Grb10 Is Involved in BCR-ABL-Positive Leukemia in Mice

ORIGINAL ARTICLE Grb10 is involved in BCR-ABL-positive leukemia in mice

AL Illert1,4, C Albers1,2,4, S Kreutmair1, H Leischner2,3, C Peschel2, C Miething1 and J Duyster1

The SH2-containing adaptor protein Grb10 was first identified in a yeast screen as a new binding partner for BCR-ABL and associates with BCR-ABL in a tyrosine-dependent manner. However, its function in BCR-ABL-mediated leukemogenesis in vivo is still unknown. Here we describe an important role of Grb10 in BCR-ABL-induced leukemia by using a versatile system for efficient oncogene expression and simultaneous Grb10 knockdown from a single vector. Primary bone marrow (BM) cells coexpressing Grb10-miR/BCR-ABL showed a significant decrease in colony formation and cell cycle progression. Transplantation of Grb10miR/ BCR-ABL- or control-miR/BCR-ABL- transduced BM leads to a CML/B-ALL-like phenotype with significantly delayed disease onset and progression resulting in prolonged overall survival in Grb10-miR-transplanted mice. Methylcellulose experiments exhibit additive effects of imatinib treatment and Grb10 knockdown. Cell cycle analysis suggests an anti-proliferative effect of Grb10 knockdown in BCR-ABL+ primary BM cells. However, Grb10 abrogation was not capable of completely abolishing the BCR-ABL- induced disease. Our findings were confirmed in the human BCR-ABL+ cell line K562, where we demonstrate reduced viability, cell cycle progression and induction of apoptosis by stable Grb10 microRNA expression. Taken together, our results suggest that Grb10 knockdown in vivo leads to impaired proliferation, longer survival and reduced colony formation, suggesting an important role of Grb10 in BCR-ABL-mediated leukemogenesis.

Leukemia (2015) 29, 858–868; doi:10.1038/leu.2014.283

INTRODUCTION kinases have been identified so far. Association of Grb10 has been The development of the BCR-ABL inhibitor imatinib had a great described for cell membrane receptor tyrosine kinases like impact on the treatment of BCR-ABL-induced hematologic epidermal growth factor receptor, insulin-like growth factor 20 malignancies.1 However, there are two major problems in receptor, platelet-derived growth factor receptor β and c-KIT as well as intracellular kinases like Raf1, MEK1, Akt,21 the imatinib-based therapies for patients with chronic myeloid 22 23 leukemia (CML). One is that suppression of the disease relies on regulatory subunit of PI3K p85, Src and Fyn. Moreover, 2,3 Grb10 is also capable of interacting with other proteins like the continuous and lifelong imatinib therapy. The other major 24 problem is the relapse of disease owing to emerged imatinib E3 ubiquitin ligase Nedd4, the pro-apoptotic protein Bim L and resistance, occurring through a variety of mechanisms, including the regulatory molecule 14-3-3. Through these variety of interactions Grb10 has a versatile role in different cellular Abl kinase domain mutations and amplification or overexpression processes including regulation of cellular growth, apoptosis, of BCR-ABL.4,5 metabolism and cell migration. Disruption of the maternal allele Further development of second generation Abl tyrosine kinase – of Grb10 in mice results in embryonic and placental overgrowth inhibitors like nilotinib and dasatinib improved CML therapy,6 12 leading to the birth of 30% heavier pups,25 adult Grb10 knockout but the persistence of BCR-ABL-positive cells in patients indicate mice show increased muscle mass and reduced adipositas with that inhibition of the Abl kinase activity alone might not be improved glucose clearance26,27 pointing to an important role of sufficient to eradicate the leukemia-initiating cell. Thus, identifica- fi Grb10 in maintaining normal growth of mice. tion of additional targets could signi cantly improve CML therapy. Interestingly, recent studies suggest an involvement of Grb10 in Inhibitors that target various stages of BCR-ABL signaling pathway, cancer development, whereas Grb10 has been shown to be such as Aurora kinase, MEK1, PI3K, mTOR and CDKs have been downregulated in different solid tumor types like bladder, brain or shown in vitro to have synergistic or additive effects in preventing breast cancer,28 it is upregulated in cervical squamous cell 13–18 BCR-ABL mediated transformation. Inhibitors for Aurora carcinoma29 and in several leukemias like acute myeloid 19 kinases, Smo-1/Hedgehog, farnesyl transferase, mTOR and CDK leukemia,30,31 acute promyelocytic leukemia32 and CML.33 Further- have already entered clinical trials. However, identification of more, oncogenic tyrosine kinases can signal via Grb10 thereby essential components by an in vivo approach remains crucial for mediating cytokine-independent growth and cell proliferation: the developing validated, improved therapies for CML with eradica- Grb10 protein was not only shown to be essential for the in vitro tion of the malignant clone. BCR-ABL-induced transformation of fibroblast and hematopoietic Here we focus on the BCR-ABL target growth factor receptor- cells,34 but recently also described as an important player in FLT3- bound protein Grb10, an adaptor protein interacting with specific ITD leukemogenesis. Grb10 constitutively associates with onco- receptors and recruiting other signaling proteins. Grb10 belongs genic FLT3-ITD resulting in higher STAT5 and AKT activation in to the Grb7 family of adaptor proteins and multiple interacting hematopoietic cells and increased colony formation in semisolid

