CHARACTERIZATION of DECHLORINATING POPULATIONS in the WBC-2 CONSORTIUM By

CHARACTERIZATION OF DECHLORINATING POPULATIONS IN THE WBC-2 CONSORTIUM by

Marie June Manchester

A thesis submitted in conformity with the requirements for the degree of Masters of Applied Science

Department of Chemical Engineering and Applied Chemistry University of Toronto © Copyright by Marie June Manchester 2012

Characterization of Dechlorinating Populations in the WBC-2 Consortium

Marie June Manchester Masters of Applied Science Department of Chemical Engineering and Applied Chemistry University of Toronto 2012

ABSTRACT The WBC-2 consortium was characterized using quantitative PCR and analytical techniques to associate growth of dechlorinating bacteria to each step of the 1,1,2,2-Tetrachloroethane (TeCA) degradation pathway. The consortium was found to degrade TeCA through dichloroelimination to trans-1,2- dichloroethene (tDCE), and reductive dehalogenation to Vinyl Chloride (VC) and ethene. Thus the pathway was hypothesized to provide three distinct niches for three genera of dechlorinating bacteria,

Dehalobacter, Dehalogenimonas and Dehalococcoides. Using qPCR to track growth over two time course experiments at different inoculum dilutions, the Dehalobacter species showed significant growth on the first step of TeCA dihaloelimination to tDCE Dehalococcoides and Dehalogenimonas species grew on the dechlorination products. The Dehalogenimonas species, a novel non-Dehalococcoides, was found to grow only on tDCE. The Dehalococcoides species also grew on cDCE, less well on tDCE, and on VC.

Acknowledgments

Thank you to Elizabeth Edwards for giving me this wonderful opportunity to learn and for being the kind of supervisor who instils passion in her students due to her own obvious love of the subject; for being not just a trailblazer but someone who shines the way for those who come after; and particularly for pushing me to do this for myself.

Thank you to Laura Hug, my “pseudo-supervisor,” who is brilliant, hard-working and guided me through many of the wobbly-legged periods of this research project. You will make a great professor someday.

Thanks to Anna Zila and Alfredo Perez de Mora for their help in qPCR troubleshooting and for being awesome lab mates.

Thanks to Mel Duhamel for her expertise in all things lab and for helping me to figure out vital things like electron equivalents and yield calculations.

Thanks to Cheryl Devine for transmitting her bountiful lab and life wisdom on many occasions.

Thank you Christina Heidorn, Anna Zila and Laura Hug for your help in editing this manuscript.

Thanks to Liane Catalfo for training me on the HPLC and for the use of your protocol.

Thank you Dr. Paul J. McMurdie II for providing access to protocols and primers for DHC differentiation.

Thanks to Michelle Lorah for generously allowing our lab to continue to use and study WBC-2. I hope you find these results useful.

Thanks to Susie for being a wonderful lab mom. You really make the lab a good place to be.

Thank you to my parents for their absolute support and for always asking me how my little guys were doing. Thanks especially to my lovely siblings: you are each an inspiration and comfort to me. And thank you to the rest of my family and friends who are all amazing and supportive.

Thank you to Yaseen for his helpful research suggestions and lab serenades. You made me want to stay in the lab late.

I would like to dedicate this thesis to Rara who was a big part of the reason why I decided to study science and would have thought this was neato.

iii

Table of Contents

ABSTRACT II

ACKNOWLEDGMENTS III

TABLE OF CONTENTS IV

LIST OF TABLES VII

LIST OF FIGURES VIII

LIST OF ABBREVIATIONS IX

1. CHAPTER 1 LITERATURE REVIEW AND THESIS INTRODUCTION 1

1.1 Literature Review 1 1.1.1 Bioremediation 1 1.1.2 Oxidation Reduction Reactions 2 1.1.3 Reductive Dehalogenation 3 1.1.4 Chlorinated Solvents – 1,1,2,2-Tetrachloroethane and the degradation byproducts 3 1.1.5 Syntrophy in Dechlorinating Consortia 4 1.1.6 The WBC-2 Consortium 5 1.1.7 Oxygen and pH Sensitivity 10 1.1.8 Electron Donor Selection 10 1.1.9 Methods for detecting microorganisms and activity – qPCR 10 1.1.10 Problems and alternatives to 16S gene identification of Dehalococcoides strains 12

1.2 Research Objectives 12

1.3 Thesis Outline 13

2. CHAPTER 2 GENERAL MATERIALS AND METHODS 14

2.1 WBC-2 Microbial Consortium History and Maintenance 14 2.1.1 Electron Equivalents 17 2.1.2 Henry’s Law constant 18

3. CHAPTER 3 CHARACTERIZATION OF THE DECHLORINATING MICROORGANISMS IN THE WBC-2 CULTURE 20

3.1 Introduction 20

3.2 Materials and Methods 21 3.2.1 Time Course Experiments 21 3.2.2 DNA Extraction 23 3.2.3 Primer Design for qPCR 24 3.2.4 Real-Time Quantitative PCR for Time Course Experiments 24 3.2.5 Cloning with Topo TA for qPCR Standard Curves 25 3.2.6 qPCR Calculations 27 3.2.7 Analytical Procedures 27

3.3 Results and Discussion 28 3.3.1 qPCR Standard Curve Equations 28 3.3.2 Population Abundance and Putative Dechlorination Roles 29 3.3.3 Time Course Experiments: 1:5 Dilution Results 32 3.3.4 Time Course Experiments: 1:20 Dilution 36

3.4 Conclusion 41

3.5 Acknowledgements 41

4. CHAPTER 4 DIFFERENTIATION OF THE DEHALOCOCCOIDES SPECIES IN WBC-2 USING AN EXTENDED CONSERVED GENOMIC REGION 42

4.1 Introduction 42

4.2 Materials and Methods 42 4.2.1 PCR Protocol Optimization 42 4.2.2 Long Range PCR amplification using Phire Polymerase 43 4.2.3 Cloning with BigEasy Kit 45 4.2.4 Primer design for Dehalococcoides Differentiation 46 4.2.5 Sequencing 47 4.2.6 Phylogenetic Tree Construction 48

4.3 Results and Discussion 48

4.4 Conclusion 54

5. THESIS CONCLUSIONS AND ENGINEERING SIGNIFICANCE 55

5.1 Conclusion 55

5.2 Engineering Significance 55

5.3 Future work 56 5.3.1 Dehalogenimonas Characterization 56 5.3.2 Time course experiments 56

6. REFERENCES 57

APPENDIX A OTHER MAINTENANCE ACTIVITIES AND EXPERIMENTS 62 v

1 Other Maintenance Methods 62 1.1 Purging Cultures 62 1.2 pH Adjustment 62 1.3 Stalled Cultures 62

2 Other Experiments 63 2.1 Donor Limitation 63 2.2 Other organisms in WBC-2 – Geobacter 65 2.3 Other dechlorinating capabilities – TCE and PCE 65 2.4 Microarray Analysis – DNA and RNA sent to University of Tennessee 68 2.5 Sterivex vs. pelleting for DNA extraction 69 2.6 Relative abundance of dechlorinating bacteria with enrichment on VC and tDCE 71 2.7 Tracking the growth of other WBC-2 consortium members (Bacteria and Archaea) 72

APPENDIX B SEQUENCES FROM CHAPTER 4 DIFFERENTIATION OF DEHALOCOCCOIDES EXPERIMENT 78 1.1 Sequence of 7kb segment from clone T4T/TCA 78 1.2 Sequence of 7kb segment from T1T/ALL 80 1.3 Sequence of 7kb segment from T2P/CDCE (clone #1) 83 1.4 Contigs from T2P/CDCE clone #2 (7kb segment not fully sequenced) 85 1.5 Contigs from T4P/TCA (7kb not fully sequenced) 87

List of Tables

Table 1.1.6.1 SiREM Clone Library 2006 (29) ...... 6

Table 1.1.6.2 USGS WBC-2 Clone Library 2006 (30, 35) ...... 7

Table 1.1.10.1 2011 Substrate Concentrations for WBC-2 Maintenance Cultures...... 17

Table 2.1.2.1 Dimensionless Henry’s Law Constants Used for Headspace Analysis ...... 19

Table 3.2.1.1 The 1:5 Dilution of Inoculum Cultures and Treatment Conditions...... 22

Table 3.2.1.2 1:20 Dilution of Inoculum Cultures and Treatment Conditions...... 22

Table 3.2.4.1 qPCR Primers Used in This Study ...... 25

Table 3.3.1.1 The Standard Curve Equations Generated from the qPCR Runs from the 1:5 and 1:20 Growth Trials ...... 28

Table 4.2.2.1 Long Range PCR Reaction Set Up for 100 l Reactions ...... 44

Table 4.2.2.2 Long range PCR Protocol ...... 44

Table 4.2.4.1 Dehalococcoides 7 kb Segment Sequencing Primers ...... 47

Table 4.2.6.1 Patristic Differences (sum of branches) associated with strains and clones presented in Figure 3a ...... 52

List of Tables in Appendix A

Table 2.1-1 HPLC Results for Lactate Samples ...... 65

Table 2.5-1 Pelleting vs. Sterivex for Dehalogenimonas and General Bacteria Relative Abundance ...... 69

Table 2.5-2 Sterivex and Pellet DNA quantity and quality results ...... 70

Table 2.7-1 Primers used to Track Growth of Facilitating Bacteria and Archaea ...... 73

Table 2.7-2 Standard Curve qPCR Equations for Facilitating Bacteria in WBC-2 ...... 74

vii

List of Figures

Figure 1.1.4.1 TeCA degradation pathway (3, 36) ...... 4

Figure 1.1.10.1 WBC-2 Culture Lineage Tree depicting the initial culture conditions and the researcher responsible for creating the cultures...... 16

Figure 3.3.2.1 WBC-2 clone library sequences...... 30

Figure 3.3.2.2 Maximum likelihood phylogenetic tree of Chloroflexi 16S rDNA sequences ...... 31

Figure 3.3.2.3 Relative abundance of dechlorinating bacteria in the WBC-2 consortium based on qPCR community screens ...... 32

Figure 3.3.3.1 Dechlorination of TeCA by WBC-2...... 34

Figure 3.3.3.2 Dechlorination of tDCE by WBC-2 ...... 35

Figure 3.3.4.1 Dechlorination of TeCA by WBC-2...... 37

Figure 3.3.4.2 Dechlorination of tDCE by WBC-2...... 38

Figure 3.3.4.3 Dehalogenimonas (Dehly) growth with 1:20 diluted culture, amended with tDCE, cDCE and just electron donor ...... 39

Figure 3.3.4.4 Dehalococcoides (DHC) growth with 1:20 diluted culture, amended with tDCE, VC and just electron donor ...... 39

Figure 3.3.4.5 Summary of experimental results ...... 40

Figure 4.2.6.1 End segments of 7kb intragenic region of DNA ...... 49

Figure 4.2.6.2 Maximum likelihood phylogenetic tree of Chloroflexi 16S rDNA sequences ...... 49

Figure 4.2.6.3 Alignment of intragenic regions ...... 50

Figure 4.2.6.4 Geneious produced alignment view of section of phylogenetic tree showing all five clones...... 53

List of Figures in Appendix A

Figure 2.1-1 Dechlorination of cDCE by WBC-2...... 63

Figure 2.3-1 Dechlorination of TCE by WBC-2...... 67

Figure 2.3-2 Dechlorination of PCE by WBC-2. PCE dechlorination profile with 1:10 diluted culture. .... 68

Figure 2.6-1 Relative abundance of dechlorinating bacteria in the WBC-2 consortium based on qPCR community screens ...... 72

Figure 2.7-1 Growth of Facilitating Bacteria and Archaea in WBC-2 ...... 76

Figure 2.7-2 Growth of Facilitating Bacteria and Archaea in WBC-2 continued...... 77 viii

LIST OF ABBREVIATIONS µg Microgram µl Microlitre 1,1-DCA 1,1-Dichloroethane 1,1-DCE 1,1-Dichloroethene 1,2-DCA 1,2-Dichloroethane 1,1,2-TCA 1,1,2-Trichloroethane Aceto Acetobacterium Arch General Archaea BTEX Benzene, Toluene, Ethyl Benzene and Xylene cDCE cis-1,2-Dichloroethene CF Chloroform CFB group Cytophaga-Flavobacteria-Bacteroides group CO2 Carbon Dioxide CT Carbon Tetrachloride Dehly Dehalogenimonas DG0’ Gibbs free energy DGGE Denaturing Gradient Gel Electrophoresis DHB Dehalobacter DHC Dehalococcoides DNA Deoxyribonucleic Acid E Efficiency e- Electron Eo’ Oxidation Reduction Potential g Gram kJ Kilojoule L Litre M Molarity (mol/L) ml Mililitre PCE Tetrachloroethene qPCR Quantitative Polymerase Chain Reaction r2 Linear Regression Coefficient RDX 1,3,5-Trinitroperhydro-1,3,5-triazine rRNA Ribosomal Ribonucleic Acid sd Standard Deviation T1P/ALL WBC-2 Parent culture maintained on TeCa, 1,1,2TCA and cDCE T1T/ALL WBC-2 Transfer culture maintained on TeCa, 1,1,2TCA and cDCE T2P/CDCE WBC-2 Parent culture maintained on cDCE T2T/CDCE WBC-2 Transfer culture maintained on cDCE T3P/TECA WBC-2 Parent culture maintained on TeCA T3T/TECA WBC-2 Transfer culture maintained on TeCA T4P/TCA WBC-2 Parent culture maintained on 1,1,2-TCA T4T/TCA WBC-2 Transfer culture maintained on 1,1,2-TCA TCE Trichloroethene tDCE trans-1,2-Dichloroethene TeCA 1,1,2,2-Tetrachloroethane TNT Trinitrotoluene USGS United States Geological Survey V Volt VC Vinyl Chloride Veil Veillonellaceae WBC-2 West Branch Canal Creek Microbial Consortium

ix 1

1. CHAPTER 1 LITERATURE REVIEW AND THESIS INTRODUCTION

1.1 Literature Review

1.1.1 Bioremediation Bioremediation is the use of microorganisms to remove contaminants from the environment. While there are many other methods of groundwater remediation, including, for example, pump and treat systems and permeable reactive barriers, bioremediation is particularly valuable in that it can offer the complete destruction of harmful compounds at relatively low cost (4, 53, 64). The field of bioremediation is relatively young, and new microbes capable of degrading a wide range of environmental pollutants are still being discovered. Target compounds include chlorinated hydrocarbons, BTEX, and nitroaromatics like Trinitrotoluene (TNT) (9, 53). Most often bioremediation has been used to remove organic contaminants, breaking them down into the inorganic constituents; resulting in just the production of CO2 or methane and an increase in cell biomass (64). Researchers have suggested that the ability of microbes to exploit extreme environments, with bioremediation being just one small example, is due to the selective pressures exerted by the large array of resources available (41). Not only are microorganisms good at using available resources but their activities often serve to convert these resources into substrates useful for other sets of microorganisms. Smith calls this ability sequential coupling, and attributes it to allowing the biologically available energy in a given substrate, or group of substrates, to be completely utilized by the microbial population. In this way, the microbial food chain serves as an electron conduit, channelling electrons to the most oxidized, and therefore most energetically favourable, electron-accepting compound available (58). However bioremediation does not just occur when contaminants are being used as an energy source. Madsen proposes that degradation of compounds occurs through the action of enzymatic or non-enzymatic reactions that are triggered in four main ways:

i) intra- or extra-cellular enzymatic attack that is essential for growth of the microorganism(s) (e.g., the attacked substrates are used as a source of carbon, energy, nitrogen, or other nutrients or as a final electron acceptor), ii) enzymatic attack that is beneficial because it serves some protective purpose (e.g., mobilization of toxic mercury away from the vicinity of the cells), iii) enzymatic attack that is of no detectable benefit to the microorganism (e.g., cometabolic reactions in which a physiologically useful primary substrate induces production of enzymes that fortuitously alter the molecular structure of another compound), and (iv) nonenzymatic reactions stemming from by-products of microbial

physiology that cause geochemical change (e.g., consumption of O2, production of fermentation by-products, or an alteration in pH) (41) Even if microbes are present that can biodegrade using these modes, bioremediation may not occur due to other concomitant factors. Walter and Crawford state that the extent and rate of biodegradation will be determined by many factors working together including the interactions between the environment, the number and type of microorganisms present and the chemical structure of the contaminant(s) being degraded (64). In order to ensure bioremediation occurs at a site, an extensive study of the area including the microbes present, the contaminant type and quantity and the biochemical and geochemical characteristics of the site must be performed (48).

1.1.2 Oxidation Reduction Reactions One of the major factors that can affect the biodegradation activity at a site is the presence of the appropriate environmental conditions for the degrading microorganisms. An example of this is provided by Walter and Crawford who note that biodegradation usually occurs at a faster rate under aerobic conditions versus anaerobic (64). One reason for this lies in microbial thermodynamics. As Smith states, microorganisms obtain all their energy for metabolism by catalyzing a variety of oxidation-reduction reactions. In subsurface environments where there is no photosynthesis, the production and transfer of electrons is the driving force for most microbial processes (58). In oxidation-reduction reactions the electron donor donates an electron and becomes oxidized, and the electron acceptor, gains an electron and becomes reduced. In groundwater systems a number of electron acceptors are often available to microbes; and the most oxidized form of the acceptors, providing the most amount of energy, will be utilized first. As the most oxidized compounds are used up, other electron acceptors will be used. Oxygen is the electron acceptor providing the greatest energy yield measured in Gibbs free energy and oxidation-reduction potential and when it is present, aerobic metabolism will dominate. Gibbs free energy (G0’), the amount of energy in a reaction, is measured in kilojoules per electron equivalent (kJ/e- eq) or kJ/mole and is negative when energy is released (48), and oxidation reduction potential (Eo’), is the likelihood that a chemical species will become reduced and is measured in volts. The more positive the Eo’, the more likely the species will be reduced. Nitrate is the next electron acceptor in the progression. As nitrate is used up iron, manganese and sulphate sequentially follow as electron acceptors. Finally, carbon dioxide becomes the terminal acceptor, being reduced to methane during methanogenesis. However not all of the methane that is produced in a microbially mediated system is derived from carbon dioxide reduction; methane

3 is also produced when volatile fatty acids such as acetate are fermented by fermenting organisms (58).

1.1.3 Reductive Dehalogenation Another group of compounds that may be used as electron acceptors are halogenated hydrocarbons. Sometimes these compounds are degraded biotically in a process called organohalide respiration, in which the compounds are reductively dehalogenated through the removal of one or more halogen atoms and their replacement with hydrogen (43). Estimation of Gibbs free energies and oxidation reduction potentials for a wide range of halogenated aromatic and aliphatic compounds indicate that they should serve as good electron acceptors, giving between -130 and -180 kJ/mol of chlorine removed by reductive dehalogenation (55). Smidt and de Vos note that the corresponding Eo’ range is between +260 and +480 mV, which is within the range of sulphate and nitrate (55).

Although the predominant organohalide respiration reaction involves hydrogenolysis (the replacement of one halogen atom with a hydrogen) another common reaction is for two halogen atoms to be removed simultaneously, called dihaloelimination. Dihaloelimination is more energetically favourable as only one mole of hydrogen is exchanged for two moles of halogen. Thus it is predicted that this reaction will prevail over hydrogenolysis under hydrogen limited conditions (55).

Smidt and de Vos suggest the use of these pathways by organohalide respiring bacteria is likely not a new phenomenon. The natural production and anthropogenic release of halogenated hydrocarbons into the environment has been the likely driving force for the evolution of the plethora of organohalide respiring bacteria able to degrade many different classes of xenobiotic haloorganics (55).

1.1.4 Chlorinated Solvents – 1,1,2,2-Tetrachloroethane and the degradation byproducts Some of the most common and useful haloorganics produced are chlorinated compounds with a wide range serving as solvents and degreasing agents (19, 26). Disposal of these compounds is often problematic however as they tend to accumulate in groundwater and are extremely toxic to humans. An example is 1,1,2,2-Tetrachloroethane (TeCA), a highly chlorinated alkane manufactured as a solvent since before World War I. It is now only produced as a byproduct in the manufacture of other chemicals, in recognition of its toxic nature (52). Nonetheless it is present in a number of contaminated sites and has been the focus of several

4 bioremediation studies (2, 35). Since the 1990’s, Michelle Lorah and others from the USGS have been working to remediate a TeCA contaminated site at the Aberdeen Proving Ground in Maryland (36). They have found that the degradation pathway of TeCA is more complex than for similar compounds such as tetrachloroethene (PCE) since reductive dehalogenation, dihaloelimination and dehydrochlorination are all known to occur. The degradation products include Trichloroethene (TCE), 1,1,2-trichloroethane (1,1,2-TCA), cis-1,2-Dichloroethene (cDCE), trans-1,2-Dichloroethene (tDCE), vinyl chloride (VC), ethene and ethane. Of these degradation products some are more toxic than the parent compound. Vinyl chloride for example is a known carcinogen. A figure of the possible reactions adapted from Lorah et al. is presented below (36).

FIGURE 1.1.4.1 TeCA degradation pathway (3, 36); a= hydrogenolysis reactions, b=dichloroelimination and c= dehydrohaloelimination.

1.1.5 Syntrophy in Dechlorinating Consortia As mentioned above, halogenated aromatics and aliphatics should be effective electron acceptors. However, despite the thermodynamic feasibility of organohalide respiration, these reactions may still be hindered by lack of electron donor. Most organohalide respiring bacteria have been found to use only hydrogen or sometimes acetate as a direct electron donor, where the hydrogen and acetate are produced by hydrolysis and fermentation of more complex electron donors. The complete degradation of halogenated contaminants under anaerobic conditions involves a consortium of many microorganisms working together with complex interrelationships (43). Some members of the consortium hydrolyze complex materials to simple monomers, others

5 ferment these monomers to alcohols and fatty acids for energy, still others oxidize the alcohols and organic acids to produce acetate and hydrogen molecules, and a few competing microorganisms oxidize acetate and hydrogen as electron donors in energy metabolism while at the same time reducing electron acceptors that may be available. Thus there is a syntrophic relationship among the microorganisms involved. The niche for organohalide respiring bacteria is found when chlorinated solvents, for example, are present but biodegradation of these compounds may stall nonetheless because these bacteria must compete for available substrates with other organisms (43). Researchers at the Edwards lab at the University of Toronto have studied a number of microbial consortia and their dechlorinating abilities, including KB-1, WL, DHB-TCA/MEAL and WBC-2 (16, 22, 23, 68).

1.1.6 The WBC-2 Consortium WBC-2 is a culture initially developed by USGS researcher Michelle Lorah. It was found in the Aberdeen Proving Ground at the West Branch Canal Creek, which is the origin of the name. It was has been well documented to dechlorinate TeCA and its degradation byproducts, 1,1,2-TCA, cDCE, tDCE, and VC, to ethene (29, 30). In addition WBC-2 has been found to degrade a range of other recalcitrant compounds. Like KB-1, it is capable of degrading TCE and PCE (see this study, Appendix A) and it has been successfully used to degrade RDX products (Lorah et al. 2008). It has also been shown to degrade chlorinated compounds while in the presence of carbon tetrachloride (CT) (a compound that commonly inhibits dechlorination) as well as CT itself (34). WBC-2 may also dechlorinate chloroform, another common inhibitor of dechlorination (29). This consortium has been studied in alternative energy applications as it stimulates methane production in coal (31). In field applications WBC-2 has been found to be effective in bioaugmenting the reduction of chlorinated ethenes and ethanes in contaminated high flow seep areas of the Aberdeen Proving Ground using a bioreactive mat technology and is included in SiREM Laboratory’s bioremediation formula KB-1 Plus (Dworatzek, SiREM Labs, personal communication), (35).

The organisms that make up the WBC-2 consortium have also been studied by the USGS, and SiREM Laboratories using denaturing gradient gel eletrophoresis (DGGE) and clone libraries (Tables 1 and 2). SiREM Laboratory’s DGGE gel band analysis found that the following microbes were present in the WBC-2 consortium including Dehalococcoides spp., Dehalobacter spp., Acetobacter spp., Clostridium spp., Desulfomicrobium spp., Cytophaga spp., Geobacter spp., Sulfuricurvum spp., Green non-sulfur bacteria, members of the Acidaminococcaceae family,

6 and Sporomusa. The SiREM 16S rRNA clone library produced 100 clones and from this identified 20 different bacteria as shown in Table 1.1.6.1. The closest phylogenetic relatives determined by BLAST search are listed with the corresponding accession numbers provided.

TABLE 1.1.6.1 SiREM Clone Library 2006 (29)

Frequency Phylogenetic Group Accession Closest Relative as Percent Putative Division number 43 Clostridiales: X96959 Acetobacterium fimetarium, Acetobacteria produces Acetate AY214195 Uncultured bacterium clone ZZ14C10, from benzene contaminated groundwater AY570601 Uncultured bacterium clone PL- 18B2, from a biodegraded oil reservoir 19 Clostridiales: DQ777749 Dehalobacter sp. 1,1-DCA1 Dehalobacter sp. AY766465 Dehalobacter sp E1, B-HCH degrader DQ250129 Dehalobacter sp. WL, from 1,1,2- TCA and 1,2-DCA dechlorinating culture 14 Clostridiales: AJ488092 Uncultured bacterium clone IIIA-2, Veillonellaceae chlorobenzene degrader AJ010961 Anaerovibrio burkinabensis DSM 6283(T), anaerobic lactate and saccharide degrader AF150722 Elbe River snow isolate SeqSRB5, isolated on sulphate and pyruvate medium 3 Clostridiales: AY858476 Uncultured bacterium clone Clostridiaceae ZEBRA_37, isolate from zebra gut, probably Clostridium sp. 3 Clostridiales: AF529116 Uncultured Gram-positive Syntrophomonadaceae bacterium clone FTLM142, from a TCE bioremediation site 1 Clostridiales: AB186885 Uncultured bacterium gene, Peptococcaceae Microbe from a dioxin dechlorinating consortium 3 Clostridiales DQ168652 Clostridiales bacterium JN18_A56_K X96961 Eubacterium callanderi, degrades aromatic acids to VFAs 7 Dehalococcoidetes: AJ965256 Dehalococcoides sp. CBDB1, Dehalococcoides Trichlorobenzene and dioxin degrader

DQ833298 Dehalococcoides sp. Clone PMVC7, VC degrading Pere Marquette River sediment enrichment 4 Delta Proteobacteria U81725 Desulfovibrio sp. Strain VeLac3, Sulfate reducer growing on H2, formate, lactate, ethanol from rice paddy soil Y17755 Unidentified Eubacterium clone vadinHA40, microbe from a chlorobenzene degrading culture 1 Bacteroidales AJ488088 Clostridiales bacterium clone IIB- 29, Aroclor 1260 degrading enrichment 1 Uncultured Bacterium DQ833339 Uncultured bacterium clone AuS2VC37, VC degrading Ausable River sediment enrichment

The USGS clone library with a total of 133 clones represented by 28 different bacteria is presented in Table 1.1.6.2; with the closest phylogenetic relative, as determined by BLAST search, and accession number provided, when available.

