 10 min at 37 °C. After 10 35

min incubation, cells were washed once with PBS followed by treatment with 0.25% trypsin and again washed three times with cold PBS to remove any cell-associated virus which had not entered the cytoplasm. Total cellular RNA was extracted to measure the amount of viral genomes that had entered the cells by real-time RT-PCR.

2.11 Measurement of mitochondrial mass:

Cells were treated with dox/dex for 24 h, infected with VSV (moi=0.1) for 16 h and stained with mitotracker (500 nM, Invitrogen) for 20 min. Later, cells were washed with

PBS and extracted with lysis buffer (0.1M TRIS containing 10% (V/V) SDS). The fluorescence of the extracts was measured in a black plate using Spectromax plate reader with excitation and emission set at 577 nm and 599 nm respectively. The fluorescence of the blank containing no cellular extracts was subtracted from the values. The fluorescence was then normalized based on the protein concentrations of individual extracts and represented as relative fluorescence units per microgram of protein.

2.12 Measurement of ROS production:

For measurement of ROS production, cells were stained with a cell-permeant 2', 7’- dichlorodihydrofluorescein diacetate (H2DCFDA) (Invitrogen), a chemically reduced form of fluorescein. HT1080 control and ISG12a expressing cells were seeded on a 24 well plate and pretreated with dox/dex for 24 h and infected with VSV for 16 h. After that time, H2DCFDA (10 μM) was added to cells and incubated for 30 min. Cells were washed extensively with PBS to remove unbound dye and extracted with lysis buffer

(0.1M TRIS containing 10% V/V SDS). The fluorescence of the extracts was measured 36

in a black plate using Spectromax plate reader with excitation and emission set at 480 nm and 530 nm respectively. The fluorescence of the blank containing no cellular extracts was subtracted from the values. The fluorescence was then normalized based on the protein concentrations of individual extracts and represented as relative fluorescence units per microgram of protein.

2.13 Plasmid construction

PCR amplified signal peptides from lysosomal associated membrane protein 1 (LAMP

1), Sortilin 1 (SORT 1) and TLR9 was cloned into pcDNA 3.1(-) ∆N ISG12 inframe with the C-terminal myc-His tag. Constructs were transfected using Lipofectamine

(Invitrogen). Primers used are listed in Table 4.

2.14 Statistical analysis:

Data were analyzed by unpaired student t-test using an online tool

(http://www.physics.csbsju.edu/stats/t-test.html). Values represent mean ± standard deviation and p-values below 0.05 were considered as significant. Experiments were repeated a minimum of three times.

Table 4: Primers for cloning

Restriction Primers Sequence Site LAMP1se. caCTCGAGATGGCGGCCCCCGGCAGCGCCCGGC Xho I LAMP1as. ccGAATTCTTGCTGACGCACAATGCATGAG ECOR I TLR9 se caCTCGAGATGGGTTTCTGCCGCAGCGCCCTGC Xho I TLR9 as. CcGAATTCTGGCCAGGGTCATGGCCAGCAT ECOR I SORT1 se. caCTCGAGATGGAGCGGCCCTGGGGAGCTGCG Xho I SORT1 as. G ccGAATTCTGCTGAGGGTCGACGGCGGCAG ECOR I

Chapter 3

Results

3.1 ISG12a protects from VSV induced cytopathicity

To investigate the role of ISG12a in cellular antiviral responses, we developed a conditional expression system using a modified Tet-on system. In these cells, ISG12a cDNA transcription is induced by addition of doxycycline and dexamethasone, rapidly inducing expression of the protein (Fig 6C). Briefly, control (encodes empty vector pcDNA3.1) and ISG12a conditional expression human fibrosarcoma (HT1080) cells were pretreated with dox/dex for 24 h and infected with VSV and EMCV (moi= 0.1) for 16 h, after which they were assessed for cytopathicity. Whereas control and ISG12 uninduced cells were sensitive to VSV induced cytopathicity, ISG12a expressing cells were resistant

(Fig 6A, B). In contrast, all the cells including ISG12a expressing cells were sensitive to

EMCV induced cytopathicity (Fig 6F). ISG12a induced cells showed reduced loss in viable cell numbers and exhibited less caspase 3 activation after VSV infection, as compared to control and uninduced cells (Fig 6C, D). To ensure that, ISG12a protein expression was required to protect cells against VSV infection, siRNA was used to specifically knock down the inducible expression of ISG12a. Transfection with ISG12a siRNA but not control siRNA, eliminated the majority of ISG12a expression, resulting in 39

re-sensitization to viral induced cytopathicity and VSV-G protein expression, thereby demonstrating specificity of the protection observed in dox/dex treated ISG12 cells (Fig

7A, B). These data confirm that ISG12a protects cells from VSV induced cytopathicity.

B C

Fig 6: ISG12a protects cells from viral cytopathicity. A) HT1080 control and ISG12a regulated cells were pretreated with dox/dex for 24 h and then left uninfected or infected with VSV (moi=0.1) for 16 h. After that time, photomicrographs were taken to illustrate viral CPE. B) The same cells as in “A” were infected with VSV (moi=0.1) for 16 h and then fixed and cell monolayers stained with crystal violet. C) Showing the regulation of

ISG12a conditional expression D) Cells were left untreated or infected with VSV as in

“A” and after 16 h fixed in TCA and stained with SRB. To quantify relative cell numbers, incorporated dye was eluted and absorbance quantified (OD 550 nm). Cell viability for each sample was expressed as a percentage of the staining in the untreated wells. E) To assess apoptosis, cells were lysed at the indicate times after infection and caspase 3 cleavage monitored by immunoblotting. F) Cells were infected with EMCV (moi=0.1)

for 16 h and then fixed and stained with crystal violet. Values are represented as means±

SD (errorbars) for three independent experiments. (p≤0.05 are significant)

Fig 7: Knockdown of ISG12a expression restores VSV induced cytopathicity in dox/dex treated ISG12a cells. A) HT1080 control and ISG12a regulated cells were left untreated or pretreated with dox/dex for 24 h and transfected with control and ISG12a siRNA for 24 h and infected with VSV (moi=0.1) for 16 h. After that time, cells were fixed and stained with crystal violet. B) HT1080 control and ISG12a regulated cells were transfected with siRNA for 24 h and infected with VSV (moi=0.1) for 16h. After that time, cells were lysed and VSV G, ISG12a-myc and actin expression was monitored by immunoblotting.

3.2 ISG12 blocks VSV replication

To determine if the decreased viral cytopathicity in ISG12a induced cells was due to defective cellular death response to virus or decreased viral replication, viral yields and

VSV-G mRNA accumulation were monitored in infected cells (Fig 8). Results indicated that viral production in ISG12a induced cells was reduced by approximately 105 fold as compared to control and ISG12a uninduced cells (-dox/dex) (Fig 8A). VSV G mRNA expression was also reduced dramatically in ISG12a expressing cells (Fig 8B). Taken together, these data suggested that ISG12a blocked cytopathicity by restricting viral replication.

3.3 ISG12a protection does not result from IFN feedback

Some antiviral ISGs, such as PLSCR1, protect cells by enhancing IFN responses through enhanced upregulation of all, or a subset of antiviral genes (Dong et al., 2004). To test whether ISG12a restricts VSV replication by amplifying the intrinsic IFN response, IFN unresponsive U3A and U4A (STAT1 and JAK1 deficient respectively) cells were transiently transfected with ISG12a and infected with VSV (moi=0.1) for 16 h.

Interestingly, both U3A and U4A cells transfected with ISG12a were resistant to VSV cytopathicity (Fig 9A, B), suggesting ISG12a expression alone can restrict viral replication. Additionally, expression of another ISG, ISG54 was detected in control and

ISG12 induced cells only when treated with poly IC or IFN but not in untreated cells.

Together, the data suggests that ISG12a restricts viral replication without augmenting

IFN response.

Fig 8: ISG12a blocks VSV replication: A) HT1080 control and ISG12a regulated cells were pretreated with dox/dex for 24 h and infected with VSV (moi=0.1) for 16 h. After infection, conditioned media was harvested and applied to L929 indicator cells in log10 dilutions. After 16 h, the cells were fixed and stained with crystal violet and viral titre quantified by counting plaques. B) Cells were pretreated with dox/dex for 24 h and infected with VSV (moi=0.1) for 12 h. After that time, total cellular RNA was harvested and reverse transcribed to cDNA that served as a template for real time SYBR green based quantitative PCR analysis of VSV-G mRNA expression. Data were normalized to

GAPDH. All results represent the means plus standard deviations (error bars) for 3 independent experiments.

A B

Fig 9: ISG12a protection does not require IFN feedback: A) U3A, U4A and HT1080 cells were transiently transfected with ISG12a or PcDNA3.1 vector for 24 h and infected with VSV (moi=0.1) for 16 h. After that time, cells were lysed and VSV-G and ISG12- myc expression monitored by immunoblotting. B) The same cells as in “A” were transfected with ISG12a and infected with VSV (moi=0.1) for 16 h and then fixed and remaining cell monolayers stained with crystal violet. C) HT1080 control and ISG12a cells were pretreated with dox/dex for 24 h and treated with either poly IC (50 µg/ml) or

IFNβ (1000 U/ml) for 8 h. Total cellular RNA was then harvested and reverse transcribed into cDNA that was used as a template for RT-PCR analysis of ISG54 or ISG12a mRNA expression. GAPDH served as a cellular RNA control.

3.4 Identification of VSV replication steps targeted by ISG12a

Since ISG12a expression by itself restricts VSV replication without augmenting IFN responses, we next investigated which stage(s) of viral replication cycle was targeted by

ISG12a. Control and ISG12a induced cells were infected with VSV (moi=1) for 2, 4, 6 and 8 h, and G protein levels assessed by immunoblotting. VSV-G accumulation in control and ISG12a uninduced cells after 8 h post infection was greater than in the

ISG12a induced cells (Fig 10A). VSV G protein expression was also assessed by immunofluorescence at 6 and 9 h postinfection (Fig 10B). G protein staining was more pronounced in control and ISG12a uninduced cells as compared to ISG12a induced cells

(Fig 10B), suggesting that, ISG12a impacts an early step in the viral replication cycle.

This could involve perturbation of viral entry into host cells or inhibition of viral

RNA/protein biosynthesis.

3.4.1 ISG12a does not inhibit VSV-G mediated viral entry

As described earlier, VSV is a negative strand virus and synthesizes positive strand upon entering into the host cell. Enveloped viruses usually express proteins that mediate viral attachment to a cellular receptor and gain entry into the cell. We investigated, whether

ISG12a blocked the VSV interaction with the host cell receptor and restrict the viral entry. To understand whether ISG12a restricts VSV entry into the cell, virus binding and entry assays were performed (Weidner et al., 2010). Briefly, HT1080 control and ISG12a regulated cells were cultured in the presence or absence of dox/dex for 24 h. For binding assays, cells were infected with VSV (50 pfu/cell) for 1 h on ice, followed by extensive washing with cold PBS. RNA was isolated from cells and cell associated viral RNA was 52

measured by using the primers that specifically amplify the genome (negative strand) to quantify viral adsorption onto the cells. Results suggested that the viral genome levels were not different between controls and ISG12 induced cells, indicating ISG12a does not restrict VSV attachment to cells (Fig 11A). To assess viral entry, cells were infected with

VSV for 1 h on ice and washed with cold PBS. Cells were then either trypsinized immediately or received prewarmed media and incubated at 37 oC for another 10 min to allow endocytosis. After 10 min incubation, cells were treated with trypsin and washed with cold PBS to remove virions that had not entered the cells. Total cellular RNA was isolated and reverse transcribed and then subjected to PCR using primers that specifically amplify VSV negative strand. The results indicated that cellular VSV genome levels were not significantly different between control and ISG12a induced cells after incubating at

37 oC for 10 min (Fig 11B), suggesting that ISG12a expression did not affect VSV endocytosis into the cells. To further investigate the role of ISG12a in viral entry, cells were infected with UV-inactivated VSV (moi=10) for 12 h and total RNA was isolated to measure the viral genome expression. The UV-inactivated virus did infect the ISG12a expressing cells as demonstrated by RT-PCR of VSV G RNA (Fig 11C). Overall, these studies suggest, ISG12a possibly restrict the virus after endocytosis.

Fig 10: ISG12a restricts viral expression during first round of replication cycle: A)

HT1080 control and ISG12a regulated cells were pretreated with dox/dex for 24h and infected with VSV (moi=1) at specific times indicated. After that time, cells were lysed and VSV-G protein expression monitored by immunoblotting. B) The indicated cells were infected with VSV (moi=1) for 6 and 9 h and then fixed and stained with a VSV G protein primary antibody and a TRITC conjugated goat anti rabbit secondary antibody.

Cellular morphology was assessed by phase contrast microscopy

37 0C for 10min - + - + - + - +

Trypsin + + + + + + + +

Control-d/d Control+d/d ISG12-d/d ISG12+d/d

Fig 11: ISG12a does not prevent VSV entry in to the cells: A) HT1080 control and

ISG12a expression cells were pretreated with dox/dex for 24 h, then infected with VSV

(50 pfu/cell) for 1 h on ice for adsorption. After washing, RNA was extracted to quantify cell bound virus. B) To quantify viral entry, cells were treated as in A, but then virus removed after 1 h binding on ice and cells exposed with trypsin or incubated at 37 oC for another 10 min to allow endocytosis, followed by washing with PBS and trypsin treatment to remove any unincorporated virus. Viral RNA was quantified by real time

PCR with primers specific for VSV genome (negative strand). A standard curve was plotted with known amount of virus and their observed Ct values. Quantification of Viral

RNA is expressed in genome/cell based upon the Ct value relative to standard curve. C)

Cells were infected with UV inactivated VSV (moi=10) for 12 h, followed by extensive washing with cold PBS. Viral RNA expression was monitored with primers specific for

VSV genome. Values are means plus standard deviations (error bars) for 3 independent experiments. NS (non-significant) and ⋆ represents p≤ 0.05

3.4.2 Role of ISG12a in preventing viral escape from endosome

Since ISG12a did not appear to restrict viral entry into the host cell, we next sought to determine whether ISG12a expression blocked endosomal release of viral particles into the cytoplasm. For these studies, we used chloroquine, a drug that inhibits endosome acidification. For these studies, cells were infected with VSV (moi=0.1) and chloroquine added at 15, 30, 45 or 60 min post infection. After 16 h in cultures, cells were harvested and G protein expression analyzed by immunoblotting (Fig 12A). When chloroquine was added after 15 min, G protein expression was strongly suppressed in control and ISG12a uninduced cells as compared to untreated cells, suggesting that the majority of VSV particles take more than 15 min to escape the endosome (Fig 12B). G protein levels increased in a time dependent manner in control cells when chloroquine was added 30, 45 and 60 min post infection. However, G protein levels remained low in ISG12a induced cells when compared to control and ISG12a uninduced cells. There appeared to be synergistic reduction of G protein levels in ISG12a induced cells treated with chloroquine

(Fig 12B). G protein mRNA levels were also correspondingly reduced in ISG12a expressing cells treated with chloroquine as compared to controls (Fig 12D). Overall, the data suggests that the viral release from endosome to cytosol is delayed in ISG12a induced cells, possibly due to altered endosomal dynamics upon ISG12a expression.

Fig 12: ISG12a delays VSV release from endosome: A) Schematic of chloroquine treatment procedure. HT1080 control and ISG12a regulated cells were pretreated with dox/dex for 24 h. Cells were infected with VSV (moi=0.1) and at various times postinfection were treated with 100 μM chloroquine. 6-16 h later, cells were harvested for protein (B), fixation (C) or RNA isolation (D). B) G protein expression in cells treated as in “A” was monitored by immunoblotting. C) Cells infected with VSV (moi=0.1) and treated with chloroquine at various time points postinfection were fixed and stained with crystal violet. D) Cells were infected with VSV(moi=0.1) and treated with chloroquine at various time points postinfection, total cellular RNA isolated after 6 h, reverse transcribed to and used as a template for RT PCR analysis of VSV-G mRNA expression.

GAPDH served as a cellular RNA control

3.4.3 ISG12a effect on viral primary transcription

As described in the introduction, following release of viral nucleocapsids from the endosome to cytosol, the parental genome undergoes primary transcription. Once the viral proteins accumulate, the virus stops primary transcription and undergoes replication to generate progeny genomes, which then undergo secondary transcription. To investigate whether ISG12a effects primary viral transcription but not viral replication or protein synthesis, cells were infected with VSV (moi=1) in the presence or absence of

Cycloheximide (CHX 50 μg/ml). Since proteins for the primary transcription are packaged in the nucleocapsid, additional viral and host cellular proteins are not required for the transcription. CHX prevents protein synthesis, thereby blocking viral replication and secondary transcription. Total RNA was isolated after 3 h infection and the levels of

VSV G mRNA detected using RT-PCR. Results show that the levels of G mRNA were reduced with CHX treatment when compared to virus infection alone in control and

ISG12a uninduced cells (Fig 13A). In ISG12a expressing cells, G mRNA levels were reduced as compared to controls with or without CHX treatment, but interestingly, the viral genomic RNA levels i.e the negative strand were also reduced (Fig 13). These data suggest that ISG12a may restrict the virus before primary transcription as evidenced by the reduced genomic RNA levels (Fig 13).

Ctrl Ctrl ISG12 ISG12 -d/d +d/d -d/d +d/d 3 h

Fig 13: ISG12a effect on primary transcription: A) i. HT1080 control and ISG12a expressing cells were pretreated with dox/dex for 24 h and infected with VSV (moi= 1) with or without cyclohexamide (CHX 50 μg/ml) for 1 h in serum free media. After 1 h, complete media was added (with or without CHX) and cells incubated for another 2 h.

Total cellular RNA was isolated and reverse transcribed to cDNA for RT-PCR analysis of VSV-G mRNA and ISG12a expression. GAPDH served as a cellular RNA control. B)

Viral RNA was quantified by real time PCR with primers specific for VSV genome

(negative strand).

3.5 Role of ISG12a in mitochondrial function

As ISG12a is localized to mitochondrial membrane, we sought to determine, whether its impact on mitochondrial function contributes antiviral responses. To study this, HT1080 control and ISG12a expressing cells were treated with poly IC (50 μg/ml) or infected with VSV (moi=0.1) for 16 h and stained with mitotracker red that fluoresces when bound to active mitochondria. Mitotracker staining pattern looked similar between control and ISG12a uninduced cells with or without poly IC treatment and the fluorescence is diminished with VSV infection, due to virus induced cytopathicity. In contrast, ISG12a expressing cells exhibited increased fluorescent staining when compared to controls with or without poly IC treatment or VSV infection (Fig 14A). To understand what this bright fluorescence staining pattern represents, we measured the mitochondrial mass by staining the cells with mitotracker red (Fig 14B). Interestingly,

ISG12a expressing cells exhibited increased mitochondrial mass when compared to controls and when infected with VSV, the mass increased even more when compared to uninfected cells (Fig 14B). Further, we measured the ROS production by staining the cells with H2DCFDA (10 μM). ISG12a expressing cells exhibited more ROS production when compared to controls and ISG12 uninduced cells (Fig 14C). Unlike mitochondrial mass, the ROS levels were not significantly different between ISG12a expressing cells with or without infection but they were still significantly elevated as compared to other cells (Fig 14 B, C). Taken together, these studies suggest that ISG12a is impacting mitochondrial function, but the impact of this altered function towards antiviral responses is unknown.

