Β8 Integrin Regulates Pancreatic Cancer Cell Radiochemo

Aus dem Nationalen Zentrum für Strahlenforschung in der Onkologie - OncoRay Arbeitsgruppe: Molekulare und Zelluläre Strahlenbiologie Gruppenleiter: Herr Prof. Dr. med. habil. Nils Cordes

β8 integrin regulates pancreatic cancer cell radiochemo-

resistance

D i s s e r t a t i o n s s c h r i f t

zur Erlangung des akademischen Grades Doktor der Biomedizin Doctor rerum medicinalium (Dr. rer. medic.)

Vorgelegt

der Medizinischen Fakultät Carl Gustav Carus der Technischen Universität Dresden

Wei-Chun Lee, M.Sc.

geboren in Taipei, Taiwan, ROC

Dresden 2020

1. Gutachter: Prof. Dr. med. habil. Nils Cordes

2. Gutachter: Prof. Dr. med. Daniela E. Aust

Tag der mündlichen Prüfung: 03.02.2021

Vorsitzender der Promotionskommission: Prof. Dr. med. Axel Roers Contents

Contents

Contents ...... I

Abbreviations ...... V

1 Introduction ...... 1

2 Background ...... 2

2.1 Pancreatic ductal adenocarcinoma ...... 2

2.1.1 Epidemiology ...... 2

2.1.2 Molecular characteristics ...... 5

2.1.3 Microenvironment ...... 7

2.1.4 PDAC therapy ...... 8

2.2 Ionizing radiation ...... 10

2.3 Therapeutic resistance ...... 12

2.4 Activation of autophagy in PDAC ...... 13

2.5 Integrins ...... 14

2.5.1 β8 integrin ...... 15

3 Hypothesis and Aims ...... 17

4 Materials and Methods ...... 18

4.1 Materials ...... 18

4.1.1 Devices ...... 18

4.1.2 Additional materials ...... 19

4.1.3 esiRNA ...... 20

4.1.4 Inhibitors ...... 34

4.1.5 Chemotherapeutic agents ...... 35

Contents

4.1.6 Protein ladders ...... 35

4.1.7 Method kits ...... 35

4.1.8 Primary antibodies ...... 35

4.1.9 Secondary antibodies ...... 36

4.1.10 Solutions for cell biological applications ...... 37

4.1.11 Solutions for protein-biochemical and molecular-biological applications ...... 38

4.1.12 Solutions for immunofluorescence applications ...... 40

4.1.13 Other solutions and chemicals ...... 40

4.1.14 Software ...... 41

4.2 Methods ...... 41

4.2.1 Cell culture ...... 41

4.2.2 Cell freezing and thawing ...... 42

4.2.3 esiRNA knockdown ...... 42

4.2.4 3D tumoroid high-throughput esiRNA-based screening (3DHT-esiRNAs) against focal adhesion proteins ...... 42

4.2.5 Chemotherapy treatment ...... 43

4.2.6 Radiation exposure ...... 43

4.2.7 Colony formation assay ...... 43

4.2.8 3D tumoroid formation ...... 44

4.2.9 2D invasion assay ...... 45

4.2.10 Spheroid and 3D invasion assay ...... 45

4.2.11 Sphere formation assay ...... 46

4.2.12 Exosome isolation ...... 46

4.2.13 Proximity ligation assay ...... 46

4.2.14 Protein biochemical analysis ...... 47

4.2.15 Dot blot analysis ...... 50

4.2.16 Immunoprecipitation ...... 51

4.2.17 Mass spectrometric analysis ...... 52

4.2.18 Immunofluorescence and image analysis ...... 52

4.2.19 Statistics ...... 53 II

Contents

5 Results ...... 54

5.1.1 3D tumoroid high-throughput esiRNA-based screening (3DHT-esiRNAs) in PDAC cells ...... 54

5.1.2 3DHT-esiRNA in PDAC cells identifies potential focal adhesion protein targets involved in radioresistance ...... 54

5.2 Secondary validation in PDAC cell line panel ...... 59

5.2.1 PINCH1 and β8 integrin expression in PDAC cells ...... 59

5.2.2 Analysis of radiosensitivity upon PINCH1 silencing in PDAC cells ...... 60

5.2.3 Analysis of radiosensitivity upon β8 integrin silencing in PDAC cells ...... 62

5.2.4 Analysis of chemosensitivity upon β8 integrin silencing in PDAC cells ...... 64

5.2.5 Analysis of stemness upon β8 integrin silencing in PDAC cells ...... 66

5.2.6 Analysis of invasiveness upon β8 integrin silencing in PDAC cells ...... 67

5.3 The location of β8 integrin in PDAC cells ...... 69

5.3.1 β8 integrin is located in the perinuclear region in PDAC cells ...... 69

5.3.2 Subcellular localization of β8 integrin in PDAC cells ...... 71

5.4 β8 integrin translocated from perinuclear region to cytosol upon genotoxic stress . 73

5.4.1 Subcellular localization of β8 integrin upon 6 Gy irradiation in PDAC cells ...... 74

5.4.2 Subcellular localization of β8 integrin upon gemcitabine treatment in PDAC cells 76

5.4.3 β8 integrin positive exosome increased upon 6 Gy irradiation in PDAC cells .. 78

5.4.4 Changes in the composition of the β8 integrin interactome to transport, catalysis and binding upon irradiation ...... 79

5.5 Fluorescence-microscopy-based screen identifies small-molecule chemical compounds to block β8 integrin translocation upon genotoxic stress in PDAC cells ...... 90

5.5.1 The fluorescence-microscopy-based screen upon 6 Gy irradiation ...... 90

5.5.2 The fluorescence-microscopy-based screen upon gemcitabine treatment...... 93

5.6 Correlation of β8 integrin and autophagy in PDAC cells ...... 98

5.6.1 β8 integrin interactome connects to autophagy in PDAC cells ...... 98

5.6.2 Depletion of β8 integrin reduces autophagy induction ...... 99

5.6.3 β8 integrin regulating autophagy induction leads to radiosensitizing effect .... 101

6 Discussion ...... 103 III

Contents

6.1 High-throughput RNAi screen identify novel focal adhesion protein targets in 3D PDAC cells ...... 103

6.2 β8 integrin subcellular location in PDAC ...... 105

6.3 β8 integrin translocation upon genotoxic stress ...... 106

6.4 β8 integrin regulates autophagy ...... 108

7 Summary ...... 111

8 Zusammenfassung ...... 113

9 Figures ...... 115

10 Tables ...... 117

11 References ...... 119

12 Acknowledgements ...... 147

Appendix ...... 148

Curriculum vitae ...... 148

Publications ...... 150

Anlage 1 ...... 151

Anlage 2 ...... 152

Darstellung des Eigenanteils ...... 153

Abbreviations

3DHT-esiRNAs 3D tumoroid high-throughput esiRNA-based screening

5-FU Fluorouracil

ALDH9A1 Aldehyde dehydrogenase 9 family members A1

ANXA2 Annexin A2

ARF3 ADP-ribosylation factor 3

ARF4 ADP-ribosylation factor 4

ARF5 ADP-ribosylation factor 5

ARN Autophagy Regulatory Network

ARPC5 Actin-related protein 2/3 complex subunit 5

ASR Age-standardized rates

ATP5J2 F1Fo-ATPase Synthase F Subunit

BMI Body mass index

BRAF Fibrosarcoma homolog B

BRPC Borderline resectable pancreatic cancer

C9ORF72 Guanine Nucleotide Exchange C9orf72

CAMDR Cell adhesion mediated drug resistance

CAMRR Cell adhesion mediated radioresistance

COL colchicine

Abbreviations

COPE Coatomer subunit epsilon

CQ Chloroquine

CSCs Cancer stem cells

DNAH10 Dynein axonemal heavy chain 10

DNAJC7 DnaJ homolog subfamily C member 7

ECM Extracellular matrix

EIF5A Eukaryotic Translation Initiation Factor 5A

EMT Epithelial-mesenchymal transition

ER Endoplasmic reticulum

ERGIC ER-Golgi intermediate compartment

ERK1/2 Extracellular-signal regulate kinase 1/2

ESCRT-III Endosomal sorting complex required for transport complex III

ETFA Electron transfer flavoprotein alpha subunit

EV extracellular vesicle

EXOC7 Exocyst complex component 7

FAK Focal adhesion kinase

FAP focal adhesion proteins

GAP GTPase-activating protein

GBF1 Golgi brefeldin A resistant guanine nucleotide exchange factor 1

GBM Glioblastoma

GDI Rho guanine nucleotide dissociation inhibitor-1

GEF Guanine nucleotide exchange factor

GEMMs Genetically engineered mouse models

HIF-1α Hypoxia-inducible factor 1-alpha

Abbreviations

HSPA1L Heat shock 70 kDa protein 1-like

HSPB1 Heat shock protein beta-1

HSPBP1 Hsp70-binding protein 1

HTS High-throughput screening

IF Immunofluorescence

ILK Integrin-linked kinase

IP-MS Mass spectrometry-based immuno-precipitation proteomics

JNK c-Jun N-terminal kinase

KDELR2 ER lumen protein-retaining receptor 2

KIF4A Microtubule motor proteins: kinesin family member 4A

KRAS KRAS proto-oncogene, GTPase

LAPC Local advanced pancreatic cancer

LET Linear energy transfer

MAPK Mitogen-activated protein kinase

MDSCs Myeloid-derived suppressor cells

MEK1/2 Mitogen-activated kinase

MLC Myosin light chain

MT1-MMP MT1-matrix metalloproteinase mTOR Mammalian target of rapamycin

MVB Multivesicular body

MYO5C myosin VC

Nab-paclitaxel Nanoparticle albumin-bound paclitaxel

NOD New-onset diabetes

NPF Nucleation-promoting factor

VII

Abbreviations

PanIN pancreatic intraepithelial neoplasia

PANTHER Protein analysis through evolutionary relationships database database

PDAC Pancreatic ductal adenocarcinoma

PI3K Phosphatidylinositol-3 kinase

PKB Protein kinase B

PLA Proximity ligation assay

PNRC perinuclear recycling compartments

PSCs Pancreatic stellate cells

PTX paclitaxel

RAB39B Ras-associated protein RAB39B

RAB8A Ras-associated protein RAB8A

RB Retinoblastoma protein

RBMX RNA-Binding Motif Protein, X Chromosome

ROCK Rho-associated kinase

RT Room temperature

SCFD1 Sec1 family domain containing 1

SEC13 Protein SEC13 homolog

SEC22B Vesicle-trafficking protein SEC22b

SEC23A Protein transport protein SEC23A

SFA Sphere formation assay

T2DM Type II diabetes mellitus

TGFβ Transforming Growth Factor Beta

TGN trans-Golgi network

VIII

Abbreviations

TMED2 Transmembrane emp 24 domain trafficking protein 2

TMPO Thymopoietin

TSPAN10 Tetraspanin-10

Un-IR Unirradiated

VPS4A Vacuolar Protein Sorting-Associated Protein 4A

VWFA Von Willebrand factor type A

Additionally, generally accepted abbreviations of the SI-unit system are used.

Introduction

1 Introduction

Pancreatic ductal adenocarcinoma (PDAC) is one of the most lethal malignancies, with a 5- year relative overall survival rate is approximately 15-20% for resectable patients (Oettle et al., 2007; Hidalgo, 2010; Narayanan and Weekes, 2016). Currently, surgical resection and cytotoxic chemotherapy are the most commonly used interventional strategies, however, neither of these approaches have shown tangible efficacy in improving patients’ chances of survival. Therefore, identification of alternative therapeutic target(s) is urgently needed.

PDAC is a stroma-rich cancer, and it is composed of a heterogeneous mixture of collagen, laminin, fibronectin and other extracellular matrix (ECM) components (Feig et al., 2012; Kleeff et al., 2016). Focal adhesions, mediated by the direct interaction of adhesion receptors with the ECM, has been shown to be essential for the regulation of metabolism, protein synthesis, survival, cancer cell proliferation and survival, metastasis, and therapeutic resistance (Hehlgans et al., 2007; Winograd-Katz et al., 2014). Accumulating evidence suggests that ECM molecules function as autophagic inducers, that is, allosteric and independent of nutrient conditions (Neill et al., 2014). Moreover, autophagy has been reported as a pro-survival and resistance conferring mechanism in PDAC against chemotherapy treatment (Kang et al., 2010; Yang et al., 2011; Donohue et al., 2013).

We designed a 3D tumoroid high-throughput esiRNA-based screening assay (3DHT-esiRNAs) to identify the regulator/mediator of therapeutic resistance in PDAC. Of these, we characterized, in more detail, the radiochemosensitizing effect induced by the expression of β8 integrin, a 769-amino acid type I transmembrane protein, which has been shown in cancer cells from other tumor entities to forms a heterodimer with αV integrin (Moyle et al., 1991; Nishimura et al., 1994). Here, we have characterized the mechanisms whereby β8 integrin confers resistance to radiotherapy and chemotherapy in PDAC.

Background

2 Background

2.1 Pancreatic ductal adenocarcinoma

2.1.1 Epidemiology

Pancreatic ductal adenocarcinoma (PDAC), the most common cancer of the pancreas, is one of the most lethal tumor entities with a bleak five-year survival rate of less than 5% and high mortality in the world (Hidalgo, 2010). Despite tremendous research efforts and improved insights into the molecular and genetic underpinnings of PDAC, the prognosis remains poor. In 2018, it was estimated that more than 458,000 people would develop PDAC and that more than 432,000 people would die from this disease in both sexes worldwide (Ferlay et al., 2015). Regions of the world with high human development index area, such as Europe, North America, Australia, and New Zealand, have a higher proportion of people newly diagnosed with PDAC, which could partially be attributed to improvement and availability of diagnostic modalities in these countries (Figure 2.1. A and B). In Germany, PDAC is the eighth most common type of cancer and accounted for the fourth cause of cancer-associated deaths in both sexes in 2018: There were an estimated 151,000 people diagnosed with PDAC and 147,000 deaths were associated with PDAC in the same year (Figure 2.1. C) (Ferlay et al., 2015).

Males have a slightly elevated risk of developing PDAC than females (Rawla et al., 2019). Age is the primary risk factor for PDAC development, with most of the patients diagnosed with PDAC comprised of individuals older than fifty years old. Tabaco smoking, obesity, and type II diabetes mellitus are the most studied life-style factors that have been implicated in the etiology of PDAC (Kleeff et al., 2016). Multiple studies have confirmed that individuals who smoke tobacco are two to three times more likely to develop PDAC than non-smokers (Parkin, 2011; Bosetti et al., 2012; Korc et al., 2017). In KRAS mutated genetically engineered mouse models (GEMMs), it was shown that tobacco exposure in mice exerted dramatic effects in the pancreas,

Background

by accelerating pancreatic intraepithelial neoplasia (PanIN) development and enhancing epithelial-mesenchymal transition (EMT) (Edderkaoui et al., 2016; Korc et al., 2017).

High body mass index (BMI) has been reported to be positively correlated with both the risk of developing PDAC and the associated mortality (Cascetta et al., 2018). In the clinic the intra- pancreatic fatty infiltration in obese patients is correlated with the development of PanIN and PDAC, likely due to the secretion of adipokines, cytokines, and pro-inflammatory factors (Rebours et al., 2015; Takahashi et al., 2018). Similarly, in KRAS mutated GEMMs, it was shown that an increase in visceral fat content elicited chronic inflammation, with the production of pro-inflammatory cytokines, which triggered the recruitment of immune cells into the pancreas and enhanced tumor progression (Hertzer et al., 2016).

Type II diabetes mellitus (T2DM) is both a risk factor for PDAC and a common pathophysio- logical outcome of PDAC (Andersen et al., 2017). Several studies have shown that metformin, a commonly prescribed anti-diabetes medicine for T2DM, repressed tumor initiation, angiogenesis, and increased the sensitivity to chemotherapy reagents, which is suggestive of a positive relationship between T2DM and PDAC (Kim et al., 2017; Candido et al., 2018; Sharma and Chari, 2018). Moreover, about 45-65% of PDAC patients are diagnosed with T2DM, and T2DM patients have a two-fold higher risk of developing PDAC than non-DM individuals (Li et al., 2019). Chari et al. first reported that approximately 1% of elderly (> 50 years) new-onset diabetes (NOD) patients would develop PDAC within three years of diagnosis (Chari et al., 2008; Pannala et al., 2009). Recently, another group reported a similar finding in a separate population-based study (Bosetti et al., 2014), suggesting that NOD could be one of the first biomarkers for prediction of PDAC diagnosis in elderly patients (Singhi et al., 2019).

Background

Figure 2.1. Incidence and mortality rates of pancreatic cancer in the world and Germany. (A) Pancreatic cancer incidence and (B) mortality of estimated age-standardized rates (ASR) in both sexes (per 100,000 persons) in the world 2018. (C) Estimated number of top ten cancer entities of incidence and mortality in Germany 2018. Reproduced and modified from Ferlay et al., 2015. Available from: https://www.iarc.fr/ .

2.1.2 Molecular characteristics

PDAC is an epithelial cancer emanating from the pancreatic duct and ductules (Eibl, 2015; Ferreira et al., 2017; Hutchings et al., 2018). The development of PDAC is similar to other carcinomas, in particular, colon cancer, which represents the accumulation of gene mutations that eventually lead to the transition of healthy pancreatic ductal cells to premalignant lesions, also known as pancreatic intraepithelial neoplasia (PanIN), named by Klimstra and Longnecker in 1994 (Klimstra and Longnecker, 1994; Hruban et al., 2000; Eibl, 2015; Perera and Bardeesy,

Figure 2.2. The progression model of pancreatic cancer. Pancreatic cancer arises from multistage of morphological and physiological changes which are associated with multiple genes mutation. Modify from Hruban et al., 2000; Morris et al., 2010; Perera and Bardeesy, 2015.

Background

2015).There are substantial numbers of gene mutations involved in this progression, of which mutations in KRAS, CDKN2A, TP53, and SMAD4 are the most commonly observed in PDAC

(Figure 2.2.) (Jones et al., 2008; Perera and Bardeesy, 2015).

KRAS proto-oncogene, which encodes a small GTPase (KRAS), is the most common gene mutation observed in PDAC, particularly in the early stages of PanIN, with a prevalence of more than 90% (Fokas et al., 2015; Waters and Der, 2018). KRAS is a ~21 kDa small GTPase protein that functions as a second messenger to mediate several cellular functions, including cell proliferation, survival, and cytoskeletal remodeling by activating downstream signaling me- diators, such as fibrosarcoma homolog B (BRAF), mitogen-activated protein kinase (MAPK), and phosphatidylinositol-3 kinase (PI3K)/ mammalian target of rapamycin (mTOR) (Eser et al., 2014; Fitzgerald et al., 2015). The most frequent mutation in human PDAC patients are point mutations at codon G12 (98% of all KRAS mutations in PDAC), G13 and Q61 (Waters and Der, 2018) that impair the intrinsic GTPase activity, leading to constitutive activation of KRAS and its downstream signaling cascade, which induce initiation of tumorigenesis (Fokas et al., 2015). Besides the gain of function of KRAS mutation, the inactivation of tumor suppressor genes, such as CDKN2A, P53, and SMAD4 are also implicated in PDAC development (Kamisawa et al., 2016; Ying et al., 2016).

The most inactivated tumor suppressor gene in PDAC is CDKN2A (>90%), which encodes two different splice variants, namely, p16 (also called INK4a) and p14ARF (Alternative Reading Frame), through incorporation of a different first exon and a different open reading frame of the second exon (Schutte et al., 1997; Fokas et al., 2015). P16INK4a is a CDK inhibitor that suppresses cyclin D/ cyclin-dependent kinase 4/6 complex activity and indirectly influences RB activity (Asghar et al., 2015). Loss-of-function of p16 INK4a results in loss of cell cycle control by virtue of augmented activation of both cyclin D/ cyclin-dependent kinase 4/6 complex retinoblastoma protein (RB) (Schneider et al., 2005). P14ARF, an E3 ubiquitin ligase, binds and degrades Mdm2, a protein for P53 degradation (Honda and Yasuda, 1999). Loss-of-function of p14ARF disturbs the function of P53, leading to abrogation of P53-induced apoptosis and cell-cycle arrest (Radfar et al., 1998; Schneider et al., 2005).

P53, known as “the guardian of the genome” (Toufektchan and Toledo, 2018), is mutated in a broad spectrum in different cancer entities, with about 50% of all human cancers (Ozaki and Nakagawara, 2011), including PDAC (>70%) (Freed-Pastor and Prives, 2012; Narayanan and Weekes, 2016), showing mutations in P53. P53, a transcription factor, controls the expression of target genes, thus inducing cell cycle arrest, apoptosis, senescence and DNA repair (Freed-

Background

Pastor and Prives, 2012). The activation of P53 is triggered by both extracellular factors, such as ionizing radiation-induced DNA damage (Kolesnick and Fuks, 2003), and intracellular stress, such as oncogene activation (Hu et al., 2012). P53 activates two different types of cellular events: (i) Cell cycle arrest, by regulating the expression of p21, a CDK inhibitor, and (ii) apoptosis, by activation of P53 upregulated modulator of apoptosis (PUMA), a pro-apoptosis protein(Ozaki and Nakagawara, 2011; Hu et al., 2012). The missense mutation in the DNA binding domain of P53 is the most common variation found in the late stages of PDAC development (PanIN-3 lesion) (Lüttges et al., 2001; Freed-Pastor and Prives, 2012). Loss-of-function mutations of P53 disturb the DNA repair process and cell cycle arrest and inhibit apoptosis (Ozaki and Nakagawara, 2011).

