Tumor Progression Is Mediated by Thymosin-B4 Through a Tgfb/MRTF Signaling Axis Tsuyoshi Morita and Ken'ichiro Hayashi

Published OnlineFirst January 12, 2018; DOI: 10.1158/1541-7786.MCR-17-0715

Signal Transduction Molecular Cancer Research Tumor Progression is Mediated by Thymosin-b4 through a TGFb/MRTF Signaling Axis Tsuyoshi Morita and Ken'ichiro Hayashi

Abstract

Although enhanced thymosin b4 (TMSB4X/Tb4) expression is level of tumor-associated genes, which is regulated by the TGFb/ associated with tumor progression and metastasis, its tumor- MRTFs pathway. In multiple human cancers, Tb4 levels correlate promoting functions remain largely unknown. Here, it is dem- positively with TGFb1 and the tumor-associated gene expression onstrated that TGFb facilitates Tb4 expression and leads to the levels through processes that respectively depend on TGFb recep- activation of myocardin-related transcription factors (MRTF), tor 1 (TGFBR1) and MRTF expression. Kaplan–Meier survival which are coactivators of serum response factor (SRF) and regulate analyses demonstrate that high Tb4 expression associates with the expression of genes critical for the epithelial–mesenchymal poor prognosis in an SRF expression–dependent manner in sev- transition (EMT) and tumor metastasis. In murine mammary eral cancers. In mice, Tb4 KO clones show significantly decreased gland cells (NMuMG), Tb4 upregulation is required for full experimental metastatic potential; furthermore, ectopic expres- induction of a MRTF-regulated EMT gene expression program sion of constitutively active MRTF-A fully restores the diminished after TGFb stimulation. Tb4 levels are transcriptionally regulated metastatic activity. In conclusion, the TGFb/Tb4/MRTF/SRF path- via the novel cis-acting element AGACAAAG, which interacts with way is critical for metastasis and tumor progression. Smad and T-cell factor/lymphoid enhancer factor (TCF/LEF) to synergistically activate the Tb4 promoter downstream of TGFb. Implications: These findings define a molecular mechanism Murine skin melanoma cells (B16F0 and B16F1) also show the underlying a tumor-promoting function of thymosin b4 through expression regulation of Tb4 by Smad and TCF/LEF. Tb4-knockout activation of MRTF/SRF signaling. Mol Cancer Res; 1–14. 2018 B16F1 (Tb4 KO) clones show significantly diminished expression AACR.

Introduction fibrosis (8). In short, MRTFs are central players in the TGFb- induced phenotypic changes accompanied by cytoskeletal remo- Dynamic cytoskeletal remodeling is critical to various morpho- deling. However, the pathway from TGFb signaling to MRTF genetic and pathologic events, such as gastrulation, neural tube activation is not thoroughly understood. MRTF activity is gener- formation, tissue fibrosis, and tumor progression. TGFb family ally regulated by the binding of N-terminal RPEL motifs to three to proteins are well-known pivotal inducers of these events (1). For five monomeric G-actin molecules, which prevents the importin- example, TGFb induces the phenotypic transition of various types mediated nuclear translocation of MRTFs (4, 9, 10). Depletion of of cells into mesenchymal, myofibroblast, and smooth muscle– the cytosolic free G-actin pool leads to the nuclear accumulation like cells, accompanied by dramatic cytoskeletal remodeling and and activation of MRTFs as transcriptional regulators. increased cell motility (2, 3). Myocardin-related transcription Thymosin-b4(Tb4; TMSB4X) is a very abundant small factors (MRTFs; MKL1 and MKL2), or robust SRF transcriptional (43-amino-acid) protein that regulates actin dynamics by binding coactivators, have been reported to organize actin cytoskeletal monomeric G-actin via its WH2 domain with 1:1 stoichiometry, rearrangement and regulate cell motility by controlling the expres- thus sequestering G-actin from spontaneous polymerization in sion of dozens of cytoskeletal/adhesion genes (4–6). the cytosol (11). In addition, Tb4 has garnered considerable We have previously reported that MRTF activation is required attention as a tumor promoter (12). Augmented Tb4 expression for cytoskeletal rearrangement during the TGFb1-induced epithe- is frequently observed during tumor progression and is associated lial–mesenchymal transition (EMT; ref. 7). MRTFs also induce with poor prognosis in various cancers. Although additional cytoskeletal and extracellular matrix gene expression and are functional targets of Tb4 have been reported (13, 14), the molec- therefore critical for TGFb-mediated myofibroblast activation in ular mechanisms underlying the role of this protein in tumor progression remain largely unclear. Previously, we have identified Tb4 as a regulator of MRTF activity: Tb4-bound G-actin cannot Department of RNA Biology and Neuroscience, Osaka University Graduate interact with MRTFs (15). Specifically, the Tb4 WH2 domain and School of Medicine, Osaka, Japan. MRTF RPEL motifs competitively interact with the same hydro- Note: Supplementary data for this article are available at Molecular Cancer phobic clef in the actin molecule (16, 17). Therefore, an increased Research Online (http://mcr.aacrjournals.org/). Tb4 level causes actin/MRTF complex dissociation and conse- Corresponding Author: Tsuyoshi Morita, Osaka University Graduate School of quently, nuclear MRTF accumulation and activation. Here, we Medicine, Yamadaoka 2-2, Suita, Osaka 5650871, Japan. Phone: 816-6879-3827; uncover the molecular mechanisms underlying the TGFb/Tb4/ Fax: 816-6879-3828; E-mail: [email protected] MRTF signaling pathway in EMT, metastasis, and tumor progres- doi: 10.1158/1541-7786.MCR-17-0715 sion by demonstrating that TGFb increases Tb4 expression by 2018 American Association for Cancer Research. activating Smad and T-cell factor/lymphoid enhancer factor