TABLE 1.1.6.2 USGS WBC-2 Clone Library 2006 (30, 35)

Frequency Phylogenetic Accession Closest Relative as percent group (putative number division) 37 Clostridiales: AY667266 TCE-dechlorinating community in a uncult. contaminated basaltic aquifer (closest Clostridium sp. relative). 26 Clostridiales: X96955 Acetobacterium wieringae isolate. Acetobacteria AY185326, 1,2-Dichloropropane-dechlorinating AY185312 enrichment. AJ535706 Mixed culture that dechlorinates tri- chlorodibenzo-p-dioxin. AJ488081 Chlorobenzene-degrading consortium. AF479584 A. malicum strain HAAP-1. 2 Clostridiales: AF422637 TCE-reducing community Dehalobacter sp. AJ009454 Trichlorobenzene-degrading consortium AJ249096, 1,2-Dichloropropane-degrading AJ278164 populations AY754830 PCB-degrading sediment culture AY754830 1,2-Dichloropropane-dechlorinating

Frequency Phylogenetic Accession Closest Relative as percent group (putative number division) bioreactor population

14 CFB group: AY217446 TCE-dechlorinating population (closest Uncult. relative) Bacteroidetes AY754840 PCB degrading community AJ488070 Chlorobenzene degrading consortia AJ306738 1,2-Dichloropropane-dechlorinating mixed culture less than 1 Delta AF223382 Trichlorobacter thiogenes, isolate that Proteobacteria reductively dechlorinates trichloroacetic acid AF447133 PCE-dechlorinating community AY667270 TCE-dechlorinating community ina contaminated basaltic aquifer AB186851 Polychlorinated dioxin-dechlorinating community AY221614 Soil contaminated with metals and organic solvents 1.5 Delta AJ012591 Sulfate reducing bacteria Proteobacteria AY548775 Desulfobulbus AF050526 Syntrophus in aquifer contaminated with 12DCA, CA, VC. Trichlorobenzene-tranforming consortium EM65:283-286 14 Epsilon AB030592 Petroleum-contaminated groundwater, Proteobacteria AY692045 Arcobacter, anaerobic biofilms Member of 2-bromophenol- dehalogenating consortium 5 Gamma AY321589 Pseudomonas stutzeri (closest relative) Proteobacteria AY017341 Chlorate reducing isolate, Pseudomonas chloritidismutans (very close relative) AJ544240 Aerobic PCE dechlorination

There are some discrepancies between the two libraries, in part due to differences in coverage (49). In addition, the USGS library was constructed when the culture had been enriched after 11 months of transfers to remove sediment, although published in 2006 (35). The SiREM library was completed in 2006 on WBC-2 culture they had been enriching since 2003. Thus the SiREMWBC-2 culture had more time to enrich for the dechlorinating bacteria involved in TeCA, 1,1,2-TCA and cDCE degradation. The main elements are discussed below.

Both the USGS and SiREM Bacterial clone libraries were dominated by Clostridiales at 63% (USGS) and 86% (SiREM). Dehalobacter species, a prominent dechlorinating member of the Clostridiales order, made up 2% of clones in the USGS library and 19% in the SiREM library. The USGS found no Dehalococcoides in their clone library but did using qPCR, and estimated that the amount compared to total cell count in the culture was 1%; furthermore the USGS did not find that the Dehalococcoides population increased dramatically as dechlorinating efficiency of the culture improved. The researchers concluded that Dehalococcoides abundance is not a good indicator of the culture’s ability to degrade chlorinated compounds (35). SiREM found 7% of clones were Dehalococcoides species, and all were from the Pinellas group (27, 28, 33). Recent qPCR studies have proved their presence as a dominant dechlorinator in the WBC-2 consortium, although consistent with the USGS findings, the abundance is lower than literature values for Dehalococcoides in other mixed cultures (see Chapter 3). The USGS has indicated that Geobacter species, also known dechlorinators, may be found in the WBC-2 culture (14). However, although these bacteria were found through SiREM Lab’s DGGE analysis, they were not found in the SiREM clone library or in recent qPCR bacterial population surveys (see Appendix A).

The total methanogens quantified by Lorah et al. using qPCR were 0.2% of the total population (34). Methanogens (Archaea) were not examined in SiREM’s clone library; however, the quantity found through recent qPCR experiments in the Edwards lab using general Archaea primers is as high as 20% (not presented in this thesis). Lorah et al. (35) have observed that methanogens serve a very important role in TeCA degradation by the consortium. In 2004, they found efficient degradation of TeCA occurred only in the presence of acetotrophic methanogens (39). In their column experiments they suggest the high production of methane gas and low efficiency of TeCA degradation could be due to hydrogenotrophic methanogens, or a syntrophic relationship between homoacetogenic Acetobacterium and the methanogens (35).

Researchers at the Edwards lab, Laura Hug and Matt Zarek, used the results from the SiREM clone library to hypothesize that the principle dechlorinators in WBC-2 were Dehalobacter and Dehalococcoides. In addition, there was a single identified clone labelled “Unknown Chloroflexi” (Figure 3.3.2.1), identified by Laura Hug, that was later named Dehalogenimonas eccentricus. This clone was only 91 percent similar to the most closely related clone, PMVC7 (Accession number: DQ833298) (68), but tantalizingly most similar to other dehalogenating clades. Because the Chloroflexi are such an unknown group, Laura and Matt decided to track this

10 clone even though it was at a low abundance We now known that this organism plays a key role in TeCA degradation by degrading tDCE (see Chapter 3).

The predominant non-dechlorinating bacteria assumed to serve syntrophic roles in the WBC-2 consortium included members of Veillonellaceae, Acetobacterium, Desulfovibrio and Archaea (68). Experiments to show relative abundance of these bacteria compared with general bacteria (using general bacteria primers) done by Matt Zarek revealed that these choices provided a relatively complete assessment of the bacterial populations in the WBC-2 consortium. These identified microorganisms were the basis for the population studies covered in this thesis.

1.1.7 Oxygen and pH Sensitivity The WBC-2 consortium has been tested for sensitivity to oxygen and pH. WBC-2 was found to be intolerant to acidic conditions, with a loss of dechlorination capacity below a pH of 5 (29). However the culture was capable of dechlorination with an alkaline pH of 8 and 9. The oxygen sensitivity test entailed monitoring the dechlorination of TeCA (5 M), 1,1,2-TCA (3M), and cDCE (6 M) after exposing WBC-2 to intervals of air (~20.9% oxygen) bubbled through the culture. The culture was exposed to ambient air for intervals of 1, 5, 10, 20 and 60 minutes followed by removal of oxygen by purging the head space with oxygen-free nitrogen. After 60 minutes of exposure, the culture took approximately 10X as long to degrade the substrates while there was no effect to dechlorination with less exposure to air (29, 34).

1.1.8 Electron Donor Selection Jones et al. (30) have investigated which electron donor is most effective at facilitating WBC-2 dechlorinating activity. Succinate, lactate, pyruvate, benzoate, propionate, formate, acetate, H2, H2 mixed with acetate and whey were compared for their ability to facilitate WBC-2 degradation of cDCE, 1,1,2-TCA and VC. The electron donor that was most effective for all three substrates was lactate.

1.1.9 Methods for detecting microorganisms and activity – qPCR Quantitative polymerase chain reaction (qPCR) is a tool that is increasingly being used to analyze microbial cultures and particularly to tie growth of targeted bacteria to substrate consumption. qPCR works much like PCR where template DNA is initially denatured, then annealed to oligonucleotide primers targeting specific sequences, followed by subsequent extension of a complementary strand from each annealed primer by a thermostable DNA

11 polymerase and resulting in an exponential increase in amplicon numbers through cycling of the PCR (57). The benefit of qPCR is that is uses a fluorescent dye, which binds only to double- stranded DNA, for detection. Thus as the target DNA is amplified, the fluorescent signal also increases and the amount of doubling per cycle can be determined in real time. Quantification of the starting template is achieved by finding the threshold cycle (Ct), for the unknown environmental nucleic acid samples and from a range of standards constructed from known amounts of the target gene in question. The Ct value is defined as the cycle number at which the accumulation of amplicons as measured by an increase in fluorescence and is significantly above the background levels of fluorescence. At this point, amplified gene copy numbers are proportional to those of the initial template extracted directly from the environmental sample, and therefore unknown samples can be quantified by comparing their Ct values to the standard curve (56). qPCR is a powerful tool for microbial population analysis in mixed cultures. However it does have some drawbacks. One is that it works on the basis of primers that typically are designed to hybridize with sequences identified already in the culture using a clone library. Thus it may under represent the diversity in the mixed sample if microorganisms have not been identified in the original clone library. Experiments to show that the chosen target microorganisms adequately represent the dominant species in the consortium should be done, for example by adding together the results from each of the targeted bacteria and comparing these with microbial numbers produced using General Bacterial and Archaeal primers (32). However even the general primers may not capture all of the diversity.

Another issue is that qPCR is sensitive to technique and prone to error if measures are not taken to ensure accurate results. A standard curve must be included in every run to assess the quality of the resulting Ct values. Aspects of the standard curves including amplification efficiency (E), linear regression coefficient (r2) and the y-intercept value must be reported. The amplification efficiency describes how well the amplification reaction occurred, a slope of 3 would denote a perfect amplification of one doubling per cycle. For the qPCR experiments in this thesis an efficiency of 100% was targeted, however in some cases results with efficiencies as low at 80% were used and this was noted. The r2 indicates how well the fit of the standard curve describes the variation in the data. The r2 value varies from 0 to 1 with a good fit being indicated by values near 1. A linear regression coefficient of greater than 99% was targeted. Finally, according to Smith et al. the y intercept value is important because it uniquely describes the standard curve and

12 indicates the sensitivity of the reaction with lower values indicating greater sensitivity in the qPCR amplification (56, 57). The y-intercept is the theoretical copy/µl and also serves as a validation tool for comparison between qPCR runs. A deviation of 3 in the y-intercept between runs represents an order of magnitude difference in copy/µl. Thus we defined an acceptable deviation of y-intercept between runs as 1; if the difference was higher than this, the run would have to be repeated. The C(t) values should remain constant for the same sample of DNA, thus it is helpful to include a control sample in each run that is always the same in order to allow comparison between runs.

A final problem with qPCR is that it assumes that the DNA extraction is 100% efficient. If different methods are used to extract DNA a different yield of DNA per ml of culture will be produced leading to different qPCR abundances. In order to manage this, the same DNA extraction method should be used throughout an experiment or series of experiments, if results are to be compared.

1.1.10 Problems and alternatives to 16S gene identification of Dehalococcoides strains The predominant way to phylogenetically differentiate microorganisms is through comparative 16S rRNA analysis. However, with Dehalococcoides species, strains with the same 16S rRNA gene sequence can have different dehalogenating abilities. For example, isolates BAV1 and FL2 have 16S rRNA gene sequence similarity of greater than 99.9%, but only BAV1 is capable of using VC as an electron acceptor for growth. The problem with this is that a researcher could detect Dehalococcoides by qPCR targeting the 16S gene sequence in a mixed microbial culture but would not know if the organism is capable of VC dechlorination, for example (17). Thus some researchers argue that functional genes such as the reductive dehalogenases should be used in place of traditional 16S rRNA analysis (10). Another method would be to compare ribosomal intergenic spacer regions (17). Dr. Paul J. McMurdie II of Stanford University, has proposed differentiating Dehalococcoides species based on a 7 kb genomic region between the 23S and 5S rRNA genes. In this thesis, this approach was investigated as well. A 7 kb portion of the Dehalococcoides genome was sequenced and used to distinguish between strains of Dehalococcoides in the WBC-2 cultures and other known strains of Dehalococcoides (see Chapter 4).

1.2 Research Objectives

WBC-2 is a culture that has been extensively studied, particularly towards field application, but required further characterization to understand the TeCA dechlorination profile and to assign roles of the bacteria in the consortium. The main goal of this thesis project was to further the understanding the functional capacity of the WBC-2 consortium so that it may be used more extensively as a biodegradation tool. The specific goals of this research project were:

1. To further characterize the TeCA degradation pathway in the WBC-2 consortium by tracking the dechlorination profile using analytical techniques.

2. To identify the dechlorinating organisms responsible for each step of the dechlorination of TeCA to ethene in WBC-2 using qPCR.

3. To determine the conditions that will make Dehalogenimonas eccentricus grow in the WBC-2 consortium.

4. To investigate the difference between Dehalococcoides strains in the WBC-2 consortium by comparing a phylogenetically informative region.

1.3 Thesis Outline This thesis includes a general discussion of the history of the WBC-2 culture and subcultures developed in the Edwards Lab and methods used to maintain these cultures in Chapter 2. Chapter 3 presents the key results of this research and is formatted as a journal article on the characterization of the dechlorinating populations in the WBC-2 consortium. Chapter 4 details an experiment on the differentiation of Dehalococcoides strains in the WBC-2 consortium by comparing the variations in the region between the 5S and 23S rRNA genes. Chapter 5 describes future work and general conclusions. Appendix A gives details of other research that has been done on WBC-2 that has not already been covered in other chapters. Finally Appendix B serves as a repository for the sequences obtained from the clones in the Dehalococcoides differentiation experiment from Chapter 4.

2. CHAPTER 2 GENERAL MATERIALS AND METHODS The methods in this section are common to almost all of the experiments in this thesis and cover WBC-2 culture history and maintenance.

2.1 WBC-2 Microbial Consortium History and Maintenance The WBC-2 culture was developed from microcosms initiated in March 2003 by Michelle Lorah from the US Geological Survey (USGS) using samples from a contaminated site in the Aberdeen Proving Ground in Maryland. After several months the sediment slurry was transferred to anaerobic culture medium and was further diluted over two years to obtain a culture with only 0.1% sediment. Once the culture was established and stable it was split into two subcultures. One subculture was maintained on TeCA (30 µM) and lactate (1 mM) and the second subculture was maintained on 1,1,2-TCA (50 µM), cDCE (50 µM), TeCA (25 µM) and lactate (1.5 mM) (30). The combination of three electron acceptors was used to try to maintain a diverse population and robust dechlorinating activity.

In 2003, samples of WBC-2 maintained on 1,1,2-TCA, cDCE, TeCA, and electron donor were transferred from the USGS to SiREM Laboratories in Guelph, Ontario, a subsidiary of Geosyntec Consultants, to generate larger volumes for bioaugmentation. SiREM tested and enriched the culture and had scaled the volume up by 2004. By mid-2006 a 100L parent culture was established. After this time a 1 L bottle of WBC-2 was transferred to the Edwards Lab at the University of Toronto for assessment of its dechlorination capability. The 1 L bottle was used by researcher Jenn Wang to inoculate four new culture lineages, one still amended with a mixture of all three chlorinated compounds (1,1,2-TCA, cDCE, TeCA), and three culture lineages amended with single compounds. Cultures (200 mL) were prepared in 250 mL screw cap clear glass bottles sealed with Mininert caps (VICI Valco Instruments, Houston, TX). Following one year of enrichment, or approximately 24 feedings, 10% transfer cultures were made of each of the single substrate amended cultures by transferring 20 ml of each parent culture into new bottles with 180 ml of fresh media. The culture maintained on all three substrates was used to make a 25% transfer culture. Each of the transfer cultures was amended with the same electron donors and acceptors as their parent culture. All cultures were diluted into medium prepared from the protocol developed by Edwards and Grbić-Galić (18). The four parent and four transfer cultures were incubated statically in an anaerobic glovebox (Coy Laboratory Products, Grass Lake, MI) at

room temperature supplied with a gas mix containing CO2/H2/N2 (10%/10%/80%). They were

15 stored in standard 250 mL serum bottles, with 50 mL of headspace, and sealed with Mininert caps. The culture bottles were draped with a black cloth to block light and prevent growth of phototrophic bacteria. The cultures were named based on a treatment numbering system and a “P” or “T” to delineate parent or transfer, respectively. Thus T1P/ALL is the parent culture and T1T/ALL the transfer of the culture maintained on all three e- acceptors, T2P/CDCE and T2T/CDCE are maintained on cDCE, T3P/TECA and T3T/TECA are maintained on TeCA and T4P/TCA and T4T/TCA are maintained on 1,1,2-TCA.

In 2010 and 2011 several new WBC-2 cultures were created from the T3T/TECA culture including cultures amended with TCE (1X), PCE (1X), tDCE (3X) and VC (1X). There are also one extra culture bottle amended with cDCE and TeCA each. These cultures have no naming convention and were simply named for the e- acceptor added; if there was more than one, a number was given. Each of these cultures was initially amended with 10 mg/L e-acceptor and 10X each of the electron donors required for complete degradation of the chlorinated compounds to ethene. With these new cultures, there is now a total of 16 subculture bottles of WBC-2 (Figure 1.1.10.1)..

In the period between 2009 and 2011 the amount of electron acceptor added was gradually increased in the initial parent and transfer cultures to 40 mg/L for the cDCE cultures, 20 mg/L for the TeCA cultures and 1,1,2 TCA cultures and 10 mg/L each e- acceptor in the cultures amended with all three chlorinated compounds. The e- acceptor amounts added to some of the more recent transfer cultures was increased similarly, with 40 mg/L now added to the cDCE culture, and 20 mg/L now added to the tDCE cultures and TeCA cultures. Ethanol and lactate were added as electron donors at five times the electron equivalents required for complete dechlorination of each added electron acceptor to ethene. The equations for determining the electron equivalents are provided in the following section. The concentrations of electron acceptor and donor added as of 2011 are listed in Table 1.1.10.1. The time for complete dechlorination in these batch cultures ranged from just under two weeks for cultures with single substrates to one month or longer for the cultures amended with all three e- acceptors.

FIGURE 1.1.10.1 WBC-2 Culture Lineage Tree depicting the initial culture conditions and the researcher responsible for creating the cultures.

TABLE 1.1.10.1 2011 Substrate Concentrations for WBC-2 Maintenance Cultures. All cultures were 200ml with Mininert caps.

e- e- Donor e- Donor e- Culture bottle name Acceptor (Lactate) (Ethanol) Acceptor Conc. Conc. Conc. T1P/ALL cDCE 100 µM TeCA 60 µM 460 µM 460 µM T1T/ALL 1,1,2- 75 µM TCA T2P/CDCE T2T/CDCE cDCE 410 µM 740 µM 740 µM cDCE T3P/TECA T3T/TECA TeCA 120 µM 300 µM 300 µM TeCA T4P/TCA 1,1,2- 150 µM 250 µM 250 µM T4T/TCA TCA VC VC 160 µM 160 µM 160 µM PCE PCE 60 µM 160 µM 160 µM TCE TCE 75 µM 155 µM 155 µM tDCE 1 tDCE 2 tDCE 205 µM 360 µM 360 µM tDCE 3

2.1.1 Electron Equivalents The amount of electron donor to add is calculated based on electron equivalents. e- eqa = Ca *(Vl + KHd * Vg) / (MWa * (EQ)a)

Where: e- eqa is the electron equivalents of a specific e- acceptor added to a given culture bottle with liquid and headspace volumes Vl and Vg.

Ca is the concentration of e- acceptor added (g/L)

Vl is the liquid volume of culture (L)

KH is the dimensionless Henry’s Law constant of the e- acceptor, further described below

Vg is the volume of headspace (L)

MWa is the molecular mass of the electron acceptor (g/mol)

(EQ)a is the electron equivalents per mole of the e- acceptor (e- eq/mol)

The calculated electron equivalents are used to determine the amount of electron donor to add:

Vd = e- eqa * Sd * MWd / ((EQ)d * d)

Where:

Vd is the volume of neat halogenated organic electron donor to add to cultures (L)

Sd is a multiplication factor, further explained below

MWd is the molecular weight of the e- donor (g/mol)

(EQ)d is the electron equivalents per mole of the e- donor (e- eq/mol)

d is the neat halogenated organic e- donor density (g/L)

The multiplication factor Sd is the factor applied to the e- donor so that it is present in excess to ensure no donor limitation. In the maintenance cultures, the e- donor multiplication factor is 5, while for growth trial experiments the factor is 10. An excess of electron donor was provided because there are many electron acceptors, in addition to the halogenated organics in the culture.

In particular there is CO2 which is reduced to methane by methanogens, or to acetate by acetogens.

2.1.2 Henry’s Law constant The Henry’s constants follow from Henry’s Law, which states that at a constant temperature, the amount of a given gas that dissolves in a given type and volume of liquid is directly proportional to the partial pressure of that gas in equilibrium with that liquid (51). This law is valid in this case because the solutions are dilute and at a low pressure.KH = ca/pg

Where:

KH is the Henry’s constant (M/atm) ca is the concentration of a species in the aqueous phase (mol/L) pg is the partial pressure of that species in the gas phase (atm)

The Henry’s Law constants used here were expressed as a dimensionless ratio between the aqueous-phase concentration ca of a species and its gas-phase concentration cg.

KHd = ca / cg = KH * RT

Where: cg is the concentration of the species in the gas phase (mol/L)

R is the gas constant (atm/M*K)

T is the temperature (K)

The Henry’s Law constants used for the above electron equivalents calculations are provided in

Table 2.1.2.1, the dimensionless KH was determined assuming temperature was 298 K:

TABLE 2.1.2.1 Dimensionless Henry’s Law Constants Used for Headspace Analysis

Substance KHd Reference 1,1-DCE 5.38E+00 (40) cDCE 3.14E-01 (40) tDCE 2.72E-01 (40) TCE 4.98E-01 (40) PCE 9.29E-01 (40) 1,1-DCA 2.40E-01 (40) 1,2-DCA 4.44E-02 (40) 1,1,2-TCA 4.87E-02 (40) TeCA 1.95E-02 (40) Ethene 8.70E+00 (40) Ethane 2.04E+01 (40) Methane 3.14E+01 (40) VC 9.29E-01 (66)

3. CHAPTER 3 CHARACTERIZATION OF THE DECHLORINATING MICROORGANISMS IN THE WBC-2 CULTURE The coauthors on this chapter that will be submitted as a Journal paper are:

Matt Zarek, a thesis and summer student who did the initial WBC-2 population abundance surveys and contributed to the manuscript.

Sandra Dworatzek from SiREM Laboratories who provided culture and recommendations on growth.

Laura Hug, a PhD student who identified Dehalogenimonas in WBC-2, designed qPCR primers for Dehalogenimonas and constructed the phylogenetic trees.

3.1 Introduction One of the first chlorinated solvents produced in North America before the First World War, 1,1,2,2 tetrachloroethane (TeCA) leaves a lingering and deadly legacy due to poor waste management practices (7). TeCA is no longer produced due to known human toxicity; chronic exposure can cause liver damage and has been recognized as a possible human carcinogen by the United States Environmental Protection Agency. Fortunately, the pathways of human exposure to TeCA are limited. TeCA is prone to volatilization and subsequent degradation by hydroxyl radicals present in the atmosphere, and so it generally only accumulates as an environmental contaminant in groundwater. Even so, TeCA has been detected in some 326 of 1699 sites recommended for the National Priorities List (52); and is ranked 146th out of 275 chemicals on the 2007 CERCLA hazardous chemicals list, a ranking system based on frequency of detection, toxicity and potential for human exposure (1). In anaerobic groundwater, TeCA degrades biotically through reductive dechlorination and dichloroelimination to the non-toxic end-product ethene and abiotically by hydrogenolysis to trichloroethene (TCE) (36). However, the intermediate daughter products along the microbially mediated TeCA degradation pathway, especially vinyl chloride (VC), are more toxic than the parent compound (11). Thus the ability to rapidly degrade these daughter products is an asset for any microbes used in TeCA bioremediation. There are several known microbial consortia and a handful of isolated strains that are capable of dechlorinating TeCA. Most of these cultures break down TeCA through a dichloroelimination step to cis-1,2-dichloroethene (cDCE) or trans-1,2-dichlorethene (tDCE), and are capable of complete degradation of TeCA to ethene (2, 3, 7, 36, 45, 50, 60-62). An

21 example is microbial mixed culture designated WBC-2 which was enriched from sediment from the West Branch Canal Creek (37). This culture dechlorinates TeCA to ethene predominantly through an initial dichloroelimination to tDCE. WBC-2 is remarkable for its ability to degrade a wide range of particularly recalcitrant contaminants. For example, the culture reductively dechlorinates TeCA, 1,1,2-TCA, 1,2-dichloroethane, TCE, cDCE, tDCE, and VC to the nontoxic end products ethane and ethene (29, 30, 36); as well as Carbon Tetrachloride (CT), Chloroform (CF) and 1,3,5-Trinitroperhydro-1,3,5-triazine (RDX) (29, 35, 38). Mixed dechlorinating cultures, such as WBC-2, break down chlorinated solvents by leveraging syntrophic interrelationships, with fermenting bacteria providing the hydrogen ions required by the dechlorinating bacteria to reduce the chlorinated electron acceptor (65). Often there are a number of dechlorinating organisms present whose populations shift depending on substrate abundance. In well-characterized mixed cultures capable of reductive dehalogenation, each of the dechlorinating bacterial species has been found to degrade a relatively narrow range of substrates. For example, Dehalococcoides species degrade TCE, cDCE and VC to ethene, and Dehalobacter species typically degrade 1,1,2-trichloroethane (1,1,2-TCA) to VC (16, 24). Strains that have been found to degrade TeCA include Desulfuromonas michiganensis (to end product cDCE), Desulfitobacterium Y51 (to end product cDCE) and Dehalogenimonas lykanthroporepellans (45, 60, 61). Although WBC-2 can degrade TeCA stoichiometrically to ethene, the microorganisms responsible for each dechlorination step in this culture have not clearly been identified.

In this study, we tracked the changes in the abundance of specific microbial populations in WBC-2 sub-cultures amended with different electron acceptors to identify growth conditions. We were able to assign roles to the Dehalobacter, and Dehalococcoides populations in the culture, and further identify a novel non-Dehalococcoides Chloroflexi that dechlorinates tDCE.

3.2 Materials and Methods

3.2.1 Time Course Experiments Several time course experiments were conducted to track the growth of specific phylotypes during dechlorination of different substrates. We found that WBC-2 did not dechlorinate well when diluted by 1:50 into sterile anaerobic medium; therefore, more conservative dilutions of 1:5 and 1:20 were used for these experiments. These two experiments will be discussed below.

In both sets of time course experiments, an inoculum of a TeCA-enriched culture was prepared by combining several bottles of highly enriched and active TeCA-degrading culture. The inoculum was well mixed and aliquots were added into glass bottles that were topped up with fresh medium to give the appropriate dilution and sealed with Mininert screw-capped tops (VICI Valco Instruments, Houston, TX). Triplicates were made of each condition, with a single electron acceptor added at a targeted concentration of 8-10 mg/L. Electron donors lactate and ethanol were added at 10X the electron equivalents. Triplicate uninoculated control bottles consisted of medium plus electron acceptor and electron donor, while active control bottles comprised triplicates of inoculated media with electron donor only (free of chlorinated compounds). Tables 3.2.1.1 and 3.2.1.2 list the treatment conditions for the two time course experiments.