Fig 14: Role of ISG12a in mitochondrial function. A) HT1080 control and ISG12a expressing cells were seeded on cover slips and pretreated with dox/dex for 24 h, followed by poly IC treatment or virus infection for 16 h. After that time, cells were stained with mitotracker (500 nM) for 20 min in DMEM, washed with PBS, mounted onto glass slides in glycerol and visualized by confocal imaging. B) Cells were treated with dox/dex for 24 h, infected with VSV (moi=0.1) for 16 h and stained with mitotracker for 20 min. Later, cells were washed and extracted with lysis buffer (0.1M

TRIS containing 10% (V/V) SDS). The fluorescence of extracts was measured by plate reader with excitation and emission set at 577 nm and 599 nm respectively. Results were expressed as relative fluorescence per microgram of protein. Results are representative of

6 independent experiments done in triplicates. C) Cells were treated with dox/dex for 24 h, infected with VSV (moi=0.1) for 16 h and stained with D2HCFDA for 30 min. Cells were washed and extracted with lysis buffer (0.1M TRIS containing 10% (V/V) SDS).

The fluorescence of extracts was measured by plate reader with excitation and emission set at 480 nm and 530 nm respectively. The fluorescence was then normalized based on the protein concentration and results were expressed as relative fluorescence per microgram of protein. Results are representative of 3 independent experiments done in triplicate. Statistical analysis was done by student t test (P<0.05 significant). Values are means ± standard deviations (error bars).

Chapter 4

Discussion

Type 1 IFNs combat viral infections by inducing a large number of cellular genes known as ISGs. Although some of them have been well studied, not all have been fully characterized in terms of their roles in antiviral responses. It is likely that multiple ISGs work together to interfere with different viral types and/or block viral replication at different stages of the life cycle. IFN induced proteins may even inhibit a virus in a cell type dependent manner (Schoggins et al., 2011). Identifying individual antiviral ISGs and their modes of action are necessary to understand viral pathogenesis and IFNs antiviral mechanism.

ISG12a is one of the most highly induced Type 1 IFN regulated genes, but information on its function is limited. ISG12a expression inhibited HCV subgenomic replication while knocking down its expression enhanced the replication (Itsui et al., 2009), implicating it as a potential antiviral gene. ISG12a expression was highly upregulated in

HCV infected hepatocytes and HCV related chronic liver disease (CLD) and hepatocellular carcinoma (Budhu et al., 2007). In contrast, its expression was not significantly upregulated in hepatitis B virus (HBV) related CLD or HBx (HBV protein) 69

infected hepatocytes, suggesting ISG12a upregulation is specific to certain viral infections (Budhu et al., 2007). ISG12a, G1P3 and ISG15 expression in chronic hepatitis

C correlated strongly with patient responsiveness, suggesting that these proteins are important biomarkers of therapeutic response to anti-HCV treatment (Asselah et al.,

2008). Prior to antiviral treatment of hepatitis patients, ISG12a expression differed between responders and non-responders, with basal ISG12a levels higher in patients who failed to respond to exogenous pegylated IFN treatment as compared to patients with low basal expression levels (Asselah et al., 2008).

Other ISG12 family members also exhibited antiviral or innate immune functions. Mouse

ISG12b1 protected neonatal mice by delaying sindbis virus induced cell death (Labrada et al., 2002). That study showed that virus induced ISG12 expression is upregulated in 4 week old mouse brains compared to 1 week old mouse brain, indicating that ISG12 expression is age dependent. In contrast, mouse ISG12b2 augmented dengue virus induced cell death through intrinsic apoptotic signaling (Lu and Liao, 2011), suggesting that ISG12 members confer antiviral responses with different mechanisms, either by delaying viral replication or sensitizing virus infected cells. Human ISG12a expression and other antiviral genes were upregulated in patients with dengue fever (Ubol et al.,

2008). Respiratory syncytial virus (RSV) downregulated G1P3 expression and upregulated chemokine levels in alveolar cells, suggest that RSV interferes with innate antiviral response by inhibiting G1P3 (Zhao et al., 2008). G1P3 expression levels were detected in primary human hepatocytes infected with HCV as early as 6 h and continued to peak until 96 h and subsequently declined (Yang et al., 2011). Overall, these studies 70

implicate ISG12 family members in antiviral responses, but the mechanisms of their actions remain unknown.

Here, we focused on the role of human ISG12a and the mechanism to VSV antiviral responses. We showed that ISG12a blocked VSV induced cytopathicity and viral replication without augmenting IFN or independently upregulating other ISGs. ISG12a antiviral responses were specific to VSV since cells were not protected by ISG12a when infected with another lytic virus, encephalomyocarditis virus (EMCV) (Fig 6F).

However, the replication cycles of these viruses are quite different, suggesting that

ISG12a antiviral effects may be specific to viruses with replication cycles similar to

VSV. Our data suggested that ISG12a restricts an early step of VSV replication cycle.

ISG12a did not inhibit viral entry into the cell, but viral genomic RNA levels were significantly reduced after 3 h infection (Fig 11A, B, 13B). VSV-G mRNA or protein levels appeared to be synergistically reduced in ISG12a expressing cells compared to controls when treated with chloroquine, suggests that ISG12a could possibly restrict the release of viral nucleocapsids from late endosome to cytosol (Fig 12). However, this early step restriction could be due direct or indirect effects of ISG12a.

ISG12a is a transmembrane hydrophobic protein localized to mitochondria (Rosebeck et al., 2008). It is not obvious how a mitochondrial protein could restrict early viral replication without augmenting IFN responses. Mitochondrial mass and reactive oxygen levels were increased in ISG12a expressing cells, suggesting a role in impacting mitochondrial function (Fig 14). Excess ROS production leads to cell death but moderate 71

levels would activate immune responses and is an important host defense mechanism against invading pathogens (Vlahos et al., 2011). Increased mitochondrial mass could reflect to either increased mitochondrial numbers or mitochondrial fusion. Mitochondrial fusion is mediated by mitofusins (Mfn1, 2) and OPA1 (Chen and Chan, 2010). Mfn1 interacts with MAVS, leading to production of type I IFNs, (Campello et al., 2010), although ISG12a does not augment IFN response. Although ISG12a does not augmenting

IFN response, the increased mass may not be due to mitochondrial fusion. Antiviral drugs such as indinavir, stavudine and zidovudine alters the mitochondrial function by increasing the mitochondrial mass, ROS production and decreasing the mitochondrial membrane potential (Viengchareun et al., 2007; Ferraresi et al., 2004). These studies suggest, ISG12a functional role is similar to antiviral drugs.

In our studies, we used Tet ON system to impact all the cells in the culture dish and to mimic the endogenous ISG12a expression. ISG12a expression levels are highly upregulated by IFN, an effect mimicked by inducible expression system. As described earlier, G1P3 which is structurally related to ISG12a is also localized at mitochondrial membrane and antagonizes TRAIL induced apoptosis (Cheriyath et al., 2007). ISG12a on the other hand augmented etoposide induced apoptosis (Rosebeck and Leaman, 2008).

Both proteins are highly induced by Type I IFNs and so the balance between the expression levels of these two proteins will possibly dictate the cell survival. G1P3 inhibits the apoptosis through mitochondrial stabilization. Knocking down either G1P3 or

ISG12a enhanced HCV replication, suggesting their antiviral roles (Itsui et al., 2009).

The question arises is whether G1P3 cooperates with ISG12a in VSV antiviral responses 72

as delaying apoptosis would protect surrounding cells and overcomes the proapoptotic activity. Our studies suggested that G1P3 and ISG12a do not interact with each other

(Rosebeck and Leaman unpublished observations) but they could still have complementary actions.

Studies suggested that VSV M protein contains a cryptic mitochondrial targeting motif that helps in localization to the mitochondria (Lichty et al., 2006). A number of functions have been attributed to M protein. M protein blocks the antiviral gene expression products by inhibiting cellular transcription and nucleocytoplasmic transport (Black et al.,

1992; Petersen et al., 2001). M inhibits nuclear export by interacting with RAE1/NUP98 complex (Faria et al., 2005). M is responsible for the VSV cytopathic effects due to the inhibition of host cell gene expression (Kopecky et al., 2003). However, function of M protein targeting to mitochondria and this localization in the life cycle of VSV is unknown. A study suggests that the mitochondria may be involved in intracellular transport of viral nucleocapsid to the periphery (Das et al., 2006). It could be possible that

ISG12a may interact with M protein at mitochondria to thwart its function.

Viruses inhibit host responses by altering cellular metabolism (Maynard et al., 2010). In infected cells, rhabdoviruses increase the uptake and utilization of glucose that can supply ATP required for the viral replication (Gray et al., 1983). Alterations in glucose metabolism and mitochondrial dysfunction are characteristic of sindbis virus infection

(Garry et al., 1986). Sindbis virus also alters mitochondrial bioenergetics, resulting in increased ATP synthesis and leading to neuronal dysfunction and viral induced 73

encephalitis (Silva da Costa et al., 2012). Mouse ISG12b1 protected the neonatal mice against sindbis induced encephalitis, it was enticing to speculate that it was via mitochondrial alterations (Labrada et al., 2002). Mouse ISG12b1 downregulated mitochondrial biogenesis by inhibiting adipocyte differentiation in another study (Li et al., 2008), lending credence to this possibility.

The budding of enveloped viruses depends on the composition of viral proteins and host lipids. Previous studies suggested that altering the triacylglycerol (TAG) levels prevents viral budding from the membrane (Hornung et al., 1994). In the presence of Lauric acid

(C12), which increased TAG levels, VSV production was reduced suggesting that medium chain length carboxylic acids suppress viral maturation (Hornung et al., 1994).

All these studies raise a possibility that human ISG12a impacts antiviral responses through modulating mitochondrial biogenesis. Currently we are conducting studies on identifying whether mitochondrial localization of ISG12a is necessary for antiviral responses.

Another possible mechanism may be due to impairment of endosomal acidification. As described earlier, VSV G protein undergoes a conformational change and fuses to late endosomal membrane at acidic pH. Chloroquine prevents this process by increasing the pH. ISG12a expression plus chloroquine treatment, synergistically downregulated viral replication when compared to control cells (Fig 12). Acidic pH in the endosome and trans golgi network is maintained by vacuolar ATPase (V-ATPase), which transport protons into the lumen by energy derived from ATP hydrolysis (Forgac, 2007). Earlier studies 74

from other labs suggested that IFN-β inhibits the transport of VSV-G protein by blocking the V-ATPase mediated acidification and increasing the pH (Sidhu et al., 1999;

Maheshwari et al., 1991). Recently another ISG, IFITM3 was found to neutralize the pH of the endosome by interacting with and regulating the function of ATP6v0b, a subunit of

V-ATPase (Wee et al., 2012). Our earlier studies also showed that ISG12a decreased the mitochondrial membrane potential (Rosebeck and Leaman, 2008). We surmise that

ISG12a may also regulate endosomal membrane potential to prevent viral fusion to the membrane. It is thus important to determine whether ISG12a is localized only at mitochondria or whether it is distributed to other membrane organelles in response to infection (see section 4.1). Overall, this study would help in identifying mechanistic role of ISG12a in inhibiting virus replication by unraveling its role in innate immune responses.

4.1 Future work

Future work on the mechanism of ISG12a in regulating antiviral responses includes

1. To identify whether mitochondrial localization of ISG12a is necessary for antiviral response.

To investigate this, ISG12a plasmids intended to direct ISG12a protein to organelles other than the mitochondria will be constructed. Signal peptides of lysosomal associated membrane protein-1 (LAMP-1), Sortilin-1 (SORT-1), Toll like receptor-9 (TLR-9) will be swapped for the natural ISG12a signal peptide. When transiently transfected with these constructs and infected with VSV (moi=0.1), the cells will be assessed for VSV induced cytopathicity and virus yield (Fig 15A). Interestingly, we found that ∆N (ISG12a without signal peptide) transfected cells were resistant to VSV induced cytopathicity, although our earlier studies suggested that ∆N still be localized at mitochondrial membrane. We are conducting subcellular fractionation and imaging studies to determine whether these modified ISG12 constructs are directed to predicted organelles. This study would help us to determine where ISG12a functions to restrict viral replication and develop more directed hypotheses on how the protein works in innate immunity

Fig 15: Role of ISG12a mitochondrial localization in antiviral responses: A) Signal peptides of LAMP-1, SORT-1, and TLR9 were swapped with natural ISG12a signal peptide. Resulting expression constructs were transfected into HT1080 cells. Full length

ISG12a and ∆N ISG12a were used as controls. After 24 h transfection, cells were infected with VSV (moi=0.1) for 16 h and photomicrographs taken to illustrate viral cytopathicity. B) Cells were transiently transfected with constructs and infected with

VSV (moi=0.1) for 16 h. After that time, cells were lysed and VSV-G and myc expression was analyzed by Immunoblotting.

References

Abraham, G., Banerjee, A.K., 1976. Sequential transcription of the genes of vesicular stomatitis virus. Proceedings of the National Academy of Sciences of the United States of America 73, 1504-1508.

Ackler, S., Mitten, M.J., Foster, K., Oleksijew, A., Refici, M., Tahir, S.K., Xiao, Y., Tse, C., Frost, D.J., Fesik, S.W., Rosenberg, S.H., Elmore, S.W., Shoemaker, A.R., 2010. The Bcl-2 inhibitor ABT-263 enhances the response of multiple chemotherapeutic regimens in hematologic tumors in vivo, Cancer Chemother Pharmacol, 2010/01/26 ed, pp. 869- 880.

Adams, J.M., Cory, S., 2007. Bcl-2-regulated apoptosis: mechanism and therapeutic potential. Current opinion in immunology 19, 488-496.

Adams, K.W., Cooper, G.M., 2007. Rapid turnover of mcl-1 couples translation to cell survival and apoptosis. The Journal of biological chemistry 282, 6192-6200.

Akira, S., Takeda, K., 2004. Toll-like receptor signalling. Nature reviews. Immunology 4, 499-511.

Akira, S., Takeda, K., 2004. Functions of toll-like receptors: lessons from KO mice. Comptes rendus biologies 327, 581-589.

Alexander, W.S., 2002. Suppressors of cytokine signalling (SOCS) in the immune system. Nature reviews. Immunology 2, 410-416.

Anderson, S.L., Carton, J.M., Lou, J., Xing, L., Rubin, B.Y., 1999. Interferon-induced guanylate binding protein-1 (GBP-1) mediates an antiviral effect against vesicular stomatitis virus and encephalomyocarditis virus. Virology 256, 8-14.

Andrejeva, J., Childs, K.S., Young, D.F., Carlos, T.S., Stock, N., Goodbourn, S., Randall, R.E., 2004. The V proteins of paramyxoviruses bind the IFN-inducible RNA helicase, mda-5, and inhibit its activation of the IFN-beta promoter. Proceedings of the National Academy of Sciences of the United States of America 101, 17264-17269.

Asselah, T., Bieche, I., Narguet, S., Sabbagh, A., Laurendeau, I., Ripault, M.P., Boyer, N., Martinot-Peignoux, M., Valla, D., Vidaud, M., Marcellin, P., 2008. Liver gene 78

expression signature to predict response to pegylated interferon plus ribavirin combination therapy in patients with chronic hepatitis C. Gut 57, 516-524.

Ball, L.A., White, C.N., 1976. Order of transcription of genes of vesicular stomatitis virus. Proceedings of the National Academy of Sciences of the United States of America 73, 442-446.

Bandyopadhyay, S.K., Leonard, G.T., Jr., Bandyopadhyay, T., Stark, G.R., Sen, G.C., 1995. Transcriptional induction by double-stranded RNA is mediated by interferon- stimulated response elements without activation of interferon-stimulated gene factor 3. The Journal of biological chemistry 270, 19624-19629.

Banerjee, A.D., Abraham, G., Colonno, R.J., 1977. Vesicular stomatitis virus: mode of transcription. The Journal of general virology 34, 1-8.

Banerjee, A.K., 1987. Transcription and replication of rhabdoviruses. Microbiological reviews 51, 66-87.

Barber, G.N., 2001. Host defense, viruses and apoptosis. Cell death and differentiation 8, 113-126.

Barber, G.N., 2005. VSV-tumor selective replication and protein translation. Oncogene 24, 7710-7719.

Baron, S., Fons, M., Albrecht, T., 1996. Viral Pathogenesis, in: Baron, S. (Ed.), Medical Microbiology, 4th ed, Galveston (TX).

Barrington, R., Zhang, M., Fischer, M., Carroll, M.C., 2001. The role of complement in inflammation and adaptive immunity. Immunological reviews 180, 5-15.

Barry, G., Breakwell, L., Fragkoudis, R., Attarzadeh-Yazdi, G., Rodriguez-Andres, J., Kohl, A., Fazakerley, J.K., 2009. PKR acts early in infection to suppress Semliki Forest virus production and strongly enhances the type I interferon response. The Journal of general virology 90, 1382-1391.

Barry, G., Fragkoudis, R., Ferguson, M.C., Lulla, A., Merits, A., Kohl, A., Fazakerley, J.K., 2010. Semliki forest virus-induced endoplasmic reticulum stress accelerates apoptotic death of mammalian cells. Journal of virology 84, 7369-7377.

Benedict, C.A., Ware, C.F., 2005. RIGing a virus trap. Nature medicine 11, 929-930. Bevilacqua, P.C., Cech, T.R., 1996. Minor-groove recognition of double-stranded RNA by the double-stranded RNA-binding domain from the RNA-activated protein kinase PKR. Biochemistry 35, 9983-9994.

Bieback, K., Lien, E., Klagge, I.M., Avota, E., Schneider-Schaulies, J., Duprex, W.P., Wagner, H., Kirschning, C.J., Ter Meulen, V., Schneider-Schaulies, S., 2002. Hemagglutinin protein of wild-type measles virus activates toll-like receptor 2 signaling. Journal of virology 76, 8729-8736.

Biron, C.A., Brossay, L., 2001. NK cells and NKT cells in innate defense against viral infections. Current opinion in immunology 13, 458-464.

Black, B.L., Lyles, D.S., 1992. Vesicular stomatitis virus matrix protein inhibits host cell- directed transcription of target genes in vivo. Journal of virology 66, 4058-4064.