www.aacrjournals.org OF1

Morita and Hayashi

(TCF7/LEF1) signaling. Subsequently, the elevated Tb4 level incubated in blocking solution (0.1% Triton X-100, 0.2% BSA, induces changes in MRTF-regulated gene expression profiles. and 10% normal goat serum in PBS) for 30 minutes. The cells were incubated in a primary antibody solution [1:50 to 1:100 dilutions Materials and Methods in Can Get Signal immunostaining reagent (TOYOBO)] for Animal studies 2 hours and in a secondary antibody solution [1:400 dilutions All animal procedures were approved by the Animal Care of Alexa 488- or 568-conjugated secondary antibodies (Thermo Committee of Osaka University (Osaka, Japan), and all animal Fisher Scientific) in blocking solution] for 2 hours. Hoechst 33342 care and protocols were conducted according to the guidelines for (Thermo Fisher Scientific) was added to the secondary antibody animal experiments of the Osaka University School of Medicine. solution for nuclear visualization. The mounted cells were For metastatic analyses, suspensions of wild-type B16F1, Tb4 observed using an all-in-one fluorescence microscope (BZ-9000; KO, and KO/MRTF cells (2 104 cells/0.5 mL of HBSS) were Keyence). Anti-Tb4 (EMD Millipore), anti-MKL1 (Santa Cruz intravenously injected into 8- to 10-week-old female C57BL/6j Biotechnology), anti-GFP (Thermo Fisher Scientific) and anti-myc mice. Three weeks after the injection, the extracted lungs were (Santa Cruz Biotechnology) were commercially purchased. fixed and bleached in Fekete's solution (60% ethanol, 3% form- aldehyde, and 4% glacial acetic acid) to easily visualize the B16F1 Western blotting tumor nodules. Clearly visible metastatic nodules on the lung Cells were lysed in SDS sample buffer [2% SDS, 125 mmol/L surface were counted. diothiothreitol (DTT), 0.005% bromophenol blue, 10% glycerol 3 and protease inhibitor cocktail (Nacalai Tesque), in 62.5 mmol/L In addition, B16F1 and Tb4 KO cells (4 10 cells/0.1 mL of HBSS) were subcutaneously inoculated into mice, and resulting Triton-HCl (pH 6.8)] and heated at 98 C for 5 minutes. Proteins tumors were extracted 3 weeks after the inoculation. To inhibit TGFb were separated electrophoretically on 10% to 15% polyacryl- fl pathway activation, EW-7197 (AdooQ Bioscience; 5 mg/kg) was amide gels and transferred to polyvinylidene di uoride (PVDF) orally administered twice on days 2 and 1 before tumor extraction. membranes (EMD Millipore). The membranes were incubated in To investigate the in vivo effects of TGFb1onTb4 expression, blocking solution [1% skim milk in TBS-T solution (0.1% Tween- TGFb1 (PeproTech; 100 mg/kg) was intraperitoneally adminis- 20, and 137 mmol/L NaCl in 20 mmol/L Tris-HCl, pH7.5)] for 30 – tered to 3-day-old female mice. Liver tissues were extracted 3 days minutes, in a primary antibody solution [1:2,000 5,000 dilutions after the administration. in Can Get Signal immunoreaction enhancer solution (TOYOBO)] for 2 hours, and in a secondary antibody solution Cell cultures, treatments, and transfections [1:5,000 dilutions of horseradish peroxidase–linked secondary NMuMG, B16F0, and B16F1 cells were obtained from ATCC in antibodies (GE Healthcare) in TBS-T] for 2 hours. To detect Tb4 2006, ATCC in 2012, and RIKEN BRC in 2012, respectively. Cell protein, the PVDF membranes were fixed with 1% paraformal- authentication and mycoplasma testing were not performed by dehyde for 30 minutes before blocking. Anti–b-actin (Sigma), ourselves. All cells were cultured in DMEM (WAKO) supple- anti-Tb4 (EMD Millipore), anti-FLAG (Sigma), and anti-HA mented with 10% FBS (Bovogen Biologicals) and maintained (Roche Life Science) antibodies were commercially purchased. for no more than 10 passages. Cells were treated with 10 ng/mL of TGFb1, 50 ng/mL of Wnt3a (PeproTech), 10 mmol/L Real-time RT-PCR RexSox (Cayman Chemical), 10 mmol/L SIS3 (Cayman Chemi- Total RNAs were extracted using RNAiso Plus (TAKARA BIO) cal), or 10 mmol/L FH535 (Focus Biomolecules). To observe the and then reverse transcribed using a PrimeScript RT Reagent Kit nuclear translocation of MRTF-A, 5 ng/mL of leptomycin B with gDNA Eraser (TAKARA BIO). Real-time PCR was performed (Calbiochem) was added into the culture medium along with using the THUNDERBIRD SYBR qPCR Mix (TOYOBO) and a TGFb1. Vectors were transfected into cells using Lipofectamine LightCycler Nano (Roche Life Science). Data were normalized to 3000 (Thermo Fisher Scientific) or ViaFect Transfection Reagent GAPDH, RPL13A, and 18S rRNA expression. The primer sequences (Promega) according to the manufacturer's instructions. In the used in this study are presented in Supplementary Table S1. knockdown experiments, cells were transfected with predesigned siRNAs via Lipofectamine RNAiMAX (Thermo Fisher Scientific). Promoter analysis The target sequences of the siRNAs used in this study are available A DNA fragment from the promoter region of mouse in Supplementary Table S1. MISSION siRNA Universal Negative Tmsb4x was isolated by PCR and inserted into the pGL3-Basic Control (Sigma-Aldrich) was used as a negative control. To vector (Promega). Twelve copies of a synthetic TRE sequence establish stable Tb4-overexpressing cell lines, NMuMG cells were (agATCAAAGggggta) were tandemly inserted into pGL3- cotransfected with a mammalian expression vector (pCAGGS) g-actin-TATA (7). The CArG-promoter and Acta2-promoter con- encoding the mouse Tmsb4x gene and Linear Hygromycin Markers structs have been described previously (18). These promoter- (Clontech Laboratories). To establish Tb4 KO cell lines using the reporter constructs were introduced into NMuMG or B16F1 cells CRISPR-Cas9 system, B16F1 cells were transfected with all-in-one using pSV-bGal (Promega), and the resulting luciferase and Cas9/gRNA plasmid pSpCas9 BB-2A-GFP (PX458; Addgene; b-galactosidase activities were measured using a Luciferase Assay gRNA target sequence, ccatgtctgacaaacccgatatg). Gene knockout System (Promega) and Galacto-Star (Roche Life Science), respec- was validated by genome sequencing and Western blotting. KO/ tively. Luciferase activity levels were normalized to b-galactosi- MRTF cell lines were isolated from Tb4 KO2 cells transfected with dase activity levels. pcDNA3.1-CA-MRTF-A (7). Chemical crosslinking Immunocytochemistry NMuMG cells were treated with 10 ng/mL of TGFb1 for 24 NMuMG, B16F0, and B16F1 cells were cultured on coverslips, hours, followed by 1 mmol/L latrunculin A (Cayman Chemical) fixed with 4% paraformaldehyde in PBS for 15 minutes and for 30 minutes. The cells were subsequently incubated with