TABLE 3.2.1.1 The 1:5 Dilution of Inoculum Cultures and Treatment Conditions. All cultures were 200ml with Mininert caps.

e- Donor e- Donor e- Acceptor Treatment Reps e- Acceptor (Lactate) (Ethanol) Conc. Conc. Conc. 1:5 cDCE 3 cDCE 100 µM 370 µM 370 µM 1:5 tDCE 3 tDCE 100 µM 370 µM 370 µM 1:5 TeCA 3 TeCA 60 µM 300 µM 300 µM 1:5 Control 3 - - 370 µM 370 µM

TABLE 3.2.1.2 1:20 Dilution of Inoculum Cultures and Treatment Conditions. All cultures were 50 ml with rubber stopper caps.

e- Donor e- Donor e- Acceptor Treatment Reps e- Acceptor (Lactate) (Ethanol) Conc. Conc. Conc. 1:20 cDCE 3 cDCE 80 µM 300 µM 300 µM 1:20 tDCE 3 tDCE 80 µM 300 µM 300 µM

1:20 TeCA 3 TeCA 50 µM 240 µM 240 µM

1:20 VC 3 VC 130 µM 300 µM 300 µM

1:20 Control 3 - - 300 µM 300 µM

In the 1:5 dilution experiment, the inoculum was created from four bottles of TeCA-enriched culture that were pooled for a total volume of 800 ml culture and mixed well. Three different single substrates, cDCE, tDCE, and TeCA, were used to investigate the growth of dechlorinating

23 bacteria. Electron acceptor concentrations were targeted at 10 mg/L for aqueous concentrations (see Table 3.2.1.1). Otherwise, the cultures were set up as described in Chapter 2. Samples for DNA extraction were taken at time zero, just prior to adding substrate and electron donor, again after 50% degradation of the primary chlorinated substrate was completed as determined by gas chromatography, and again once complete degradation had occurred. For TeCA-amended cultures, samples were taken after complete degradation of TeCA and again after complete degradation of tDCE. The experiment was continued over three degradation cycles, or about 70 days. Only lactate was re-amended to all bottles during two occasions in the first degradation cycle and thereafter was added with ethanol when cultures were re-amended with electron acceptor.

A second growth trial was carried out using a greater dilution of the starting inoculum in order to achieve more significant growth of prominent dechlorinators. To accomplish this, TeCA-enriched culture that had been degrading TeCA at a constant rate for more than three complete degradation cycles was used as the inoculum. The culture set-up was the same as above except 60 ml glass serum bottles with butyl rubber stoppers sealed with metal crimp tops were used. These bottles and stoppers were chosen because they were more immediately available and were deemed appropriate for use as no adsorption of solvent to rubber was detected. The amount of electron acceptor added was targeted at 8 mg/L which was lower than the previous growth trial in an effort to shorten the time for dechlorination, while the ethanol and lactate were again added at 10X the amount of electron equivalents required for complete degradation to ethene each (see Table 3.2.1.2). Four different substrates, TeCA, cDCE, tDCE, and VC, were tested independently in triplicate bottles and compared against uninoculated controls as described above. The samples for DNA extraction were taken at slightly different junctures than for the above 1:5 growth trial: the time zero sample was taken from the inoculum before diluting in the experiment bottles, the next sample was obtained just at the point when the electron acceptor had been completely degraded, and for the TeCA-amended treatment, the final sample was taken when the tDCE had been completely degraded. The growth trial was continued over 2 degradation cycles lasting a total of about 70 days. Only lactate was re-amended to all cultures during the first degradation cycle and to the TeCA amended cultures in the second degradation cycle. Otherwise ethanol and lactate were re-amended when cultures were re-amended with electron acceptor.

3.2.2 DNA Extraction

DNA was extracted from the various enrichment cultures for qPCR analysis. For the time course experiments, 5 mL was removed from each culture bottle and was filtered through sterile 0.2 μm Sterivex filters (Millipore, Billerica, MA). To survey the abundance of specific phylotypes in the parent and transfer cultures using qPCR, 50 ml of culture was sampled and cells harvested using Sterivex filters as above. The filters were frozen for more than one hour at -80°C. Next, the membrane filter in the Sterivex cartridge was excised and sliced with a sterile surgical blade and placed into the bead-beating tube of the UltraClean Soil DNA Kit (Mo Bio Laboratories Inc., Carlsbad, CA). The DNA was extracted from the filter following the manufacturer’s alternative protocol for maximum yields, except that DNA was eluted in sterile water rather than the eluant provided to facilitate downstream DNA analysis. The DNA concentration and quality were assessed using a spectrophotometer (NanoDrop ND-1000; NanoDrop Technologies, Wilmington, DE). DNA was stored at 4C.

3.2.3 Primer Design for qPCR The qPCR primers were designed by aligning the sequences of the putative operational taxonomic units (OTUs) with ClustalW (Bioedit) and visually identifying unique candidate segments relative to other community member sequences. The primers were chosen by eye, and tested using OligoAnalyzer 3.1 (Integrated DNA Technologies, www.idtdna.com/analyzer/applications/oligoanalyzer/). The design criteria specified primers that had an annealing temperature around 60 °C, and which would be thermodynamically unlikely to form a hairpin loop, self-dimerize, or form hetero-dimers with their amplification partner primer. The primers were synthesized by Sigma. Lastly, the qPCR primers were verified by regular PCR with positive and negative controls to ensure specificity.

3.2.4 Real-Time Quantitative PCR for Time Course Experiments DNA extracted from the WBC-2 cultures was amplified by real-time quantitative PCR (qPCR). Primer sets were chosen to target the following genera: Dehalococcoides, Dehalobacter and Dehalogenimonas (Table 3.2.4.1).

TABLE 3.2.4.1 qPCR Primers Used in This Study

Annealing Refs. Primer Phylogenetic Temp. Sequence 5’-3’ Set Target (°C) Dhb477f GATTGACGGTACCTAACGAGG (24) Dehalobacter 62.5 Dhb647r TACAGTTTCCAATGCTTTACGG (24) Dhc1f GATGAACGCTAGCGGCG (28) Dehalococcoides 59 Dhc264r CCTCTCAGACCAGCTACCGATCGAA (28) oddDhc_ this study TAGCTCCCGGTCGCCCG 273F Dehalogenimonas 59 oddDhc_ CCTCACCAGGGTTTGACATGTTAGAA this study 537R G

The choice of these organisms was based on the results from the clone library that was generated by SiREM Laboratories in 2006, highlighting the microorganisms that likely play an important role in dechlorination (29). DNA samples were diluted 100X with distilled water that had been filtered with a 0.2 m filter (Acrodisc, Pall Corporation, Port Washington, NY) prior to qPCR analysis to minimize inhibition. Once dilutions were made, the samples were stored at 4 ºC for immediate use. Further DNA sample manipulations such as preparing qPCR reactions were done in a PCR cabinet (ESCO Technologies, Hatboro, PA) with the fan on. Each qPCR reaction was run in triplicate. The qPCR reactions were calibrated by constructing a standard curve using known concentrations of plasmid DNA containing the corresponding 16S rRNA gene insert. The reactions were run in an Opticon DNA Engine 2 Continuous Fluorescence Detector (MJ Research) with the SYBR Green JumpStart Taq ReadyMix kit (Sigma-Aldrich, St. Louis, MO). Each 20 µL reaction mixture contained 1X SYBR Green JumpStart Taq ReadyMix, 0.5 µM each of both forward and reverse primers, and 2 µL of diluted DNA template. The thermocycling program was as follows: initial denaturation at 95°C for 5 minutes; 45 cycles of denaturation, at 95°C for 30 s, annealing at 59°C for 30 s and extension at 72°C for 30 s; and a final melting curve analysis from 72 to 95°C, measuring fluorescence every 0.5°C. The Dehalobacter qPCRs were run with an annealing temperature of 62.5°C.

3.2.5 Cloning with Topo TA for qPCR Standard Curves The plasmid DNA for use in qPCR standard curves was produced using the Topo TA Cloning Kit with OneShot® TOP10 chemically competent cells (Invitrogen Corporation, Carlsbad, CA) according to manufacturer’s instructions with the following exceptions. DNA was cloned from both PCR product amplified from previously prepared plasmid DNA and from

26 previously prepared plasmid DNA without PCR amplification, in both cases 1 μl of DNA was used in the cloning reaction for eventual transformation and incubated for 5 minutes. Transformed cells were spread in 20 μl and 100 μl amounts over individual plates and allowed to incubate overnight. White colonies were transferred to 2 ml LB media with 50 μg/ml kanamycin to grow up overnight on a shaking incubator (Innova, New Brunswick Scientific, Edison, NJ) set at 400 rpm and 37 ºC. From this, 300 μl was added to 700 μl 50:50 distilled water/glycerol solution for storage in the -80°C freezer. Then plasmid DNA was extracted from the remaining fresh overnight culture using the Sigma GenElute Plasmid Miniprep Kit according to manufacturer’s instructions.

The standard curves comprised serial dilutions of the plasmid DNA for each bacteria of interest from 108 copies/ul DNA stock solutions. The stock solutions were made by adding the appropriate amount of plasmid DNA, calculation shown below, to 500 μl of filtered distilled water.

To determine the amount of plasmid DNA to add to 500 μl, the gene copies/μl were calculated as follows:

-1 -1 -9 gene copies/μl = ((CDNA) * (Av * (MWDNA) * (Tbp) * 10 g/ng)

Where:

CDNA is the concentration of DNA in the sample (ng/ul)

Av is number of basepairs (bp) of nucleotides in one mole of DNA (Avogadro’s number = 6.02 x 1023) (bp/mol bp)

MWDNA is the molecular weight of DNA (660 g/mol bp)

Tbp is the total number of base pairs in the 16S rRNA gene sequence (1550 for the Bacterial clones and 1100 for the Archael clones).plus the vector (3931) per gene copy.

Thus the amount of plasmid DNA to add to 500 μl water to make the 108 copies/μl stock was found using the above calculated gene copies /μl:

Volume to add to 500 μl = 108 copies/μl / (calculated gene copies/μl) * 500 μl

Aliquots of the 108 stock solutions were stored at 4 ºC for immediate use while the remainder was stored at -20 degrees. Standard curves were made with the stock solutions using a set of 7 serial dilutions: 108, 106, 105, 104, 103, 102 and 10 copies per microlitre.

3.2.6 qPCR Calculations The Opticon 2 software program (DNA Engine, Bio-Rad, Hercules, CA) computes an equation of the standard curve from each run, and uses this to determine the concentration of unknown samples. To obtain the equation first the user must define a threshold (Ct), the cycle number at which the curves are significantly above background fluorescence and within the exponential phase. The Ct is a critical number that affects the standard equation and must be chosen to supply optimal efficiency. The Ct for each of the runs in this experiment was set at the same number, which was a log fluorescence of 0.015; when the same threshold is used for all runs, it is possible to meaningfully compare the y-intercept. This threshold ensured high amplification efficiency for all runs regardless of primer set utilized. The amplification efficiency (E) could be assessed from the slope of the standard curve using the following equation (47):

E = 10(-1/slope)*100%

The software automatically computes the copies/μl of target DNA present in the samples using the standard curve equation. The 16S rRNA gene copies/ml culture must be calculated as follows:

Copies/ml culture = (copies/μl DNA) * (volume of DNA sample (μl)) / (volume of culture used for DNA extraction (ml))

Where:

The volume of sample DNA was 30 μl

The volume of culture used for DNA extraction was 5 ml for the time course experiments and 50 ml for the population abundance screens.

3.2.7 Analytical Procedures For culture maintenance and time course experiments a gas chromatograph (GC) was used to measure the concentrations of the volatile chlorinated compounds and reduced end products. For analyzing the concentration of chlorinated alkanes and alkenes, methane, ethene and ethane in the WBC-2 cultures, a 300 µL headspace sample was injected into a Hewlett Packard 5890 Series II gas chromatograph coupled with a flame ionization detector and a GSQ 30 m by 0.53

28 mm (inner diameter) PLOT column (J&W Scientific, Folsom, CA). The oven temperature was held for 1 min at 50 °C, then ramped up to 190 °C at 30 °C/min and held constant at 190 °C for 5 minutes. For analyzing the concentration of TeCA another 300 µL headspace sample was injected onto a 7890A GC System (Agilent Technologies, Santa Clara, CA) gas chromatograph coupled with a flame ionization detector and a DB624 column (Agilent). The oven temperature was held for 1 min at 40 °C, then ramped up to 200 °C at 30 °C/min and held constant at 200 °C for 5 minutes. Aqueous external standards of TeCA, TCE, tDCE, cDCE 1,1-DCE, 1,2-DCA and 1,1,2-TCA, were prepared gravimetrically using methanolic stocks. VC (Sigma-Aldrich) was added separately to these standards using a gas tight syringe (Hamilton Company, Reno, NV). Another set of aqueous external standards of ethene, methane and ethane were made using 99.5% pure ethene and gas mix with 1% of each compound (Scotty II; Alltech Associates Inc., Deerfield, IL) and used to calibrate the GC.

3.3 Results and Discussion

3.3.1 qPCR Standard Curve Equations The standard curve equations resulting from each of the qPCR runs used to determine the quantity of dechlorinating bacteria are displayed below. They are presented with the mean y- intercept with the standard deviation as well as the mean efficiency and standard deviation. The standard deviation of the y-intercept for each of the dechlorinating bacteria is less than 3, thus there is less than an order of magnitude of difference between the runs. The mean efficiency is above 90% for each of the dechlorinating bacteria.

TABLE 3.3.1.1 The Standard Curve Equations Generated from the qPCR Runs from the 1:5 and 1:20 Growth Trials

Mean y standard Mean standard Standard Curve Equations E intercept deviation Efficiency deviation DHB (Dehalobacter) y = -3.614x + 34.15; r2 = 0.996 89.1 y = -3.459x + 33.32; r2 = 0.997 94.6 y = -3.397x + 33.12; r2 = 0.995 97.0 y = -3.549x + 33.86; r2 = 0.994 91.3 33.4 0.6 92.5 3.8 y = -3.56x + 33.14; r2 = 0.995 90.9 y = -3.398x + 32.30; r2 = 0.996 96.9 y = -3.668x + 33.89; r2 = 0.998 87.3

Mean y standard Mean standard Standard Curve Equations E intercept deviation Efficiency deviation DHC (Dehalococcoides) y = -3.55x + 33.21; r2 = 0.997 91.3 y = -3.683x + 33.91; r2 = 0.996 86.9 y = -3.423x + 31.99; r2 = 0.994 95.9 y = -3.613x + 33.29; r2 = 0.997 89.1 y = -3.554x + 33.20; r2 = 0.99 91.1 33.6 1.2 93.0 7.0 y = -3.264X + 31.83; r2 = 0.995 102.5 y = -3.693x + 34.79; r2 = 0.998 86.5 y = -3.657x + 34.42; r2 = 0.997 87.7 y = -3.186x + 35.64; r2 = 0.992 106.0 Dehly (Dehalogenimonas) y = -3.204x + 31.07; r2 = 0.99 105.2 y = -3.291x + 32.20; r2 = 0.993 101.3 y = -3.495x +35.63; r2 = 0.998 93.3 y = -3.412x + 32.73; r2 = 0.996 96.4 33.3 1.5 95.9 5.6 y = -3.462x + 33.14; r2 = 0.995 94.5 y = -3.572x + 34.55; r2 = 0.995 90.5 y = -3.588x + 33.58; r2 = 0.998 90.0

3.3.2 Population Abundance and Putative Dechlorination Roles In 2006, a bacterial clone library was constructed using DNA from a WBC-2 culture that was maintained on a mixture of TeCA, cDCE and 1,1,2-TCA and donors lactate and ethanol. One hundred bacterial clones returned 85 chimera-free sequences representing 20 different microbes. Though 85 clones do not provide a deep study of the microbial diversity, the library provided some insight into the major species present (Figure 3.3.2.1).

Syntrophomonadaceae 1% Peptococcaceae 1% Unknown Chloroflexi Bacteroidales 1% 1%

Desulfovibrio Anaerovibrio 4% 5%

Acetobacterium 47% Dehalococcoides 6% Clostridiales 7%

Acidaminococcaceae Dehalobacter 8% 19%

FIGURE 3.3.2.1 WBC-2 clone library sequences based on BLAST identification of the 16S rRNA gene against the NCBI nr database. Groupings are based on genus and, where unclear, higher hierarchical classifications. The only exception is the Unknown Chloroflexi, which was separated from its BLAST-based genus (Dehalococcoides). The predominant dechlorinators were Dehalococcoides and Dehalobacter; other organisms included Acetobacterium, Veillonellaceae, Desulfovibrio and methanogens. An oddity in this clone library was a single clone that was assigned to the genus Chloroflexi based on 16S rDNA gene similarities. It was of particular interest despite its single appearance in the clone library as it showed a significantly higher divergence within the 16S rDNA gene compared to other putative Dehalococcoides clones in the library. As determined by a BLAST search, this clone had only 91% similarity to its nearest phylogenetic relative, an uncultured environmental Dehalococcoides clone (Accession number: DQ833298). The five other Dehalococcoides clones from the WBC-2 library showed 99% and 100% similarity with strain CBDB1, for two and three clones, respectively. A 16S rDNA phylogenetic tree shows the novel Chloroflexi sequence’s affiliation within the clade of described dechlorinators (Figure 3.3.2.2). The 16S rDNA sequence is more closely related to recently described strains of Dehalogenimonas (45), thus it was dubbed “Dehalogenimonas eccentricus”. It was hypothesized that this novel bacterium, Dehalogenimonas eccentricus, so named because of its close proximity to other Dehalogenimonas species and as it was the “odd one out” in the clone library, has a role in TeCA dechlorination because of its proximity to other known TeCA dechlorinators on the phylogenetic tree (Dehalogenimonas lyanthroporepellans).

FIGURE 3.3.2.2 Maximum likelihood phylogenetic tree of Chloroflexi 16S rDNA sequences. The alignment was generated using the GreenGenes NAST alignment algorithm, with subsequent alignment of three additional sequences using the Geneious consensus alignment builder. The alignment was manually edited and masked, and the tree generated using the PhyML plugin in Geneious under the GTR model of evolution. Bootstrap support values (out of 100 bootstraps) are indicated. Where applicable, the NCBI accession numbers are listed. In 2008, the relative quantities of 16S rRNA gene copies/ml of culture of each of the dechlorinating organisms, Dehalococcoides, Dehalobacter and Dehalogenimonas, in the parent and transfer cultures, were determined (Figure 3.3.2.3). From this examination, all three phylotypes were significantly present in the cultures maintained on a mixture of all three substrates and those fed TeCA had a higher relative percentage of Dehalogenimonas. This further strengthened the hypothesis that Dehalogenimonas has a role in TeCA degradation. The elucidation of the specific role of Dehalogenimonas within the TeCA degradation pathway required time course experiments to examine growth in real-time using specific chlorinated compounds.

32 100% 90% 80%

70% 60% 50% 40%

30% 20% 10%

0% cDCE, TeCA TeCA 1,1,2-TCA 1,1,2-TCA cDCE cDCE 1,1,2-TCA, parent transfer parent transfer parent transfer TeCA Dehalococcoides Dehalobacter Dehalogenimonas

FIGURE 3.3.2.3 Relative abundance of dechlorinating bacteria in the WBC-2 consortium based on qPCR community screens with organism-specific primer sets. 100% represents approximately 2E7 16S rRNA copies/ml culture.

3.3.3 Time Course Experiments: 1:5 Dilution Results The GC profile of the degradation of TeCA by WBC-2 shows a successive peak pattern of products, with TeCA being degraded through dichloroelimination to tDCE, followed by reductive dechlorination of tDCE to ethene (Figure 3.3.3.1a).

Although VC was not detected in dechlorination trials amended with TeCA (Figure 3.3.3.1a), it was hypothesized that there are three different substrate niches for different dechlorinating bacteria to capitalize on within this process. The qPCR results indicated that all three dechlorinating bacteria tracked in this study (Dehalobacter, Dehalococcoides, Dehalogenimonas) grow in TeCA-fed cultures, increasing in cell density by about one order of magnitude over the course of 30 days (Figure 3.3.3.1b). The cultures fed tDCE and cDCE also display a successive peak pattern of degradation with hydrogenolysis steps to VC and then ethene (Figures 3.3.3.2a and b).

The degradation of tDCE to VC suggests that TeCA-fed cultures also degrade tDCE to VC, although VC did not accumulate to detectable levels in the TeCA-fed bottles. Both the cDCE and tDCE substrates were degraded completely in about 30 days. The similarity of these two rates confirms that the tDCE seen accumulating in WBC-2 cultures amended with TeCA is the dominant product of dihaloelimination, and not a product that accumulates due to an inability of

33 the culture to degrade it further. The qPCR results from the tDCE and cDCE amended conditions for Dehalogenimonas and Dehalococcoides growth show differential organism growth (Figure 3.3.3.2c and d, respectively). In the tDCE condition there is significant growth of Dehalogenimonas, of about an order of magnitude over the course of dechlorination, while in the cDCE fed condition there is no significant growth of Dehalogenimonas, similar to the donor amended control (Figure 3.3.3.2c). However, Dehalococcoides shows increased growth under both conditions (tDCE and cDCE) (Figure 3.3.3.2d). Dehalobacter growth was also examined in the tDCE and cDCE bottles, but did not show growth in either condition (not shown).

From this examination, it can be seen that though all three dechlorinating genera grow in the TeCA fed condition, the Dehalogenimonas exhibits specific growth in the presence of tDCE, the dominant daughter product from TeCA dihaloelimination.

In order to further parse out the roles of the bacteria in the TeCA degradation pathway, another growth trial was conducted using a higher, 1:20 dilution, and a new condition added wherein the single substrate VC was amended in addition to the other three substrates.

14 12 Ethene 10 TeCA tDCE

6 4

2 Concentration (umol/bottle) 0 1,1,2-TCA b) 0102030

1.E+07 DHC DHB

1.E+06

culture 1.E+05 Dehly

gene copies/ml 16 S rRNA 1.E+04 0 102030

Time (Days)

FIGURE 3.3.3.1 Dechlorination of TeCA by WBC-2. a) TeCA dechlorination profile with 1:5 diluted culture. Each curve shows the mean values of triplicate bottles and error bars are the standard deviation. Black squares represent TeCA; black crosses, 1,1,2-TCA; black circles, tDCE; and white squares, ethene. b) Dehalobacter (DHB), Dehalococcoides (DHC) and Dehalogenimonas (Dehly) growth during TeCA dechlorination. Circles represent DHB; squares, DHC; triangles Dehly; closed symbols indicate cultures amended with electron donor and TeCA, open symbols with dashed lines indicate controls amended with electron donor only.

35 a) 25 b) 25 tDCE cDCE Ethene 20 Ethene 20

15 15

10 10 (umol/bottle) (umol/bottle) VC Concentration 5 Concentration 5 VC 0 0 0 102030 0102030

c) d) Amended with cDCE 5.E+06 5.E+06

Amended with tDCE Amended with tDCE 5.E+05 5.E+05 culture Amended with cDCE Amended with e- donor

culture

16S rRNA gene copies/ml 16S rRNA 5.E+04 Amended with e- donor 5.E+04

0102030 gene copies/ml 16S rRNA 0102030 Time (Days) Time (Days)

FIGURE 3.3.3.2 a) tDCE dechlorination profile with 1:5 diluted culture. Each curve shows the mean values of triplicate bottles and error bars are the standard deviation. Black circles represent tDCE; black triangles, VC and white squares, ethene; b) cDCE dechlorination profile with 1:5 diluted culture. Symbols as in a) except that black diamonds represent cDCE; c) Dehalogenimonas (Dehly) growth on tDCE, cDCE and just electron donor, triangles represent Dehly; closed symbols indicate cultures amended with electron donor and e- acceptor, open symbols with dashed lines indicate controls amended with electron donor only; d) Dehalococcoides growth on tDCE, cDCE and just electron donor. Symbols as in c) except squares represent DHC.

3.3.4 Time Course Experiments: 1:20 Dilution From this second trial, it was observed that the three dechlorinating bacteria exhibited growth of approximately one order of magnitude in the TeCA-fed trials over the 70 day study period. A comparison of the qPCR results for Dehalobacter growth in the TeCA and tDCE amended cultures shows that Dehalobacter grows on TeCA but not on the degradation products (Figure 3.3.4.1b and Figure 3.3.4.2b, respectively, and Figure 3.3.4.5). Dehalobacter was not seen to grow in cDCE or VC conditions either (not shown).

Similar to the 1:5 dilution trial, the 1:20 dilution experiment condition exhibited growth of Dehalogenimonas on tDCE but not on cDCE, Figure 3.3.4.3. In the case of the VC amended cultures, the Dehalogenimonas was not seen to grow on VC (Figure 3.3.4.5). However, Dehalococcoides grew on VC at a slightly greater rate than on the tDCE over two degradation cycles (Figure 3.3.4.4).

37 a) 6

Ethene 4 tDCE 3 TeCA 2

Concentration (umol/bottle) 0 0 204060 b) 1.E+07 DHC

1.E+06 DHB Dehly 1.E+05 culture

1.E+04

16S rRNA gene copies/ml 16S rRNA

1.E+03 0 204060 Time (Days)

FIGURE 3.3.4.1 Dechlorination of TeCA by WBC-2. a) TeCA dechlorination profile with 1:20 diluted culture. Each curve shows the mean values of triplicate bottles and error bars are the standard deviation. Black squares represent TeCA; black circles, tDCE; and white squares, ethene. b) Dehalobacter (DHB), Dehalococcoides (DHC) and Dehalogenimonas (Dehly) growth during TeCA dechlorination. Circles represent DHB; squares, DHC; triangles Dehly; closed symbols indicate bottles amended with electron donor and TeCA, open symbols with dashed lines indicate controls amended with electron donor only.

This suggests that Dehalogenimonas does not have an exclusive niche in the degradation of tDCE. It is however challenging to assign the growth of Dehalococcoides to tDCE as this compound is step-wise degraded to VC, which Dehalococcoides exclusively degrades. Hence, the growth of Dehalococcoides in tDCE-amended cultures may be due to degradation of tDCE in competition with Dehalogenimonas, or due to degradation of the product VC from Dehalogenimonas-degraded tDCE, or a combination of both.

38 a)

8 tDCE Ethene

4 VC 2

Concentration (umol/bottle) 0 0 20406080

1.E+06 DHC Dehly

DHB

1.E+05

1.E+04

culture gene copies/ml 16SrRNA 1.E+03 0 20406080 Time (days)

FIGURE 3.3.4.2 Dechlorination of tDCE by WBC-2. a) tDCE dechlorination profile with an average of 1:10 and 1:20 diluted culture. Each curve shows the mean values of 2 sets of triplicate bottles and error bars are the standard deviation. Black circles, represent tDCE; black triangles, VC and white squares, ethene; b) Dehalobacter (DHB), Dehalococcoides (DHC) and Dehalogenimonas (Dehly) growth during tDCE dechlorination with 1:20 diluted culture. Circles represent DHB; squares, DHC; triangles Dehly; closed symbols indicate bottles amended with electron donor and e- acceptor, open symbols with dashed lines indicate controls amended with electron donor only.

1.E+06 Amended with tDCE

1.E+05

1.E+04 Amended with e- donor

Amended with cDCE

16SrRNA gene copies/ml culture gene copies/ml 16SrRNA 1.E+03 0 20406080 Time (days)

FIGURE 3.3.4.3 Dehalogenimonas (Dehly) growth with 1:20 diluted culture, amended with tDCE, cDCE and just electron donor, triangles represent Dehly; closed symbols indicate growth in cultures amended with electron donor and e- acceptor, open symbols with dashed lines indicate controls amended with electron donor only.