Bluyssen, H.A., Muzaffar, R., Vlieststra, R.J., van der Made, A.C., Leung, S., Stark, G.R., Kerr, I.M., Trapman, J., Levy, D.E., 1995. Combinatorial association and abundance of components of interferon-stimulated gene factor 3 dictate the selectivity of interferon responses. Proceedings of the National Academy of Sciences of the United States of America 92, 5645-5649.

Boehme, K.W., Guerrero, M., Compton, T., 2006. Human cytomegalovirus envelope glycoproteins B and H are necessary for TLR2 activation in permissive cells. Journal of immunology 177, 7094-7102.

Boyce, M., Bryant, K.F., Jousse, C., Long, K., Harding, H.P., Scheuner, D., Kaufman, R.J., Ma, D., Coen, D.M., Ron, D., Yuan, J., 2005. A selective inhibitor of eIF2alpha dephosphorylation protects cells from ER stress. Science 307, 935-939.

Brass, A.L., Huang, I.C., Benita, Y., John, S.P., Krishnan, M.N., Feeley, E.M., Ryan, B.J., Weyer, J.L., van der Weyden, L., Fikrig, E., Adams, D.J., Xavier, R.J., Farzan, M., Elledge, S.J., 2009. The IFITM proteins mediate cellular resistance to influenza A H1N1 virus, West Nile virus, and dengue virus. Cell 139, 1243-1254.

Budhu, A., Chen, Y., Kim, J.W., Forgues, M., Valerie, K., Harris, C.C., Wang, X.W., 2007. Induction of a unique gene expression profile in primary human hepatocytes by hepatitis C virus core, NS3 and NS5A proteins. Carcinogenesis 28, 1552-1560.

Burzyn, D., Rassa, J.C., Kim, D., Nepomnaschy, I., Ross, S.R., Piazzon, I., 2004. Toll- like receptor 4-dependent activation of dendritic cells by a retrovirus. Journal of virology 78, 576-584.

Campello, S., Scorrano, L., 2010. Mitochondrial shape changes: orchestrating cell pathophysiology. EMBO reports 11, 678-684.

Cardenas, W.B., Loo, Y.M., Gale, M., Jr., Hartman, A.L., Kimberlin, C.R., Martinez- Sobrido, L., Saphire, E.O., Basler, C.F., 2006. Ebola virus VP35 protein binds double- stranded RNA and inhibits alpha/beta interferon production induced by RIG-I signaling. Journal of virology 80, 5168-5178. 80

Chang, H.W., Jacobs, B.L., 1993. Identification of a conserved motif that is necessary for binding of the vaccinia virus E3L gene products to double-stranded RNA. Virology 194, 537-547.

Chattopadhyay, S., Yamashita, M., Zhang, Y., Sen, G.C., 2011. The IRF-3/Bax-mediated apoptotic pathway, activated by viral cytoplasmic RNA and DNA, inhibits virus replication. Journal of virology 85, 3708-3716.

Chawla-Sarkar, M., Lindner, D.J., Liu, Y.F., Williams, B.R., Sen, G.C., Silverman, R.H., Borden, E.C., 2003. Apoptosis and interferons: role of interferon-stimulated genes as mediators of apoptosis. Apoptosis : an international journal on programmed cell death 8, 237-249.

Chen, H., Chan, D.C., 2010. Physiological functions of mitochondrial fusion. Annals of the New York Academy of Sciences 1201, 21-25.

Chen, L., Willis, S.N., Wei, A., Smith, B.J., Fletcher, J.I., Hinds, M.G., Colman, P.M., Day, C.L., Adams, J.M., Huang, D.C., 2005. Differential targeting of prosurvival Bcl-2 proteins by their BH3-only ligands allows complementary apoptotic function. Molecular cell 17, 393-403.

Cheriyath, V., Glaser, K.B., Waring, J.F., Baz, R., Hussein, M.A., Borden, E.C., 2007. G1P3, an IFN-induced survival factor, antagonizes TRAIL-induced apoptosis in human myeloma cells. The Journal of clinical investigation 117, 3107-3117.

Coil, D.A., Miller, A.D., 2004. Phosphatidylserine is not the cell surface receptor for vesicular stomatitis virus. Journal of virology 78, 10920-10926.

Colamonici, O., Yan, H., Domanski, P., Handa, R., Smalley, D., Mullersman, J., Witte, M., Krishnan, K., Krolewski, J., 1994. Direct binding to and tyrosine phosphorylation of the alpha subunit of the type I interferon receptor by p135tyk2 tyrosine kinase. Molecular and cellular biology 14, 8133-8142.

Collins, S.E., Noyce, R.S., Mossman, K.L., 2004. Innate cellular response to virus particle entry requires IRF3 but not virus replication. Journal of virology 78, 1706-1717.

Compton, T., Kurt-Jones, E.A., Boehme, K.W., Belko, J., Latz, E., Golenbock, D.T., Finberg, R.W., 2003. Human cytomegalovirus activates inflammatory cytokine responses via CD14 and Toll-like receptor 2. Journal of virology 77, 4588-4596.

Constant, S.L., Bottomly, K., 1997. Induction of Th1 and Th2 CD4+ T cell responses: the alternative approaches. Annual review of immunology 15, 297-322.

Crotty, S., Ahmed, R., 2004. Immunological memory in humans. Seminars in immunology 16, 197-203. 81

Cureton, D.K., Massol, R.H., Saffarian, S., Kirchhausen, T.L., Whelan, S.P., 2009. Vesicular stomatitis virus enters cells through vesicles incompletely coated with clathrin that depend upon actin for internalization. PLoS pathogens 5, e1000394.

Darnell, J.E., Jr., Kerr, I.M., Stark, G.R., 1994. Jak-STAT pathways and transcriptional activation in response to IFNs and other extracellular signaling proteins. Science 264, 1415-1421.

Das, S.C., Nayak, D., Zhou, Y., Pattnaik, A.K., 2006. Visualization of intracellular transport of vesicular stomatitis virus nucleocapsids in living cells. Journal of virology 80, 6368-6377.

David, M., Chen, H.E., Goelz, S., Larner, A.C., Neel, B.G., 1995. Differential regulation of the alpha/beta interferon-stimulated Jak/Stat pathway by the SH2 domain-containing tyrosine phosphatase SHPTP1. Molecular and cellular biology 15, 7050-7058.

Der, S.D., Zhou, A., Williams, B.R., Silverman, R.H., 1998. Identification of genes differentially regulated by interferon alpha, beta, or gamma using oligonucleotide arrays. Proceedings of the National Academy of Sciences of the United States of America 95, 15623-15628.

Diaz-Guerra, M., Rivas, C., Esteban, M., 1997. Inducible expression of the 2-5A synthetase/RNase L system results in inhibition of vaccinia virus replication. Virology 227, 220-228.

Dolganiuc, A., Oak, S., Kodys, K., Golenbock, D.T., Finberg, R.W., Kurt-Jones, E., Szabo, G., 2004. Hepatitis C core and nonstructural 3 proteins trigger toll-like receptor 2- mediated pathways and inflammatory activation. Gastroenterology 127, 1513-1524.

Domanski, P., Witte, M., Kellum, M., Rubinstein, M., Hackett, R., Pitha, P., Colamonici, O.R., 1995. Cloning and expression of a long form of the beta subunit of the interferon alpha beta receptor that is required for signaling. The Journal of biological chemistry 270, 21606-21611.

Doms, R.W., Lamb, R.A., Rose, J.K., Helenius, A., 1993. Folding and assembly of viral membrane proteins. Virology 193, 545-562.

Dong, B., Zhou, Q., Zhao, J., Zhou, A., Harty, R.N., Bose, S., Banerjee, A., Slee, R., Guenther, J., Williams, B.R., Wiedmer, T., Sims, P.J., Silverman, R.H., 2004. Phospholipid scramblase 1 potentiates the antiviral activity of interferon. Journal of virology 78, 8983-8993.

Edelmann, K.H., Richardson-Burns, S., Alexopoulou, L., Tyler, K.L., Flavell, R.A., Oldstone, M.B., 2004. Does Toll-like receptor 3 play a biological role in virus infections? Virology 322, 231-238.

Epperson, D.E., Arnold, D., Spies, T., Cresswell, P., Pober, J.S., Johnson, D.R., 1992. Cytokines increase transporter in antigen processing-1 expression more rapidly than HLA class I expression in endothelial cells. Journal of immunology 149, 3297-3301.

Espert, L., Degols, G., Gongora, C., Blondel, D., Williams, B.R., Silverman, R.H., Mechti, N., 2003. ISG20, a new interferon-induced RNase specific for single-stranded RNA, defines an alternative antiviral pathway against RNA genomic viruses. The Journal of biological chemistry 278, 16151-16158.

Espert, L., Degols, G., Lin, Y.L., Vincent, T., Benkirane, M., Mechti, N., 2005. Interferon-induced exonuclease ISG20 exhibits an antiviral activity against human immunodeficiency virus type 1. The Journal of general virology 86, 2221-2229.

Faria, P.A., Chakraborty, P., Levay, A., Barber, G.N., Ezelle, H.J., Enninga, J., Arana, C., van Deursen, J., Fontoura, B.M., 2005. VSV disrupts the Rae1/mrnp41 mRNA nuclear export pathway. Molecular cell 17, 93-102.

Fearon, D.T., Locksley, R.M., 1996. The instructive role of innate immunity in the acquired immune response. Science 272, 50-53.

Fennell, D.A., Chacko, A., Mutti, L., 2008. BCL-2 family regulation by the 20S proteasome inhibitor bortezomib. Oncogene 27, 1189-1197.

Fensterl, V., Wetzel, J.L., Ramachandran, S., Ogino, T., Stohlman, S.A., Bergmann, C.C., Diamond, M.S., Virgin, H.W., Sen, G.C., 2012. Interferon-Induced Ifit2/ISG54 Protects Mice from Lethal VSV Neuropathogenesis. PLoS pathogens 8, e1002712.

Fernandez, Y., Miller, T.P., Denoyelle, C., Esteban, J.A., Tang, W.H., Bengston, A.L., Soengas, M.S., 2006. Chemical blockage of the proteasome inhibitory function of bortezomib: impact on tumor cell death. The Journal of biological chemistry 281, 1107- 1118.

Fernandez, Y., Verhaegen, M., Miller, T.P., Rush, J.L., Steiner, P., Opipari, A.W., Jr., Lowe, S.W., Soengas, M.S., 2005. Differential regulation of noxa in normal melanocytes and melanoma cells by proteasome inhibition: therapeutic implications. Cancer research 65, 6294-6304.

Ferraresi, R., Troiano, L., Rossi, D., Gualdi, E., Lugli, E., Mussini, C., Cossarizza, A., 2004. Mitochondrial membrane potential and nucleosidic inhibitors of HIV reverse transcriptase: a cytometric approach. Mitochondrion 4, 271-278.

Fields, B.N., 1983. How do viruses cause different diseases? JAMA : the journal of the American Medical Association 250, 1754-1756.

Fitzgerald, K.A., McWhirter, S.M., Faia, K.L., Rowe, D.C., Latz, E., Golenbock, D.T., Coyle, A.J., Liao, S.M., Maniatis, T., 2003. IKKepsilon and TBK1 are essential components of the IRF3 signaling pathway. Nature immunology 4, 491-496.

Flint, S.J., 2000. Principles of virology : molecular biology, pathogenesis, and control. ASM Press, Washington, D.C.

Forgac, M., 2007. Vacuolar ATPases: rotary proton pumps in physiology and pathophysiology. Nature reviews. Molecular cell biology 8, 917-929.

Fouchier, R.A., Kuiken, T., Schutten, M., van Amerongen, G., van Doornum, G.J., van den Hoogen, B.G., Peiris, M., Lim, W., Stohr, K., Osterhaus, A.D., 2003. Aetiology: Koch's postulates fulfilled for SARS virus. Nature 423, 240.

Foy, E., Li, K., Sumpter, R., Jr., Loo, Y.M., Johnson, C.L., Wang, C., Fish, P.M., Yoneyama, M., Fujita, T., Lemon, S.M., Gale, M., Jr., 2005. Control of antiviral defenses through hepatitis C virus disruption of retinoic acid-inducible gene-I signaling. Proceedings of the National Academy of Sciences of the United States of America 102, 2986-2991.

Fredericksen, B.L., Gale, M., Jr., 2006. West Nile virus evades activation of interferon regulatory factor 3 through RIG-I-dependent and -independent pathways without antagonizing host defense signaling. Journal of virology 80, 2913-2923.

Fridman, W.H., 1993. Regulation of B-cell activation and antigen presentation by Fc receptors. Current opinion in immunology 5, 355-360.

Fritsch, R.M., Schneider, G., Saur, D., Scheibel, M., Schmid, R.M., 2007. Translational repression of MCL-1 couples stress-induced eIF2 alpha phosphorylation to mitochondrial apoptosis initiation. The Journal of biological chemistry 282, 22551-22562.

Gack, M.U., Albrecht, R.A., Urano, T., Inn, K.S., Huang, I.C., Carnero, E., Farzan, M., Inoue, S., Jung, J.U., Garcia-Sastre, A., 2009. Influenza A virus NS1 targets the ubiquitin ligase TRIM25 to evade recognition by the host viral RNA sensor RIG-I. Cell host & microbe 5, 439-449.

Gack, M.U., Shin, Y.C., Joo, C.H., Urano, T., Liang, C., Sun, L., Takeuchi, O., Akira, S., Chen, Z., Inoue, S., Jung, J.U., 2007. TRIM25 RING-finger E3 ubiquitin ligase is essential for RIG-I-mediated antiviral activity. Nature 446, 916-920.

Gad, H.H., Dellgren, C., Hamming, O.J., Vends, S., Paludan, S.R., Hartmann, R., 2009. Interferon-lambda is functionally an interferon but structurally related to the interleukin- 10 family. The Journal of biological chemistry 284, 20869-20875.

Galabru, J., Hovanessian, A., 1987. Autophosphorylation of the protein kinase dependent on double-stranded RNA. The Journal of biological chemistry 262, 15538-15544.

Garcia-Sastre, A., Biron, C.A., 2006. Type 1 interferons and the virus-host relationship: a lesson in detente. Science 312, 879-882.

Garcia-Sastre, A., Egorov, A., Matassov, D., Brandt, S., Levy, D.E., Durbin, J.E., Palese, P., Muster, T., 1998. Influenza A virus lacking the NS1 gene replicates in interferon- deficient systems. Virology 252, 324-330.

Garry, R.F., Bostick, D.A., Ulug, E.T., 1986. Sindbis virus infection increases hexose transport in quiescent cells. Virology 155, 378-391.

Gauzzi, M.C., Velazquez, L., McKendry, R., Mogensen, K.E., Fellous, M., Pellegrini, S., 1996. Interferon-alpha-dependent activation of Tyk2 requires phosphorylation of positive regulatory tyrosines by another kinase. The Journal of biological chemistry 271, 20494- 20500.

George, C.X., Li, Z., Okonski, K.M., Toth, A.M., Wang, Y., Samuel, C.E., 2009. Tipping the balance: antagonism of PKR kinase and ADAR1 deaminase functions by virus gene products. Journal of interferon & cytokine research : the official journal of the International Society for Interferon and Cytokine Research 29, 477-487.

Gitlin, L., Barchet, W., Gilfillan, S., Cella, M., Beutler, B., Flavell, R.A., Diamond, M.S., Colonna, M., 2006. Essential role of mda-5 in type I IFN responses to polyriboinosinic:polyribocytidylic acid and encephalomyocarditis picornavirus. Proceedings of the National Academy of Sciences of the United States of America 103, 8459-8464.

Gjermandsen, I.M., Justesen, J., Martensen, P.M., 2000. The interferon-induced gene ISG12 is regulated by various cytokines as the gene 6-16 in human cell lines. Cytokine 12, 233-238.

Gomez-Bougie, P., Wuilleme-Toumi, S., Menoret, E., Trichet, V., Robillard, N., Philippe, M., Bataille, R., Amiot, M., 2007. Noxa up-regulation and Mcl-1 cleavage are associated to apoptosis induction by bortezomib in multiple myeloma. Cancer research 67, 5418-5424.

Goodbourn, S., Didcock, L., Randall, R.E., 2000. Interferons: cell signalling, immune modulation, antiviral response and virus countermeasures. The Journal of general virology 81, 2341-2364. 85

Goubau, D., Romieu-Mourez, R., Solis, M., Hernandez, E., Mesplede, T., Lin, R., Leaman, D., Hiscott, J., 2009. Transcriptional re-programming of primary macrophages reveals distinct apoptotic and anti-tumoral functions of IRF-3 and IRF-7. European journal of immunology 39, 527-540.

Gray, M.A., Micklem, K.J., Brown, F., Pasternak, C.A., 1983. Effect of vesicular stomatitis virus and Semliki Forest Virus on uptake of nutrients and intracellular cation concentration. The Journal of general virology 64 (Pt 7), 1449-1456.

Grivennikov, S.I., Greten, F.R., Karin, M., 2010. Immunity, inflammation, and cancer. Cell 140, 883-899.

Guillot, L., Le Goffic, R., Bloch, S., Escriou, N., Akira, S., Chignard, M., Si-Tahar, M., 2005. Involvement of toll-like receptor 3 in the immune response of lung epithelial cells to double-stranded RNA and influenza A virus. The Journal of biological chemistry 280, 5571-5580.

Hacker, H., Redecke, V., Blagoev, B., Kratchmarova, I., Hsu, L.C., Wang, G.G., Kamps, M.P., Raz, E., Wagner, H., Hacker, G., Mann, M., Karin, M., 2006. Specificity in Toll- like receptor signalling through distinct effector functions of TRAF3 and TRAF6. Nature 439, 204-207.

Haller, O., Arnheiter, H., Gresser, I., Lindenmann, J., 1979. Genetically determined, interferon-dependent resistance to influenza virus in mice. The Journal of experimental medicine 149, 601-612.

Haller, O., Kochs, G., 2002. Interferon-induced mx proteins: dynamin-like GTPases with antiviral activity. Traffic 3, 710-717.

Haller, O., Staeheli, P., Kochs, G., 2007. Interferon-induced Mx proteins in antiviral host defense. Biochimie 89, 812-818.

Haller, O., Stertz, S., Kochs, G., 2007. The Mx GTPase family of interferon-induced antiviral proteins. Microbes and infection / Institut Pasteur 9, 1636-1643.

Harding, H.P., Calfon, M., Urano, F., Novoa, I., Ron, D., 2002. Transcriptional and translational control in the Mammalian unfolded protein response. Annual review of cell and developmental biology 18, 575-599.

Harton, J.A., Linhoff, M.W., Zhang, J., Ting, J.P., 2002. Cutting edge: CATERPILLER: a large family of mammalian genes containing CARD, pyrin, nucleotide-binding, and leucine-rich repeat domains. Journal of immunology 169, 4088-4093.

Hassan, M., Alaoui, A., Feyen, O., Mirmohammadsadegh, A., Essmann, F., Tannapfel, A., Gulbins, E., Schulze-Osthoff, K., Hengge, U.R., 2008. The BH3-only member Noxa causes apoptosis in melanoma cells by multiple pathways. Oncogene 27, 4557-4568.