SMAD4, a co-transcription factor (Massagué et al., 2005), is often inactivated, mainly by ho- mozygous deletion, by approximately 55% in PDAC (Hahn et al., 1996; Iacobuzio-Donahue et al., 2004; Saiki and Horii, 2014). SMAD4 serves as a common mediator in the TGF-β singling pathway by forming a complex with R-Smads (Smad 2/3) and translocating to the nucleus, where it promotes transcription of genes that induce cell cycle arrest, apoptosis, and fibrosis (Massagué et al., 2005). TGF-β singling pathway in PDAC plays a complicated role. Whereas the canonical TGF-β singling pathway suppresses the tumor cell growth in the early stages of PDAC development (PanIN-1 and PanIN-2) (Hanahan and Weinberg, 2011; Hezel et al., 2012), it has been shown to promote tumor cell growth and migration in the late stages of PDAC development (PanIN-3 and invasive cancers) (Nolan-Stevaux et al., 2009; David et al., 2016; Shen et al., 2017). The loss-of-function mutations in SMAD4 promote PDAC progression and induce resistance to radiotherapy- and chemotherapy (Blackford et al., 2009; Wang et al., 2018).

2.1.3 Microenvironment

PDAC has an abundant and dense collagenous stroma (desmoplasia) that corresponds to approximately 80 to 90% of the tumor volume (Fokas et al., 2015; Kleeff et al., 2016). The components of PDAC stroma are heterogeneous and are comprised of cellular and acellular constituents such as cytokines, growth factors, collagen, laminin, fibronectin, hyaluronan, and other extracellular matrix (ECM) proteins (Feig et al., 2012; Kleeff et al., 2016; Narayanan and Weekes, 2016). PDAC induces excessive synthesis of ECM proteins by activating canonical TGF-β signaling pathway that leads to fibrosis (Truty andUrrutia, 2007; Feig et al., 2012). Re- cent studies have shown that the major components of PDAC stroma, such as collagen I, III,

Background

IV, and fibronectin, can increase cancer cell proliferation, survival, migration and also serve as a physical barrier to prevent drug entrance to the tumor (Koenig et al., 2006; Feig et al., 2012; Olivares et al., 2017; Weniger et al., 2018). Importantly, adhesion to the ECM proteins, such as collagens (I, III, IV), hyaluronan (Provenzano et al., 2012; Sato et al., 2016), decorin, versi- can, fibronectin, laminin, and Osteonectin/SPARC, can increase chemoresistance in PDAC (Miyamoto et al., 2004; Swayden et al., 2018; Weniger et al., 2018).

Cellular components of the stroma include the pancreatic stellate cells (PSCs), endothelial cells, infiltrating immune cells, and neuronal cells (Kleeff et al., 2016). PSCs were first described by Watari in 1982 (WATARI et al., 1982) as a rare stromal cell type located at pancreatic lobules adjacent to the ducts and blood capillaries, with a three-dimensional network (Apte et al., 2013; Ferdek and Jakubowska, 2017). Under hemostatic conditions, PSCs are quiescent, and their physiologic function is still not delineated, however, it is postulated that they may be responsible for the maintenance of ECM turnover (Feig et al., 2012). PSCs are stimulated by cytokines and growth factors from PDAC to proliferate and differentiate into myofibroblast lin- eage, secreting ECM proteins that support PDAC cell proliferation, migration, and stemness

(Apte et al., 2013). Regulatory T cells (Treg cells), myeloid-derived suppressor cells (MDSCs), mast cells, and macrophages are found in the PDAC microenvironment which facilitate the cancer cell proliferation and induce immunosuppression (Clark et al., 2007; Kleeff et al., 2016; Narayanan and Weekes, 2016). These studies support the crucial role of stroma in PDAC tumorigenesis and development of therapeutic resistance.

2.1.4 PDAC therapy

Despite the tremendous insights gained into PDAC tumorigenesis, the current aspects of PDAC therapy remain a formidable challenge. Surgery is still the only curative therapeutic strategy, and the approach has well developed from unacceptably high morbidity and mortality to a current mortality rate of <5%, and morbidity of about 20%–30% in major medical centers (Hartwig et al., 2013; Neoptolemos et al., 2018). However, only 10-20% of PDAC patients will be ideal candidates to receive surgical resection, and the five-year survival rate is only 15-20% (Eibl, 2015; Kleeff et al., 2016). In patients who have undergone surgical resection, adjuvant therapy is a standard treatment to improve the prognosis and increase the overall survival. Fluorouracil (5-FU) and leucovorin or gemcitabine are the most commonly used reagents for the adjuvant chemotherapy and have shown significant improvement of both five-year survival and overall survival rates in comparison to observation (Eibl, 2015; Kleeff et al., 2016).

Background

Most patients are diagnosed with PDAC in advanced-stages of the disease, with local advanced pancreatic cancer (LAPC) or in a distantly metastasized state, which are technically unresectable (Adamska et al., 2017; Neoptolemos et al., 2018). An elegant preclinical study published in 2012 revealed that PDAC is a systemic disease, even in the initiation phase, as determined by a genetically engineered mouse model (Rhim et al., 2012). In 2013, a clinical trial observed that about 60% of patients had relapsed within six months post-surgical resection (Oettle et al., 2013). As such, PDAC patients should receive chemotherapy in all cases.

Gemcitabine, a nucleoside analog, has been the standard agent for treating PDAC patients since 1997, thanks in great part to the findings of a clinical trial in 1997, which showed that gemcitabine improved the survival in comparison to fluorouracil (Garrido-Laguna and Hidalgo, 2015). In 2005, the combination of erlotinib, an EGFR inhibitor, with gemcitabine, had shown a significant but slight increase of disease-free survival and was approved by the FDA (Moore et al., 2007). In 2011, the FOLFIRINOX regimen (oxaliplatin 85 mg/m², folinic acid [leucovorin] 400 mg/m², irinotecan 180 mg/m², bolus fluorouracil 400 mg/m², infusional fluorouracil 2400 mg/m² over 46 h, every 14 days) had shown a better disease-free survival, with the overall survival period increasing to 11.1 months in comparison to gemcitabine monotherapy (6.8 months; P <0.001) (Conroy et al., 2011). Nonetheless, significant side effects, including diar- rhea, nausea, fatigue myelosuppression, and neuropathy, were observed. Therefore, the FOLFIRINOX regimen is recommended for patients under 75 years old with good performance status (Kamisawa et al., 2016; Kleeff et al., 2016). In 2012, another clinical trial (MPACT) had shown that gemcitabine combined with nanoparticle albumin-bound paclitaxel (nab-paclitaxel) improved survival in comparison to gemcitabine monotherapy (8.5 vs. 6.7 months; P<0.001) (VonHoff et al., 2011; Garrido-Laguna and Hidalgo, 2015). Although the side effects associated with this therapy need to be considered, including alopecia, myelosuppression, nausea, fatigue, and neuropathy, unlike the FOLFIRINOX, this regimen can be given to older patients and those with worst performance (Kamisawa et al., 2016; Kleeff et al., 2016). In conclusion, based on clinical evidence, gemcitabine is still the standard treatment for all PDAC patients, both FOLFI- RINOX and gemcitabine, in conjunction with nab-paclitaxel, are therapeutic strategies for patients who can tolerate the side effects.

Background

2.2 Ionizing radiation

After Wilhelm Conrad Röntgen discovered X-rays in 1895, radium was used for treating cancer within a concise period of time (Walsh, 1897). Radiation therapy is still the most common therapeutic strategy for cancer, with more than 50% of cancer patients receiving radiation therapy (Moding et al., 2013).

Ionizing radiation is a process in which radiation has enough energy to eject at least one electron from its orbital to ionize an atom or molecule, and can be classified as either electromagnetic or particulate (Hall and Giaccia, 2012). X- and γ-rays are two forms of electromagnetic radiation. The difference between X- and γ-rays is their source. X-rays are produced extra- nuclearly, which means that they are generated via an electrical device to accelerate high energy electrons and collide to a tungsten or gold made target. Part of the energy will transfer to X-rays. On the other hand, γ-rays are intranuclear, which are emitted by radioactive isotopes (Hall and Giaccia, 2012; Bell et al., 2018). In contrast to X- and γ-rays, electrons, protons, neutrons, α-particles, and heavy ions are particulate radiations. Electrons, small and negatively charged particles generated by the accelerator, are widely used in cancer therapy (Hall and

Figure 2.3. Direct and indirect DNA damage induced by ionising radiation. Direct DNA damage of ionising radiation is the secondary electron formed by absorption of an x-ray photon attack DNA directly. Indirect DNA damage of ionising radiation occurs when the secondary electron interaction with other molecules, such as water to form hydroxyl radical, which induces DNA damage (Hall and Giaccia, 2012).

Background

Giaccia, 2012). Charged particles, including electrons, protons, α-particles, and heavy ions are direct sources of radiation, because they can disturb the atomic structure through Coulombic force and transfer enough kinetic energy to produce chemical and biological changes (Hall and Giaccia, 2012). Neutrons, X- and γ-rays are indirectly ionizing, as they are not charged and tend to be more penetrant. They transfer sufficient kinetic energy to ionize and free an orbital electron from the target material in the Compton effect (Hall and Giaccia, 2012).

The relative biological effectiveness of radiation depends on (i) the density of ionization events and (ii) the amount of deposited energy. The number of ionization events can be calculated by linear energy transfer (LET). The LET, the average energy deposited per unit length of track (keV/µm), is dependent on the energy and type of radiation involved. Therefore, ionizing radiations with high LET (i.e. densely ionizing) and low LET (i.e. sparsely ionizing) are differenti- ated. The relative biological effectiveness increases with the LET. X-rays, typically used for therapeutic purposes, are sparsely ionizing radiations with a relatively low LET of >3.5 keV/µm. The absorbed dose is defined as the amount of energy emitted by a charged particle that is transferred to a defined unit of mass. The unit of the dose is Gray (Gy) and is calculated by dividing the absorbed energy by the mass of a given object (one Gy = one J/kg). In radiotherapy, this unit is used to describe the dose that is administered to a patient (Hall and Giaccia, 2012). Ionized molecules are extremely reactive and bear a fast cascade of chemical changes, which might result in breaking of chemical bonds. Ionized radiation deposits its energy randomly, which damage all the molecules in the cell, including mRNA, proteins, lipids, and others. In particular, the double-stranded DNA molecule is a major target for the biological effect of ionizing radiations, resulting in gene mutations, carcinogenesis, and cell death. Ionizing radiations induce a large number of lesions, including DNA bases damage (>1000 per cell in one Gy), single-strand DNA break (1000 per cell in one Gy), and double-strand DNA break (20-40 per cell in one Gy) (Joiner and Kogel, 2009; Hall and Giaccia, 2012). - The biological effects induced by ionised radiation can be divided into direct and indirect effects (Figure 2.3.). In the direct radiation action, ionized radiation and the biological effect take place on the same target molecule, as would be incurred by DNA directly. On the other hand, with indirect radiation action, the ionizing radiation interacts with different molecules such as hydro- lyzing of water molecules to generate free radicals that lead to damage of the target molecule. For the x-ray irradiation, approximately seventy percent of DNA damages are generated by indirect radiation action (Hall and Giaccia, 2012).

Background

2.3 Therapeutic resistance

PDAC is known to respond poorly to both chemo- and radiotherapy by triggering several factors, including decreasing bioavailability to the cancer cells, rapidly activating bypass signaling, and barrier of dense desmoplasia (Wang et al., 2011; Haqq et al., 2014; Orth et al., 2019). Therapy resistance can be classified into intrinsic (de novo or innate) and extrinsic resistance. Both extrinsic and intrinsic resistance arise from the dense stroma, an essential consequence for PDAC therapy resistance (Whatcott et al., 2012; Ju et al., 2015). There are a myriad of microenvironmental factors that affect PDAC therapy resistance, in part, via cancer cells physically interacting with components of the ECM (Feig et al., 2012; Weniger et al., 2018). In our group’s previous publication has pointed out cell adhesion-mediated drug resistance (CAMDR) and cell adhesion-mediated radioresistance (CAMRR) are the most critical paradigms underlying therapy resistance (Eke and Cordes, 2015). First, integrin and focal adhesion mediated downstream signaling pathways regulate cell survival, proliferation and therapy resistance via activation of focal adhesion kinase (FAK), c-Jun N-terminal kinase (JNK), extracellular-signal regulate kinase 1/2 (ERK1/2), mitogen-activated kinase (MEK1/2), and protein kinase B (PKB), also known as AKT (Eke and Cordes, 2015). In 2010 Eke et al. have discovered that PINCH1, an adopter protein of focal adhesion complex, enhances radioresistance by inhibiting PP1a in many tumor entities including PDAC (Eke et al., 2010; Sandfort et al., 2010). Moreover, in 2015 Zienert et al. have revealed FHL2, an adopter protein of focal adhesion complex, critically determines PDAC radioresistnace (Zienert et al., 2015). FAK, a highly conserved non-receptor tyrosine kinase, was first discovered by Schaller MD et al. in the v-Src transformed chicken embryo fibroblasts in 1992 (Schaller et al., 1992). FAK serves as a scaffolding protein, connecting integrin heterodimer and their adaptor protein paxillin, after which this complex can regulate cell migration and invasion via activation of Rho-GTPases (Sulzmaier et al., 2014a; Kanteti et al., 2016). In addition, FAK can be translocated to nucleus for downregulating P53 gene expression to prevent cancer cell apoptosis (Golubovskaya and Cance, 2007; Sulzmaier et al., 2014a). Moreover, FAK also can crosstalk with growth factor/cytokine receptors to regulate cell survival and proliferation via PI3K-AKT-mTOR and Ras-Raf-MEK-ERK pathways (Sulzmaier et al., 2014a; Sulzmaier et al., 2014b). Secondly, the dense desmoplasia of PDAC is generating high-level solid stress and hydrostatic pressure in the tumor mediating hypoxia and nutrient-poor microenvironment (Perera and Bardeesy, 2015; Kleeff et al., 2016; Neoptolemos et al., 2018; Orth et al., 2019). Recently studies have shown that inhibiting the critical transcription factor of hypoxia, HIF-1α, sensitized PDAC to gemcitabine and irradiation, reducing PDAC growth (Schwartz et al., 2010; Zhao et al., 2015). Moreover, PDAC is deficient

Background

vascular network, in combination with desmoplasia; these serve as a barrier to drug uptake (Provenzano et al., 2012; Haqq et al., 2014). Third, cancer cell gains therapy resistance through acquiring epithelial-mesenchymal transition (EMT) phenotype, characterized by adop- tion of a spindle-like shape, reduced E-cadherin expression, increased vimentin expression, and upregulation of Notch signaling cascade via TGF-β signaling pathway (Rhim et al., 2012; Gaianigo et al., 2017). Additionally, PDACs often manifest deregulated cellular transporter proteins to reduce the sensitivity of chemotherapy reagent, such as downregulation of the expression of the bidirectional transporter of pyrimidine nucleosides, which lead to gemcitabine resistance in PDAC patients (Spratlin et al., 2004).

It remains a considerable challenge to ameliorate therapy for patients with PDAC. A better understanding of the PDAC therapy resistance mechanism(s) is required in order to improve the survival rate of patients with PDAC.

2.4 Activation of autophagy in PDAC

Macroautophagy (autophagy), an evolutionarily conserved catabolic process, sequesters mis- folded protein aggregates, damaged organelles, or invading pathogens into a double-membrane vesicle called autophagosome and fuse it with lysosome for bulk degradation (Kenific and Debnath, 2015; Santana-Codina et al., 2017). Autophagy is crucial for maintaining home- ostasis and mounting cell stress responses (Murrow and Debnath, 2013). Recently studies have indicated that autophagy in cancer plays a contentious or biphasic role. Autophagy can induce both pro-apoptotic and pro-survival effects during different stages of cancer progression (Maes et al., 2013). In 2011, Kimmelman and colleagues showed that PDAC requires autophagy for tumor growth, in both xenograft mouse models in vitro assays (Yang et al., 2011).

Moreover, Roberge and colleagues have shown that inhibition of autophagy can moderately enhance gemcitabine sensitivity in a xenograft mouse model (Donohue et al., 2013). Interest- ingly, in 2018 an elegant work revealed that SMAD4 gene mutation renders PDAC radioresistance via activation of autophagy (Wang et al., 2018). In conclusion, converging evidence suggests that autophagy plays an important role in PDAC tumorigenesis and also a cytoprotective role in PDAC.

Background

2.5 Integrins

Integrins, first discovered by Tamkun. J. 1986 (Tamkun et al., 1986), are cell-surface adhesion molecules that mediate cell-cell adhesion by connecting intracellular and extracellular environment through physical attachment/anchoring to the extracellular matrix (Srichai and Zent, 2010). Integrins are type I transmembrane heterodimeric glycoproteins, which have two non- covalently bound α and β subunits (Srichai and Zent, 2010). There are eighteen α and eight β known subunits, which are composed of at least twenty-four distinct integrin heterodimers (Hynes, 2002). The classification of integrin heterodimers are via the binding ligands of ECM components, including laminins, collagens, and fibronectin (Figure 2.4.) (Plow et al., 2000; Hynes, 2002). The β1 integrins, β2 integrins, and αV integrins are the three largest subfamily in this classification (Barczyk et al., 2010). The α1β1, α2β1, α10β1, α11β1 integrins are collagen receptors; α3β1, α6β1, α6β4, and α7β1 integrins are the best characterized laminin receptors; and α5β1, α8β1, αIIbβ3, and αVβ6 are the major fibronectin receptors that bind to the RGD sequence (Hynes, 2002; Barczyk et al., 2010).

Integrins have a large extracellular domain that binds to the extracellular environment, a single- membrane-spanning transmembrane domain and a short intracellular cytoplasmic tail domain that links cytoplasmic adaptor proteins and these cytoskeletal proteins transduce signaling for cell adhesion, migration, differentiation, proliferation, survival, and apoptosis (Srichai and Zent, 2010). Integrins transduce intracellular signal bi-directionally, mediating both “outside-in” and “inside-out” signaling processes. The “inside-out” signaling mainly involves a conformation change from inactivate state (bent) to active form, which is regulated by talins, kindlins, filamins, mifgfilin and FAK (Srichai and Zent, 2010; Winograd-Katz et al., 2014). “Inside-out” signaling is crucial in physiological conditions, especially in blood, where the ligands are in close proximity to the cells, integrins activated upon external stimulation, such as injury to the vasculature or induction of inflammation (Ratnikov et al., 2005; Srichai and Zent, 2010).

Unlike other cell surface receptors, integrins lack intrinsic catalytic activity, but provide a connection between extracellular matrix and the actin cytoskeleton (Srichai and Zent, 2010). The “outside-in” signaling mediated by integrins requires structural changes with the cytoplasmic region when binding to their ligands. Integrin signaling is complex and is influenced by crosstalk with growth factor receptors to control downstream intracellular signaling pathways, such as Src-FAK signaling complex, Ras-MEK-MAPK signaling pathway, and Akt-/PI3K signaling pathway (Srichai and Zent, 2010).

Background

Integrins are known to be involved in both health and disease, such as thrombosis, infection immune system disorders, osteoporosis, and cancer, and have been recognized as potential therapeutic targets (Cox et al., 2010; Raab-Westphal et al., 2017).

Figure 2.4. The diversity of integrin subunits and their interactions. The integrin family consist of four sub- groups: RGD receptors (blue), collagen receptors (orange), laminin receptors (purple), and a set of a subunits confined to leukocytes (yellow).Modified from Hynes, 2002. 2.5.1 β8 integrin

β8 integrin, discovered by W. McLean et al. in 1991, is a type I transmembrane protein with a 769-amino acid polypeptide (Moyle et al., 1991). β8 integrin has a large extracellular domain that contains a VWFA domain, four cysteine-rich repeats and a short cytosolic domain (Moyle et al., 1991; Nishimura et al., 1994). β8 integrin forms a heterodimer with αV integrin and binds to RGD sequence of the latent-TGF-β1 and TGF-β3, mediating ligand activation and signal transduction as a negative regulator of epithelial cell growth (Moyle et al., 1991; Cambier et al., 2000; Ozawa et al., 2016; Wang et al., 2017). Previous studies indicated that β8 integrin has several unique structural features in comparison to other β integrins, (i) only 31 to 37% identity at the amino acid level, (ii) 6 of 56 conserved cysteine residues within the extracellular domain are absent in β8 integrin amino acid sequence, with two of the six missing cysteine in the first cysteine-rich repeat are unique, (iii) the cytoplasmic amino acid sequence of β8 integrin is

Background

slightly larger and shares no apparent homology with other β integrins, including the talin binding motif (Moyle et al., 1991). This divergence suggests that β8 integrin signaling is distinct from that of other integrins (Nishimura et al., 1994). Recently studies revealed that β8 integrin is bound to Rho guanine nucleotide dissociation inhibitor-1 (GDI) and activates Rac 1 small GTPase in mouse glomerular mesangial cell (Lakhe-Reddy et al., 2006), and β8 integrin binds with DAL-1 in lung adenocarcinoma (McCarty et al., 2005).

Materials and Methods

3 Hypothesis and Aims

Pancreatic ductal adenocarcinoma (PDAC) is one of the well-known stromal-rich malignancies. Focal adhesions are thought to essentially contribute to the regulation of cancer cell proliferation, survival, metastasis, and therapeutic resistance. Interestingly, we were able to identify β8 integrin as a potential candidate involved in PDAC cell survival and radiosensitivity from our 3D tumoroid high-throughput esiRNA-based screening (3DHT-esiRNAs).

We hypothesize that β8 integrin plays an essential role in PDAC therapeutic resistance.

The aims of this project are:

⚫ To elucidate the underlying mechanism(s) through which β8 integrin mediate PDAC therapeutic resistance.

⚫ To determine the localization of β8 integrin in both PDAC cell lines and PDAC primary cell cultures.

⚫ To investigate the translocation of β8 integrin in PDAC cells upon x-ray or gemcitabine mediated genotoxic stress.