1Department of Hematology/Oncology, University Medical Center Freiburg, Freiburg, Germany; 2Department of Internal Medicine III, Klinikum Rechts der Isar, Technical University of Munich, Munich, Germany and 3Department of Hematology, Oncology, and Tumor Immunology, HELIOS Klinikum Berlin-Buch, Berlin, Germany. Correspondence: Dr AL Illert, Department of Hematology/Oncology, University Medical Center Freiburg, Hugstetter Strasse 55, 79106 Freiburg, Germany. E-mail: [email protected] 4These authors contributed equally to this work. Received 8 June 2014; revised 14 August 2014; accepted 5 September 2014; accepted article preview online 24 September 2014; advance online publication, 21 October 2014 Role of Grb10 in leukemia AL Illert et al 859 culture.31 However, the significance of these encouraging in vitro Transduction of murine bone marrow and syngeneic findings need to be elucidated in a relevant mouse model in vivo. transplantation model This study describes a crucial role of Grb10 in BCR-ABL- Murine bone marrow (BM) was collected and transduced as described mediated leukemia in mice by utilizing a retroviral vector system previously.37 Briefly, BM was harvested from female BALB/c donor mice for the dual downregulation of Grb10 with coupled BCR-ABL 4 days after injection of 150 mg/kg 5-fluorouracil (5-FU; Medac) and expression. prestimulated overnight in BBMM medium (IMDM, 30% fetal calf serum, 1% bovine serum albumin) containing growth factors (10 ng/ml mIL-3, 10 ng/ml mIL-6, 50 ng/ml mSCF). Cells were transduced by four rounds of MATERIALS AND METHODS spin infection (1200g, 32 °C, 90 min) every 12 h in retroviral supernatant (viral titers of 2–8×104) supplemented with growth factors, 4 g/ml Growth factors and antibodies polybrene (Sigma-Aldrich) and 20% BBMM. Infection efficiency was Recombinant murine Interleukin-3 (IL-3), IL-6 and SCF were purchased determined by FACS analysis 12 h after last spin infection round and from R&D Systems (Minneapolis, MN, USA). BCR-ABL and ABL was detected adjusted to 10% EGFP-positive cells. The median EGFP intensity was by immunoblotting using an ABL-specific antibody 8E9 (BD Biosciences, comparable, indicating comparable oncogene expression levels. Subse- San Jose, CA, USA) and actin antibody was purchased from Sigma-Aldrich quently, cells were resuspended in HBSS (Sigma-Aldrich) and were used for (AC-15, St Louis, CA, USA). Tyrosine phosphorylation was detected using methylcellulose assays or for transplantation. For transplantation, cells monoclonal anti-phosphotyrosine antibody 4G10 (Millipore, Billerica, MA, were mixed with untransduced BM to adjust to 2.5% EGFP+ cells (5000 USA) and PY20 (BD Biosciences). Grb10 antibodies (K-20 and A-18) came EGFP+ cells with 195 000 EGFP− cells), and injected into the tail veins of from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Fluorescence- lethally irradiated female BALB/c recipient mice. Animals that received a activated cell sorting (FACS) antibodies (anti-CD45, anti-Thy1.2, anti-B220, transplant were monitored for signs of disease development by serial anti-Mac-1, anti-Gr-1, anti-CD19) were from eBioscience (San Diego, CA, measurements of peripheral blood counts. Mice were caged in special USA) and used as directed. caging system with autoclaved food and acidified water at the Technical University of Munich in accordance with national and institutional Plasmids guidelines for animal care. pCDNA 3.1 BCR-ABL was described previously.35 pLMP miRCtrl, pLMP miRmGrb10 and pLMP miRhGrb10 were generated by subcloning the target- Clonal growth in methylcellulose specific hairpin sequence from pSM2c (Catalog number RHS1707 To analyze clonal growth, retrovirally transduced BM cells were plated in Non-silencing shRNA vector for miRCtrl, oligo-ID V2MM_71217 for murine MethoCult #3234 or #3434 (StemCell Technologies, Vancouver, BC, Canada) Grb10 miRGrb10/1 and oligo-ID V2MM_63534 for murine Grb10 miRGrb10/2 supplemented with imatinib (final concentration from 100 nM to 2 μM)or (Openbiosystems upon BioCat, Heidelberg, Germany) to pLMP according puromycine. EGFP+ BM cells (0.5–1×103 ) in 1 ml of methylcellulose to the manufacturer’s instructions. In further experiments, Grb10 miRGrb10/1 medium per 12 wells were plated in duplicates or quadruplicates and sequence was used for efficient knockdown. pMmiRTOI-BCR-ABL was the colonies were photographed and counted on day 10 (#3234) or day 8 cloned in as described previously.36 The 21 mer sequence for human (#3434). Grb10 miRhGrb10 was calculated using the siRNA prediction software biopredsi (www.biopredsi.org, developed by Novartis Institutes for Quantitative PCR BioMedical Research, provided by Friedrich Miescher Institute for RNA from cell lines and primary BM was isolated with the RNeasy Mini Kit Biomedical Research) and were adapted to miR30-based shRNA according (QIAGEN, Venlo, Netherlands). cDNA was generated using the Titan One to pLMP manufacturer’s instructions. Oligonucleotide sequence serving as Tube RT-PCR Kit (Roche Applied Science, Basel, Switzerland). Quantitative PCR template was: 5′-TGCTGTTGACAGTGAGCGACACAGGATCATTAAACAGC real-time PCR was performed using Platinum SYBR Green qPCR SuperMIX AATAGTGAAGCCACAGATGTATTGCTGTTTAATGATCCTGTGGTGCCTACTGCC fi ′ UDG (Invitrogen) using primers speci c for murine glyceraldehyde TCGGA-3 3-phosphate dehydrogenase (fw: 5′-GGTCATCCCAGAGCTGAACGG-3′; rev: 5′-CCTGCTTCACCACCTTCTTG-3′) and murine Grb10 (fw: 5′-GACCTGGAAGA Cell culture AAGCAGCAT-3′; rev: 5′-CTTCGCTTTGTTTGGCTTGA-3′). The IL-3-dependent murine myeloid cell line 32D and the IL-3-dependent mouse pro-B cell line Ba/F3 (DSMZ, Braunschweig, Germany) were cultured Cell cycle analysis and cell viability assays in RPMI 1640 (PAA Laboratories, Pasching, Austria) supplemented with For EdU incorporation and DNA content analysis, cells (either primary BM 10% fetal calf serum (PAA Laboratories), 2 ng/ml IL-3, penicillin/strepto- cells grown for 48 h after infection in BBMM without cytokines or primary mycin and L-glutamine. Phoenix E helper virus-free ecotropic packaging BM cells of colony-forming cell plates washed out the methylcellulose cells (G. Nolan, Stanford, CA, USA) and NIH/3T3 (DSMZ) cells were 7 days after plating) were pulsed with 10 μM EdU (Life Technologies, fi maintained in Dulbecco's modi ed medium (DMEM, PAA Laboratories) Carlsbad, CA, USA) for 60 min and subsequently stained using the kit supplemented with 10% fetal calf serum. Cells were cultured in a directions (AlexaFluor 647 Click-iT kit, Life Technologies). Click-treated fi humidi ed incubator at 37 °C with 5% CO2. Puromycin for selection was cells were treated with Fx Cycle violet according to the manufacturer’s fi μ used in a nal concentration of 2 g/ml. protocol (Life Technologies). Cell cycle distribution was determined by flow cytometry and subsequent analysis using the FlowJo software (Tree Star Inc., Ashland, OR, USA). Retrovirus preparation and generation of cell lines Ctrl hGrb10 6 Cell viability of K562 pLMP miR or pLMP miR in the presence of 2×10 Phoenix E cells were plated on 60-mm dishes and transiently 20 0/100/200/300/500 nM imatinib was analyzed as described previously. transfected using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) 18 h Samples were measured in triplicate after 0, 24, 48, 72 and 96 h of culture, later according to the manufacturer’s instructions. Medium was replaced measurement was terminated after reaching a saturated OD (492 nm) after 12 h and retroviral stocks were collected at 12-h intervals beginning of 1.0. 24 h after transfection. Retroviral titers were determined by transduction of 5×104 NIH/3T3 cells with serial dilutions of retrovirus supplemented with 4 g/ml polybrene (Sigma-Aldrich). The 48-h post-transduction percentage Annexin/7-AAD assays of infected cells was determined by flowcytometric analysis of enhanced For Annexin V/ 7-AAD assays, cells were stained with Annexin V–PE and green fluoroscent protein (EGFP) expression. Titer was calculated by the 7-AAD and evaluated for apoptosis by flow cytometry according to the multiplication of the total number of EGFP-positive cells with dilution manufacturer’s protocol (eBioscience). Briefly, cells were washed twice with factor of the respective retroviral supernatant. To generate stable retroviral phosphate-buffered saline, stained with 5 μl of Annexin V–PE in 1 × infected cell lines derived from 32D, Ba/F3 or K562 (expressing the binding buffer (10 mM HEPES, pH 7.4, 140 mM NaOH, 2.5 mM CaCl2) for ecotrophic receptor) cell line origin, 5 × 104 cells were transduced by 2–4 15 min at room temperature in the dark, washed again and stained with rounds of spin infection (1200 g, 32 °C, 90 min) every 12 h in retroviral 5 μl 7-AAD for 15 min at 4°. The apoptotic cells were determined using a supernatant supplemented with 2 ng/ml IL-3, 4 g/ml polybrene (Sigma- CyAn ADP flow cytometer (Beckman Coulter, Pasadena, CA, USA) and Aldrich), and 10% RPMI 1640. analyzed by FlowJo software (Tree Star Inc.).

