Genetic Investigation of Chromosome 5Q GABAA Receptor Subunit Genes

Genetic investigation of chromosome 5q GABAA receptor subunit genes in schizophrenia TL Petryshen1,2, FA Middleton3,4,5, AR Tahl1, GN Rockwell1, S Purcell2, KA Aldinger1, A Kirby6, CP Morley3,4, L McGann5, KL Gentile5, SG Waggoner1, HM Medeiros3,7, C Carvalho3, A Macedo8, M Albus9, W Maier10, M Trixler11, P Eichhammer12, SG Schwab13,14, DB Wildenauer14, MH Azevedo8, MT Pato3,4,7,15, CN Pato3,4,7,15, MJ Daly1,6 and P Sklar1,2 1Program in Medical and Population Genetics, Broad Institute of Harvard and Massachusetts Institute of Technology, Cambridge, MA, USA; 2Psychiatric and Neurodevelopmental Genetics Unit, Center for Human Genetics Research, and Department of Psychiatry, Harvard Medical School, Massachusetts General Hospital, Boston, MA, USA; 3Center for Neuropsychiatric Genetics, State University of New York (SUNY), Syracuse, NY, USA; 4Department of Psychiatry, State University of New York (SUNY), Syracuse, NY, USA; 5Department of Neuroscience and Physiology, State University of New York (SUNY), Syracuse, NY, USA; 6Center for Human Genetic Research, Massachusetts General Hospital, Boston, MA, USA; 7Department of Psychiatry, Georgetown University, Washington DC, USA; 8Psicologia Medica, Universidade de Coimbra, Coimbra, Portugal; 9Mental State Hospital, Haar, Germany; 10Department of Psychiatry, University of Bonn, Bonn, Germany; 11Department of Psychiatry, University Medical School of Pe´cs, Pe´cs, Hungary; 12Department of Psychiatry, University of Regensburg, Regensburg, Germany; 13Western Australian Institute for Medical Research and Centre for Medical Research, University of Western Australia, Crawley, WA, Australia; 14School of Psychiatry and Clinical Neurosciences, University of Western Australia, Crawley, WA, Australia; 15Veterans Administration Medical Center, Washington, DC, USA

We previously performed a genome-wide linkage scan in Portuguese schizophrenia families that identified a risk locus on chromosome 5q31–q35. This finding was supported by meta- analysis of 20 other schizophrenia genome-wide scans that identified 5q23.2–q34 as the second most compelling susceptibility locus in the genome. In the present report, we took a two-stage candidate gene association approach to investigate a group of gamma-aminobutyric acid (GABA) A receptor subunit genes (GABRA1, GABRA6, GABRB2, GABRG2, and GABRP) within our linkage peak. These genes are plausible candidates based on prior evidence for GABA system involvement in schizophrenia. In the first stage, associations were detected in a Portuguese patient sample with single nucleotide polymorphisms (SNPs) and haplotypes in GABRA1 (P ¼ 0.00062–0.048), GABRP (P ¼ 0.0024–0.042), and GABRA6 (P ¼ 0.0065–0.0088). The GABRA1 and GABRP findings were replicated in the second stage in an independent German family-based sample (P ¼ 0.0015–0.043). Supportive evidence for association was also obtained for a previously reported GABRB2 risk haplotype. Exploratory analyses of the effects of associated GABRA1 haplotypes on transcript levels found altered expression of GABRA6 and coexpressed genes of GABRA1 and GABRB2. Comparison of transcript levels in schizophrenia patients and unaffected siblings found lower patient expression of GABRA6 and coexpressed genes of GABRA1. Interestingly, the GABRA1 coexpressed genes include synaptic and vesicle-associated genes previously found altered in schizophrenia prefrontal

cortex. Taken together, these results support the involvement of the chromosome 5q GABAA receptor gene cluster in schizophrenia, and suggest that schizophrenia-associated haplotypes may alter expression of GABA-related genes. Molecular Psychiatry (2005) 10, 1074–1088. doi:10.1038/sj.mp.4001739; published online 20 September 2005 Keywords: linkage disequilibrium; haplotypes; single nucleotide polymorphisms; oligonucleotide array sequence analysis; gene expression

Introduction Schizophrenia is a complex psychiatric disorder with Correspondence: Dr P Sklar, Psychiatric and Neurodevelopmental a strong genetic component.1,2 Nearly 40 independent Genetics Unit, Center for Human Genetic Research, 185 Cambridge genome-wide linkage scans of schizophrenia have Street, 6th Floor, Boston, MA 02114, USA. 3–37 E-mail: [email protected] been conducted to date. Meta-analysis of 20 of Received 2 May 2005; revised 11 July 2005; accepted 19 July 2005; these scans identified chromosome 5q23.2–q34 from published online 20 September 2005 D5S2098 to D5S422 (123.8–162.1 Mb; National Center 5q GABAA receptor genes confer schizophrenia risk TL Petryshen et al 1075 for Biotechnology Information (NCBI) Build 35 hu- receptor subunit transcripts,66 while dysbindin likely man genome assembly) as the second most significant colocalizes with GABAA receptor subunits in the risk locus in the genome.38 Subsequently, we reported hippocampus, cortex, and cerebellum through its linkage to an overlapping region at chromosome association with beta-dystrobrevin in the dystrophin 5q31.1–q35.1 in a genome-wide scan of schizophrenia protein complex.67–69 Despite the evidence for GABA and schizoaffective depressed type (SA-D) families of system alterations in schizophrenia patients, there Portuguese descent.32 The maximum linkage signal in has been little investigation of association between 29 families was an NPL ¼ 3.09 (P ¼ 0.0012) at marker GABA receptor genes and schizophrenia, although D5S820, falling just short of genome-wide signifi- association with the GABRB2 gene was recently cance based on simulations of the data.32 Higher reported in a Chinese patient sample.70 density mapping in an expanded sample of 40 We performed an association study of the 5q pedigrees produced a peak NPL ¼ 3.28 (P ¼ 0.00066) GABAA receptor subunit gene cluster in schizophre- in the same region. Nominally significant linkage was nia based on: (1) strong meta-analytic evidence for obtained across a B35 cM region from D5S816 to linkage between schizophrenia and chromosome 5q, D5S1456 located from 135.3 to 169 Mb. Although the (2) linkage to 5q in our Portuguese schizophrenia 5q risk locus is large, the strength and consistency of families, (3) evidence for involvement of the GABA the linkage findings warrants candidate gene associa- system in schizophrenia, and (4) location of the tion studies to identify the underlying schizophrenia GABAA receptor subunit gene cluster in the 5q risk risk gene. locus. To increase the chance of detecting association, The chromosome 5q risk locus contains a cluster of we screened a Portuguese patient sample that was gamma-aminobutyric acid (GABA) A receptor subunit ascertained in the same manner as the Portuguese genes, GABRB2, GABRA6, GABRA1, and GABRG2, family sample, which demonstrated linkage to 5q. which are grouped within an 860-kb region at 5q34 Positive associations were followed up in an inde- that is B4 Mb telomeric to our peak at D5S820. A fifth pendent sample of German patients. We subsequently

GABAA receptor subunit gene, GABRP, is located explored whether GABAA receptor subunit gene B12 Mb telomeric to our peak at the boundary of our haplotypes that were found to be associated with linkage region, which nevertheless could be within schizophrenia were related to altered transcript levels range to produce this linkage signal. As reviewed by of the GABAA genes and groups of GABA-related 39 Steiger and Russek, the GABAA receptor is a genes. We also tested for disease-related expression neuronal ligand-gated ion channel that is the major differences in schizophrenia patients compared to inhibitory receptor in the adult brain via its function their unaffected siblings. Our findings provide evi- in triggering chloride ion influx, resulting in cell dence for associations between schizophrenia and the hyperpolarization. Numerous receptor subunits have GABRA1, GABRP, and GABRB2 genes, and suggest been identified and each displays different temporal relationships between disease-associated haplotypes and spatial patterns of expression. The subunits and transcript expression, as well as disease-specific assemble into pentamers, typically of two alpha, two transcript alterations. beta, and one gamma subunit. The most widely expressed GABAA receptor in the adult brain is composed of alpha 1, beta 2, and gamma 2 subunits, Materials and methods encoded by GABRA1, GABRB2, and GABRG2, respec- Subjects tively. These three genes are all located in the 5q Characteristics of the samples utilized in the current GABAA receptor subunit gene cluster. The cluster also study are provided in Table 1. contains GABRA6 that encodes the alpha 6 subunit expressed in granule cells of the cerebellum and the Portuguese-descent association and microarray mRNA cochlea.40 The pi subunit encoded by GABRP, which expression samples The subjects utilized in our influences drug effects on the receptor,41 has been association analyses and microarray expression detected in the hippocampus and temporal cortex, as analyses originated from continental Portugal and the well as several peripheral tissues.42 islands of the Azores and Madeira, and have been The 5q GABA genes are plausible candidates for the previously described.32 Unrelated patients and control schizophrenia risk gene in the 5q locus based on a individuals were also ascertained from the Azorean converging body of literature implicating GABA immigrant population of Fall River, USA, and were system dysfunction in schizophrenia pathophysiol- confirmed to have all four grandparents from the ogy.43–49 In schizophrenia patient brain samples, Azores, Madeira, or continental Portugal. Controls markers of GABAergic neurons are reduced in consisted of unrelated individuals ascertained expression and postsynaptic receptor complexes are through a brochure left in community facilities (eg increased in number.47,50,51 Furthermore, there is churches, community centers, doctor’s offices, large evidence that neuregulin 1 (NRG1) and dysbindin employers) and four unaffected individuals that (DTNBP1), two schizophrenia candidate risk married into our linkage pedigrees.32 Best estimate 33,52–65 genes, interact with the GABAA receptor. For diagnoses of schizophrenia or SA-D according to DSM- example, treatment of the rat hippocampus with IV criteria were made by two blinded researchers after