⚫ To clarify the change of β8 integrin interactome composition upon irradiation and how β8 integrin facilitate a connection to autophagy.

Materials and Methods

4 Materials and Methods

4.1 Materials

4.1.1 Devices

Table 4.1. Devices used for biochemical, molecular-biological, and cell culture applications.

Device Type Company

Autoclave V-65 Systec, Wettenberg, DE

Barometer Conrad Electronics, Hirschau, DE

Binocular, incl. light source Stemi2000 Carl Zeiss, Jena, DE

Bag sealing machine Dual Electronic Jencons-PLS, London, GB

Centrifuge 5415R Eppendorf, Hamburg, DE

Centrifuge S415R Eppendorf, Hamburg, DE

Dosimeter PTW Unidos PTW, Freiburg, DE

Freezer, -20 °C KX1011 Liebherr, Ochsenhausen, DE

Heraeus Holding GmbH, Hanau, Freezer, -80 °C DE

Fridge, 4 °C Liebherr, Ochsenhausen, DE

Ice machine AT-10 Scotsman, London, GB

Heraeus Holding GmbH, Hanau, Incubator cell culture HERAcell 240i DE

Inverted Microscope Axiovert 25 Carl Zeiss, Jena, DE

Inverted Fluorescence Carl Zeiss, Jena, DE microscope Laminar flow hood HERAsafe KS Heraeus Holding GmbH, Hanau, DE

Laser Scanning Microscope Axiovert 200M, Carl Zeiss, Jena, DE (LSM) LSM 510 Meta Magnetic stirrer with heater MR 3001 Heidolph, Schwabach, DE

Sharp Electronics (Europe) Microwave GmbH, Hamburg, DE

Mini Vertical Protein Electro- SE250 Hoefer, San Francisco, USA phoresis

Materials and Methods

Device Type Company

Orbital shaker KS260 basic IKA, Staufen, DE

pH-meter ph Level 1 inoLab, Weilheim, DE

Platform shaker Polymax 1040, 2040 Heidolph, Schwabach, DE

Power Supply EPS601 Amersham, Freiburg, DE

Precision scale LE244S-0CE Sartorius, Göttingen, DE

Scale BL 1500S Sartorius, Göttingen, DE

Semi-Dry transfer unit TE77 Amersham, Freiburg, DE

Tecan Microplate-Reader Genios Pro Tecan, Crailsheim, DE

Thermomixer comfort 1,5 ml Eppendorf, Hamburg, DE

VacuSafe IBS Integra Bioscience, Vacuum pump Vacusafe comfort Chur, CH

Vortex mixer Reax control VWR, Darmstadt, DE

Yxlon International GmbH, X-ray system Y.Maxishot Hamburg, DE

4.1.2 Additional materials

Table 4.2. Materials used for biochemical, molecular-biological, and cell culture applications.

Material Company

Cell culture flasks; T-25, T-75, T-175 cm2 Corning Life Science, Wiesbaden, DE

Cell culture plates, 96-Well, flat bottom Corning Life Science, Wiesbaden, DE

Cell culture plates, 96-Well, round bottom Corning Life Science, Wiesbaden, DE

Cell culture plates; 6-, 12-, 24-Well BD, Heidelberg, DE

Cell culture plates; 60 mm, 100 mm BD, Heidelberg, DE

Cell scraper BD, Heidelberg, DE

Centrifuge tubes; 15 ml, 50 ml Greiner Bio-one GmbH, Frickenhausen, DE

Coverslips, 12 mm, round Glaswarenfabrik Karl Hecht KG, Sondheim, DE

Cryo vials Biochrom, Berlin, DE

Culture-Insert 2 Well in µ-Dish 35 mm ibidi GmbH, Gräfelfing, DE

Eppendorf Safe-Lock Tubes, 1.5 ml, 2 ml Eppendorf, Hamburg, DE

Materials and Methods

Material Company

Film cassette Amersham, Freiburg, DE

Glass Pasteur pipets Brand GmbH u. Co. KG, Wertheim, DE

Hamilton-Syringe, 50 µl Hamilton Bonaduz AG, Bonaduz, CH

HyperTM ECL-films Amersham, Freiburg, DE

Insulin syringe, 0,3 mm x 12 mm Braun, Melsungen, DE

Laboratory bottles Schott AG, Mainz, DE

Nitrocellulose membrane Protran; 0,2 µm Schleicher & Schuell, Dassel, DE

Microscopy slides, Superfrost Roth, Karlsruhe, DE

Pipette tips with filter, sterile; 10-1000 µl Sarstedt, DE

Pipettes; 1, 5, 10, 25 ml BD, Heidelberg, DE

Pipette controller, accu jet pro Brand, Herrenberg, DE

Protein A/G beads, 50% slurry Alpha Diagnostics, Paramus, USA

Reaction tube, Safe Lock; 1,5 ml, 2 ml Eppendorf, Hamburg, DE

Reaction tube rack Rotilab, Roth, Karlsruhe, DE

Whatman filter paper; 3 mm Bender-Hobein, Zürich, CH

4.1.3 esiRNA

Table 4.3. Enzymatically-prepared siRNA (esiRNA) used to silence the indicated genes. Corresponding sequences are shown.

Gene name Sequence

TCCCCGTAACAAGAGAGGAGTGATAATTAAAGGTTTAGAAGAAATTACAGTACACAACAAGGATGAA GTCTATCAAATTTTAGAAAAGGGGGCAGCAAAAAGGACAACTGCAGCTACTCTGATGAATGCATACT CTAGTCGTTCCCACTCAGTTTTCTCTGTTACAATACATATGAAAGAAACTACGATTGATGGAGAAGAG KIF11 CTTGTTAAAATCGGAAAGTTGAACTTGGTTGATCTTGCAGGAAGTGAAAACATTGGCCGTTCTGGAG CTGTTGATAAGAGAGCTCGGGAAGCTGGAAATATAAATCAATCCCTGTTGACTTTGGGAAGGGTCAT TACTGCCCTTGTAGAAAGAACACCTCATGTTCCTTATCGAGAATCTAAACTAACTAGAATCCTCCAG GATTCTCTTGGAGGGCGTACA

GATAACTGGTCCGCAGTGGTGGGCCAGATGTAAACAAATGAATGTTCTTGATTCATTTATTAATTATT ATGATTCAGAAAAACATGCAGAAAATGCTGTTATTTTTTTACATGGTAACGCGGCCTCTTCTTATTTAT GGCGACATGTTGTGCCACATATTGAGCCAGTAGCGCGGTGTATTATACCAGACCTTATTGGTATGG RLUC GCAAATCAGGCAAATCTGGTAATGGTTCTTATAGGTTACTTGATCATTACAAATATCTTACTGCATGG TTTGAACTTCTTAATTTACCAAAGAAGATCATTTTTGTCGGCCATGATTGGGGTGCTTGTTTGGCATT TCATTATAGCTATGAGCATCAAGATAAGATCAAAGCAATAGTTCACGCTGAAAGTGTAGTAGATGTG ATTGAATCATGGGATGAATGG

GGCAAGATGAGAGTGCACAAGATCTCCAACGTCAACAAGGCCCTGGATTTCATAGCCAGCAAAGGC GTCAAACTGGTGTCCATCGGAGCCGAAGAAATCGTGGATGGGAATGTGAAGATGACCCTGGGCAT ACTN1 GATCTGGACCATCATCCTGCGCTTTGCCATCCAGGACATCTCCGTGGAAGAGACTTCAGCCAAGGA AGGGCTGCTCCTGTGGTGTCAGAGAAAGACAGCCCCTTACAAAAATGTCAACATCCAGAACTTCCA CATAAGCTGGAAGGATGGCCTCGGCTTCTGTGCTTTGATCCACCGACACCGGCCCGAGCTGATTGA CTACGGGAAGCTGCGGAAGGATGATCCACTCACAAATCTGAATACGGCTTTTGACGTGGCAGAGAA

Materials and Methods

GTACCTGGACATCCCCAAGATGCTGGATGCCGAAGACATCGTTGGAACTGCCCGACCGGATGAGA AAGCCATCATGACTTACGTGTCTAGCTTCTACCACGCCTTCTCTGGAG

TCAGCATGCAAGGACAAGAGCGTGCGCATCATCGACCCCCGTCGGGGCACCCTGGTGGCAGAGC GGGAGAAGGCTCATGAGGGGGCCCGGCCCATGCGGGCCATCTTCCTGGCAGATGGCAAGGTGTT CACCACAGGCTTCAGCCGAATGAGCGAGCGGCAGCTGGCGCTCTGGGACCCAGAAAACCTCGAG GAACCCATGGCCCTGCAGGAACTGGACTCGAGCAACGGGGCCCTGCTGCCCTTCTACGACCCCGA CORO1B CACCAGTGTGGTCTACGTCTGCGGCAAGGGTGACTCCAGCATCCGGTACTTTGAGATCACAGAGGA GCCTCCCTACATCCACTTCCTGAACACGTTCACCAGCAAGGAGCCGCAGCGGGGTATGGGCAGCA TGCCCAAGCGGGGCCTGGAGGTCAGCAAGTGCGAGATCGCCCGGTTCTACAAACTGCATGAGCGC AAGTGTGAGCCCATCGTCATGACTGTGCCAAGAAAGTCG

TTGCTGCAGATGTTCTACCGGCAACAGGAGGAGATCCGAAGGCTCCGGGAGCTGTTGACCCAGCG AGAGGTCCAGGCCAAACAGTTGGAACTGGAGATCAAAAACTTGCGGATGGGCTCAGAGCAGCTCT GAGCAGAGACCTCTGCCCTCCTCACCCTCAGGGACACCACTCGGCTCCATGGGGAGGTTTAGAAC CORO2A CAAACCACAAGTCCCCTCAAGGACAACCACTATTTCTATATTTTTTACCAGAAAACAAAACTCTCCAT CGCTGAAAGAGATTCCAGTGGGACATGGTGCCGTTTTTCTGTTTGCCTTCTTGCAACAACAGTTTCT GAATTGACTTTGTTTTCAGATGATGCCTTCTGTTGAATTCTGTTATTAAGGGCCCATGATGAGCTGTA ACTTCTCAAGAGGAAAGAACACAGTAGAAAACTAGAGCTGGAAGGATCTAGGTTGA

CTTGGGAAGGAAGGCAGTGCCTGCTCTGCTGTGAGCCGCCAGGAACCCTCCTCCTGTCAATGGGG GTGTAGTATTTTTGCCAAAATATCATGTTCAATTTCAGTAGTTTGATCAGTTGAAGGCTAGAAGTGTG AAGTGCAGATGAGTGTGTGTTCTTCCCCAAGGTCCCCCCACAGCTCCAGGACACCGCTGTCCTGGC CTTN ATTTGTGGCCACTCACTTTGTAGGAAACTCATCTCCTTCCTGAGGAGCCGGGAGGCTGGACCAGTC CCGTCGTGCAGTCAGGTGGGCGGTGTGTCTTTCCAGAAGGTCACGTGGAAATGTCTCGGGACTTG GGTCCCGGAGTGCCCGTGAAGCGTGTTTTTGCTCCTGAGGTGCATTTTCTCATCATCCTTGCTTTAC CACAATGAGCAATGAGGTCGGGTTTTA

GACATCATCCGCAATGACAATGACACCTTCACGGTCAAGTACACGCCCCGGGGGGCTGGCAGCTA CACCATTATGGTCCTCTTTGCTGACCAGGCCACGCCCACCAGCCCCATCCGAGTCAAGGTGGAGC CCTCTCATGACGCCAGTAAGGTGAAGGCCGAGGGCCCTGGCCTCAGTCGCACTGGTGTCGAGCTT FLNA GGCAAGCCCACCCACTTCACAGTAAATGCCAAAGCTGCTGGCAAAGGCAAGCTGGACGTCCAGTTC TCAGGACTCACCAAGGGGGATGCAGTGCGAGATGTGGACATCATCGACCACCATGACAACACCTAC ACAGTCAAGTACACGCCTGTCCAGCAGGGTCCAGTAGGCGTCAATGTCACTTATGGAGGGGATCCC ATCCCTAAGAGCCCTTTC

ATCGATGGCCACATCTATGCCGTCGGCGGCTCCCACGGCTGCATCCACCACAACAGTGTGGAGAG GTATGAGCCAGAGCGGGATGAGTGGCACTTGGTGGCCCCAATGCTGACACGAAGGATCGGGGTG GGCGTGGCTGTCCTCAATCGTCTCCTTTATGCCGTGGGGGGCTTTGACGGGACAAACCGCCTTAAT TCAGCTGAGTGTTACTACCCAGAGAGGAACGAGTGGCGAATGATCACAGCAATGAACACCATCCGA KEAP1 AGCGGGGCAGGCGTCTGCGTCCTGCACAACTGTATCTATGCTGCTGGGGGCTATGATGGTCAGGA CCAGCTGAACAGCGTGGAGCGCTACGATGTGGAAACAGAGACGTGGACTTTCGTAGCCCCCATGA AGCACCGGCGAAGTGCCCTGGGGATCACTGTCCACCAGGGGAGAATCTACGTCCTTGGAGGCTAT GATGGTCACA

GAAGAAGCCCTACTGCAACGCACACTACCCCAAGCAGTCCTTCACCATGGTGGCGGACACCCCGG AAAACCTTCGCCTCAAGCAACAGAGTGAGCTCCAGAGTCAGGTGCGCTACAAGGAGGAGTTTGAGA AGAACAAGGGCAAAGGTTTCAGCGTAGTGGCAGACACGCCCGAGCTCCAGAGAATCAAGAAGACC LASP1 CAGGACCAGATCAGTAACATAAAATACCATGAGGAGTTTGAGAAGAGCCGCATGGGCCCTAGCGG GGGCGAGGGCATGGAGCCAGAGCGTCGGGATTCACAGGACGGCAGCAGCTACCGGCGGCCCCTG GAGCAGCAGCAGCCTCACCACATCCCGACCAGTGCCCCGGTTTACCAGCAGCCCCAGCAGCAGCC GGTGGCCCAGTCCTATGGTGGCTACAAGGAGCC

AAAGTCAGCAAGCAGGAGGAGGCCTCAGGGGGGCCCACAGCCCCCAAAGCTGAGAGTGGTCGAA GCGGAGGTGGGGGACTCATGGAAGAGATGAACGCCATGCTGGCCCGGAGAAGGAAAGCCACGCA AGTTGGGGAGAAAACCCCCAAGGATGAATCTGCCAATCAGGAGGAGCCAGAGGCCAGAGTCCCGG VASP CCCAGAGTGAATCTGTGCGGAGACCCTGGGAGAAGAACAGCACAACCTTGCCAAGGATGAAGTCG TCTTCTTCGGTGACCACTTCCGAGACCCAACCCTGCACGCCCAGCTCCAGTGATTACTCGGACCTA CAGAGGGTGAAACAGGAGCTTCTGGAAGAGGTGAAGAAGGAATTGCAGAAAGTGAAAGAGGAAAT CATTGAAGCCTTCG

AGATTTCGATGGGGTCCTCTATCATATTTCAAATCCTAATGGAGACAAAACAAAAGTGATGGTCAGT ATTTCTTTGAAATTCTACAAGGAACTTCAGGCACATGGTGCTGATGAGTTATTAAAGAGGGTGTACG GGAGTTTCTTGGTAAATCCAGAATCAGGATACAATGTCTCTTTGCTATATGACCTTGAAAATCTTCCG ARPC2 GCATCCAAGGATTCCATTGTGCATCAAGCTGGCATGTTGAAGCGAAATTGTTTTGCCTCTGTCTTTG AAAAATACTTCCAATTCCAAGAAGAGGGCAAGGAAGGAGAGAACAGGGCAGTTATCCATTATAGGG ATGATGAGACCATGTATGTTGAGTCTAAAAAGGACAGAGTCACAGTAGTCTTCAGCACAGTGTTTAA GGATGACGACGATGTGGTCATTGGAAAGGTGTTCATGCAG

Materials and Methods

ACGCCTACATCGACAACCTCATGGCGGACGGGACCTGTCAGGACGCGGCCATCGTGGGCTACAAG GACTCGCCCTCCGTCTGGGCCGCCGTCCCCGGGAAAACGTTCGTCAACATCACGCCAGCTGAGGT GGGTGTCCTGGTTGGCAAAGACCGGTCAAGTTTTTACGTGAATGGGCTGACACTTGGGGGCCAGA PFN1 AATGTTCGGTGATCCGGGACTCACTGCTGCAGGATGGGGAATTTAGCATGGATCTTCGTACCAAGA GCACCGGTGGGGCCCCCACCTTCAATGTCACTGTCACCAAGACTGACAAGACGCTAGTCCTGCTGA TGGGCAAAGAAGGTGTCCACGGTGGTTTGATCAACAAGAAATGTTATGAAATGGCCTCCCACCTTC GGCGTTCCCAGTACTGACCTCGTCTGTCCCTTC

ACCGTCATTCTGGGAAAGAAAACAGAAGTGAAAGCCACGAGGGAGCAAGAAAGAAACAGACCAGAA ACCATCCGAACAAAGCCAGAAGAGAAAATGTTCGATTCTAAAGAGAAGGCTTCCGAGGAGAGAAAC CTAAGATGGGAAGAATTGACAAAGTTAGATAAGGAAGCGAGACAGAGAGAAAGCCAGCAGATGAAG SYNM GAGAAGGCTAAGGAGAAGGACTCACCGAAGGAGAAGAGCGTGCGAGAGAGAGAGGTGCCGATTA GTCTAGAAGTATCCCAGGACAGAAGAGCAGAGGTGTCCCCGAAAGGTTTGCAGACGCCTGTGAAG GATGCTGGTGGTGGGACCGGTAGAGAGGCAGAAGCAAGAGAGCTACGGTTCAGGTTGGGCACCA GTGATGCCACTGGTTCTCTGCAAGGCGATTCCATGACAGAAACCGTAGCA

GGTGTGGTTCGGACTAAGGATCACCGCTTTGAAAGTGTCAGTCACCTTATCAGCTACCACATGGAC AATCACTTGCCCATCATCTCTGCGGGCAGCGAACTGTGTCTACAGCAACCTGTGGAGCGGAAACTG TGATCTGCCCTAGCGCTCTCTTCCAGAAGATGCCCTCCAATCCTTTCCACCCTATTCCCTAACTCTC SHC1 GGGACCTCGTTTGGGAGTGTTCTGTGGGCTTGGCCTTGTGTCAGAGCTGGGAGTAGCATGGACTC TGGGTTTCATATCCAGCTGAGTGAGAGGGTTTGAGTCAAAAGCCTGGGTGAGAATCCTGCCTCTCC CCAAACATTAATCACCAAAGTATTAATGTACAGAGTGGCCCCTCACCTGGGCCTTTCCTGTGCCAAC CTGAT

TCATTTATGGAGGGTGCAATCATTTATGTTATAAAGAAGAATGATGATGGCTGGTATGAAGGAGTCT GCAATCGAGTGACTGGTCTGTTCCCTGGGAACTATGTTGAATCAATCATGCACTATACTGATTAATTT TTTTTTTTCTTTTGAAGTAGATTCTTATTACTCAGTCATACTGTGGGACTATTATGGTTAACAGAACTG SSH3BP TCTTAATATGTTTTAAAATGTGCCCATATTTTCAGAACATGCTGTTTTATTGGTAAATTGAATGTCTAC CTGTAAGCATAAATCTTTGAGGCAGTTTATGTATTGCTGAATAGCAATTTATACAAGAAGCTGTCCAT AACTGATTATGCTTATGTACTTACTTACACATTTTTAACTTTATGACCAGCCTAAATATTCTGGGGGAA GTGGGGTATA

GACCCCAATGGCTACATGATGATGTCCCCCAGCGGTGGCTGCTCTCCTGACATTGGAGGTGGCCC CAGCAGCAGCAGCAGCAGCAGCAACGCCGTCCCTTCCGGGACCAGCTATGGAAAGCTGTGGACAA ACGGGGTAGGGGGCCACCACTCTCATGTCTTGCCTCACCCCAAACCCCCAGTGGAGAGCAGCGGT IRS1 GGTAAGCTCTTACCTTGCACAGGTGACTACATGAACATGTCACCAGTGGGGGACTCCAACACCAGC AGCCCCTCCGACTGCTACTACGGCCCTGAGGACCCCCAGCACAAGCCAGTCCTCTCCTACTACTCA TTGCCAAGATCCTTTAAGCACACCCAGCGCCCCGGGGAGCCGGAGGAGGGTGCCCGGCATCAGC ACCTCCGCCTTTCCACTAGCTCTGGTCGCCTTC

TCCGGCAGGTAGATGAGAACTGGTACGAAGGGAGGATCCCGGGGACATCCCGACAAGGCATCTTC CCCATCACCTACGTGGATGTGATCAAGCGACCACTGGTGAAAAACCCTGTGGATTACATGGACCTG CCTTTCTCCTCCTCCCCAAGTCGCAGTGCCACTGCAAGCCCACAGCAACCTCAAGCCCAGCAGCGA SORBS1 AGAGTCACCCCCGACAGGAGTCAAACCTCACAAGATTTATTTAGCTATCAAGCATTATATAGCTATAT ACCACAGAATGATGATGAGTTGGAACTCCGCGATGGAGATATCGTTGATGTCATGGAAAAATGTGA CGATGGA

GTCCACCTTCCAGCAGATGTGGATCAGCAAGCAGGAGTATGACGAGTCCGGCCCCTCCATCGTCC ACCGCAAATGCTTCTAGGCGGACTATGACTTAGTTGCGTTACACCCTTTCTTGACAAAACCTAACTT GCGCAGAAAACAAGATGAGATTGGCATGGCTTTATTTGTTTTTTTTGTTTTGTTTTGGTTTTTTTTTTT ACTB TTTTTGGCTTGACTCAGGATTTAAAAACTGGAACGGTGAAGGTGACAGCAGTCGGTTGGAGCGAGC ATCCCCCAAAGTTCACAATGTGGCCGAGGACTTTGATTGCACATTGTTGTTTTTTTAATAGTCATTCC AAATATGAGATGCGTTGTTACAGGAAGTCCCTTGCCATCCTAAAAGCCACCCCACTTCTCTCTAAGG AGAATGGCCCAGTCCTCTCCCAAGTCCACACAGGGGAGGTGATAGCAT