© 2015 Macmillan Publishers Limited Leukemia (2015) 858 – 868 Role of Grb10 in leukemia AL Illert et al 860 RESULTS oncogene expression with stable knockdown of Grb10 at the A retroviral vector system coupling Grb10 knockdown to BCR-ABL same time. Therefore, we cloned two different miR30-based Grb10 expression shRNAs (miRGrb10) into the retroviral pLMP vector, transduced Grb10 is upregulated in BM upon BCR-ABL expression (Figures 1a these constructs into NIH/3T3 ﬁbroblasts and assessed the and b). To investigate the impact of Grb10 on BCR-ABL-mediated resulting cell populations for the knockdown of Grb10. The pLMP Grb10/1 transformation, we established a system to combine BCR-ABL miR was more effective at suppressing Grb10 protein

Figure 1. A retroviral vector system enabling Grb10 downregulation in every BCR-ABL-expressing cell. (a,b) Grb10 upregulation by BCR-ABL expression. BM cells from 5-FU pretreated donor Balb/C mice were retrovirally infected with MIG empty vector or MIG BCR-ABL. Cells were cultivated for 6 days in growth factor supplemented BBMM medium and starved overnight in 3% fetal calf serum containing medium without cytokines before analysis by quantitative real-time (qRT)-PCR (a). Grb10 expression levels were normalized to the housekeeping gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and analysis was performed in duplicate. For western blot analyses (b) BM was cultured for 3 days after retroviral infection without cytokines (in case of MIG BCR-ABL) and with cytokines (in case of MIG empty), harvested and subjected to immunoblotting as indicated. (c) Western blot analysis of NIH/3T3 cells transduced with different Grb10 miRs in pLMP after puromycin selection. Because of efficient knockdown all further experiments were performed with Grb10 miR1. (d) Schematic representation of the single-vector design of pMmiRTOI-BCR-ABL. BCR-ABL and a miR30-based TOI-specific shRNA are expressed from the same RNA Pol II promoter long terminal repeat. EGFP is expressed via an internal ribosomal entry site (IRES). The DNA is transcribed by RNA Pol II resulting in one unique mRNA transcript encoding for target-specific miR, oncogene and EGFP as a fluorescent marker. Dicer processes miR30 sequence of the transcript or ribosomes initiate translation of the oncogene and EGFP. Provirus layouts are shown with open arrows indicating active promoters and two inverted block arrows representing shRNA stem sequence. (e) NIH/3T3 cells retrovirally infected with pMmiRGrb10/2-BCR- ABL or pMmiRCtrl-BCR-ABL construct. (f) 32D cells or 5-FU-enriched mouse BM-derived progenitor cells were infected either with pMmiRCtrl- BCR-ABL or pMmiRGrb10/2-BCR-ABL retrovirus. Expression levels of Grb10 were analyzed by quantitative real time PCR in EGFP cells 5 days after transduction. Results were normalized to the housekeeping gene GAPDH.

Figure 2. Grb10 depletion abolishes BCR-ABL-induced transformation of hematopoitic stem cels in vitro.(a,b) 5-FU-enriched mouse BM-derived progenitor cells were infected either with pMmiRCtrl-BCR-ABL or pMmiRGrb10-BCR-ABL retrovirus and plated in methylcellulose without growth factors in the absence or presence of imatinib as indicated. CFUs were quantified 10 days after plating, results shown are from one of three independent experiments performed in duplicates (a). P-values were determined by Student's t-test. Representative photographs in different magnifications of methylcellulose colonies of pMmiRCtrl-BCR-ABL or pMmiRGrb10-BCR-ABL-transduced BM cells are shown in (b). FACS analyses of the BCR-ABL infected BM 7 days after seeding in methylcellulose (c) demonstrated mainly myeloid (Mac-1 and Gr-1-positive cells), but also some lymphoid cells (CD19 and Thy1.2-positive cells) independently of Grb10 knockdown. (d) Colony-forming ability of 5-FU enriched mouse BM cells transduced with pLMP miRCtrl or pLMP miRGrb10 in methylcellulose medium supplemented with growth factors and puromycin. CFUs from four plates per construct were quantified 9 days after plating. P-value was determined by Student's t-test.