NRG1 resulted in lower expression of GABAA review of clinical information, Diagnostic Interview

Molecular Psychiatry 5q GABAA receptor genes confer schizophrenia risk TL Petryshen et al 1076 Table 1 Characteristics of samples used in association and microarray expression analyses

Sample No. of individuals Gender (male : female) Diagnosis

Association Portuguese 111 parent–proband trios 79M : 32F probands 111 schizophrenia probands 321 cases 189M : 132F 321 schizophrenia 242 controls 90M : 148 — German 238 parent-proband trios 141M : 90F probands 228 schizophrenia, 10 SA-D probands Expression 66 (33 discordant sibpairs) 11M : 22F sibpairs 32 schizophrenia, 1 SA-D affected sibs

Gender data missing for four Portuguese control individuals and seven German probands.

for Genetic Studies (DIGS),71 Operational Criteria (N ¼ 228) or SA-D (N ¼ 10). The study received Checklist for Psychotic Illness (OPCRIT),72 and approval by all appropriate Institutional Review written narratives. The study received approval by Boards and subjects provided informed consent. all appropriate Institutional Review Boards and subjects provided informed consent. Genotyping Our first-stage association sample consisted of Single nucleotide polymorphisms (SNPs) spanning Portuguese-descent parent–proband trios (N ¼ 111; the 5q GABA receptor subunit genes were 30% continental Portugal, 55% Azores, 15% Ma- A selected from the NCBI dbSNP database (http:// diera), unrelated cases (N ¼ 321; 38% continental www.ncbi.nlm.nih.gov/SNP/), the Celera Discovery Portugal, 45% Azores, 17% Madiera), and control System database (http://www.celeradiscoverysys- individuals (N ¼ 242; 12% continental Portugal, 85% tem.com/), and the International HapMap Project Azores, 3% Madiera). All trio probands and cases (http://hapmap.org/). We also genotyped five were diagnosed with schizophrenia. In all, 12 parent– GABRB2 SNPs previously reported to be associated proband trios and six cases were also present in our with schizophrenia in Chinese patients70 (rs187269, previously reported linkage pedigrees.32 We used the rs252944, rs194072, rs1816071, and rs6556547; note Genetic Power Calculator73 to determine that the trios that rs6556547 in the current study is B217G1584 in sample had 28 and 44% power, and the case–control the previous report). SNP genomic positions were sample had 58 and 81% power, to detect a risk allele according to the NCBI Build 35 human genome with 10% frequency and 20% frequency, respectively, assembly (http://www.ncbi.nlm.nih.gov/genome/ with a multiplicative genotype relative risk of 1.5. guide/human/). Genotyping was performed by mass Given the modest power of the separate samples, spectrometry as described previously78 using ampli- association results for the parent–proband trios and fication and extension primers designed by Spectro- for the unrelated cases and controls were combined Designer software (Sequenom, La Jolla, CA, USA). (described below), as the collective sample had 75 Only genotype data for those SNPs that met the and 92% power under the same assumptions. Tests following quality control standards were further for stratification74 using B60% of the collective analyzed: (1) 485% of attempted genotypes were sample (94 trios, 152 cases, and 149 controls) and successful (mean ¼ 95.7% in Portuguese sample; 46 unlinked markers did not detect population mean ¼ 97.8% in German sample), (2) parental alleles substructure between the trios and case–control were in Hardy–Weinberg equilibrium, (3) 1% of samples, nor between the cases and controls (75 and o chromosomes transmitted from parents to probands data not shown). had Mendelian inheritance errors, (4) 42% minor The Portuguese microarray mRNA expression sam- allele frequency. Marker rs1037715 was genotyped in ple has been described previously.59 Briefly, the triplicate in the Portuguese sample using different sample consisted of primary leukocyte cell prepara- amplification and extension primers for each assay, tions from 33 age- and gender-matched sibling pairs and the concordance rate between assays was 98.5%. (22 female, 11 male pairs; 32 schizophrenia and one SNP primer sequences are available in Supplemen- SA-D discordant pairs) selected from our linkage tary Table 1. pedigrees.32 Of the 33 sibpairs, 32 sibpairs were also genotyped for the same set of markers as the association sample. Of these individuals, 17 were Linkage disequilibrium and association analysis cases in our association sample. methods The Haploview program79 was used to determine German association sample Our second-stage linkage disequilibrium (LD) between pairs of markers association sample consisted of parent–proband by calculation of the D0 statistic,80 which ranges from trios (N ¼ 238) from Germany and Hungary, and D0 ¼ 0 (complete recombination) to D0 ¼ 1.0 (no re- have been previously described.76 Probands met combination). Haplotype blocks (regions of minimal Research Diagnostic Criteria77 for schizophrenia historical recombination that contain only a few

Molecular Psychiatry 5q GABAA receptor genes confer schizophrenia risk TL Petryshen et al 1077 common haplotypes) were defined as previously Microarray mRNA expression methods described.81 LD between haplotype blocks was deter- As described previously,59 total RNA was extracted mined by the Haploview program, which considers from blood leukocyte cell preparations from discor- haplotypes within blocks as alleles of a multiallelic dant sibpairs selected from our Portuguese linkage marker using Hedrick’s multiallelic extension to the pedigrees.32 Microarray samples were labeled and D0 statistic.82 Maximum-likelihood expectation (MLE) processed according to standard protocols, hybri- haplotypes within each haplotype block were recon- dized to the Human Genome U133A GeneChips structed using an expectation maximization algo- (Affymetrix), washed and stained on the Fluidics rithm.83 Station (Affymetrix) according to the EukGE-WS2 Association analyses were performed using a protocol, and scanned using the Agilent G2500A narrow phenotype that included schizophrenia and Gene Array Scanner. Scans were subjected to a priori SA-D, which we refer to collectively as ‘schizophre- quality control criteria and matching criteria to obtain nia’. Single markers and MLE haplotypes were tested 33 high-quality matched sibpairs for expression for association with schizophrenia by the transmis- analyses. The scan files were normalized to a median sion disequilibrium test (TDT)84 for parent–proband intensity value of 500 using Affymetrix MicroArray trios, and by w2 test for the unrelated cases and Suite 5.0. Normalized expression data for the 5q controls. Note that the trio probands were not used as GABAA receptor subunit genes and GABA gene sets cases in the case–control analyses, thus the trios and reported in this study are available in Supplementary case–control samples did not overlap. Since the Table 2. power of each sample was not high to detect associations with lower frequency alleles, the results Validation of microarray data by real-time quantitative for the trios sample and the case–control sample were PCR combined. This was carried out by reformatting the Microarray expression levels of the discordant sibpair TDT results and w2 results as a mean, observed, and expression sample used in the current study have variance on the number of risk alleles transmitted in previously been successfully validated for five tran- the trios or found in the unrelated cases. A combined scripts of interest and two reference genes using real- standard normal Z-score was calculated, where the time quantitative RT-PCR.59,87 In those studies, the sum of the deviations from expected frequencies fold changes reported by the microarray and RT-PCR (under the null hypothesis of no association) of each methods for the seven genes were highly correlated sample was divided by the sum of the variances of (r ¼ 0.95) based on triplicate assays for 19 sibpairs that each sample, as previously described.59,85 Nominal had sufficient RNA for both procedures. In light of significance levels were obtained from the Z distribu- this previous work, and due to the limited amount of tion. This approach provided SNP allele- or haplo- RNA available for validation in only a subset of the type-specific nominal significance levels. Odds ratios sample, we did not perform additional validation (OR) were computed using the method of Morris and efforts in the present study. Gardner,86 with the logit method used to calculate the OR of the combined Portuguese trios and case–control Microarray expression data analysis sample. Associations that surpassed a nominal two-tailed Linear regression analysis of GABA transcript Po0.05 in our Portuguese sample were subsequently expression We tested whether two GABRA1 examined in an independent German sample. Single haplotypes, Hap10A and Hap10B, that had evidence markers and MLE haplotypes were tested for associa- for association with schizophrenia in both our tion to schizophrenia by the TDT.84 One-tailed P- Portuguese and German association samples had an values, indicated by (*), are reported for the German effect on transcript expression levels of the 5q GABAA sample for all alleles and haplotypes that were receptor subunit genes. Haplotypes were determined associated in the same manner as in the Portuguese for each individual from 32 of the 33 discordant sample (eg, higher frequency in Portuguese patients schizophrenia sibpairs for which we had expression and overtransmitted to German trio probands). We data. The observed frequencies of the tested considered an allele or haplotype to be replicated in haplotypes were as follows: GABRA1 Hap10A: 17% the German sample only if the association was in the þ / þ , 52% þ /À, 31% À/À; and GABRA1 Hap10B: same manner with a one-tailed Po0.05*. This two- 0% þ / þ , 37% þ /À, 63% À/À. GABRP Hap18D, stage approach has the advantage that it is not overly which also had evidence for association in both punitive in the first stage, but relies on replication in patient samples, was not tested because the a second sample for support of association. Relative haplotype frequency was too low to be informative risks were computed as the ratio of the number of for these analyses. Expression data were linearly transmissions to the number of nontransmissions, as regressed on genotypes regardless of schizophrenia determined by the TDT. One-tailed P-values are also diagnosis (ie, the effect of a particular haplotype was reported for the Portuguese and German samples for investigated in the schizophrenia and unaffected GABRB2 alleles and haplotypes that supported siblings together). We only tested for haplotype schizophrenia association results previously reported effects on expression of the five 5q GABAA receptor in a Chinese study.70 subunit genes, GABRA1, GABRA6, GABRB2,