AACCCCACTGACAAGACCAGCAGCATCCAGTCACGACCCCTGCCCTCACCCCCTAAGTTCACCTCC CAGGACTCGCCAGATGGGCAGTACGAGAACAGCGAGGGGGGCTGGATGGAGGACTATGACTACG TCCACCTACAGGGGAAGGAGGAGTTTGAGAAGACCCAGAAGGAGCTGCTGGAAAAGGGCAGCATC ACGCGGCAGGGCAAGAGCCAGCTGGAGTTGCAGCAGCTGAAGCAGTTTGAACGACTGGAACAGGA BCAR1 GGTGTCACGGCCCATAGACCACGACCTGGCCAACTGGACGCCAGCCCAACCCCTGGCCCCGGGG CGAACAGGCGGCCTGGGGCCCTCGGACCGGCAGCTGCTGCTCTTCTACCTGGAGCAGTGTGAGG CCAACCTGACCACACTGACCAACGCCGTGGACGCCTTCTTTACCGCCGTGGCCACCAACCAGCCG CCCAAGATCTTTGTGGCGCACAGCAAGTTCGTCATCCTCA

AATCTGCCTCTGAAGCTGGAGATACTAGCTGCAGAGCTCAGGGGAGCTGCTCCACATCACCGACAT GAAGGGAACAGGCATCATGGACTGTGCGCCCAAGGCACTCCTGGCCAGGGCACTTTATGACAACT CASS4 GCCCTGACTGCTCTGACGAGCTGGCTTTCAGCAGAGGGGACATCCTGACCATTCTGGAGCAACAC GTGCCAGAAAGCGAGGGTTGGTGGAAGTGTTTGCTCCATGGGAGGCAAGGCCTGGCCCCTGCCAA CCGCCTCCAAATCCTCACGGAGGTCGCTGCAGACAGGCCGTGCCCCCCATTCCTGAGAGGCCTGG

Materials and Methods

AAGAAGCTCCTGCCAGCTCAGAGGAGACCTATCAGGTGCCCACTCTACCCCGCCCTCCCACTCCA GGCCCCGTTTATGAGCAGATGAGGAGTTGGG

GAGCTGAGCGAGAAGCAAGTGTACGACGCGCACACCAAGGAGATCGACCTGGTCAACCGCGACCC TAAACACCTCAACGATGACGTGGTCAAGATTGACTTTGAAGATGTGATTGCAGAACCAGAAGGGAC ACACAGTTTTGACGGCATTTGGAAGGCCAGCTTCACCACCTTCACTGTGACGAAATACTGGTTTTAC CAV1 CGCTTGCTGTCTGCCCTCTTTGGCATCCCGATGGCACTCATCTGGGGCATTTACTTCGCCATTCTCT CTTTCCTGCACATCTGGGCAGTTGTACCATGCATTAAGAGCTTCCTGATTGAGATTCAGTGCATCAG CCGTGTCTATTCCATCTACGTCCACACCGTCTGTGACCCACTCTTTGAAGCTGTTGGGAAAATATTC AGCAATGTCCGCATC

GAGGTCGGTGAGCTGGTAAAGGTTACGAAGATTAATGTGAGTGGTCAGTGGGAAGGGGAGTGTAA TGGCAAACGAGGTCACTTCCCATTCACACATGTCCGTCTGCTGGATCAACAGAATCCCGATGAGGA CTTCAGCTGAGTATAGTTCAACAGTTTTGCTGACAGATGGGAACAATCTTTTTTTTTTTTTTCCAACTG CRK CCATCTATACAATTTTCTTACAGATGTCAAAAGCAGTCTAGTTTATATAAGCATTCTGTTACCTGTGAT ATTTTTTAGACTGAACTGCTCCATTCCTAGTCTTAATTACCATATTCAGGGTACGAACTGGAGGGCTT GTGTGTTAGCTTCTGAATTGGCAATTGGAGGCGGTAGTGGTCGTGCCTGTGTGTATCAGAAGGGAT AGGTATCTTGCCTCCTTTCTCTCAGGCAGTGCAAATCAC

ATCTGTCTCAGCACCCAACCTGCCTACAGCAGAAGATAACCTGGAATATGTACGGACTCTGTATGAT TTTCCTGGGAATGATGCCGAAGACCTGCCCTTTAAAAAGGGTGAGATCCTAGTGATAATAGAGAAG CCTGAAGAACAGTGGTGGAGTGCCCGGAACAAGGATGGCCGGGTTGGGATGATTCCTGTCCCTTA CRKL TGTCGAAAAGCTTGTGAGATCCTCACCACACGGAAAGCATGGAAATAGGAATTCCAACAGTTATGG GATCCCAGAACCTGCTCATGCATACGCTCAACCTCAGACCACAACTCCTCTACCTGCAGTTTCCGGT TCTCCTGGGGCAGCAATCACCCCTTTGCCATCCACACAGAATGGACCTGTCTTTGCGAAAGCAATC CAGAAAAGAGTACCCTGTGCTTATGACAAGACTGCCTTGGCATTAGAGGTTGGTGACATCGTGAA

CCCTCAGATCCCAGTTCCTTTAGAAAGCAGTTACCCAACAGAAACATTCTGGGCTGGGAACCAGGG AGGCGCCCTGGTTTGTTTTCCCCAGTTGTAATAGTGCCAAGCAGGCCTGATTCTCGCGATTATTCTC GAATCACCTCCTGTGTTGTGCTGGGAGCAGGACTGATTGAATTACGGAAAATGCCTGTAAAGTCTG VIL2 AGTAAGAAACTTCATGCTGGCCTGTGTGATACAAGAGTCAGCATCATTAAAGGAAACGTGGCAGGA CTTCCATCTGTGCCATACTTGTTCTGTATTCGAAATGAGCTCAAATTGATTTTTTAATTTCTATGAAGG ATCCATCTTTGTATATTTACATGCTTAGAGGGGTGAAAATTATTTTGGAAATTGAGTCTGAAGCACTC TCGCACACACAG

GGTGTACTGCCTGGACGACTTCTACAGGAAATTCGCCCCCGTCTGCAGCATCTGTGAAAATCCCAT CATCCCTCGGGATGGGAAAGATGCCTTCAAAATCGAATGCATGGGAAGAAACTTCCATGAAAATTG CTACAGGTGTGAGGACTGCAGGATCCTCCTGTCTGTCGAGCCCACGGACCAAGGCTGCTACCCCC FBLIM1 TGAACAACCATCTCTTCTGCAAGCCATGCCATGTGAAGCGGAGTGCTGCGGGGTGCTGCTGAGAGT GCCCGCTGGGCAGTGAACAGACCACTAGCCCCGGCTGGGGCCCTTCCCTGACTTGGTTTCCCTTC CTAACCTGCTCTTGCACACTTTCCTTCTGAGCCTCCATGGAGACCAGCCTGCAAGCCGGCCCAGCC TGTCCAGGATACAGTGGGGCTGAG

GAACAAGGCATCCAAGAGGATGAGCAGCTGCTCTTACGATTTAAATATTATTCTTTCTTCGACTTGAA TCCTAAATATGATGCTGTCCGAATAAACCAACTCTATGAGCAAGCCAGGTGGGCCATTCTCTTAGAA GAAATTGATTGCACAGAGGAAGAAATGTTGATCTTTGCAGCTCTACAGTACCACATTAGCAAACTGT C20orf42 CGTTGTCTGCTGAAACACAGGATTTTGCAGGCGAGTCCGAGGTTGATGAAATAGAAGCGGCGCTTT CTAATTTGGAAGTAACCCTAGAAGGTGGAAAAGCGGACAGCCTTTTGGAGGACATTACTGATATCCC TAAACTTGCAGATAATCTCAAATTATTTAGGCCCAAGAAGTTACTACCAAAAGCTTTCAAACAATATT GGTTTATCTTTAAAGACACATCCATAGCATACTTTAAAAATAAGGAACTTGAACAAGGAGAACCA

TCTGCTTGGTTTGGTGACAGTGCTTTGTCAGAAGGCAATCCTGGTATACTTGCTGTCAGTCAACCAA TCACGTCACCAGAAATCTTGGCAAAAATGTTCAAGCCTCAAGCTCTTCTTGATAAAGCAAAAATCAAC CAAGGATGGCTTGATTCCTCAAGATCTCTCATGGAACAAGATGTGAAGGAAAATGAGGCCTTGCTG PLEKHC1 CTCCGATTCAAGTATTACAGCTTTTTTGATTTGAATCCAAAGTATGATGCAATCAGAATCAATCAGCT TTACGAGCAGGCCAAATGGGCCATTCTCCTGGAAGAGATTGAATGCACAGAAGAAGAAATGATGAT GTTTGCAGCCCTGCAGTATCATATCAATAAGCTGTCAATCATGACATCAGAGAATCATTTGAACAACA GTGACAAAGAAGTTGATGAAGTTGATGCTGCCCTTTC

GAAAGTTCAAGGCCAAGCAGCTCACCCCACGGATCCTGGAAGCCCACCAGAATGTGGCCCAGTTG TCGCTGGCAGAGGCCCAGCTGCGCTTCATCCAGGCCTGGCAGTCCCTGCCCGACTTCGGCATCTC CTATGTCATGGTCAGGTTCAAGGGCAGCAGGAAAGACGAGATCCTGGGCATCGCCAACAACCGAC FERMT3 TGATCCGCATCGACTTGGCCGTGGGCGACGTGGTCAAGACCTGGCGTTTCAGCAACATGCGCCAG TGGAATGTCAACTGGGACATCCGGCAGGTGGCCATCGAGTTTGATGAACACATCAATGTGGCCTTC AGCTGCGTGTCTGCCAGCTGCCGAATTGTACACGAGTATATCGGGGGCTACATTTTCCTGTCGACG CGGGAGCGGGCCCGTGGGGAGGAGCTGGATGAAGACCTCTTCCTGCAGCTCAC

TCCTCACAGAGAGGGACGACATCCTGTGCCCCGACTGTGGGAAAGACATCTGAATTCAACACAGAG FHL2 AAGTTGCTGCTTGTGATCTCACACACAGATTTTTATGTTTTCTTTCTCACCCAGGCAATCTTGCCTTC TGGTTTCTTCCAGCCACATTGAGACTTTCTTCTAGTGCTTTTCAGTGATACTCACGTTTGCTTAAACC

Materials and Methods

CTTTAGTGCTTTGTGATAGTTCAGTCCCAGGGAAAGAGAAAACTCGCCCTAGGCCCTAGGTGGGAA GATGGTTTGAAATTTTTGTAATCGAGTAAGGCACACCCAAATGTAAAAATCCTTTTGAATGATGCCTT TATAAATCTTTCTCTCACTGTCTATTTAAGTGCAATTAACATATGTCACGAACTTGAAAGTTTTCTAAA CTCAATAAGGTAATGACCAGTTGTTATTTACAGCTCTGTAACCTCCCGTTGCGTCAAGTCTAAACC

TGACATTCCTCCAACACCTGGTAATACTTATCAGATTCCACGAACATTTCCAGAAGGAACCTTGGGA CAGACATCAAAGCTAGACACTATTCCAGATATTCCTCCACCTCGGCCACCGAAACCACATCCAGCTC ATGACCGATCTCCTGTGGAAACGTGTAGTATCCCACGCACCGCCTCAGACACTGACAGTAGTTACT GAB1 GTATCCCTACAGCAGGGATGTCGCCTTCACGTAGTAATACCATTTCCACTGTGGATTTAAACAAATT GCGAAAAGATGCTAGTTCTCAAGACTGCTATGATATTCCACGAGCATTTCCAAGTGATAGATCTAGT TCACTTGAAGGCTTCCATAACCACTTTAAAGTCAAAAATGTGTTGACAGTGGGAAGTGTTTCAAGTG AAGAACTGGATGAAAATTACGTCCCAATGAATCCCAATTCACC

CTGAGTGTGGCCTTCTCCTCTGACAACCGGCAGATTGTCTCTGGATCTCGAGATAAAACCATCAAG CTATGGAATACCCTGGGTGTGTGCAAATACACTGTCCAGGATGAGAGCCACTCAGAGTGGGTGTCT TGTGTCCGCTTCTCGCCCAACAGCAGCAACCCTATCATCGTCTCCTGTGGCTGGGACAAGCTGGTC GNB2L1 AAGGTATGGAACCTGGCTAACTGCAAGCTGAAGACCAACCACATTGGCCACACAGGCTATCTGAAC ACGGTGACTGTCTCTCCAGATGGATCCCTCTGTGCTTCTGGAGGCAAGGATGGCCAGGCCATGTTA TGGGATCTCAACGAAGGCAAACACCTTTACACGCTAGATGGTGGGGACATCATCAACGCCCTGTGC TTCAGCCCTAACCGCTACTGGCTGTGTG

CCCTCTCACTTTGGTTGGAACTTTAGGGGGTGGGAGGGGGCGTTGGATTTAAAAATGCCAAAACTT ACCTATAAATTAAGAAGAGTTTTTATTACAAATTTTCACTGCTGCTCCTCTTTCCCCTCCTTTGTCTTT TTTTTCATCCTTTTTTCTCTTCTGTCCATCAGTGCATGACGTTTAAGGCCACGTATAGTCCTAGCTGA GRB2 CGCCAATAATAAAAAACAAGAAACCAAGTGGGCTGGTATTCTCTCTATGCAAAATGTCTGTTTTAGTT GGAATGACTGAAAGAAGAACAGCTGTTCCTGTGTTCTTCGTATATACACACAAAAAGGAGCGGGCA GGGCCGCTCGATGCCTTTGCTGTTTAGCTTCCTCCAGAGGAGGGGACTTGTAGGAATCTGCCTTCC AGCCCAGACCCCCAGTGTATTTT

AGCTGTCTCGATGCACACACTGGTATATCCCATGAAGACCTCATCCAGAACTTCCTGAATGCTGGCA GCTTTCCTGAGATCCAGGGCTTTCTGCAGCTGCGGGGTTCAGGACGGAAGCTTTGGAAACGCTTTT TCTGCTTCTTGCGCCGATCTGGCCTCTATTACTCCACCAAGGGCACCTCTAAGGATCCGAGGCACC GRB7 TGCAGTACGTGGCAGATGTGAACGAGTCCAACGTGTACGTGGTGACGCAGGGCCGCAAGCTCTAC GGGATGCCCACTGACTTCGGTTTCTGTGTCAAGCCCAACAAGCTTCGAAATGGCCACAAGGGGCTT CGGATCTTCTGCAGTGAAGATGAGCAGAGCCGCACCTGCTGGCTGGCTGCCTTCCGCCTCTTCAA GTACG

CACTTCGGGACTCAATGCTTAAGTATCCAGATAGTCACCAGCCCAGGATCTTTGGGGGGGTCTTGG AGAGTGATGCAAGAAGTGAATCCCCCCAACCAGCACCAGACTGGGGCTCCCAGAGGCCATTTCATA GGTTTGATGATGTATGGCCTATGGACCCCCATCCTAGAACCAGAGAGGACAATGATCTTGATTCCCA HAX1 GGTTTCCCAGGAGGGTCTTGGCCCGGTTCTACAGCCCCAGCCCAAATCCTATTTCAAGAGCATCTC TGTGACCAAGATCACTAAACCAGATGGGATAGTGGAGGAGCGCCGGACTGTGGTGGACAGTGAGG GCCGGACAGAGACTACAGTAACCCGACACGAAGCAGATAGCAGTCCTAGGGGTGATCCAGAATCA CCAAGACCTCCAGCCCTGGATGATGCCTTTTCCATCCTG

GAGCGGGAACGGGAGTAGCTGCCTGGGCGCCAAAGGCCGCGGCACTCCCACGCGGACCCCGAA GTCCGCAACCCGGGGATGGGCCCGCGGCTGCGAGGGGATCTTCTCTGGATCAAGCAATGGTGGT GAAAAATGTTTCGCAAGGGCAAAAAACGACACAGTAGTAGCAGTTCCCAAAGTAGCGAAATCAGTA ITGB1BP1 CTAAGAGCAAGTCTGTGGATTCTAGCCTTGGGGGTCTTTCACGATCCAGCACTGTGGCCAGCCTCG ACACAGATTCCACCAAAAGCTCAGGACAAAGCAACAATAATTCAGATACCTGTGCAGAATTTCGAAT AAAATATGTTGGTGCCATTGAGAAACTGAAACTCTCCGAGGGAAAAGGCCTTGAAGGGCCATTAGA CCTGATAAATTATATAGACGTTGCCCAGCAAGATGGAAAGTTGCCTT

GAGGACTACTTCGGCACCTGTATCAAGTGCAACAAAGGCATCTATGGGCAGAGCAATGCCTGCCAG GCCCTGGACAGCCTCTACCACACCCAGTGCTTTGTTTGCTGCTCTTGTGGGCGAACTTTGCGTTGC AAGGCTTTCTACAGTGTCAATGGCTCTGTGTACTGTGAGGAAGATTATCTGTTTTCAGGGTTTCAGG JUB AGGCAGCTGAGAAATGCTGTGTCTGTGGTCACTTGATTTTGGAGAAGATCCTACAAGCAATGGGGA AGTCCTATCATCCAGGCTGTTTCCGATGCATTGTTTGCAACAAGTGCCTGGATGGCATCCCCTTCAC AGTGGACTTCTCCAACCAAGTATACTGTGTCACCGACTACCACAAAAATTATGCTCCTAAGTGTGCA GCCTGTG

ACCTTTAGCCCTGCCTTCTCCCGGCCCTCCGCCTTCTCCTCACTCGCCGAGGCCTCTGACCCTGGC CCTCCGCGGGCCAGCCTGAGGGCCAAGACCAGCCCAGAGGGGGCCCGGGACCTACTCGGCCCAA AAGCCCTGCCGGGCTCGAGCCAGCCGAGGCAATATAACAACCCCATTGGCCTGTACTCGGCAGAG LDB3 ACCCTGAGGGAGATGGCTCAGATGTACCAGATGAGCCTCCGAGGGAAGGCCTCGGGTGTCGGACT CCCAGGAGGGAGCCTCCCTATTAAGGACCTTGCCGTAGACAGCGCCTCTCCCGTCTACCAGGCTG TGATTAAGAGCCAGAACAAGCCAGAAGATGAGGCTGACGAGTGGGCACGCCGTTCCTCCAACCTG CAGTCTCGCTCCTTCCGCATCCTGGCCCAGATGACGGGGACAGAATT

Materials and Methods

CATCGCCATTATGAGAGGAAAGGCCTGGCATATTGTGAAACTCACTATAACCAGCTATTTGGTGATG TTTGCTTCCACTGCAATCGTGTTATAGAAGGTGATGTGGTCTCTGCTCTTAATAAGGCCTGGTGCGT GAACTGCTTTGCCTGTTCTACCTGCAACACTAAATTAACACTCAAGAATAAGTTTGTGGAGTTTGACA LIMS1 TGAAGCCAGTCTGTAAGAAGTGCTATGAGAAATTTCCATTGGAGCTGAAGAAAAGACTTAAGAAACT AGCTGAGACCTTAGGAAGGAAATAAGTTCCTTTATTTTTTCTTTTCTATGCAAGATAAGAGATTACCA ACATTACTTGTCTTGATCTACCCATATTTAAAGCTATATCTCAAAGCAGTTGAGAGAAGAGGACC

ATTGCCTTCTCCCTTCCTGTTCCCTCATCTCTGCCTTCCCCATGTCTCTCCTCTCCTTGGCCGTGGC TTCTGTCTGTGAGGAGGCAGGAGCTGGGGAGTGGGAGCCTATGACCCCACGTCTGACAGCCATGT CCACCTGTGCCCACAGCTTCCGCCCACAGACCTCCAGGGACAGGAGCAAATTGCACCACAGCTCC LIMS2 CCGCCTGGCCTGGCCCTCCCCAGGCGGCTCAGTGGCTCATGCTGTCCTGTGAGAGCCCCTGCCCC AGAGCGGCCCCACTAAGCGCATGTGGCTCCTGGGCTACCCACAGCCAGGGCAGCCTGCTGGAGC CACAGGGCCAGGGCCATGCAGATGGAGGCCTCTGGGAGCCACCTCCAATCCCTCACCACTCACTC AACCAGTGGCACAGTGTCCTTGTGCCCACACTGAGCCAGCAAGTCCT

TGCATCATCTGCAACAACAAGCTCCGAGGGCAGCCATTCTATGCTGTGGAAAAGAAAGCATACTGC GAGCCCTGCTACATTAATACTCTGGAGCAGTGCAATGTGTGTTCCAAGCCCATCATGGAGCGGATT CTCCGAGCCACCGGGAAGGCCTATCATCCTCACTGTTTCACCTGCGTGATGTGCCACCGCAGCCTG LPP GATGGGATCCCATTCACTGTGGATGCTGGCGGGCTCATTCACTGCATTGAGGACTTCCACAAGAAA TTTGCCCCGCGATGTTCTGTGTGCAAGGAGCCTATTATGCCAGCCCCGGGCCAGGAGGAGACTGT CCGTATTGTGGCTTTGGATCGAGATTTCCATGTTCACTGCTACCGATGCGAGGATTGCGGTGGTCT CCTGTCTGAAGGAGATAACCAAGGCTGCTACCCC