© 2015 Macmillan Publishers Limited Leukemia (2015) 858 – 868 Role of Grb10 in leukemia AL Illert et al 862 expression than pLMP miRGrb10/2, producing nearly undetectable out of the methylcellulose 7 days after seeding and subjected to Grb10 levels assessed by immunoblotting (Figure 1c). FACS analyses with the indicated antibodies. As shown in In contrast to conventional shRNAs, transcription of miR30- Figure 2d, EGFP+ colonies were mainly positive for myeloid based shRNAs can be driven by strong Pol II promoters. To take markers (87% Mac-1+ and 70% Gr-1+ in pMmiRCtrl-BCR-ABL- vs advantage of this property we generated a retroviral vector 82% Mac-1+ and 59% Gr-1+ in pMmiRGrb10-BCR-ABL infected BM encoding for BCR-ABL and miRGrb10 or miRCtrl on a shared cells), but some colonies where also from B-cell or T-Cell origin mRNA transcript (pMmiRCtrl-BCR-ABL and pMmiRGrb10-BCR-ABL (12% CD19+ and 23% Thy1.2+ in pMmiRCtrl-BCR-ABL- vs 19% Figure 1d). NIH/3T3 cells were transduced with these constructs CD19+ and 17% Thy1.2+ in pMmiRGrb10-BCR-ABL infected BM cells) and its functionality was verified. In this vector background, Grb10 suggesting a mixed disease (CML/B-ALL) phenotype with a was strongly downregulated by the miRGrb10, and BCR-ABL general anti-proliferative effect of Grb10 knockdown in BCR-ABL- expression was detectable on protein level (Figure 1e), indicating induced leukemogenesis, which is not restricted to a specific that the fusion of a miR30-based shRNA to the BCR-ABL mRNA hematopoietic lineage. does neither disturb gene expression of BCR-ABL nor knocks down Two-dimensional dynamic cell cycle analyses (Figure 3a) of the target. We also determined the vector system in the murine pMmiRGrb10-BCR-ABL and pMmiRCtrl-BCR-ABL infected BM cells myeloid cell line 32D and in primary murine BM cells by retroviral grown either in colony-forming cell plates or kept in liquid culture infection. Transduced primary BM and 32D cells were then sorted for 2 days after retroviral infection substantiate the anti-proliferative for EGFP positivity, subjected to quantitative real-time PCR and as role of Grb10 downregulation: primary murine BM cells infected seen in Figure 1f, we could show a significant downregulation of with pMmiRGrb10-BCR-ABL showed a significantly reduced EdU Grb10 to about 25% of control siRNA levels in this primary cellular uptake with a reduced proportion of cells in S-phase and a background. concomitant increase in the G1/0-population in comparison with Together, these data demonstrate that miR30-based shRNAs primary BM cells infected with pMmiRCtrl-BCR-ABL (Figure 3b). expressed together with BCR-ABL oncogene on one sole mRNA Moreover, we were able to show that Grb10 has also anti-apoptotic driven by the Pol II promoter long terminal repeat are effective in function in BCR-ABL-positive murine BM cells by Annexin/7-AAD- both: strong target gene knockdown and expression of the BCR- Stainings. Murine primary BM cells infected with pMmiRGrb10- ABL oncogene. Transduced cells cannot select for the expression BCR-ABL grown in methylcellulose for 7 days show a distinct of miRGrb10 or BCR-ABL, making this vector system a versatile tool upregulation of early apoptotic cells in comparison with BM cells to investigate the role of Grb10 on BCR-ABL-driven CML in a infected with pMmiRCtrl-BCR-ABL (Supplementary Figure 1). relevant murine system. Inactivation of Grb10 by RNAi delays the onset of leukemia in a Grb10 is crucial for BCR-ABL-dependent transformation of murine model of CML hematopoietic cells in vitro To test the impact of Grb10 for BCR-ABL-mediated leukemogen- We next investigated the role of Grb10 in the BCR-ABL-dependent esis in vivo, we next generated mice developing BCR-ABL-positive transformation of murine hematopoietic stem and progenitor cells leukemia by the retroviral syngeneic transplantation method. in an in vitro colony-formation assays in methylcellulose. Here, Therefore, BM derived from 5-FU pretreated donor mice was cells derived from 5-FU pretreated murine Balb/C BM were infected with pMmiRGrb10-BCR-ABL or pMmiRCtrl-BCR-ABL retro- transduced with pMmiRGrb10-BCR-ABL or pMmiRCtrl-BCR-ABL retro- viruses via spin infection. After FACS analyses, 5000 EGFP-positive virus and then plated in methylcellulose in the absence of growth BM cells were intravenously injected into the tail vain of lethally factors and in the presence of different concentrations of imatinib. irradiated recipient Balb/C mice (see material and methods, for Under these conditions, pMmiRCtrl-BCR-ABL and pMmiRGrb10-BCR- summary of all transplants see Supplementary Table 1). All mice ABL-transformed cells were able to form verifiable colonies receiving pMmiRCtrl-BCR-ABL infected cells developed a leukemia- (Figure 2a, counted 10 days after plating), whereas BM cells like disease with a short latency and 100% penetrance (Figure 4a) transfected with pLMP miRGrb10 or pLMP miRCtrl were not able to characterized by a rising peripheral blood leukocyte (white blood form colonies under these conditions (data not shown). In cell, WBC) count within the first 3 weeks after transplantation comparison with pMmiRCtrl-BCR-ABL cells, colony formation with- (Figure 4b). The mice succumbed to leukemia within 5 weeks after out growth factors of pMmiRGrb10-BCR-ABL cells was significantly transplantation, demonstrating that the pMmiRCtrl-BCR-ABL con- reduced fivefold. Furthermore, these effects were even poten- struct is efficiently inducing a CML-like disease in this murine tiated by adding imatinib, which potently suppressed colony retroviral transduction/ transplantation model. Recipients of formation in hematopoietic stem and progenitor cells expressing pMmiRGrb10-BCR-ABL-transduced BM cells showed a substantially BCR-ABL with control siRNA with an IC50 of ≈100 nM, whereas BCR- prolonged survival (P-value = 0.0032; Figure 4a) with a median ABL expressing Grb10-knockdown cells were significantly sensi- survival of 36 vs 25 days in the pMmiRCtrl-BCR-ABL BM tized displaying a decrease in imatinib IC50 to 30 nM (Figure 2a). To transplanted mice. The onset and progression of the disease exclude general toxicity of Grb10 knockdown in hematopoietic was significantly delayed in Grb10-knockdown animals as progenitor cells, we tested the effect of solely Grb10 down- depicted by lower proportion of WBC on all taken time points regulation without BCR-ABL oncogene expression on normal (day 6,11,15,19 and 22 after transplantation) with the most hematopoiesis in vitro. Upon knock down of Grb10 by pLMP prominent difference at day 22 after transplantation were miRGrb10/1, there was no significant difference in control siRNA recipients of pMmiRGrb10-BCR-ABL transduced BM cells showed a infected BM cells, observable regarding colony-formation ability in WBC count of 40 000 g/l, whereas mice transplanted with semisolid medium supplemented with growth factors (Figure 2b). pMmiRCtrl-BCR-ABL BM had a WBC count of 4300 000 g/l To further investigate the differences in the phenotype of grown (Figure 4b). A representative blood smear (Pappenheim stain of colonies from pMmiRCtrl-BCR-ABL vs pMmiRGrb10-BCR-ABL infected day 18) of both the groups is shown in Figure 4c. Mice of both primary BM cells we examined the colony type as well as the groups were killed when moribund and spleen size was immunphenotype by FACS analyses 7 days after plating. As seen determined. As seen in Figure 4d, the animals transplanted with in Figure 2c colony-forming cell plates consist mainly of GFU-Gs, pMmiRCtrl-BCR-ABL BM show distinct splenomegaly, which was CFU-GMs and CFU-Bs independently of Grb10 expression. To significantly reduced in recipient transplanted with pMmiRGrb10- further verify these data, we performed immunphenotyping of the BCR-ABL transduced BM cells (790 vs 420 mg, P-value = 0.017). colony-forming cell plates. Therefore, colonies of pMmiRCtrl-BCR- In addition, the leukemia burden represented by lower ABL and pMmiRGrb10-BCR-ABL infected primary BM were washed proportion of leukemic WBC in the peripheral blood was

Figure 3. Grb10 knockdown has anti-proliferative and pro-apoptotic effects in BCR-ABL transduced primary murine BM. (a) 5-FU-enriched mouse BM-derived progenitor cells were infected either with pMmiRCtrl-BCR-ABL or pMmiRGrb10-BCR-ABL retrovirus and either kept without cytokines in liquid culture for 2 days or plated in methylcellulose without growth factors. Seven days after seeding (for methylcellulose), or 2 days after infection (for liquid culture) cells were pulsed for 60 min with EdU and harvested. After overnight ﬁxation EdU staining was performed and EGFP-positive cells were analyzed for EdU uptake as well as Fx Cycle violet stain. (b) Quantiﬁcation of three independent 2-dimensional cell cycle analyses from methylcellulose and liquid culture assays. P-value was determined by Student's t-test. *Po0.05.