Molecular Psychiatry 5q GABAA receptor genes confer schizophrenia risk TL Petryshen et al 1078 GABRG2, and GABRP. We utilized the standard genetic effects of the associated haplotypes: Hap þ / þ biometrical model88 with additive effect only. For vs À/À (similar to an additive model but excluding GABRA1 Hap10A, we also tested an additive þ Hap þ /À individuals), Hap þ / þ vs þ /À and À/À dominant model, since all three genetic classes were (recessive model), or Hap þ / þ and þ /À vs À/À observed in the sample. Thus, a total of 15 tests were (dominant model). Note that only the Hap þ /À vs performed (five transcripts Â three genetic models HapÀ/À model could be tested for GABRA1 Hap10B, (Hap10A: two models þ Hap10B: one model)). since the corresponding Hap þ / þ homozygous Significance of each model was assessed by F-test, classes were not observed in the sample. We and the additive and additive þ dominant models for performed a total of 80 tests for haplotype effects on Hap10A were compared by ANOVA to determine if gene set expression (20 GABA gene sets Â four genetic there was a significant dominance component. models (Hap10A: three models þ Hap10B: one mod- Nominal P-values are reported. el)). GSEA was also performed to compare the schizophrenia and unaffected siblings (regardless of Gene Set Enrichment Analysis of GABA gene sets We the presence of particular haplotypes) for differences used the Gene Set Enrichment Analysis (GSEA) in expression of the 20 GABA gene sets. method89 to test whether two haplotypes that were associated with schizophrenia (GABRA1 Hap10A and Analysis of schizophrenia and unaffected sibling GABRA1 Hap10B) were also associated with pairs Scheffe’s tests were performed to identify coordinate alterations in expression of related genes. expression differences between schizophrenia and Details of the analysis are provided in Supplementary unaffected siblings in transcripts of the 5q GABAA Table 3. Briefly, for a given pairwise comparison receptor subunit genes. A paired design was utilized (eg Hap10A þ / þ vs Hap10AÀ/À), we determined in which expression differences within each sibpair whether the expression of a related set of genes (the were calculated and subsequently averaged across all ‘gene set’) was coordinately altered (ie, either up- or sibpairs. down-regulated) in one haplotype group compared to the other. To determine nominal significance levels Results adjusted for the number of genes on the microarray included in the analyses, the category labels of the Association between schizophrenia and 5q GABAA samples (eg Hap10A þ / þ or Hap10AÀ/À) were receptor subunit genes randomly permuted 10 000 times, and the observed To test for association with schizophrenia, 132 SNPs B result was compared with the permutation results. To spanning the coding regions and 10 kb of flanking interpret the results with respect to the number of sequence of GABRB2, GABRA6, GABRA1, GABRG2, gene sets and haplotype comparisons tested, we and GABRP were genotyped in a Portuguese sample calculated a false discovery rate (FDR),90 which is consisting of parent–proband trios (N ¼ 111), unre- the expected proportion of false results (Type I errors) lated cases (N ¼ 321), and controls (N ¼ 242). Figure 1 among the results that surpassed a particular demonstrates the chromosomal order and distances significance threshold. The FDR was calculated as between the genes, with GABRB2, GABRA6, GA- nP/R, where n is the number of independent tests, P is BRA1, and GABRG2 (listed centromeric to telomeric) the significance threshold applied to the results, and clustered within an 860-kb region, and GABRP B R is the number of reported results that met or located 8 Mb telomeric to the cluster. Figure 2 surpassed P. displays the SNP positions relative to the five genes. Gene sets were created consisting of coexpressed Significant associations were detected between schizophrenia and 19 SNPs (Po0.05) spanning the gene genes of each of the 5q GABAA receptor subunit genes. For each gene (GABRA1, GABRA6, GABRB2, GABRG2, cluster (Table 2). The majority of associated SNPs and GABRP), we derived four gene sets comprised of: were in GABRA1, with some in GABRB2, GABRA6, (a) the 50 nearest expression neighbors of the gene in and GABRP. Association results for all 132 SNPs the Genomics Institute of the Novartis Research spanning the cluster are provided in Supplementary Foundation (GNF) expression atlas version 191 (con- Table 4. sisting of B12 000 genes), using either all of the tissues To further investigate these associations, we per- or only the brain tissues in the atlas, and (b) the 100 formed haplotype-based analyses. We determined the nearest expression neighbors of the gene in the GNF pairwise LD between all SNPs and identified 21 expression atlas version 291,92 (consisting of B22 000 haplotype blocks of strong LD spanning the gene genes), using either all of the tissues or only the brain cluster (Figure 2). The haplotype blocks averaged tissues in the atlas. This resulted in a total of 20 GABA gene sets. The gene sets were named according to the

GABAA receptor subunit gene, the atlas version, and the atlas tissues used (eg GABRA1-v1-all tissues). Peripheral leukocyte microarray samples from the Figure 1 Genomic structure of the chromosome 5q GABAA 32 discordant sibpairs were grouped to reflect as receptor subunit genes tested for association with schizo- closely as possible, given the restriction to two-class phrenia. Orientation of genes is indicated by direction of comparisons in the GSEA method, three possible arrows. Physical distances between genes are shown.

Molecular Psychiatry 5q GABAA receptor genes confer schizophrenia risk TL Petryshen et al 1079

Figure 2 LD and haplotype block structure of the 5q GABAA receptor subunit genes. Gene structure is shown, with vertical lines indicating exons, above the bar representing the chromosome. Markers are displayed relative to gene location. LD structure between marker pairs is indicated by the colored matrices. Haplotype blocks spanning the GABAA receptor subunit genes are shown as yellow rectangles. Genomic positions are according to the NCBI Build 35 human genome assembly. Figure generated using LocusView version 2.0 (Petryshen and Kirby, unpublished software; http://www.broad.mit.edu/mpg/locusview/).

Molecular Psychiatry oeua Psychiatry Molecular 1080

Table 2 SNP and haplotype associations between schizophrenia and 5q GABAA receptor subunit genes

Gene SNP Allele Portuguesea Germanb

Trans Untrans Cases Controls Odds P-valuec Trans Untrans Relative P-valued (No.) (No.) (%) (%) ratio (No.) (No.) risk

GABRB2 rs168697 A 17 3 96.8 95.8 1.79 0.011 25 11 2.27 0.010* GABRA6 rs2197414 G 54 45 68.9 61.6 1.33 0.0084 100 96 1.04 0.39* rs3811991 G 57 47 69.2 61.8 1.34 0.0065 97 97 1.00 1.00 hCV26071323 A 27 17 82.3 77.0 1.42 0.0088 70 91 0.77 0.098 GABA 5q

GABRA1 hCV256030 A 47 39 56.5 49.2 1.31 0.011 121 110 1.10 0.24* A

hCV26001043 A 49 38 56.0 49.0 1.32 0.0090 124 112 1.11 0.22* risk schizophrenia confer genes receptor rs4464735 A 59 49 57.4 49.2 1.34 0.0051 122 108 1.13 0.18* hCV478645 A 61 54 58.1 49.6 1.32 0.0071 ND ND ND ND hCV26056767 T 56 47 63.0 57.5 1.24 0.040 125 105 1.19 0.094* rs4367330 A 57 42 56.6 48.6 1.38 0.0021 ND ND ND ND rs4254937 A 62 45 56.5 48.6 1.38 0.0018 122 110 1.11 0.22* rs4260711 G 53 44 58.0 50.2 1.33 0.0068 118 111 1.06 0.32* rs1350376 G 51 46 64.0 58.1 1.23 0.048 107 89 1.20 0.10* Petryshen TL rs1037715 C 32 12 85.0 82.4 1.42 0.012 66 36 1.83 0.0015* rs998754 G 48 39 60.7 54.1 1.29 0.017 108 96 1.13 0.20* hCV11814518 C 46 42 53.9 46.9 1.26 0.027 102 106 0.96 0.78 tal et hCV1991794 A 53 46 53.8 46.8 1.28 0.020 110 98 1.12 0.20*

GABRP rs7736504 G 5 13 96.1 98.7 0.35 0.0049 0 4 – 0.023* rs732157 T 47 56 54.3 60.7 0.79 0.022 104 114 0.91 0.25*

Haplotypee Alleles

GABRB2 Hap3C AGGGCGA 20 11 6.3 8.1 0.97 0.92 42 27 1.56 0.035* GABRA6 Hap8C CCTTT 23 42 16.7 20.7 0.70 0.0067 64 56 1.14 0.47 GABRA1 Hap9A AAGGAAA 44 33 56.8 48.1 1.40 0.0019 112 99 1.13 0.19* Hap10A CAAGCAGAGCTGTCA 59 41 52.5 44.8 1.40 0.0019 119 94 1.27 0.043* Hap9A þ 10A AAGGAAACAAGCAGAGCTGTCA 58 34 50.6 43.4 1.47 0.00086 120 91 1.32 0.023* Hap9C GGGGTAC 14 38 15.2 19.2 0.64 0.0013 62 54 1.15 0.46 Hap10B CACATCAATTTTTTT 13 32 15.2 17.4 0.74 0.027 37 64 0.58 0.0036* Hap9C þ 10B GGGGTACCACATCAATTTTTTT 6 26 7.2 10.3 0.55 0.00062 33 39 0.85 0.24*