CCACCTGGCTGAAACTCAATAAGAAGGTGACTGCCCAGGATGTGCGGAAGGAAAGCCCCCTGCTC TTTAAGTTCCGTGCCAAGTTCTACCCTGAGGATGTGTCCGAGGAATTGATTCAGGACATCACTCAGC GCCTGTTCTTTCTGCAAGTGAAAGAGGGCATTCTCAATGATGATATTTACTGCCCGCCTGAGACCGC MSN TGTGCTGCTGGCCTCGTATGCTGTCCAGTCTAAGTATGGCGACTTCAATAAGGAAGTGCATAAGTCT GGCTACCTGGCCGGAGACAAGTTGCTCCCGCAGAGAGTCCTGGAACAGCACAAACTCAACAAGGA CCAGTGGGAGGAGCGGATCCAGGTGTGGCATGAGGAACACCGTGGCATGCTCAGGGAGGATGCT GTCCT

GGACGTCGATTGACTGGTCTTCAGAAGCAGAAGGACTCCATGAAAGATGACAGAAGAAGTTATTGT GATAGCCAAGTGGGACTACACCGCCCAGCAGGACCAGGAGCTGGACATCAAGAAGAACGAGCGGC TGTGGTTGCTGGACGACTCCAAGACGTGGTGGCGGGTGAGGAACGCGGCCAACAGGACGGGCTA NCK2 TGTACCGTCCAACTACGTGGAGCGGAAGAACAGCCTGAAGAAGGGCTCCCTCGTGAAGAACCTGA AGGACACACTAGGCCTCGGCAAGACGCGCAGGAAGACCAGCGCGCGGGATGCGTCCCCCACGCC CAGCACGGACGCCGAGTACCCCGCCAATGGCAGCGGCGCCGACCGCATCTACGACCTCAACATCC CGGCCTTCGTCAAGTTCGCCTATGTGGCCGAGCGGGAGGATGAGTTGTCCCTGGTG

GGAAACTGCTTATTGGAAGGAACTTTCCTTGAAGTATAAGCAAAGCTTCCAGGAAGCTCGGGATGA GCTAGTTGAATTCCAGGAAGGAAGCAGAGAATTAGAAGCAGAGTTGGAGGCACAATTAGTACAGGC TGAACAAAGAAATAGAGACTTGCAGGCTGATAACCAAAGACTGAAATATGAAGTGGAGGCATTAAAG NDEL1 GAGAAGCTAGAGCATCAATATGCACAGAGCTATAAGCAGGTCTCAGTGTTAGAAGATGATTTAAGTC AGACTCGGGCCATTAAGGAGCAGTTGCATAAGTATGTGAGAGAGCTGGAGCAGGCCAACGACGAC CTGGAGCGAGCCAAAAGGGCAACAATAGTTTCACTGGAAGACTTTGAACAAAGGCTAAACCAGGCC ATT

GAGAGGAGCTGGATGGATGACTACGATTACGTCCACCTACAGGGTAAGGAGGAGTTTGAGAGGCA ACAGAAAGAGCTATTGGAAAAAGAGAATATCATGAAACAGAACAAGATGCAGCTGGAACATCATCAG CTGAGCCAGTTCCAGCTGTTGGAACAAGAGATTACAAAGCCCGTGGAGAATGACATCTCGAAGTGG NEDD9 AAGCCCTCTCAGAGCCTACCCACCACAAACAGTGGCGTGAGTGCTCAGGATCGGCAGTTGCTGTG CTTCTACTATGACCAATGTGAGACCCATTTCATTTCCCTTCTCAACGCCATTGACGCACTCTTCAGTT GTGTCAGCTCAGCCCAGCCCCCGCGAATCTTCGTGGCACACAGCAAGTTTGTCATCCTCAGTGCAC ACA

CCAGTTTGGCTGTTATGCAAAGCAGGTGATTTGTCTTAATCAGATAAAAGATAGAGGCTATGGGGGC CTCAAGATTTTTGGAGAGCAGAGGTGGTCTCTGGCAATTCCATCTGGTTTTGAGAAACTTAGCAGCT CACAGAGCACAGAGATCCTGCCTTCTTCCTACTATCAGGCTGACCTAATGGGGTTGGGCTGCTCGG NF2 CAACTGCTTGGGTCACCTTGCCCCAAGGAAACCAGCCCTGGGTGCCACCCAGCCACTTAGGGTCT ACAGGGTGGGACTCCAGACCTAGAGCGTAAGTATGGATGTTGTGGCCCTGTGTCTTCCTAGTGTGA CCCAGCC

CCAAGCAACTATGTGGCTGAGCAGGCAGAATCCATTGACAATCCATTGCATGAAGCAGCAAAAAGA GGCAACTTGAGCTGGTTGAGAGAGTGTTTGGACAACAGAGTGGGTGTTAATGGCTTAGACAAAGCT GGAAGCACTGCCTTATACTGGGCTTGCCACGGGGGCCACAAAGATATAGTGGAAATGCTATTTACT OSTF1 CAACCAAATATTGAACTGAACCAGCAGAACAAGTTGGGAGATACAGCTTTGCATGCTGCTGCCTGG AAGGGTTATGCAGATATCGTCCAGTTGCTTCTGGCAAAAGGTGCTAGAACAGACTTAAGAAACATTG AGAAGAAGCTGGCCTTCGACATGGCTACCAATGCTGCCTGTGCATCTCTCCTGAAAAAGAAACAGG GAACAGATGCAGTTCGAACATTAAGCAATGCCGAGG

Materials and Methods

CGAAGAAAGAATGGCTCGTCGACTGCTAGGTGCTGACAGTGCAACTGTCTTTAATATTCAGGAGCC AGAAGAGGAAACAGCTAATCAGGAATACAAAGTCTCCAGCTGTGAACAGAGACTCATCAGTGAAATA GAGTACAGGCTAGAAAGGTCTCCTGTGGATGAATCAGGTGATGAAGTTCAGTATGGAGATGTGCCT PALLD GTGGAAAATGGAATGGCACCATTCTTTGAGATGAAGCTGAAACATTACAAGATCTTTGAGGGAATGC CAGTAACTTTCACATGTAGAGTGGCTGGAAATCCAAAGCCAAAGATCTATTGGTTTAAAGATGGGAA GCAGATCTCTCC

CCCCAAGCTTCAAGAACTGATGAAGGTATTAATTGACTGGATTAATGATGTGTTGGTTGGAGAAAGA ATCATTGTGAAAGACCTAGCTGAAGATTTGTATGATGGACAAGTCCTGCAGAAGCTTTTCGAGAAAC TGGAGAGTGAGAAGCTAAATGTGGCTGAGGTCACCCAGTCAGAGATTGCTCAGAAGCAAAAACTGC AGACTGTCCTGGAGAAGATCAATGAAACCCTGAAACTTCCTCCCAGGAGCATCAAGTGGAATGTGG PARVA ATTCTGTTCATGCCAAGAGCCTGGTGGCCATCTTACACCTGCTCGTTGCTCTGTCTCAGTATTTCCG CGCACCAATTCGACTCCCAGACCATGTTTCCATCCAAGTGGTTGTGGTCCAGAAACGAGAAGGAAT CCTCCAGTCTCGGCAAATCCAAGAGGAAATAACTGGTAACACAGAGTATAGTTCCCGGCACAAACG TGATGCCTTTGACACCTTGTTCGACCA

GATGGCGTGTACCTGGTTCTGCTCATGGGCCTTCTGGAAGACTACTTTGTTCCTCTCCACCACTTCT ACCTGACTCCGGAAAGCTTCGATCAGAAGGTCCACAATGTGTCCTTCGCCTTTGAGCTGATGCTGG ACGGAGGCCTCAAGAAACCCAAGGCTCGTCCTGAAGACGTGGTTAACTTGGACCTCAAATCCACCC TGAGGGTTCTTTACAACCTGTTCACCAAGTACAAGAACGTGGAGTGACGGGGGAGCTGTGGATGGT PARVB GGCAGGAGTGTCCCAGCAAGAAAGGCGGCATCCGTCTGTGCCCTGTGCCTTTCCAGGGAGCCAGG CGCCATGGGCTTCTGGTCCAAGCTGTGTTGACTGTCATCCCCACCCCACCCCTACCTCACGCCTGC CCCACCCCCTGCCTCTTTTGGTTGTTGTTCTTAATCTCCTCTCCATGTAGTTCCCAGTGGGCAAGAG CCTTTGAAAATGC

GAGACAACAGGCCCTGAGAAGCTAAGCGATTTGCCCTGTGGCATGGATGGTAGAGAGGGGAGCTG GCACTTGAACTCAGGTCTGGCTCGACCTCAGAATGAGTGATCTTGTGTCTCTGTGCCCCAGGACTG PXN CATCCTCTCACCAATACTTCACCAGCCTAGGGATCTGTGCTCCCAAGAGCCTGTTGACATTGTAAAC CTGAATCCAATCCATAAACCAAAAGCCCAGGCTTAGAATCACATTGTGGTGGAGCGGGTGTTTGGT GGAGTCCCTGATTCAAAATGTTTGACAAGGAAGCCTGACC

GTTTGCGTGAGGTCTGGTTTTTTGGGCTGCAGTATGTAGACAGCAAAGGTTATTCTACATGGCTTAA ACTAAATAAAAAGGTAACACAGCAGGATGTTAAAAAAGAGAATCCTTTACAGTTCAAGTTTAGAGCTA AATTCTTTCCTGAAGATGTTTCTGAGGAATTAATTCAAGAAATAACCCAGAGACTCTTCTTCTTGCAA GTTAAAGAAGCCATCTTAAATGATGAGATATATTGCCCGCCAGAAACTGCAGTTCTTTTGGCTTCCTA RDX TGCTGTCCAAGCCAAGTATGGAGATTACAATAAAGAGATTCATAAGCCAGGCTACCTGGCTAATGAT AGACTCCTACCCCAGCGTGTATTGGAACAACACAAACTAACAAAAGAACAGTGGGAAGAAAGAATA CAGAACTGGCATGAAGAACATAGAGGAATGTTAAGGGAGGATTCTATGATGGAATACCTGAAGATT GCACAAGATCTAGAAATGTATGGAGTCAACTATTTTGAAATAAAAAATAAAAAAGGAACTGAATTGTG GCTAGGTGTTGATGCTTTGGGTC

CCCTTTGAACGGACGATTACCATGCATAAGGATAGCACTGGACATGTTGGTTTTATCTTTAAAAATG GAAAAATAACATCCATAGTGAAAGATAGCTCTGCAGCCAGAAATGGTCTTCTCACGGAACATAACAT CTGTGAAATCAATGGACAGAATGTCATTGGATTGAAGGACTCTCAAATTGCAGACATACTGTCAACA SDCBP TCTGGGACTGTAGTTACTATTACAATCATGCCTGCTTTTATCTTTGAACATATTATTAAGCGGATGGC ACCAAGCATTATGAAAAGCCTAATGGACCACACCATTCCTGAGGTTTAAAATTCACGGCACCATGGA AATGTAGCTGAACGTCTCCAGTTTCCTTCTTTGGCAACTTCTGTATTATGCACGTGAAGCCTTCC

CAGAGGGAAGAGCTGCTGAGTTTCATGGGGGCTGAGGAGGCAGCCCCTGACCCAGCCGGAGTGG GCCGGGGAGGAGGGGTGGCTGGGCCTCCTTCAGGGGGAGGAGGGCAGCCTCAGTGGCAGAAGT GTCGCCTGCTGCTTCGAAGTGAAGGAGAAGGAGGAGGAGGAAGTCGCCTGGAGTTCTTTGTACCA CCCAAGGCCTCTCGGCCCCGACTCAGCATCCCCTGCTCTTCTATCACAGACGTCCGGACAACCACA SH2B1 GCCCTGGAGATGCCTGACCGGGAGAACACGTTTGTGGTTAAGGTGGAAGGTCCATCCGAGTATATC ATGGAGACAGTGGATGCCCAGCATGTGAAGGCCTGGGTGTCTGACATCCAAGAATGCCTGAGCCC AGGACCCTGCCCTGCTACCAGTCCCCGCCCCATGACCCTCCCTCTGGCCCCTGGGACCTCATTCC TTACAAGGGAGAACACAGACAGCCTGGAGCT

GGCGACATCATAGAGGTGGTAGGAGAGGTAGAGGAAGGATGGTGGGAAGGTGTTCTCAACGGGAA GACTGGAATGTTTCCTTCCAACTTCATCAAGGAGCTGTCAGGGGAGTCGGATGAGCTTGGCATTTC CCAGGATGAGCAGCTATCCAAGTCAAGTTTAAGGGAAACCACAGGCTCCGAGAGTGATGGGGGTG SH3KBP1 ACTCAAGCAGCACCAAGTCTGAAGGTGCCAACGGGACAGTGGCAACTGCAGCAATCCAGCCCAAG AAAGTTAAGGGAGTGGGCTTTGGAGACATTTTCAAAGACAAGCCAATCAAACTAAGACCAAGGTCAA TTGAAGTAGAAAATGACTTTCTGCCGGTAGAAAAGACTATTGGGAAGAAGTTACCTGCAACTACAGC AACTCCAGACTCATCAAAAACAGAAATGGACAGCAGGACAAAGAGCAAGGA

GTTAGAGCCATCCAGGCAAATATCAATATTCCAATGGGAGCCTTTCGGCCAGGAGCAGGTCAACCC CCCAGAAGAAAAGAATGTACTCCTGAAGTGGAGGAGGGTGTTCCTCCCACCTCGGATGAGGAGAA SMPX GAAGCCAATTCCAGGAGCGAAGAAACTTCCAGGACCTGCAGTCAATCTATCGGAAATCCAGAATATT AAAAGTGAACTAAAATATGTCCCCAAAGCTGAACAGTAGTAGGAAGAAAAAAGGATTGATGTGAAGA AATAAAGAGGCAGAAGATGGATTCAATAGCTCACTAAAATTTTATATATTTGTATGATGATTGTGAAC

Materials and Methods

CTCCTGAATGCCTGAGACTCTAGCAGAAATGGCCTGTTTGTACATTTATATCTCTTCCTTCTAGTTGG CTGTATTTCTTACTTTATCTTCATTTTTGGCACCTCACA

GGCATCTTCCCGATCTCATACGTAGAGAAACTCACACCTCCTGAGAAAGCACAGCCTGCAAGACCA CCTCCGCCAGCCCAGCCCGGAGAAATCGGAGAAGCTATAGCCAAATACAACTTCAACGCAGACACA AATGTGGAGCTGTCACTGAGAAAGGGAGATAGAGTTATTCTTCTTAAAAGAGTTGATCAAAACTGGT SORBS2 ATGAAGGTAAAATCCCAGGAACCAACAGACAAGGCATCTTCCCTGTTTCCTATGTGGAGGTCGTCAA GAAGAACACAAAAGGTGCTGAGGACTACCCTGACCCTCCAATACCCCACAGCTATTCTAGTGATAG GATTCACAGCTTGAGCTCAAATAAGCCACAGCGTCCTGTGTTTACTCATGAAAATATTCAAGGTGGG GGGGAACCGTTTCAGGCTCTGTATAACTATACTCCCAGGAATGAAGATGAGCTGGA

CCCTCTGCAAGCACAAAGATCCCTGCCTCCCAGCACACCCAGAACTGGTCAGCCACGTGGACCAA GGACAGCAAGCGTCGGGACAAGCGCTGGGTCAAGTACGAGGGAATCGGGCCCGTGGACGAGAGC GGCATGCCCATTGCCCCCCGATCCAGCGTTGACAGACCCAGAGACTGGTACCGGAGAATGTTCCA SORBS3 GCAGATTCACCGGAAAATGCCAGACTTGCAGCTGGACTGGACCTTCGAGGAGCCACCCAGAGACC CCAGGCATCTAGGAGCCCAGCAAAGACCTGCCCACAGGCCCGGCCCGGCAACATCTTCCAGTGGA AGAAGCTGGGACCACTCTGAAGAGTTACCTAGAAGCACCTTCAACTACAGACCTGGAGCATTCTCC ACTGTGCTGCAGCCCTCAAATCAGGTGCTCAGACG

GGACAAGCTGTGCTCCATCTGCAAAGCCATGGAGACATGGCTCAGTGCTGACCCACAGCACGTGG TCGTACTATACTGCAAGGGAAACAAGGGCAAGCTTGGGGTCATCGTTTCTGCCTACATGCACTACA GCAAGATCTCTGCAGGGGCGGACCAGGCACTGGCCACTCTTACCATGCGGAAATTCTGCGAGGAC AAGGTGGCCACAGAACTGCAGCCCTCCCAGCGTCGATATATCAGCTACTTCAGTGGGCTGCTATCT TENC1 GGCTCCATCAGAATGAACAGCAGCCCTCTCTTCCTGCACTATGTGCTCATCCCCATGCTGCCAGCC TTTGAACCTGGCACAGGCTTCCAGCCCTTCCTTAAAATCTACCAGTCCATGCAGCTTGTCTACACAT CTGGAGTCTATCACATTGCAGGCCCTGGTCCCCAGCAGCTTTGCATCAGCCTGGAGCCAGCCCTCC TCCTCAAAGGCGATGTCATGGTA

CCATGAACTCCTGGTTGACATGATTTATTTTTGGAAGAATGAGAAGCTATACTGTGGCAGACATTACT GTGACAGCGAGAAACCCCGATGTGCTGGCTGTGACGAGCTGATATTCAGCAATGAGTATACCCAGG CAGAAAACCAGAATTGGCACCTGAAACACTTCTGCTGCTTTGACTGTGATAGCATTCTAGCTGGGGA TES GATATACGTGATGGTCAATGACAAGCCCGTGTGCAAGCCCTGCTATGTGAAGAATCACGCTGTGGT GTGTCAAGGATGCCACAATGCCATCGACCCAGAAGTGCAGCGGGTGACCTATAACAATTTCAGCTG GCATGCATCCACAGAGTGCTTTCTGTGCTCTTGCTGCAGCAAATGCCTCATTGGGCAGAAGTTCAT GCCAGTAGAAGGGATGGTTTTCTGTTCAGTGGAATGTAAGAAGAGGATGTCTTAGGAGGAGGGC

GCTAGATCGGTTGCTTCAGGAACTTAATGCCACTCAGTTCAACATCACAGATGAAATCATGTCTCAG TTCCCATCTAGCAAGGTGGCTTCAGGAGAGCAGAAGGAGGACCAGTCTGAAGATAAGAAAAGACCC AGCCTCCCTTCCAGCCCGTCTCCTGGCCTCCCAAAGGCTTCTGCCACCTCAGCCACTCTGGAGCTG TGFB1I1 GATAGACTGATGGCCTCACTCTCTGACTTCCGCGTTCAAAACCATCTTCCAGCCTCTGGGCCAACTC AGCCACCGGTGGTGAGCTCCACAAATGAGGGCTCCCCATCCCCACCAGAGCCGACTGGCAAGGGC AGCCTAGACACCATGCTGGGGCTGCTGCAGTCCGACCTCAGCCGCCGGGGTGTTCCCACCCAGGC CAAAGGCCTCTGTGGCTCCTGCAATAA

ACTTTGGTTGCCTGGACAGTGTAATGGAGAACTCAAAGGTGCTGGGCGAGGCCATGACTGGCATCT CCCAAAATGCCAAGAACGGAAACCTGCCAGAGTTTGGAGATGCCATTTCCACAGCCTCAAAGGCAC TTTGTGGCTTCACCGAGGCAGCTGCACAGGCTGCATATCTGGTTGGTGTCTCTGACCCCAATAGCC TLN1 AAGCTGGACAGCAAGGGCTAGTGGAGCCCACACAGTTTGCCCGTGCAAACCAGGCAATTCAGATG GCCTGCCAGAGTTTGGGAGAGCCTGGCTGTACCCAGGCCCAGGTGCTCTCTGCAGCCACCATTGT GGCTAAACACACCTCTGCACTGTGTAACAGCTGTCGCCTGGCTTCTGCCCGTACCACCAATCCTAC TGCCAA

CAATGCAGACCCTCACAATGTCGTTGTTCTACACAACAAGGGAAACCGAGGCAGGATAGGAGTTGT CATCGCGGCTTACATGCACTACAGCAACATTTCTGCCAGTGCGGACCAGGCTCTGGACCGGTTTGC AATGAAGCGGTTCTATGAGGATAAGATTGTGCCCATTGGCCAGCCATCCCAAAGAAGGTACGTGCA TNS1 TTACTTCAGTGGCCTGCTCTCCGGCTCCATCAAAATGAACAACAAGCCCTTGTTTCTGCACCACGTG ATCATGCACGGCATCCCCAACTTTGAGTCTAAAGGAGGATGTCGGCCATTTCTCCGCATCTACCAG GCCATGCAACCTGTGTACACATCTGGCATCTACAACATCCCAGGAGACAGCCAGACTAGCGTCTGC ATCACCA

TRIP6 CATATTGCGAGGGCTGCTACGTGGCCACCCTGGAGAAATGTGCCACGTGCTCCCAGCCCATCCTG GACCGGATCCTGCGGGCTATGGGGAAGGCCTACCACCCTGGCTGCTTCACCTGCGTGGTGTGTCA

Materials and Methods

CCGCGGCCTCGACGGCATCCCCTTCACAGTGGATGCTACGAGCCAGATCCACTGCATTGAGGACT TTCACAGGAAGTTTGCCCCAAGATGCTCAGTGTGCGGTGGGGCCATAATGCCTGAGCCAGGTCAG GAGGAGACTGTGAGAATTGTTGCTCTGGATCGAAGTTTTCACATTGGCTGTTACAAGTGCGAGGAG TGTGGGCTGCTGCTCTCCTCTGAGGGCGAGTGTCAGGGCTGCTACCCGCTGGATGGGCACATCTT GTGCAAGGCCTGCAGCGCCTGGCGCATCCAGGAGCTCTCAGCCACCGTCACCACTGACTGCTGAG TCTTCCTAGAAGTACCTGCTGGGTTCTCAGTTCCAGTTCCCATCCTTTGA