Figure 4. Grb10 is crucial for BCR-ABL-mediated leukemogenesis in vivo.(a) Grb10 knockdown in BCR-ABL-positive cells signiﬁcantly prolongs the overall survival of mice in a retroviral BM transduction/transplantation model. Kaplan–Meier plot detailing survival times of mice transplanted with pMmiRCtrl-BCR-ABL or pMmiRGrb10-BCR-ABL (n = 10) in three independent experiments. P-value was determined by log-rank test. (b) WBC counts from the peripheral blood (PB) of mice that received transplants of one experiment at indicated time points (n = 3for each group). (c) Representative microphotographs of Pappenheim stained PB smears illustrating the resulting pathologies at day 18 post transplantation. (d) Cumulative spleen weight comparison. Animals were killed when moribund and spleen size was determined (n = 2). P-value was determined by Student's t-test.

© 2015 Macmillan Publishers Limited Leukemia (2015) 858 – 868 Role of Grb10 in leukemia AL Illert et al 864 significantly reduced in Grb10-knockdown leukemic mice com- (3.946 fold change; P=0.001).40 The fact that Grb10 was scoring in pared with mice receiving pMmiRCtrl-BCR-ABL infected BM: on day all three studies among the 4% top upregulated genes highlights 19 post transplantation 80% of peripheral WBCs expressed BCR- the importance of the adaptor protein. ABL recognized by EGFP-expression, whereas the WBC population In further analyses we asked whether Grb10 expression is expressing BCR-ABL with simultaneously Grb10 knockdown could dependent on BCR-ABL in CML cells, and therefore performed only expand to 32% pointing to an effective anti-proliferative immunoblot analyses with imatinib-treated K562 cells. As shown effect by Grb10 knockdown in BCR-ABL-induced leukemogenesis in Figure 6g, Grb10 steady state protein levels are reduced by the in vivo (Figure 5a). inhibition of BCR-ABL kinase activity, suggesting that BCR-ABL However, Grb10 abrogation was not capable of completely kinase activity leads to the induction of Grb10 as an anti-apoptotic abolishing the BCR-ABL-induced disease in these mice and and growth-promoting protein in BCR-ABL-positive cells. interestingly both Ctrl and Grb10-knockdown animals showed the same mixed disease phenotype with Mac-1+/EGFP+, Gr-1+/ DISCUSSION EGFP+ and B220+/EGFP+ cells as seen in the immunphenotyping analyses of the peripheral blood taken 2 days before the mice In a genetically complex disease like leukemia, which is further were killed (Figure 5b). Immunphenotyping of the spleen complicated by the diverse interactions between leukemic cell confirmed the mixed phenotype in both the transplanted groups and host organism, in vivo genetic loss-of-function studies in the with mainly lymphoid cell infiltration (B220+/EGFP+ and Th1.2+/ mouse are an invaluable tool to determine functional dependen- EGFP+cells) but also distinct infiltration of myeloid cells (Mac-1+/ cies within the tumor network. EGFP+ and Gr-1+/EGFP+ cells). In 2002, Cullen and colleagues discovered that hairpin Taken together, our results suggest, that knockdown of Grb10 sequences of the endogenous microRNA (miR) miR30 can be in BCR-ABL expressing cells leads to impaired proliferation, replaced by a target-sp ecific sequence, generating a synthetic, 41 significantly longer survival and reduced colony formation in target-specific miR30-based shRNA. In contrast to conventional murine hematopoietic progenitor cells, suggesting an important shRNAs, these miR30-based shRNAs can be transcribed by RNA Pol 41–44 role of Grb10 for BCR-ABL-mediated leukemogenesis. II promoters. Taking advantage of these characteristics of miR-based shRNAs, we have developed an RNAi-based system that alleviates most of the problems entailed in the ‘classical’ Grb10 knockdown by RNAi leads to reduced cell viability, impaired approach using knockout mice.36 We analyzed the functionality of cell cycle progression and induction of apoptosis in the human this vector system in a BM transduction transplantation model for Ph+ cell line K562 CML/B-ALL, where BALB/C mice transplanted with low p185 To verify our results from the murine model system in a human transduced cell numbers develop a CML with features of a B-ALL BCR-ABL-positive cell line, we designed and cloned a microRNA – 45,46 + within a period of 3 4 weeks. directed against human Grb10. K562 cells, a human Ph CML cell The gold standard for CML therapy is the BCR-ABL kinase line where retrovirally infected with pLMP miRhGrb10 and pLMP Ctrl inhibitor imatinib. The majority of patients with BCR-ABL-positive miR vectors, which express the marker protein EGFP and CML show excellent responses to tyrosine kinase inhibitor puromycin as a selection marker, for stable downregulation of treatment.8,9 However, the persistence of BCR-ABL-positive cells Grb10 (Figure 6a). Competition assays of pLMP miRhGrb10 and in imatinib-treated patients indicates that inhibition of the ABL pLMP miRCtrl-infected K562 cells, which competed with unin- kinase activity alone might not be sufficient to eradicate leukemia. fected K562 cells without selection pressure resulted in a + Combining BCR-ABL tyrosine kinase inhibitors with inhibitors of significant reduction of the pLMP miRhGrb10-infected EGFP cell downstream signaling targets may improve CML therapy. Only a population (Figure 6b) suggesting a proliferation disadvantage of few of the molecules involved in BCR-ABL signaling have so far Grb10 knockdown in K562 cells, whereas the pLMP miRCtrl- been directly examined for their role in mediating BCR-ABL- infected K562 cells grow at similar levels as the uninfected K562 induced transformation in vivo, an important aspect in the cell. Moreover, MTT Assays for cell viability revealed significantly validation of potential therapeutic targets.47–50 reduced viability of pLMP miRhGrb10-infected K562 cells in One interesting candidate is Grb10 as it has been described to comparison with pLMP miRCtrl-infected K562 cells (Figure 6c). be upregulated in CML.33 In accordance with this finding we The differences in the viability were even more pronounced by the observed an upregulation of Grb10 upon BCR-ABL expression in addition of imatinib (Figure 6d), where growth of pLMP murine hematopoietic stem and progenitor cells (Figures 1a and b). miRhGrb10-infected K562 cells was significantly impaired in Grb10 is an adaptor protein that has a role in different signaling presence of 200 nM imatinib in comparison with pLMP miRCtrl- cascades within the cell, for example, the MAPK or the PI3K/AKT infected K562 cells. These could also be shown with other cascade.20,51 These cascades are highly activated by BCR-ABL concentrations of imatinib (Supplementary Figure 2). Dynamic cell and are main signaling routes for mediating cell survival and cycle experiments with pLMP miRhGrb10 and pLMP miRCtrl- proliferation.52–54 Moreover, oncogenic tyrosine kinases can signal infected K562 cells showed a significant reduction of EdU-positive via Grb10 thereby mediating cytokine-independent growth and S-phase cells by knockdown of Grb10 (Figure 6e). Moreover, cell proliferation: Grb10 binds to normal FLT3 and oncogenic FLT3- Annexin assays of pLMP miRhGrb10 and pLMP miRCtrl-infected ITD through phosphotyrosine residues 572 and 793 and can K562 cells revealed anti-apoptotic effects of Grb10 in BCR-ABL- thereby induce PI3K-Akt and STAT5 signaling pathways.31 More- positive cells. Downregulation of Grb10 in K562 cells led to over, BCR-ABL also interacts with Grb10 through phosphotyrosine significant induction of early apoptotic (and late apoptotic) cells in residues in BCR site and this interaction is important for BCR-ABL- comparison with K562 cells infected with a control miR (Figure 6f). induced cell transformation in Ba/F3 cells in vitro. However, the Taken together, these experiments with a human Ph+ cell line significance of these encouraging in vitro findings needs to be confirm our results with primary murine BM and in vivo elucidated in a relevant mouse model in vivo: Using a retroviral experiments in mice and imply an important role of Grb10 for vector system, we here directly combine efficient Grb10 knock- human CML. Interestingly, expression arrays from CML patient down with parallel BCR-ABL expression generating a model material vs normal blood show a significant (P-value 6.10E-8) system for the inhibition of the potential therapeutic target Grb10 upregulation with 1.309 Fold change (P-value 6.10E-8).38 Grb10 in every leukemic cell in vivo. The consequences of shRNA- Two other groups could also show a significant upregulation of mediated Grb10 suppression in BCR-ABL expressing primary Grb10 in primary adult B-ALL patient material (1.533 fold change; murine BM cells was as a significant reduction of colony-forming P-value 2.86 E-7)39 and primary childhood B-ALL patient material ability in a methylcellulose assay in vitro. Furthermore in the BM