He, B., 2006. Viruses, endoplasmic reticulum stress, and interferon responses. Cell death and differentiation 13, 393-403.

Hefti, H.P., Frese, M., Landis, H., Di Paolo, C., Aguzzi, A., Haller, O., Pavlovic, J., 1999. Human MxA protein protects mice lacking a functional alpha/beta interferon system against La crosse virus and other lethal viral infections. Journal of virology 73, 6984- 6991.

Heil, F., Hemmi, H., Hochrein, H., Ampenberger, F., Kirschning, C., Akira, S., Lipford, G., Wagner, H., Bauer, S., 2004. Species-specific recognition of single-stranded RNA via toll-like receptor 7 and 8. Science 303, 1526-1529.

Helbig, K.J., Eyre, N.S., Yip, E., Narayana, S., Li, K., Fiches, G., McCartney, E.M., Jangra, R.K., Lemon, S.M., Beard, M.R., 2011. The antiviral protein viperin inhibits hepatitis C virus replication via interaction with nonstructural protein 5A. Hepatology 54, 1506-1517.

Hewson, C.A., Jardine, A., Edwards, M.R., Laza-Stanca, V., Johnston, S.L., 2005. Toll- like receptor 3 is induced by and mediates antiviral activity against rhinovirus infection of human bronchial epithelial cells. Journal of virology 79, 12273-12279.

Hoebee, B., Rietveld, E., Bont, L., Oosten, M., Hodemaekers, H.M., Nagelkerke, N.J., Neijens, H.J., Kimpen, J.L., Kimman, T.G., 2003. Association of severe respiratory syncytial virus bronchiolitis with interleukin-4 and interleukin-4 receptor alpha polymorphisms. The Journal of infectious diseases 187, 2-11.

Honda, K., Yanai, H., Negishi, H., Asagiri, M., Sato, M., Mizutani, T., Shimada, N., Ohba, Y., Takaoka, A., Yoshida, N., Taniguchi, T., 2005. IRF-7 is the master regulator of type-I interferon-dependent immune responses. Nature 434, 772-777.

Hornung, B., Amtmann, E., Sauer, G., 1994. Lauric acid inhibits the maturation of vesicular stomatitis virus. The Journal of general virology 75 ( Pt 2), 353-361.

Hornung, V., Ellegast, J., Kim, S., Brzozka, K., Jung, A., Kato, H., Poeck, H., Akira, S., Conzelmann, K.K., Schlee, M., Endres, S., Hartmann, G., 2006. 5'-Triphosphate RNA is the ligand for RIG-I. Science 314, 994-997.

Horvath, C.M., 2004. Silencing STATs: lessons from paramyxovirus interferon evasion. Cytokine & growth factor reviews 15, 117-127.

Hovanessian, A.G., 2007. On the discovery of interferon-inducible, double-stranded RNA activated enzymes: the 2'-5'oligoadenylate synthetases and the protein kinase PKR. Cytokine & growth factor reviews 18, 351-361.

Huang, I.C., Bailey, C.C., Weyer, J.L., Radoshitzky, S.R., Becker, M.M., Chiang, J.J., Brass, A.L., Ahmed, A.A., Chi, X., Dong, L., Longobardi, L.E., Boltz, D., Kuhn, J.H., Elledge, S.J., Bavari, S., Denison, M.R., Choe, H., Farzan, M., 2011. Distinct patterns of IFITM-mediated restriction of filoviruses, SARS coronavirus, and influenza A virus. PLoS pathogens 7, e1001258.

Imani, F., Jacobs, B.L., 1988. Inhibitory activity for the interferon-induced protein kinase is associated with the reovirus serotype 1 sigma 3 protein. Proceedings of the National Academy of Sciences of the United States of America 85, 7887-7891.

Indraccolo, S., 2010. Interferon-alpha as angiogenesis inhibitor: learning from tumor models. Autoimmunity 43, 244-247.

Inohara, N., Nunez, G., 2001. The NOD: a signaling module that regulates apoptosis and host defense against pathogens. Oncogene 20, 6473-6481.

Isaacs, A., Lindenmann, J., 1957. Virus interference. I. The interferon. Proceedings of the Royal Society of London. Series B, Containing papers of a Biological character. Royal Society 147, 258-267.

Itsui, Y., Sakamoto, N., Kakinuma, S., Nakagawa, M., Sekine-Osajima, Y., Tasaka- Fujita, M., Nishimura-Sakurai, Y., Suda, G., Karakama, Y., Mishima, K., Yamamoto, M., Watanabe, T., Ueyama, M., Funaoka, Y., Azuma, S., Watanabe, M., 2009. Antiviral effects of the interferon-induced protein guanylate binding protein 1 and its interaction with the hepatitis C virus NS5B protein. Hepatology 50, 1727-1737.

Iverson, L.E., Rose, J.K., 1981. Localized attenuation and discontinuous synthesis during vesicular stomatitis virus transcription. Cell 23, 477-484.

Iverson, L.E., Rose, J.K., 1982. Sequential synthesis of 5'-proximal vesicular stomatitis virus mRNA sequences. Journal of virology 44, 356-365.

Iwasaki, A., Medzhitov, R., 2004. Toll-like receptor control of the adaptive immune responses. Nature immunology 5, 987-995.

Janeway, C.A., Jr., Medzhitov, R., 2002. Innate immune recognition. Annual review of immunology 20, 197-216.

Jiang, C.C., Lucas, K., Avery-Kiejda, K.A., Wade, M., deBock, C.E., Thorne, R.F., Allen, J., Hersey, P., Zhang, X.D., 2008. Up-regulation of Mcl-1 is critical for survival of

human melanoma cells upon endoplasmic reticulum stress. Cancer research 68, 6708- 6717.

Jullig, M., Zhang, W.V., Ferreira, A., Stott, N.S., 2006. MG132 induced apoptosis is associated with p53-independent induction of pro-apoptotic Noxa and transcriptional activity of beta-catenin. Apoptosis : an international journal on programmed cell death 11, 627-641.

Kadowaki, N., Antonenko, S., Lau, J.Y., Liu, Y.J., 2000. Natural interferon alpha/beta- producing cells link innate and adaptive immunity. The Journal of experimental medicine 192, 219-226.

Kanneganti, T.D., Ozoren, N., Body-Malapel, M., Amer, A., Park, J.H., Franchi, L., Whitfield, J., Barchet, W., Colonna, M., Vandenabeele, P., Bertin, J., Coyle, A., Grant, E.P., Akira, S., Nunez, G., 2006. Bacterial RNA and small antiviral compounds activate caspase-1 through cryopyrin/Nalp3. Nature 440, 233-236.

Kato, H., Sato, S., Yoneyama, M., Yamamoto, M., Uematsu, S., Matsui, K., Tsujimura, T., Takeda, K., Fujita, T., Takeuchi, O., Akira, S., 2005. Cell type-specific involvement of RIG-I in antiviral response. Immunity 23, 19-28.

Kato, H., Takeuchi, O., Sato, S., Yoneyama, M., Yamamoto, M., Matsui, K., Uematsu, S., Jung, A., Kawai, T., Ishii, K.J., Yamaguchi, O., Otsu, K., Tsujimura, T., Koh, C.S., Reis e Sousa, C., Matsuura, Y., Fujita, T., Akira, S., 2006. Differential roles of MDA5 and RIG-I helicases in the recognition of RNA viruses. Nature 441, 101-105.

Kaufman, R.J., 2002. Orchestrating the unfolded protein response in health and disease. The Journal of clinical investigation 110, 1389-1398.

Kawai, T., Akira, S., 2009. The roles of TLRs, RLRs and NLRs in pathogen recognition. International immunology 21, 317-337.

Kawai, T., Takahashi, K., Sato, S., Coban, C., Kumar, H., Kato, H., Ishii, K.J., Takeuchi, O., Akira, S., 2005. IPS-1, an adaptor triggering RIG-I- and Mda5-mediated type I interferon induction. Nature immunology 6, 981-988.

Kelly, J.M., Gilbert, C.S., Stark, G.R., Kerr, I.M., 1985. Differential regulation of interferon-induced mRNAs and c-myc mRNA by alpha- and gamma-interferons. European journal of biochemistry / FEBS 153, 367-371.

Kim, J.Y., Ahn, H.J., Ryu, J.H., Suk, K., Park, J.H., 2004. BH3-only protein Noxa is a mediator of hypoxic cell death induced by hypoxia-inducible factor 1alpha. The Journal of experimental medicine 199, 113-124.

Kohlhuber, F., Rogers, N.C., Watling, D., Feng, J., Guschin, D., Briscoe, J., Witthuhn, B.A., Kotenko, S.V., Pestka, S., Stark, G.R., Ihle, J.N., Kerr, I.M., 1997. A JAK1/JAK2 chimera can sustain alpha and gamma interferon responses. Molecular and cellular biology 17, 695-706.

Kopecky, S.A., Lyles, D.S., 2003. Contrasting effects of matrix protein on apoptosis in HeLa and BHK cells infected with vesicular stomatitis virus are due to inhibition of host gene expression. Journal of virology 77, 4658-4669.

Kotenko, S.V., Gallagher, G., Baurin, V.V., Lewis-Antes, A., Shen, M., Shah, N.K., Langer, J.A., Sheikh, F., Dickensheets, H., Donnelly, R.P., 2003. IFN-lambdas mediate antiviral protection through a distinct class II cytokine receptor complex. Nature immunology 4, 69-77.

Krishnan, K., Yan, H., Lim, J.T., Krolewski, J.J., 1996. Dimerization of a chimeric CD4- interferon-alpha receptor reconstitutes the signaling events preceding STAT phosphorylation. Oncogene 13, 125-133.

Kubota, K., Nakahara, K., Ohtsuka, T., Yoshida, S., Kawaguchi, J., Fujita, Y., Ozeki, Y., Hara, A., Yoshimura, C., Furukawa, H., Haruyama, H., Ichikawa, K., Yamashita, M., Matsuoka, T., Iijima, Y., 2004. Identification of 2'-phosphodiesterase, which plays a role in the 2-5A system regulated by interferon. The Journal of biological chemistry 279, 37832-37841.

Kuroda, J., Yamamoto, M., Nagoshi, H., Kobayashi, T., Sasaki, N., Shimura, Y., Horiike, S., Kimura, S., Yamauchi, A., Hirashima, M., Taniwaki, M., 2010. Targeting activating transcription factor 3 by Galectin-9 induces apoptosis and overcomes various types of treatment resistance in chronic myelogenous leukemia. Molecular cancer research : MCR 8, 994-1001.

Kurt-Jones, E.A., Chan, M., Zhou, S., Wang, J., Reed, G., Bronson, R., Arnold, M.M., Knipe, D.M., Finberg, R.W., 2004. Herpes simplex virus 1 interaction with Toll-like receptor 2 contributes to lethal encephalitis. Proceedings of the National Academy of Sciences of the United States of America 101, 1315-1320.

Kurt-Jones, E.A., Popova, L., Kwinn, L., Haynes, L.M., Jones, L.P., Tripp, R.A., Walsh, E.E., Freeman, M.W., Golenbock, D.T., Anderson, L.J., Finberg, R.W., 2000. Pattern recognition receptors TLR4 and CD14 mediate response to respiratory syncytial virus. Nature immunology 1, 398-401.

Labrada, L., Liang, X.H., Zheng, W., Johnston, C., Levine, B., 2002. Age-dependent resistance to lethal alphavirus encephalitis in mice: analysis of gene expression in the central nervous system and identification of a novel interferon-inducible protective gene, mouse ISG12. Journal of virology 76, 11688-11703. 90

Lallemand, C., Blanchard, B., Palmieri, M., Lebon, P., May, E., Tovey, M.G., 2007. Single-stranded RNA viruses inactivate the transcriptional activity of p53 but induce NOXA-dependent apoptosis via post-translational modifications of IRF-1, IRF-3 and CREB. Oncogene 26, 328-338.

Leaman, D.W., Chawla-Sarkar, M., Jacobs, B., Vyas, K., Sun, Y., Ozdemir, A., Yi, T., Williams, B.R., Borden, E.C., 2003. Novel growth and death related interferon- stimulated genes (ISGs) in melanoma: greater potency of IFN-beta compared with IFN- alpha2. Journal of interferon & cytokine research : the official journal of the International Society for Interferon and Cytokine Research 23, 745-756.

Leaman, D.W., Leung, S., Li, X., Stark, G.R., 1996. Regulation of STAT-dependent pathways by growth factors and cytokines. FASEB journal : official publication of the Federation of American Societies for Experimental Biology 10, 1578-1588.

Leaman DW, Rosebeck S, Borden EC (2005) Biological and clinical properties of type I interferons. In: Disis ML (ed) Immunotherapy of Cancer. Humana Press, pp 365–396

Le Blanc, I., Luyet, P.P., Pons, V., Ferguson, C., Emans, N., Petiot, A., Mayran, N., Demaurex, N., Faure, J., Sadoul, R., Parton, R.G., Gruenberg, J., 2005. Endosome-to- cytosol transport of viral nucleocapsids. Nature cell biology 7, 653-664.

Lee, A.H., Iwakoshi, N.N., Anderson, K.C., Glimcher, L.H., 2003. Proteasome inhibitors disrupt the unfolded protein response in myeloma cells. Proceedings of the National Academy of Sciences of the United States of America 100, 9946-9951.

Lemaitre, B., Nicolas, E., Michaut, L., Reichhart, J.M., Hoffmann, J.A., 1996. The dorsoventral regulatory gene cassette spatzle/Toll/cactus controls the potent antifungal response in Drosophila adults. Cell 86, 973-983.

Le Page, C., Genin, P., Baines, M.G., Hiscott, J., 2000. Interferon activation and innate immunity. Reviews in immunogenetics 2, 374-386.

Levy, D.E., Garcia-Sastre, A., 2001. The virus battles: IFN induction of the antiviral state and mechanisms of viral evasion. Cytokine & growth factor reviews 12, 143-156.

Levy, D.E., Marie, I., Smith, E., Prakash, A., 2002. Enhancement and diversification of IFN induction by IRF-7-mediated positive feedback. Journal of interferon & cytokine research : the official journal of the International Society for Interferon and Cytokine Research 22, 87-93.

Li, B., Shin, J., Lee, K., 2009. Interferon-stimulated gene ISG12b1 inhibits adipogenic differentiation and mitochondrial biogenesis in 3T3-L1 cells. Endocrinology 150, 1217- 1224. 91

Li, J., Lee, B., Lee, A.S., 2006. Endoplasmic reticulum stress-induced apoptosis: multiple pathways and activation of p53-up-regulated modulator of apoptosis (PUMA) and NOXA by p53. The Journal of biological chemistry 281, 7260-7270.

Li, X.D., Sun, L., Seth, R.B., Pineda, G., Chen, Z.J., 2005. Hepatitis C virus protease NS3/4A cleaves mitochondrial antiviral signaling protein off the mitochondria to evade innate immunity. Proceedings of the National Academy of Sciences of the United States of America 102, 17717-17722.

Lichty, B.D., McBride, H., Hanson, S., Bell, J.C., 2006. Matrix protein of Vesicular stomatitis virus harbours a cryptic mitochondrial-targeting motif. The Journal of general virology 87, 3379-3384.

Lindahl, P., Gresser, I., Leary, P., Tovey, M., 1976. Interferon treatment of mice: enhanced expression of histocompatibility antigens on lymphoid cells. Proceedings of the National Academy of Sciences of the United States of America 73, 1284-1287.

Liu, Y.J., Zhang, J., Lane, P.J., Chan, E.Y., MacLennan, I.C., 1991. Sites of specific B cell activation in primary and secondary responses to T cell-dependent and T cell- independent antigens. European journal of immunology 21, 2951-2962.

Lu, M.Y., Liao, F., 2011. Interferon-stimulated gene ISG12b2 is localized to the inner mitochondrial membrane and mediates virus-induced cell death. Cell death and differentiation 18, 925-936.

Lund, J., Sato, A., Akira, S., Medzhitov, R., Iwasaki, A., 2003. Toll-like receptor 9- mediated recognition of Herpes simplex virus-2 by plasmacytoid dendritic cells. The Journal of experimental medicine 198, 513-520.

Lund, J.M., Alexopoulou, L., Sato, A., Karow, M., Adams, N.C., Gale, N.W., Iwasaki, A., Flavell, R.A., 2004. Recognition of single-stranded RNA viruses by Toll-like receptor 7. Proceedings of the National Academy of Sciences of the United States of America 101, 5598-5603.

Maheshwari, R.K., Sidhu, G.S., Bhartiya, D., Friedman, R.M., 1991. Primary amines enhance the antiviral activity of interferon against a membrane virus: role of intracellular pH. The Journal of general virology 72 ( Pt 9), 2143-2152.

Malakhova, O.A., Kim, K.I., Luo, J.K., Zou, W., Kumar, K.G., Fuchs, S.Y., Shuai, K., Zhang, D.E., 2006. UBP43 is a novel regulator of interferon signaling independent of its ISG15 isopeptidase activity. The EMBO journal 25, 2358-2367.

Malathi, K., Dong, B., Gale, M., Jr., Silverman, R.H., 2007. Small self-RNA generated by RNase L amplifies antiviral innate immunity. Nature 448, 816-819. 92

Marie, I., Durbin, J.E., Levy, D.E., 1998. Differential viral induction of distinct interferon-alpha genes by positive feedback through interferon regulatory factor-7. The EMBO journal 17, 6660-6669.

Martensen, P.M., Sogaard, T.M., Gjermandsen, I.M., Buttenschon, H.N., Rossing, A.B., Bonnevie-Nielsen, V., Rosada, C., Simonsen, J.L., Justesen, J., 2001. The interferon alpha induced protein ISG12 is localized to the nuclear membrane. European journal of biochemistry / FEBS 268, 5947-5954.

Matsuyama, T., Kimura, T., Kitagawa, M., Pfeffer, K., Kawakami, T., Watanabe, N., Kundig, T.M., Amakawa, R., Kishihara, K., Wakeham, A., et al., 1993. Targeted disruption of IRF-1 or IRF-2 results in abnormal type I IFN gene induction and aberrant lymphocyte development. Cell 75, 83-97.

Maynard, N.D., Gutschow, M.V., Birch, E.W., Covert, M.W., 2010. The virus as metabolic engineer. Biotechnology journal 5, 686-694.

McGettrick, A.F., O'Neill, L.A., 2004. The expanding family of MyD88-like adaptors in Toll-like receptor signal transduction. Molecular immunology 41, 577-582.

Medigeshi, G.R., Lancaster, A.M., Hirsch, A.J., Briese, T., Lipkin, W.I., Defilippis, V., Fruh, K., Mason, P.W., Nikolich-Zugich, J., Nelson, J.A., 2007. West Nile virus infection activates the unfolded protein response, leading to CHOP induction and apoptosis. Journal of virology 81, 10849-10860.