GABRP Hap18D CAT 13 4 4.0 1.3 3.18 0.0024 4 0 – 0.023* Hap20A CAAT 15 20 54.2 61.7 0.73 0.042 96 94 1.02 0.88 Hap21B GCTC 31 34 18.9 26.5 0.74 0.038 68 58 1.17 0.37

aSNP major allele and haplotype counts are shown for parent to proband transmissions (Trans) and nontransmissions (Untrans), frequencies are shown for cases and controls. bSNP major allele and haplotype counts are shown for parent to proband transmissions (Trans) and nontransmissions (Untrans). ND indicates SNP not genotyped in the sample. cNominal two-tailed P-values were obtained from the Z distribution of the deviation from expected frequencies (under the null hypothesis of no association) in the parent–proband trios and case–control samples. dNominal two-tailed P-values obtained from the TDT, except (*) denotes one-tailed P-values. Po0.05 indicated in bold. eRefer to Figure 2 for SNPs comprising each haplotype. 5q GABAA receptor genes confer schizophrenia risk TL Petryshen et al 1081 25 kb in size and consisted of two to eight common GABRA1, risk haplotypes Hap10A and Hap9A þ 10A haplotypes with frequencies 42%. Haplotype alleles were overtransmitted to affected probands (P ¼ 0.043* and population frequencies are presented in Supple- and P ¼ 0.023*, respectively), while Hap10B was mentary Table 5. undertransmitted to probands (P ¼ 0.0036*). Note that As shown in Table 2, significant associations Hap10B is uniquely tagged by the T allele of (Po0.05) were detected with several haplotypes in rs1037715(C/T), one of the two associated SNPs in the gene cluster. In GABRA1, associations were found this sample, in that the T allele was found only on with four haplotypes in adjacent haplotype blocks 9 Hap10B and no other haplotypes in block 10 and 10 that span the gene and contain all of the (Supplementary Table 5). In GABRP, risk haplotype GABRA1 SNPs that were individually associated with Hap18D was overtransmitted to probands (P ¼ 0.023*; schizophrenia. Haplotypes Hap9A in block 9 and Table 2). This haplotype is uniquely tagged by the A Hap10A in block 10 were in excess in patients allele of rs7736504(G/A), one of the two SNPs (parent–proband transmissions and unrelated cases) associated in this sample. After stringent Bonferroni compared to controls (parent–proband nontransmis- correction for the 29 tests (19 SNPs and 10 haplo- sions and unrelated controls) (both P ¼ 0.0019). types) performed in the German sample, only the Hap9C and Hap10B were at lower frequencies in association with rs1037715 in GABRA1 remained patients (P ¼ 0.0013 and 0.027, respectively). Since significant at P ¼ 0.044* (nominal P ¼ 0.0015* Â 29). LD was strong between haplotype blocks 9 and 10 (D0 ¼ 0.9), we tested haplotypes spanning both blocks Support for association between schizophrenia and for association. Hap9A þ 10A was at higher frequency GABRB2 in patients (P ¼ 0.00086) and Hap9C þ 10B was at We specifically investigated GABRB2 SNPs pre- lower frequency (P ¼ 0.00062). Associations were also viously reported to be associated in Chinese schizo- 70 detected with two other 5q GABAA receptor subunit phrenia patients. None of the SNPs (rs187269, genes. In GABRA6, Hap8C was under-represented rs252944, rs194072, rs1816071, and rs6556547) were (P ¼ 0.0067) in patients compared to controls. In significantly associated in either the Portuguese or GABRP, a low-frequency (o5%) haplotype, Hap18D, German patient samples (all P40.05; Supplementary was in excess in patients (P ¼ 0.0024). Adjacent Table 4). The alleles of each of the five SNPS that were GABRP haplotypes Hap20A and Hap21B were less at higher frequency in the Chinese cases together frequent in patients (P ¼ 0.042 and 0.038, respec- comprised a haplotype, Hap3C, found at B8% tively). As shown in Table 2, comparison of the frequency in our samples. This haplotype was over- number of transmissions and nontransmissions in the transmitted to probands in the German sample trios sample, and the frequencies in the case–control (P ¼ 0.035*; Table 2), and thereby provided support sample, found that the haplotype associations were for the association reported in the previous study.70 not due to one sample alone, but rather the effects Hap3C was not associated in the Portuguese parent– were consistent in the two samples. Frequencies of proband trios and case–control sample (P ¼ 0.92; the above haplotypes were similar in a subset of 31 Table 2). Post hoc analyses of the Portuguese trios and 59 unrelated cases that had a positive trios and case–control samples separately found family history, defined as having at least one first- or that Hap3C was overtransmitted to trio probands second-degree relative with schizophrenia (data not (20 transmissions vs 11 nontransmissions; shown). P ¼ 0.053*), but the cases and controls had similar haplotype frequencies (6.3% cases vs 8.1% controls; Replication of association between schizophrenia and P ¼ 0.24). 5q GABAA receptor subunit genes We sought to replicate the nominally significant Effects of haplotypes associated with schizophrenia on Portuguese SNP and haplotype associations in an GABAA receptor subunit expression levels independent sample of German parent–proband trios Disease-associated haplotypes may exert their effect (N ¼ 238). As shown in Table 2, associations were by altering their own expression or the expression of replicated at Po0.05 for three of the 19 SNPs tested: other genes. Thus, we examined whether the haplo- rs168697 in GABRB2 (P ¼ 0.010*), rs1037715 in types that we found associated with schizophrenia in GABRA1 (P ¼ 0.0015*) and rs7736504 in GABRP both the Portuguese and German samples were related

(P ¼ 0.023*). Note that these two SNPs were asso- to alterations in transcript levels of the 5q GABAA ciated in the same manner as the Portuguese sample, receptor subunit genes in a sample of 32 discordant in that the alleles found in excess in the Portuguese sibling pairs. We determined the genotype of each patients were also overtransmitted to the German individual for haplotypes GABRA1 Hap10A and probands. We reconstructed haplotypes in the Ger- GABRA1 Hap10B. We did not test GABRP Hap18D, man sample using the same haplotype block structure even though we detected association with this defined in the Portuguese sample, since the LD haplotype in both the Portuguese and German sam- structures of the two samples were for the most part ples, because it was too rare to be informative. identical (data not shown). Of the 10 haplotypes Haplotypes from all individuals (both affected and tested, associations were replicated at Po0.05 for four unaffected) were analyzed together in order to max- haplotypes in GABRA1 and GABRP (Table 2). In imize statistical power. Microarray mRNA expression

Molecular Psychiatry 5q GABAA receptor genes confer schizophrenia risk TL Petryshen et al 1082

levels of each of the five 5q GABAA receptor subunit d genes were linearly regressed against genotypes of GABRA1 Hap10A or GABRA1 Hap10B. A significant

effect of GABRA1 Hap10A on lower GABRA6 expres- P-value

sion was found under a dominant model (P ¼ 0.016, s. 1 df; Table 3), with Hap10A þ / þ and þ /À individuals

having 1.7-fold lower expression of GABRA6 com- c pared to Hap10AÀ/À individuals. 1.14 0.025 1.25 0.0014 1.37 0.027 1.681.21 0.016 0.0100 À À Exploration of effects of haplotypes associated with À

schizophrenia on GABA gene set expression difference

Changes at the transcript or protein level of a GABAA receptor subunit could affect the physiologic state of

the cell by altering cell electrical potential and À À À / / / À À downstream signaling molecules. Thus, we explored À whether the associated GABRA1 haplotypes had effects on expression of groups of genes related to unaffected unaffected Hap10A Hap10B the GABAA receptor subunit genes. Since functionally Hap10B vs 93,94 vs and vs vs related genes are often coregulated, we created vs þ À À À

sets of genes based on coexpression with each GABA / / / A / þ þ þ receptor subunit gene. Specifically, for each of the þ

five GABAA receptor subunit genes (GABRA1, GABRA6, GABRB2, GABRG2, and GABRP), we created four Schizophrenia Hap10B Schizophrenia Hap10A Hap10A Hap10B gene sets using either of two public expression atlases Analysis Expression (referred to as ‘v1’ and ‘v2’)91,92, and either all tissues or only the brain tissues in each atlas (referred to as ‘all tissues’ and ‘brain’), resulting in a total of 20 gene

sets. The 32 discordant sibpairs described above were b classified based on presence of a particular haplotype into two categories that reflected additive, dominant, and recessive genetic models (as detailed in the Materials and methods section). For each haplotype–gene set analysis, we used GSEA89 to examine the microarray mRNA expression data for the pre- associated genes receptor, other receptor genes Biological process sence of gene set members among those genes that associated genes were the most differentially expressed between the two haplotype categories compared. Of the total 80 haplotype-gene set comparisons tested, two results were significant at a threshold of Pp0.01. This a corresponds to a 40% FDR, thus one of the two results may be false. Both of the two significant haplotype–gene set results involved GABRA1 Hap10B, which we found under-represented in schizophrenia patients. As GABRA1-v1-all tissues Synaptic, vesicle- reported in Table 3, Hap10B was related to higher GABRB2-v2-all tissues Neurotransmitter expression of two GABA gene sets: Hap10B þ /À individuals had 1.21-fold higher expression of the receptor subunit genes and GABA gene sets in peripheral leukocytes from schizophrenia discordant sibpairs A GABRA1-v1-all tissues gene set, and 1.25-fold higher expression of the GABRB2-v2-all tissues gene set, compared to Hap10BÀ/À individuals (P ¼ 0.0100 and 0.0014, respectively). Note that the genes in these two Effect Gene or gene set gene sets do not overlap, and thus the effects of Hap10B on the gene sets were not due to shared genes. As shown in Table 3, the GABRA1 gene set primarily contains presynaptic and vesicle-associated proteins, and the GABRB2 gene set contains many Hap10AHap10B Risk Protective GABRA1-v1-all GABRA6 tissues gene Synaptic, vesicle- neurotransmitter receptors and other receptors. Post -value. P hoc analyses of the individual genes in the two gene Altered expression of GABA sets determined that many genes had significant expression differences on their own between the Schizophrenia GABRA6 gene GABRA1 GABRA1 Nominal Predominant functions of genes in the gene set. Gene sets were obtained from nearest neighbor analysisMean of expression all level tissues of or the only gene brain or tissues gene in set the in GNF the expression genotype version group 1 in (v1) bold or relative version to 2 the (v2) mean atlase expression level in the other genotype group. Phenotype particular haplotype groups (uncorrected Student’s Table 3 Haplotype a b c d