OF2 Mol Cancer Res; 2018 Molecular Cancer Research

TGFb/Tb4/MRTF Signaling in Tumor Progression

2.5 mmol/L dithiobis (succinimidyl propionate; DSP; Thermo analysis of covariance (ANCOVA). The Kaplan–Meier survival Fisher Scientific) in PBS for 1 hour, after which crosslinking was analysis was performed using JMP Pro 12 software, and survival terminated by adding 20 mmol/L Tris-HCl (pH8.0). The resulting data were statistically analyzed using the Wilcoxon rank-sum test cells were lysed in DTT-free SDS-PAGE buffer, and the cross-linked and log-rank test. proteins were separated and visualized by Western blotting. Data availability – Protein DNA binding assay All microarray data for this study have been deposited in the Biotin-labeled DNA probes containing wild-type or mutated Gene Expression Omnibus (GEO) database under the accession ST1 sites were synthesized by PCR (WT; gggagacaagcgaggg- number GSE99492. Previously published RNA-seq and clinical AGACAAAGagggccgggt, mut SBE; gggagacaagcgagggAtACAAA- datasets that were reanalyzed in this study are available via the Gagggccgggt, mut TCF; gggagacaagcgagggAGACgggGagggccgggt) TCGA Data Portal (https://tcga-data.nci.nih.gov). and subsequently bound to streptavidin on Dynabeads M-280 fi (Thermo Fisher Scienti c). The recombinant proteins HA-Smad3, Results HA-Smad4, and FLAG-LEF1 were synthesized in HEK293T cells b b and incubated with the DNA-bound Dynabeads in 0.5% NP-40, Increased T 4 expression is required for TGF -induced MRTF 10% glycerol, and protease inhibitor cocktail in PBS for 3 hour. activation during EMT in NMuMG cells The resulting DNA–protein complexes were magnetically pulled We have previously reported on the pivotal functions of MRTFs down and using SDS sample buffer. The precipitated proteins in TGFb-induced EMT (7), an important event in the acquisition were then separated and visualized by Western blotting. of invasive and metastatic abilities (19). In murine mammary gland NMuMG cells, TGFb1 increased the activity of a synthetic reporter construct containing CArG boxes, or MRTF/SRF complex- Microarray analysis binding cis-acting elements (Fig. 1A). Furthermore, TGFb1 Total RNAs were extracted from Tb4 KO and parental B16F1 increased the promoter activity of Acta2, a major MRTF target in cells using RNAiso Plus and purified using NucleoSpin RNA EMT, in a CArG box–dependent manner (Fig. 1B). The latter Plus (Macherey-Nagel). Next, 100 ng of total RNA was ampli- activity was completely suppressed by the MRTF inhibitor CCG- fied and labeled using a Low Input Quick Amp Labelling Kit, 1423 (Fig. 1B). We also identified Tb4 as a downstream target of One-Color (Agilent Technologies). Cy3-labeled cRNA were TGFb1 during EMT (Fig. 1C), and its expression exhibited a hybridized on a SurePrint G3 Mouse Gene Expression 8 similar increase over time as that of MRTF/SRF activation after 60K Microarray (Agilent Technologies). The hybridized images TGFb1 stimulation (Fig. 1A and D). In contrast, the expression of were scanned using a SureScan Microarray Scanner (Agilent thymosin-b10 (Tmsb10), a thymosin-b family protein with high Technologies) and analyzed using Feature Extraction Software similarity to Tb4, was significantly but only slightly increased after (v12.0.3.1; Agilent Technologies). A Gene Ontology (biological TGFb1 stimulation (Fig. 1D). process) analysis was performed using DAVID functional anno- We have previously reported that increased Tb4 level tation tools. expression enhances MRTF activity through Tb4/G-actin complex formation (15). Tb4, a small (5 kDa) protein, forms a Clinical dataset analysis roughly 45-kDa complex with monomeric actin, as visualized The Cancer Genome Atlas (TCGA) mRNA expression and by chemical crosslinking with DSP (Fig. 1E). TGFb1stimula- clinical datasets were downloaded from the cBioPortal for Cancer tion increased complex formation, whereas latrunculin A Genomics and included cutaneous melanoma (TCGA, provision- (LatA) prevented complex formation by binding to and occu- al), breast invasive carcinoma (TCGA, provisional), renal clear cell pying the Tb4-binding sites of actin molecules (20). Tb4 carcinoma (TCGA, Nature 2013), hepatocellular carcinoma knockdown suppressed the nuclear accumulation of MRTF- (TCGA, provisional), papillary thyroid carcinoma (TCGA, Cell A and activation of MRTFs/SRF after TGFb stimulation (Fig. 1F 2014), lower grade glioma (TCGA, provisional), and glioblasto- and G). Furthermore, ectopic Tb4 overexpression robustly ma (TCGA, Cell 2013). These datasets did not distinguish the enhanced MRTF-A nuclear accumulation and MRTFs/SRF expression of TMSB4X and TMSB4XP8, which have highly similar activity even in the absence of TGFb1 (Fig. 1H and I). In sequences; only six single-nucleotide mismatch sites and one summary, elevated Tb4 competitively prevents MRTF/G-actin four-nucleotide deletion site were detected in the 633-b TMSB4X complex formation, leading to nuclear MRTF accumulation mRNA. However, TMSB4XP8 is a pseudogene expressed at and subsequent MRTFs/SRF signaling activation during TGFb- extremely low levels relative to TMSB4X, at least in cultured induced EMT. human cell lines. Previously, we have shown that MRTFs regulate the expression of various EMT-related genes during TGFb1-induced EMT in Statistics and reproducibility canine normal kidney epithelial MDCK cell lines (7). We con- Data from the in vitro experiments were subjected to a statistical firmed that MRTFs also controlled EMT-related gene expression in analysis using Student two-tailed t test or the two-tailed Mann– NMuMG cells (Supplementary Fig. S1A), whereas Tb 4 knock- Whitney U test. Correlation coefficients were calculated using down significantly abolished these transcriptional changes (Fig. Pearson correlation test or Spearman correlation test. All experi- 1J). Using stably Tb4-overexpressing NMuMG cell lines, we dem- ments were repeated independently at least three times. Data are onstrated a morphologic change from an epithelial to a mesen- presented as means SEM. Statistical significance is indicated by chymal cell shape and altered EMT-related gene expression levels P values ( , P < 0.05 and , P < 0.01). In the regression analysis, after EMT, even in the absence of TGFb1 (Supplementary Fig. outliers were excluded using the Smirnov–Grubbs test, and dif- S1B–S1D). Thus, Tb4 upregulation is critical for TGFb-induced ferences between two groups were statistically evaluated using an EMT.

www.aacrjournals.org Mol Cancer Res; 2018 OF3

Morita and Hayashi

Figure 1. Tb4 is required for MRTF activation during TGFb1-induced EMT in NMuMG cells. A, CArG-promoter assay of cells treated with TGFb1. Numbers indicate the elapsed time after stimulation. B, Acta2-promoter assay using reporter constructs containing wild-type (WT) or mutated (mut) CArG boxes. To inhibit MRTF activity, cells were treated with CCG1423. C, Induction of Tb4 protein expression by TGFb1. Immunocytochemistry of endogenous Tb4 (left). To visualize nuclei, cells were costained with Hoechst. Scale bar, 20 mm. Western blotting with anti-Tb4 and anti-GAPDH (loading control) antibodies (right). D, Quantification of Tmsb4x and Tmsb10 expression levels by real-time RT-PCR. Numbers indicate the elapsed time after TGFb1 stimulation. E, Chemical crosslinking between Tb4and b-actin proteins using dithiobis (succinimidyl propionate; DSP). Proteins were visualized by Western blotting. F, Immunocytochemistry of endogenous MRTF-A in control or Tb4 knockdown cells (left). Scale bar, 50 mm. The subcellular localization of MRTF-A was scored as predominantly cytoplasmic (Nuc < Cyt), nuclear (Nuc > Cyt), or uniformly distributed (Nuc ¼ Cyt; right). G, CArG-promoter reporter assay of control or Tb4 knockdown cells (right). Knockdown efficiency was evaluated by real-time RT-PCR (left). H, Immunocytochemistry using anti-GFP, anti-myc, and/or anti-MRTF-A antibodies in cells exogenously expressing GFP (as a control) or Tb4-myc (left). Scale bar, 50 mm. The subcellular localization of MRTF-A was scored (right). I, CArG-promoter reporter assay of cells exogenously expressing GFP or Tb4-myc. J, Quantified expression levels of EMT-related genes by real-time RT-PCR in control or Tb4 knockdown NMuMG cells. All statistical data in Fig. 1 are presented as means SEMs. , P < 0.05; , P < 0.01; two-tailed Student t test.