CGGGTTGGAAAAGAGACTGTTCAAACCACTGAGGATCAGATTTTGAAGAGAGATATGCCACCAGCA TTTATTAAGGTTGAGAATGCTTGCACCAAGCTTGTCCAGGCAGCTCAGATGCTTCAGTCAGACCCTT ACTCAGTGCCTGCTCGAGATTATCTAATTGATGGGTCAAGGGGCATCCTCTCTGGAACATCAGACCT VCL GCTCCTTACCTTCGATGAGGCTGAGGTCCGTAAAATTATTAGAGTTTGCAAAGGAATTTTGGAATAT CTTACAGTGGCAGAGGTGGTGGAGACTATGGAAGATTTGGTCACTTACACAAAGAATCTTGGGCCA GGAATGACTAAGATGGCCAAGATGATTGACGAGAGACAGCAGGAGCTCACTCACCAGGAGCACCG AGTGATGTTGGTGAACTCGATGAACACCGTGA

GCTTGGAGTACGTGTGGTCACCAGGACTGAGTCGCTTGGAACAGCAGAGCCTGCTCCTTGCGTAC CACAGGGATTAATCCTGCTTGTGCTGGGAAATGCAACTCACTCATGTATTTGGAGAAACAGGAGTGT TCACTTATCTAGTGCAATATGTTCACAGTTTATTAATGCTTTAAACAGCTTCATGTTTTAGAATTTGTG TATTGTCAATACTTAATTGGGGGTGGGAGAGACTGAGCTACACTACTGCTAAACTATTTTTAGCATAA ZFYVE21 TATATACCATTTTTATGAGTTCGCAGGTCTACTAGAAGGTTCTGGCCCATCAATATTCATTTCATTTAA TTCTTCCACAGAACCAGTTTGGGCAGTAGGAACTCAGGCTTCTGGTCTGCAGTGGAGCCTGTTCGC CTCTAATAGCCAGTTTACAGCACTTGCCTTAGCCTGTTTCACAGACTTGTCCACTTACCTTGTCACTA ATTTGGGGCTTCTGGG

ACGTCACCCAGAATGACACAGGATTCTACACCCTACAAGTCATAAAGTCAGATCTTGTGAATGAAGA AGCAACTGGACAGTTCCATGTATACCCGGAGCTGCCCAAGCCCTCCATCTCCAGCAACAACTCCAA CCCTGTGGAGGACAAGGATGCTGTGGCCTTCACCTGTGAACCTGAGACTCAGGACACAACCTACCT GTGGTGGATAAACAATCAGAGCCTCCCGGTCAGTCCCAGGCTGCAGCTGTCCAATGGCAACAGGA CEACAM1 CCCTCACTCTACTCAGTGTCACAAGGAATGACACAGGACCCTATGAGTGTGAAATACAGAACCCAG TGAGTGCGAACCGCAGTGACCCAGTCACCTTGAATGTCACCTATGGCCCGGACACCCCCACCATTT CCCCTTCAGACACCTATTACCGTCCAGGGGCAAACCTCAGCCTCTCCTGCTATGCAGCCTCTAACC CACC

AACACGGAGCTCAAGGAGAACCTGAAGGACACCATGACCAAGCGCTACCACCAGCCGGGCCATGA GGCTGTGACCAGCGCTGTGGACCAGCTGCAGCAGGAGTTCCACTGCTGTGGCAGCAACAACTCAC AGGACTGGCGAGACAGTGAGTGGATCCGCTCACAGGAGGCCGGTGGCCGTGTGGTCCCAGACAG CD151 CTGCTGCAAGACGGTGGTGGCTCTTTGTGGGCAGCGAGACCATGCCTCCAACATCTACAAGGTGG AGGGCGGCTGCATCACCAAGTTGGAGACCTTCATCCAGGAGCACCTGAGGGTCATTGGGGCTGTG GGGATCGGCATTGCCTGTGTGCAGGTCTTTGGCATGATCTTCACGTGCTGCCTGTAC

CATCAATTCCCAATGTCACAGAAGTAAAGGAGAACATGACATTTGGATCAACTTTAGTCACCAACCC AAATGGAGGATTTCTGGCTTGTGGGCCCTTATATGCCTATAGATGTGGACATTTGCATTACACAACT ITGA1 GGAATCTGTTCTGACGTCAGCCCCACATTTCAAGTCGTGAATTCCATTGCCCCTGTACAAGAATGCA GCACTCAACTGGACATAGTCATAGTGCTGGATGGTTCCAACAGTATTTACCCATGGGACAGTGTTAC AGCTTTTTTAAATGACCTTCTTGAAAGAATGGATATTGGTCC

CAACAGCATCTACCCCTGGTCTGAAGTTCAGACCTTCCTACGAAGACTGGTAGGGAAACTGTTTATT GACCCAGAACAGATACAGGTGGGACTGGTACAGTATGGGGAGAGCCCTGTACATGAGTGGTCCCT GGGAGATTTCCGAACGAAGGAAGAAGTGGTGAGAGCAGCAAAGAACCTCAGTCGGCGGGAGGGA CGAGAAACAAAGACTGCCCAAGCAATAATGGTGGCCTGCACAGAAGGGTTCAGTCAGTCCCATGG ITGA10 GGGCCGACCCGAGGCTGCCAGGCTACTGGTGGTTGTCACTGATGGAGAGTCCCATGATGGAGAGG AGCTTCCTGCAGCACTAAAGGCCTGTGAGGCTGGAAGAGTGACACGCTATGGGATTGCAGTCCTTG GTCACTACCTCCGGCGGCAGCGAGATCCCAGCTCTTTCCTGAGAGAAATTAGAACTATTGCCAGTG ATCCAGATGAGCGATTCTTTTTCAATGTCACAGATGAGGCTGCTCTGACTGACATTGTGGATGCACT AGGAGATCGGA

ACACCACAGGGATGTGTTCAAGAGTCAACTCCAACTTCAGGTTCTCCAAGACCGTGGCCCCAGCTC TCCAAAGGTGCCAGACCTACATGGACATCGTCATTGTCCTGGATGGCTCCAACAGCATCTACCCCT GGGTGGAGGTTCAGCACTTCCTCATCAACATCCTGAAAAAGTTTTACATTGGCCCAGGGCAGATCC ITGA11 AGGTTGGAGTTGTGCAGTATGGCGAAGATGTGGTGCATGAGTTTCACCTCAACGACTACAGGTCTG TAAAAGATGTGGTGGAAGCTGCCAGCCACATTGAGCAGAGAGGAGGAACAGAGACCCGGACGGCA TTTGGCATTGAATTTGCACGCTCAGAGGCTTTCCAGAAGGGTGGAAGGAAAGGAGCCAAGAAGGTG ATGATTGTCATCACAGATGGGGAGTCCCACGACAGCCCAGACCTGGAGAAGGTGATCCA

CATGGCCATTTGATCTTTCCTAAACAAGCCTTTGACCAAATTCTGCAGGACAGAAATCACAGTTCATA TTTAGGTTACTCTGTGGCTGCAATTTCTACTGGAGAAAGCACTCACTTTGTTGCTGGTGCTCCTCGG ITGA2 GCAAATTATACCGGCCAGATAGTGCTATATAGTGTGAATGAGAATGGCAATATCACGGTTATTCAGG CTCACCGAGGTGACCAGATTGGCTCCTATTTTGGTAGTGTGCTGTGTTCAGTTGATGTGGATAAAGA CACCATTACAGACGTGCTCTTGGTAGGTGCACCAATGTACATGAGTGACCTAAAGAAAGAGGAAGG

Materials and Methods

AAGAGTCTACCTGTTTACTATCAAAGAGGGCATTTTGGGTCAGCACCAATTTCTTGAAGGCCCCGAG GGCATTGAAAACACTCGATTTGGTTCAGCAATTGCAGCTCTTTCAGACATCAACATGGATGGC

GATGACTGTGAGCGGATGAACATCACAGTGAAAAATGACCCTGGCCATCACATTATTGAGGACATG TGGCTTGGAGTGACTGTGGCCAGCCAGGGCCCTGCAGGCAGAGTTCTGGTCTGTGCCCACCGCTA CACCCAGGTGCTGTGGTCAGGGTCAGAAGACCAGCGGCGCATGGTGGGCAAGTGCTACGTGCGA ITGA3 GGCAATGACCTAGAGCTGGACTCCAGTGATGACTGGCAGACCTACCACAACGAGATGTGCAATAGC AACACAGACTACCTGGAGACGGGCATGTGCCAGCTGGGCACCAGCGGTGGCTTCACCCAGAACAC TGTGTACTTCGGCGCCCCCGGTGCCTACAACTGGAAAGGAAACAGCTACATGATTCAGCGCAAGGA GTGGGACTTATCTGAGTATAGTTACAAGGACCCAGAGGACCAAGGAAACCT

CCCTACAACGTGGACACTGAGAGCGCGCTGCTTTACCAGGGCCCCCACAACACGCTGTTCGGCTA CTCGGTCGTGCTGCACAGCCACGGGGCGAACCGATGGCTCCTAGTGGGTGCGCCCACTGCCAACT ITGA4 GGCTCGCCAACGCTTCAGTGATCAATCCCGGGGCGATTTACAGATGCAGGATCGGAAAGAATCCC GGCCAGACGTGCGAACAGCTCCAGCTGGGTGACCCTAATGGAGAACCTTGTGGAAAGACTTGTTTG GAAGAGAGAGACAATCAGTGGTTGGGGGTCACACTTTCCAGACAGCCAGGAGAAAATGGA

CGCTCTCAACTTCTCCTTGGACCCCCAAGCCCCAGTGGACAGCCACGGCCTCAGGCCAGCCCTAC ATTATCAGAGCAAGAGCCGGATAGAGGACAAGGCTCAGATCTTGCTGGACTGTGGAGAAGACAACA TCTGTGTGCCTGACCTGCAGCTGGAAGTGTTTGGGGAGCAGAACCATGTGTACCTGGGTGACAAGA ITGA5 ATGCCCTGAACCTCACTTTCCATGCCCAGAATGTGGGTGAGGGTGGCGCCTATGAGGCTGAGCTTC GGGTCACCGCCCCTCCAGAGGCTGAGTACTCAGGACTCGTCAGACACCCAGGGAACTTCTCCAGC CTGAGCTGTGACTACTTTGCCGTGAACCAGAGCCGCCTGCTGGTGTGTGACCTGGGCAACCCCAT GAAGGCAGGAGCCAGTCTGTGGGGTGGCCTTCGGTTTACAGTCCCTCATCTCCGG

GGCCTCTTCATTTGGCTATGATGTGGCGGTGGTGGACCTCAACAAGGATGGGTGGCAAGATATAGT TATTGGAGCCCCACAGTATTTTGATAGAGATGGAGAAGTTGGAGGTGCAGTGTATGTCTACATGAAC CAGCAAGGCAGATGGAATAATGTGAAGCCAATTCGTCTTAATGGAACCAAAGATTCTATGTTTGGCA ITGA6 TTGCAGTAAAAAATATTGGAGATATTAATCAAGATGGCTACCCAGATATTGCAGTTGGAGCTCCGTA TGATGACTTGGGAAAGGTTTTTATCTATCATGGATCTGCAAATGGAATAAATACCAAACCAACACAG GTTCTCAAGGGTATATCACCTTATTTTGGATATTCAATTGCTGGAAACATGGACCTTGATCGAAATTC CTACCCTGATGTTGCTGTTGGTTCCCT

GAATGCCTCCCATGTTGAGTGTGAGCTGGGGAACCCCATGAAGAGAGGTGCCCAGGTCACCTTCTA CCTCATCCTTAGCACCTCCGGGATCAGCATTGAGACCACGGAACTGGAGGTAGAGCTGCTGTTGGC CACGATCAGTGAGCAGGAGCTGCATCCAGTCTCTGCACGAGCCCGTGTCTTCATTGAGCTGCCACT ITGA7 GTCCATTGCAGGAATGGCCATTCCCCAGCAACTCTTCTTCTCTGGTGTGGTGAGGGGCGAGAGAGC CATGCAGTCTGAGCGGGATGTGGGCAGCAAGGTCAAGTATGAGGTCACGGTTTCCAACCAAGGCC AGTCGCTCAGAACCCTGGGCTCTGCCTTCCTCAACATCATGTGGCCTCATGAGATTGCCAATGGGA AGTGGTTGCTGTACCCAATGCAGGTTGA

ACGGACGCTCTTCCTTGATAACCATCAGGCTCATCGCGTCTTCCCTCTTGTGATAAAAAGGCAGAAA TCCCACCAGTGCCAGGATTTCATCGTTTACCTTCGAGATGAAACTGAATTCCGAGATAAATTATCTC CAATCAACATTAGTTTGAATTACAGTTTGGACGAATCCACCTTTAAAGAAGGCCTGGAAGTGAAACC ITGA8 AATATTGAACTACTACAGAGAAAACATTGTTAGTGAACAGGCTCACATTCTGGTGGACTGTGGAGAA GACAATCTGTGTGTTCCTGACTTGAAGCTGTCGGCTAGACCAGATAAGCATCAGGTAATCATTGGAG ATGAAAATCACCTTATGCTCATAATAAATGCAAGAAATGAAGGGGAAGGAGCATATGAAGCTGAACT CTTTGTAATGATACCAGAAGAGGCAGATTATGTTGGAATCGAACGCAACAACAAGGGATT

CATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGGACTTCCTCAA ATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTATGAATTCAGCGTGATCTTTGATACA AGCCACCTGTCTGGGGAAGAGGAAGTTCTCAGCTTCATTGTTACTGCTCAGAGTGGCAACACGGAG CGCTCTGAATCCCTGCATGACAACACCCTCGTGCTGATGGTGCCACTGATGCACGAGGTGGACAC ITGA9 GTCCATCACCGGAATCATGTCTCCAACCTCCTTTGTATATGGCGAGTCCGTGGACGCAGCCAACTT CATTCAGCTGGATGACCTGGAGTGTCACTTTCAGCCCATCAATATCACCCTTCAGGTCTACAACACT GGCCCAAGCACCCTTCCAGGGTCATCTGTCAGCATCTCTTTCCCTAATCGACTCTCATCTGGTGGT GCAGA

TCTTCCTGATTGACGGCTCTGGAAGCATTGACCAAAATGACTTTAACCAGATGAAGGGCTTTGTCCA AGCTGTCATGGGCCAGTTTGAGGGCACTGACACCCTGTTTGCACTGATGCAGTACTCAAACCTCCT GAAGATCCACTTCACCTTCACCCAATTCCGGACCAGCCCGAGCCAGCAGAGCCTGGTGGATCCCAT CGTCCAACTGAAAGGCCTGACGTTCACGGCCACGGGCATCCTGACAGTGGTGACACAGCTATTTCA ITGAD TCATAAGAATGGGGCCCGAAAAAGTGCCAAGAAGATCCTCATTGTCATCACAGATGGGCAGAAGTA CAAAGACCCCCTGGAATACAGTGATGTCATCCCCCAGGCAGAGAAGGCTGGCATCATCCGCTACG CTATCGGGGTGGGACACGCTTTCCAGGGACCCACTGCCAGGCAGGAGCTGAATACCATCAGCTCA GCG

CTTCGTTGCAGTTCTGTCCAAACCATCCATAATGTACGTGAACACAGGCCAGGGGCTTTCTCACCAC ITGAE AAAGAATTCCTCTTCCATGTACATGGGGAGAACCTCTTTGGAGCAGAATACCAGTTGCAAATTTGCG TCCCAACCAAATTACGAGGTCTCCAGGTTGTAGCAGTGAAGAAGCTGACGAGGACTCAGGCCTCCA

Materials and Methods

CGGTGTGCACCTGGAGTCAGGAGCGCGCTTGTGCGTACAGTTCGGTTCAGCATGTGGAAGAATGG CATTCAGTGAGCTGTGTCATCGCTTCAGATAAAGAAAATGTCACCGTGGCTGCAGAGATCTCCTGG GATCACTCTGAGGAGTTACTAAAAGATGTAACTGAACTGCAGATCCTTGGTGAAATATCTTTCAACAA ATCTCTATATGAGGGACTGAATGCAGAGAACCACAGAACTAAGATCACTGTCGTCTTCCTGAAAGAT GAGAAGTACCATTCTTTGCCTATCATCATTAAAGGCAGCGTTGG

GCCAAGTCAGCGGATAGAAGGGACCCAAGTGCTCTCAGGAATTCAGTGGTTTGGACGCTCCATCCA TGGGGTGAAGGACCTTGAAGGGGATGGCTTGGCAGATGTGGCTGTGGGGGCTGAGAGCCAGATG ATCGTGCTGAGCTCCCGGCCCGTGGTGGATATGGTCACCCTGATGTCCTTCTCTCCAGCTGAGATC CCAGTGCATGAAGTGGAGTGCTCCTATTCAACCAGTAACAAGATGAAAGAAGGAGTTAATATCACAA ITGAL TCTGTTTCCAGATCAAGTCTCTCATCCCCCAGTTCCAAGGCCGCCTGGTTGCCAATCTCACTTACAC TCTGCAGCTGGATGGCCACCGGACCAGAAGACGGGGGTTGTTCCCAGGAGGGAGACATGAACTCA GAAGGAATATAGCTGTCACCACCAGCATGTCATGCACTGACTTCTCATTTCATTTCCCGGTATGTGT TCAAGACCTCATCTCCCCCATCAATGTT

GCGGATGAAGGAGTTTGTCTCAACTGTGATGGAGCAATTAAAAAAGTCCAAAACCTTGTTCTCTTTG ATGCAGTACTCTGAAGAATTCCGGATTCACTTTACCTTCAAAGAGTTCCAGAACAACCCTAACCCAA GATCACTGGTGAAGCCAATAACGCAGCTGCTTGGGCGGACACACACGGCCACGGGCATCCGCAAA ITGAM GTGGTACGAGAGCTGTTTAACATCACCAACGGAGCCCGAAAGAATGCCTTTAAGATCCTAGTTGTCA TCACGGATGGAGAAAAGTTTGGCGATCCCTTGGGATATGAGGATGTCATCCCTGAGGCAGACAGAG AGGGAGTCATTCGCTACGTCATTGGGGTGGGAGATGCCTTCCGCAGTGAGAAATCCCGCCAAGAG CTTAAT

ATTCCACTGCAGGCTGATTTCATCGGGGTTGTCCGAAACAATGAAGCCTTAGCAAGACTTTCCTGTG CATTTAAGACAGAAAACCAAACTCGCCAGGTGGTATGTGACCTTGGAAACCCAATGAAGGCTGGAA CTCAACTCTTAGCTGGTCTTCGTTTCAGTGTGCACCAGCAGTCAGAGATGGATACTTCTGTGAAATT ITGAV TGACTTACAAATCCAAAGCTCAAATCTATTTGACAAAGTAAGCCCAGTTGTATCTCACAAAGTTGATC TTGCTGTTTTAGCTGCAGTTGAGATAAGAGGAGTCTCGAGTCCTGATCATGTCTTTCTTCCGATTCC AAACTGGGAGCACAAGGAGAACCCTGAGACTGAAGAAGATGTTGGGCCAGTTGTTCAGCACATCTA TGAGCTGAGAAACAATGGTCCAAGTTCATTCAGCAAGGCA

CCAGTTTTCCCTGATGCAGTTCTCCAACAAATTCCAAACACACTTCACTTTCGAGGAATTCAGGCGC AGCTCAAACCCCCTCAGCCTGTTGGCTTCTGTTCACCAGCTGCAAGGGTTTACATACACGGCCACC GCCATCCAAAATGTCGTGCACCGATTGTTCCATGCCTCATATGGGGCCCGTAGGGATGCCGCCAAA ITGAX ATTCTCATTGTCATCACTGATGGGAAGAAAGAAGGCGACAGCCTGGATTATAAGGATGTCATCCCCA TGGCTGATGCAGCAGGCATCATCCGCTATGCAATTGGGGTTGGATTAGCTTTTCAAAACAGAAATTC TTGGAAAGAATTAAATGACATTGCATCGAAGCCCTCCCAGGAACACATATTTAAAGTGGAGGACTTT GATGCTCTG

TGGGCTTTACGGAGGAAGTAGAGGTTATTCTTCAGTACATCTGTGAATGTGAATGCCAAAGCGAAG GCATCCCTGAAAGTCCCAAGTGTCATGAAGGAAATGGGACATTTGAGTGTGGCGCGTGCAGGTGCA ATGAAGGGCGTGTTGGTAGACATTGTGAATGCAGCACAGATGAAGTTAACAGTGAAGACATGGATG CTTACTGCAGGAAAGAAAACAGTTCAGAAATCTGCAGTAACAATGGAGAGTGCGTCTGCGGACAGT ITGB1 GTGTTTGTAGGAAGAGGGATAATACAAATGAAATTTATTCTGGCAAATTCTGCGAGTGTGATAATTTC AACTGTGATAGATCCAATGGCTTAATTTGTGGAGGAAATGGTGTTTGCAAGTGTCGTGTGTGTGAGT GCAACCCCAACTACACTGGCAGTGCATGTGACTGTTCTTTGGATACTAGTACTTGTGAAGCCAGCAA CG