Medzhitov, R., Janeway, C.A., Jr., 1998. Innate immune recognition and control of adaptive immune responses. Seminars in immunology 10, 351-353.

Medzhitov, R., Janeway, C., Jr., 2000. Innate immune recognition: mechanisms and pathways. Immunological reviews 173, 89-97.

Meylan, E., Curran, J., Hofmann, K., Moradpour, D., Binder, M., Bartenschlager, R., Tschopp, J., 2005. Cardif is an adaptor protein in the RIG-I antiviral pathway and is targeted by hepatitis C virus. Nature 437, 1167-1172.

Morisato, D., Anderson, K.V., 1994. The spatzle gene encodes a component of the extracellular signaling pathway establishing the dorsal-ventral pattern of the Drosophila embryo. Cell 76, 677-688.

Muller, M., Briscoe, J., Laxton, C., Guschin, D., Ziemiecki, A., Silvennoinen, O., Harpur, A.G., Barbieri, G., Witthuhn, B.A., Schindler, C., et al., 1993. The protein tyrosine kinase JAK1 complements defects in interferon-alpha/beta and -gamma signal transduction. Nature 366, 129-135.

Nikiforov, M.A., Riblett, M., Tang, W.H., Gratchouck, V., Zhuang, D., Fernandez, Y., Verhaegen, M., Varambally, S., Chinnaiyan, A.M., Jakubowiak, A.J., Soengas, M.S., 2007. Tumor cell-selective regulation of NOXA by c-MYC in response to proteasome inhibition. Proceedings of the National Academy of Sciences of the United States of America 104, 19488-19493.

Nilsen, T.W., Maroney, P.A., Baglioni, C., 1982. Synthesis of (2'-5')oligoadenylate and activation of an endoribonuclease in interferon-treated HeLa cells infected with reovirus. Journal of virology 42, 1039-1045.

Novick, D., Cohen, B., Rubinstein, M., 1994. The human interferon alpha/beta receptor: characterization and molecular cloning. Cell 77, 391-400.

Oda, E., Ohki, R., Murasawa, H., Nemoto, J., Shibue, T., Yamashita, T., Tokino, T., Taniguchi, T., Tanaka, N., 2000. Noxa, a BH3-only member of the Bcl-2 family and candidate mediator of p53-induced apoptosis. Science 288, 1053-1058.

Ohgaki, S., Iida, K., Yokoo, T., Watanabe, K., Kihara, R., Suzuki, H., Shimano, H., Toyoshima, H., Yamada, N., 2007. Identification of ISG12b as a putative interferon- inducible adipocytokine which is highly expressed in white adipose tissue. Journal of atherosclerosis and thrombosis 14, 179-184.

Olejniczak, S.H., Blickwedehl, J., Belicha-Villanueva, A., Bangia, N., Riaz, W., Mavis, C., Clements, J.L., Gibbs, J., Hernandez-Ilizaliturri, F.J., Czuczman, M.S., 2010. Distinct molecular mechanisms responsible for bortezomib-induced death of therapy-resistant versus -sensitive B-NHL cells. Blood 116, 5605-5614.

Otsuka, M., Kato, N., Moriyama, M., Taniguchi, H., Wang, Y., Dharel, N., Kawabe, T., Omata, M., 2005. Interaction between the HCV NS3 protein and the host TBK1 protein leads to inhibition of cellular antiviral responses. Hepatology 41, 1004-1012.

Palese, P., 2004. Influenza: old and new threats. Nature medicine 10, S82-87.

Papac-Milicevic, N., Breuss, J.M., Zaujec, J., Ryban, L., Plyushch, T., Wagner, G.A., Fenzl, S., Dremsek, P., Cabaravdic, M., Steiner, M., Glass, C.K., Binder, C.J., Uhrin, P., Binder, B.R., 2012. The interferon stimulated gene 12 inactivates vasculoprotective functions of NR4A nuclear receptors. Circulation research 110, e50-63.

Parker, N., Porter, A.C., 2004. Identification of a novel gene family that includes the interferon-inducible human genes 6-16 and ISG12. BMC genomics 5, 8. Pearce, A.F., Lyles, D.S., 2009. Vesicular stomatitis virus induces apoptosis primarily through Bak rather than Bax by inactivating Mcl-1 and Bcl-XL. Journal of virology 83, 9102-9112.

Perez-Galan, P., Roue, G., Villamor, N., Montserrat, E., Campo, E., Colomer, D., 2006. The proteasome inhibitor bortezomib induces apoptosis in mantle-cell lymphoma through generation of ROS and Noxa activation independent of p53 status. Blood 107, 257-264.

Perfettini, J.L., Roumier, T., Castedo, M., Larochette, N., Boya, P., Raynal, B., Lazar, V., Ciccosanti, F., Nardacci, R., Penninger, J., Piacentini, M., Kroemer, G., 2004. NF- kappaB and p53 are the dominant apoptosis-inducing transcription factors elicited by the HIV-1 envelope. The Journal of experimental medicine 199, 629-640.

Pestka, S., Krause, C.D., Walter, M.R., 2004. Interferons, interferon-like cytokines, and their receptors. Immunological reviews 202, 8-32.

Petersen, J.M., Her, L.S., Dahlberg, J.E., 2001. Multiple vesiculoviral matrix proteins inhibit both nuclear export and import. Proceedings of the National Academy of Sciences of the United States of America 98, 8590-8595.

Petersen, L.R., Marfin, A.A., 2005. Shifting epidemiology of Flaviviridae. Journal of travel medicine 12 Suppl 1, S3-11.

Ploner, C., Kofler, R., Villunger, A., 2008. Noxa: at the tip of the balance between life and death. Oncogene 27 Suppl 1, S84-92.

Plumet, S., Herschke, F., Bourhis, J.M., Valentin, H., Longhi, S., Gerlier, D., 2007. Cytosolic 5'-triphosphate ended viral leader transcript of measles virus as activator of the RIG I-mediated interferon response. PloS one 2, e279.

Puthalakath, H., O'Reilly, L.A., Gunn, P., Lee, L., Kelly, P.N., Huntington, N.D., Hughes, P.D., Michalak, E.M., McKimm-Breschkin, J., Motoyama, N., Gotoh, T., Akira, S., Bouillet, P., Strasser, A., 2007. ER stress triggers apoptosis by activating BH3-only protein Bim. Cell 129, 1337-1349.

Qanungo, K.R., Shaji, D., Mathur, M., Banerjee, A.K., 2004. Two RNA polymerase complexes from vesicular stomatitis virus-infected cells that carry out transcription and replication of genome RNA. Proceedings of the National Academy of Sciences of the United States of America 101, 5952-5957.

Rasmussen, U.B., Wolf, C., Mattei, M.G., Chenard, M.P., Bellocq, J.P., Chambon, P., Rio, M.C., Basset, P., 1993. Identification of a new interferon-alpha-inducible gene (p27) on human chromosome 14q32 and its expression in breast carcinoma. Cancer research 53, 4096-4101.

Rassa, J.C., Ross, S.R., 2003. Viruses and Toll-like receptors. Microbes and infection / Institut Pasteur 5, 961-968.

Reis, L.F., Ruffner, H., Stark, G., Aguet, M., Weissmann, C., 1994. Mice devoid of interferon regulatory factor 1 (IRF-1) show normal expression of type I interferon genes. The EMBO journal 13, 4798-4806.

Ri, M., Iida, S., Nakashima, T., Miyazaki, H., Mori, F., Ito, A., Inagaki, A., Kusumoto, S., Ishida, T., Komatsu, H., Shiotsu, Y., Ueda, R., 2010. Bortezomib-resistant myeloma cell lines: a role for mutated PSMB5 in preventing the accumulation of unfolded proteins and fatal ER stress. Leukemia : official journal of the Leukemia Society of America, Leukemia Research Fund, U.K 24, 1506-1512.

Roberts, R.M., Liu, L., Guo, Q., Leaman, D., Bixby, J., 1998. The evolution of the type I interferons. Journal of interferon & cytokine research : the official journal of the International Society for Interferon and Cytokine Research 18, 805-816.

Robison, C.S., Whitt, M.A., 2000. The membrane-proximal stem region of vesicular stomatitis virus G protein confers efficient virus assembly. Journal of virology 74, 2239- 2246.

Rodriguez, L.L., 2002. Emergence and re-emergence of vesicular stomatitis in the United States. Virus research 85, 211-219.

Rosebeck, S., Leaman, D.W., 2008. Mitochondrial localization and pro-apoptotic effects of the interferon-inducible protein ISG12a. Apoptosis : an international journal on programmed cell death 13, 562-572.

Rudd, B.D., Burstein, E., Duckett, C.S., Li, X., Lukacs, N.W., 2005. Differential role for TLR3 in respiratory syncytial virus-induced chemokine expression. Journal of virology 79, 3350-3357.

Sadler, A.J., Williams, B.R., 2008. Interferon-inducible antiviral effectors. Nature reviews. Immunology 8, 559-568.

Saito, T., Hirai, R., Loo, Y.M., Owen, D., Johnson, C.L., Sinha, S.C., Akira, S., Fujita, T., Gale, M., Jr., 2007. Regulation of innate antiviral defenses through a shared repressor domain in RIG-I and LGP2. Proceedings of the National Academy of Sciences of the United States of America 104, 582-587.

Sato, M., Suemori, H., Hata, N., Asagiri, M., Ogasawara, K., Nakao, K., Nakaya, T., Katsuki, M., Noguchi, S., Tanaka, N., Taniguchi, T., 2000. Distinct and essential roles of transcription factors IRF-3 and IRF-7 in response to viruses for IFN-alpha/beta gene induction. Immunity 13, 539-548.

Sato, M., Tanaka, N., Hata, N., Oda, E., Taniguchi, T., 1998. Involvement of the IRF family transcription factor IRF-3 in virus-induced activation of the IFN-beta gene. FEBS letters 425, 112-116. 96

Schlegel, R., Tralka, T.S., Willingham, M.C., Pastan, I., 1983. Inhibition of VSV binding and infectivity by phosphatidylserine: is phosphatidylserine a VSV-binding site? Cell 32, 639-646.

Schoggins, J.W., Wilson, S.J., Panis, M., Murphy, M.Y., Jones, C.T., Bieniasz, P., Rice, C.M., 2011. A diverse range of gene products are effectors of the type I interferon antiviral response. Nature 472, 481-485.

Seo, Y.W., Shin, J.N., Ko, K.H., Cha, J.H., Park, J.Y., Lee, B.R., Yun, C.W., Kim, Y.M., Seol, D.W., Kim, D.W., Yin, X.M., Kim, T.H., 2003. The molecular mechanism of Noxa-induced mitochondrial dysfunction in p53-mediated cell death. The Journal of biological chemistry 278, 48292-48299.

Seth, R.B., Sun, L., Ea, C.K., Chen, Z.J., 2005. Identification and characterization of MAVS, a mitochondrial antiviral signaling protein that activates NF-kappaB and IRF 3. Cell 122, 669-682.

Shibue, T., Takeda, K., Oda, E., Tanaka, H., Murasawa, H., Takaoka, A., Morishita, Y., Akira, S., Taniguchi, T., Tanaka, N., 2003. Integral role of Noxa in p53-mediated apoptotic response. Genes & development 17, 2233-2238.

Sidhu, G.S., Singh, A.K., Sundarrajan, R.N., Sundar, S.V., Maheshwari, R.K., 1999. Role of vacuolar H(+)-ATPase in interferon-induced inhibition of viral glycoprotein transport. Journal of interferon & cytokine research : the official journal of the International Society for Interferon and Cytokine Research 19, 1297-1303.

Siegal, F.P., Kadowaki, N., Shodell, M., Fitzgerald-Bocarsly, P.A., Shah, K., Ho, S., Antonenko, S., Liu, Y.J., 1999. The nature of the principal type 1 interferon-producing cells in human blood. Science 284, 1835-1837.

Silva da Costa, L., Pereira da Silva, A.P., Da Poian, A.T., El-Bacha, T., 2012. Mitochondrial bioenergetic alterations in mouse neuroblastoma cells infected with Sindbis virus: implications to viral replication and neuronal death. PloS one 7, e33871.

Silverman, R.H., 1994. Fascination with 2-5A-dependent RNase: a unique enzyme that functions in interferon action. Journal of interferon research 14, 101-104.

Silverman, R.H., 2007. Viral encounters with 2',5'-oligoadenylate synthetase and RNase L during the interferon antiviral response. Journal of virology 81, 12720-12729.

Simmonds, P., 2001. Reconstructing the origins of human hepatitis viruses. Philosophical transactions of the Royal Society of London. Series B, Biological sciences 356, 1013- 1026. 97

Smidt, K.C., Hansen, L.L., Sogaard, T.M., Petersen, L.K., Knudsen, U.B., Martensen, P.M., 2003. A nine-nucleotide deletion and splice variation in the coding region of the interferon induced ISG12 gene. Biochimica et biophysica acta 1638, 227-234.

Spiro, M.J., Spiro, R.G., 2001. Release of polymannose oligosaccharides from vesicular stomatitis virus G protein during endoplasmic reticulum-associated degradation. Glycobiology 11, 803-811.

Stark, G.R., Kerr, I.M., Williams, B.R., Silverman, R.H., Schreiber, R.D., 1998. How cells respond to interferons. Annual review of biochemistry 67, 227-264. Stewart, M.J., Blum, M.A., Sherry, B., 2003. PKR's protective role in viral myocarditis. Virology 314, 92-100.

Stillman, E.A., Whitt, M.A., 1997. Mutational analyses of the intergenic dinucleotide and the transcriptional start sequence of vesicular stomatitis virus (VSV) define sequences required for efficient termination and initiation of VSV transcripts. Journal of virology 71, 2127-2137.

Stojdl, D.F., Abraham, N., Knowles, S., Marius, R., Brasey, A., Lichty, B.D., Brown, E.G., Sonenberg, N., Bell, J.C., 2000. The murine double-stranded RNA-dependent protein kinase PKR is required for resistance to vesicular stomatitis virus. Journal of virology 74, 9580-9585.

Sumpter, R., Jr., Loo, Y.M., Foy, E., Li, K., Yoneyama, M., Fujita, T., Lemon, S.M., Gale, M., Jr., 2005. Regulating intracellular antiviral defense and permissiveness to hepatitis C virus RNA replication through a cellular RNA helicase, RIG-I. Journal of virology 79, 2689-2699.

Sun, Y., Leaman, D.W., 2005. Involvement of Noxa in cellular apoptotic responses to interferon, double-stranded RNA, and virus infection. The Journal of biological chemistry 280, 15561-15568.

Sun, Q., Sun, L., Liu, H.H., Chen, X., Seth, R.B., Forman, J., Chen, Z.J., 2006. The specific and essential role of MAVS in antiviral innate immune responses. Immunity 24, 633-642.

Szegezdi, E., Logue, S.E., Gorman, A.M., Samali, A., 2006. Mediators of endoplasmic reticulum stress-induced apoptosis. EMBO reports 7, 880-885.

Tabeta, K., Georgel, P., Janssen, E., Du, X., Hoebe, K., Crozat, K., Mudd, S., Shamel, L., Sovath, S., Goode, J., Alexopoulou, L., Flavell, R.A., Beutler, B., 2004. Toll-like receptors 9 and 3 as essential components of innate immune defense against mouse cytomegalovirus infection. Proceedings of the National Academy of Sciences of the United States of America 101, 3516-3521. 98

Tahara, E., Jr., Tahara, H., Kanno, M., Naka, K., Takeda, Y., Matsuzaki, T., Yamazaki, R., Ishihara, H., Yasui, W., Barrett, J.C., Ide, T., Tahara, E., 2005. G1P3, an interferon inducible gene 6-16, is expressed in gastric cancers and inhibits mitochondrial-mediated apoptosis in gastric cancer cell line TMK-1 cell. Cancer immunology, immunotherapy : CII 54, 729-740.

Takaoka, A., Yanai, H., Kondo, S., Duncan, G., Negishi, H., Mizutani, T., Kano, S., Honda, K., Ohba, Y., Mak, T.W., Taniguchi, T., 2005. Integral role of IRF-5 in the gene induction programme activated by Toll-like receptors. Nature 434, 243-249.

Takeda, K., Kaisho, T., Akira, S., 2003. Toll-like receptors. Annual review of immunology 21, 335-376.

Takeuchi, O., Akira, S., 2009. Innate immunity to virus infection. Immunological reviews 227, 75-86.

Taniguchi, T., Ogasawara, K., Takaoka, A., Tanaka, N., 2001. IRF family of transcription factors as regulators of host defense. Annual review of immunology 19, 623-655.

Taylor, R.T., Lubick, K.J., Robertson, S.J., Broughton, J.P., Bloom, M.E., Bresnahan, W.A., Best, S.M., 2011. TRIM79alpha, an interferon-stimulated gene product, restricts tick-borne encephalitis virus replication by degrading the viral RNA polymerase. Cell host & microbe 10, 185-196.

Tesh, R.B., Peralta, P.H., Johnson, K.M., 1969. Ecologic studies of vesicular stomatitis virus. I. Prevalence of infection among animals and humans living in an area of endemic VSV activity. American journal of epidemiology 90, 255-261.

Testa, D., Banerjee, A.K., 1977. Two methyltransferase activities in the purified virions of vesicular stomatitis virus. Journal of virology 24, 786-793.

Thomis, D.C., Samuel, C.E., 1993. Mechanism of interferon action: evidence for intermolecular autophosphorylation and autoactivation of the interferon-induced, RNA- dependent protein kinase PKR. Journal of virology 67, 7695-7700.

Traenckner, E.B., Wilk, S., Baeuerle, P.A., 1994. A proteasome inhibitor prevents activation of NF-kappa B and stabilizes a newly phosphorylated form of I kappa B-alpha that is still bound to NF-kappa B. The EMBO journal 13, 5433-5441.

Ubol, S., Masrinoul, P., Chaijaruwanich, J., Kalayanarooj, S., Charoensirisuthikul, T., Kasisith, J., 2008. Differences in global gene expression in peripheral blood mononuclear cells indicate a significant role of the innate responses in progression of dengue fever but not dengue hemorrhagic fever. The Journal of infectious diseases 197, 1459-1467.

Umareddy, I., Pluquet, O., Wang, Q.Y., Vasudevan, S.G., Chevet, E., Gu, F., 2007. Dengue virus serotype infection specifies the activation of the unfolded protein response. Virology journal 4, 91.

Uze, G., Lutfalla, G., Gresser, I., 1990. Genetic transfer of a functional human interferon alpha receptor into mouse cells: cloning and expression of its cDNA. Cell 60, 225-234.

Valmas, C., Grosch, M.N., Schumann, M., Olejnik, J., Martinez, O., Best, S.M., Krahling, V., Basler, C.F., Muhlberger, E., 2010. Marburg virus evades interferon responses by a mechanism distinct from ebola virus. PLoS pathogens 6, e1000721.