Figure 5. CML onset was delayed but there was no immunphenotype switch by Grb10 knockdown in transplanted recipients. (a) Proportion of leukemic WBCs in the peripheral blood (PB) of mice that received transplants at indicated time points (n = 3). P-value was determined by Student's t-test. (b,c) Disease immunphenotype is similar in PB (b) and spleen cells (c) of control and Grb10-knockdown animals. (b) CD45+ cells from PB of mice 18 days after transplantation were stained for Mac-1, Gr-1, B220 or Thy1.2 and analyzed by flow cytometry. As disease kinetics differ between the control and Grb10-knockdown group, in this experiment we compared two animals with similar latency, which became moribund 1–2 days post flowcytometric analysis. (c) Spleen cells of moribund animals were isolated and stained for Mac-1, Gr-1, B220 or Thy1.2 and analyzed by flow cytometry.

Figure 6. Grb10 knockdown by RNAi leads to reduced cell viability, impaired cell cycle progression and induction of apoptosis in the human Ph+ cell line K562. (a) Western blot analysis of K562 cells transduced with microRNA sequence directed against human Grb10 in pLMP after 5 days puromycin selection. (b) pLMP miRhGrb10-infected K562 cells have a growth disadvantage in comparison with parental K562 cells in a competition assay of pLMP miRhGrb10 and pLMP miRCtrl-infected K562 cells, which were cultured together with uninfected K562 cells without puromycin selection and monitored for EGFP-positive population. (c, d) Cell viability assay of pLMP miRhGrb10- and pLMP miRCtrl- infected K562 cells without (c) and with 200 nM (d) imatinib. (e) Two-dimensional cell cycle analyses of pLMP miRhGrb10 and pLMP miRCtrl- infected K562 cells revealed a slight, but significantly impaired cell cycle progression of K562 by the knockdown of Grb10. Quantification of two independent 2-dimensional cell cycle analyses. P-value was determined by Student's t-test. (f) Annexin assays of pLMP miRhGrb10 and pLMP miRCtrl-infected K562 cells 5 days after purpomycin selection showed a significant induction of early apoptotic cells by the downregulation of Grb10. Quantification of three independent annexin analyses. P-value was determined by Student's t-test. (g) Immunoblot analyses of K562 cells treated with 2 μM imatinib, harvested at indicated time points and subjected to immunoblotting with pY, ABL and Grb10 antibodies. Actin-antibody served as a loading control. *Po0.05, **Po0.01. transplant model for CML/B-ALL in vivo Grb10 downregulation in 6 Kantarjian H, Giles F, Wunderle L, Bhalla K, O'Brien S, Wassmann B et al. Nilotinib in BCR-ABL-positive cells leads to a reduced transforming capacity imatinib-resistant CML and Philadelphia chromosome-positive ALL. N Engl J Med. and cell proliferation accompanied by a prolonged latency, 2006; 354: 2542–2551. reduced splenomegaly, leukocytosis and leukemic burden in the 7 Quintas-Cardama A, Kantarjian H, Jones D, Nicaise C, O'Brien S, Giles F et al. animals, indicating that Grb10 is an important intermediate in the Dasatinib (BMS-354825) is active in Philadelphia chromosome-positive chronic BCR-ABL signaling cascade in vivo, required for the efficient myelogenous leukemia after imatinib and nilotinib (AMN107) therapy failure. Blood 2007; 109:497–499. induction of leukemia in mice. Further experiments show an 8 Kantarjian H, Shah NP, Hochhaus A, Cortes J, Shah S, Ayala M et al. Dasatinib important role of Grb10 in cell proliferation, viability and survival versus imatinib in newly diagnosed chronic-phase chronic myeloid leukemia. of a BCR-ABL-positive human cell line K562. N Engl J Med 2010; 362: 2260–2270. Interestingly, it could recently be shown that Grb10 is important 9 Saglio G, Kim DW, Issaragrisil S, le Coutre P, Etienne G, Lobo C et al. Nilotinib for colony formation in FLT3-ITD-positive leukemogenesis: Kazi versus imatinib for newly diagnosed chronic myeloid leukemia. N Engl J Med. and Ronnstrand31 show, that Grb10 constitutively associates with 2010; 362: 2251–2259. oncogenic FLT3-ITD, resulting in higher STAT5 and AKT activation 10 Kantarjian HM, Giles F, Gattermann N, Bhalla K, Alimena G, Palandri F et al. in hematopoietic cells and increased colony formation in Nilotinib (formerly AMN107), a highly selective BCR-ABL tyrosine kinase inhibitor, semisolid culture. Moreover, they were able to prove that Grb10 is effective in patients with Philadelphia chromosome-positive chronic fi myelogenous leukemia in chronic phase following imatinib resistance and expression is signi cantly increased in acute myeloid leukemia intolerance. Blood 2007; 110: 3540–3546. patients compared to healthy controls and was also elevated in 11 Talpaz M, Shah NP, Kantarjian H, Donato N, Nicoll J, Paquette