1.E+08

1.E+07 Amended with VC

1.E+06 Amended with tDCE

1.E+05 Amended with e- donor

1.E+04

16SrRNA gene copies/ml culture gene copies/ml 16SrRNA 1.E+03 0 20406080 Time (days)

FIGURE 3.3.4.4 Dehalococcoides (DHC) growth with 1:20 diluted culture, amended with tDCE, VC and just electron donor, squares represent DHC; closed symbols indicate growth in cultures amended with electron donor and e- acceptor, open symbols with dashed lines indicate controls amended with electron donor only.

Another confirmation as to the role of Dehalobacter is provided by a further relative abundance screen done on a WBC-2 culture maintained tDCE over more than three degradation cycles, which exhibited an enrichment of Dehalogenimonas and Dehalococcoides and a loss of Dehalobacter relative to the TeCA parent and transfer cultures, see Appendix A. However it remains for future study whether this culture could be further enriched for Dehalogenimonas by careful feeding of tDCE before the VC is allowed to build up, thus limiting the growth of Dehalococcoides.

FIGURE 3.3.4.5 Summary of experimental results; the bacteria responsible for each step of the TeCA dechlorination pathway. The dashed arrow represents a pathway that was not detected in these growth trials. The assignment of the bacteria to the dechlorination of 1,1,2-TCA and TCE is based on the results from the relative abundance screen and TCE dechlorination experiment presented in Appendix A, respectively.

3.4 Conclusion The different WBC-2 treatments in this study exhibited population shifts in response to enrichment on a single chlorinated compound. Ultimately, the resulting shifts permitted putative assignment of dechlorinating ability to various genera, further elucidating the WBC-2 biotic degradation pathways.

Individual enrichments of WBC-2 on cDCE, TeCA and 1,1,2-TCA have revealed the role of the novel bacterium, Dehalogenimonas eccentricus. It was hypothesized that its role was in the degradation of TeCA because of the enrichment seen in those bottles. Thus far only three microorganisms have been isolated that can dechlorinate TeCA: Desulfuromonas michiganensis, Desulfitobacterium Y51 and Dehalogenimonas lykanthroporepellans (45, 60, 61). Two of these bacteria degrade TeCA to the end product cDCE, while Dehalogenimonas lykanthroporepellans degrades TeCA but not cDCE or tDCE. Here we provide evidence that another microorganism, a Dehalobacter, is responsible for catalyzing the metabolic degradation of TeCA to the end product tDCE in WBC-2. As the first description of a non-Dehalococcoides species capable of degrading chlorinated compounds beyond the dichloroethenes, we demonstrate that Dehalogenimonas in WBC-2 is capable of growth on tDCE. tDCE is ranked just under TeCA at 173rd on the CERCLA hazardous chemicals list (1). The main source of this contaminant is from industrial discharge, but also significantly as a degradation product of TCE and PCE biodegradation (8, 21). Thus this novel bacterium, Dehalogenimonas eccentricus, part of the WBC-2 consortium, would serve as an effective tool in bioremediating these contaminated sites.

3.5 Acknowledgements Support was provided by the Government of Canada through NSERC, Genome Canada and the Ontario Genomics Institute (2009-OGI-ABC-1405). Support was also provided by the Government of Ontario through the ORF-GL2 program and the United States Department of Defense through the Strategic Environmental Research and Development Program (SERDP) under contract W912HQ-07-C-0036 (project ER-1586).

4. CHAPTER 4 DIFFERENTIATION OF THE DEHALOCOCCOIDES SPECIES IN WBC-2 USING AN EXTENDED CONSERVED GENOMIC REGION

4.1 Introduction To assess the diversity of organisms as small as bacteria, a method of molecular phylogeny has been developed involving 16S rRNA gene analysis. This gene is unique to the species level for most microorganisms and in mixed culture studies bacteria are often differentiated based on 3% dissimilarity in 16S rRNA gene, called operational taxonomic units (OTUs) (54). However, in some genera, such as Dehalococcoides, functional characteristics are not reflected in significant differences on the 16S rRNA gene level. Indeed it has been suggested that because of the prevalence of 16S rRNA gene sequencing it is often overlooked that microbial species are really defined by their niche and not by their gene sequence (32). With this in mind, it makes sense that other areas of the bacterial genome may need to be studied in order to differentiate between species. There are other genes that could and have been used for this purpose, such as the 5S or 23S rRNA genes. The 5S and 16S rRNAs have been used most for rRNA-based phylogenetic characterizations, due to historical and technical reasons (46). The 5S rRNA gene (~120 nucleotides) was first used extensively in the 1960s because it was small and easy to sequence. As sequencing technologies improved, the 16S rRNA gene (~1600 nucleotides) was used more frequently; as this gene is bigger it has a greater number of independently varying nucleotide positions (46). The even larger size of the 23S rRNA gene (~3300 nucleotides) made it an unwieldy and hence unpopular option for early attempts at phylogenetic comparison (20). Today, modern sequencing technology offers a level of efficiency and ease of analysis hitherto unknown; making it feasible to study these genes as well as the regions between them, and could provide solutions to problems such as those encountered with Dehalococcoides. As introduced in Chapter 1, researchers at Stanford University have devised a method using a 7 kb area between the 5S and 23S rRNA genes to differentiate the strains within this genus level group (44).

4.2 Materials and Methods

4.2.1 PCR Protocol Optimization The long range PCR methodology was based on the Phire polymerase manufacturer’s suggested protocol (Finnzymes, part of Thermo Fisher Scientific, Lafayette, CO). The optimal annealing temperature was determined by running a temperature gradient of 65 to 70 ºC with two-degree

43 intervals on the template-primer pair. Simultaneously the optimum quantity of DMSO was determined by adding a DMSO titration from 0% to 4% DMSO. The optimal temperature and DMSO % to use were determined based on the resulting DNA, which was examined using 1% agarose gel electrophoresis. The best conditions were those that produced a 7kb band of DNA without any smearing or excess bands. The optimum temperature was 65 ºC while the best quantity of DMSO was 0%.

4.2.2 Long Range PCR amplification using Phire Polymerase PCR amplification of the 7 kb target DNA was accomplished with Phire polymerase a hot start DNA polymerase designed to amplify long DNA fragments. The DNA was first extracted from each of the eight parent and transfer WBC-2 cultures (T1P/ALL, T1T/ALL, T2P/CDCE, T2T/CDCE, T3P/TECA, T3T/TECA, T4P/TCA and T4T/TCA) described in Chapter 2. The amount of sample taken as well as the protocol used for DNA extraction was the same as described for the time course experiments in Chapter 3. The PCR reactions were prepared according to the below reaction set up (Table 4.2.2.1) including the already described optimization specifications and primers, designed by Dr. Paul J. McMurdie II, DHC 004F (CCACTGCCCGGGGAGCTTTG) and DHC 006R (TGGTGGAGCCGGAGGGATTCG). The DNA was amplified using the protocol detailed in Table 4.2.2.2 and run in a PTC-200 Peltier Thermal Cycler (MJ Research).

TABLE 4.2.2.1 Long Range PCR Reaction Set Up for 100 l Reactions

Volume/rxn desired stock Units Units (l) conc. conc.

Phire 5X buffer 20.0 1 X 5 X dNTPs 0.8 0.2 mM 25 mM Phire polymerase 2.0 1 X 50 X forward primer 2.0 0.5 M 25 M reverse primer 2.0 0.5 M 25 M DMSO 0.0 0 % 100 % template 0.2 ng/μl ng/μl water Up to 100 total 100.0

TABLE 4.2.2.2 Long range PCR Protocol

Thermocycle Protocol Units Time Units Step number initial denaturing 98 oC 30 sec 1 cycle denature 98 oC 5 sec 2 Annealing 65 oC 15 sec 3 Extension 72 oC 1.8 min 4 Go to 2 31 times - - 5 Final extension 72 oC 1 min 6 Preserve 4 oC forever min 7

To ensure that the PCR was successful, 5μl of DNA was run on a 1% agarose gel to check for the 7 kb fragment. The remainder of the DNA was run in an agarose gel using 10X BlueJuice gel loading buffer (Invitrogen) to enable gel extraction of the 7 kb band. The bands were selected using UV table (without exposing DNA to UV), excised and purified using the Promega Wizard gel clean up system (Promega Corporation, Madison, WI). Finally this DNA was purified using

45 the PCR Product GeneJET kit (Fermentas, part of Thermo Fisher Scientific, Lafayette, CO) according to the protocol and eluted in 44 μl of sterile water.

4.2.3 Cloning with BigEasy Kit The 7kb band of DNA between the 5S and 23S rRNA genes was cloned using the BigEasy Long PCR Cloning Kit (Lucigen Corporation, Middleton, WI), following the protocol for blunt ended DNA (Phire polymerase generates blunt ends). Protocol B was followed with the addition of 5’ phosphates to the PCR product. After phosphorylation, the PCR products were purified using gel extraction a second time with the Promega Wizard kit. The purified DNA was used as an insert with the pJAZZ-OK Blunt Vector. Approximately 100 ng of insert DNA was added to the ligation reaction as required by the protocol. The electroporation of the BigEasy electrocompetent cells was accomplished with a Bio-Rad Micropulser Electroporator (Bio-Rad, Hercules, CA) at optimum settings as defined by the manufacturer, with 1 mm gap Fisherbrand electroporation cuvettes (Fisher Brand, part of Thermo Fisher Scientific). Plates of YT medium were made up with the provided mix according to kit instructions, with the addition of 30 μg/ml kanamycin, 20 μg/ml XGAL, and 1 mM IPTG. Enough plates were made up to have two per ligation reaction; 25 μl and 100 μl amounts were spread onto the prepared plates. The plates were incubated overnight at 37 ºC. The transformed clones were further grown in 3 ml of LB medium with 50 μg/ml kanamycin, shaken at 400 rpm at 37 degrees overnight. The grown up cells were then split in two with a portion being saved for storage in the -80 ºC freezer (300 μl cell solution stored in 700 μl 50:50 glycerol water solution). The plasmid DNA was extracted from the remaining fresh cells using the Sigma GenElute Miniprep Kit according to the manufacturer’s protocol except that DNA was eluted into 50 μl distilled, filtered water. The quantity of DNA was measured using the nano drop.

In order to determine if the insert had been cloned, the enzyme Not1 was first used to remove the insert DNA from the vector arms. The Not1 fragment from the left arm was 10 kb and the right arm was 2.2 kb, while the insert was 7 kb. The Not1 enzyme has the following specifications: 1 unit is the amount of enzyme that will digest 1 μg of DNA in 1 hour at 37 ºC, in a total reaction volume of 50 μl. Thus the reactions consisted of 1X NE buffer3 (New England Biolabs, Ipswich, MA) and 5ul of DNA combined with 1 unit of Not1 for a total reaction volume of 50 μl. Finally these digests were run on a 1% agarose gel. From gel band analysis it was possible to tell which samples of plasmid DNA contained the desired insert. These samples were sequenced using the

46 primers provided with the BigEasy Kit, SL1 and NZ-RevC. The successful sequences provided the first and final sections of the 7 kb segment of DNA between the 5S and 23S rRNA genes, pictured in Figure 4.2.6.1. Using these short end sequences as a start and end point and consensus sequences that had already been completed by Dr. McMurdie from 6 known strains, primers were designed to cover the entire segment.

4.2.4 Primer design for Dehalococcoides Differentiation The primers for PCR to target the 7 kb segment of DNA (DHC 004 and DHC 006) were designed by Dr. McMurdie using the Primer 3 implementation program in Geneious Pro (13). To accomplish this he extracted a conserved region spanning from the 23S rRNA to the 5S gene from each sequenced Dehalococcoides species. The full regions were aligned using the Geneious alignment algorithm, and primers designed to target conserved areas at the ends of the region. These conserved areas became the start and end points for a series of primers in this study designed to walk across the segment. These primers were designed using the IDT OligoAnalyzer 3.1 software program (http://www.idtdna.com/ANALYZER/Applications/OligoAnalyzer/). Each primer was selected by eye from the consensus sequence of the 6 known strains (VS, DE195, CBDB1, BAV1, GT, and the dominant strain in the KB-1 metagenome) and checked for tendency to hairpin or self-dimerize, a GC content of close to 50 %, annealing temperatures of about 55 ºC, optimal bp numbers of 21 and a very low quantity of degeneracies (≤2). The primer sequences are provided in Table 4.2.4.1. The location of the primers on the initial consensus sequence is pictured in Figure 4.2.6.1.

TABLE 4.2.4.1 Dehalococcoides 7 kb Segment Sequencing Primers

Primer Name Sequence 5’-3’

MMDHC1A CTTACCTCCAGAGCCAAAAAGG MMDHC2A ATGCCGCYAATATCCTCAAGC MMDHC3A GCYATTGTTACCATATCCAAGGC MMDHC4A ATGAAAGACAAGCTGCTGGG MMDHC5A GTATTCCAYTCCTGACAGSCG MMDHC6A CGSCTGTCAGGARTGGAATAC MMDHC6BR GGCATTAAGGTCDGTCTCAGC MMDHC7A ACCCGGTGCTATAAATCAGG MMDHC8A AATACYACCAGTTTCGGCCAG MMDHC9A CGGTTTCAACTGTCAAAGAGGC MMDHC10A GGGCAGAYATTATCCARAAAGCC MMDHC11A GGCCATRTAGATACCATCCG MMDHC12A ACTCTGGARCAGATGATGGC

4.2.5 Sequencing Plasmid DNA was amplified using the original PCR primers and phire polymerase in 100 μl reactions to provide an adequate quantity of DNA for sequencing. A 5 μl portion of the PCR product was checked for successful amplification of the correct band on an agarose gel then remainder was purified using the PCR Product GeneJET Kit. The purified PCR product was sequenced using the above 7kb segment sequencing primers at The Centre for Applied Genomics in Toronto. To ensure the 7 kb segment was sequenced in its entirety, trimmed sequences were aligned to the consensus sequence of 6 known Dehalococcoides strains, using the Geneious alignment algorithm. Finally the WBC-2 sequences from each clone were assembled to create a consensus sequence using highest quality of base call. The complete sequenced regions were analysed with Geneious software to construct a phylogenetic tree showing the relative differences between the Dehalococcoides in the WBC-2 consortium and the other known Dehalococcoides based on the variations in the 7 kb portion of the genome between the 5S and 23 S rRNA genes (13, 25).

4.2.6 Phylogenetic Tree Construction The three completed clone sequences (from T1T/ALL, T2P/CDCE, T4T/TCA) were aligned to the original 23S to 5S region, generated by Dr. McMurdie for initial primer design, using the Geneious consensus alignment algorithm. The resulting alignment was curated manually and masked to remove regions of ambiguous alignment and flanking regions that the clone sequences did not contain. A maximum likelihood tree was run using the PHYML plugin in Geneious. Bootstrap bipartition support on the trees is based on 100 bootstraps. A second alignment and tree was run which included two incomplete clone sequences (from T2P/CDCE, T4P/TCA). All methods were the same, except that masking included regions where the incomplete clone sequences contained gaps (13, 25).

4.3 Results and Discussion The long-range PCR and subsequent cloning resulted in six clones that contained the insert and could be successfully sequenced. Two of the clones were from the parent culture, T2P/CDCE, maintained on just cDCE, one clone was from the parent culture, T4P/TCA, maintained on just 1,1,2 TCA, one clone was from the transfer culture, T4T/TCA, amended with just 1,1,2-TCA, one was from the transfer culture, T1T/ALL, maintained on all three substrates, and the final clone was found from the parent culture, T3P/TECA, maintained on just TeCA. Due to time constraints only three clones were completely sequenced (one from each of T1T/ALL, T2P/CDCE, and T4T/TCA). The clones from T2P/CDCE (clone 2) and T4P/TCA were not completely sequenced but were included in the phylogenetic analysis in Figure 4.2.6.3b as there was enough sequence information to differentiate them from the other clones. The clone from T3P/TECA was not completely sequenced or included in a tree as it was assessed to likely be the same Dehalococcoides as the fully sequenced clone from T2P/CDCE by comparing select areas of variability within the 7 kb region. Phylogenetic trees of the Dehalococcoides 16S rDNA genes as well as the selected genomic region are presented in figures 4.2.6.2, 4.2.6.3a and b, respectively. It can be seen that there is greater differentiation between the strains of Dehalococcoides with the phylogenetic tree constructed from the 7kb region of DNA between the 5S and 23S rRNA genes than with the 16S rRNA tree. It is also worth noting that the two clones from the cultures fed the same electron acceptor in both cases are unique. All the Dehalococcoides in the WBC-2 consortium found in this manner are related to the Pinellas group, which is consistent with what has been found before in the SiREM clone library (Chapter 1).

End segments of DNA FIGURE 4.2.6.1 End segments of 7kb intragenic region of DNA, produced from sequencing primers from BigEasy kit, aligned to consensus sequence o f six known strains of Dehalococcoides using Geneious. The arrows mark where sequencing primers were designed in this study to “walk across” the 7kb segment. The arrows point in the direction in which they were designed to sequence.

FIGURE 4.2.6.2 Maximum likelihood phylogenetic tree of Chloroflexi 16S rDNA sequences. The alignment was generated using the GreenGenes NAST alignment algorithm, with subsequent alignment of three additional sequences using the Geneious consensus alignment builder. The alignment was manually edited and masked, and the tree generated using the PhyML plugin in Geneious under the GTR model of evolution. Bootstrap support values (out of 100 bootstraps) are indicated. Where applicable, the NCBI accession numbers are listed. a) b)

FIGURE 4.2.6.3 Alignment of intragenic regions a) The three completed clone sequences (T1, T2 clone 1, T4 clone 1) were aligned to the original 23S to 5S region alignment using the Geneious consensus alignment algorithm. The resulting alignment was curated manually and masked to remove regions of ambiguous alignment and flanking regions the clone sequences did not contain. A maximum likelihood tree was generated using the PHYML plugin in Geneious. Bootstrap bipartition support on the trees is based on 100 bootstraps; b) A second alignment and tree was run which included two incomplete clone sequences (T2 clone 2, T4 clone 2). All methods were the same, except that masking included regions where the incomplete clone sequences contained gaps.

The patristic differences, sum of the branch lengths from the trees, associated with the strains and clones in Figure 4.2.6.3a are displayed in Table 4.2.6.1. Known strains closely related in the Pinellas group such as CBDB1 and GT have a difference of 0.018. Comparing the patristic differences between the clones from the WBC-2 consortium and the known strains CBDB1 and GT, the WBC-2 clones are 0.01-0.011 different from the CBDB1 strain and 0.017 to 0.018 different from GT. At the same time, the WBC-2 clones themselves are only 0.002 to 0.003 different from each other. From this analysis the WBC-2 Dehalococcoides clones may not be distinct enough from each other to be considered separate strains in their own right. However, a one-nucleotide difference in 16S rRNA sequence translates into 99.93% sequence similarity, which has been sufficient to identify different strains of other bacteria (without the same differentiation issues as Dehalococcoides) (for eg.(45)). Given the larger size of the genomic region, an equivalent percent sequence similarity would be found with a four-nucleotide difference in the 5S to 23S rRNA intergenic region between the Dahalococcoides strains; The fully sequenced clone from the T2P/CDCE culture differs from the other two fully sequenced clones by 4 nucleotides and the clone from the T4T/TCA culture differs from the other two by 5 nucleotides (Figure 4.2.6.4). This is evidence that these Dehalococcoides could be different strains that may also have different substrate ranges; T2P/CDCE is amended with cDCE and T4T/TCA is amended with 1,1,2-TCA. Further study would be necessary to prove that the substrate ranges were unique to the strain level.

It should also be taken into consideration that the BigEasy cloning did not provide extensive coverage, with only 6 viable clones produced. Unfortunately, the 7 kb segment of DNA is difficult to clone using other means. More work would be required to assure that the resulting clones from this method were representative of the different strains of Dehalococcoides in cultures like WBC-2. Also, given sources of error, such as from sequencing and primer specificity, it will be important to further optimize this method; especially with a more extensive range of Dehalococcoides species.

TABLE 4.2.6.1 Patristic Differences (sum of branches) associated with strains and clones presented in Figure 3a. The highlighted areas are displaying the patristic difference between the CBDB1, GT and WBC-2 clones.

VS DE195 KB-1 BAV1 CBDB1 GT WBC-2 WBC-2 WBC-2 T2P/CDC T1T/AL T4T/TC E clone 1 L A VS 0 0.281 0.487 0.503 0.493 0.509 0.501 0.501 0.502 DE195 0.281 0 0.477 0.493 0.483 0.499 0.491 0.491 0.492 KB-1 0.487 0.477 0 0.02 0.01 0.026 0.018 0.018 0.019 BAV1 0.503 0.493 0.02 0 0.018 0.034 0.026 0.026 0.027 CBDB1 0.493 0.483 0.01 0.018 0 0.018 0.011 0.01 0.011 GT 0.509 0.499 0.026 0.034 0.018 0 0.018 0.017 0.018 WBC-2 T2P/CDC 0.501 0.491 0.018 0.026 0.011 0.018 0 0.002 0.003 E clone 1 WBC-2 T1T/ALL 0.501 0.491 0.018 0.026 0.01 0.017 0.002 0 0.003 WBC-2 T4T/TCA 0.502 0.492 0.019 0.027 0.011 0.018 0.003 0.003 0

FIGURE 4.2.6.4 Geneious produced alignment view of section of phylogenetic tree showing all five clones. From this view it is possible to examine the number of nucleotide differences for each clone, the WBC-2 clones are numbered 7-9. T2P/CDCE is maintained on cDCE and has 4 unique nts, T1T/ALL is maintained on TeCA, 1,1,2-TCA, and cDCE and has 2 unique nts, and T4T/TCA is maintained on 1,1,2-TCA and has 5 unique nts.

4.4 Conclusion Strains of Dehalococcoides cannot be adequately differentiated using 16S rRNA gene analysis especially when present in a mixed biodegrading consortium; without other means, it would be impossible to tell the dechlorination range of a culture that contains Dehalococcoides. By sequencing the region between the 5S and 23S rRNA genes, proposed by Dr. McMurdie, the Dehalococcoides species in the WBC-2 consortium may be differentiated from other known Dehalococcoides strains to a more significant degree than is possible using the 16S rRNA gene. This tool could offer a quick method for characterization of a Dehalococcoides containing mixed consortium that would circumvent immediate requirements for expensive and time consuming isolation and substrate use studies.

5. THESIS CONCLUSIONS AND ENGINEERING SIGNIFICANCE

5.1 Conclusion The studies presented in this thesis were successful in achieving the research objectives.

1. Time course experiments were conducted linking the degradation of TeCA, tDCE, cDCE and VC to the growth of dechlorinating microorganisms (Chapter 3). The results showed an order of magnitude growth of three dechlorinating bacteria on these chlorinated substrates. The conditions that make Dehalogenimonas eccentricus grow were thus determined. This is the first time a non-Dehalococcoides genus has been found to dechlorinate a lesser-chlorinated ethenes such as tDCE.

2. The differences between Dehalococcoides strains in the WBC-2 consortium were investigated by comparing a phylogenetically informative region. Five unique sequences of this region were found from clones from 3 cultures of WBC-2 maintained on different substrates. Can these enable us to distinguish strains?

5.2 Engineering Significance WBC-2 has been used in field applications by the USGS to bioremediate contaminated sites at the Aberdeen Proving Ground and is maintained at SiREM. It is sometimes being added to their KB-1 plus formula (Dworatzek, Personal Communication) for use at sites with chlorinated ethanes and ethenes. WBC-2 has proved to be a powerful tool for removing recalcitrant chlorinated solvents from the environment. However, for WBC-2 to be used in wider applications and in order to develop molecular markers for tracking activity in the field, it needed to be more fully characterized. While many of the bacteria had been identified in WBC-2, the function of these bacteria in the dechlorination of TeCA was still guesswork. This study has established many of the missing connections between the putative dechlorinating bacteria and their substrate ranges. It has introduced a novel bacterium, which is capable of degrading tDCE and is not a member of the Dehalococcoides. This offers a functional redundancy to Dehalococcoides and may explain why WBC-2 is resilient to pH fluctuations and oxygen exposure. With hundreds of sites significantly contaminated with tDCE, WBC-2 would provide a useful bioremediation tool. In addition, the WBC-2 culture is known to degrade both chlorinated ethenes and ethanes and in this study it was demonstrated that the substrate range includes PCE and TCE. Thus WBC-2 does

56 more than just buttress cultures used in PCE bioremediation, such as KB-1, in mixed contaminated sites; WBC-2 aids in chlorinated ethene degradation.

5.3 Future work

5.3.1 Dehalogenimonas Characterization The main suggestion for future work would be to continue to develop the knowledge around the Dehalogenimonas species responsible for tDCE degradation. Already researchers at the Edwards lab have taken over the tDCE amended cultures to enrich them for Dehalogenimonas by feeding tDCE immediately after it is degraded and by ensuring adequate electron donor.

It would be beneficial to isolate Dehalogenimonas and to accomplish this I would recommend attempting the method used by William Moe et al. (44) because this was effective with other Dehalogenimonas species. Dahalogenimonas lykanthroporepellens is resistant to antibiotics ampicillin and vancomycin and uses H2 as an electron donor (45).

Another method of isolation suggested by Melanie Duhamel (Toronto, personal communication) was to take advantage of the WBC-2 consortium’s resistance to oxygen exposure, and use this as a means of removing other species of non-interest that have oxygen sensitivity.