Viengchareun, S., Caron, M., Auclair, M., Kim, M.J., Frachon, P., Capeau, J., Lombes, M., Lombes, A., 2007. Mitochondrial toxicity of indinavir, stavudine and zidovudine involves multiple cellular targets in white and brown adipocytes. Antiviral therapy 12, 919-929.

Villunger, A., Michalak, E.M., Coultas, L., Mullauer, F., Bock, G., Ausserlechner, M.J., Adams, J.M., Strasser, A., 2003. p53- and drug-induced apoptotic responses mediated by BH3-only proteins puma and noxa. Science 302, 1036-1038.

Vlahos, R., Stambas, J., Selemidis, S., 2012. Suppressing production of reactive oxygen species (ROS) for influenza A virus therapy. Trends in pharmacological sciences 33, 3-8.

Vossen, M.T., Westerhout, E.M., Soderberg-Naucler, C., Wiertz, E.J., 2002. Viral immune evasion: a masterpiece of evolution. Immunogenetics 54, 527-542.

Wang, Q., Mora-Jensen, H., Weniger, M.A., Perez-Galan, P., Wolford, C., Hai, T., Ron, D., Chen, W., Trenkle, W., Wiestner, A., Ye, Y., 2009. ERAD inhibitors integrate ER stress with an epigenetic mechanism to activate BH3-only protein NOXA in cancer cells. Proceedings of the National Academy of Sciences of the United States of America 106, 2200-2205.

Wang, T., Town, T., Alexopoulou, L., Anderson, J.F., Fikrig, E., Flavell, R.A., 2004. Toll-like receptor 3 mediates West Nile virus entry into the brain causing lethal encephalitis. Nature medicine 10, 1366-1373.

Wang, X., Hinson, E.R., Cresswell, P., 2007. The interferon-inducible protein viperin inhibits influenza virus release by perturbing lipid rafts. Cell host & microbe 2, 96-105.

Weber, A., Kirejczyk, Z., Potthoff, S., Ploner, C., Hacker, G., 2009. Endogenous Noxa Determines the Strong Proapoptotic Synergism of the BH3-Mimetic ABT-737 with Chemotherapeutic Agents in Human Melanoma Cells. Translational oncology 2, 73-83.

100

Wee, Y.S., Roundy, K.M., Weis, J.J., Weis, J.H., 2012. Interferon-inducible transmembrane proteins of the innate immune response act as membrane organizers by influencing clathrin and v-ATPase localization and function. Innate immunity.

Wei, M.C., Zong, W.X., Cheng, E.H., Lindsten, T., Panoutsakopoulou, V., Ross, A.J., Roth, K.A., MacGregor, G.R., Thompson, C.B., Korsmeyer, S.J., 2001. Proapoptotic BAX and BAK: a requisite gateway to mitochondrial dysfunction and death. Science 292, 727-730.

Weidner, J.M., Jiang, D., Pan, X.B., Chang, J., Block, T.M., Guo, J.T., 2010. Interferon- induced cell membrane proteins, IFITM3 and tetherin, inhibit vesicular stomatitis virus infection via distinct mechanisms. Journal of virology 84, 12646-12657.

Wertz, G.W., Levine, M., 1973. RNA synthesis by vesicular stomatitis virus and a small plaque mutant: effects of cycloheximide. Journal of virology 12, 253-264.

Wertz, G.M., Howard, M.B., Davis, N., Patton, J., 1987. The switch from transcription to replication of a negative-strand RNA virus. Cold Spring Harbor symposia on quantitative biology 52, 367-371.

West, A.P., Koblansky, A.A., Ghosh, S., 2006. Recognition and signaling by toll-like receptors. Annual review of cell and developmental biology 22, 409-437.

Wilkins, C., Gale, M., Jr., 2010. Recognition of viruses by cytoplasmic sensors. Current opinion in immunology 22, 41-47.

Willis, S.N., Chen, L., Dewson, G., Wei, A., Naik, E., Fletcher, J.I., Adams, J.M., Huang, D.C., 2005. Proapoptotic Bak is sequestered by Mcl-1 and Bcl-xL, but not Bcl-2, until displaced by BH3-only proteins. Genes & development 19, 1294-1305.

Wiseman, R.L., Balch, W.E., 2005. A new pharmacology--drugging stressed folding pathways. Trends in molecular medicine 11, 347-350.

Wreschner, D.H., McCauley, J.W., Skehel, J.J., Kerr, I.M., 1981. Interferon action-- sequence specificity of the ppp(A2'p)nA-dependent ribonuclease. Nature 289, 414-417. Xu, L.G., Wang, Y.Y., Han, K.J., Li, L.Y., Zhai, Z., Shu, H.B., 2005. VISA is an adapter protein required for virus-triggered IFN-beta signaling. Molecular cell 19, 727-740.

Yakovlev, A.G., Di Giovanni, S., Wang, G., Liu, W., Stoica, B., Faden, A.I., 2004. BOK and NOXA are essential mediators of p53-dependent apoptosis. The Journal of biological chemistry 279, 28367-28374.

Yamamoto, M., Sato, S., Hemmi, H., Hoshino, K., Kaisho, T., Sanjo, H., Takeuchi, O., Sugiyama, M., Okabe, M., Takeda, K., Akira, S., 2003. Role of adaptor TRIF in the MyD88-independent toll-like receptor signaling pathway. Science 301, 640-643. 101

Yang, D., Liu, N., Zuo, C., Lei, S., Wu, X., Zhou, F., Liu, C., Zhu, H., 2011. Innate host response in primary human hepatocytes with hepatitis C virus infection. PloS one 6, e27552.

Yoneyama, M., Suhara, W., Fukuhara, Y., Fukuda, M., Nishida, E., Fujita, T., 1998. Direct triggering of the type I interferon system by virus infection: activation of a transcription factor complex containing IRF-3 and CBP/p300. The EMBO journal 17, 1087-1095.

You, M., Yu, D.H., Feng, G.S., 1999. Shp-2 tyrosine phosphatase functions as a negative regulator of the interferon-stimulated Jak/STAT pathway. Molecular and cellular biology 19, 2416-2424. Yu, C.Y., Chiang, R.L., Chang, T.H., Liao, C.L., Lin, Y.L., 2010. The interferon stimulator mitochondrial antiviral signaling protein facilitates cell death by disrupting the mitochondrial membrane potential and by activating caspases. Journal of virology 84, 2421-2431.

Yu, C.Y., Hsu, Y.W., Liao, C.L., Lin, Y.L., 2006. Flavivirus infection activates the XBP1 pathway of the unfolded protein response to cope with endoplasmic reticulum stress. Journal of virology 80, 11868-11880.

Yu, Z., Manickan, E., Rouse, B.T., 1996. Role of interferon-gamma in immunity to herpes simplex virus. Journal of leukocyte biology 60, 528-532.

Zall, H., Weber, A., Besch, R., Zantl, N., Hacker, G., 2010. Chemotherapeutic drugs sensitize human renal cell carcinoma cells to ABT-737 by a mechanism involving the Noxa-dependent inactivation of Mcl-1 or A1. Molecular cancer 9, 164.

Zhang, B., Yamamura, T., Kondo, T., Fujiwara, M., Tabira, T., 1997. Regulation of experimental autoimmune encephalomyelitis by natural killer (NK) cells. The Journal of experimental medicine 186, 1677-1687.

Zhao, D., Peng, D., Li, L., Zhang, Q., Zhang, C., 2008. Inhibition of G1P3 expression found in the differential display study on respiratory syncytial virus infection. Virology journal 5, 114.

Zhou, A., Paranjape, J.M., Der, S.D., Williams, B.R., Silverman, R.H., 1999. Interferon action in triply deficient mice reveals the existence of alternative antiviral pathways. Virology 258, 435-440.

102

Appendix A

Involvement of Noxa in mediating cellular ER stress responses to lytic virus infection

Activation of the innate and adaptive immune responses is critical to survival of the host during virus infection. Production of type I interferons (IFNs), including IFN-β and members of the IFN-α family is an obligatory component of the antiviral response (Stark et al., 1998). Recognition of components of the viral genome or replicative intermediates, such as double-stranded RNA (dsRNA) and single-stranded RNA is carried out by a variety of intracellular receptors, which trigger signaling cascades that culminate in the induction of target genes, including type I IFNs and other inﬂammatory cytokines

(Iwasaki and Medzhitov, 2004). IFNs induce many genes that mediate cellular antiviral responses by either directly inhibiting virus replication or stimulating the adaptive immune system (Leaman et al., 2006). dsRNA may also directly stimulate expression of many of the same genes involved in the innate immune response (Bandyopadhyay et al.,

1995).

Effective mechanisms for preventing viral replication, spread, and persistence include inhibition of protein synthesis, protein transport, and induction of apoptosis. Several IFN- 103

regulated genes encode proteins that are important components of the antiviral response, including the dsRNA-activated protein kinase R (PKR), RNase L, guanylate binding protein 1 (Gbp-1), tumor necrosis factor-related apoptosis-inducing ligand

(TRAIL/Apo2L), cig 5 (viperin), and XIAP-1 associated factor-1 (XAF1) (Reviewed in

Leaman et al., 2006; Chawla-Sarkar et al., 2003). It is likely that these proteins function to block virus replication directly, as in the case of PKR, RNase L, Gbp-1, and viperin, and indirectly by promoting apoptosis of infected cells prior to completion of viral replication, effectively limiting further virus infection (Haller et al., 2007; Silverman,

2007; George et al., 2009). Upregulation of proteins involved in sensing viral nucleic acids and priming components of the adaptive immune response are also critical for a full antiviral response to IFNs (Takeuchi and Akira, 2009).

Virus infection and replication not only stimulate innate immune and inﬂammatory responses, but also cause stress to the endoplasmic reticulum (ER; He, 2006). The ER is sensitive to imbalances in cellular homeostasis, including massive protein production and misfolding, loss of calcium homeostasis, and inhibition of N-linked glycosylation

(Szegezdi et al., 2006). Replication of many viruses requires the production of properly folded and heavily modiﬁed proteins, making the ER an essential organelle for proper maturation of nascent viruses (He, 2006). In response to ER stress, a complex adaptive process, termed the unfolded protein response (UPR), is initiated to help reduce the number of misfolded proteins, either by suppressing protein synthesis or by elevating levels of proteins involved in folding and degradation (Harding et al., 2002). A major component of the UPR is PKR-like ER kinase (PERK), which down-regulates global 104

protein translation by phosphorylating eukaryotic translation initiating factor 2α (eIF2α).

In addition to the PERK-dependent pathway, activation of ATF6 and Inositol-requiring enzyme 1 (IRE1) induces other mediators of the UPR, including X box binding protein 1

(XBP1). When the cell is unable to recover from extended ER stress, apoptotic signals, including upregulation of C/EBP homologous protein (CHOP/GADD153), are initiated to eliminate the stressed cell (Kaufman, 2002). Indeed, infection of cells by various viruses can activate a canonical ER stress response including induction of CHOP expression, eIF2α phosphorylation, XBP1 splicing and eventual induction of apoptosis in the infected cell (Yu et al., 2006; Medigeshi et al., 2007; Barry et al., 2010), although some viruses combat this process to allow production of large amounts of structural proteins (He,

2006).

A small molecule pharmacologic inhibitor of ER stress response, salubrinal, is able to block many of the cytotoxic responses to ER stress as a means to prevent cellular death

(Boyce et al., 2005). Salubrinal inhibits PP1-GADD34 phosphatase activity, thereby blocking eIF2α dephosphorylation and extending translational attenuation. It may also block apoptotic responses downstream of the IRE1 and ATF6 transcription factors, depending on the cellular context (Wiseman and Balch, 2005). Salubrinal has been used to block cellular cytopathic responses to Dengue and Herpes Simplex viruses (Boyce et al., 2005; Umareddy et al., 2007), thereby implicating ER stress in the replication and cellular response to some lytic viruses.

105

We have previously shown that Noxa, a mitochondrial BH3-only member of the Bcl-2 family, is induced by virus infection or dsRNA and can augment virus-induced apoptosis

(Sun and Leaman, 2005). Noxa was originally identiﬁed as a p53-regulated protein required for DNA damage-induced apoptosis (Oda et al., 2000; Yakovlev et al., 2004), but has subsequently been implicated in a variety of stress response pathways (Ploner et al., 2008). Noxa expression can be upregulated by dsRNA or virus infection in a p53- independent manner (Sun and Leaman, 2005; Goubau et al., 2009), as well as by the ER stressors tunicamycin and thapsigargin (Li et al., 2006). Noxa expression is also rapidly upregulated in a number of different tumor cell lines by the proteasome inhibitors bortezomib (velcade, PS-341) and MG132, again independently of p53 status (Jüllig et al., 2006; Fennell et al., 2008). Application of the synergistic upregulation of Noxa by proteasome inhibitors, and other chemotherapeutics, and restoration of apoptotic responsiveness has recently been the target of intense study in a number of refractory tumor types (Nikiforov et al., 2007; Zall et al., 2010; Kuroda et al., 2010; Ri et al., 2010;

Weber et al., 2009). Because virus infection and proteasome inhibitors can both induce

ER stress, we sought to examine the effects of lytic viruses and viral mimetics, including the combination of dsRNA and MG132 or other well-characterized ER stressors (Lee et al., 2003), on Noxa regulation and cytopathicity. We hypothesize that Noxa is a critical mediator of this response, which represents a mechanism by which cells detect and respond to virus infection via apoptosis.

In the present study, we show that lytic viruses can replicate in Noxa null cells, but that viral CPE is dramatically reduced. The relative roles of the dsRNA and ER stress-sensing 106

pathways were examined and suggested that ER stress is a more potent regulator of cellular cytopathicity in response to lytic virus infection. We also show that dsRNA synergizes with MG132 to rapidly upregulate Noxa and augment apoptosis, in a manner similar to VSV or EMCV infection. We observed enhanced activation of caspase 3 and cell death in response to the combination as compared to each individual treatment alone.

We also show activation of Bax, release of cytochrome c, degradation of Mcl-1, and loss of mitochondrial membrane potential in response to dsRNA and MG132. Knockdown of

Noxa levels using siRNA attenuated the proapoptotic effects of dsRNA and MG132.

Together, these data highlight the importance of Noxa as an intermediate in both dsRNA- and ER stress-dependent cellular cytopathic responses.

107

Materials and methods:

Cells and reagents:

A375 melanoma and HT1080 fibrosarcoma cells have been described before (Muller et al., 1993; Kohlhuber et al., 1997). Wildtype and Noxa null baby mouse kidney cells (a generous gift from Eileen White, Rutgers University) were maintained in Dulbecco's modified Eagles medium containing 8% fetal bovine serum. IFN-β (Serono), dsRNA

(poly(I)-poly(C); GE Healthcare), MG132 (Z-Leu-Leu-Leu-H aldehyde; peptides

International), thapsigargin (Sigma Aldrich), Tunicamycin (Sigma Aldrich), Bortezomib

(LC Laboratories) and salubrinal (Tocris Bioscience) were used at the concentrations described in the text. Noxa expression plasmids have been described previously (Sun and

Leaman, 2005). In addition to the antibodies described in the following methods, we also used commercial antibodies to P-PERK (Cell Signaling), Cox IV (Molecular Probes) and alpha actin (Cell Signaling) in the reported studies.

RNAi

Control or Noxa-specific siRNAs were obtained as a pool of four targeting siRNA duplexes (On-Target plus SMART pool; Dharmacon). A375 cells were reverse transfected with control or Noxa siRNAs using Lipofectamine RNAiMAX (Invitrogen)

108

according to the manufacturer's recommendations. Knockdown of Noxa was confirmed by Western blot using a Noxa monoclonal antibody (Alexis Biochemicals).

Assessment of cell viability and apoptosis induction: To determine cell viability, replicate plates were stained with sulforhodamine B (SRB) as described previously (Sun and Leaman, 2005). Briefly, cells were fixed with 10% TCA for 15 min, then stained with SRB solution (0.4% in 1% acetic acid) for 15–30 min and washed four times with

1% acetic acid. After drying, the dye was eluted in 10 mM unbuffered Tris and the absorbance was read on a plate reader at 550 nm.

For immunoblot analysis of caspase 3 cleavage, floating and adherent cells were lysed in

RIPA buffer (150mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, 50mM

Tris pH 8.0, 1 mM PMSF), and proteins were separated on 10–15% SDS-PAGE, electrotransferred to Immobilon- P PVDF membrane (Millipore Corp.), and caspase 3 was detected by probing with an antibody for caspase 3 (Cell Signaling). Cytochrome c release from the mitochondria was assessed by fractionating adherent and floating cells into mitochondrial and cytoplasmic extracts. Briefly, the cell pellet was resuspended in 5 volumes of mitochondrial isolation buffer (MIB; 220 mM mannitol, 68 mM sucrose, 10 mM HEPES pH 7.4, 10 mM KCl, 1 mM EGTA, 1 mM EDTA, 1 mM MgCl2) then dounce homogenized. The homogenate was centrifuged at 1000 g for 10 min. The low- speed pellet was washed once in MIB and spun again. Low speed supernatants were pooled and centrifuged at 10,000 g for 10 min to generate the crude mitochondrial pellet and cytoplasmic extract (supernatant). 109

To assess changes in mitochondrial potential, A375 cells were treated with dsRNA and

MG132 for up to 6 h, and then analyzed by FACS following tetramethylrhodamine ethyl ester (TMRE, Molecular Probes; 10 μM) staining. Treatment of cells with the protonophore carbonyl cyanide m-chlorophenyl hydrazone (CCCP) was used as a control to set the marker for the TMRE-low population. TMRE fluorescence was quantified on a

FACS Calibur flow cytometer (Becton Dickinson) using Cell Quest software.

Immunoprecipitations

For Bax activation and Mcl-1 immunoprecipitations, cells were treated as described above, harvested and lysed in CHAPS buffer (10 mM HEPES pH 7.4, 150 mM NaCl, 1%

CHAPS) by three rounds of freeze–thaw. Cleared lysates (500 μg total protein) were incubated with 2 μg of the Bax activation state-specific monoclonal antibody (6A7;

Trevigen) or 1 μg of Mcl-1 monoclonal antibody (RC13; Lab Vision Corporation) for 2 h, after which protein G sepharose beads (GE Healthcare) were added and incubated for an additional 1 h. The beads were washed three times with CHAPS lysis buffer and SDS loading buffer was used to elute immune complexes. After SDS-PAGE and transfer, blots were probed with polyclonal antisera to Bax (BD Pharmingen), Mcl-1 (S-19; Santa

Cruz Biotechnology) or with a monoclonal antibody to Noxa, where appropriate.