R et al. Dasatinib in patients carrying FLT3-ITD mutations. Consistent with our results imatinib-resistant Philadelphia chromosome-positive leukemias. N Engl J Med. in BCR-ABL-mediated leukemogenesis, Grb10 mRNA was found to 2006; 354: 2531–2541. be upregulated in CML patients,38 as well as in adult39 and 12 Kantarjian HM, Hochhaus A, Saglio G, De Souza C, Flinn IW, Stenke L et al. Nilotinib childhood B-ALL,40 patients and Grb10 scored in all three studies versus imatinib for the treatment of patients with newly diagnosed chronic phase, among the 4% top upregulated genes. Philadelphia chromosome-positive, chronic myeloid leukaemia: 24-month minimum follow-up of the phase 3 randomised ENESTnd trial. Lancet Oncol Taken together, our data establish Grb10 as an essential 12 – regulator in BCR-ABL-mediated leukemogenesis and suggest that 2011; :841 851. 13 Gontarewicz A, Balabanov S, Keller G, Colombo R, Graziano A, Pesenti E et al. deregulation of the protein could provide a substantial contribu- Simultaneous targeting of Aurora kinases and Bcr-Abl kinase by the small tion during the process of tumorigenesis. molecule inhibitor PHA-739358 is effective against imatinib-resistant BCR-ABL mutations including T315I. Blood 2008; 111: 4355–4364. 14 Skorski T, Kanakaraj P, Nieborowska-Skorska M, Ratajczak MZ, Wen SC, Zon G et al. CONFLICT OF INTEREST Phosphatidylinositol-3 kinase activity is regulated by BCR/ABL and is required The authors declare no conflict of interest. for the growth of Philadelphia chromosome-positive cells. Blood 1995; 86: 726–736. 15 Mohi MG, Boulton C, Gu TL, Sternberg DW, Neuberg D, GriffinJDet al. ACKNOWLEDGEMENTS Combination of rapamycin and protein tyrosine kinase (PTK) inhibitors for the treatment of leukemias caused by oncogenic PTKs. Proc Natl Acad Sci USA 2004; This work was supported by a grant to JD from the Deutsche Forschungsge- 101: 3130–3135. meinschaft (SFB684); ALI was supported by the FoKo Freiburg. We thank Melanie 16 Klejman A, Rushen L, Morrione A, Slupianek A, Skorski T. Phosphatidylinositol-3 Thiede and Sabina Schaberg for technical assistance. kinase inhibitors enhance the anti-leukemia effect of STI571. Oncogene 2002; 21: 5868–5876. 17 Yu C, Krystal G, Dent P, Grant S. Flavopiridol potentiates STI571-induced mito- REFERENCES chondrial damage and apoptosis in BCR-ABL-positive human leukemia cells. Clin 1 Druker BJ, Talpaz M, Resta DJ, Peng B, Buchdunger E, Ford JM et al. Efficacy and Cancer Res 2002; 8: 2976–2984. safety of a specific inhibitor of the BCR-ABL tyrosine kinase in chronic myeloid 18 Peters DG, Hoover RR, Gerlach MJ, Koh EY, Zhang H, Choe K et al. Activity of the leukemia. N Engl J Med. 2001; 344: 1031–1037. farnesyl protein transferase inhibitor SCH66336 against BCR/ABL-induced murine 2 Bhatia R, Holtz M, Niu N, Gray R, Snyder DS, Sawyers CL et al. Persistence of leukemia and primary cells from patients with chronic myeloid leukemia. Blood malignant hematopoietic progenitors in chronic myelogenous leukemia patients 2001; 97:1404–1412. in complete cytogenetic remission following imatinib mesylate treatment. Blood 19 Borthakur G, Kantarjian H, Daley G, Talpaz M, O'Brien S, Garcia-Manero G et al. 2003; 101: 4701–4707. Pilot study of lonafarnib, a farnesyl transferase inhibitor, in patients with chronic 3 Mahon FX, Rea D, Guilhot J, Guilhot F, Huguet F, Nicolini F et al. Discontinuation of myeloid leukemia in the chronic or accelerated phase that is resistant or refractory imatinib in patients with chronic myeloid leukaemia who have maintained to imatinib therapy. Cancer 2006; 106:346–352. complete molecular remission for at least 2 years: the prospective, multicentre 20 Jahn T, Seipel P, Urschel S, Peschel C, Duyster J. Role for the adaptor protein Stop Imatinib (STIM) trial. Lancet Oncol 2010; 11: 1029–1035. Grb10 in the activation of Akt. Mol Cell Biol 2002; 22:979–991. 4 de Lavallade H, Apperley JF, Khorashad JS, Milojkovic D, Reid AG, Bua M et al. 21 Nantel A, Mohammad-Ali K, Sherk J, Posner BI, Thomas DY. Interaction of the Imatinib for newly diagnosed patients with chronic myeloid leukemia: incidence Grb10 adapter protein with the Raf1 and MEK1 kinases. J Biol Chem 1998; 273: of sustained responses in an intention-to-treat analysis. J Clin Oncol 2008; 26: 10475–10484. 3358–3363. 22 Deng Y, Bhattacharya S, Swamy OR, Tandon R, Wang Y, Janda R et al. 5 Druker BJ, Guilhot F, O'Brien SG, Gathmann I, Kantarjian H, Gattermann N et al. Growth factor receptor-binding protein 10 (Grb10) as a partner of Five-year follow-up of patients receiving imatinib for chronic myeloid leukemia. phosphatidylinositol 3-kinase in metabolic insulin action. J Biol Chem 2003; 278: N Engl J Med. 2006; 355:2408–2417. 39311–39322.