5.3.2 Time course experiments Time course experiments such as those done in Chapter 3 are very useful for assigning roles to bacteria. Some general suggestions for future growth trials with the WBC-2 consortium are:

 Add more substrate (all growth trials done in this study used about 10X less substrate than other studies on similar organisms in the literature)  Add electron donor more frequently and at regular intervals (easier to do and prettier results)  Use big bottles (250 ml) in case the growth trial needs to continue for longer than expected and more DNA needs to be extracted  Gradually ramp up the amount of substrate added, if multiple feedings are to be looked at in one growth trial  Take the initial time zero DNA sample from diluted inoculum in each experimental bottle rather than from the inoculum itself and having to calculate a dilution later (it leads to more accurate population growth results)

6. REFERENCES

1. ATSDR 2011 2007, posting date. CERCLA Priority List of Hazardous Substances. http://www.atsdr.cdc.gov/spl/index.html 2. Aulenta, F., A. Canosa, M. Leccese, M. P. Papini, M. Majone, and P. Viottit. 2007. Field study of in situ anaerobic bioremediation of a chlorinated solvent source zone. Industrial & Engineering Chemistry Research 46:6812-6819. 3. Aulenta, F., M. Potalivo, M. Majone, M. P. Papini, and V. Tandoi. 2006. Anaerobic bioremediation of groundwater containing a mixture of 1,1,2,2-tetrachloroethane and chloroethenes. Biodegradation 17:193-206. 4. Bollag, J.-M. a. B., W.R. 1995. Soil Contamination and Feasibility of Biological Remediation. In H. D. a. T. Skipper, R.F. (ed.), Bioremediation: Science and Applications. Soil Science Society of America, Madison, Wisconsin. 5. Brown, T. A. 2010. Gene cloning and DNA analysis: an introduction, vol. Wiley- Blackwell. 6. Catalfo, L. 2010. Detection of Soluble Metabolites Produced by Microbial Enrichments that Anaerobically Degrade Recalcitrant Cellulosic- Biomass. University of Toronto, Toronto. 7. Chen, C., J. A. Puhakka, and J. F. Ferguson. 1996. Transformations of 1,1,2,2- tetrachloroethane under methanogenic conditions (vol 30, pg 542, 1996). Environmental Science & Technology 30:2420-2420. 8. Cheng, D., W. L. Chow, and J. Z. He. 2010. A Dehalococcoides-containing co-culture that dechlorinates tetrachloroethene to trans-1,2-dichloroethene. Isme Journal 4:88-97. 9. Coates, J. D. 2004. Anaerobic Biodegradation of Hydrocarbons. In O. P. A. Singh and Ward (ed.), Biodegradation and Bioremediation. Springer, Heidelberg, Germany. 10. Cupples, A. M. 2008. Real-time PCR quantification of Dehalococcoides populations: Methods and applications. Journal of Microbiological Methods 72:1-11. 11. Cupples, A. M., A. M. Spormann, and P. L. McCarty. 2004. Vinyl chloride and cis- dichloroethene dechlorination kinetics and microorganism growth under substrate limiting conditions. Environmental Science & Technology 38:1102-1107. 12. Diekert, G. 1990. CO2 reduction to acetate in anaerobic bacteria. Fems Microbiology Reviews 87:391-395. 13. Drummond AJ, A. B., Buxton S, Cheung M, Cooper A, Heled J, Kearse M, Moir R, Stones-Havas S, Sturrock S, Thierer T and Wilson A 2010, posting date. Geneious v. 5.1. [Online.] 14. Duhamel, M., and E. A. Edwards. 2007. Growth and yields of dechlorinators, acetogens, and methanogens during reductive dechlorination of chlorinated ethenes and dihaloelimination of 1,2-dichloroethane. Environmental Science & Technology 41:2303- 2310. 15. Duhamel, M., and E. A. Edwards. 2006. Microbial composition of chlorinated ethene- degrading cultures dominated by Dehalococcoides. Fems Microbiology Ecology 58:538- 549. 16. Duhamel, M., K. Mo, and E. A. Edwards. 2004. Characterization of a highly enriched Dehalococcoides-containing culture that grows on vinyl chloride and trichloroethene. Applied and Environmental Microbiology 70:5538-5545. 17. Duhamel, M. A. 2005. Community structure and dynamics of anaerobic chlorinated ethene-degrading enrichment cultures. University of Toronto, Toronto.

18. Edwards, E. A., and D. Grbicgalic. 1994. Anaerobic degradation of toluene and o- xylene by a methanogenic consortium. Applied and Environmental Microbiology 60:313- 322. 19. Fetzner, S. 1998. Bacterial dehalogenation. Applied Microbiology and Biotechnology 50:633-657. 20. Fox, G. E., K. R. Pechman, and C. R. Woese. 1977. Comparative cataloging of 16S ribosomal ribonucleic acid - molecular approach to prokaryotic systematics. International Journal of Systematic Bacteriology 27:44-57. 21. Griffin, B. M., J. M. Tiedje, and F. E. Loffler. 2004. Anaerobic microbial reductive dechlorination of tetrachloroethene to predominately trans-1,2-dichloroethene. Environmental Science & Technology 38:4300-4303. 22. Grostern, A., and E. A. Edwards. 2006. A 1,1,1-trichloroethane-degrading anaerobic mixed microbial culture enhances biotransformation of mixtures of chlorinated ethenes and ethanes. Applied and Environmental Microbiology 72:7849-7856. 23. Grostern, A., and E. A. Edwards. 2009. Characterization of a Dehalobacter Coculture That Dechlorinates 1,2-Dichloroethane to Ethene and Identification of the Putative Reductive Dehalogenase Gene. Applied and Environmental Microbiology 75:2684-2693. 24. Grostern, A., and E. A. Edwards. 2006. Growth of Dehalobacter and Dehalococcoides spp. during degradation of chlorinated ethanes. Applied and Environmental Microbiology 72:428-436. 25. Guindon, S., and O. Gascuel. 2003. A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Systematic Biology 52:696-704. 26. Haggblom, M. M., and I. D. Bossert. 2003. Halogenated Organic Compounds - A Global Perspective. In M. M. Haggblom and I. D. Bossert (ed.), Dehalogenation: microbial processes and environmental applications. Springer. 27. He, J., Y. Sung, R. Krajmalnik-Brown, K. M. Ritalahti, and F. E. Loffler. 2005. Isolation and characterization of Dehalococcoides sp strain FL2, a trichloroethene (TCE)- and 1,2-dichloroethene-respiring anaerobe. Environmental Microbiology 7:1442-1450. 28. Hendrickson, E. R., J. A. Payne, R. M. Young, M. G. Starr, M. P. Perry, S. Fahnestock, D. E. Ellis, and R. C. Ebersole. 2002. Molecular analysis of Dehalococcoides 16S ribosomal DNA from chloroethene-contaminated sites throughout north America and Europe. Applied and Environmental Microbiology 68:485-495. 29. Geosyntec Consultants. 2007. West Branch Canal Ceek: Microbial Consortia Growth and Characterization. Geosyntec Consultants. 30. Jones, E., M. Voytek, M. Lorah, and J. Kirshtein. 2006. Characterization of a Microbial Consortium Capable of Rapid and Simultaneous Dechlorination of 1, 1, 2, 2- Tetrachloroethane and Chlorinated Ethane and Ethene Intermediates. Bioremediation Journal 10:153-168. 31. Jones, E. J. P., M. A. Voytek, M. D. Corum, and W. H. Orem. 2010. Stimulation of Methane Generation from Nonproductive Coal by Addition of Nutrients or a Microbial Consortium. Applied and Environmental Microbiology 76:7013-7022. 32. Kartal, B. a. S., M. 2008. Methods to Study Consortia and Mixed Cultures. In K. Zengler (ed.), Accessing uncultivated microorganisms: from the environment to organisms and genomes and back. Amer Society for Microbiology. 33. Krajmalnik Brown, R., Y. Sung, K. M. Ritalahti, F. Michael Saunders, and F. E. Lˆffler. 2007. Environmental distribution of the trichloroethene reductive dehalogenase gene (tceA) suggests lateral gene transfer among Dehalococcoides. FEMS microbiology ecology 59:206-214.

34. Lorah, M., Jones, EA and Voytek, MA. 2008. Anaerobic Microbial Composition and Methods of Using Same. US Patent Application. 35. Lorah, M. M., Majcher, E.H., Jones, E.J., and Voytek, M.A. 2007. Microbial Consortia Development and Microcosm and Column Experiments for Enhanced Bioremediation of Chlorinated Volatile Organic Compounds West Branch Canal Creek Wetland Area, Aberdeen Proving Ground, Maryland. U.S. Department of the Interior, U.S. Geological Survey Scientific Investigations Report 2007-5165. 36. Lorah, M. M., and L. D. Olsen. 1999. Degradation of 1,1,2,2-tetrachloroethane in a freshwater tidal wetland: Field and laboratory evidence. Environmental Science & Technology 33:227-234. 37. Lorah, M. M., and L. D. Olsen. 1999. Natural attenuation of chlorinated volatile organic compounds in a freshwater tidal wetland: Field evidence of anaerobic biodegradation. Water Resources Research 35:3811-3827. 38. Lorah, M. M., Vogler, E.T., Dennis, P., Graves, D., and Gallegos, J. 2008. Presented at the Proceedings of the Sixth International Battelle Conference, Monterey, CA. 39. Lorah, M. M., and M. A. Voytek. 2004. Degradation of 1,1,2,2-tetrachloro ethane and accumulation of vinyl chloride in wetland sediment microcosms and in situ porewater: biogeochemical controls and associations with microbial communities. Journal of Contaminant Hydrology 70:117-145. 40. Mackay, D., and W. Y. Shiu. 1981. A critical review of Henrys Law Constants for chemicals of environmental interest Journal of Physical and Chemical Reference Data 10:1175-1199. 41. Madsen, E. 1997. Methods for determining biodegradability. Manual of environmental microbiology. Washington, DC, American Society for Microbiology Press (ASMP):709- 720. 42. Marchandin, H., C. Teyssier, J. Campos, H. Jean-Pierre, F. Roger, B. Gay, J. P. Carlier, and E. Jumas-Bilak. 2010. Negativicoccus succinicivorans gen. nov., sp nov., isolated from human clinical samples, emended description of the family Veillonellaceae and description of Negativicutes classis nov., Selenomonadales ord. nov and Acidaminococcaceae fam. nov in the bacterial phylum Firmicutes. International Journal of Systematic and Evolutionary Microbiology 60:1271-1279. 43. McCarty, P. L. 1997. Breathing with chlorinated solvents. Science 276:1521. 44. McMurdie, P. J., L. A. Hug, E. A. Edwards, S. Holmes, and A. M. Spormann. Site- Specific Mobilization of Vinyl Chloride Respiration Islands by a Mechanism Common in Dehalococcoides. BMC Genomics 12. 45. Moe, W. M., J. Yan, M. F. Nobre, M. S. da Costa, and F. A. Rainey. 2009. Dehalogenimonas lykanthroporepellens gen. nov., sp nov., a reductively dehalogenating bacterium isolated from chlorinated solvent-contaminated groundwater. International Journal of Systematic and Evolutionary Microbiology 59:2692-2697. 46. Olsen, G. J., D. J. Lane, S. J. Giovannoni, N. R. Pace, and D. A. Stahl. 1986. Microbial ecology and evolution - a ribosomal-RNA approach Annual Review of Microbiology 40:337-365. 47. Pfaffl, M. W. 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Research 29. 48. Rittmann, B. E., and P. L. McCarty. 2001. Environmental biotechnology: principles and applications, vol. 6. McGraw-Hill New York.

49. Roling, W. F. M. a. H., I.M. 2005. Prokaryotic sytematics: PCR and sequence analysis of amplified 16S rRNA genes. In A. M. a. S. Osborn, C.J. (ed.), Molecular Microbial Ecology. BIOS Scientific Publ. 50. Rossetti, S., F. Aulenta, M. Majone, G. Crocetti, and V. Tandoi. 2008. Structure analysis and performance of a microbial community from a contaminated aquifer involved in the complete reductive dechlorination of 1,1,2,2-tetrachloroethane to ethene. Biotechnology and Bioengineering 100:240-249. 51. Sander, R. 1999. Compilation of Henryís law constants for inorganic and organic species of potential importance in environmental chemistry. Available at: www. henrys-law. org. 52. Services, U. D. o. H. a. H. 2008. Toxicological Profile for 1,1,2,2-Tetrachloroethane. US Dept of Health and Human Services, Public Health Service Agency for Toxic Substances and Disease Registry. 53. Singh, A. a. W., O.P. 2004. Biotechnology and Bioremediation - An Overview. In O. P. A. Singh and Ward (ed.), Biodegradation and Bioremediation. Springer, Heidelberg, Germany. 54. Sloan, W., Quince, C., and Curtis, T. 2008. The Uncountables. In K. Zengler (ed.), Accessing uncultivated microorganisms: from the environment to organisms and genomes and back. Amer Society for Microbiology. 55. Smidt, H., and W. M. de Vos. 2004. Anaerobic microbial dehalogenation. Annu. Rev. Microbiol. 58:43-73. 56. Smith, C. J., D. B. Nedwell, L. F. Dong, and A. M. Osborn. 2006. Evaluation of quantitative polymerase chain reaction-based approaches for determining gene copy and gene transcript numbers in environmental samples. Environmental Microbiology 8:804- 815. 57. Smith, C. J., and A. M. Osborn. 2009. Advantages and limitations of quantitative PCR (Q-PCR)-based approaches in microbial ecology. Fems Microbiology Ecology 67:6-20. 58. Smith, R., C. Hurst, G. Knudsen, M. McInerney, L. Stetzenbach, and M. Walter. 1997. Determining the terminal electron-accepting reaction in the saturated subsurface. Manual of environmental microbiology.:577-585. 59. Strohhacker, J., and B. Schink. 1991. Energetic aspects of malate and lactate fermentation by Acetobacterium-malicum Fems Microbiology Letters 90:83-88. 60. Sung, Y., K. M. Ritalahti, R. A. Sanford, J. W. Urbance, S. J. Flynn, J. M. Tiedje, and F. E. Loffler. 2003. Characterization of two tetrachloroethene-reducing, acetate- oxidizing anaerobic bacteria and their description as Desulfuromonas michiganensis sp nov. Applied and Environmental Microbiology 69:2964-2974. 61. Suyama, A., R. Iwakiri, K. Kai, T. Tokunaga, N. Sera, and K. Furukawa. 2001. Isolation and characterization of Desulfitobacterium sp strain Y51 capable of efficient dehalogenation of tetrachloroethene and polychloroethanes. Bioscience Biotechnology and Biochemistry 65:1474-1481. 62. van Eekert, M. H. A., A. J. M. Stams, J. A. Field, and G. Schraa. 1999. Gratuitous dechlorination of chloroethanes by methanogenic granular sludge. Applied Microbiology and Biotechnology 51:46-52. 63. Waller, A. S. 2010. Molecular Investigation of Chloroethene Reductive Dehalogenation by the Mixed Microbial Community KB1. University of Toronto, Toronto. 64. Walter, M., and R. Crawford. 1997. Overview: biotransformation and biodegradation. Manual of Environmental Microbiology. American Society for Microbiology Press, Washington, DC p:707-708.

65. Yang, Y. R., and P. L. McCarty. 1998. Competition for hydrogen within a chlorinated solvent dehalogenating anaerobic mixed culture. Environmental Science & Technology 32:3591-3597. 66. Yaws, C. L. 1992. Thermodynamic and physical property data, vol. Gulf Publishing. 67. Yu, Y., C. Lee, S. Hwang, S. Guiot, S. Pavlostathis, and J. van Lier. 2005. Analysis of community structures in anaerobic processes using a quantitative real-time PCR method. Water science & technology 52:85-91. 68. Zarek, M. 2009. Two case studies on microbial community dynamics. University of Toronto, Toronto, Canada.

Appendix A Other Maintenance Activities and Experiments The goal of this Appendix is to provide a record of other maintenance activities and experiments done on the WBC-2 consortium for the purpose of future Edwards lab use.

1 Other Maintenance Methods 1.1 Purging Cultures At times the cultures may need to be purged to remove built up methane and ethene gas. This is based on the some observations in the Edwards lab that occasionally culture bottles will crack if too much gas is allowed to accumulate and that there is a detrimental effect to further degradation if the products dominate the headspace (Chan and Duhamel, Personal Communication). Purging may also be necessary at the start of an experiment to ensure an accurate mole balance is achieved. Purging is accomplished, with caution, by bubbling N2:CO2 gas (80:20 by volume) that has first passed through a heated copper catalyst that removes oxygen. The gas is bubbled through the culture using a sterilized 5” needle with affixed 0.2 μm filter penetrated through the port of the Mininert lid and submerged in the culture with the lid itself cracked open. Cultures are only purged after they have degraded all chlorinated substrates, but even so purging is done in the fumehood. The gas mix is bubbled through the culture for about 45 minutes.

1.2 pH Adjustment Over time, the degradation of chlorinated solvents will lead to the production of acidic products (HCl, acetate) in culture bottles resulting in lowering of pH, once the buffer is exhausted. The lowering of pH itself can cause cultures to stop degrading. The WBC-2 cultures were periodically checked for pH using a rough estimate with pH sensitive paper (Hydrion Papers, Microessential Laboratory, Brooklyn, NY). The cultures were maintained at a pH of about neutral. When the pH was found to fall below neutral (e.g, 6), bicarbonate (saturated solution, 260g of NaHCO3 per litre (18)) was added in 100 μl increments until the pH reading was back to neutral.

1.3 Stalled Cultures When cultures were stalled so that they were no longer degrading one or more substrates the pH was checked and more electron donor was added. If these adjustments had been made and cultures were still stalled, the cultures were resuspended in fresh media. To accomplish this the cultures were poured into 2 sterile anaerobic 100 ml centrifuge bottles (Nalgene, Nalge Nunc International Corporation, Rochester, NY ) and spun down in the centrifuge (Beckman Coulter

Avanti J-E, rotor = JLA 16.250) at 5403Xg for 30 minutes. The spun down cultures were then brought back into the anaerobic glove box and the supernatant poured out and disposed of by first sterilizing with the autoclave. The cells were then resuspended in 200 ml fresh anaerobic medium, and then transferred to a sterile anaerobic standard 250 ml glass bottle with a Mininert cap.

2 Other Experiments 2.1 Donor Limitation The amount of electron donor added to dechlorinating cultures should provide enough electrons for organohalide respiration to occur. The amount of donor required is calculated based on electron equivalents (Chapter 2) and is multiplied by a factor of 5 or 10 in order to avoid donor limitation. This is considering the syntrophic nature of the microbes in a mixed consortium (Chapter 1), where, for example, the methanogenic microbes may out-compete the dechlorinating microbes for the available electron donor substrates. Still, frequently, a lag in the degradation of chlorinated substrates was observed in growth trial experiments, even with a 10X factor applied to electron donors, ethanol and lactate (Figure 2.1-1).

0.05 0.045 cDCE 0.04 Methane 0.035 0.03 0.025 Ethene 0.02 0.015 VC 0.01

Concentration (mmol/bottle) 0.005 0 0 10203040506070 Time (Days)

FIGURE 2.1-1 Dechlorination of cDCE by WBC-2. a) cDCE dechlorination profile with 1:10 diluted culture. Each curve shows the mean values of triplicate bottles and error bars are the standard deviation. Black diamonds, represent cDCE; black triangles, VC; white squares, ethene and white diamonds, methane. Figure 2.1-1 shows that the degradation of the 20 mg/L cDCE by the 1:10 diluted culture stalled for the first half of the time trial, even though electron donor had been added at 10 X the amount

64 required for complete degradation to ethene for both ethanol and lactate at the start of the experiment, until more electron donor was added on day 29. These results led to the question of whether the electron donor was being lost due to competition from other microbes or because of bacterial contamination and degradation of the lactate feedstock prior to adding to the cultures. Methanogens present in the consortium could potentially use available electron donors to produce methane, thus the first question was investigated using the equations of fermentation with mixed donors and products provided by Rittmann and McCarty (48). The amount of methane in the lagging culture bottles was measured and it was found that about 10 times less methane was being produced than was predicted if all the lactate and ethanol were to be converted to methane by methanogens. However, with fermenting bacteria present in the consortium, it is likely that the lactate would first be fermented to produce other intermediary compounds like acetate and propionate, which were not measured. If it were assumed that a high proportion of the lactate is being converted to these intermediary compounds rather than methane then this would explain the small methane production. It would also suggest that the methanogens in the WBC-2 culture are not acetotrophic but rather hydrogenotrophic as has been already suggested (35). Question number two was investigated by measuring the amount of lactate in the feedstock provided to the cultures using high performance liquid chromatography (HPLC). The protocol used was developed by Liane Catalfo and described in her thesis (6). The experiment compared three samples: 1) the lactate feedstock that had been added to the culture bottles and filtered with a 0.2 m filter (“old lactate with filter”), 2) the lactate feedstock that had been added to the culture bottles unfiltered (“old lactate with no filter”), and 3) a fresh sample of anaerobic and sterile lactate that was unfiltered (“new lactate no filter”). The results, presented in Table 2.1-1, showed that the lactate peaks as measured by the HPLC in uRIU*min did not vary significantly between samples. Thus the lactate feedstock had not been degraded before addition to the culture bottles and thus did not contribute to the low level of dechlorination.

TABLE 2.1-1 HPLC Results for Lactate Samples

Mean Sample Name uRIU*min sd (N=3) (N=3)

old lactate with filter 1116.6 1162.1 72.2 old lactate with no filter 1124.4 new lactate with no filter 1245.3

2.2 Other organisms in WBC-2 – Geobacter A qPCR screen of TeCA enriched cultures amended with single substrates tDCE, TCE, cDCE, TeCA, and controls with just electron donor, was done using primers Geo 73f (CTTGCTCTTTCATTTAGTGG) and Geo 485r (AAGAAAACCGGGTATTAACC) with an annealing temperature of 59°C (15) and methods as described in Chapter 3. These primers are specific for Geobacter found in the KB-1 consortium. The results indicated that none of this strain of KB-1 Geobacter was in the WBC-2 samples. However, the efficiency of the resulting standard curve was only 80% indicating that this experiment should be repeated. It may also be repeated with a less specific Geobacter primer set. Thus, though Geobacter was seen in the clone library done by the USGS in 2006 (see Chapter 1), there was very little to no Geobacter detected in the WBC-2 consortium in 2011.

2.3 Other dechlorinating capabilities – TCE and PCE As discussed in Chapter 1, WBC-2 is capable of dechlorinating a wide array of chlorinated alkenes and alkanes. However to our knowledge WBC-2 had not yet been specifically enriched on PCE or TCE. In order to test whether WBC-2 could degrade these substrates, new culture bottles were set up in the same method described in Chapter 3 except at a 1:10 dilution of TeCA enriched culture and amended with 10 mg/L chlorinated substrate and electron donors ethanol and lactate at 10X the amount required for electron equivalents; bottles were set up in triplicate. The cultures were monitored for degradation and, in the case of the TCE amended cultures, samples were removed for DNA extraction and subsequent qPCR analysis, exclusively looking for Dehalococcoides, Dehalobacter and Dehalogenimonas, in the method described previously in Chapter 3. The results of this experiment are shown in Figures 2.3-1a and b, and 2.3-2. The TCE amended culture was immediately capable of degrading TCE and broke it down completely in 25 days (Figure 2.3-1a). This makes sense, as TCE is an abiotic TeCA dechlorination product that the culture had already been exposed to, and which does not build up

66 in this culture over time. The TCE degradation products were predominantly cDCE and VC, with tDCE being present from the beginning and slowly degrading over the course of the trial; all were converted to ethene. The qPCR analysis results for the TCE amended cultures show that Dehalococcoides predominantly grew on TCE with Dehalogenimonas growing slightly more than the control near the end of the degradation curve and no growth of Dehalobacter was observed (Figure 2.3-1b). The small growth of Dehalogenimonas could be due to the DHC producingtDCE fromTCE..The PCE amended culture initially took 4 times as long to break down the PCE as the TCE; in subsequent feedings however, the PCE degradation rate doubled (Figure 2.3-2). No dechlorination products, other than ethene were detected. The PCE degradation profile results are based on one bottle that was monitored for 250 days; the other two bottles were only monitored for 123 days (although not shown, the GC results were the same). Both the PCE and TCE maintained cultures, one bottle of each, are now kept under a regular maintenance schedule in the Edwards lab.

67 a) 25 TCE Ethene

5 tDCE

Concentration (umol/bottle cDCE VC 0 0 5 10 15 20 25 30 b) 5.E+06 DHC

5.E+05 Dehly culture

DHB

gene copies/ml 16S rRNA 5.E+04 0102030 Time (Days)

FIGURE 2.3-1 Dechlorination of TCE by WBC-2. a) TCE dechlorination profile with 1:10 diluted culture. Each curve shows the mean values of triplicate bottles and error bars are the standard deviation. Black dashes represent, TCE; black circles, tDCE; black diamonds, cDCE; black triangles, VC and white squares, ethene; b) Dehalobacter (DHB), Dehalococcoides (DHC) and Dehalogenimonas (Dehly) growth during TCE dechlorination. Circles represent DHB; squares, DHC; triangles Dehly; closed symbols indicate bottles amended with electron donor and TCE, open symbols with dashed lines indicate controls amended with electron donor only

68 Ethene 140 120 100

80 60 PCE 40 20

Concentration (umol/bottle) 0 0 50 100 150 200 250 Time (Days)

FIGURE 2.3-2 Dechlorination of PCE by WBC-2. PCE dechlorination profile with 1:10 diluted culture. Black dashes represent PCE and white squares represent ethene

2.4 Microarray Analysis – DNA and RNA sent to University of Tennessee In 2010, samples of RNA and DNA from two WBC-2 maintenance cultures were sent to the University of Tennessee for microarray analysis. The results have not yet been provided and thus analysis could not be included in this thesis. Nonetheless, the details of the sample preparation will be discussed below for use by future graduate students. There were a total of four samples of RNA extracted from two WBC-2 maintenance cultures. Two samples were from the T1 parent culture of WBC-2 amended with 10 mg/L each of TeCA, 1,1,2 TCA and cDCE and two were from the T3 parent culture of WBC-2 amended with just TeCA. The amount taken from each culture for RNA extraction was 50 ml. One sample from each culture was taken on April 27th and the other on May 11th. The April 27th samples were taken when the T1P/ALL culture was at the mid-degradation point of having finished degrading the cDCE to VC and being almost done degrading the 1,1,2-TCA to ethene. The T3P/TECA culture was at a point where it was done degrading TeCA and the degradation by-products to ethene. The May 11th samples were taken from the same cultures as on April 27th (which means that they were coming from more dilute cultures having been topped up with media). On May 11th the T1P/ALL was done degrading each substrate and the T3P/TECA had just been amended, and was in the process of degrading TeCA. The RNA extraction protocol is described in Dr. Alison Waller’s thesis (63).

Two samples of DNA, one from each culture T1P/ALL and T3P/TECA, were also sent for analysis. This was done using DNA extraction methods discussed previously in Chapter 3, except that the DNA was extracted from 20 ml of culture. Samples were taken from the cultures on April

27th.

2.5 Sterivex vs. pelleting for DNA extraction The low yields of microorganisms, Dehalococcoides in particular, from the WBC-2 qPCR results in Chapter 3 has spurred investigation into the efficiency of the DNA extraction protocol. A main area of concern has been the method used for harvesting the cells from the media. Traditionally, in the Edwards lab, this process was accomplished by pelleting the cells by centrifugation. Now Sterivex filters are being increasingly utilized for faster processing of large amounts of sample. The method involves flushing the sample through the Sterivex filter with the microorganisms getting trapped on the filter. The filter is then frozen for more than 1 hour at -80C, the filter cartridge is then opened, and the filter itself is sliced into approximately 2 mm x 2 mm squares to be added to the beads and solution for the first step of the MoBio DNA extraction kit. This method has been shown to be effective on large samples of culture, particularly groundwater samples, which are microbially less dense (Edwards and Perez de Mora, personal communication). However in the experiments included in this thesis, 5 ml of culture was used. The amount of culture chosen for DNA extraction was based on an experiment that looked at the resulting copies/l of general bacteria and Dehalogenimonas between DNA extracted from 1 ml culture using the pelleting protocol, 5 ml using Sterivex filtration and 20 ml using Sterivex. The results, presented in Table 2.5-1, indicate that 5 ml culture processed with a Sterivex filter could give reasonable qPCR results for Dehalogenimonas copies/ml culture. The Dehalogenimonas abundance of 11.03% was more consistent with past population screens done by Laura Hug and Matt Zarek. However, the low copies/ml culture of the general bacteria does indicate that the Sterivex filter is not as efficient at removing bacteria from a lower sample volume.