OF4 Mol Cancer Res; 2018 Molecular Cancer Research

TGFb/Tb4/MRTF Signaling in Tumor Progression

TGFb1 signaling controls Tb4 promoter activity via a novel enhanced Tb4 expression in B16F1 cells relative to B16F0 cells, cis-acting element despite comparable levels of Serpine1 induction (Fig. 3A). In As observed in NMuMG cells, TGFb1 stimulation upregulated B16F1 cells, Tb4 protein was strongly expressed and formed a Tb4 expression in various mouse and human cells (Fig. 2A) and complex with b-actin, especially after TGFb1 stimulation; in increased Tb4 expression, accompanied by Acta2 upregulation, in contrast, Tb4 was rather weakly expressed in B16F0 cells (Fig. vivo (Fig. 2B and C). These data suggest that TGFb signaling 3B). Accordingly, CArG-box promoter analyses showed that universally controls Tb4 expression. Knockdown of Smad4, a TGFb1 significantly activated MRTF/SRF only in B16F1 cells, a canonical downstream effector of the TGFb cascade, suppressed process attenuated by Tb4 knockdown (Fig. 3C and D); thus, the TGFb1-induced Tb4 expression (Fig. 2D). Tb4 induction was also high Tb4 level promotes the activation of MRTFs in B16F1 cells. severely suppressed by treatment with the TGFb type I receptor Furthermore, TGFb1 increased the nuclear translocation of MRTFs inhibitor RepSox and the Smad3-specific inhibitor SIS3 (Fig. 2E), in B16F1 cells, which was also attenuated by Tb4 knockdown (Fig. indicating involvement of the canonical TGFb/Smad pathway in 3E). In B16F0 cells, ectopic Tb4 expression remarkably induced Tb4 induction. nuclear MRTF-A accumulation and MRTF/SRF activation (Fig. 3F For a detailed investigation of the mechanism underlying Tb4 and G). transcription regulation, a DNA fragment upstream of exon 1 of As in NMuMG cells, RepSox, SIS3, and FH535 all inhibited the mouse Tb4 gene was subjected to a promoter analysis. TGFb1 TGFb1-induced Tb4 upregulation in B16F1 cells (Fig. 3H), where- stimulation equivalently activated reporter constructs containing as SIS3 but not FH535 inhibited Serpine1 induction (Fig. 3I). the 3,145-b or 523-b fragment, but not the 254-b fragment (Fig. Treatment with these inhibitors and Smad4 knockdown also 2F). From a Tb4 promoter region sequence comparison across reduced basal Tb4 expression (Fig. 3J and K), suggesting that multiple mammals, we identified evolutionally conserved Smad- autocrine TGFb signaling contributes to the high basal Tb4 binding elements (SBE: cAGACa) between 254 and 523, expression in B16F1 cells. The expression levels of Smad and together with other predicted cis-elements (Fig. 2G; Supplemen- TCF/LEF pathways signaling components were compared tary Fig. S2). The human and mouse genomes harbor two copies between the two melanoma variants to elucidate the cause for of highly conserved DNA sequences (ST1 and ST2: AGACAAAG) the differences in TGFb responsiveness (Fig. 3L). Notably, Tgfr1, containing a partially overlapping SBE and TCF/LEF transcrip- Tgfr2, Smad3, Tcf7, and Lef1 expression was significantly stronger tional response element (TRE: ACAAAG). Mutation of the ST1 and in B16F1 cells. Moreover, Tcf7 and LEF1 knockdown attenuated ST2 sequences in the 523-b construct completely abolished TGFb TGFb1-induced Tb4 expression (Fig. 3M), suggesting that in responsiveness (Fig. 2H), suggesting the involvement of Smad addition to the canonical Smad pathway, TCF/LEF activation is and/or TCF/LEF. In a DNA–protein binding assay, both Smad3/4 important for TGFb-induced Tb4 expression. and LEF1 proteins bound to a short DNA fragment containing the ST1 site, but not to fragments containing a mutated SBE or TRE Tb4 regulates the expression of MRTF-target genes (Fig. 2I). The ectopic expression of constitutively active Smad3/4 In the tumor microenvironment, TGFb is supplied to cancer and LEF1 synergistically activated the Tb4 promoter construct, cells in an autocrine/paracrine manner, which exacerbates tumor whereas mutations of the ST1 and ST2 sites notably abolished progression and metastasis (25). When B16F1 cells were subcu- these activations (Fig. 2J), suggesting that both Smad and TCF/LEF taneously inoculated into mice, Tb4 expression levels increased directly control Tb4 expression via the ST1 and ST2 sites. considerably in the resulting tumors, although this was signifi- TCF/LEF has been reported as a noncanonical downstream cantly attenuated by treatment with an orally bioavailable TGFb effector of TGFb (21–23). A synthetic reporter construct contain- receptor inhibitor, EW7197 (Fig. 4A). To investigate the role of ing 12 tandemly arranged TRE sequences was designed to monitor Tb4 in B16F1 metastasis, we isolated Tb4-knockout B16F1 cell TCF/LEF activity and was predictably activated by Wnt3a, a typical lines (KO1 and KO2) using the CRISPR-Cas9 system (Fig. 4B) and b-catenin/TCF/LEF pathway activator, and constitutively active performed a microarray analysis. Downregulated genes in Tb4- LEF1 (Fig. 2K). TGFb1 actually activated this construct, which was KO cells included several TGFb1-inducible genes (Fig. 4C and D; severely suppressed by the b-catenin/TCF inhibitor FH535, indi- Supplementary Table S2); furthermore, the expression of these cating the ability of TGFb1 to activate TCF/LEF signaling. Fur- genes was largely reduced by CCG1423 treatment (Fig. 4C–E). A thermore, ST1/ST2 mutation abolished the synergistic activating Gene Ontology (GO) analysis of downregulated genes in KO cells effects of TGFb1 and Wnt3a on the Tb4 promoter construct (Fig. revealed significant enrichment for terms related to circadian 2L). FH535 also inhibited the TGFb1-induced upregulation of rhythm, cell proliferation, cell migration, and cytoskeleton/adhe- endogenous Tb4, whereas upregulation of the Serpine1 gene, a sion (Fig. 4F; Supplementary Table S3), which were also report- direct downstream target of TGFb/Smad signaling, was inhibited edly enriched among the GO terms of MRTF-regulated genes (6). by SIS3 but not FH535 (Fig. 2E). These findings indicate that Therefore, Tb4 almost certainly regulates MRTF activity down- Smad and TCF/LEF cooperatively regulate Tb4 transcription stream of TGFb signaling in B16F1 cells. downstream of TGFb signaling via the ST1 and ST2 elements. Among the Tb4-regulated genes, we focused on Itgb1, Mmp14, Myh9, Myl9, Tpm3, and Wisp1, because expression of these genes B16F1 cells exhibit stronger responsiveness than B16F0 cells to reportedly depends on MRTF activity and is strongly associated TGFb/Tb4/MRTF signaling with tumor metastasis (Fig. 4G; refs. 6, 26–31). We confirmed the Clark and colleagues have previously reported enhanced Tb4 reduced expressions of these genes in Tb4-KO tumors formed by expression in highly metastatic B16 murine melanoma cell var- subcutaneous inoculation into mice (Supplementary Fig. S3). iants (F1, F2, and F3) subcloned by repeated in vivo metastatic Transient Tb4 knockdown, as well as SRF knockdown and double selection from poorly metastatic B16F0 cells (24). We observed MRTF-A/B knockdown, also reduced their expressions in B16F1 considerably higher basal expression of Tb4 in B16F1 cells relative cells (Fig. 4H). Meanwhile, transient overexpression of Tb4or to B16F0 cells (Fig. 3A). Moreover, TGFb1 more strongly MRTF-A partially restored the expression of these Tb4-regulated

www.aacrjournals.org Mol Cancer Res; 2018 OF5

Morita and Hayashi

Figure 2. Molecular mechanism underlying the transcriptional regulation of Tb4byTGFb signaling. A, Fold changes in endogenous Tmsb4x induction by TGFb1 in indicated cells, calculated using real-time RT-PCR. B, In vivo induction of endogenous Tmsb4x in mouse livers via intraperitoneal TGFb1 administration. Bars indicate mean scores. , P < 0.05, two-tailed Mann–Whitney U test. C, Correlation between Tmsb4x and Acta2 expression in the liver. r, Spearman rank correlation coefficient. D, Quantified endogenous Tmsb4x expression levels by real-time RT-PCR in control or Smad4 knockdown NMuMG cells (right). Knockdown efficiency was evaluated by real-time RT-PCR (left). E, Quantified endogenous Tmsb4x and Serpine1 expression levels by real-time RT-PCR. NMuMG cells were pretreated with the indicated reagents and subsequently stimulated by TGFb1. F, Promoter assay with reporter constructs containing Tb4 promoter regions. Numbers indicate the nucleotide positions upstream of exon 1 of the mouse Tmsb4x gene. G, Schematic representation of the Tb4 promoter region (top). SBE, SMAD-binding element; TRE, TCF/LEF transcriptional response element; ST1/2, SBE- and TRE-containing element 1/2; SP1, SP1-binding element; AP1, AP1-binding element; EBS, ETS-binding site; E2F, E2F-binding element; CRE, cAMP response element; octamer, octamer motif; TATA, TATA box. Sequence comparison of mouse and human ST1/2 (bottom). The core sequence of ST1/2 is bolded. H, Tb4-promoter assay using reporter construct containing wild-type (WT), mutated ST1 (mut ST1), mutated ST2 (mut ST2), and mutated ST1 and ST2 (mutated ST1&2). I, DNA–protein binding assay with a DNA probe containing a WT or SBE/TRE-mutated (mutSBE/mutTRE) ST1 site. Precipitated Smad3/4 and LEF1 proteins were visualized by Western blotting. J, Tb4-promoter assay of NMuMG cells exogenously expressing constitutively active Smad3, Smad4, and LEF1 proteins. K, TRE-promoter assay of NMuMG cells expressing constitutively active LEF1 (CA-LEF1). In other experiments, cells were treated with Wnt3a, TGFb1, and/or FH535. L, Tb4-promoter assay using WT ST1 or mut ST1&2 reporter constructs. Cells were treated with TGFb1 and/or Wnt3a. All statistical data in Fig. 2, excluding B and C, are shown as means SEMs. , P < 0.05; , P < 0.01, two-tailed Student t test.