© 2015 Macmillan Publishers Limited Leukemia (2015) 858 – 868 Role of Grb10 in leukemia AL Illert et al 868 23 Langlais P, Dong LQ, Hu D, Liu F. Identification of Grb10 as a direct substrate subclassification of leukemia: report from the International Microarray Innovations for members of the Src tyrosine kinase family. Oncogene 2000; 19: in Leukemia Study Group. J Clin Oncol 2010; 28:2529–2537. 2895–2903. 39 Coustan-Smith E, Song G, Clark C, Key L, Liu P, Mehrpooya M et al. New markers 24 Murdaca J, Treins C, Monthouel-Kartmann MN, Pontier-Bres R, Kumar S, for minimal residual disease detection in acute lymphoblastic leukemia. Blood Van Obberghen E et al. Grb10 prevents Nedd4-mediated vascular endothelial 2011; 117:6267–6276. growth factor receptor-2 degradation. J Biol Chem 2004; 279: 26754–26761. 40 Maia S, Haining WN, Ansen S, Xia Z, Armstrong SA, Seth NP et al. Gene expression 25 Charalambous M, Smith FM, Bennett WR, Crew TE, Mackenzie F, Ward A. profiling identifies BAX-delta as a novel tumor antigen in acute lymphoblastic Disruption of the imprinted Grb10 gene leads to disproportionate overgrowth by leukemia. Cancer Res 2005; 65: 10050–10058. an Igf2-independent mechanism. Proc Natl Acad Sci USA 2003; 100: 8292–8297. 41 Zeng Y, Wagner EJ, Cullen BR. Both natural and designed micro RNAs can inhibit 26 Holt LJ, Turner N, Mokbel N, Trefely S, Kanzleiter T, Kaplan W et al. Grb10 regulates the expression of cognate mRNAs when expressed in human cells. Mol Cell 2002; the development of fiber number in skeletal muscle. FASEB J 2012; 26: 3658–3669. 9: 1327–1333. 27 Smith FM, Holt LJ, Garfield AS, Charalambous M, Koumanov F, Perry M et al. Mice 42 Silva JM, Li MZ, Chang K, Ge W, Golding MC, Rickles RJ et al. Second-generation with a disruption of the imprinted Grb10 gene exhibit altered body composition, shRNA libraries covering the mouse and human genomes. Nat Genet 2005; 37: glucose homeostasis, and insulin signaling during postnatal life. Mol Cell Biol 1281–1288. 2007; 27: 5871–5886. 43 Stegmeier F, Hu G, Rickles RJ, Hannon GJ, Elledge SJ. A lentiviral microRNA-based 28 Yu Y, Yoon S-O, Poulogiannis G, Yang Q, Ma XM, Villén J et al. Phosphoproteomic system for single-copy polymerase II-regulated RNA interference in analysis identifies Grb10 as an mTORC1 substrate that negatively regulates insulin mammalian cells. Proc Natl Acad Sci USA 2005; 102: 13212–13217. signaling. Science 2011; 332: 1322–1326. 44 Zeng Y, Cai X, Cullen BR. Use of RNA polymerase II to transcribe artificial 29 Okino K, Konishi H, Doi D, Yoneyama K, Ota Y, Jin E et al. Up-regulation of growth microRNAs. Methods Enzymol 2005; 392:371–380. factor receptor-bound protein 10 in cervical squamous cell carcinoma. Oncol Rep 45 Li S, Ilaria RL Jr, Million RP, Daley GQ, Van Etten RA. The P190, P210, and P230 2005; 13: 1069–1074. forms of the BCR/ABL oncogene induce a similar chronic myeloid leukemia-like 30 Casas S, Ollila J, Aventin A, Vihinen M, Sierra J, Knuutila S. Changes in apoptosis- syndrome in mice but have different lymphoid leukemogenic activity. J Exp Med related pathways in acute myelocytic leukemia. Cancer Genet Cytogenet 2003; 1999; 189:1399–1412. 146:89–101. 46 Van Etten RA. Retroviral transduction models of Ph+ leukemia: advantages and 31 Kazi JU, Ronnstrand L. FLT3 signals via the adapter protein Grb10 and limitations for modeling human hematological malignancies in mice. Blood Cells overexpression of Grb10 leads to aberrant cell proliferation in acute myeloid Mol Dis 2001; 27:201–205. leukemia. Mol Oncol 2013; 7:402–418. 47 Ren R. Mechanisms of BCR-ABL in the pathogenesis of chronic myelogenous 32 Gutierrez NC, Lopez-Perez R, Hernandez JM, Isidro I, Gonzalez B, Delgado M et al. leukaemia. Nat Rev Cancer 2005; 5: 172–183. Gene expression profile reveals deregulation of genes with relevant functions in 48 Jiang X, Stuible M, Chalandon Y, Li A, Chan WY, Eisterer W et al. Evidence for a the different subclasses of acute myeloid leukemia. Leukemia 2005; 19:402–409. positive role of SHIP in the BCR-ABL-mediated transformation of primitive murine 33 Diaz-Blanco E, Bruns I, Neumann F, Fischer JC, Graef T, Rosskopf M et al. Molecular hematopoietic cells and in human chronic myeloid leukemia. Blood 2003; 102: signature of CD34(+) hematopoietic stem and progenitor cells of patients with 2976–2984. CML in chronic phase. Leukemia 2007; 21:494–504. 49 Sattler M, Mohi MG, Pride YB, Quinnan LR, Malouf NA, Podar K et al. Critical role for 34 Bai RY, Jahn T, Schrem S, Munzert G, Weidner KM, Wang JY et al. The Gab2 in transformation by BCR/ABL. Cancer Cell 2002; 1: 479–492. SH2-containing adapter protein GRB10 interacts with BCR-ABL. Oncogene 1998; 50 Di Cristofano A, Niki M, Zhao M, Karnell FG, Clarkson B, Pear WS et al. p62(dok), 17: 941–948. a negative regulator of Ras and mitogen-activated protein kinase (MAPK) activity, 35 von Bubnoff N, Veach DR, van der Kuip H, Aulitzky WE, Sanger J, Seipel P et al. opposes leukemogenesis by p210(bcr-abl). J Exp Med 2001; 194:275–284. A cell-based screen for resistance of Bcr-Abl-positive leukemia identifies the 51 Kebache S, Ash J, Annis MG, Hagan J, Huber M, Hassard J et al. Grb10 and active mutation pattern for PD166326, an alternative Abl kinase inhibitor. Blood 2005; Raf-1 kinase promote Bad-dependent cell survival. J Biol Chem 2007; 282: 105: 1652–1659. 21873–21883. 36 Albers C, Illert AL, Miething C, Leischner H, Thiede M, Peschel C et al. 52 Xia Z, Dickens M, Raingeaud J, Davis RJ, Greenberg ME. Opposing effects of ERK An RNAi-based system for loss-of-function analysis identifies Raf1 as a crucial and JNK-p38 MAP kinases on apoptosis. Science 1995; 270: 1326–1331. mediator of BCR-ABL-driven leukemogenesis. Blood 2011; 118: 2200–2210. 53 Chang L, Karin M. Mammalian MAP kinase signalling cascades. Nature 2001; 410: 37 Miething C, Feihl S, Mugler C, Grundler R, von Bubnoff N, Lordick F et al. 37–40. The Bcr-Abl mutations T315I and Y253H do not confer a growth advantage in the 54 Aceves-Luquero CI, Agarwal A, Callejas-Valera JL, Arias-Gonzalez L, absence of imatinib. Leukemia 2006; 20:650–657. Esparis-Ogando A, del Peso Ovalle L et al. ERK2, but not ERK1, mediates acquired 38 Haferlach T, Kohlmann A, Wieczorek L, Basso G, Kronnie GT, Bene MC et al. and "de novo" resistance to imatinib mesylate: implication for CML therapy. PLoS Clinical utility of microarray-based gene expression profiling in the diagnosis and One 2009; 4: e6124.

Supplementary Information accompanies this paper on the Leukemia website (http://www.nature.com/leu)