ACTGATGACGGCTTCCATTTCGCGGGCGACGGGAAGCTGGGCGCCATCCTGACCCCCAACGACGG CCGCTGTCACCTGGAGGACAACTTGTACAAGAGGAGCAACGAATTCGACTACCCATCGGTGGGCC AGCTGGCGCACAAGCTGGCTGAAAACAACATCCAGCCCATCTTCGCGGTGACCAGTAGGATGGTG ITGB2 AAGACCTACGAGAAACTCACCGAGATCATCCCCAAGTCAGCCGTGGGGGAGCTGTCTGAGGACTC CAGCAATGTGGTCCAACTCATTAAGAATGCTTACAATAAACTCTCCTCCAGGGTCTTCCTGGATCAC AACGCCCTCCCCGACACCCTGAAAGTCACCTACGACTCCTTCTGCAGCAATGGAGTGACGCACAGG AACCAGCCCAGAGGTGACTGTGATGGCGTGCAGATCAATGTCCCGATCACC

CAGGCATTGTCCAGCCTAATGACGGGCAGTGTCATGTTGGTAGTGACAATCATTACTCTGCCTCCA CTACCATGGATTATCCCTCTTTGGGGCTGATGACTGAGAAGCTATCCCAGAAAAACATCAATTTGAT CTTTGCAGTGACTGAAAATGTAGTCAATCTCTATCAGAACTATAGTGAGCTCATCCCAGGGACCACA ITGB3 GTTGGGGTTCTGTCCATGGATTCCAGCAATGTCCTCCAGCTCATTGTTGATGCTTATGGGAAAATCC GTTCTAAAGTAGAGCTGGAAGTGCGTGACCTCCCTGAAGAGTTGTCTCTATCCTTCAATGCCACCTG CCTCAACAATGAGGTCATCCCTGGCCTCAAGTCTTGTATGGGACTCAAGATTGGAGACACGGTGAG C

GTGGTCATGGAGAGCAGCTTCCAAATCACAGAGGAGACCCAGATTGACACCACCCTGCGGCGCAG CCAGATGTCCCCCCAAGGCCTGCGGGTCCGTCTGCGGCCCGGTGAGGAGCGGCATTTTGAGCTG ITGB4 GAGGTGTTTGAGCCACTGGAGAGCCCCGTGGACCTGTACATCCTCATGGACTTCTCCAACTCCATG TCCGATGATCTGGACAACCTCAAGAAGATGGGGCAGAACCTGGCTCGGGTCCTGAGCCAGCTCAC CAGCGACTACACTATTGGATTTGGCAAGTTTGTGGACAAAGTCAGCGTCCCGCAGACGGACATGAG

Materials and Methods

GCCTGAGAAGCTGAAGGAGCCCTGGCCCAACAGTGACCCCCCCTTCTCCTTCAAGAACGTCATCAG CCTGACAGAAGATGTGGATGAGTTCCGG

CACTGCATTTGCTGGTGTTCACAACAGATGATGTGCCCCACATCGCATTGGATGGAAAATTGGGAG GCCTGGTGCAGCCACACGATGGCCAGTGCCACCTGAACGAGGCCAACGAGTACACTGCATCCAAC CAGATGGACTATCCATCCCTTGCCTTGCTTGGAGAGAAATTGGCAGAGAACAACATCAACCTCATCT ITGB5 TTGCAGTGACAAAAAACCATTATATGCTGTACAAGAATTTTACAGCCCTGATACCTGGAACAACGGT GGAGATTTTAGATGGAGACTCCAAAAATATTATTCAACTGATTATTAATGCATACAATAGTATCCGGT CTAAAGTGGAGTTGTCAGTCTGGGATCAGCCTGAGGATCTTAATCTCTTCTTTACTGCTACCTGCCA AGATGGGGTA

CAAACTAGCAGGCATCGTCATTCCTAATGACGGGCTCTGTCACTTGGACAGCAAGAATGAATACTCC ATGTCAACTGTCTTGGAATATCCAACAATTGGACAACTCATTGATAAACTGGTACAAAACAACGTGTT ATTGATCTTCGCTGTAACCCAAGAACAAGTTCATTTATATGAGAATTACGCAAAACTTATTCCTGGAG CTACAGTAGGTCTACTTCAGAAGGACTCCGGAAACATTCTCCAGCTGATCATCTCAGCTTATGAAGA ITGB6 ACTGCGGTCTGAGGTGGAACTGGAAGTATTAGGAGACACTGAAGGACTCAACTTGTCATTTACAGC CATCTGTAACAACGGTACCCTCTTCCAACACCAAAAGAAATGCTCTCACATGAAAGTGGGAGACACA GCTTCCTTCAGCGTGACTGTGAATATCCCACACTGCGAGAGAAGAAGCAGGCACATTATCATAAAG CCTGTGGGGCTGGGGGATGCCCTGGAATTACTTGTCAGCCCAGAATGCAACTGCGACTGTCAG

CCTCTACAGTCGCAGCACAGAGTTTGACTACCCTTCTGTGGGTCAGGTAGCCCAGGCCCTCTCTGC AGCAAATATCCAGCCCATCTTTGCTGTCACCAGTGCCGCACTGCCTGTCTACCAGGAGCTGAGTAA ACTGATTCCTAAGTCTGCAGTTGGGGAGCTGAGTGAGGACTCCAGCAACGTGGTACAGCTCATCAT GGATGCTTATAATAGCCTGTCTTCCACCGTGACCCTTGAACACTCTTCACTCCCTCCTGGGGTCCAC ITGB7 ATTTCTTACGAATCCCAGTGTGAGGGTCCTGAGAAGAGGGAGGGTAAGGCTGAGGATCGAGGACA GTGCAACCACGTCCGAATCAACCAGACGGTGACTTTCTGGGTTTCTCTCCAAGCCACCCACTGCCT CCCAGAGCCCCATCTCCTGAGGCTCCGGGCCCTTGGCTTCTCAGAGGAGCTGATTGTGGAGTTGC A

TCCAGAATGTGGATGGTGTGTTCAAGAGGATTTCATTTCAGGTGGATCAAGAAGTGAACGTTGTGAT ATTGTTTCCAATTTAATAAGCAAAGGCTGCTCAGTTGATTCAATAGAATACCCATCTGTGCATGTTAT AATACCCACTGAAAATGAAATTAATACCCAGGTGACACCAGGAGAAGTGTCTATCCAGCTGCGTCCA ITGB8 GGAGCCGAAGCTAATTTTATGCTGAAAGTTCATCCTCTGAAGAAATATCCTGTGGATCTTTATTATCT TGTTGATGTCTCAGCATCAATGCACAATAATATAGAAAAATTAAATTCCGTTGGAAACGATTTATCTA GAAAAATGGCATTTTTCTCCCGTGACTTTCGTCTTGGATTTGGCTCATACGTTGATAAAACAGTTTCA CCATACATTAGCATCCACCCCG

TCTGAAGATGAGGCTCTTTGTGTTGTAGACTTGCTAAAGGAGAAGTCTGGTGTAATACAAGATGCTT TAAAGAAGTCAAGTAAGGGAGAATTGACTACGCTTATACATCAGCTTCAAGAAAAGGACAAGTTACT CGCTGCTGTGAAGGAAGATGCTGCTGCTACAAAGGATCGGTGTAAGCAGTTAACCCAGGAAATGAT KTN1 GACAGAGAAAGAAAGAAGCAATGTGGTTATAACAAGGATGAAAGATCGAATTGGAACATTAGAAAAG GAACATAATGTATTTCAAAACAAAATACATGTCAGTTATCAAGAGACTCAACAGATGCAGATGAAGTT TCAGCAAGTTCGTGAGCAGATGGAGGCAGAGATAGCTCACTTGAAGCAGGAAAATGGTATACTGAG AGATGCAGTCAGCAACACTACAAATCAACTGGAAAGCAAGCAGTCTGCAGA

TGCTACTGCAACAGCAGCTTTCAGCTTCAGGCAGATGGCAAGACCTGCAAAGATTTTGATGAGTGC TCAGTGTACGGCACCTGCAGCCAGCTATGCACCAACACAGACGGCTCCTTCATATGTGGCTGTGTT GAAGGATACCTCCTGCAGCCGGATAACCGCTCCTGCAAGGCCAAGAACGAGCCAGTAGACCGGCC LRP1 CCCTGTGCTGTTGATAGCCAACTCCCAGAACATCTTGGCCACGTACCTGAGTGGGGCCCAGGTGTC TACCATCACACCTACGAGCACGCGGCAGACCACAGCCATGGACTTCAGCTATGCCAACGAGACCGT ATGCTGGGTGCATGTTGGGGACAGTGCTGCTCAGACGCAGCTCAAGTGTGCCCGCATGCCTGGCC TAAAGGGCTTCGTGGATGAG

CGCCTGAACTACCCTGAGAATGGGTGGACTCCCGGAGAGGATTCCTACCGAGAGTGGATACAGGT AGACTTGGGCCTTCTGCGCTTTGTCACGGCTGTCGGGACACAGGGCGCCATTTCAAAAGAAACCAA GAAGAAATATTATGTCAAGACTTACAAGATCGACGTTAGCTCCAACGGGGAAGACTGGATCACCATA NRP1 AAAGAAGGAAACAAACCTGTTCTCTTTCAGGGAAACACCAACCCCACAGATGTTGTGGTTGCAGTAT TCCCCAAACCACTGATAACTCGATTTGTCCGAATCAAGCCTGCAACTTGGGAAACTGGCATATCTAT GAGATTTGAAGTATACGGTTGCAAGATAACAGATTATCCTTGCTCTGGAATGTTGGGTATGGTGTCT GGA

AAGGTCCAGCTCACTGGAGAGCCAGTGCCCATGGCCCGCTGCGTCTCCACAGGGGGTCGCCCGC CAGCCCAAATCACCTGGCACTCAGACCTGGGCGGGATGCCCAATACGAGCCAGGTGCCAGGGTTC CTGTCTGGCACAGTCACTGTCACCAGCCTCTGGATATTGGTGCCCTCAAGCCAGGTGGACGGCAA GAATGTGACCTGCAAGGTGGAGCACGAGAGCTTTGAGAAGCCTCAGCTGCTGACTGTGAACCTCAC PVR CGTGTACTACCCCCCAGAGGTATCCATCTCTGGCTATGATAACAACTGGTACCTTGGCCAGAATGA GGCCACCCTGACCTGCGATGCTCGCAGCAACCCAGAGCCCACAGGCTATAATTGGAGCACGACCA TGGGTCCCCTGCCACCCTTTGCTGTGGCCCAGGGCGCCCAGCTCCTGATCCGTCCTGTGGACAAA CCAATCA

Materials and Methods

CCACCGAACCCAAGAAACTAGAGGAGAATGAGGTTATCCCCAAGAGAATCTCACCCGTTGAAGAGA GTGAGGATGTGTCCAACAAGGTGTCAATGTCCAGCACTGTGCAGGGCAGCAACATCTTTGAGAGAA CGGAGGTCCTGGCAGCTCTGATTGTGGGTGGCATCGTGGGCATCCTCTTTGCCGTCTTCCTGATCC TACTGCTCATGTACCGTATGAAGAAGAAGGATGAAGGCAGCTATGACCTGGGCAAGAAACCCATCT SDC4 ACAAGAAAGCCCCCACCAATGAGTTCTACGCGTGAAGCTTGCTTGTGGGCACTGGCTTGGACTTTA GCGGGGAGGGAAGCCAGGGGATTTTGAAGGGTGGACATTAGGGTAGGGTGAGGTCAACCTAATAC TGACTTGTCAGTATCTCCAGCTCTGATTACCTTTGAAGTGTTCAGAAGAGACATTGTCTTCTACTGTT CTGCCAGGTTCTTCTTGAGCTTTGGGCCTCAGTTGCCCTGGCAGAAAAATGGATTCAACTTGGCCTT TCTGAAGGCAAGACTGGGAT

CAGAAGGATGATGTCGCTCAGACTGACTTGCTGCAGATCGACCCCAATTTTGGCTCCAAGGAAGAT TTTGACAGTCTCTTGCAATCGGCTAAAAAAAAGAGCATCCGTGTCATTCTGGACCTTACTCCCAACT ACCGGGGTGAGAACTCGTGGTTCTCCACTCAGGTTGACACTGTGGCCACCAAGGTGAAGGATGCT CTGGAGTTTTGGCTGCAAGCTGGCGTGGATGGGTTCCAGGTTCGGGACATAGAGAATCTGAAGGAT SLC3A2 GCATCCTCATTCTTGGCTGAGTGGCAAAATATCACCAAGGGCTTCAGTGAAGACAGGCTCTTGATTG CGGGGACTAACTCCTCCGACCTTCAGCAGATCCTGAGCCTACTCGAATCCAACAAAGACTTGCTGT TGACTAGCTCATACCTGTCTGATTCTGGTTCTACTGGGGAGCATACAAAATCCCTAGTCACACAGTA TTTGAATGCCACTGGCAATCGCTGGTGCAGCTGGAGTTTGTCTCAGGCAAGGC

GCCAAATCCTTCTCAGCATCAGATGAAGACCTGATCCAGCAGGTCCTTGCCGAGGGGGTCAGCAG CCCAGCCCCTACCCAAGACACCCACATGGAAACGGACCTGCTCAGCAGCCTGTCCAGCACTCCTG GGGAGAAGACAGAGACGCTGGCGCTGCAGAGGCTGGGGGAGCTGGGGCCACCCAGCCCAGGCC TGAACTGGGAACAGCCCCAGGCAGCGAGGCTGTCCAGGACAGGACTGGTGGAGGGTCTGCGGAA PKD1 GCGCCTGCTGCCGGCCTGGTGTGCCTCCCTGGCCCACGGGCTCAGCCTGCTCCTGGTGGCTGTG GCTGTGGCTGTCTCAGGGTGGGTGGGTGCGAGCTTCCCCCCGGGCGTGAGTGTTGCGTGGCTCC TGTCCAGCAGCGCCAGCTTCCTGGCCTCATTCCTCGGCTGGGAGCCACTGAAGGTCTTGCTGGAA GCCCTGTACTT

GCCATCTACCGAAGACACTCATGAAGTAGATTCCAAAGCAGCTTTAATACCGGATTGGTTACAAGAT AGACCATCAAACAGAGAAATGCCATCTGAAGAAGGAACATTAAATGGTCTCACTTCTCCATTTAAGC CAGCTATGGATACAAATTACTATTATTCAGCTGTGGAAAGAAATAACTTGATGAGGTTATCACAGAGC TRPM7 ATTCCATTTACACCTGTGCCTCCAAGAGGGGAGCCTGTCACAGTGTATCGTTTGGAAGAGAGTTCA CCCAACATACTAAATAACAGCATGTCTTCTTGGTCACAACTAGGCCTCTGTGCCAAAATAGAGTTTTT AAGCAAAGAGGAGATGGGAGGAGGTTTACGAAGAGCTGTCAAAGTACAGTGTACCTGGTCAGAACA TGATATCCTCAAATCAGGGCATCTT

CCTTCGACCTGCTCATCTTCGGCTCTGGCTCTGAGGAGCTGATCGGGCTGCTGAAGACTGCGCGG CTGCTGCGGCTGGTGCGCGTGGCGCGGAAGCTGGATCGCTACTCAGAGTACGGCGCGGCCGTGC TGTTCTTGCTCATGTGCACCTTTGCGCTCATCGCGCACTGGCTAGCCTGCATCTGGTACGCCATCG KCNH2 GCAACATGGAGCAGCCACACATGGACTCACGCATCGGCTGGCTGCACAACCTGGGCGACCAGATA GGCAAACCCTACAACAGCAGCGGCCTGGGCGGCCCCTCCATCAAGGACAAGTATGTGACGGCGCT CTACTTCACCTTCAGCAGCCTCACCAGTGTGGGCTTCGGCAACGTCTCTCCCAACACCAACTCAGA GAAGATCTTCTCCATCTGCGTCATGCTCATTGGCTCCCTCATGTATGC

TCTCAGTTCCGGCAAGTTCTACGGTGACGAGGAGAAAGATAAAGGTTTGCAGACAAGCCAGGATGC ACGCTTTTATGCTCTGTCGGCCAGTTTCGAGCCTTTCAGCAACAAAGGCCAGACGCTGGTGGTGCA GTTCACGGTGAAACATGAGCAGAACATCGACTGTGGGGGCGGCTATGTGAAGCTGTTTCCTAATAG CALR TTTGGACCAGACAGACATGCACGGAGACTCAGAATACAACATCATGTTTGGTCCCGACATCTGTGG CCCTGGCACCAAGAAGGTTCATGTCATCTTCAACTACAAGGGCAAGAACGTGCTGATCAACAAGGA CATCCGTTGCAAGGATGATGAGTTTACACACCTGTACACACTGATTGTGCGGCCAGACAACACCTAT GAGGTGAAGATTGACAACAGCCAGGTGGAGTCCGGCTCCTTGGAAGACGATTGGGACTTC

GAAGAGGTTCAGTGCGAAGGCAACAGCTTCCATAAATCCTGCTTCCTGTGCATGGTCTGCAAGAAG AATCTGGACAGTACCACTGTGGCCGTGCATGGTGAGGAGATTTACTGCAAGTCCTGCTACGGCAAG AAGTATGGGCCCAAAGGCTATGGCTACGGGCAGGGCGCAGGCACCCTCAGCACTGACAAGGGGG CSRP1 AGTCGCTGGGTATCAAGCACGAGGAAGCCCCTGGCCACAGGCCCACCACCAACCCCAATGCATCC AAATTTGCCCAGAAGATTGGTGGCTCCGAGCGCTGCCCCCGATGCAGCCAGGCAGTCTATGCTGC GGAGAAGGTGATTGGTGCTGGGAAGTCCTGGCATAAGGCCTGCTTTCGATGTGCCAAGTGTGGCA AAGGCCTTGAGTCAACCACCCTGGCAGACAAGGATGGCGAGATT

GGCCTCTGGCCTCTAGGTAACCAGTTTAAATTGGTTCAGGGTGATAACTACTTAGCACTGCCCTGGT CD47 GATTACCCAGAGATATCTATGAAAACCAGTGGCTTCCATCAAACCTTTGCCAACTCAGGTTCACAGC AGCTTTGGGCAGTTATGGCAGTATGGCATTAGCTGAGAGGTGTCTGCCACTTCTGGGTCAATGGAA

Materials and Methods

TAATAAATTAAGTACAGGCAGGAATTTGGTTGGGAGCATCTTGTATGATCTCCGTATGATGTGATATT GATGGAGATAGTGGTCCTCATTCTTGGGGGTTGCCATTCCCACATTCCCCCTTCAACAAACAGTGTA ACAGGTCCTTCCCAGATTTAGGGTACTTTTATTGATGGATATGTTTTCCTTTTATTCACATAACCCCTT GAAACCCTG

TTTCCCGAATCTCAGAATGCCTGTTAAAAGATCACTGAAGTTGGATGGTCTGTTAGAAGAAAATTCAT TTGATCCTTCAAAAATCACAAGGAAGAAAAGTGTTATAACTTATTCTCCAACAACTGGAACTTGTCAA ATGAGTCTATTTGCTTCTCCCACAAGTTCTGAAGAGCAAAAGCACAGAAATGGACTATCAAATGAAA ITGB3BP AGAGAAAAAAATTGAATCACCCCAGTTTAACTGAAAGCAAAGAATCTACAACAAAAGACAATGATGA ATTCATGATGTTGCTATCAAAAGTTGAGAAATTGTCAGAAGAAATCATGGAGATAATGCAAAATTTAA GTAGTATACAGGCTTTGGAGGGCAGTAGAGAGCTTGAAAATCTCATTGGAATCTCCTGTGCA

CATGCAGATCTGGACCACTGGAGAATACTCCTTCAAGATCTTTCCAGAGAAAAACATTCGTGGCTTC AAGCTCCCAGACACACCTCAAGGCCTCCTGGGGGAGGCCCGGATGCTCAATGCCAGCATTGTGGC ATCCTTCGTGGAGCTACCGCTGGCCAGCATTGTCTCACTTCATGCCTCCAGCTGCGGTGGTAGGCT ENG GCAGACCTCACCCGCACCGATCCAGACCACTCCTCCCAAGGACACTTGTAGCCCGGAGCTGCTCA TGTCCTTGATCCAGACAAAGTGTGCCGACGACGCCATGACCCTGGTACTAAAGAAAGAGCTTGTTG CGCATTTGAAGTGCACCATCACGGGCCTGACCTTCTGGGACCCCAGCTGTGAGGCAGAGGACAGG GGTGACAAGTTTGTCTTGCGCAGTGCTTACT

GCCTTCGTCTGGACTGCCGCCATGAGAATACCAGCAGTTCACCCATCCAGTACGAGTTCAGCCTGA CCCGTGAGACAAAGAAGCACGTGCTCTTTGGCACTGTGGGGGTGCCTGAGCACACATACCGCTCC THY1 CGAACCAACTTCACCAGCAAATACAACATGAAGGTCCTCTACTTATCCGCCTTCACTAGCAAGGACG AGGGCACCTACACGTGTGCACTCCACCACTCTGGCCATTCCCCACCCATCTCCTCCCAGAACGTCA CAGTGCTCAGAGACAAACTGGTCAAGTGTGAGGGCATCAGCCTGCTGGCTCAGAAC

AATCATTTAAGAGTTCCTGTAACAGTTATGCAGAAAATACTAAAACCCATCAGGCAAGATCACCACG CATTGAAATATTTTCATATCAAGATAAAGTCGCACATTTTCCACAATACATTGCTAAAATAAAGAGGA ENAH GAAAGGCTTAGGAAGTTTTTTTGCAGAGAGTGCTGGTAAAGAATTGAGCAAGTTTGCTATTGTATTG TAATGTTTCTCTCAGGTTTGTTCTTCCTATCATGTTTGATATTCCATGAATAATTGAGATCAGCCCTAT GTAAGTTAAGATCATAATATGTGGAACAAATGGAATTGTAAGTGCTTTC