OF6 Mol Cancer Res; 2018 Molecular Cancer Research

TGFb/Tb4/MRTF Signaling in Tumor Progression

Figure 3. Transcriptional regulation of Tb4 in B16 melanoma cells. A, Tmsb4x and Serpine1 expression levels in B16F0 and B16F1 cells were quantified by real-time RT-PCR. B, Chemical crosslinking of Tb4andb-actin proteins using dithiobis (succinimidyl propionate) and visualization by Western blotting. C, CArG-promoter assay of B16F0 and B16F1 cells. D, CArG-promoter assay of control or Tb4 knockdown B16F1 cells. E, Immunocytochemistry of endogenous MRTF-A in control or Tb4 knockdown B16F1 cells (left). Scale bar, 50 mm. The subcellular localization of MRTF-A was scored as predominantly cytoplasmic (Nuc < Cyt), nuclear (Nuc > Cyt), or uniformly distributed (Nuc ¼ Cyt; right). F, Immunocytochemistry with anti-GFP, anti-myc, and anti-MRTF-A antibodies in B16F0 cells exogenously expressing GFP or Tb4-myc (left). Scale bar, 50 mm. The subcellular localization of MRTF-A was scored. G, CArG-promoter analysis in B16F0 cells exogenously expressing GFP or Tb4-myc. H, Quantified Tmsb4x expression levels by real-time RT-PCR in B16F1 cells stimulated by TGFb1 and the indicated reagents. I, Quantified Serpine1 expression levels by real-time RT-PCR in B16F1 cells stimulated by TGFb1 and the indicated reagents. J, Quantified Tmsb4x expression levels by real-time RT-PCR in B16F1 cells treated with the indicated reagents. K, Quantified Tmsb4x expression levels by real-time RT-PCR in control or Smad4 knockdown B16F1 cells (right). Knockdown efficiency was evaluated using real-time RT-PCR (left). L, Comparisons of expression levels of the indicated genes between B16F0 and B16F1 cells, quantified by real-time RT-PCR. M, Quantified Tmsb4x expression levels by real-time RT-PCR in TCF7 knockdown and/or LEF1 knockdown B16F1 cells (right). Knockdown efficiencies were evaluated using real-time RT-PCR (left). All statistical data in Fig. 3 are shown as means SEM. , P < 0.05; , P < 0.01, two-tailed Student t test.

www.aacrjournals.org Mol Cancer Res; 2018 OF7

Morita and Hayashi

Figure 4. Effect of Tb4 knockout in B16F1 cells. A, Quantified Tmsb4x expression levels by real-time RT-PCR in cultured B16F1 cells and B16F1 tumors formed by subcutaneous inoculation into mice. EW7197 was administered orally. Bars indicate mean scores. , P < 0.05; , P < 0.01, two-tailed Mann–Whitney U test. B, Validation of Tb4 knockout by Western blotting with anti-Tb4 and anti–b-actin antibodies. C, Heatmap of a microarray analysis representing fold changes in gene expression levels downregulated <0.5-fold in Tb4-KO cells relative to parental B16F1 cells in the presence of TGFb1. TGFb1: TGFb1/B16F1 versus vehicle/B16F1, CCG1423: CCG1423 þ TGFb1/B16F1 versus TGFb1/B16F1, Tb4 KOs: TGFb1/Tb4 KOs versus TGFb1/B16F1. D, Venn diagram of the numbers of genes upregulated >2.0-fold or downregulated <0.5-fold under the indicated conditions. E, Scatterplot of the log fold change (logFC) in gene expression values. The logFC values between TGFb1/Tb4 KO and TGFb1/B16F1 and between CCG1423 þ TGFb1/B16F1 and TGFb1/B16F1 are plotted on the x-axis and y-axis, respectively, with a cut-off threshold of |logFC| < 1. Numbers indicate the number of microarray gene probes plotted in each area. F, Representative Gene Ontology terms of the genes downregulated <0.5-fold in Tb4 KO cells. G, Representative microarray data of downregulated tumor-associated genes in Tb4 knockout (KO) cells. H, Quantified expression levels of the indicated genes by real-time RT-PCR in B16F1 cells subjected to Mkl1/2, Srf or Tmsb4x knockdown. I, Quantified expression levels of the indicated by real-time RT-PCR in Tb4 KO2 cells expressing exogenous Tb 4 and MKL1. All statistical data in Fig. 4H and I are shown as means SEM. , P < 0.05; , P < 0.01, two-tailed Student t test.