Immunofluorescence: For immunofluorescence detection of VSV, wild-type and Noxa null BMK cells were seeded on poly-L-lysine coated coverslips for 24 h and then infected with VSV (moi=0.001) for 16 h (both BMK lines) or 96 h (Noxa null BMK only). 110

Coverslips were then washed with PBS and fixed with 4% paraformaldehyde in PBS for

15 min, permeabilized with 0.2% Triton X-100 for 3 min and then blocked with 5% bovine serum albumin (BSA) for 15 min. Cells were incubated with rabbit anti VSV G

(Sigma Aldrich) primary antibody (1:1000 dilution) for 2 h at room temperature, washed and then incubated with fluorescein isothiocyanate conjugated goat anti-rabbit (Sigma

Aldrich) secondary antibody (1:200 dilution) for 1 h at room temperature. Cover slips were mounted on to glass slides in Vecta shield (Vector Laboratories) containing 4′,6- diamidino-2-phenylindole (DAPI). Fluorescent images were captured on an Olympus

1×51 fluorescent microscope. Additional studies were performed with higher moi

(Supplemental Fig. 1) following the above staining procedures.

Virus infection and yield assays

Wild-type BMK cells, Noxa null cells, Noxa null cells stably transfected with empty vector, and Noxa null cells stably complemented with Noxa were plated on 6 cm dishes for 24 h and infected with laboratory stocks of VSV (Indiana strain) or EMCV at an moi of 0.001 and 0.01 for 1 h in serum free media. After 1 h, the cells were washed with PBS and 2 mL of complete media was added. On the subsequent day, the virus-infected media was harvested and centrifuged for 3–4 min at 4000 g. For viral yield assays, the clarified supernatants were used to infect an indicator cell line (HT1080 fibrosarcoma cells) at

1:10 serial dilutions. The next day, cells were fixed in 100% methanol for 10 min and stained with crystal violet for 5 min. Quantified results, plotted on a log scale, represented the dilution at which 50% cell lysis was observed. For UV inactivation of virus, high concentration stocks of VSV were exposed to UV light for 15 s in a 6 cm dish 111

using a Stratagene UV Stratalinker 1800 (6000 μJ/cm2). Cells were infected with the inactivated virus at a moi of 0.1.

RNA isolation and RT-PCR

Total cellular RNA was isolated using Trizol reagent (Invitrogen, CA) according to the manufacturer's instructions and reverse transcribed (RT) with Moloney murine leukemia virus (MMLV) reverse transcriptase (Fisher scientific, NJ). For virus-infected cells, both floating and attached cells were harvested for RNA isolation. RT reactions utilized 1 μg of total cellular RNA, which was incubated with 1 μg of random hexamer primers at 70

°C for 10 min then quick chilled on ice. Reactions included dNTPs (1.25 mM), ribonuclease inhibitor (RNasin, 40 U; Promega Corp., CA) and MMLV reverse transcriptase (200 U, Fisher scientific, NJ) and were incubated at 42 °C for 1 h. The resulting cDNA was used a template for semi-quantitative PCR amplification (25–30 cycles: 30 s at 94 °C, 30 s at 52 °C and 60 s at 72 °C). PCR products were analyzed on

1% agarose gels, visualized with ethidium bromide and digital images were inverted to give dark bands on a light background. RT-PCR studies were conducted with iQ SYBR

Green supermix (BioRad, CA) using a two-step amplification (94 °C, 30 s; at 60 °C for

60 s) on an Eppendorf RealPlex thermocycler. Relative target gene expression was calculated by the ΔΔCt method using GAPDH as an internal control.

112

Results:

Noxa induction by virus is required for enhanced apoptosis

Upregulation of Noxa expression is observed in a variety of cell types in response to

DNA damage, hypoxia and therapeutically relevant proteasome inhibitors (Oda et al.,

2000; Yakovlev et al., 2004; Kim et al., 2004; Fernandez et al., 2005; Pérez-Galán et al.,

2006). We have shown previously that Noxa is upregulated by virus or dsRNA in a p53- independent, IRF-3-dependent manner (Sun and Leaman, 2005; Goubau et al., 2009). To extend our analyses into Noxa's function in cellular antiviral responses, immortalized wild-type (WT) and Noxa null (−/−) baby mouse kidney (BMK) epithelial cells were used in virus replication and cytopathicity studies. To serve as reconstituted controls, the

Noxa knockout cells were stably transfected with empty plasmid (−/− Vector) or wild- type Noxa (−/− Noxa) (Goubau et al., 2009). Wild-type, −/−, −/− Vector and −/− Noxa

BMK cells were infected with VSV (moi 0.001) or EMCV (moi 0.01) for 16 h and assessed for cytopathicity. Both virus types undergo 2–3 rounds of replication in this timeframe in these cells (data not shown). Whereas WT and Noxa complemented cells were sensitive to VSV or EMCV-induced cytopathicity, Noxa null cells (unmodiﬁed or vector transfected) were resistant (Figs. 16A, B). This phenotype was observed across multiple vector or Noxa- complemented clonal lines (data not shown). The Noxa null cells (−/−and−/−Vector) also showed reduced loss in viable cell numbers after VSV or

113

EMCV infection, as compared to the WT or Noxa complemented cells (Fig. 16C), and knockout cells exhibited less caspase 3 activation following VSV infection (Fig. 16D), consistent with our earlier siRNA studies (Sun and Leaman, 2005).

The lack of viral CPE in the knockout cells could reflect a difference in infectivity or defects in cellular response to the virus. To confirm that the −/− and −/− Vector cells were not deficient in VSV adsorption or uptake, viral replication was assessed in all cell lines by measuring viral yields and VSV G-protein mRNA accumulation (Fig. 17A).

Results indicated that viral production in the knockout cells was reduced by about 10-fold as compared to WT cells (Fig. 17Ai), but that virus was still produced in the knockout cells as indicated by VSV G mRNA accumulation in cells (Fig. 17Aii). Similar data were obtained for EMCV (Figs. 21A–C). VSV G-protein expression was assessed by immunoﬂuorescence in infected WT or Noxa null cells (Figs. 18B, C). After 16 h, staining in the WT and knockout BMK cells was observed (Figs. 18B, C), but unlike the

WT BMK cells that died quickly thereafter, VSV G-protein expression persisted beyond

96 h in the Noxa null cells (Fig. 18C). Even infection with a high moi of VSV failed to induce death of the knockout cells (Fig. 21D), indicating that it was the lack of a cellular death response, and not reduced viral replication rates, that lead to the differences in cytopathic responses between the wild-type and Noxa −/− cells. Together, these data suggested that loss of Noxa blocked cellular apoptosis but did not prevent virus replication or persistence.

114

Involvement of ER stress pathways in Noxa regulation and viral CPE

Although IRF3 is clearly involved in Noxa upregulation by dsRNA or virus (Goubau et al., 2009), the response of Noxa null cells infected with lytic viruses more closely mirrored the observed effects of proteasome inhibitors or ER stress inducers, which preferentially kill Noxa-intact versus knockout cells (Fig. 18A). Indeed, combined

MG132/dsRNA treatment of cells promoted cytopathic responses that were nearly identical to those obtained with VSV infection (Fig. 18A). Thus, to investigate a role for

ER stress responses in the resistance of Noxa null cells to lytic viruses, we treated WT and Noxa null cells with VSV, EMCV, thapsigargin (TG) or bortezomib and assessed

Noxa mRNA expression. Viral infection or treatment with TG or bortezomib-induced

Noxa mRNA in WT BMK cells (Fig. 18Bi). CHOP/GADD153, a marker of ER stress that mediates speciﬁc transcriptional responses to ER perturbation, was also upregulated by virus infection, TG, and bortezomib treatment of WT BMK cells (Fig. 18Bii).

Importantly, CHOP was also upregulated in the Noxa null cells (Fig. 18Bii), indicating that the upstream components of the ER stress response were intact in these cells. In addition to Noxa and CHOP, ATF4 was similarly induced by these treatments (Figs. 22A,

B). Other BH3-only proteins, including Bim and PUMA have been implicated in virus- induced apoptosis. We found that both PUMA and Bim were induced by dsRNA and weakly by virus, but not by ER stressors (Fig. 22D). Furthermore, both were still induced in the Noxa null cells that resisted virus-induced cytopathicity (Fig. 22D), suggesting that loss of Noxa is dominant to the pro-apoptotic effects that these proteins may exert in this cell type. 115

To further investigate the importance of the ER stress versus the dsRNA sensing pathway in upregulating Noxa expression following virus infection, WT BMK cells were infected with replication active or UV-inactivated VSV. Activation of IRF3 upon viral entry, but in the absence of replication, is sufﬁcient to induce an innate immune response (Collins et al., 2004). While infection with active VSV elicited a normal CPE response, including cell rounding, loss of viable cell numbers and activation of caspase 3 (Fig. 18C), infection with UV-inactivated VSV had no effect on cell viability (Fig. 18C).

Nevertheless, the UV-inactivated virus did infect the cells as demonstrated by RT-PCR of

VSV G mRNA (Fig. 18D), but it did not produce progeny or induce cell death. As expected, CHOP mRNA was only weakly induced by the UV-inactivated virus (Fig.

18D). Noxa similarly showed little or no upregulation, whereas the dsRNA-responsive

ISG56 mRNA was upregulated strongly by both wild-type and UV-inactivated VSV (Fig.

18D). These data suggest that ER stress pathways that are activated in response to virus infection play an important role in Noxa induction in infected cells.

To determine whether the ER stress pathways that upregulate Noxa and CHOP are required to elicit virus-induced CPE responses in cells, the ER stress inhibitor salubrinal was employed. Salubrinal is proposed to inhibit ER stress signaling by blocking cellular phosphatase complexes that dephosphorylate eIF2α, preventing the ER stress response and subsequent cell death (Boyce et al., 2005). In WT BMK cells, Salubrinal pretreatment was able to partially or fully block upregulation of CHOP and Noxa by all of the stimuli tested (Figs. 19Ai, ii). Salubrinal is proposed to act downstream of PERK phosphorylation, and immunoblot analysis conﬁrmed that PERK phosphorylation was not 116

affected in the Salubrinal treated cells (Fig. 19Aiii). Importantly, salubrinal was able to protect cells from CPE (Figs. 19Bi, ii) and apoptosis (Fig. 19C) induced by the viruses and ER stress activators employed in these studies. As with loss of Noxa, salubrinal did not fully prevent virus infection or replication (Fig. 19Biii), and cells did eventually succumb to cytopathic effects (data not shown). Nevertheless, these data demonstrate a role for ER stress in the immediate cytopathic response to lytic viruses such as VSV or

EMCV.

Noxa upregulation correlates with enhanced apoptosis typiﬁed by mitochondrial dysfunction.

Our data suggest that ER stress is an important contributor to Noxa induction and virus- induced CPE. Previous studies had clearly indicated that dsRNA can directly stimulate

Noxa expression (Sun and Leaman, 2005; Goubau et al., 2009). Although the studies conducted here suggest that ER stress is an obligatory component of virus-induced Noxa expression, we sought to determine which aspects of virus infection stimulated Noxa transcription. In particular, we investigated whether dsRNA plus ER stress stimuli could mimic a virus infection and combinatorially upregulate Noxa expression. Treatment of

A375 melanoma cells with IFN-β, dsRNA, or MG132 alone or in combination led to

Noxa upregulation (Fig. 18A, see also Fig. 21A). The combination of dsRNA and

MG132 synergistically upregulated Noxa and this corresponded to enhanced caspase 3 activation and cell death (Fig. 18A, lane 6) versus treatment with either stimulus alone.

Similar results were obtained with Thapsigargin and dsRNA (data not shown). In all cells tested, upregulation of Noxa by virus, dsRNA, MG132, or TG occurred at the 117

transcriptional level (Fig. 20A, Figs. 23B and C) and was not simply due to MG132- mediated stabilization of protein. CHOP and GADD34 were assessed in parallel as additional markers of ER stress (Fig. 23B).

The mechanism of Noxa-induced cell death has been well characterized (Shibue et al.,

2003; Villunger et al., 2003; Seo et al., 2003). Noxa binds to the anti-apoptotic Bcl-2 family member Mcl-1 (Willis et al., 2005; Chen et al., 2005). This results in the displacement of sequestered Bax and Bak, which allows for their activation and the degradation of Mcl-1. Once activated, Bax and Bak oligomerize to form pores in the outer mitochondrial membrane that promote the release of cytochrome c and activation of caspases, which then cleave intracellular targets and promote the morphological changes associated with apoptosis. To investigate the mechanism of Noxa-induced cell death in response to virus infection and ER stress, A375 cells treated with dsRNA and MG132 were lysed to immunoprecipitate Mcl-1 to assess Noxa and Mcl-1 association.

Interestingly, we found an interaction between Noxa and Mcl-1 in both untreated and treated cells. Over the 6 h time course, Noxa protein levels increased and we eventually observed cleavage of Mcl-1 (Fig. 20Bi). Replicate samples were used to immunoprecipitate active Bax using an active state-speciﬁc monoclonal antibody. Levels of active Bax increased signiﬁcantly after 2 and 6 h of treatment with dsRNA and

MG132 (Fig. 20Bi). We have been unable to detect an interaction between either Bak or inactive Bax and the Noxa Mcl-1 complex (data not shown). An aliquot of the treated cells not used for immunoprecipitating active Bax or Mcl-1 was fractionated into mitochondrial and cytosolic extracts to monitor the release of cytochrome c. Not 118

surprisingly, the activation of Bax and degradation of Mcl-1 also corresponded to an increase in cytosolic cytochrome c (Fig. 20Bi). We also analyzed the cleavage and activation of caspase 3 in whole-cell lysates of the same samples. At 6 h of treatment with dsRNA and MG132, where levels of active Bax, Mcl-1 cleavage, and cytochrome c release are highest, activation of caspase 3 is also seen (Fig. 20Bi). There was no change in total levels of Bax, Bak, or Bcl-2, underscoring the importance of the Noxa-Mcl-1 interaction and subsequent degradation of Mcl-1 in the setting of ER stress.

To conﬁrm that the observed effects on Bax activation and cytochrome c release in response to ER stress appropriately mimicked virus infection, A375 cells were infected with either VSV or EMCV, or treated with TG. After 16 h of treatment, cells were harvested and either lysed to immunoprecipitate active Bax or fractionated to detect cytosolic levels of cytochrome c. In agreement with dsRNA/MG132 treatment, all three stimuli promoted activation of Bax and concomitant release of cytochrome c from the mitochondria into the cytosol (Fig. 20Bii). The mitochondrial marker COX IV was assessed in parallel experiments, conﬁrming the purity of cellular fractions employed in these studies (Fig. 20D).

Activation of pro-apoptotic Bcl-2 family members leads to permeabilization of the outer mitochondrial membrane, release of key mediators for augmenting the apoptotic response, and, from a biochemical standpoint, leads to depolarization of the inner mitochondrial membrane. To extend our studies on the effects of Noxa induction on apoptosis, we used a potentiometric dye, TMRE, to measure mitochondrial membrane 119

potential in A375 cells treated with dsRNA and MG132. In line with our previous mechanistic data, the increase in apoptosis also corresponded to a loss of mitochondrial membrane potential (Fig. 20Ci). To determine the relative contribution of Noxa to dsRNA/MG132-induced apoptosis, we transfected cells with either control or Noxa- speciﬁc siRNA to reduce levels of the endogenous protein. In accordance with previous observations, knocking down Noxa resulted in an approximately 50% reduction in cell death, loss of mitochondrial membrane potential, and caspase 3 activation (Figs. 20Ci and Cii; Jullig et al., 2006). These data paralleled our earlier observations that Noxa knockdown reduced EMCV-induced apoptosis (Sun and Leaman, 2005).

Discussion

The role of cellular apoptosis in the dissemination of viral progeny within an infected host is complex. Many lytic viruses induce apoptosis as part of the normal replication process as a means to move beyond the infected cell. However, host factors, rather than virus-encoded proteins, appear to be the primary initiators of cellular apoptosis. This host innate immune response utilizes apoptotic mechanisms to minimize virus damage and prevent long term infections. A number of cellular factors have been implicated in modulating viral CPE (apoptotic) effects. These include PKR, TRAIL and PML, each of which are upregulated by virus infection directly or through IFN feedback and have been implicated in virus-induced apoptotic responses (Barber, 2001). However, others must certainly play a role in determining whether a cell ultimately undergoes a cytopathic response or survives the initial infection. Our data suggest that Noxa is another example

120

of a host factor that is required for appropriate cellular apoptotic responsiveness to viral stresses.

Noxa is potently upregulated by dsRNA, IFN and virus within 3–6 h of treatment (Sun and Leaman, 2005; Goubau et al., 2009), and the upregulation by virus or dsRNA does not require IFN (Sun and Leaman, 2005) or p53 (Sun and Leaman, 2005; Lallemand et al., 2007) as an intermediate. Upregulation by virus or dsRNA clearly involved IRF3 regulated mechanisms: Noxa was robustly induced by adenovirally expressed IRF3 5D, a constitutively active form of IRF3, and its induction by dsRNA was defective in IRF3 null MEFs (Goubau et al., 2009). Expression of a Noxa promoter/luciferase construct was upregulated by IRF3 5D, and IRF3 was recruited to the Noxa promoter following dsRNA treatment (Goubau et al., 2009). In contrast, IRF7 was only weakly able to induce Noxa expression (Goubau et al., 2009). Thus, IRF3 clearly can induce Noxa following virus infection. However, while IRF3-null cells are not deﬁcient in virus-induced apoptosis

(Sato et al., 2000), Noxa null cells were unable to mount a normal CPE response to VSV or EMCV (Fig. 1), suggesting that Noxa plays a prominent role in virus-induced apoptosis and that factors other than IRF3 are involved in its regulation. Studies conducted herein with UV-inactivated virus supported this observation and implicated other virus-induced pathways in the regulation of Noxa and viral CPE responses.

Although Noxa was originally implicated as an integral component of the p53-dependent response to DNA damage or hypoxia (Oda et al., 2000), a number of recent studies have demonstrated the signiﬁcance of the p53-independent induction of Noxa downstream of proteasome inhibition and ER stress. Proteasome inhibitors were originally developed to 121

counteract the aberrant activation of classical NF-κB signaling (Traenckner et al., 1994;

Grivennikov et al., 2010) by preventing the proteasome-dependent degradation of IκBα.

In addition to the NF-κB-inhibitory effects, treatment with proteasome inhibitors also promoted expression and activation of pro-apoptotic BH3-only proteins including Noxa,

Bid, and Puma (Fennell et al., 2008). In particular, induction of Noxa in response to bortezomib treatment has been reported in a wide variety of tumor cell types and serves as a prognostic indicator for the efﬁcacy of treatment (Pérez-Galán et al., 2006; Ri et al.,

2009; Gomez-Bougie et al., 2007; Chen et al., 2010; Nikiforov et al., 2007). Rapid induction of Noxa by bortezomib correlated with a signiﬁcant increase in apoptosis in melanoma, but not in normal keratinocytes (Fernandez et al., 2006), and shRNA dependent knockdown of Noxa attenuated bortezomib-induced cytotoxicity (Pérez-Galán et al., 2006). Overall, proteasome inhibit or dependent upregulation of Noxa has been used synergistically with other therapeutics to maximize the induction of tumor cell death

(Kim et al., 2010; Ackler et al., 2010; Zall et al., 2010; Weber et al., 2009).