TABLE 2.5-1 Pelleting vs. Sterivex for Dehalogenimonas and General Bacteria Relative Abundance

Amount of starting culture 1 ml 5ml 20 ml

Cell harvesting method Pellet Sterivex Sterivex

Dehly copies/ml culture 1.31E+05 6.33E+05 6.02E+05

General Bacteria copies/ml 1.56E+07 5.74E+06 1.25E+07 culture

Percent of Dehly in General 0.84% 11.03% 4.83% bacteria

Another experiment was designed to show whether there was any difference in the quality or quantity of DNA extracted from cells harvested using the pellet or Sterivex filter methods. To do this, cells were harvested from 5 ml of TeCA enriched culture, undiluted and diluted to 1:20, using the two methods. The pelleting of culture was done by depositing the sample into sets of three 2 ml tubes for a total of 5 ml culture. These tubes were centrifuged for 7 minutes at top speed and supernatant was removed with a pipette. The pellet was quite soft so not all supernatant was removed. The samples were frozen at -80 C for one hour. Then the pellets were resuspended in the reagent from Solution #1 of the MoBio DNA extraction kit with the reagent from two of these tubes being used for each grouping of three tubes (with 5 ml culture-worth of pellet). More Solution #1 was used compensate for the residual supernatant. The DNA was extracted using MoBio kit protocol for Maximum yields except the two tubes with the same sample were amalgamated into one filter column at the end of the DNA extraction protocol and DNA was eluted into 30 l of Solution #5. The sample processing procedure for the Sterivex filtration was the same as described previously in Chapter 3. Finally, the DNA was tested using the nanodrop for quality and quantity with the results presented in Table 2.5-2.

TABLE 2.5-2 Sterivex and Pellet DNA quantity and quality results

DNA Sample Name Concentration 260/280 (ng/ul)

sterivex 1:1 32.62 1.94 sterivex 1:1 32.63 1.97 sterivex 1:20 3.45 1.67 sterivex 1:20 3.04 1.5 pellet 1:1 40.73 1.81 pellet 1:1 45.37 1.73 pellet 1:20 9.89 1.39 pellet 1:20 10.33 1.54 The quantity of the DNA from the samples run through the Sterivex filters was less than those that were pelletted. However as indicated by the 260/280 ratio, the quality of the DNA from the pellets was low. The 260/280 ratio is a ratio of the absorbance of DNA measured at wavelengths 260 and 280, and serves as a measure for DNA quality; pure DNA will have a ratio of 1.8, and

71 less than 1.8 indicates that the sample is contaminated with protein (5). A possible cause for this is the left over supernatant in the pelletted samples, which may have diluted the Mo Bio Kit solutions and inhibited cell lysis. However, in both cell harvest methods, the concentration results from the 1:20 dilution of culture were inaccurate and this is likely due to their being lower than the detection limit of the nanodrop. In sum, the quantity of the extracted DNA from the pellet and Sterivex methods for cell harvest are not drastically different from each other and do not sufficiently explain the low yields in the WBC-2 consortium.

These experiments suggest that the yields of dechlorinating bacteria in the WBC-2 consortium are simply lower than those found in other mixed cultures in the Edwards lab. Indeed this tendency for low numbers of dechlorinators such as Dehalococcoides in WBC-2 has already been noted by Lorah et al. 2007 (35).

2.6 Relative abundance of dechlorinating bacteria with enrichment on VC and tDCE The relative abundance analysis of dechlorinating bacteria in the maintenance cultures introduced in Chapter 3 was redone for new transfer cultures maintained on just VC and just tDCE (Figure 2.6-1). These screens showed that the makeup of the dechlorinating species in WBC-2 amended with VC is almost 100% Dehalococcoides while that amended with tDCE is split between Dehalogenimonas and Dehalococcoides. This is further evidence for the role of Dehalobacter in the first stage of TeCA degradation because only those cultures with TeCA amendment have Dehalobacter. In cultures maintained on just tDCE the Dehalobacter is removed. Cultures amended with 1,1,2-TCA also exhibit Dehalobacter, which would support an argument for TeCA being degraded through reductive dehalogenation to 1,1,2-TCA. However, 1,1,2-TCA rarely accumulates in the TeCA maintained cultures and has not been detected as a major degradation product of TeCA in any growth trials. Please specify the date the DNA was extracted for the figure below

100% 90%

80% 70% 60% 50% 40%

30% 20% 10% 0% cisDCE, TeCA parent 1,1,2-TCA cisDCE tDCE VC transfer 1,1,2-TCA, parent parent transfer TeCA FIGURE 2.6-1 RelativeDehalococcoides abundance of dechlorinatingDehalobacter bacteria inDehalogenimonas the WBC-2 consortium based on qPCR community screens of T1P/ALL (maintained on TeCA, 1,1,2-TCA, and cDCE), T2P/CDCE (parent culture maintained on cDCE), T3P/TECA, (maintained on TeCA) and transfer cultures maintained on just tDCE and VC with organism-specific primer sets. 100% represents approximately 2E7 16S rRNA copies/ml culture.

2.7 Tracking the growth of other WBC-2 consortium members (Bacteria and Archaea) There are a number of bacteria and archaea in WBC-2 that are hypothesized to contribute or competitive effects with dechlorination. Veillonellaceae and Acetobacterium are thought to be facilitating bacteria as they degrade complex electron donor substrates making them more available. Veillonellaceae species vary in their capacity to degrade lactate; those that can, produce acetic acid and propionic acid (42). The Acidaminococcaceae members present in WBC- 2 as shown in the SiREM clone library (Chapter 1) do not ferment lactate but have been known to grow with succinate and propionate production and use amino acids as the energy source (42).

The Acetobacterium are also known fermenters that produce acetate by reducing CO2 (12). Notably, Acetobacterium malicum, found in the USGS clone library, ferments lactate to acetate (59). Methanogens, prominent Archaea, are seen as competitors because they convert electron donor substrates into methane.

The growth of the facilitating bacteria and archaea, Actetobacterium, Veillonellaceae and General Archaea, was tracked in the 1:5 and 1:20 growth trials discussed in Chapter 3. The qPCR results are displayed below. The methods and materials were the same as in Chapter 3 except that for the qPCR, the elongation time for Veillonellaceae was set at 50 seconds rather than 30 seconds

73 because this improved the efficiency. As well, for the general archaea standard curves, a mix of plasmids containing the archaeal Methanosarcina 16S rRNA sequence was used. The qPCR primers are provided in Table 2.7-1, primers developed for this study were by Laura Hug. The standard curve results for the qPCR runs in shown in Table 2.7-2

TABLE 2.7-1 Primers used to Track Growth of Facilitating Bacteria and Archaea

Phylogenetic Sequence Primer Set Annealing Temp. °C Refs Target 5’-3’

GGCTCAACCGGTGACATGC (15) Aceto 572f A Acetobacterium 59 Aceto 784r ACTGAGTCTCCCCAACACCT (15)

CCTCGTGAGGGGACAGAAA this Veil_898F CTGG study Veillonellaceae 59 Veil_1434 CGACTTTACTCGCTGGCAAC this R ATAGGAT study

ARCH- ATTAGATACCCGBGTAGTC (67) C 787F General 55 ARCH- Archaea (67) GCCATGCACCWCCTCT 1059R

TABLE 2.7-2 Standard Curve qPCR Equations for Facilitating Bacteria in WBC-2

Consolidated 1:5 and 1:20 Mean y Standard Curve Equations E sd Mean E sd int Aceto (Acetobacterium) y= -3.258x +31.10; r^2 = 0.996 102.7 y = -3.296x + 30.85; r^2 = 0.998 101.1 y = -3.62x + 33.28; r^2 = 0.993 88.9 32.7 1.6 93.7 7.6 y = -3.615x + 33.92; r^2 = 0.995 89.1 y = -3.688x + 34.10; r^2 = 0.995 86.7 Arch (Archaea) y = -3.497x + 33.31; r^2 = 0.996 93.2 y = -3.349x + 33; r^2 = 0.997 98.9 y = -3.484x + 32.82; r^2 = 0.994 93.7 y = -3.378x + 31.67; r^2 = 0.997 97.7 33.6 1.2 90.6 7.0 y = -3.707x + 34.18; r^2 = 0.993 86.1 y = -3.8x + 34.60; r^2 = 0.993 83.3 y=-3.875x + 35.35; r^2 = 0.994 81.2 Veil (Veillonellaceae) y = -3.389x + 33.29; r^2 = 0.99 97.3 y = -3.61 + 33.40; r^2 = 0.996 89.2 y = -3.487x + 32.38; r^2 = 0.997 93.5 y = -3.527x + 33.08; r^2 = 1 92.1 y = -3.598x + 33.98; r^2 = 0.996 89.6 33.8 1.0 88.2 5.9 y = -3.689x + 33.51; r^2 = 0.997 86.7 y = -3.756x + 33.84; r^2 = 0.999 84.6 y = -3.876x + 34.96; r^2 = 0.995 81.1 y = -3.944x + 35.65; r^2 = 0.995 79.3

Table 2.7-2 presents the standard curve results. The shaded areas are the curves from the 1:20 dilution growth trial. During this experiment there was a problem with the qPCR reagent, eventually remedied by ordering a new lot, which affected the efficiencies of the reactions.

The growth of the facilitating bacteria and archaea is shown below in Figures 2.7-1 and 2.7-2. Figure 2.7-1a and c show the growth during the degradation of TeCA by WBC-2 in the 1:5 and 1:20 growth trials, respectively. Figure 2.7-1b and d show the facilitating microorganism growth during degradation of tDCE by WBC-2 in the 1:5 and 1:20 growth trials, respectively. Figure 2.7- 2a and c display the growth of the facilitating microbes during cDCE degradation by WBC-2 in the 1:5 and 1:20 growth trials, respectively. Finally Figure 2.7-2b shows the facilitating microorganism growth during VC degradation in the 1:20 growth trial. Each of the figures shows

75 the growth of the Bacteria and Archaea amended with electron acceptor and electron donor compared with the growth in the control bottles, amended with just electron donor.

Each figure shows the facilitating Bacteria and Archaea grew in both the electron acceptor amended and electron acceptor free treatment conditions, except for a few instances. In the 1:5 growth trial the Acetobacterium grew more than the control in the TeCA amended cultures (Figure 2.7-1a), tDCE amended cultures (Figure 2.7-1b) and in the cDCE amended cultures (Figure 2.7-2a). In the 1:20 growth trial the VC and cDCE amended conditions led to less growth of the facilitating bacteria than in the controls (Figures 2.7-2b and c, respectively). In each of the above instances however there is less than an order of magnitude difference between the numbers of organisms maintained on the electron acceptor and those just amended with electron donor.

76 a) b) Veil 1.00E+07 1.E+07

1.00E+06 1.E+06 Arch 1.00E+05 1.E+05

1.00E+04 Aceto 1.E+04

1.00E+03 1.E+03 0102030 0102030

Time (Days) 16S rRNA gene copies/ml culture Time (Days)

copies/ml culture rRNA gene S 16

c) d) 1.E+07 1.E+07

1.E+06 1.E+06

1.E+05 1.E+05

culture 1.E+04 1.E+04

1.E+03 copies/ml 16SrRNA gene 1.E+03 0 204060 0 20406080

16S rRNA gene copies/ml culture Time (Days) Time (Days)

FIGURE 2.7-1 Growth of Facilitating Bacteria and Archaea in WBC-2. For all graphs: Each curve shows the mean values of triplicate bottles and error bars are the standard deviation. a) As in Chapter 3, 1:5 diluted culture amended with TeCA; Acetobacterium (Aceto), General Archaea (Arch) and Veillonellaceae (Veil) growth during TeCA dechlorination. Circles represent Veil; squares, Arch; triangles Aceto; closed symbols indicate bottles amended with electron donor and TeCA, open symbols with dashed lines indicate controls amended with electron donor only. b) Same as for a), except 1:20 diluted culture. c) Same as a), except amended with tDCE. d) same as c), except 1:20 diluted culture.

77 1.E+07 a) 1.E+07 b) 1.E+06 1.E+06 1.E+05 1.E+05 1.E+04 1.E+04 1.E+03 1.E+03 0 20406080 0102030 Time (Days) Time (Days) 16S rRNA gene copies/ml culture 16S rRNA gene copies/ml culture 5.E+06 c) 5.E+05

5.E+04

5.E+03

5.E+02 0 204060

16S rRNA gene copies/ml culture Time (Days)

FIGURE 2.7-2 Growth of Facilitating Bacteria and Archaea in WBC-2 continued. For all graphs: Each curve shows the mean values of triplicate bottles and error bars are the standard deviation. a) As in Chapter 3, 1:5 diluted culture amended with cDCE; Acetobacterium (Aceto), General Archaea (Arch) and Veillonellaceae (Veil) growth during cDCE dechlorination. Circles represent Veil; squares, Arch; triangles Aceto; closed symbols indicate bottles amended with electron donor and cDCE, open symbols with dashed lines indicate controls amended with electron donor only. b) Same as for a), except 1:20 diluted culture. c) Same as b), except amended with VC.

Appendix B Sequences from Chapter 4 Differentiation of Dehalococcoides Experiment These sequences are stored electronically as fasta files in the Edlab server.

1.1 Sequence of 7kb segment from clone T4T/TCA GCGGCCGCTTGACTTCAGTCTAATGGCCCCCACTGCCCGGGGAGCTTTGCTTTTTCATTCACT TGAAAGCAGAGCTCCATTTTCCCTCTGATATTTAATTAAAAACAAGGCCCGTTAAGGGTCTTT TTTTATTTCAAAGCTAATGCCCCCTATTTGCCTTTACACTTTCTTTTTGGCTGAGCTATAATAA GAGTACTAACCGAGTGAAAGTAAAAAAATTATGTCTAGCAGATTTGATAAATTTTCCGAAAG AGCGCGCCGGGTTCTTACCTATGCACAGGAAGAAGCCCAGAGCCTTAACCATAACTACATCG GCACTGAGCATATACTGCTGGGGCTGGTGAGAGAAGAAGAAGGCGTGGCCGCCCGGGTGCT GGTGAATATGGACGTAAACCTGGCCAAGGTACGTTCGGCTGTTGAATTTATACTGGGACGGG GTGAACACCCTGCTACCTCTGAAACCGGTCTTACCTCCAGAGCCAAAAAGGTAATCGAGCTG GGTATTGATGAAGCCAGAAATCTGGGCCATAACTACATTGGCACTGAGCATTTGCTTTTAGG CCTTCTGCGTGAAGGTGAAGGGGCGGCTGCCGGTGTGCTTGAGAGTTTTGGGGTTACAGTTG AAAAGGTGCGCACCGAAGTAGGGCGTATCTTGAATCAGGGTTTAAACAAACCTAAAACCAG CCGGACAACCCCCAGCCGAACCCCCCAGCTGGACCAGTTAGGTTTTGACCTGACGGCCGCAG CCAAGGCTGGTAAGCTTGACCCGGTTATCGGGCGTTCCAAAGAAATAGAACGGGTAGTCCAG ATTCTTTCCCGCCGTACCAAAAATAACCCTGCGCTTATAGGCGAACCTGGCGTAGGAAAAAC CTCCATTGTGGAGGGGCTGGCCCAGCGCATTGTTTCGGGTGACGTACCGGAAACTCTGGAAC AGAAGCATATAATCTCACTGGACGTGGCCTCACTGGTGGCCGGTACCAAATACCGGGGTGAA TTTGAGGAACGGCTTAAGAAGGTTATTGAGGAGATTAAAAATGCAGGAAACATAATCCTGTT TATAGACGAATTCCACACCATGGTGGGAGCCGGTGCTGCCGAGGGGGCAGTAGATGCCGCC AATATCCTCAAGCCTTCACTGGCCAGAGGTGAGGTGCAGGTTATCGGTGCGACCACTCTGGA TGATTTCCGTAAGTATGTTGAGCGTGATGCCGCACTTGAGAGACGCTTCCAGCCGGTACTGGT TGAAGAACCGGCCATAGAAGATACACTGAGCATTCTCAGGGGTATAAAAGAACGCTATGAG GAGCATCATAAGCTTATCATCAGCGATGAAGCTATTATCGCTGCTGCCAATATGGCTGCCAG ATATATACCTGACCGCTTTTTGCCGGACAAGGCTATAGATTTGGTTGACGAAGCTGCATCACG GGTGCGGATAAAGAAACGCACCAAGCCGGTCTCTTTGAAAGAGATGAAAGCTATAGAAGAC AGCTACCGCCGGGATAAAGAAGCCGCTCTGGCTACCCAGCAGTACGACTATGCTTCCGAACT CCGCGAGCGTGAGCTTCAGATAGCTGAAAAGATACGCCGCATGGAAGATGAATGGCAGACC GAACAGGCTATGGACAAGCCGGTGGTGGGCGAAGAAGATATTGTTCAGGTAGTCAGTATGT GGACAGGTGTCCCTCTGGTACAGCTTACCGGTGACGAAACCGAACGCCTTCTCCATATGGAA GATGCTTTGCACGAGCGGATTATCGGCCAGGAAGAGGCTATTGTTACCATATCCAAGGCTGT CAGGCGGGCACGGGCCGGTCTTAAAGATCCCCGTCACCCCATTGGCAACTTTGTTTTCCTTGG ACCTACCGGCGTGGGTAAAACCGAATTGGCACGGGCGCTTGCCCAGTTTATGTTCGGTTCGG AAGACTCTTTGGTTCGGCTGGATATGTCCGAATTTATGGAAAAATTCGCTGTATCCCGTCTGG TGGGTGCACCCCCCGGATATGTGGGCTATGATGAGGGCGGCCAGTTGACGGAAGCTGTTCGC CGCAAGTCATATTGCCTGATACTGCTGGACGAAATAGAAAAAGCTCATCCTGACGTTTTTAA TATTCTCCTTCAGATATTTGATGACGGCCACCTGACAGATGCCAAGGGCAGGCGGGTGGACT TCAGGAATACCATTATCATCATGACCTCTAACATTGGGGCTGAACTTATCCGCAAGGGTAGC GGGACTATCGGATTTGCCACTCAGACAGACGAATCAAAGGCCCAGCAGACCAATTTTGAGCA CATGAAAGACAAGCTGCTGGGTGAGCTTAAAAAGAGTTTCCGTCCGGAGTTTTTAAACCGTA TTGACAGTGTGGTGGTCTTCCACTCGCTAAATAAAGAGCAGATTCGCAGTATTGTTGACCTGA TGCTCAAGAGTGTGGTCAAGCAGATGGCTGAAAAGGGCATCGGGCTTGAGGTGACCGAATCT GCTAAGGACTTGCTGGGCAAGAAGGGTTATGATGAGGTTTATGGTGCCAGGCCTCTGCGCCG CACTATCCAGACCATGATAGAAGACCGCTTGTCTGAAGACTTGCTGCGGGCTAAATTTAAAG

CCGGGGATAAAGTAATAGTGGATACTGCCGAAGACGAAATAATTGTCCGGCTGGCCGAACC GGCTGAGCTTAGTCAGGCTACTCCTTAAGGGCGGGTACCGGTAACGGATTAGTTTAAGGGGA GTTTTAAGACTCCCCTTTTTGTTTAGGGTAAAATAAAAATGATTAGCTGGGTAAGCCTGTCCT GCCGGGTAAGTAGCAAACGCTGGTTTGTCCGTTAAGCGAAGAGCTAAAAAACAAACTCCGA AATAGTTTACTCCTTATGGGGTGGGCATAGGGGTTACTGTCAGCCTTAGCCTGACGCATGGG CTTATGCTGCCTGCCAGCCTTTGAAAGCGGTCCGCCTATTACCTTTTGCGGGGGGGGTGCTGG CAGCGCCTAGGCAGAGCTTTTACCGGGCGGCATATTTTATCAAGGCGGTTGTCTGGCAGTAA TCCTTTTTTACAAAGTGTATATTCGCCGGAATATCTGAGGTAAACTAAGGGGCAGGTACGCC CTTGCTTTAGCGGATTAAATTGTGTAAAGTCTTCTGTATATGGATAAAAGCCGTAATGTTTAT ATCTGTTCCAACTGCGGACATGAGAGCCTGAGTGGCTGGGGCGTTGCCCCGGCTGTCAGGAA TGGAATACTCTTGAAGAAACAACAATTGCTGCACCTCTCGGGCGTAAAAATGCACCTGCCCG GGTTATCAGCCCGGCAGCCGAGCTTTCCAGTCTGAATGCATCAGATACTACCCGCCGGAGTC TATCTATTTCAGAGTTCAACCGGGTTTTGGGCGATGGAATAGTGCCGGGTTCACTGATGCTTT TAGGGGGTGAACCGGGTATCGGCAAATCCACGCTCCTTCTTCAGGTGGCTGCCTCGGTAGCC CAGAGCGGCGGCAAAGTGGTATATGTTTCCGGGGAAGAGAACCCCGCCCAGATAAAAATGC GCGCTCAGCGTCTGGGTATCAGCGGCGAGGGGCTTTTCCTTATGGCTGAGACAGACCTTAAT GCCATTCTAGCCCAGCTTTCAGTCCTCTGCCCGTCATTGGTTGTTATAGACTCTATCCAGACT GTATTCCTGCCTGAGCTTGAGGCCGCACCCGGTGCTATAAATCAGGTGCGTGAATCAGCCCT CCGCCTGATGCAGTGGGCTAAGAACAGCGGTGCCAGCGTATTTATTGCCGCCCATGTTACCA AAGAGGGCAACATCGCCGGGCCGCGCATACTGGAACATATAGTAGATGTGGTCATGTACTTT GAGGGCGAGTCCCAGAGTGCTTACCGTTTGATACGTTCGGTCAAAAACCGCTTCGGTTCTAC CAACGAAGTAGGCATATTTGAAATGAAAAGTGAAGGATTGGTGGAAGTAGCCAATCCCTCG CAGATATTTTTATCTAATCGGCAGGCAAACACTGTTGGTTCAGCTGTAACAGCAGTGCTGGA GGGTAGCCGCCCTTTACTGGTAGAGGTGCAGGCACTCACCAATACCACCAGTTTCGGCCAGC CGCGCCGCACGGCCAACGGGGTAGATTTTAACCGTACTATTATGATAGCCGCTGTTCTTTCCA AACGCCTTTCCATGCGGCTGGGTACCCAGGACATAATAGTAAATGCCACCGGCGGTATTCGT CTGGACGAGCCGGCCGCAGATTTGGCTATTGCTTTGGCCATTGCCTCCAGTTACCGTGATATC GGGGTCTGCCCGGAAACCATAGCACTGGGTGAGATTGGCCTTTCAGGGGAACTGAGGACAAT CCCTCATTTGGAAAGACGTCTTTCCGAGGCCAGCCGTTTGGGTTTTACGAGGGCTTTGGTACC TGCCGGTGCTAATTGCCAGAATATAAATATAAATGGTATCCAGATTATTGCGGTTTCAACTGT CAAAGAGGCTATTAAACTGGCGCTTACCGGGGTAAAAACGGAGACCGAAGATGTTTTTGAAT GAAAAAGTAGGGGCAGTTATTGTAGCTGCCGGTCAGAGCCGCCGAATGGAGGGGCAGGACA AGATTTTTGCCCTTCTGGCGGGTAAACCTGTTTTGGCTCACACGCTTTCGGTTTTTCAAGAATC CCCGCAGGTAGATGATATTGCTCTGGTTATGGCAGAACACAATATTGAAAAAGCCAAAGAGC TGGTTAAGGAATATAATTTCAGCAAGGTTATAGCCATTTGCTCCGGCGGGACACTCCGCCAG GACTCTGTCCGCTCAGGGCTGTCAGCCCTGTGTGACTGCGGCTGGATACTCATTCATGACGGG GCGCGCCCCCTGCTTGAGCCTGACTCTATACCCGAAGGGTTGGAAGCGGCTAAACTCTGCGG TTCGGCCATCGCGGCAGTACCCCTTAAAGATACCATTAAAGAAATATCCCCGGAAGGGCTGG TGGAAAAAACCCTGCCCAGAGAGAGGCTGATATCCGTCCAGACACCTCAGGTGTTTCGGGCA GATATTATCCAAAAAGCCTACCAGCGGGTGGGTATAATCGCCACTGACGATGCCCAACTGGT AGAAAAACTGAAGCTCCCAGTCAGGATATTCTCCGGCGCATGTGCTAATATAAAGATAACCA CACCTGAAGACCTGCTTATGGCAGAAATACTGCTGAAGAAAGGACGGTGAGCATAATGCGT ATTGGAAACGGTTATGATGTCCATCGTCTGGCACCGGGGCAGAAACTGGTGCTGGGCGGGGT GGAAATCCCCTTTGAATGCGGGCTTATCGGCTGGAGTGATGCAGATGTGCTTACCCATGCCA TTATGGATTCGCTTCTGGGAGCGGCGACACTGGGGGATATAGGACTCTACTTCCCGCCGGGA GACCCAAAGTACAAAGGCATATCTTCACTCAAACTTCTTGAACAGGTGACAGACTTGCTGGC

TAAAAAAGGTTTTGGCATAATAAATGTAGATTCAGTTATAGTAGCGGAGGAACCAAAGCTAC GCGGCCATATAGATACCATGCGCAAACACCTTGCCAAGGCCATGGGCATAGACCCCGGGCG GGTGGGGATTAAAGCCAGTACCTCGGAGCAACTCGGCTTTGTCGGCCGGCAGGAGGGAATG GTAGCTTGGGCGGTGGCCCTCGTAGATGAAAAATAGACTATGAAAATATATAACACTTTATC CGGCAAGCTGGAAAAATTCGTCCCTCTGGAAAACGGCAAAGTCAAAATGTATGTCTGCGGCA TTACCCCGCAGTCAGAGCCGCATATCGGCCACGCCATGAGCTATATAAACTTTGACGTAATC CGCCGCTACCTTACCTATAAAGGTTATCGGGTAAAATATATCCAGAACTTTACCGATATAGAT GATAAAATAATAGCCAAGGCCAATGCCCAAGGCATAGAGCCGTCTACTCTGGCAGAGCGTA ATATCGGGGTGTTTCTGGACGCCATGGCTGCACTTAATATAACCCCGGCAGATTATTATCCCA GAGCCACTCAGGAAGTGCCCAAGATAATAGAAATGGTCTCCGGCCTTATAGAAAAAGGCTAT GCTTATGCGGTAGGCGGCAGTGTCTACCTGCGGGTGCAGAAGGTGGACGGTTACGGCAAACT GTCCCATCGTACTCTGGAGCAGATGATGGCCGGTGCCCGGGTTGAAATTGATGAAGAAAAAG AATACCCCATGGATTTTGCCCTTTGGAAGGCCACCAAACCCGGCGAACCGTCTTGGGAAAGC CCTTGGGGACTGGGACGCCCCGGCTGGCATATTGAATGTTCTGCCATGTCTCTTCGTTATCTG GGCGAGCAGATAGATATACACGGCGGCGGGCAGGATCTTATATTCCCCCATCATGAAAATGA AATAGCCCAGTCCGAGTGCTTCAGCGGGGTCAAACCCTTTGTTAAGTACTGGCTGCACAACG GACTTTTAAAACTCGGCGAAGAGAAAATGAGCAAATCACTGGGCAATCTGGTTACTATAAAA GAAGCCCTCAGCCGTTACTCGGCAGATGCTCTGCGGATTTTTGTGCTCAGTTCCAGCTACCGT AATCCGCTTACTTACTCTGAAGAAGCTCTGGAAGCGGCTGAAAAAGGGGCGGAACGTCTGCG TCAGACAGCTGCCCGTAAGGATAATCCCCAGTTTAAAGAAACCGCGGTGGATACCAAGGCAT ATCGTGAGCGTTTTACCCAGTATATGGACAATGACTTTAATACTTCGGCTGCTCTGGCTACTA TCTTTGACCTTAGCCGCGAATTAAACCGTATAGAGGGCGAGGCTGGTAAAAGCACTGACGGC CAAAAGCTATTTAAAGAACTGGCGGATATACTTGGACTTAGTCTGATAGTAGCAGAGTCCAA AACCGGTACAGACGTTGCTCCTTTTATAGAGCTGCTGATAGAACTCAGAAAAGACCTGCGGG TGGCAAAGCAGTACCAGCTGGCAGACAAAATCCGTACCAGTCTGGATACAGCCGGGATACTT CTGGAAGACTCTGCTGGTGGCACTGTTTGGAAAGTAAAAAAATAAAATAACCGGGAAATTCA GGGTTAAATACTCGCCCTGTATTTTTATTATAAAGCTAAAAAAAGTTGCACTTAGTGACCATT TATGATAGATTATCTATCTGTTGCTGGGGCCGTAGTTCACTTGGGAGAACGT