OF8 Mol Cancer Res; 2018 Molecular Cancer Research

TGFb/Tb4/MRTF Signaling in Tumor Progression

genes in Tb4-KO2 cells (Fig. 4I). These findings suggest that Tb4/ TMSB4X-high/SRF-low groups (blue), particularly for renal cell MRTFs regulate the expression of tumor-associated genes in carcinoma and glioblastoma where MSTs of TMSB4X-high/SRF- B16F1 cells. low groups were statistically comparable with those of TMSB4X- moderate/low groups [73.168 vs. 90.384; P ¼ 0.2157 (Wilcoxon Correlations of Tb4 gene expression with TGFb1 and MRTF- rank sum test) in renal cell carcinoma and 13.3 vs. 14.0; P ¼ target genes in human cancers 0.7537 in glioblastoma; Fig. 6C and G]. We confirmed that SRF In humans, enhanced Tb4 expression has been correlated with levels did not directly correlate with prognosis (Fig. 6D and H) metastasis and poor prognosis (12), although it's functional roles and that Tb4 expression levels were not lower in TMSB4X-high/ in tumor progression remain largely unknown. We validated the SRF-low groups than in TMSB4X-high/SRF-high groups (Fig. 6E importance of the TGFb1/Tb4/MRTFs signaling cascade in tumor and I). These data suggest that Tb4 expression affects human progression using human cancer genomic datasets from The cancer prognosis via MRTFs/SRF signaling. Cancer Genome Atlas. We observed significant positive correlations between the expression of TGFB1 and TMSB4X (encodes Tb4 controls B16F1 metastatic potential through regulating human Tb4 protein) in cutaneous melanoma, breast invasive MRTF activity carcinoma, renal clear cell carcinoma, hepatocellular carcinoma, To further investigate the importance of Tb4/MRTF signaling in papillary thyroid carcinoma, lower grade glioma, and glioblas- tumor progression, we performed experimental metastasis assay toma (Fig. 5A). As a dataset control, we confirmed that the TGFB1 using Tb4 KO cells. In mice, intravenously injected parental B16F1 expression levels positively correlated with those of SERPINE1 but cells exhibited pulmonary metastasis and formed numerous not SRF, the expression of which is independent of TGFb signaling pulmonary nodules within 3 weeks postinjection, whereas Tb4 (Supplementary Fig. S4A). deletion led to significant decreases in metastatic potential and To clarify whether TMSB4X expression occurs downstream of secondary tumor formation (Fig. 7A and B). We further isolated TGFB1 in this context, the expression data were grouped by TGFb KO/MRTF clones from Tb4 KO2 cells transfected with a consti- receptor 1 (TGFBR1) levels (Fig. 5B). Low-TGFBR1–expressing tutively active MRTF-A expression vector, because the expression melanomas, thyroid carcinomas, and gliomas exhibited signifi- levels of MRTFs-target genes were largely reduced in Tb4 KO cells cant low TMSB4X to TGFB1 expression ratios, suggesting that (Fig. 4C and E). KO/MRTF cells exhibited restored expressions of TGFB1/TGFBR1 signaling increases TMSB4X expression. SER- the Tb4/MRTF–dependent tumor-associated genes and enhanced PINE1 expression levels also depended on TGFBR1 expression metastatic activity in mice (Figs. 7A–C), supporting the idea that (Supplementary Fig. S4B). In B16F1 cells, TGFb/TCF/LEF signal- MRTF activation is critical for the Tb4-contributed tumor pro- ing affected Tb4 induction (Fig. 3H and M). To verify the contri- gression and metastasis. bution of this pathway in human cancers, the expression data were grouped according to TCF7 or LEF1 expression. Low-TCF7– expressing melanomas and thyroid carcinomas and low-LEF1– Discussion expressing gliomas had significant low TMSB4X/TGFB1 expres- Mounting evidence suggests that MRTFs promote tumor pro- sion ratios (Fig. 5C and D), supporting our hypothesis that TGFb gression by regulating cytoskeletal component gene expression signaling induces Tb4 expression via TGFBR/SMAD and TCF/LEF (26, 31–33). Medjkane and colleagues clearly demonstrated that signaling in human cancer tissues. MRTFs regulate the motility, invasiveness, and lung metastatic Next, we evaluated the correlation between Tb4 and Tb4- capacities of human breast carcinoma MDA-MB-231 and B16 regulated tumor-associated genes (ITGB1, MMP14, MYH9, MYL9, melanoma cells (31). Furthermore, MRTF knockdown severely TPM3, WISP1) in human cancers. In many cases, TMSB4X expres- suppressed the metastatic potential of B16F2 cells, whereas con- sion correlated positively with the tumor-associated gene expres- stitutively active MRTF-A expression enhanced the lung metastatic sion, although the correlation between TMSB4X and MYH9 was capacity of B16F0 cells. Medjkane and colleagues identified relatively weak (Fig. 5A). When the expression data were grouped MYH9 and MYL9, the expression of which is required for tumor by MKL1 (MRTF-A) and MKL2 (MRTF-B) expression levels, MKL1/ invasion and metastasis, as critical MRTF targets. Similarly, we 2-low groups exhibited extremely low tumor-associated gene to observed that MYL9 expression was suppressed in Tb4 KO cells TMSB4X expression ratios, compared with MKL1/2-high groups but robustly induced by ectopic Tb4 and MRTF-A expression (Fig. 6A). Thus, enhanced Tb4 expression most likely promoted (Fig. 4) and identified significant positive correlations between the increased expression of tumor-associated genes in human TMSB4X and MYL9 expression levels in all examined human cancer tissues by activating MRTFs. cancers (Fig. 5A). Medjkane and colleagues also identified additional eight common MRTF target genes between the two studied In human cancers, Tb4 expression correlates with prognosis in cell lines (31), of which six (PDE1C, VGLL3, TPM1, HELLS, a MRTF/SRF pathway-dependent manner DENND2A, and PHLDB2) were confirmed to be downregulated Kaplan–Meier survival analyses of renal clear cell carcinoma, in our Tb4 KO cells (Supplementary Table S2). Many down- glioblastoma, breast invasive carcinoma, and lower grade glioma regulated genes in Tb4 KO cells overlapped with those in revealed that strong TMSB4X expression correlated significantly CCG1423-treated cells (256/681 genes; 37.6%, Fig. 4D), and with a poor prognosis (TMSB4X-high groups, red vs. TMSB4X- their expression levels were significantly positively correlated moderate/low groups, yellow; Fig. 6B–I; Supplementary Fig. S5A– (Pearson r ¼ 0.6238, P < 0.001; Fig. 4E), indicating a similar S5H). To validate the involvement of MRTFs/SRF signaling, mode of regulation (e.g., MRTFs/SRF). TMSB4X-high groups were further subdivided by SRF expression We demonstrated that increased Tb4 expression is critical for level because the MKL1 level directly affected survival rates (Sup- TGFb-induced MRTF activation. MRTF activity is generally regu- plementary Fig. S5I). The TMSB4X-high/SRF-high groups (green) lated by Rho signaling, which in some cells is directly stimulated exhibited significantly shorter mean survival times (MST) than the by TGFb stimulation within 30 minutes (34, 35). In NMuMG and

www.aacrjournals.org Mol Cancer Res; 2018 OF9

Morita and Hayashi

Figure 5. Correlation between the expression of TGFb1andTb4 in human cancers. A, Correlation of TMSB4X expression with TGFB1 and tumor-associated gene expressions. r value and P value, Pearson correlation. Orange shaded numbers, r > 0.2 and P < 0.05. B–D, Regression analysis of the expression levels of TGFB1 and TMSB4X. Each dataset was divided into two groups according to TGFBR1 (B), TCF7 (C), or LEF1 (D) expression. DY/DX, regression coefﬁcient. P value, analysis of covariance (ANCOVA).

MDCK (8) cells, however, 16 to 24 hours were required to fully a pivotal role for Tb4 in the TGFb/MRTF pathway, other factors activate MRTFs after TGFb1 stimulation (Fig. 1A), thus supporting might contribute to this complex system. our ﬁndings regarding the involvement of transcriptional regu- The TGFb/Smad and Wnt/TCF/LEF pathways commonly cross- lation. Previously, several Rho signaling factors, including RhoB, talk during developmental processes and cancer progression. RhoC, GEF-H1, and Net-1, have been reported to be transcrip- Many human tumors overexpress TGFb and Wnt, which are tionally upregulated by TGFb stimulation (36–39). Our micro- important effectors of invasive properties, mainly via EMT induc- array analysis conﬁrmed the weak upregulation of these factors tion (40). During morphogenesis, these signals cooperatively along with Tb4(Tmsb4x: 4.52-fold) in B16F1 cells after regulate gene expression; for example, the promoter regions of TGFb1treatment, excluding Net1 [Rhob: 1.88-fold, Rhoc: 1.60- the homeobox genes Xtwn and Msx2 contain both SBE and TRE, fold, Arhgef2 (GEF-H1): 1.65-fold, Net1: 0.99-fold]. Furthermore, and TGFb and Wnt synergistically induce the expression of both some Rho signaling factors are transcriptionally regulated by genes (21, 41). Here, we demonstrated that Tb4 expression is MRTFs, which likely forms a positive feedback loop (31). cooperatively regulated by Smad and TCF/LEF signals in NMuMG Although our knockdown/knockout experiments demonstrated and B16F1 cells and some human cancer tissues (Figs. 2, 3, and 5).

OF10 Mol Cancer Res; 2018 Molecular Cancer Research

TGFb/Tb4/MRTF Signaling in Tumor Progression

Figure 6. MRTF/SRF pathway mediates the correlations of Tb4 expression with tumor-associated gene expressions and prognosis in human cancers. A, Regression analysis of the expression levels of TMSB4X and tumor-associated genes. Each dataset was divided into two groups according to the average MKL1 and MKL2 expression level. DY/DX, regression coefﬁcient. P value, analysis of covariance (ANCOVA). B and F, Scatterplot of TMSB4X and SRF expression levels. The data were divided into four groups according to TMSB4X and SRF expression levels. Kaplan–Meier survival curves based on TMSB4X (C and G)andSRF (D and H) expression levels. MST, median survival time. P value, Wilcoxon rank-sum test. E and I, Comparison of TMSB4X expression levels between the indicated groups. Bars indicate the means SEM. , P < 0.05; , P < 0.01, two-tailed Student t test. B–I, Kidney renal clear cell carcinoma (B–E) and glioblastoma (F–I).

www.aacrjournals.org Mol Cancer Res; 2018 OF11

Morita and Hayashi

Figure 7. Involvement of Tb4/MRTF signaling in metastatic process of B16F1 cells. A, Representative images of pulmonary metastases of parental (WT), Tb4 knockout (KO1 and KO2), and constitutively active MRTF-A– expressing KO2 (KO/MRTF-1 and -2) cells. B, Statistical analysis of pulmonary metastasis by quantifying the numbers of metastatic lung nodules. Bars indicate the mean scores. , P < 0.01, two-tailed Mann–Whitney U test. C, Quantiﬁed expression levels of the tumor-associated genes by real- time RT-PCR in KO2, KO/MRTF-1, and KO/MRTF-2 cells. Bars indicate the means SEM. , P < 0.05; , P < 0.01, two-tailed Student t test.