Molecular Psychiatry 5q GABAA receptor genes confer schizophrenia risk TL Petryshen et al 1083 t-test PX0.0032; Supplementary Table 3). Supple- frequency that spanned the same region, Hap10B, was mentary Table 3 lists the gene set members and their under-represented in Portuguese patients and under- expression fold changes between Hap10B þ /À and transmitted to German probands. These haplotypes Hap10BÀ/À individuals. contain the SNP that had the strongest association in our second-stage German sample, which remained Transcript expression alterations in schizophrenia significant at Po0.05 after stringent Bonferroni patient peripheral leukocytes correction for the number of tests performed in this Previous studies of postmortem prefrontal cortex from sample. It will be important to determine whether schizophrenia patients have reported alterations in only one of these haplotypes accounts for the some of the 5q GABAA receptor subunit genes and in observed association; however, to do this effectively 95–97 GABAergic genes. Therefore, we investigated the requires a much larger sample than we currently discordant sibling pairs for expression differences have. We also detected associations in both of our between the schizophrenia siblings and the unaf- patient samples with a rare risk haplotype in GABRP. fected siblings (ie, we tested for an effect of disease, None of the SNP alleles that uniquely mark these rather than effects of haplotypes as reported above). GABRA1 and GABRP haplotypes are known to be Linear regression analysis of each of the five GABAA functional, and are thus not likely themselves directly receptor subunit genes detected an average 1.37-fold responsible for the altered risk of schizophrenia decrease in GABRA6 transcript expression in the observed, but are likely in LD with other functional schizophrenia siblings (P ¼ 0.027; Table 3). Analysis or regulatory alleles. Identifying the causal alleles of the 20 GABA gene sets using GSEA detected an will require further sequencing of these genes to average 1.14-fold decrease of the GABRA1-v1-all assemble a comprehensive set of sequence variants, tissues gene set in schizophrenia siblings (P ¼ 0.025; followed by genotyping in large, well-characterized FDR ¼ 50%). We have also found that this gene set has populations of schizophrenia patients. lower expression in the prefrontal cortex of schizo- We specifically investigated a GABRB2 risk haplo- phrenia patients compared to controls (P ¼ 0.005; type containing SNP alleles reported to be in excess in unpublished data) in a postmortem sample obtained Chinese schizophrenia patients,70 and obtained mod- from the Stanley Medical Research Foundation that est support for association in our German and 98 has been described previously. Supplementary Portuguese parent–proband trios samples. The ob- Table 3 lists the GABRA1 gene set members and their served association in our trios samples indicates that expression fold changes between schizophrenia pa- the Chinese report was unlikely due to population tients and unaffected individuals. stratification between cases and controls, and like- wise our trios results are not likely due to transmis- Discussion sion distortion. Association was not detected with this haplotype in our Portuguese case–control sam- Numerous pharmacological, imaging, and postmor- ple, however. The reason is unclear, and may only tem studies have implicated the GABA system in become apparent after additional studies in indepen- schizophrenia pathophysiology.47–49 The current dent samples are carried out to delineate the role of study has presented several lines of evidence for the this haplotype in schizophrenia risk. Evidence has specific involvement of GABAA receptor subunit also been presented for association with GABRG2 in genes located in the 5q schizophrenia risk locus. We Finnish patients;99 however, the data have not yet detected association between schizophrenia and both been published to permit thorough comparison with

GABRA1 and GABRP in a patient sample of Portu- our findings. Other 5q GABAA receptor subunit gene guese descent. Importantly, we subsequently repli- haplotypes were also associated in our Portuguese cated the GABRA1 and GABRP associations in an sample but were not replicated in the German sample, independent sample of German origin. We also suggesting that the Portuguese associations may be obtained supportive evidence for association with Type I errors. However, investigation of these haplo- GABRB2 that was previously reported in a Chinese types in other patient samples may be necessary to patient sample.70 Furthermore, exploratory analyses conclusively rule out their involvement in schizo- suggested that the associated GABRA1 haplotypes phrenia. had effects on mRNA expression levels of some of the Our results and those of others70,99 suggest that the 5q GABAA receptor genes and related groups of genes, functionally related GABRA1, GABRB2, GABRG2, including some synaptic and vesicle-associated genes and GABRP genes on chromosome 5q may all confer that have been reported to be altered in schizophrenia risk of schizophrenia. This finding is not overly prefrontal cortex.96 surprising since the first three genes encode subunits

We detected associations between two GABRA1 that associate together in the major GABAA receptor haplotypes and schizophrenia in our Portuguese in the adult brain,100,101 and the latter gene encodes a sample that we subsequently replicated in our Ger- regulatory subunit that modulates the effects of drugs man sample. A ‘risk’ haplotype at B50% population on the receptor.41 Given that these subunits associate frequency, Hap10A, was in excess in the Portuguese together in a receptor, epistatic interactions between patients and was overtransmitted to German pro- subunit genes are possible. However, investigation of bands. In contrast, a ‘protective’ haplotype at B15% interactions will require larger samples than we

Molecular Psychiatry 5q GABAA receptor genes confer schizophrenia risk TL Petryshen et al 1084 currently have in order to achieve adequate statistical acetylcholine receptor beta 3, GABA receptor rho 2 power, particularly for less frequent haplotypes (eg subunit, GABA receptor theta subunit, and N-methyl- our Portuguese sample had o75% power to detect D-aspartate receptor 2A subunit (GRIN2A)) and other interactions between the GABRA1 and GABRB2 receptors (eg retinoic acid receptor beta, retinoid X haplotypes). receptor gamma, estrogen-related receptor alpha, and Gene polymorphisms that are involved in disease fibroblast growth factor receptor 2). susceptibility may function by altering the encoded Lower expression of presynaptic secretory machin- polypeptide sequence, transcript expression levels, or ery has been postulated as a specific schizophrenia- temporal expression patterns, for example. Expres- related defect.102 Our results demonstrated that a sion alterations may occur either by a sequence GABRA1 gene set which, as described above, contains variant in a gene dictating the level of transcription many synaptic and vesicle-associated genes, was of the gene itself, or the processing or stability of its coordinately decreased an average of 1.14-fold in mRNA transcript. Alternatively, a gene sequence schizophrenia siblings compared to unaffected sib- variant may alter the expression of other genes. lings. Further support for this defect has been found Changes in the expression level or encoded protein in our unpublished observations, in which this gene

of a GABAA receptor subunit could affect the set has lower expression in the prefrontal cortex of physiologic state of the cell through alterations in schizophrenia patients compared to controls in a cell electrical potential and downstream signaling postmortem sample obtained from the Stanley Med-

molecules, since the GABAA receptors flux chloride. ical Research Foundation. Such changes could affect regulation of a multitude We point out two important considerations in of genes through various signal transduction interpreting our mRNA expression results. The first pathways. is that we applied nominal significance thresholds to Our exploratory analyses of the effects of GABRA1 our gene set analysis results that were adjusted for the haplotypes that we found associated with schizo- large number of genes on the microarray, but were not phrenia on expression of the GABA genes and GABA- corrected for the number of comparisons performed. related gene sets produced several interesting Therefore, to interpret our results in light of the findings. We did not detect significant effects of the multiple tests, we determined the FDR for our haplotypes on expression of their own transcripts, analyses. The FDR’s were 40 and 50% for our although our sample may have insufficient power to haplotype-based and disease-based gene set analyses, detect such effects, particularly for less frequent respectively, indicating that one of the two significant haplotypes. However, we did observe potential effects gene sets in the haplotype-based analyses, and the of the haplotypes on expression levels of other 5q only significant gene set in the disease-based ana- GABA subunit genes and coexpressed genes. Speci- lyses, may be false positives. The second considera- fically, the GABRA1 Hap10A risk haplotype was tion is that, as we have discussed previously,59 we correlated with lower expression of the GABRA6 utilized peripheral leukocytes isolated from blood, gene, and the GABRA1 Hap10B protective haplotype rather than postmortem brain tissue. Our rationale is was related to coordinate expression alterations in that artefacts introduced by postmortem hypoxia, gene sets that are coexpressed with GABRA1 and anatomical inconsistencies, and postmortem interval GABRB2. Furthermore, many of the genes in these in postmortem tissue studies are not an issue with two gene sets on their own had nominally significant leukocyte samples. However, it is unknown the extent expression differences between the haplotype groups. to which this cell population reflects transcript These preliminary findings suggest that one or more expression profiles of the brain. Nonetheless, many sequence variants residing on haplotypes of GABRA1 brain-related genes and metabolic transcripts that function to regulate biological pathways in which have altered expression in schizophrenic postmortem itself and the GABRB2 gene, which we and others70 prefrontal cortex are also altered in peripheral tissues, have implicated in schizophrenia risk, may operate. including lymphocytes,103–105 arguing for the validity However, determination of the exact nature of the of using peripheral leukocytes to measure schizo- relationship between these haplotypes, the altered phrenia gene expression alterations. Of relevance to biological pathways, and the pathophysiological the current study, murine T lymphocytes express

findings observed in the brains of schizophrenia functional GABAA receptors that are pharmacologi- patients requires further investigation. Interestingly, cally similar to their central nervous system counter- the altered GABRA1 gene set primarily consist of parts,106 and GABA receptors have been found in synaptic and vesicle-associated proteins (eg dynamin, pancreatic islets, the gastrointestinal tract, ovaries, N-ethylmalemide-sensitive factor (NSF), synaptotag- and the adrenal medulla.107 Furthermore, we detected min, synaptogyrin, and synaptophysin), many of significant haplotype effects on gene sets containing which have previously been reported to be down- synaptic and vesicle-associated genes that have regulated in schizophrenia prefrontal cortex.96 The previously been implicated in schizophrenia,96 in- altered GABRB2 gene set contains a more diverse dicating that genes that are typically considered set of primarily membrane-bound and extracellular brain-specific are in fact expressed in peripheral proteins, including neurotransmitter receptors leukocytes. Clearly, the next step will be to determine (eg 5-hydroxytryptamine receptor 1F, nicotinic in a large postmortem brain sample whether the