1.2 Sequence of 7kb segment from T1T/ALL GCTTTGCTTTTTCATTCACTTGAAAGCAGAGCTCCATTTTCCCTCTGATATTTAATTAAAAACA AGGCCCGTTAAKGGTCTTTTTTTATTTCAAAGCTAATGCCCCCTATTTGCCTTTACACTTTCTT TTTGGCTGAKCTATAATAAGAGTACTAACCGAGTGAAAGTAAAAAAATTATGTCTAGCAGAT TTGATAAATTTTCCGAAAGAGCGCGCCGGGTTCTTACCTATGCACAGGAAGAAGCCCAGAGC CTTAACCATAACTACATCGGCACTGAGCATATACTGCTGGGGCTGGTGAGARAARAAGAAGG CGTGGCCGCCCGGGTGCTGGTGAATATGGACSTAAACCTGGCCAAGGTACGTTCGGCTGTTG AATTTATACTGGGACGGGGTGAACACCCTGCTACCTCTGAAACCGGTCTTACCTCCAGAGCC AAAAAGGTAATCGAKCTGGGTATTGATGAAGCCAGAAATCTGGGCCATAACTACATTGGCAC TGAGCATTTGCTTTTAGGCCTTCTGCGTGAAGGTGAAGGGGCGGCTGCCGGTGTGCTTGAGA GTTTTGGGGTTACAGTTGAAAAGGTGCGCACCGAAGTAGGGCGTATCTTGAATCAGGGTTTA AACAAACCTAAAACCAGCCGGACAACCCCCAGCCGAACCCCCCAGCTGGACCAGTTAGGTTT TGACCTGACGGCCGCAGCCAAGGCTGGTAAGCTTGACCCGGTTATCGGGCGTTCCAAAGAAA TAGAACGGGTAGTCCAGATTCTTTCCCGCCGTACCAAAAATAACCCTGCGCTTATAGGCGAA CCTGGCGTAGGAAAAACCTCCATTGTGGAGGGGCTGGCCCAGCGCATTGTTTCGGGTGACGT ACCGGAAACTCTGGAACAGAAGCATATAATCTCACTGGACGTGGCCTCACTGGTGGCCGGTA

CCAAATACCGGGGTGAATTTGAGGAACGGCTTAAGAAGGTTATTGAGGAGATTAAAAATGC AGGAAACATAATCCTGTTTATAGACGAATTCCACACCATGGTGGGAGCCGGTGCTGCCGAGG GGGCAGTAGATGCCGCCAATATCCTCAAGCCTTCACTGGCCAGAGGTGAGGTGCAGGTTATC GGTGCGACCACTCTGGATGATTTCCGTAAGTATGTTGAGCGTGATGCCGCACTTGAGAGACG CTTCCAGCCGGTACTGGTTGAAGAACCGGCCATAGAAGATACACTGAGCATTCTCAGGGGTA TAAAAGAACGCTATGAGGAGCATCATAAGCTTATCATCAGCGATGAAGCTATTATCGCTGCT GCCAATATGGCTGCCAGATATATACCTGACCGCTTTTTGCCGGACAAGGCTATAGATTTGGTT GACGAAGCTGCATCACGGGTGCGGATAAAGAAACGCACCAAGCCGGTCTCTTTGAAAGAGA TGAAAGCTATAGAAGACAGCTACCGCCGGGATAAAGAAGCCGCTCTGGCTACCCAGCAGTA CGACTATGCTTCCGAACTCCGCGAGCGTGAGCTTCAGATAGCTGAAAAGATACGCCGCATGG AAGATGAATGGCAGACCGAACAGGCTATGGACAAGCCGGTGGTGGGCGAAGAAGATATTGC TCAGGTAGTCAGTATGTGGACAGGTGTCCCTCTGGTACAGCTTACCGGTGACGAAACCGAAC GCCTTCTCCATATGGAAGATGCTTTGCACGAGCGGATTATCGGCCAGGAAGAGGCTATTGTT ACCATATCCAAGGCTGTCAGGCGGGCACGGGCCGGTCTTAAAGATCCCCGTCACCCCATTGG CAACTTTGTTTTCCTTGGACCTACCGGCGTGGGTAAAACCGAATTGGCACGGGCGCTTGCCCA GTTTATGTTCGGTTCGGAAGACTCTTTGGTTCGGCTGGATATGTCCGAATTTATGGAAAAATT CGCTGTATCCCGTCTGGTGGGTGCACCCCCCGGATATGTGGGCTATGATGAGGGCGGCCAGC TGACGGAAGCTGTTCGCCGCAAGTCATATTGCCTGATACTGCTGGACGAAATAGAAAAAGCT CATCCTGACGTTTTTAATATTCTCCTTCAGATATTTGATGACGGCCACCTGACAGATGCCAAG GGCAGGCGGGTGGACTTCAGGAATACCATTATCATCATGACCTCAAACATTGGGGCTGAACT TATCCGCAAGGGTAGCGGGACTATCGGATTTGCCACTCAGACAGACGAATCAAAGGCCCAGC AGACCAATTTTGAGCACATGAAAGACAAGCTGCTGGGTGAGCTTAAAAAGAGTTTCCGTCCG GAGTTTTTAAACCGTATTGACAGTGTGGTGGTCTTCCACTCGCTAAATAAAGAGCAGATTCGC AGTATTGTTGACCTGATGCTCAAGAGTGTGGTCAAGCAGATGGCTGAAAAGGGCATCGGGCT TGAGGTGACCGAATCTGCTAAGGACTTGCTGGGCAAGAAGGGTTATGATGAGGTTTATGGTG CCAGGCCTCTGCGCCGCACTATCCAGACCATGATAGAAGACCGCTTGTCTGAAGACTTGCTG CGGGCTAAATTTAAAGCCGGGGATAAAGTAATAGTGGATACTGCCGAAGACGAAATAATTG TCCGGCTGGCCGAACCGGCTGAGCTTAGTCAGGCTACTCCTTAAGGGCGGGTACCGGTAACG GATTAGTTTAAGGGGAGTTTTAAGACTCCCCTTTTTGTTTAGGGTAAAATAAAAATGATTAGC TGGGTAAGCCTGTCCTGCCGGGTAAGTAGCAAACGCTGGTTTGTCCGTTAAGCGAAGAGCTA AAAAACAAACTCCGAAATAGTTTACTCCTTATGGGGTGGGCATAGGGGTTACTGTCAGCCTT AGCCTGACGCATGGGCTTATGCTGCCTGCCAGCCTTTGAAAGCGGTCCGCCTATTACCTTTTG CGGGGGGGGTGCTGGCAGCGCCTAGGCAGAGCTTTTACCGGGCGGCATATTTTATCAAGGCG GTTGTCTGGCAGTAATCCTTTTTTACAAAGTGTATATTCGCCGGAATATCTGAGGTAAACTAA GGGGCAGGTACGCCCTTGCTTTAGCGGATTAAATTGTGTAAAGTCTTCTGTATATGGATAAA AGCCGTAATGTTTATATCTGTTCCAACTGCGGACATGAGAGCCTGAAGTGGCTGGGGCGTTG CCCCGGCTGTCAGGAATGGAATACTCTTGAAGAAACAACAATTGCTGCACCTCTCGGGCGTA AAAATGCACCTGCCCGGGTTATCAGCCCGGCAGCCGAGCTTTCCAGTCTGAATGCATCAGAT ACTACCCGCCGGAGTCTATCTATTTCAGAGTTCAACCGGGTTTTGGGCGGTGGAATAGTGCC GGGTTCACTGATGCTTTTAGGGGGTGAACCGGGTATCGGCAAATCCACGCTCCTTCTTCAGGT GGCTGCCTCGGTAGCCCAGAGCGGCGGCAAAGTGGTATATGTTTCCGGGGAAGAGAACCCC GCCCAGATAAAAATGCGCGCTCAGCGTCTGGGTATCAGCGGCGAGGGGCTTTTCCTTATGGC TGAGACAGACCTTAATGCCATTCTAGCCCAGCTTTCAGTCCTCTGCCCGTCATTGGTTGTTAT AGACTCTATCCAGACTGTATTCCTGCCTGAGCTTGAGGCCGCACCCGGTGCTATAAATCAGGT GCGTGAATCAGCCCTCCGCCTGATGCAGTGGGCTAAGAACAGCGGTGCCAGCGTATTTATTG CCGCCCATGTTACCAAAGAGGGCAACATCGCCGGGCCGCGCATACTGGAACATATAGTAGAT

GTGGTCATGTACTTTGAGGGCGAGTCCCAGAGTGCTTACCGTTTGATACGTTCGGTCAAAAA CCGCTTCGGTTCTACCAACGAAGTAGGCATATTTGAAATGAAAAGTGAAGGATTGGTGGAAG TAGCCAATCCCTCGCAGATATTTTTATCTAATCGGCAGGCAAACACTGTTGGTTCAGCTGTAA CAGCAGTGCTGGAGGGTAGCCGCCCTTTACTGGTAGAGGTGCAGGCACTCACCAATACCACC AGTTTCGGCCAGCCGCGCCGCACGGCCAACGGGGTAGATTTTAACCGTACTATTATGATAGC CGCTGTTCTTTCCAAACGCCTTTCCATGCGGTTGGGTACCCAGGACATAATAGTAAATGCCAC CGGCGGTATTCGTCTGGACGAGCCGGCCGCAGATTTGGCTATTGCTTTGGCCATTGCCTCCAG TTACCGTGATATCGGGGTCTGCCCGGAAACCATAGCACTGGGTGAGATTGGCCTTTCAGGGG AACTGAGGACAATCCCTCATTTGGAAAGACGTCTTTCCGAGGCCAGCCGTTTGGGTTTTACG AGGGCTTTGGTACCTGCCGGTGCTAATTGCCAGAATATAAATATAAATGGTATCCAGATTATT GCGGTTTCAACTGTCAAAGAGGCTATTAAACTGGCGCTTACCGGGGTAAAAACGGAGACCGA AGATGTTTTTGAATGAAAAAGTAGGGGCAGTTATTGTAGCTGCCGGTCAGAGCCGCCGAATG GAGGGGCAGGACAAGATTTTTGCCCTTCTGGCGGGTAAACCTGTTTTGGCTCACATGCTTTCG GTTTTTCAAGAATCCCCGCAGGTAGATGATATTGCTCTGGTTATGGCAGAACACAATATTGA AAAAGCCAAAGAGCTGGTTAAGGAATATAATTTCAGCAAGGTTATAGCCATTTGCTCCGGCG GGACACTCCGCCAGGACTCTGTCCGCTCAGGGCTGTCAGCCCTGTGTGACTGCGGCTGGATA CTCATTCATGACGGGGCGCGCCCCCTGCTTGAGCCTGACTCTATACCCGAAGGGTTGGAAGC GGCTAAACTCTGCGGTTCGGCCATCGCGGCAGTACCCCTTAAAGATACCATTAAAGAAATAT CCCCGGAAGGGCTGGTGGAAAAAACCCTGCCCAGAGAGAGGCTGATATCCGTCCAGACACC TCAGGTGTTTCGGGCAGATATTATCCAAAAAGCCTACCAGCGGGTGGGTATAATCGCCACTG ACGATGCCCAACTGGTAGAAAAACTGAAGCTCCCAGTCAGGATATTCTCCGGCGCATGTGCT AATATAAAGATAACCACACCTGAAGACCTGCTTATGGCAGAAATACTGCTGAAGAAAGGAC GGTGAGCATAATGCGTATTGGAAACGGTTATGATGTCCATCGTCTGGCACCGGGGCAGAAAC TGGTGCTGGGCGGGGTGGAAATCCCCTTTGAATGCGGGCTTATCGGCTGGAGTGATGCAGAT GTGCTTACCCATGCCATTATGGATTCGCTTCTGGGAGCGGCGGCACTGGGGGATATAGGACT CTACTTCCCGCCGGGAGACCCAAAGTACAAAGGCATATCTTCACTCAAACTTCTTGAACAGG TGACAGACTTGCTGGCTAAAAAAGGTTTTGGCATAATAAATGTAGATTCAGTTATAGTAGCG GAGGAACCAAAGCTACGCGGCCATATAGATACCATGCGCAAACACCTTGCCAAGGCCATGG GCATAGACCCCGGGCGGGTGGGGATTAAAGCCAGTACCTCGGAGCAACTCGGCTTTGTCGGC CGGCAGGAGGGAATGGTAGCTTGGGCGGTGGCCCTCGTAGATGAAAAATAGACTATGAAAA TATATAACACTTTATCCGGCAAGCTGGAAAAATTCGTCCCTCTGGAAAACGGCAAAGTCAAA ATGTATGTCTGCGGCATTACCCCGCAGTCAGAGCCGCATATCGGCCACGCCATGAGCTATAT AAACTTTGACGTAATCCGCCGCTACCTTACCTATAAAGGTTATCGGGTAAAATATATCCAGA ACTTTACCGATATAGATGATAAAATAATAGCCAAGGCCAATGCCCAAGGCATAGAGCCGTCT ACTCTGGCAGAGCGTAATATCGGGGTGTTTCTGGACGCCATGGCTGCACTTAATATAACCCC GGCAGATTATTATCCCAGAGCCACTCAGGAAGTGCCCAAGATAATAGAAATGGTCTCCGGCC TTATAGAAAAAGGCTATGCTTATGCGGTAGGCGGCAGTGTCTACCTGCGGGTGCAGAAGGTG GACGGTTACGGCAAACTGTCCCATCGTACTCTGGAGCAGATGATGGCCGGTGCCCGGGTTGA AATTGATGAAGAAAAAGAATACCCCATGGATTTTGCCCTTTGGAAGGCCACCAAACCCGGCG AACCGTCTTGGGAAAGCCCTTGGGGACTGGGACGCCCCGGCTGGCATATTGAATGTTCTGCC ATGTCTCTTCGTTATCTGGGCGAGCAGATAGATATACACGGCGGCGGGCAGGATCTTATATT CCCCCATCATGAAAATGAAATAGCCCAGTCCGAGTGCTTCAGCGGGGTCAAACCCTTTGTTA AGTACTGGCTGCACAACGGACTTTTAAAACTCGGCGAAGAGAAAATGAGCAAATCACTGGG CAATCTGGTTACTATAAAAGAAGCCCTCAGCCGTTACTCGGCAGATGCTCTGCGGATTTTTGT GCTCAGTTCCAGCTACCGTAATCCGCTTACTTACTCTGAAGAAGCTCTGGAAGCGGCTGAAA AAGGGGCGGAACGTCTGCGTCAGACAGCTGCCCGTAAGGATAATCCCCAGTTTAAAGAAAC

CGCGGTGGATACCAAGGCATATCGTGAGCGTTTTACCCAGTATATGGACAATGACTTTAATA CTTCGGCTGCTCTGGCTACTATCTTTGACCTTAGCCGCGAATTAAACCGTATAGAGGGCGAGG CTGGTAAAAGCACTGACGGCCAAAAGCTATTTAAAGAACTGGCGGATATACTTGGACTTAGT CTGATAGTAGCAGAGTCCAAAACCGGTACAGACGTTGCTCCTTTTATAGAGCTGCTGATAGA ACTCAGAAAAGACCTGCGGGTGGCAAAGCAGTACCAGCTGGCAGACAAAATCCGTACCAGT CTGGATACAGCCGGGATACTTCTGGAAGACTCTGCTGGTGGCACTGTTTGGAAAGTAAAAAA ATAAAATAACCGGGAAATTCAGGGTTAAATACTCGCCCTGTATTTTTATTATAAAGCTAAAA AAAGTTGCACTTAGTGACCATTTATGATAGATTATCTATCTGTTGCTGGGGCCGTAGTTCACT TGGGAGAACGTTTGACTGGCAGTCAAAAGGTAGAGGGTTCGAATCCCTCCGGCTCCACCAGG GCC

1.3 Sequence of 7kb segment from T2P/CDCE (clone #1) ATCTGGGCCATAACTACATTGGCACTGAGCATTTGCTTTTAGGCCTTCTGCGTGAAGGTGAAG GGGCGGCTGCCGGTGTGCTTGAKAGTTTTGGGGTTACAGTTGAAAAGGTGCGCACCGAAGTA KGGCGTATCTTGAATCARGGTTTAAACAAACCTAAAACCAGCCGGACAACCCCCAGCCGAAC CCCCCAGCTGGACCAGTTAGGTTTTGACCTGACGGCCGCAGCCAAGGCTGGTAAGCTTGACC CGGTTATCGGGCGTTCCAAAGAAATAGAACGGGTAGTCCAGATTCTTTCCCGCCGTACCAAA AATAACCCTGCGCTTATAGGCGAACCTGGCGTAGGAAAAACCTCCATTGTGGAGGGGCTGGC CCAGCGCATTGTTTCGGGTGACGTACCGGAAACTCTGGAACAGAAGCATATAATCTCACTGG ACGTGGCCTCACTGGTGGCCGGTACCAAATACCGGGGTGAATTTGAGGAACGGCTTAASAAG GTTATTGAGGAGATTAAAAATGCAGGAAACATAATCCTGTTTATAGACGAATTCCACACCAT GGTGGGAGCCGGTGCTGCCGAGGGGGCAGTAGATGCCGCCAATATCCTCAWGCCTTCACTG GCCAKARGTGAGGTGCAGGTTATCGGTGCGACCACTCTGGATGATTTCCGTAAGTATGTTGA GCGTGATGCCGCACTTGAGAGACGCTTCCAGCCGGTACTGGTTGAAGAACCGGCCATAGAAG ATACACTGAGCATTCTCAGGGGTATAAAAGAACGCTATGAGGAGCATCATAAGCTTATCATC AGCGATGAAGCTATTATCGCTGCTGCCAATATGGCTGCCAGATATATACCTGACCGCTTTTTG CCGGACAAGGCTATAGATTTGGTTGACGAAGCTGCATCACGGGTGCGGATAAAGAAACGCA CCAAGCCGGTCTCTTTGAAAGAGATGAAAGCTATAGAAGACAGCTACCGCCGGGATAAAGA AGCCGCTCTGGCTACCCAGCAGTACGACTATGCTTCCGAACTCCGCGAGCGTGAGCTTCAGA TAGCTGAAAAGATACGCCGCATGGAAGATGAATGGCAGACCGAACAGGCTATGGACAAGCC GGTGGTGGGCGAAGAAGATATTGCTCAGGTAGTCAGTATGTGGACAGGTGTCCCTCTGGTAC AGCTTACCGGTGACRAAACCGAACGCCTTCTCCATATGGAAGATGCTTTGCACGAGCGGATT ATCGGCCAGGAAGAGGCTATTGTTACCATATCCAAGGCTGTCAGGCGGGCACGGGCCGGTCT TAAAGATCCCCGTCACCCCATTGGCAACTTTGTTTTCCTTGGACCTACCGGCGTGGGTAAAAC CGAATTGGCACGGGCGCTTGCCCAGTTTATGTTCGGTTCGGAAGACTCTTTGGTTCGGCTGGA TATGTCCGAATTTATGGAAAAATTCGCTGTATCCCGTCTGGTGGGTGCACCCCCCGGATATGT GGGCTATGATGAGGGCGGCCAGCTGACGGAAGCTGTTCGCCGCAAGTCATATTGCCTGATAC TGCTGGACGAAATAGAAAAAGCTCATCCTGACGTTTTTAATATTCTCCTTCAGATATTTGATG ACGGCCACCTGACAGATGCCAAGGGCAGGCGGGTGGACTTCAGGAATACCATTATCATCATG ACCTCAAACATTGGGGCTGAACTTATCCGCAAGGRTAGCGGGACTATCGGATTTGCCACTCA GACAGACGAATCAAAGGCCCAGCAGACCAATTTTGAGCACATGAAAGACAAGCTGCTGGGT GAGCTTAAAAAGAGTTTCCGTCCGGAGTTTTTAAACCGTATTGACAGTGTGGTGGTCTTCCAC TCGCTAAATAAAGAGCAGATTCGCAGTATTGTTGACCTGATGCTCAAGAGTGTGGTCAAGCA GATGGCTGAAAAGGGCATCGGGCTTGAGGTGACCGAATCTGCTAAGGACTTGCTGGGCAAG AAGGGTTATGATGAGGTTTATGGTGCCAGGCCTCTGCGCCGCACTATCCAGACCATGATAGA AGACCGCTTGTCTGAAGACTTGCTGCGGGCTAAATTTAAAGCCGGGGATAAAGTAATAGTGG

ATACTGCCGAAGACGAAATAATTGTCCGGCTGGCCGAACCGGCTGAGCTTAGTCAGGCTACT CCTTAAGGGCGGGTACCGGTAACGGATTAGTTTAAGGGGAGTTTTAAGACTCCCCTTTTTGTT TAGGGTAAAATAAAAATGATTAGCTGGGTAAGCCTGTCCTGCCGGGTAAGTAGCAAACGCTG GTTTGTCCGTTAAGCGAAGAGCTAAAAAACAAACTCCGAAATAGTTTACTCCTTATGGGGTG GGCATAGGGGTTACTGTCAGCCTTAGCCTGACGCATGGGCTTATGCTGCCTGCCAGCCTTTGA AAGCGGTCCGCCTATTACCTTTTGCGGGGGGGGTGCTGGCAGCGCCTAGGCAGAGCTTTTAC CGGGCGGCATATTTTATCAAGGCGGTTGTCTGGCAGTAATCCTTTTTTACAAAGTGTATATTC GCCGGAATATCTGAGGTAAACTAAGGGGCAGGTACGCCCTTGCTTTAGCGGATTAAATTGTG TAAAGTCTTCTGTATATGGATAAAAGCCGTAATGTTTATATCTGTTCCAACTGCGGACATGAG AGCCTGAAGTGGCTGGGGCGTTGCCCCGGCTGTCAGGAATGGAATACTSYYGAAGAAACAA CAATTGCTGCACCTCTCGGGCGTAAAAATGCACCTGCCCGGGTTATCAGCCCGGCAGCCGAG CTTTCCAGTCTGAATGCATCAGATACTACCCGCCGGAGTCTATCTATTTCAGAGTTCAACCGG GTTTTGGGCGGTGGAATAGTGCCGGGTTCACTGATGCTTTTAGGGGGTGAACCGGGTATCGG CAAATCCACGCTCCTTCTTCAGGTGGCTGCCTCGGTAGCCCAGAGCGGCGGCAAAGTGGTAT ATGTTTCCGGGGAAGAGAACCCCGCCCAGATAAAAATGCGCGCTCAGCGTCTGGGTATCAGC GGCGAGGGGCTTTTCCTTATGGCTGAGACAGACCTTAATGCCATTCTAGCCCAGCTTTCAGTC CTCTGCCCGTCATTGGTTGTTATAGACTCTATCCAGACTGTATTCCTGCCTGAGCTTGAGGCC GYACCCGGTGCTATAAATCAGGTGCGTGAATCAGCCCTCCGCCTGATGCAGTGGGCTAAGAA CAGCGGTGCCAGCGTATTTATTGCCGCCCATGTTACCAAAGAGGGCAACATCGCCGGGCCGC GCATACTGGAACATATAGTAGATGTGGTCATGTACTTTGAGGGCGAGTCCCAGAGTGCTTAC CGTTTGATACGTTCGGTCAAAAACCGCTTCGGTTCTACCAACGAAGTAGGCATATTTGAAAT GAAAAGTGAAGGATTGGTGGAAGTAGCCAATCCCTCGCAGATATTTTTATCTAATCGGCAGG CAAACACTGTTGGTTCAGCTGTAACAGCAGTGCTGGAGGGTAGCCGCCCTTTACTGGTAGAG GTGCAGGCACTCACCAATACCACCAGTTTCGGCCAGCCGCGCCGCACGGCCAACGGGGTAGA TTTTAACCGTACTATTATGATAGCCGCTGTTCTTTCCAAACGCCTTTCCATGCGGCTGGGTAC CCAGGACATAATAGTAAATGCCACCGGCGGTATTCGTCTGGACGAGCCGGCCGCAGATTTGG CTATTGCTTTGGCCATTGCCTCCAGTTACCGTGATATCGGGGTCTGCCCGGAAACCATAGCAC TGGGTGAGATTGGCCTTTCAGGGGAACTGAGGACAATCCCTCATTTGGAAAGACGTCTTTCC GAGGCCAGCCGTTTGGGTTTTACGAGGGCTTTGGTACCTGCCGGTGCTAATTGCCAGAATAT AAATATAAATGGTATCCAGATTATTGCGGTTTCAACTGTCAAAGAGGCTATTAAACTGGCGC TTACCGGGGTAAAAACGGAGACCGAAGATGTTTTTGAATGAAAAAGTAGGGGCAGTTATTGT AGCTGCCGGTCAGAGCCGCCGAATGGAGGGGCAGGACAAGATTTTTGCCCTTCTGGCGGGTA AACCTGTTTTGGCTCACACGCTTTCGGTTTTTCAAGAATCCCCGCAGGTAGATGATATTGCTC TGGTTATGGCAGAACACAATATTGAAAAAGCCAAAGAGCTGGTTAAGGAATATAATTTCAGC AAGGTTATAGCCATTTGCTCCGACGGGACACTCCGCCAGGACTCTGTCCACTCAGGGCTGTC AGCCCTGTGTGACTGCGGCTGGATACTCATTCATGACGGGGCGCGCCCCCTGCTTGAGCCTG ACTCTATACCCGAAGGGTTGGAAGCGGCTAAACTCTGCGGTTCGGCCATCGCGGCAGTACCC CTTAAAGATACCATTAAAGAAATATCCCCGGAAGGGCTGGTGGAAAAAACCCTGCCCAGAG AGAGGCTGATATCCGTCCAGACACCTCAGGTGTTTCGGGCAGATATTATCCAAAAAGCCTAC CAGCGGGTGGGTATAATCGCCACTGACGATGCCCAACTGGTAGAAAAACTGAAGCTCCCAGT CAGGATATTCTCCGGCGCATGTGCTAATATAAAGATAACCACACCTGAAGACCTGCTTATGG CAGAAATACTGCTGAAGAAAGGACGGTGAGCATAATGCGTATTGGAAACGGTTATGATGTCC ATCGTCTGGCACCGGGGCAGAAACTGGTGCTGGGCGGGGTGGAAATCCCCTTTGAATGCGGG CTTATCGGCTGGAGTGATGCAGATGTGCTTACCCATGCCATTATGGATTCGCTTCTGGGAGCG GCGGCACTGGGGGATATAGGACTCTACTTCCCGCCGGGAGACCCAAAGTACAAAGGCATATC TTCACTCAAACTTCTTGAACAGGTGACAGACTTGCTGGCTAAAAAAGGTTTTGGCATAATAA