However, the expression of Serpine1, a typical transcriptional progression (25). Within fibrotic tissues and tumors, myofibro- target of TGFb/Smad, was controlled in a Smad-dependent but blasts, tumor cells and immune cells secrete TGFb, which acts in TCF/LEF–independent manner (Figs. 2E and 3I), indicating that an autocrine/paracrine manner to provoke EMT, angiogenesis, the latter is not necessarily required for TGFb/SMAD pathway phenotypic fibroblast and macrophage transition, and tumor activity. In the Tb4 gene promoter region, we identified a novel immunosurveillance escape. Recent research has focused on TGFb-responsive cis-acting element, AGACAAAG, which is con- tumor-associated macrophages (TAM) and cancer-associated served across several mammals and contains partially overlapping fibroblasts (CAF), which secrete TGFb within the tumor micro- SBE and TRE sequences and interacts with both Smad3/4 and environment and promote metastatic potential (45, 46). Our LEF1. Around ST1/2, we also identified conserved predicted results suggest that TGFb might direct cancer cells to increase Tb4 binding elements for the SP-1, AP-1, and ETS transcription factors, expression within the tumor microenvironment (Figs. 4A which are frequently identified in functional Smad2/3 and and 5A), raising a possibility that TAMs and CAFs facilitate Tb4 Smad4-binding regions (42, 43). Although TCF/LEF is not a expression and MRTF activation to promote metastasis in the canonical downstream target of TGFb, we observed TGFb1- tumor microenvironment. induced TCF/LEF activation in NMuMG cells (Fig. 2K). Previous Taken together, our findings point to a principal role for Tb4in studies of other cell types have also reported direct/indirect the TGFb/MRTF pathway and provide the first demonstration of the activation of the b-catenin/TCF pathway by TGFb (21–23), and molecular mechanism underlying the transcriptional regulation of Smad3 and Smad4 reportedly interact with TCF/LEF (21, 44). Tb4 genes by TGFb signaling via a novel cis-acting element. Nota- These findings demonstrate that TGFb signaling activates Smad bly, in cancer cells, elevated Tb4 contributed to tumor progression and TCF/LEF and promotes their recruitment to ST1/2 elements and metastasis by inducing tumor-associated genes, such as MYL9, individually or as a complex. via MRTF/SRF signaling. Although further studies are needed to The multifunctional cytokine TGFb is a potent inducer of EMT understand the MRTF-independent functions of Tb4, our study and fibrosis and both a promoter and suppressor of tumor provides new and important insights into the roles of Tb4inEMT

OF12 Mol Cancer Res; 2018 Molecular Cancer Research

TGFb/Tb4/MRTF Signaling in Tumor Progression

and tumor progression. We suggest MRTF signaling as a potential Acknowledgments therapeutic target in tumors with enhanced Tb4 expression. This work was supported by JSPS KAKENHI grant number 15K07076 (to T. Morita) and 16K08142 (to K. Hayashi), the Takeda Science Disclosure of Potential Conﬂicts of Interest Foundation (to T. Morita), Mitsubishi Tanabe Pharma Corporation and Project MEET, Osaka University Graduate School of Medicine (to T. T. Morita reports receiving a commercial research grant from Mitsubishi Morita). Tanabe Pharma Corporation and Project MEET, Osaka University Graduate The authors thank Prof. Yukio Kawahara and all the members in the School of Medicine. No potential conﬂicts of interest were disclosed by the other laboratory for discussion and technical support. We thank all the staff in the author. Center for Medical Research and Education of Osaka University Graduate School of Medicine for their technical assistance. We also thank Enago Authors' Contributions (www.enago.jp) for the English language review. Conception and design: T. Morita Development of methodology: K. Hayashi Acquisition of data (provided animals, acquired and managed patients, The costs of publication of this article were defrayed in part by the provided facilities, etc.): T. Morita, payment of page charges. This article must therefore be hereby marked Analysis and interpretation of data (e.g., statistical analysis, biostatistics, advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate computational analysis): T. Morita, this fact. Writing, review, and/or revision of the manuscript: T. Morita, Administrative, technical, or material support (i.e., reporting or organizing data, constructing databases): K. Hayashi Received November 29, 2017; revised December 21, 2017; accepted Decem- Study supervision: T. Morita, K. Hayashi ber 26, 2017; published OnlineFirst January 12, 2018.

References 1. Morikawa M, Derynck R, Miyazono K. TGF-b and the TGF-b family: 17. Weissbach J, Schikora F, Weber A, Kessels M, Posern G. Myocardin-related context-dependent roles in cell and tissue physiology. Cold Spring Harb transcription factor A activation by competition with WH2 domain pro- Perspect Biol 2016;8:pii:a021873. teins for actin binding. Mol Cell Biol 2016;36:1526–39. 2. Moustakas A, Stournaras C. Regulation of actin organisation by TGF-beta in 18. Morita T, Hayashi K. Arp5 is a key regulator of myocardin in smooth muscle H-ras-transformed fibroblasts. J Cell Sci 1999;112:1169–79. cells. J Cell Biol 2014;204:683–96. 3. Nalluri SM, O'Connor JW, Gomez EW. Cytoskeletal signaling in TGFb- 19. Prieto-García E, Díaz-García CV, García-Ruiz I, Agullo-Ortu no~ MT. induced epithelial-mesenchymal transition. Cytoskeleton 2015;72: Epithelial-to-mesenchymal transition in tumor progression. Med Oncol 557–69. 2017;34:122. 4. Miralles F, Posern G, ZaromytidouAI,TreismanR.Actindynamics 20. Yarmola EG, Somasundaram T, Boring TA, Spector I, Bubb MR. Actin- control SRF activity by regulation of its coactivator MAL. Cell 2003; latrunculin A structure and function. Differential modulation of actin- 113:329–42. binding protein function by latrunculin A. J Biol Chem 2000;275: 5. Morita T, Mayanagi T, Sobue K. Reorganization of the actin cytoskeleton via 28120–7. transcriptional regulation of cytoskeletal/focal adhesion genes by myocar- 21.NishitaM,HashimotoMK,OgataS,LaurentMN,UenoN,Shibuya din-related transcription factors (MRTFs/MAL/MKLs). Exp Cell Res H, et al. Interaction between Wnt and TGF-beta signalling path- 2007;313:3432–45. ways during formation of Spemann's organizer. Nature 2000;403: 6. EsnaultC,StewartA,GualdriniF,EastP,HorswellS,MatthewsN,etal. 781–5. Rho-actin signaling to the MRTF coactivators dominates the immediate 22. Baarsma HA, Menzen MH, Halayko AJ, Meurs H, Kerstjens HA, Gosens R. transcriptional response to serum in fibroblasts. Genes Dev 2014; b-Catenin signaling is required for TGF-b1-induced extracellular matrix 28:943–58. production by airway smooth muscle cells. Am J Physiol Lung Cell Mol 7. Morita T, Mayanagi T, Sobue K. Dual roles of myocardin-related transcrip- Physiol 2011;301:L956–65. tion factors in epithelial mesenchymal transition via slug induction and 23. Baarsma HA, Spanjer AI, Haitsma G, Engelbertink LH, Meurs H, Jonker MR, actin remodeling. J Cell Biol 2007;179:1027–42. et al. Activation of WNT/b-catenin signaling in pulmonary fibroblasts by