Molecular Psychiatry 5q GABAA receptor genes confer schizophrenia risk TL Petryshen et al 1085 haplotypes also affect these GABA-related pathways References in the brain. Interestingly, a recent study found that treatment of 1 Kendler KS. Schizophrenia genetics. In: Sadock J, Sadock VA (eds). Kaplan and Sadock’s Comprehensive Textbook of Psychia- the rat hippocampus with NRG1 resulted in signifi- try. Lippincott, Williams and Wilkins: Philadelphia, 2000. cantly lower mRNA expression of the GABAA 2 Owen MJ, O’Donovan MC, Gottesman II. Schizophrenia. In: receptor alpha 1 and alpha 2 subunits, and modestly McGuffin P, Owen M, Gottesman II (eds) Psychiatric Genetics and Genomics. Oxford University Press: Oxford, 2002, pp 247–256. decreased GABAA receptor beta 2 and gamma 2 66 3 Abecasis GR, Burt RA, Hall D, Bochum S, Doheny KF, Lundy SL subunit expression. Furthermore, different isoforms et al. Genomewide scan in families with schizophrenia from the of NRG1 appear to act as attractants for migrating founder population of Afrikaners reveals evidence for linkage cortical GABAergic interneurons.108 These findings and uniparental disomy on chromosome 1. Am J Hum Genet are highly intriguing given the reported association 2004; 74: 403–417. between the NRG1 gene and schizophrenia,33,52–59 and 4 JSSLG. Initial genome-wide scan for linkage with schizophrenia in the Japanese Schizophrenia Sib-Pair Linkage Group (JSSLG) suggest that defects in GABAA receptor regulation by families. Am J Med Genet 2003; 120B: 22–28. NRG1 is a possible mechanism by which NRG1 5 Bailer U, Leisch F, Meszaros K, Lenzinger E, Willinger U, Strobl R contributes to schizophrenia. Indeed, in a previous et al. Genome scan for susceptibility loci for schizophrenia. study using the same 33 discordant sibpairs as in the Neuropsychobiology 2000; 42: 175–182. 6 Barr CL, Kennedy JL, Pakstis AJ, Wetterberg L, Sjogren B, Bierut L present study, we found higher expression of the et al. Progress in a genome scan for linkage in schizophrenia in a SMDF isoform of NRG1 in subjects with schizophre- large Swedish kindred. Am J Med Genet 1994; 54: 51–58. nia.59 Thus, the conferred risk of schizophrenia by 7 Blouin JL, Dombroski BA, Nath SK, Lasseter VK, Wolyniec PS, Nestadt G et al. Schizophrenia susceptibility loci on chromo- NRG1 and the 5q GABAA receptor subunit genes may be through a common GABA-related pathway, lend- somes 13q32 and 8p21. Nat Genet 1998; 20: 70–73. 8 Brzustowicz LM, Hodgkinson KA, Chow EW, Honer WG, Bassett ing support to the GABA hypothesis of schizophrenia AS. Location of a major susceptibility locus for familial schizo- pathophysiology. phrenia on chromosome 1q21–q22. Science 2000; 288: 678–682. In conclusion, the current study has obtained 9 Camp NJ, Neuhausen SL, Tiobech J, Polloi A, Coon H, Myles- evidence from multiple fronts that the GABA Worsley M. Genomewide multipoint linkage analysis of A seven extended Palauan pedigrees with schizophrenia, by a receptor subunit genes located on chromosome 5q Markov-chain Monte Carlo method. Am J Hum Genet 2001; 69: are involved in schizophrenia risk and pathophysiol- 1278–1289. ogy. We have presented evidence for replicated 10 Coon H, Jensen S, Holik J, Hoff M, Myles-Worsley M, Reimherr F et al. Genomic scan for genes predisposing to schizophrenia. Am associations between two GABAA receptor subunit genes and schizophrenia in two European samples, J Med Genet 1994; 54: 59–71. 11 Coon H, Myles-Worsley M, Tiobech J, Hoff M, Rosenthal J, the most compelling results being for GABRA1. Our Bennett P et al. Evidence for a chromosome 2p13–14 schizo- study also provides modest support for a previously phrenia susceptibility locus in families from Palau, Micronesia. reported GABRB2 association. Furthermore, we found Mol Psychiatry 1998; 3: 521–527. relationships between associated GABRA1 haplo- 12 DeLisi LE, Mesen A, Rodriguez C, Bertheau A, LaPrade B, Llach M et al. Genome-wide scan for linkage to schizophrenia in a types and expression levels of GABA genes, as well Spanish-origin cohort from Costa Rica. Am J Med Genet 2002; as gene sets that may be coregulated with the GABA 114: 497–508. genes. Taken together with historical and more recent 13 DeLisi LE, Shaw SH, Crow TJ, Shields G, Smith AB, Larach VW et data implicating the GABA system in schizophrenia, al. A genome-wide scan for linkage to chromosomal regions in our data suggest that further investigations of these 382 sibling pairs with schizophrenia or schizoaffective disorder. Am J Psychiatry 2002; 159: 803–812. genes are warranted to understand the complex role 14 Devlin B, Bacanu SA, Roeder K, Reimherr F, Wender P, Galke B et that the GABA subunits and related genes play in al. Genome-wide multipoint linkage analyses of multiplex schizophrenia pathogenesis. schizophrenia pedigrees from the oceanic nation of Palau. Mol Psychiatry 2002; 7: 689–694. 15 Ekelund J, Lichtermann D, Hovatta I, Ellonen P, Suvisaari J, Terwilliger JD et al. Genome-wide scan for schizophrenia in the Acknowledgements Finnish population: evidence for a locus on chromosome 7q22. Hum Mol Genet 2000; 9: 1049–1057. We gratefully acknowledge the families and indivi- 16 Fallin MD, Lasseter VK, Wolyniec PS, McGrath JA, Nestadt G, duals who participated in this study. We thank Ana Valle D et al. Genomewide linkage scan for schizophrenia susceptibility loci among Ashkenazi Jewish families shows Dourado, Jose Valente, Carlos Paz Ferreira, Isabel evidence of linkage on chromosome 10q22. Am J Hum Genet Coelho, and MJ Soares for patient collection, Sinead 2003; 73: 601–611. O’Leary for analytical assistance, and Eric Lander, Ed 17 Faraone SV, Matise T, Svrakic D, Pepple J, Malaspina D, Suarez B Skolnick, Nick Patterson, and Vamsi Mootha for et al. Genome scan of European-American schizophrenia pedigrees: results of the NIMH Genetics Initiative and Millennium helpful discussions of the manuscript. We acknowl- Consortium. Am J Med Genet 1998; 81: 290–295. edge the Stanley Medical Research Foundation, and 18 Garver DL, Holcomb J, Mapua FM, Wilson R, Barnes B. Michael Knable, DO, Serge Weis, MD, Fuller Torrey, Schizophrenia spectrum disorders: an autosomal-wide scan in MD, Maree Webster, PhD, and Robert Yolken, MD for multiplex pedigrees. Schizophr Res 2001; 52: 145–160. donating postmortem brain tissue. This research was 19 Gurling H, Kalsi G, Brynjolfson J, Sigmundsson T, Sherrington R, Mankoo B et al. Genomewide genetic linkage analysis confirms supported by NIMH Grants MH52618 and MH058693 the presence of susceptibility loci for schizophrenia, on chromo- to CNP, and NARSAD Young Investigator awards to somes 1q32.2, 5q33.2, and 8p21–22 and provides support for TLP and CNP. MJD was a Pfizer Fellow in Computa- linkage to schizophrenia, on chromosomes 11q23.3–24 and tional Biology. 20q12.1–11.23. Am J Hum Genet 2001; 68: 661–673.