An important consequence of treating cells with proteasome inhibitors is the accumulation of improperly folded or modiﬁed proteins within the ER, leading to ER stress. A cytoprotective activity, known as the unfolded protein response (UPR), is initiated to promote refolding or degradation of the ER burden. However, the UPR can also lead to the induction of apoptosis if the aggregation of faulty proteins cannot be resolved. ER stress-induced apoptosis depends on pro-apoptotic Bcl-2 family members, including Noxa and Bax, and activation of caspases (Lai et al., 2006). Once activated

Bax/Bak oligomerize and promote the release of cytochrome c and activation of caspases 122

9 and 3 through permeabilization of the outer mitochondrial membrane (Adams and

Cory, 2007). Mcl-1 is then subject to degradation by caspases, enhancing the apoptotic signal. Indeed, Mcl-1 downregulation can promote activation of Bax and Bak (Adams and Cooper, 2007). Mcl-1 levels are regulated both transcriptionally and translationally, and Mcl-1 protein is subject to rapid turnover (Fritsch et al., 2007). Cells that express high levels of Mcl-1 are resistant to proteasome inhibitor-induced cell death (Jiang et al.,

2008). However, concomitant upregulation of Noxa and downregulation of Mcl-1 using siRNA or BH3 mimetics promotes apoptosis in resistant cells, suggesting that a balance in favor of increased Noxa activity is required for optimal killing (Zall et al., 2010;

Weber et al., 2009). Upregulation of Noxa in response to the ER stressors thapsigargin and tunicamycin correlates with the induction of apoptosis, while MEFs lacking both Bax and Bak are resistant to apoptosis induced by thapsigargin, tunicamycin, and brefeldin A

(Wei et al., 2001). These data implicate Bax/Bak in Noxa-mediated effects on ER stress induced apoptosis. Our results are consistent with this, and a recent report emphasizing the importance of Mcl-1 degradation in VSV induced apoptosis (Pearce and Lyles, 2009), although that study suggested that Bid also played an important role in the process. Other

BH3-only proteins, including Bim and PUMA have been implicated in viral cytopathic responses (Perfettini et al., 2004; Puthalakath et al., 2007). While our results were consistent with their upregulation by virus and dsRNA, this induction was also observed in Noxa null cells that were resistant to virus-induced cytopathicity (Fig. 20). While this does not rule out a role for these proteins in innate immune response to virus, it does imply that they are either less critical than Noxa, or at least insufﬁcient to replace the loss of Noxa in these cells. 123

Because of the importance of Noxa in mediating ER stress responses, we assessed the role of virus-associated ER stress in promoting Noxa expression and cellular apoptosis.

Virus infection and replication are well-known inducers of ER stress and apoptosis (He,

2006; Yu et al., 2006; Medigeshi et al., 2007; Barry et al., 2010). Viruses rely on the infected host cell machinery, namely the ER, to fold and modify proteins for productive replication. VSV, in particular, produces large amounts of G-protein that is modiﬁed through the ER/golgi apparatus. Our studies using UV-inactivated VSV demonstrate that, although the defective virus was still able to infect BMK cells, it was unable to induce

Noxa expression, presumably due to its inability to replicate or induce ER stress.

Furthermore, treatment with an ER stress signaling inhibitor, salubrinal, prevented not only the upregulation of Noxa in response to virus infection, proteasome inhibition, and direct ER stressors, but also blocked virus-induced cytopathic effects and ER stress- induced apoptosis. Although salubrinal exhibits some non-specific effects, particularly those that result from its ability to reduce protein synthesis, the results obtained with this inhibitor were consistent with those observed in the Noxa knockout cells, suggesting that least a portion of the resulting phenotypes (i.e. reduced CPE in Noxa −/− or salubrinal- treated cells) was due to reduced ER stress responses. Additional studies with future, more specific ER stress inhibitors will be required to confirm the relative contribution of the UPR in this process. Similarly, our studies demonstrated that cells lacking Noxa were also devoid of cytopathic effects after the induction of ER stress by virus infection and therapeutics.

124

The data presented here suggest that both ER stress and dsRNA pathways are crucial for optimal Noxa induction by virus (Fig. 24). Noxa in turn promotes Mcl-1 degradation and, presumably, Bax or Bak oligomerization, which promotes mitochondrial outer membrane permeabilization leading to cytochrome c release and apoptosis. Although the precise transcriptional regulators downstream of the unfolded protein response that regulate Noxa transcriptional induction were not identiﬁed in this study, it is likely that transcription factors such as ATF3/ATF4 (Wang et al., 2009), p38 (Hassan et al., 2008) and other stress-activated regulators are involved. Although c-myc has been implicated in the regulation of Noxa by proteasome inhibitors (Nikiforov et al., 2007; Fig. 24), we did not observe a change in c-myc expression that would be consistent with a role in Noxa induction in the BMK cells examined here (data not shown). Thus, c-myc's role in regulating Noxa may be most prominent in tumor cells, as suggested previously by others

(Nikiforov et al., 2007). Regulation via these coordinated pathways ultimately promotes sufﬁcient Noxa expression to displace pro-apoptotic factors from Mcl-1 and tip the balance in favor of cell death. Although we feel that Noxa plays a critical role in this determination, our model is not intended to imply that Noxa is therefore both necessary and sufﬁcient for the process. Other factors, such as IRF- 3, MAVS, caspase 8 and Bid, clearly must coordinate with Noxa to regulate cell death or survival, and different cell types may depend on Noxa to a greater or lesser extent (Barber, 2001; Yu et al., 2010;

Chattopadhyay et al., 2011). Nevertheless, our data strongly connect Noxa to virus- induced cellular damage and, potentially, to viral persistence because failure to rid the body of infected cells could sustain the infection and/or reduce adaptive immune responses. These results are also relevant to the use of oncolytic viruses aimed at 125

speciﬁcally targeting tumor cells (Barber, 2005). Since Noxa expression may be more strongly impacted in tumor cells as compared to normal cells, its analysis may provide a prognostic marker for anti-tumor effectiveness in lytic virus-based tumor therapies.

Conclusions

These studies provide evidence that Noxa is a critical component of ER stress-induced apoptosis and cytopathic responses in virally infected cells. Although ER stress is a known product of virus infection, the speciﬁc identities of genes activated through this response that regulate viral cytopathicity and dissemination are less well characterized.

Our data for the ﬁrst time clearly implicate Noxa as a downstream effector of the ER stress pathway in virally infected cells, and suggest that loss of this response could lead to a state of persistent infection

126

Fig 16: Noxa null cells resist viral cytopathicity. A) Wild-type (WT) BMK cells, Noxa

−/− cells, Noxa −/− cells transfected with empty vector and Noxa −/− cells stably expressing wild-type Noxa were left untreated or infected with VSV (moi=0.001) or

EMCV (moi=0.01) for 16 h. After that time, photomicrographs were taken to illustrate viral CPE in wildtype and Noxa-complemented, but not Noxa null or vector- complemented cells. B) The same cells as in “A” were infected with VSV (moi=0.01 or

0.001) or EMCV (moi=0.1 or 0.01) for 16 h and then fixed and remaining cell monolayers stained with crystal violet. C) To quantify cellular viability, cells were left untreated or infected with VSV or EMCV as in “A” and after 16 h fixed in TCA and stained with SRB. To quantify relative cell numbers, incorporated dye was eluted and absorbance quantified (OD 550 nm). Cell viability for each sample was expressed as a 127

percentage of the staining in the untreated cells. D) To assess apoptosis, cells were lysed at the indicate times after infection and caspase 3 cleavage was monitored by immunoblotting. (Fig D was done by Tiannan Chen)

128

129

Fig 17: Viral replication in WT and Noxa −/−cells. A) i. The indicated BMK cell lines were infected with VSV (moi=0.001 or 0.0001) for 16 h, the conditioned medium was harvested and applied to indicator HT1080 cells in Log10 dilutions. After an additional 130

16–24 h, indicator cells were fixed and stained with crystal violet and viral titers quantified as the dilution providing 50% cytopathicity, and expressed as a value relative to that observed in WT BMK infected with moi=0.001. ii. To assess viral RNA accumulation, cells were infected with VSV (moi=0.001) for 0–96 h and then total cellular RNA was isolated and reverse transcribed into cDNA that was used as a template for RT-PCR analysis of VSV G-protein mRNA expression. GAPDH served as a cellular

RNA control. B) WT BMK cells were infected with VSV (moi=0.001) for 16 h and then fixed and stained for immunofluorescent detection of VSV using a G-protein primary antibody and a FITC-conjugated goat anti-mouse secondary antibody. Cellular morphology was assessed by phase contrast microscopy, and cell nuclei were detected by

DAPI staining. C) Noxa −/− BMK were infected with VSV for 16 h or 96 h and then fixed and stained as in “B”.

131

132

133

Fig 18: Role of ER stress response in Noxa mode of action. A) WT BMK cells, −/− cells, −/− cells transfected with empty vector and −/− cells stably expressing wild-type

Noxa were left untreated or treated with bortezomib (16 h, 20 nM), MG132 (6 h, 10 μM),

MG132+poly IC (6 h, 100 μg/ml) or infected with VSV (16 h, moi=0.001). After treatment, cells were photographed under phase contrast microscopy to illustrate morphological changes associated with those treatments. B) i. WT and −/−BMK cells were left untreated, infected with VSV (moi=0.001) or EMCV (moi=0.01) for 16 h, or treated with thapsigargin (TG; 1 μm) or bortezomib (20 nM) for 16 h. RNA was isolated and RT-PCR studies were performed using primers specific for mouse Noxa and mouse

GAPDH as a loading control. ii. CHOP (a marker of ER stress) mRNA levels were quantified by using real time SYBR green-based qRT-PCR. C) i. WT BMK cells were left uninfected or were infected with replication competent VSV (moi=0.001) or UV- inactivated VSV (moi=0.1) for 16 h, after which time photomicrographs of the cells were taken under phase contrast microscopy. ii. Viability of cells treated as in “i” was determined by SRB staining, and results were presented as a percentage of the staining observed in uninfected controls. iii. Cells were infected as above and apoptosis demonstrated by immunoblot analysis of caspase 3 cleavage. D) Induction of ER stress- regulated and dsRNA-regulated genes was assessed by RT-PCR analysis of WT BMK cells infected with either wild-type VSV (moi=0.001) or UV-inactivated virus (moi=0.1)

16 h after infection. Mouse GAPDH was used as an internal control.

134

135

136

Fig 19: Inhibition of ER stress response blocks Noxa upregulation and viral CPE. A) i. WT BMK cells were left untreated (Ctrl) or were infected with VSV (16 h, moi=0.001),

EMCV (16 h, moi=0.01), TG (16 h, 1 μM) or bortezomib (16 h, 20 nM) with or without prior treatment with the ER stress inhibitor salubrinal (Sal; 75 μM, 24 h). Total cellular

RNA was then isolated and reverse transcribed for RT-PCR analysis of CHOP and Noxa mRNA induction. GAPDH was used as an internal control. ii. To quantify CHOP and

Noxa mRNA expression, SYBR green-based qRT-PCR was used and the values were normalized to GAPDH. B) i. WT BMK cells were infected with VSV or EMCV or treated with TG, with or without Sal (75 μM) pretreatment. After 16 h, photomicrographs were taken to illustrate morphological changes associated with VSV, EMCV and TG cytopathicity.

137

138

Fig 20: Noxa mechanism of action in MG132/dsRNA treated A375 cells. A)

Immunoblot analysis of Noxa upregulation by IFN-α (1000 U/mL, 16 h), dsRNA (poly

IC, 100 μg/mL, 6 h), MG132 (10 μM, 6 h) and combinations thereof in A375 melanoma cells. Because of the significant synergistic increase in Noxa protein levels, as compared to single treatments, a short exposure was chosen for the clearest representation of all samples. Cell death was qualitatively assessed by immunoblotting for caspase 3 and quantified by assessing the number of trypan blue positive cells. B) i. Mcl-1 was immunoprecipitated from cells treated for the indicated times and Noxa association was assessed by immunoblotting. Noxa was associated with Mcl-1 basally and exhibited enhanced association with treatment, combined with Mcl-1 cleavage (ns=non-specific; arrowheads=cleaved forms). Replicate samples were used to immunoprecipitate Bax with the active conformation-specific 6A7 antibody, followed by immunoblotting to show Bax 139

activation upon MG132/dsRNA treatment. Fractionation of cells to generate post- mitochondrial cytosolic extracts was used to assess the presence of released cytochrome c. A parallel study was done showing Noxa upregulation, caspase 3 activation and Mcl-1 cleavage in whole-cell lysates (WCL). Bax, Bcl-2, and Bak blots are provided to show lack of change in the levels of these proteins. ii. A375 melanoma cells were left untreated or infected with VSV (16 h, moi=0.001) or EMCV (16 h, moi=0.01), or treated with TG

(16 h, 1 μM). As described in “i”, cells were harvested for either immunoprecipitating active Bax or fractionated to assess the presence of cytochrome c in post-mitochondrial cytosolic extracts. C) i. Cells were reverse transfected with control or Noxa-specific siRNAs and treated for up to 6 h with dsRNA and MG132. After treatment, cells were stained with TMRE (10 μM) and then analyzed by flow cytometry to detect changes in mitochondrial membrane potential. Treatment of a subset of control cells with the protonophore CCCP was used to set the marker for the TMRE-low population. The percentage of cells with depolarized mitochondrial membranes is indicated in each histogram. ii. A portion of cells not subjected to flow cytometry was also analyzed for cell death by immunoblotting for caspase 3 and staining with trypan blue. Successful knockdown of Noxa was also confirmed by immunoblotting. (Done by Dr. Rosebeck)

140

Fig 21: EMCV replication in WT and −/− cells. A) The indicated BMK cell lines were infected with EMCV (moi = 0.01 or 0.001) for 16 h. The conditioned medium was harvested and applied to indicator HT1080 cells in Log10 dilutions. After an additional

16–24 h, indicator cells were fixed and stained with crystal violet and viral titers were quantified as the dilution providing 50% cytopathicity and expressed as a value relative to that observed in WT BMK infected with moi = 0.01. B) To assess virus RNA accumulation, cells were infected with EMCV (moi = 0.01) for 16 h and then total cellular RNA was isolated and reverse transcribed into cDNA that was used as a template for RT-PCR analysis of EMCV 3D-polymerase mRNA expression. GAPDH served as a cellular RNA control. C) To further assess EMCV replication, 3-D polymerase protein expression was assessed by immunoblotting in WT or Noxa −/− cells infected with

EMCV (moi = 0.01) for the indicated times. D) To demonstrate that Noxa null cell 141

resistance to viral CPE was not solely due to reduced viral replication rates, WT and

Noxa −/− BMK cells were infected with VSV at a moi > 1.0. Eight hours later, cells were fixed and stained with DAPI and VSV G-protein Ab (FITC secondary). The data show that infection and VSV G-protein expression was comparable in each cell line, but CPE observed only in the WT BMK cells. (Fig C was done by Tiannan Chen)

142

Fig. 22: Induction of ATF4, activation of Caspase 12 and expression of Puma and

Bim in virus-infected WT and Noxa −/− cells. A) WT and −/− BMK cells were left untreated or infected with VSV (moi = 0.001) or EMCV (moi = 0.01) for 16 h, or treated with thapsigargin (TG; 1 μm, 16 h) or bortezomib (20 nM, 16 h). RNA was isolated and

RT-PCR studies were performed using primers specific for mouse CHOP, Noxa, ATF4 or GAPDH as a loading control. Like CHOP, induction of ATF4 was observed in both

WT and Noxa −/− BMK cells in response to all treatments. B) Cells were treated as in A, but with or without pretreatment with Salubrinal, and then ATF4 mRNA expression monitored by RT-PCR. In each case, Salubrinal reduced the induction of ATF4 by these stimuli, suggesting an involvement of ER stress in the induced expression. C) WT BMK

143

cells were treated with VSV, EMCV, TG and Tunicamycin (TM; 10 μg/ml) and then

Caspase 12 cleavage assessed in cell lysates by immunoblotting. Cleavage of the pro- caspase 12 was observed with all treatments, although complete cleavage was observed only in the virus-infected samples. D) WT or Noxa −/− BMK cells were left untreated or infected with VSV (moi = 0.001) for 16 h, or treated with dsRNA (ds, poly IC 100 μg/ml,

8 h) thapsigargin (TG; 1 μm, 16 h) or bortezomib (20 nM, 16 h). RNA was isolated and

RT-PCR studies were performed using primers specific for mouse CHOP, Bim, Noxa,

PUMA or GAPDH as a loading control.

144

Fig 23: Combinatorial effects of various stimuli on Noxa and CHOP expression and cellular apoptosis. A) The experiment described in 19A was repeated to provide stronger evidence for Noxa protein induction by dsRNA alone in these cells. Caspase 3 cleavage was again assessed as an indicator of cellular apoptosis. B) A375 melanoma cells were treated with the indicated stimuli, and RNA was isolated and reverse transcribed into cDNA that was used as a template for RT-PCR analysis of Noxa, CHOP/GADD153 and

GADD34 mRNA expression. GAPDH served as a cellular RNA control. C) To quantify the above RT-PCR results, Noxa and CHOP mRNA levels were quantified by using real time SYBR green-based qRT-PCR. Results were normalized to GAPDH and quantified using the ddCt method. Numbers correspond to treatments from part C. D) A375

145

melanoma cells were left untreated or infected with VSV (16 h, moi = 0.001) or EMCV

(16 h, moi = 0.01), or treated with thapsigargin (TG; 16 h, 1 μM) or Bortezomib (16 h,

20 nM). Cells were harvested and fractionated to assess the presence of cytochrome c in mitochondrial or post-mitochondrial cytosolic extracts. Actin was used as a loading control, while COX IV was used as a mitochondrial marker. (Fig B and C was done by

Dr. Rosebeck)

146

Fig. 24: Model for Noxa induction by virus and other stimuli: involvement of ER

Stress responses. The data presented in this and previous reports suggest that Noxa is regulated by virus through both IRF3-dependent regulation and ER stress-induced pathways. Of these, our data suggest that ER stress response signaling is most critical for

Noxa regulation. These same pathways are also known to mediate Noxa induction by other ER stressors, including proteasome inhibition, thapsigargin or tunicamycin. In tumor cells, it has been proposed that c-myc also regulates Noxa expression following proteasome inhibition (Nikiforov et al., 2007).

147

Fig 25: Mouse ISG12 expression in different organs: From the indicated tissues, total

RNA was isolated and reverse transcribed to cDNA that was used as a template for RT

PCR analysis for mISG12a and mISG12b2 expression. GAPDH was used as an internal control

148