8. Small EM. The actin-MRTF-SRF gene regulatory axis and myoﬁbroblast TGF-b1 is increased in chronic obstructive pulmonary disease. PLoS One differentiation. J Cardiovasc Transl Res 2012;5:794–804. 2011;6:e25450. 9. Pawłowski R, Rajakyl€a EK, Vartiainen MK, Treisman R. An actin-regulated 24. Clark EA, Golub TR, Lander ES, Hynes RO. Genomic analysis of metastasis importin a/b-dependent extended bipartite NLS directs nuclear import of reveals an essential role for RhoC. Nature 2000;406:532–5. MRTF-A. EMBO J 2010;29:3448–58. 25. Caja F, Vannucci L. TGFb: A player on multiple fronts in the tumor 10. Hayashi K, Morita T. Differences in the nuclear export mechanism between microenvironment. J Immunotoxicol 2015;12:300–7. myocardin and myocardin-related transcription factor A. J Biol Chem 26. Brandt DT, Baarlink C, Kitzing TM, Kremmer E, Ivaska J, Nollau P, et al. 2013;288:5743–55. SCAI acts as a suppressor of cancer cell invasion through the transcriptional 11. Hannappel E. beta-Thymosins. Ann N Y Acad Sci 2007;1112:21–37. control of beta1-integrin. Nat Cell Biol 2009;11:557–68. 12. Sribenja S, Wongkham S, Wongkham C, Yao Q, Chen C. Roles and 27. O'Sullivan NC, Pickering M, Di Giacomo D, Loscher JS, Murphy KJ. Mkl mechanisms of b-thymosins in cell migration and cancer metastasis: an transcription cofactors regulate structural plasticity in hippocampal neu- update. Cancer Invest 2013;31:103–10. rons. Cereb Cortex 2010;20:1915–25. 13. Bock-Marquette I, Saxena A, White MD, Dimaio JM, Srivastava D. Thy- 28. Gross SR. Actin binding proteins: their ups and downs in metastatic life. mosin beta4 activates integrin-linked kinase and promotes cardiac cell Cell Adh Migr 2013;7:199–213. migration, survival and cardiac repair. Nature 2004;432:466–72. 29. Gurbuz I, Ferralli J, Roloff T, Chiquet-Ehrismann R, Asparuhova MB. SAP 14. Freeman KW, Bowman BR, Zetter BR. Regenerative protein thymosin beta- domain-dependent Mkl1 signaling stimulates proliferation and cell migra- 4 is a novel regulator of purinergic signaling. FASEB J 2011;25:907–15. tion by induction of a distinct gene set indicative of poor prognosis in 15. Morita T, Hayashi K. G-actin sequestering protein thymosin-b4 regulates breast cancer patients. Mol Cancer 2014;13:22. the activity of myocardin-related transcription factor. Biochem Biophys Res 30. Ling B, Watt K, Banerjee S, Newsted D, Truesdell P, Adams J, et al. A novel Commun 2013;437:331–5. immunotherapy targeting MMP-14 limits hypoxia, immune suppression 16. Dominguez R. The beta-thymosin/WH2 fold: multifunctionality and and metastasis in triple-negative breast cancer models. Oncotarget 2017; structure. Ann N Y Acad Sci 2007;1112:86–94. 8:58372–85.

www.aacrjournals.org Mol Cancer Res; 2018 OF13

Morita and Hayashi

31. Medjkane S, Perez-Sanchez C, Gaggioli C, Sahai E, Treisman R. 38. Vasilaki E, Papadimitriou E, Tajadura V, Ridley AJ, Stournaras C, Kardassis Myocardin-related transcription factors and SRF are required for cyto- D. Transcriptional regulation of the small GTPase RhoB gene by TGF skeletal dynamics and experimental metastasis. Nat Cell Biol 2009; {beta}-induced signaling pathways. FASEB J 2010;24:891–905. 11:257–68. 39. Lu X, Guo H, Chen X, Xiao J, Zou Y, Wang W, et al. Effect of RhoC on the 32. Kato T, Enomoto A, Watanabe T, Haga H, Ishida S, Kondo Y, et al. TRIM27/ epithelial-mesenchymal transition process induced by TGF-b1 in lung MRTF-B-dependent integrin b1 expression defines leading cells in cancer adenocarcinoma cells. Oncol Rep 2016;36:3105–12. cell collectives. Cell Rep 2014;7:1156–67. 40. Castellone MD, Laukkanen MO. TGF-beta1, WNT, and SHH signaling in 33. Luo XG, Zhang CL, Zhao WW, Liu ZP, Liu L, Mu A, et al. Histone tumor progression and in fibrotic diseases. Front Biosci (Schol Ed) methyltransferase SMYD3 promotes MRTF-A-mediated transactivation of 2017;9:31–45. MYL9 and migration of MCF-7 breast cancer cells. Cancer Lett 2014; 41. Hussein SM, Duff EK, Sirard C. Smad4 and beta-catenin co-activators 344:129–37. functionally interact with lymphoid-enhancing factor to regulate graded 34. Bhowmick NA, Ghiassi M, Aakre M, Brown K, Singh V, Moses HL. TGF- expression of Msx2. J Biol Chem 2003;278:48805–14. beta-induced RhoA and p160ROCK activation is involved in the inhibition 42. Koinuma D, Tsutsumi S, Kamimura N, Imamura T, Aburatani H, Miyazono of Cdc25A with resultant cell-cycle arrest. Proc Natl Acad Sci U S A K. Promoter-wide analysis of Smad4 binding sites in human epithelial 2003;100:15548–53. cells. Cancer Sci 2009;100:2133–42. 35.PengF,ZhangB,WuD,IngramAJ,GaoB,KrepinskyJC.TGFbeta- 43. Koinuma D, Tsutsumi S, Kamimura N, Taniguchi H, Miyazawa K, induced RhoA activation and fibronectin production in mesan- Sunamura M, et al. Chromatin immunoprecipitation on microarray gial cells require caveolae. Am J Physiol Renal Physiol 2008;295: analysis of Smad2/3 binding sites reveals roles of ETS1 and TFAP2A in F153–64. transforming growth factor beta signaling. Mol Cell Biol 2009;29:172–86. 36. Shen X, Li J, Hu PP, Waddell D, Zhang J, Wang XF. The activity of 44. Labbe E, Letamendia A, Attisano L. Association of Smads with lymphoid guanine exchange factor NET1 is essential for transforming growth enhancer binding factor 1/T cell-specific factor mediates cooperative sig- factor-beta-mediated stress fiber formation. J Biol Chem 2001;276: naling by the transforming growth factor-beta and wnt pathways. Proc Natl 15362–8. Acad Sci U S A 2000;97:8358–63. 37. Tsapara A, Luthert P, Greenwood J, Hill CS, Matter K, Balda MS. The RhoA 45. Calon A, Tauriello DV, Batlle E. TGF-beta in CAF-mediated tumor growth activator GEF-H1/Lfc is a transforming growth factor-beta target gene and and metastasis. Semin Cancer Biol 2014;25:15–22. effector that regulates alpha-smooth muscle actin expression and cell 46. Gratchev A. TGF-b signalling in tumour associated macrophages. migration. Mol Biol Cell 2010;21:860–70. Immunobiology 2017;222:75–81.

OF14 Mol Cancer Res; 2018 Molecular Cancer Research

Tumor Progression is Mediated by Thymosin-β4 through a TGF β/MRTF Signaling Axis

Tsuyoshi Morita and Ken'ichiro Hayashi

Mol Cancer Res Published OnlineFirst January 12, 2018.

Updated version Access the most recent version of this article at: doi:10.1158/1541-7786.MCR-17-0715

Supplementary Access the most recent supplemental material at: Material http://mcr.aacrjournals.org/content/suppl/2018/01/12/1541-7786.MCR-17-0715.DC1

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://mcr.aacrjournals.org/content/early/2018/04/04/1541-7786.MCR-17-0715. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.