Molecular Psychiatry 5q GABAA receptor genes confer schizophrenia risk TL Petryshen et al 1086 20 Hovatta I, Varilo T, Suvisaari J, Terwilliger JD, Ollikainen V, 39 Steiger JL, Russek SJ. GABAA receptors: building the bridge Arajarvi R et al. A genomewide screen for schizophrenia genes in between subunit mRNAs, their promoters, and cognate transcrip- an isolated Finnish subpopulation, suggesting multiple suscept- tion factors. Pharmacol Therapeutics 2004; 101: 259–281. ibility loci. Am J Hum Genet 1999; 65: 1114–1124. 40 Varecka L, Wu CH, Rotter A, Frostholm A. GABAA/benzodiaze- 21 Kaufmann CA, Suarez B, Malaspina D, Pepple J, Svrakic D, pine receptor alpha 6 subunit mRNA in granule cells of the Markel PD et al. NIMH Genetics Initiative Millenium Schizo- cerebellar cortex and cochlear nuclei: expression in developing phrenia Consortium: linkage analysis of African-American and mutant mice. J Comp Neurol 1997; 339: 341–352. pedigrees. Am J Med Genet 1998; 81: 282–289. 41 Neelands TR, Macdonald RL. Incorporation of the pi subunit into 22 Lerer B, Segman RH, Hamdan A, Kanyas K, Karni O, Kohn Y et al. functional gamma-aminobutyric Acid(A) receptors. Mol Pharma- Genome scan of Arab Israeli families maps a schizophrenia col 1999; 56: 598–610. susceptibility gene to chromosome 6q23 and supports a locus at 42 Hedblom E, Kirkness EF. A novel class of GABAA receptor chromosome 10q24. Mol Psychiatry 2003; 8: 488–498. subunit in tissues of the reproductive system. J Biol Chem 1997; 23 Levinson DF, Mahtani MM, Nancarrow DJ, Brown DM, Kruglyak 272: 15346–15350. L, Kirby A et al. Genome scan of schizophrenia. Am J Psychiatry 43 Squires RF, Lajtha A, Saederup E, Palkovits M. Reduced 1998; 155: 741–750. [3H]flunitrazepam binding in cingulate cortex and hippocampus 24 Lindholm E, Ekholm B, Shaw S, Jalonen P, Johansson G, of postmortem schizophrenic brains: is selective loss of glutama- Pettersson U et al. A schizophrenia-susceptibility locus at 6q25, tergic neurons associated with major psychoses? Neurochem Res in one of the world’s largest reported pedigrees. Am J Hum Genet 1993; 18: 219–223. 2001; 69: 96–105. 44 Akbarian S, Huntsman MM, Kim JJ, Tafazzoli A, Potkin SG, 25 Macgregor S, Visscher PM, Knott SA, Thomson P, Porteous DJ, Bunney Jr WE et al. GABAA receptor subunit gene expression in Millar JK et al. A genome scan and follow-up study identify a human prefrontal cortex: comparison of schizophrenics and bipolar disorder susceptibility locus on chromosome 1q42. Mol controls. Cereb Cortex 1995; 5: 550–560. Psychiatry 2004; 9: 1083–1090. 45 Huntsman MM, Tran BV, Potkin SG, Bunney Jr WE, Jones EG. 26 Maziade M, Roy MA, Chagnon YC, Cliche D, Fournier JP, Altered ratios of alternatively spliced long and short gamma2 Montgrain N et al. Shared and specific susceptibility loci for subunit mRNAs of the gamma-amino butyrate type A receptor in schizophrenia and bipolar disorder: a dense genome scan in prefrontal cortex of schizophrenics. Proc Natl Acad Sci USA Eastern Quebec families. Mol Psychiatry 2004; 10: 486–499. 1998; 95: 15066–15071. 27 Moises HW, Yang L, Kristbjarnarson H, Wiese C, Byerley W, 46 Ohnuma T, Augood SJ, Arai H, McKenna PJ, Emson PC. Macciardi F et al. An international two-stage genome-wide Measurement of GABAergic parameters in the prefrontal cortex search for schizophrenia susceptibility genes. Nat Genet 1995; in schizophrenia: focus on GABA content, GABA(A) receptor 11: 321–324. alpha-1 subunit messenger RNA and human GABA transporter-1 28 Paunio T, Ekelund J, Varilo T, Parker A, Hovatta I, Turunen JA et (HGAT-1) messenger RNA expression. Neuroscience 1999; 93: al. Genome-wide scan in a nationwide study sample of schizo- 441–448. phrenia families in Finland reveals susceptibility loci on 47 Lewis DA, Volk DW, Hashimoto T. Selective alterations in chromosomes 2q and 5q. Hum Mol Genet 2001; 10: 3037–3048. prefrontal cortical GABA neurotransmission in schizophrenia: a 29 Rees MI, Fenton I, Williams NM, Holmans P, Norton N, Cardno A novel target for the treatment of working memory dysfunction. et al. Autosome search for schizophrenia susceptibility genes in Psychopharmacology (Berlin) 2004; 174: 143–150. multiply affected families. Mol Psychiatry 1999; 4: 353–359. 48 Wassef A, Baker J, Kochan LD. GABA and schizophrenia: a 30 Schwab SG, Hallmayer J, Albus M, Lerer B, Eckstein GN, review of basic science and clinical studies. J Clin Psychophar- Borrmann M et al. A genome-wide autosomal screen for macol 2003; 23: 601–640. schizophrenia susceptibility loci in 71 families with affected 49 Coyle JT. The GABA-glutamate connection in schizophrenia: siblings: support for loci on chromosome 10p and 6 [In Process which is the proximate cause? Biochem Pharmacol 2004; 68: Citation]. Mol Psychiatry 2000; 5: 638–649. 1507–1514. 31 Shaw SH, Kelly M, Smith AB, Shields G, Hopkins PJ, Loftus J et 50 Hashimoto T, Volk DW, Eggan SM, Mirnics K, Pierri JN, Sun Z et al. A genome-wide search for schizophrenia susceptibility genes. al. Gene expression deficits in a subclass of GABA neurons in the Am J Med Genet 1998; 81: 364–376. prefrontal cortex of subjects with schizophrenia. J Neurosci 2003; 32 Sklar P, Pato MT, Kirby A, Petryshen TL, Medeiros H, Carvalho C 23: 6315–6326. et al. Genome-wide scan in Portuguese Island families identifies 51 Ishikawa M, Mizukami K, Iwakiri M, Hidaka S, Asada T. GABAA 5q31–5q35 as a susceptibility locus for schizophrenia and receptor gamma subunits in the prefrontal cortex of patients psychosis. Mol Psychiatry 2004; 9: 213–218. with schizophrenia and bipolar disorder. Neuroreport 2004; 15: 33 Stefansson H, Sigurdsson E, Steinthorsdottir V, Bjornsdottir S, 1809–1812. Sigmundsson T, Ghosh S et al. Neuregulin 1 and susceptibility to 52 Stefansson H, Sarginson J, Kong A, Yates P, Steinthorsdottir V, schizophrenia. Am J Hum Genet 2002; 71: 877–892. Gudfinnsson E et al. Association of neuregulin 1 with schizo- 34 Straub RE, MacLean CJ, Ma Y, Webb BT, Myakishev MV, Harris- phrenia confirmed in a Scottish population. Am J Hum Genet Kerr C et al. Genome-wide scans of three independent sets of 90 2003; 72: 83–87. Irish multiplex schizophrenia families and follow-up of selected 53 Williams NM, Preece A, Spurlock G, Norton N, Williams HJ, regions in all families provides evidence for multiple suscept- Zammit S et al. Support for genetic variation in neuregulin 1 ibility genes. Mol Psychiatry 2002; 7: 542–559. and susceptibility to schizophrenia. Mol Psychiatry 2003; 8: 35 Wijsman EM, Rosenthal EA, Hall D, Blundell ML, Sobin C, Heath 485–487. SC et al. Genome-wide scan in a large complex pedigree with 54 Corvin AP, Morris DW, McGhee K, Schwaiger S, Scully P, Quinn J predominantly male schizophrenics from the island of Kosrae: et al. Confirmation and refinement of an ‘at-risk’ haplotype for evidence for linkage to chromosome 2q. Mol Psychiatry 2003; 8: schizophrenia suggests the EST cluster, Hs.97362, as a potential 695–705, 643. susceptibility gene at the Neuregulin-1 locus. Mol Psychiatry 36 Williams NM, Rees MI, Holmans P, Norton N, Cardno AG, Jones 2004; 9: 208–213. LA et al. A two-stage genome scan for schizophrenia suscept- 55 Yang JZ, Si TM, Ruan Y, Ling YS, Han YH, Wang XL et al. ibility genes in 196 affected sibling pairs. Hum Mol Genet 1999; 8: Association study of neuregulin 1 gene with schizophrenia. Mol 1729–1739. Psychiatry 2003; 8: 706–709. 37 Williams NM, Norton N, Williams H, Ekholm B, Hamshere ML, 56 Tang JX, Chen WY, He G, Zhou J, Gu NF, Feng GY et al. Lindblom Y et al. A systematic genomewide linkage study in Polymorphisms within 5’ end of the Neuregulin 1 gene are 353 sib pairs with schizophrenia. Am J Hum Genet 2003; 73: genetically associated with schizophrenia in the Chinese popula- 1355–1367. tion. Mol Psychiatry 2004; 9: 11–12. 38 Lewis CM, Levinson DF, Wise LH, DeLisi LE, Straub RE, Hovatta I 57 Li T, Stefansson H, Gudfinnsson E, Cai G, Liu X, Murray RM et al. et al. Genome scan meta-analysis of schizophrenia and bipolar Identification of a novel neuregulin 1 at-risk haplotype in Han disorder, part II: schizophrenia. Am J Hum Genet 2003; 73: 34–48. schizophrenia Chinese patients, but no association with the