ATGTAGATTCAGTTATAGTAGCGGAGGAACCAAAGCTACGCGGCCATATAGATACCATGCGC AAACACCTTGCCAAGGCCATGGGCATAGACCCCGGGCGGGTGGGGATTAAAGCCAGTACCT CGGAGCAACTCGGCTTTGTCGGCCGGCAGGAGGGAATGGTAGCTTGGGCGGTGGCCCTCGTA GATGAAAAATAGACTATGAAAATATATAACACTTTATCCGGCAAGCTGGAAAAATTCGTCCC TCTGGAAAACGGCAAAGTCAAAATGTATGTCTGCGGCATTACCCCGCAGTCAGAGCCGCATA TCGGCCACGCCATGAGCTATATAAACTTTGACGTAATCCGCCGCTACCTTACCTATAAAGGTT ATCGGGTAAAATATATCCAGAACTTTACCGATATAGATGATAAAATAATAGCCAAGGCCAAT GCCCAAGGCATAGAGCCGTCTACTCTGGCAGAGCGTAATATCGGGGTGTTTCTGGACGCCAT GGCTGCACTTAATATAACCCCGGCAGATTATTATCCCAGAGCCACTCAGGAAGTGCCCAAGA TAATAGAAATGGTCTCCGGCCTTATAGAAAAAGGCTATGCTTATGCGGTAGGCGGCAGTGTC TACCTGCGGGTGCAGAAGGTGGACGGTTACGGCAAACTGTCCCATCGTACTCTGGAGCAGAT GATGGCCGGTGCCCGGGTTGAAATTGATGAAGAAAAAGAATACCCCATGGATTTTGCCCTTT GGAAGGCCACCAAACCCGGCGAACCGTCTTGGGAAAGCCCTTGGGGACTGGGACGCCCCGG CTGGCATATTGAATGTTCTGCCATGTCTCTTCGTTATCTGGGCGAGCAGATAGATATACACGG CGGCGGGCAGGATCTTATATTCCCCCATCATGAAAATGAAATAGCCCAGTCCGAGTGCTTCA GCGGGGTCAAACCCTTTGTTAAGTACTGGCTGCACAACGGACTTTTAAAACTCGGCGAAGAG AAAATGAGCAAATCACTGGGCAATCTGGTTACTATAAAAGAAGCCCTCAGCAGTTACTCGGC AGATGCTCTGCGGATTTTTGTGCTCAGTTCCAGCTACCGTAATCCGCTTACTTACTCTGAAGA AGCTCTGGAAGCGGCTGAAAAAGGGGCGGAACGTCTGCGTCAGACAGCTGCCCGTAAGGAT AATCCCCAGTTTAAAGAAACCGCGGTGGATACCAAGGCATATCGTGAGCGTTTTACCCAGTA TATGGACAATGACTTTAATACTTCGGCTGCTCTGGCTACTATCTTTGACCTTAGCCGCGAATT AAACCGTATAGAGGGCGAGGCTGGTAAAAGCACTGACGGCCAAAAGCTATTTAAAGAACTG GCGGATATACTTGGACTTAGTCTGATAGTAGCAGAGTCCAAAACCGGTACAGACGTTGCTCC TTTTATAGAGCTGCTGATAGAACTCAGAAAAGACCTGCGGGTGGCAAAGCAGTACCAGCTGG CAGACAAAATCCGTACCAGTCTGGATACAGCCGGGATACTTCTGGAAGACTCTGCTGGTGGC ACTGTTTGGAAAGTAAAAAAATAAAATAACCGGGAAATTCAGGGTTAAATACTCGCCCTGTA TTTTTATTATAAAGCTAAAAAAAGTTGCACTTAGTGACCATTTATGATAGATTATCTATCTGT TGCTGGGGCCGTAGTTCACTTGGGAGAACGTTTGACTGGCAGTCAAAAGGTAGAGGGTTCGA ATCCCTCCGGCTCCACCAGGGCC

1.4 Contigs from T2P/CDCE clone #2 (7kb segment not fully sequenced) Contig #1

GGCCGCTTGACTTCAGTCTAATGGCCCCCACTGCCCGGGGAGCTTTGCTTTTTCATTCACTTG AAAGCAGAGCTCCWTTTTCCCTCTGATATTTAATTAAAAACAAGGCCCGTTAAGGGTCTTTTT TTATTTCAAAGCTAATGCCCCCTATTTGCCTTTACACTTTCTTTTTGGCTGAGCTATAATAAGA GTACTAACCGAGTGAAAGTAAAAAAATTATGTCTAGCAKATTTGATAWWTTTTCCGAAAGA GCGCGCCGGGTTCTTACCTATGCACARGAAGAAGCCCAGAGCCTTAACCATAACTACATCGG CACTGAGCATATACTGCTGGGGCTGGWGARARAARAAGAAGGCGTGGCCGCCCGGGTGCTG GTGAATATGGACGTAAACCTGGCCAAGGTACGTTCGGCTGTTGAATTTATACTGGGACGGGG TGAACACCCTGCTACCTCTGAAACCGGTCTTACCTCCAGAGCCAAAAAGGTAATCGAGCTGG GTATTGATGAAGCCAGAAATCTGGGCCATAACTACATTGGCACTGAGCATTTGCTTTTAGGC CTTCTGCGTGAAGGTGAAGGGGCGGCTGCCGGTGTGCTTGAGAGTTTTGGGGTTACAGTTGA AAAGGTGCGCACCGAAGTAGGGCGTATCTTGAATCAGGGTTTAAACAAACCTAAAACCAGC CGGACAACCCCCAGCCGAACCCCCCAGCTGGACCAGTTAKGTTTTGACCTGACGGCCGCAGC CAAGGCTGGTAAGCTTGACCCGGTTATCGGGCGTTCCAAAGAAATAGAACGGGTAGTCCAGA TTCTTTCCCGCCGTMCCAAAATAACCCTGCGCTTATAGGCGAACCTGGCGTAGGAAAAACCT

CCATTGTGGAGGGGCTGGCCCAGCGCATTGTTTCGGGTGACGTACCGGAAACTCTGGAACAG AAGCATATAATCTCACTGGACGTGGCCTCACTGGTGGCCGGTACCAAATACCGGGGTGAATT TGAGGAACGGCTTAAGAAGGTTATTGAGGAGATTAAAAATGCAGGAAACATAATCCTGTTTA TAGACGAATTCCACACCATGGTGGGAGCCGGTGCTGCCGAGGGGGCAGTAGATGCCGCCAA TATCCTCAAGCCTTCACTGGCCAGAGGTGAGGTGCAGGTTATCGGTGCGACCACTCTGGATG ATTTCCGTAAGTATGTTGAGCGTGATGCCGCACTTGAGAGACGCTTCCAGCCGGTACTGGTTG AAGAACCGGCCATAGAAGATACACTGAGCATTCTCAGGGGTATAAAAGAACGCTATGAGGA GCATCATAAGCTTATCATCAGCGATGAAGCTATTATCGCTGCTGCCAATATGGCTGCCAGAT ATATACCTGACCGCTTTTTGCCGGACAAGGCTATAGATTTGGTTGACGAAGCTGCATCACGG GTGCGGATAAAGAAACGCACCAAGCCGGTCTCTTTGAAAGAGATGAAAGCTATAGAAGACA GCTACCGCCGGGATAAAGAAGCCGCTCTGGCTACCCAGCAGTACGACTATGCTTCCGAACTC CGCGAGCGTGAGCTTCAGATAGCTGAAAAGATACGCCGCATGGAAGATGAATGGCAGACCG AACAGGCTATGGACAAGCCGGTGGTGGGCGAAGAAGATATTGCT

Contig #2

GATACCCAGACGCTGAGCGCGCATTTTTATCTGGGCGGGGTTCTCTTCCCCGGAAACATATAC CACTTTGCCGCCGCTCTGGGCTACCGAGGCAGCCACCTGAAGAAGGAGCGTGGATTTGCCGA TACCCGGTTCACCCCCTAAAAGCATCAGTGAACCCGGCACTATTCCACCGCCCAAAACCCGG TTGAACTCTGAAATAGATAGACTCCGGCGGGTAGTATCTGATGCATTCAGACTGGAAAGCTC GGCTGCCGGGCTGATAACCCGGGCAGGTGCATTTTTACGCCCGA

Contig #3

TTTACCGTACTATTATGATAGCCGCTGTTCTTTCCAAACGCCTTTCCATGCGGCTGGGTACCC AGGACATAATAGTAAATGCCACCGGCGGTATTCGTCTGGACGAGCCGGCCGCAGATTTGGCT ATTGCTTTGGCCATTGCCTCCAGTTACCGTGATATCGGGGTCTGCCCGGAAACCATAGCACTG GGTGAGATTGGCCTTTCAGGGGAACTGAGGACAATCCCTCATTTGGAAAGACGTCTTTCCGA GGCCAGCCGTTTGGGTTTTACGAGGGCTTTGGTACCTGCCGGTGCTAATTGCCAGAATATAA ATATAAATGGTATCCAGATTATTGCGGTTTCAACTGTCAAAGAGGCTATTAAACTGGCGCTTA CCGGGGTAAAAACGGAGACCGAAGATGTTTTTGAATGAAAAAGTAGGGGCAGTTATTGTAG CTGCCGGTCAGAGCCGCCGAATGGAGGGGCAGGACAAGATTTTTGCCCTTCTGGCGGGTAAA CCTGTTTTGGCTCACACGCTTTCGGTTTTTCAAGAATCCCCGCAGGTAGATGATATTGCTCTG GTTATGGCAGAACACAATATTGAAAAAGCCAAAGAGCTGGTTAAGGAATATAATTTCAGCA AGGTTATAGCCATTTGCTCCGGCGGGACACTCCGCCAGGACTCTGTCCGCTCAGGGCTGTCA GCCCTGTGTGACTGCGGCTGGATACTCATTCATGACGGGGCGCGCCCCCTGCTTGAGCCTGA CTCTATACCCGAAGGGTTGGAAGCGGCTAAACTCTGCGGTTCGGCCATCGCGGCAGTACCCC TTAAAGATACCATTAAAGAAATATCCCCGGAAGGGCTGGTGGAAAAAACCCTGCCCAGAGA GAGGCTGATATCCGTCSAGACACCTCAGGTGTTTCGGGCAGATATTATCCAAAAAGCCTA

Contig #4

TGACGATGCCCAACTGGTAGAAAAACTGAAGCTCCCAGTCAGGATATTCTCCGGCGCATGTG CTAATATAAAGATAACCACACCTGAAGACCTGCTTATGGCAGAAATACTGCTGAAGAAAGG ACGGTGAGCATAATGCGTATTGGAAACGGTTATGATGTCCATCGTCTGGCACCGGGGCAGAA ACTGGTGCTGGGCGGGGTGGAAATCCCCTTTGAATGCGGGCTTATCGGCTGGAGTGATGCAG ATGTGCTTACCCATGCCATTATGGATTCGCTTCTGGGAGCGGCGGCACTGGGGGATATAGGA CTCTACTTCCCGCCGGGAGACCCAAAGTACAAAGGCATATCTTCACTCAAACTTCTTGAACA

GGTGACAGACTTGCTGGCTAAAAAAGGTTTTGGCATAATAAATGTAGATTCAGTTATAGTAG CGGAGGAACCAAAGCTACGCGGCCATATAGATACCATGCGCAAACACCTTGCCAAGGCCAT GGGCATAGACCCCGGGCGGGTGGGGATTAAAGCCAGTACCTCGGAGCAACTCGGCTTTGTCG GCCGGCAGGAGGGAATGGTAGCTTGGGCGGTGGCCCTCGTAGATGAAAAATAGACTATGAA AATATATAACACTTTATCCGGCAAGCTGGAAAAATTCGTCCCTCTGGAAAACGGCAAAGTCA AAATGTATGTCTGCGGCATTACCCCGCAGTCAGAGCCGCATATCGGCCACGCCATGAGCTAT ATAAACTTTGACGTAATCCGCCGCTACCTTACCTATAAAGGTTATCGGGTAAAATATATCCAG AACTTTACCGATATAGATGATAAAATAATAGCCAAGGCCAATGCCCAAGGCATAGAGCCGTC TACTCTGGCAGAGCGTAATATCGGGGTGTTTCTGGACGCCATGGCTGCACTTAATATAACCCC GGCAGATTATTATCCCAGAGCCACTCAGGAAGTGCCCAAGATAATAGAAATGGTCTCCGGCC TTATAGAAAAAGGCTATGCTTATGCGGTAGGCGGCAGTGTCTACCTGCGGGTGCAGAAGGTG GACGGTTACGGCAAACTGTCCCATCGTACTCTGGAGCAGATGATGGCCGGTGCCCGGGTTGA AATTGATGAAGAAAAAGAATACCCCATGGATTTTGCCCTTTGGAAGGCCACCAAACCCGGCG AACCGTCTTGGGAAAGCCCTTGGGGACTGGGACGCCCCGGCTGGCATATTGAATGTTCTGCC ATGTCTCTTCGTTATCTGGGCGAGCAGATAGATATACACGGCGGCGGGCAGGATCTTATATT CCCCCATCATGAAAATGAAATAGCCCAGTCCGAGTGCTTCAGCGGGGTCAAACCCTTTGTTA AGTACTGGCTGCACAACGGACTTTTAAAACTCGGCGAAGAGAAAATGAGCAAATCACTGGG CAATCTGGTTACTATAAAAGAAGCCCTCAGCCGTTACTCGGCAGATGCTCTGCGGATTTTTGT GCTCAGTTCCAGCTACCGTAATCCGCTTACTTACTCTGAAGAAGCTCTGGAAGCGGCTGAAA AAGGGGCGGAACGTCTGCGTCAGACAGCTGCCCGTAAGGATAATCCCCAGTTTAAAGAAAC CGCGGTGGATACCAAGGCATATCGTGAGCGTTTTACCCAGTATATGGACAATGACTTTAATA CTTCGGCTGCTCTGGCTACTATCTTTGACCTTAGCCGCGAATTAAACCGTATAGAGGGCGAGG CTGGTAAAAGCACTGACGGCCAAAAGCTATTTAAAGAACTGGCGGATATACTTGGACTTAGT CTGATAGTAGCAGAGTCCAAAACCGGTACAGACGTTGCTCCTTTTATAGAGCTGCTGATAGA ACTCAGAAAAGACCTGCGGGTGGCAAAGCAGTACCAGCTGGCAAACAAAATCCGTACCAGT CTGGATACAGCCGGGATACTTCTGGAAGACTCTGCTGGTGGCACTGTTTGGAAAGTAAAAAA ATAAAATAACCGGGAAATTCAGGGTTAAATACTCGCCCTGTATTTTTATTATAAAGCTAAAA AAAGTTGCACTTAGTGACCATTTATGATAGATTATCTATCTGTTGCTGGGGCCGTAGTTCACT TGGGAGAACGTTTGACTGGCAGTCAAAAGGTAGAGGGTTCGAATCCCTCCGGCTCCACCAGG

1.5 Contigs from T4P/TCA (7kb not fully sequenced) Contig #1

CCCCGTCACCCCATTGGCAACTTTGTTTTCCTTGGACCTACCGGCGTGGGTAAAACCGAATTG GCACGGGCGCTTGCCCAGTTTATGTTCGGTTCGGAAGACTCTTTGGTTCGGCTGGATATGTCC GAATTTATGGAAAAATTCGCTGTATCCCGTCTGGTGGGTGCACCCCCCGGATATGTGGGCTAT GATGAGGGCGGCCAGCTGACGGAAGCTGTTCGCCGCAAGTCATATTGCCTGATACTGCTGGA CGAAATAGAAAAAGCTCATCCTGACGTTTTTAATATTCTCCTTCAGATATTTGATGACGGCCA CCTGACAGATGCCAAGGGCAGGCGGGTGGACTTCAGGAATACCATTATCATCATGACCTCAA ACATTGGGGCTGAACTTATCCGCAAGGGTAGCGGGACTATCGGATTTGCCACTCAGACAGAC GAATCAAAGGCCCAGCAGACCAATTTTGAGCACATGAAAGACAAGCTGCTGGGTGAGCTTA AAAAGAGTTTCCGTCCGGAGTTTTTAAACCGTATTGACAGTGTGGTGGTCTTCCACTCGCTAA ATAAAGAGCAGATTCGCAGTATTGTTGACCTGATGCTCAAGAGTGTGGTCAAGCAGATGGCT GAAAAGGGCATCGGGCTTGAGGTGACCGAATCTGCTAAGGACTTGCTGGGCAAGAAGGGTT ATGATGAGGTTTATGGTGCCAGGCCTCTGCGCCGCACTATCCAGACCATGATAGAAGACCGC TTGTCTGAAGACTTGCTGCGGGCTAAATTTAAAGCCGGGGATAAAGTAATAGTGGATACTGC CGAAGACGAAATAATTGTCCGGCTGGCCGAACCGGCTGAGCTTAGTCAGGCTACTCCTTAAG

GGCGGGTACCGGTAACGGATTAGTTTAAGGGGAGTTTTAAGACTCCCCTTTTTGTTTAGGGTA AAATAAAAATGATTAGCTGGGTAAGCCTGTCCTGCCGGGTAAGTAGCAAACGCTGGTTTGTC CGTTAAGCGAAGAGCTAAAAAACAAACTCCGAAATAGTTTACTCCTTATGGGGTGGGCATAG GGGTTACTGTCAGCCTTAGCCTGACGCATGGGCTTATGCTGCCTGCCAGCCTTTGAAAGCGGT CCGCCTATTACCTTTTGCGGGGGGGGTGCTGGCAGCGCCTAGGCAGAGCTTTTACCGGGCGG CATATTTTATCAAGGCGGTTGTCTGGCAGTAATCCTTTTTTACAAAGTGTATATTCGCCGGAA TATCTGAGGTAAACTAAGGGGCAGGTACGCCCTTGCTTTAGCGGATTAAATTGTGTAAAGTC TTCTGTATATGGATAAAAGCCGTAATGTTTATATCTGTTCCAACTGCGGACATGAGAGCCTGA AGTGGCTGGGGCGTTGCCCCGGCTGTCAGGAATGGAATACTCTTGAAGAAACAACAATTGCT GCACCTCTCGGGCGTAAAAATGCACCTGCCCGGGTTATCAGCCCGGCAGCCGAGCTTTCCAG TCTGAATGCATCAGATACTACCCGCCGGAGTCTATCTATTTCAGAGTTCAACCGGGTTTTGGG CGGTGGAATAGTGCCGGGTTCACTGATGCTTTTAGGGGGTGAACCGGGTATCGGCAAATCCA CGCTCCTTCTTCAGGTGGCTGCCTCGGTAGCCCAGAGCGGCGGCAAAGTGGTATATGTTTCCG GGGAAGAGAACCCCGCCCAGATAAAAATGCGCGCTCAGCGTCTGGGTATCAGCGGCGAGGG GCTTTTCCTTATGGCTGAGACAGACCTTAATGCCATTCTAGCCCAGCTTTCAGTCCTCTGCCC GTCATTGGTTGTTATAGACTCTATCCAGACTGTATTCCTGCCTGAGCTTGAGGCCGCACCCGG TGCTATAAATCAGGTGCGTGAATCAGCCCTCCGCCTGATGCAGTGGGCTAAGAACAGCGGTG CCAGCGTATTTATTGCCGCCCATGTTACCAAAGAGGGCAACATCGCCGGGCCGCGCATACTG GAACATATAGTAGATGTGGTCATGTACTTTGAGGGCGAGTCCCAGAGTGCTTACCGTTTGAT ACGTTCGGTCAAAAACCGCTTCGGTTCTACCAACGAAGTAGGCATATTTGAAATGAAAAGTG AAGGATTGGTGGAAGTAGCCAATCCCTCGCAGATATTTTTATCTAATCGGCAGGCAAACACT GTTGGTTCAGCTGTAACAGCAGTGCTGGAGGGTAGCCGCCCTTTACTGGTAGAGGTGCAGGC ACTCACCAATACCACCAGTTTCGGCCAGCCGCGCCGCACGGCCAACGGGGTAGATTTTAACC GTACTATTATGATAGCCGCTGTTCTTTCCAAACGCCTTTCCATGCGGCTGGGTACCCAGGACA TAATAGTAAATGCCACCGGCGGTATTCGTCTGGACGAGCCGGCCGCAGATTTGGCTATTGCT TTGGCCATTGCCTCCAGTTACCGTGATATCGGGGTCTGCCCGGAAACCATAGCACTGGGTGA GATTGGCCTTTCAGGGGAACTGAGGACAATCCCTCATTTGGAAAGACGTCTTTCCGAGGCCA GCCGTTTGGGTTTTACGAGGGCTTTGGTACCTGCCGGTGCTAATTGCCAGAATATAAATATAA ATGGTATCCAGATTATTGCGGTTTCAACTGTCAAAGAGGCTATTAAACTGGCGCTTACCGGG GTAAAAACGGAGACCGAAGATGTTTTTGAATGAAAAAGTAGGGGCAGTTATTGTAGCTGCCG GTCAGAGCCGCCGAATGGAGGGGCAGGACAAGATTTTTGCCCTTCTGGCGGGTAAACCTGTT TTGGCTCACACGCTTTCGGTTTTTCAAGAATCCCCGCAGGTAGATGATATTGCTCTGGTTATG GCAGAACACAATATTGAAAAAGCCAAAGAGCTGGTTAAGGAATATAATTTCAGCAAGGTTA TAGCCATTTGCTCCGGCGGGACACTCCGCCAGGACTCTGTCCGCTCAGGGCTGTCAGCCCTGT GTGACTGCGGCTGGATACTCATTCATGACGGGGCGCGCCCCCTGCTTGAGCCTGACTCTATAC CCGAAGGGTTGGAAGCGGCTAAACTCTGCGGTTCGGCCATCGCGGCAGTACCCCTTAAAGAT ACCATTAAAGAAATATCCCCGGAAGGGCTGGTGGAAAAAACCCTGCCCAGAGAGAGGCTGA TATCCGTCCAGACACCTCAGGTGTTTCGGGCAGATATTATCCAAAAAGCCTACCAGCGGGTG GGTATAATCGCCACTGACGATGCCCAACTGGTAGAAAAACTGAAGCTCCCAGTCAGGATATT CTCCGGCGCATGTGCTAATATAAAGATAACCACACCTGAAGACCTGCTTATGGCAGAAATAC TGCTGAAGAAAGGACGGTGAGCATAATGCGTATTGGAAACGGTTATGATGTCCATCGTCTGG CACCGGGGCAGAAACTGGTGCTGGGCGGGGTGGAAATCCCCTTTGAATGCGGGCTTATCGGC TGGAGTGATGCAGATGTGCTTACCCATGCCATTATGGATTCGCTTCTGGGAGCGGCGGCACT GGGGGATATAGGACTCTACTTCCCGCCGGGAGACCCAAAGTACAANGGCATATCTTCACTCA AACTTCTTGAACAGGTGACAG

Contig #2

TCGGCCGGCAGGAGGGATGGTAGCTTGGGCGGTGGCCCTCGTAGATGAAAAATAGACTATG AAAATATATAACACTTTATCCGGCAAGCTGGAAAAATTCGTCCCTCTGGAAAACGGCAAAGT CAAAATGTATGTCTGCGGCATTACCCCGCAGTCAGAGCCGCATATCGGCCACGCCATGAGCT ATATAAACTTTGACGTAATCCGCCGCTACCTTACCTATAAAGGTTATCGGGTAAAATATATCC AGAACTTTACCGATATAGATGATAAAATAATAGCCAAGGCCAATGCCCAAGGCATAGAGCC GTCTACTCTGGCAGAGCGTAATATCGGGGTGTTTCTGGACGCCATGGCTGCACTTAATATAAC CCCGGCAGATTATTATCCCAGAGCCACTCAGGAAGTGCCCAAGATAATAGAAATGGTCTCCG GCCTTATAGAAAAAGGCTATGCTTATGCGGTAGGCGGCAGTGTCTACCTGCGGGTGCAGAAG GTGGACGGTTACGGCAAACTGTCCCATCGTACTCTGGAGCAGATGATGGCCGGTGCCCGGGT TGAAATTGATGAAGAAAAAGAATACCCCATGGATTTTGCCCTTTGGAAGGCCACCAAACCCG GCGAACCGTCTTGGGAAAGCCCTTGGGGACTGGGACGCCCTGGCTGGCATATTGAATGTTCT GCCATGTCTCTTCGTTATCTGGGCGAGCAGATAGATATACACGGCGGCGGGCAGGATCTTAT ATTCCCCCATCATGAAAATGAAATAGCCCAGTCCGAGTGCTTCAGCGGGGTCAAACCCTTTG TTAAGTACTGGCTGCACAACGGACTTTTAAAACTCGGCGAAGAGAAAATGAGCAAATCACTG GGCAATCTGGTTACTATAAAAGAAGCCCTCAGCCGTTACTCGGCAGATGCTCTGCGGATTTTT GTGCTCAGTTCCAGCTACCGTAATCCGCTTACTTACTCTGAAGAAGCTCTGGAAGCGGCTGA AAAAGGGGCGGAACGTCTGCGTCAGACAGCTGCCCGTAAGGATAATCCCCAGTTTAAAGAA ACCGCGGTGGATACCAAGGCATATCGTGAGCGTTTTACCCAGTATATGGACAATGACTTTAA TACTTCGGCTGCTCTGGCTACTATCTTTGACCTTAGCCGCGAATTAAACCGTATAGAGGGCGA GGCTGGTAAAAGCACTGACGGCCAAAAGCTATTTAAAGAACTGGCGGATATACTTGGACTTA GTCTGATAGTAGCAGAGTCCAAAACCGGTACAGACGTTGCTCCTTTTATAGAGCTGCTGATA GAACTCAGAAAAGACCTGCGGGTGGCAAAGCAGTACCAGCTGGCAGACAAAATCCGTACCA GTCTGGATACAGCCGGGATACTTCTGGAAGACTCTGCTGGTGGCACTGTTTGGAAAGTAAAA AAATAAAATAACCGGGAAATTCAGGGTTAAATACTCGCCCTGTATTTTTATTATAAAGCTAA AAAAAGTTGCACTTAGTGACCATTTATGATAGATTATCTATCTGTTGCTGGGGCCGTAGTTCA CTTGGGAGAACGTTTGACTGGCAGTCAAAAGGTAGAGGGTTCGAATCCCTCCGGCTCCACCA GG