Molecular Psychiatry 5q GABAA receptor genes confer schizophrenia risk TL Petryshen et al 1087 Icelandic/Scottish risk haplotype. Mol Psychiatry 2004; 9: 77 Spitzer RL, Endicott J, Robins E. Research diagnostic criteria: 698–704. rationale and reliability. Arch Gen Psychiatry 1978; 35: 773–782. 58 Zhao X, Shi Y, Tang J, Tang R, Yu L, Gu N et al. A case control and 78 Sklar P, Gabriel SB, McInnis MG, Bennett P, Lim YM, Tsan G et al. family based association study of the neuregulin1 gene and Family-based association study of 76 candidate genes in bipolar schizophrenia. J Med Genet 2004; 41: 31–34. disorder: BDNF is a potential risk locus. Brain-derived neu- 59 Petryshen TL, Middleton FA, Kirby A, Aldinger KA, Purcell S, trophic factor. Mol Psychiatry 2002; 7: 579–593. Tahl AR et al. Support for involvement of neuregulin 1 79 Barrett JC, Fry B, Maller J, Daly MJ. Haploview: analysis and in schizophrenia pathophysiology. Mol Psychiatry 2005; 10: visualization of LD and haplotype maps. Bioinformatics 2005; 21: 366–374. 263–265. 60 Straub RE, Jiang Y, MacLean CJ, Ma Y, Webb BT, Myakishev MV 80 Lewontin RC. The interaction of selection and linkage. I. General et al. Genetic variation in the 6p22.3 gene DTNBP1, the human considerations; heterotic models. Genetics 1964; 49: 49–67. ortholog of the mouse dysbindin gene, is associated with 81 Gabriel SB, Schaffner SF, Nguyen H, Moore JM, Roy J, schizophrenia. Am J Hum Genet 2002; 71: 337–348. Blumenstiel B et al. The structure of haplotype blocks in the 61 Schwab SG, Knapp M, Mondabon S, Hallmayer J, Borrmann- human genome. Science 2002; 296: 2225–2229. Hassenbach M, Albus M et al. Support for association of 82 Hedrick PW, Thomson G. Maternal–fetal interactions and the schizophrenia with genetic variation in the 6p22.3 gene, maintenance of HLA polymorphism. Genetics 1988; 119: 205–212. dysbindin, in sib-pair families with linkage and in an additional 83 Excoffier L, Slatkin M. Maximum-likelihood estimation of sample of triad families. Am J Hum Genet 2003; 72: 185–190. molecular haplotype frequencies in a diploid population. Mol 62 van den Oord EJ, Sullivan PF, Jiang Y, Walsh D, O’Neill FA, Biol Evol 1995; 12: 921–927. Kendler KS et al. Identification of a high-risk haplotype for the 84 Spielman RS, McGinnis RE, Ewens WJ. Transmission test for dystrobrevin binding protein 1 (DTNBP1) gene in the Irish study linkage disequilibrium: the insulin gene region and insulin- of high-density schizophrenia families. Mol Psychiatry 2003; 8: dependent diabetes mellitus (IDDM). Am J Hum Genet 1993; 52: 499–510. 506–516. 63 Van Den Bogaert A, Schumacher J, Schulze TG, Otte AC, Ohlraun 85 Rioux JD, Karinen H, Kocher K, McMahon SG, Karkkainen P, S, Kovalenko S et al. The DTNBP1 (dysbindin) gene contributes Janatuinen E et al. Genomewide search and association studies in to schizophrenia, depending on family history of the disease. Am a Finnish celiac disease population: Identification of a novel J Hum Genet 2003; 73: 1438–1443. locus and replication of the HLA and CTLA4 loci. Am J Med 64 Tang JX, Zhou J, Fan JB, Li XW, Shi YY, Gu NF et al. Family-based Genet A 2004; 130: 345–350. association study of DTNBP1 in 6p22.3 and schizophrenia. Mol 86 Morris JA, Gardner MJ. Calculating confidence intervals for Psychiatry 2003; 8: 1008. relative risks (odds ratios) and standardised ratios and rates. Br 65 Williams NM, Preece A, Morris DW, Spurlock G, Bray NJ, Med J (Clin Res Ed) 1988; 296: 1313–1316. Stephens M et al. Identification in 2 independent samples of a 87 Middleton FA, Pato CN, Gentile KL, McGann L, Brown AM, novel schizophrenia risk haplotype of the dystrobrevin binding Trauzzi M et al. Gene expression analysis of peripheral blood protein gene (DTNBP1). Arch Gen Psychiatry 2004; 61: 336–344. leukocytes from discordant sib-pairs with schizophrenia and 66 Okada M, Corfas G. Neuregulin1 downregulates postsynaptic bipolar disorder reveals points of convergence between genetic GABAA receptors at the hippocampal inhibitory synapse. and functional genomic approaches. Am J Med Genet B Hippocampus 2004; 14: 337–344. Neuropsychiatr Genet 2005; 136: 12–25. 67 Benson MA, Newey SE, Martin-Rendon E, Hawkes R, Blake DJ. 88 Falconer DS, MacKay TFC. Introduction to Quantitative Genetics. Dysbindin, a novel coiled-coil-containing protein that interacts Prentice-Hall: Harlow, 1996. with the dystrobrevins in muscle and brain. J Biol Chem 2001; 89 Mootha VK, Lindgren CM, Eriksson KF, Subramanian A, Sihag S, 276: 24232–24241. Lehar J et al. PGC-1alpha-responsive genes involved in oxidative 68 Peters MF, O’Brien KF, Sadoulet-Puccio HM, Kunkel LM, Adams phosphorylation are coordinately downregulated in human ME, Froehner SC. Beta-dystrobrevin, a new member of the diabetes. Nat Genet 2003; 34: 267–273. dystrophin family. Identification, cloning, and protein associa- 90 Reiner A, Yekutieli D, Benjamini Y. Identifying differentially tions. J Biol Chem 1997; 272: 31561–31569. expressed genes using false discovery rate controlling proce- 69 Knuesel I, Mastrocola M, Zuellig RA, Bornhauser B, Schaub MC, dures. Bioinformatics 2003; 19: 368–375. Fritschy JM. Short communication: altered synaptic clustering of 91 Su AI, Cooke MP, Ching KA, Hakak Y, Walker JR, Wiltshire T et al. GABAA receptors in mice lacking dystrophin (mdx mice). Eur J Large-scale analysis of the human and mouse transcriptomes. Neurosci 1999; 11: 4457–4462. Proc Natl Acad Sci USA 2002; 99: 4465–4470. 70 Lo WS, Lau CF, Xuan Z, Chan CF, Feng GY, He L et al. 92 Su AI, Wiltshire T, Batalov S, Lapp H, Ching KA, Block D et al. A Association of SNPs and haplotypes in GABAA receptor beta2 gene atlas of the mouse and human protein-encoding transcrip- gene with schizophrenia. Mol Psychiatry 2004; 9: 603–608. tomes. Proc Natl Acad Sci USA 2004; 101: 6062–6067. 71 Nurnberger Jr JI, Blehar MC, Kaufmann CA, York-Cooler C, 93 DeRisi JL, Iyer VR, Brown PO. Exploring the metabolic and Simpson SG, Harkavy-Friedman J et al. Diagnostic interview for genetic control of gene expression on a genomic scale. Science genetic studies. Rationale, unique features, and training. NIMH 1997; 278: 680–686. Genetics Initiative. Arch Gen Psychiatry 1994; 51: 849–859; 94 Spellman PT, Sherlock G, Zhang MQ, Iyer VR, Anders K, Eisen discussion 863–864. MB et al. Comprehensive identification of cell cycle-regulated 72 McGuffin P, Farmer A, Harvey I. A polydiagnostic application of genes of the yeast Saccharomyces cerevisiae by microarray operational criteria in studies of psychotic illness. Development hybridization. Mol Biol Cell 1998; 9: 3273–3297. and reliability of the OPCRIT system. Arch Gen Psychiatry 1991; 95 Hakak Y, Walker JR, Li C, Wong WH, Davis KL, Buxbaum JD et al. 48: 764–770. Genome-wide expression analysis reveals dysregulation of 73 Purcell S, Cherny SS, Sham PC. Genetic power calculator: design myelination-related genes in chronic schizophrenia. Proc Natl of linkage and association genetic mapping studies of complex Acad Sci USA 2001; 98: 4746–4751. traits. Bioinformatics 2003; 19: 149–150. 96 Mirnics K, Middleton FA, Marquez A, Lewis DA, Levitt P. 74 Pritchard JK, Rosenberg NA. Use of unlinked genetic markers to Molecular characterization of schizophrenia viewed by micro- detect population stratification in association studies. Am J Hum array analysis of gene expression in prefrontal cortex. Neuron Genet 1999; 65: 220–228. 2000; 28: 53–67. 75 Freedman ML, Reich D, Penney KL, McDonald GJ, Mignault AA, 97 Vawter MP, Crook JM, Hyde TM, Kleinman JE, Weinberger DR, Patterson N et al. Assessing the impact of population stratifica- Becker KG et al. Microarray analysis of gene expression in the tion on genetic association studies. Nat Genet 2004; 36: 388–393. prefrontal cortex in schizophrenia: a preliminary study. Schi- 76 Sklar P, Schwab SG, Williams NM, Daly M, Schaffner S, Maier W zophr Res 2002; 58: 11–20. et al. Association analysis of NOTCH4 loci in schizophrenia 98 Torrey EF, Webster M, Knable M, Johnston N, Yolken RH. The using family and population-based controls. Nat Genet 2001; 28: Stanley Foundation brain collection and Neuropathology Con- 126–128. sortium. Schizophr Res 2000; 44: 151–155.

Molecular Psychiatry 5q GABAA receptor genes confer schizophrenia risk TL Petryshen et al 1088 99 Turunen JA, Paunio T, Ekelund J, Suhonen J, Varilo T, Patrtonen 104 Vawter MP, Ferran E, Galke B, Cooper K, Bunney WE, Byerley W. T et al. Association of GABRG2 gene variants with susceptibility Microarray screening of lymphocyte gene expression differences to schizophrenia. Am J Med Genet 2003; 122B:18. in a multiplex schizophrenia pedigree. Schizophr Res 2004; 67: 100 Laurie DJ, Wisden W, Seeburg PH. The distribution of thirteen 41–52. GABAA receptor subunit mRNAs in the rat brain. III. Embryonic 105 Perl O, Ilani T, Strous RD, Lapidus R, Fuchs S. The alpha7 and postnatal development. J Neurosci 1992; 12: 4151–4172. nicotinic acetylcholine receptor in schizophrenia: decreased 101 Wisden W, Laurie DJ, Monyer H, Seeburg PH. The distribution of mRNA levels in peripheral blood lymphocytes. FASEB J 2003; 13 GABAA receptor subunit mRNAs in the rat brain. I. 17: 1948–1950. Telencephalon, diencephalon, mesencephalon. J Neurosci 1992; 106 Tian J, Chau C, Hales TG, Kaufman DL. GABAA receptors 12: 1040–1062. mediate inhibition of T cell responses. J Neuroimmunol 1999; 96: 102 Mirnics K, Middleton FA, Lewis DA, Levitt P. Analysis of 21–28. complex brain disorders with gene expression microarrays: 107 Erdo SL, Wolff JR. Gamma-aminobutyric acid outside the schizophrenia as a disease of the synapse. Trends Neurosci mammalian brain. J Neurochem 1990; 54: 363–372. 2001; 24: 479–486. 108 Flames N, Long JE, Garratt AN, Fischer TM, Gassmann M, 103 Middleton FA, Mirnics K, Pierri JN, Lewis DA, Levitt P. Gene Birchmeier C et al. Short- and long-range attraction of cortical expression profiling reveals alterations of specific metabolic GABAergic interneurons by neuregulin-1. Neuron 2004; 44: pathways in schizophrenia. J Neurosci 2002; 22: 2718–2729. 251–261.

Supplementary Information accompanies the paper on the Molecular Psychiatry website ( http://www.nature.com/mp)

Molecular Psychiatry