TGCTGAAAGCACTGAAGTCCTTATTTGAACACCACAAAGCTCTGGATGAAAAGGTGAGAGAGCGATT ACGAGTAGCACTTGAAAGATGTAGTTTGTTAGAAGAGGAATTAGGTGCCACACACAAAGAGCTAATG PPFIA1 ATTCTTAAAGAACAGAATAATCAGAAAAAAACTCTAACAGATGGAGTGCTGGACATAAACCATGAAC AAGAAAATACACCAAGCACGAGTGGAAAGAGATCTTCTGATGGTTCTTTAAGCCACGAGGAAGACC TTGCTAAAGTAATTGAGCTCCAAGAAATCATAAGTAAGCAGTCAAGGGAACAG

AATGATTTATGCCAGCTCCAAGGACGCCATCAAGAAGAAGCTGACAGGGATCAAGCATGAATTGCA AGCAAACTGCTACGAGGAGGTCAAGGACCGCTGCACCCTGGCAGAGAAGCTGGGGGGCAGTGCC CFL1 GTCATCTCCCTGGAGGGCAAGCCTTTGTGAGCCCCTTCTGGCCCCCTGCCTGGAGCATCTGGCAG CCCCACACCTGCCCTTGGGGGTTGC

TTTCTCACCTGCCGTGAACACATCAGTGTCTACCGTAGCATCCACGGTTGCTCCAATGTATGCCGGA GATCTTCGCACAAAGCCACCTCTTGACCACAATGCAAGTGCCACTGACTATAAGTTTTCTTCTTCAAT SVIL AGAAAATTCGGACTCTCCAGTTAGAAGCATTCTGAAATCGCAAGCTTGGCAGCCTTTGGTAGAGGG TAGCGAGAACAAGGGAATGTTGAGAGAATATGGAGAGACAGAAAGCAAGAGAGCTTTGACAGGTCG AGACAGTGGGATGGAGAAGTATGGGTCCTTTGAGGAAGCAGAAGCATCCTACC

TGTACCCCGCTTCTGACTGCCTAGGGCGAGTGGGCATCCTGTCATCATCTCCACTGTCCCAAGCAG TCACTAGGTGGCGGCCGGGCCAGCTGGAACCCAGCCCATCCTCTCAGGCAGAGCAGGGTGGTCC NUDT16L1 GGGCACACTGGGCCTGCCTCTCCAGCCTCAGGATGCTCTTGTTTATTCTGGGCTCAGACCCTCCTC TTGTACGTCTCATCACAGCTGGTAGAGACCCAGGAGTGCCTGATTGTCCCACAGGGGTGGCGCAC AGCTCTGGGACCACTCAGAAGATGGGATGTGTGGGTGGA

ATGACTACTAGCTCCCCTCCCCTCTCCCTGGAACTTTCTCTTTCACTCCAACTTTCTTACTACATCCA TCTTTTCTGTGGCGGGGCCAAAAAAGGAAACCAGGAGTGCCACTATGCTGACTTCTTATTCCTTTTC NEXN ATAACAGTCTTCAAAGCACAGCTCATCTAAAGAATGCCTACTTCTTTTCCAAATAAGCATCAGATTTA TCGCCTATTATGCAGTAACAGTCAATAAAATGTACTTATGGGGGGGAATTACTCAATTATTCTATCAG AACCTATTATAAAGACTGTATTTCCCATAGACGTTTACAGCAACTATGT

CCCTGGACAAGAACTTCCACATGAAGTGTTACAAGTGTGAGGACTGCGGGAAGCCCCTGTCGATTG AGGCAGATGACAATGGCTGCTTCCCCCTGGACGGTCACGTGCTCTGTCGGAAGTGCCACACTGCT ZYX AGAGCCCAGACCTGAGTGAGGACAGGCCCTCTTCAGACCGCAGTCCATGCCCCATTGTGGACCAC CCACACTGAGACCACCTGCCCCCACCTCAGTTATTGTTTTGATGTCTAGCCCCTCCCATTTCCAACC CCTCCCTAGCATCCCAGGTGCCCTGACCCAGGACCCAACATGGTCTAGGGATGCAGG

CACCAAGAGCCACTAGAGAACTTTCAGTGCAATGTTCCTCTGGGCATGGAGTCTGGCCGGATTGCT NRP2 AATGAACAGATCAGTGCCTCATCTACCTACTCTGATGGGAGGTGGACCCCTCAACAAAGCCGGCTC CATGGTGATGACAATGGCTGGACCCCCAACTTGGATTCCAACAAGGAGTATCTCCAGGTGGACCTG

Materials and Methods

CGCTTTTTAACCATGCTCACGGCCATCGCAACACAGGGAGCGATTTCCAGGGAAACACAGAATGGC TACTATGTCAAATCCTACAAGCTGGAAGTCAGCACTAATGGAGAGGACTGGATGGT

AATGACAAGACCTATTGTCAACCTTGCTTCAATAAGCTCTTCCCACTGTAATGCCAACTGATCCATAG CCTCTTCAGATTCCTTATAAAATTTAAACCAAGAGAGGAGAGGAAAGGGTAAATTTTCTGTTACTGAC LPXN CTTCTGCTTAATAGTCTTATAGAAAAAGGAAAGGTGATGAGCAAATAAAGGAACTTCTAGACTTTACA TGACTAGGCTGATAATCTTATTTTTTAGGCTTCTATACAGTTAATTCTATAAATTCTCTTTCTCCCTCT CTTCTCCAATCAAGCACTTGGAGTTAGATCTAGGTCCTTCTATCTCG

4.1.4 Inhibitors

Table 4.4. Inhibitors used for cell culture experiments

Concentration Inhibitor Target Company [M]

Antimycin A ATP synthase 50 Sigma-Aldrich

Aphidicolin DNA-Polymerase α and δ 10 Sigma-Aldrich

Bafilomycin A1 H+-ATPase 0.1 Sigma-Aldrich

Carboxy-PTIO Radical Scavenger 50 Thermo Fisher

Chloroquine Autophagy 25 Sigma-Aldrich

Colchicine Tubulin 0.05 Sigma-Aldrich

DDR1-IN DDR1 10 Tocris

Erlotinib EGFR 10 Selleckchem

Imatinib C-Abl 12 Selleckchem

KU55933 ATM 5 Calbiochem

Latrunculin B Actin 5 Sigma-Aldrich

Ly294002 PI3K 20 Selleckchem

MuTBAP peroxynitrite scavenger 50 Merck

Oligomycin ATP synthase 5 Sigma-Aldrich

Paclitaxel Tubulin 0.001 Sigma-Aldrich

PD98059 MEK 50 Selleckchem

PF00573228 FAK 1 Pfizer

SB203580 MAPK 20 Selleckchem

SP600125 JNK 10 Santa Cruz

Materials and Methods

TAE226 FAK (Tyr397) 1 Selleckchem

UO126 MEK 10 Selleckchem

4.1.5 Chemotherapeutic agents

Table 4.5. Chemotherapeutics used for cell culture experiments.

Chemotherapeutic agent Company Gemcitabine

4.1.6 Protein ladders

The PageRuler Unstained Protein Ladder (ThermoFisher Scientific, Erlangen, DE) was used as internal molecular weight standards for SDS gel electrophoresis.

4.1.7 Method kits

Table 4.6. Method kits used for biochemical applications.

Kit Application Company BCA Protein Assay Kit Determination of protein concentration Pierce, Bonn, DE ECL Western Blotting Amersham, Frei- Western blot detection Detection Reagents burg, DE ProteoExtract Subcellu- Calbiochem, Bad lar Proteome Extraction Subcellular protein fractionation Soden, DE Kit Life Technologies Total Exosome Isolation Exosome isolation GmbH, Darmstadt, (from cell culture media) DE

4.1.8 Primary antibodies

Table 4.7. Primary antibodies used for Western blot, immunoprecipitation, and immunofluorescence applications.

Antibody Application Dilution Company

Novus Biologicals, Littelton, αV integrin Immunofluorescence 1:250 USA,

Western blot 1:1000 β1 integrin Abcam, Cambridge, UK Immunofluorescence 1:100

β8 integrin Western blot 1:1000 Abcam, Cambridge, UK

Materials and Methods

Antibody Application Dilution Company Immunofluorescence 1:200 Immunoprecipitation 10 µl

β-Actin, Klon AC-15, Sigma Aldrich, Taufkirchen, Western blot 1:10000 mouse, monoclonal DE

Cell Signaling, Frankfurt a. M., γH2AX Western blot 1:1000 DE

Sigma Aldrich, Taufkirchen, APPL2 Immunofluorescence 1:100 DE

Caveolin 1 Immunofluorescence 1:100 BD, Heidelberg, DE

GM130 Immunofluorescence 1:100 BD, Heidelberg, DE

HSP70 Western blot 1:1000 Santa Cruz, Dallas, USA

Sigma Aldrich, Taufkirchen, LC3B Immunofluorescence 1:500 DE

Cell Signaling, Frankfurt a. M., MEK1/2 Western blot 1:1000 DE

Rockland Immunochemicals Normal rabbit IgG Immunoprecipitation 10 µl Inc. Limerick, USA

4.1.9 Secondary antibodies

Table 4.8. Secondary antibodies used for Western blot, immunoprecipitation, immunofluorescence or immunohistochemical applications.

Antibody Application Dilution Company

Anti-mouse IgG, HRP con- Western blot 1:5000 Pierce, Bonn, DE jugated

Anti-rabbit IgG, HRP con- Western blot 1:5000 Pierce, Bonn, DE jugated

Alexa Fluor®488 Life Technologies GmbH, Immunofluorescence 1:500 Anti-rabbit IgG Darmstadt, DE

Alexa Fluor®549 Life Technologies GmbH, Immunofluorescence 1:500 Anti-mouse IgG Darmstadt, DE

Alexa Fluor®594 Life Technologies GmbH, Immunofluorescence 1:800 Phalloidin Darmstadt, DE

Materials and Methods

4.1.10 Solutions for cell biological applications

Table 4.9. Solutions used for cell biological applications. The detailed composition for each solution is shown.

Substance Composition Company

1x PBS Sigma Aldrich, Taufkirchen, DE

1x Trypsin/EDTA (4 °C) Sigma Aldrich, Taufkirchen, DE

1 g Agarose 1% Agarose Sigma Aldrich, Taufkirchen, DE ad 100 ml ddH2O

10 nM Non-Essential Amino (4 °C) Sigma Aldrich, Taufkirchen, DE Acid Solution (NEAA)

800 ml Ethanol, denatured, Berkel, Berlin, DE 80% Ethanol 99% ad 1 l ddH2O

B27 supplement (-20 °C) Life Technologies, Karlsruhe, DE

DMEM with GlutaMAX™ (supplemented with 10% FCS, 1% NEAA) Life Technologies, Karlsruhe, DE

Cell culture medium Keratinocyte-SFM with Keratinocyte Supplements Life Technologies, Karlsruhe, DE (contains Bovine Pituitary Ex- tract (BPE), EGF Human Re- combinant)

Collagen Type I Rat Tail High Corning Life Science, Wiesbaden,

Concentration DE

100 ml Methanol Roth, Karlsruhe, DE 37,5 ml Acidic acid Merck, Darmstadt, DE Coomassie stain 0,25 g Coomassie G250 Merck, Darmstadt, DE

ad 500 ml ddH2O

Heat inactivated prior to use: PAA Laboratories GmbH, Fetal Calf Serum (FCS) 30 min at 56 °C (-20 °C) Cölbe, DE

Heparin 5000U/ml ad 5 ml ddH2O Millipore, Darmstadt, DE

HEPES solution 1M Sigma Aldrich, Taufkirchen, DE

50 µg reconstituted with Human EGF ddH2O supplemented with 1% Life Technologies, Karlsruhe, DE FCS to 200 µg/ml

50 µg reconstituted with Human FGFb lyophilized ddH2O supplemented with 1% Life Technologies, Karlsruhe, DE FCS to 200 µg/ml

Materials and Methods

Substance Composition Company

Oligofectamine Life Technologies, Karlsruhe, DE

OptiMEM with GlutaMAX™ (4 °C) Life Technologies, Karlsruhe, DE

Recombinant Human Latent R&D TGF-β1

4.1.11 Solutions for protein-biochemical and molecular-biological applications

Table 4.10. Solutions used for protein-biochemical and molecular-biological applications. The composition for each solution is shown.

Substance Composition (Storage) Company

30.3 g Tris base Roth, Karlsruhe, DE 144.1 g Glycine Roth, Karlsruhe, DE 10x SDS running buffer 10 g SDS Roth, Karlsruhe, DE

ad 1 l ddH2O (RT)

100 ml 10x SDS running buffer 1x SDS running buffer ad 1 l ddH2O (RT)

AppliChem GmbH, Darmstadt, 1 g APS 10% Ammonium persulfate DE (APS) ad 10 ml ddH2O (-20 °C)

30.275 g Tris base Roth, Karlsruhe, DE 0.5 M Tris buffer (pH 6.8) ad 1 l ddH2O (RT)

181.71 g Tris base Roth, Karlsruhe, DE 3 M Tris buffer (pH 8.8) ad 1 l ddH2O (RT)

100 g SDS Roth, Karlsruhe, DE 10% SDS ad 1 l ddH2O (RT)

29 g Glycine Roth, Karlsruhe, DE 10x Transfer buffer 58 g Tris base Roth, Karlsruhe, DE (Maniatis-SDS) ad 1 l ddH2O (RT)

100 ml 10x Transfer buffer 1x Transfer buffer 200 ml Methanol Roth, Karlsruhe, DE

ad 1 l ddH2O (RT)

25x CompleteTM protease 1 Tablet Roche Diagnostics GmbH,

inhibitor cocktail ad 2 ml ddH2O (-20 °C) Mannheim, DE

AppliChem GmbH, Darmstadt, RIPA buffer 12.5 ml Tris-HCl (pH 7.4) DE

Materials and Methods

Substance Composition (Storage) Company 2.5 ml NP-40 Fluka, München, DE 6.25 ml 10% Sodium AppliChem GmbH, Darmstadt, deoxycholate DE 7.5 ml 5 M NaCl Merck, Darmstadt, DE 0.5 ml 0.5 M EDTA Roth, Karlsruhe, DE

ad 250 ml ddH2O (4 °C)

951 µl RIPA buffer 40 µl 25x CompleteTM protease Modified RIPA lysis buffer inhibitor cocktail

5 µl 200 mM Na3VO4 4 µl 500 mM NaF

3.678 g Na3VO4 200 mM Na3VO4 Sigma Aldrich, Taufkirchen, DE ad 100 ml ddH2O (-20 °C)

2.1 g NaF 500 mM NaF Sigma Aldrich, Taufkirchen, DE ad 100 ml ddH2O (-20 °C)

176 g NaCl Merck, Darmstadt, DE 20x TBS (pH 7.6) 48 g Tris base Roth, Karlsruhe, DE

ad 1 l ddH2O (RT)

50 ml 20x TBS 1x TBS ad 1 l ddH2O (RT)

TBS/0.05% Tween 20 0,5 ml Tween 20 Serva, Heidelberg, DE (TBST) ad 1 l 1x TBS (RT)

5 ml Glycerol Roth, Karlsruhe, DE 0.925 g DTT AppliChem GmbH, Darmstadt, DE 6x Reducing electrophore- 1.2 g SDS Roth, Karlsruhe, DE sis loading dye 3.5 ml Tris base Roth, Karlsruhe, DE 1.2 mg Bromophenol blue AppliChem GmbH, Darmstadt, ad 10 ml ddH2O (-20 °C) DE

1 ml 10x Cell Lysis Buffer 40 µl CompleteTM protease inhibi- Cell Signaling, Frankfurt a. M., 1x Cell Lysis Buffer tor cocktail DE

ad 9 ml ddH2O

0.5 g Bovine Serum Albumin Serva, Heidelberg, DE 5% BSA solution ad 10 ml PBST (4°C)

Materials and Methods

Substance Composition (Storage) Company

5 g skimmed milk powder AppliChem GmbH, Darmstadt, 5% Non-fat dry Milk solution ad 100 ml 1x PBS (4 °C) DE

250 ml Developer GBX-Developer-Kodak Kodak, Stuttgart, DE ad 1 l ddH2O

250 ml Fixer GBX-Fixer-Kodak Kodak, Stuttgart, DE ad 1 l ddH2O

4.1.12 Solutions for immunofluorescence applications

Table 4.11. Solutions used for immunofluorescence applications. The composition for each solution is shown.

Substance Composition (Storage) Company 1x PBS (4 °C) Sigma Aldrich, Taufkirchen, DE

3.7% Formaldehyde 1 ml 37% Formaldehyde Merck, Darmstadt, DE ad 10 ml 1x PBS (RT)

0,25% Triton X-100 125 µl Triton X-100 Roth, Karlsruhe, DE ad 50 ml 1x PBS (RT)

1% BSA 0,5 g Bovine serum albumin (BSA) Sigma Aldrich, Taufkirchen, ad 50 ml 1x PBS (4 °C) DE

4.1.13 Other solutions and chemicals

Table 4.12. Other solutions and chemicals used for biochemical or molecular-biological applications.

Substance Company

30 % Acrylamide-bisacrylamide solution (29:1) Serva, Heidelberg, DE

Dimethyl sulfoxide (DMSO) AppliChem GmbH, Darmstadt, DE

Ethylenediaminetetraacetic acid (EDTA) Merck, Darmstadt, DE

Ethanol, 99 % Merck, Darmstadt, DE

Formaldehyde, 37% Merck, Darmstadt, DE

Hydrochloric acid (HCl) Merck, Darmstadt, DE

Isopropyl alcohol Merck, Darmstadt, DE

Mitotracker Life Technologies, Karlsruhe, DE

Ponceau S Sigma, Taufkirchen, DE

ProLong Diamant Antifade Mountant with DAPI Life Technologies, Karlsruhe, DE

Materials and Methods

Substance Company

Tetramethylethylenediamine (TEMED) Merck, Darmstadt, DE

Coomassie Brilliant Blue R-250 Staining Solu- Bio-Rad Laboratories GmbH, Munich, DE tion

4.1.14 Software

Table 4.13. PC programs for data analysis and presentation.

Program Company

GraphPad Prism 7 GraphPad Software Inc., San Diego, USA

Fiji (Schindelin et al., 2012) National Institutes of Health

Magellan 5.0 Software Tecan, Crailsheim, DE

Microsoft Office 2010 Microsoft Corp., Redmond, WA, USA Zeiss LSM Image Browser Version 3,5,0,376 Carl Zeiss GmbH Jena, DE

Zeiss AxioVision SE64 Rel. 4.9 Carl Zeiss GmbH Jena, DE Zeiss ZEN 2 core v2.4 Carl Zeiss GmbH Jena, DE

4.2 Methods

4.2.1 Cell culture

Human pancreatic ductal adenocarcinoma (PDAC) cell lines BxPC3, MiaPaCa2, Panc-1, Patu8902 were purchased from ATCC, Capan-1, COLO357, and patient-derived primary cell lines (PacaDD119, PacaDD137, PacaDD159) were a kind gift from Prof. Christian Pilarsky (TU Dresden). Established cell lines were cultured in Dulbecco’s modified Eagle’s medium with 10 % fetal calf serum and 1 % non-essential amino acids. Patient-derived primary cell cultures (PacaDD119, PacaDD137, PacaDD159) were cultured in DMEM with 33% K-SFM and 13 % FCS. Cells were incubated at 37 °C with 8.5 % CO2 at pH 7.4. Cells were grown to 70-80 % confluency and subcultured every three days.

Materials and Methods

4.2.2 Cell freezing and thawing

Cells were used for cryoconservation in low passage (passage < 2). Cells were grown in T175 flask to 70-80 % confluency and detached by trypsin and resuspend by adding complete medium to the flask. Single-cell suspension was mixed and transferred to a 50 ml falcon tube. Cell numbers were determined by using Neubauer counting chamber. Cells were centrifuged at 130 g, 3 minutes, RT, and resuspend in 10 ml cryomedium (0.5 ml DMSO, 1 ml FCS and 8.5 ml complete DMEM). One milliliter cell suspension was transferred to cryovial in the pre- cooled freezing container at -80 °C for twenty-four hours. The cryovials were transferred into a storage box and keep at -80 or liquid nitrogen tank for long term storage.

For thawing, cryovial was removed from -80 °C and thawed in 37 °C dry bath. Cells were resuspended in 9 ml complete DMEM and centrifuged at 130 g, 3 minutes, RT to remove cryomedium. Cells were resuspended in 5 ml complete DMEM and transferred to T25 flask in normal cell culture condition.

4.2.3 esiRNA knockdown

250,000 cells were seeded per well of six-well plate, targeting esiRNAs or nonspecific RLUC esiRNA of 1 µg / ml final concentrations were transfected by using oligofectamine according to the manufacturer’s protocol. The knockdown efficiency of β8 integrins was measured by Western blotting.

4.2.4 3D tumoroid high-throughput esiRNA-based screening (3DHT-esiRNAs)

against focal adhesion proteins

High-throughput screening (HTS) is an approach to answer complex biological questions. HTS is commonly used in drug discovery, and validation of new genes or proteins modulate a particular biological pathway.

MiaPaCa2 cells were transfected with library focal adhesion proteins esiRNA at ten ng final concentration using Oligofectamine transfection reagent in 96-well plate. twenty-four hours post-transfection, cells were trypsinized and resuspended. 3000 cells were seeded into 96-

Materials and Methods

well plates with laminin-rich extracellular matrix (IrECM, final concentration of 0.5 mg/ml), incubated at 37°C incubator with 8.5 % CO2 at pH 7.4 for one day. The cells were x-ray irradiated with 0 or 6 Gy and incubated at 37°C for eight days. Tumoroid (>50 cells) were counted. Here are the equations to calculate tumoroid formation and radiosensitizing enhancement ratio.

푛표. 표푓 푡푢푚표푟표푖푑 푐표푢푛푡푒푑 (퐹퐴푃 푔푒푛푒푠 푒푠푖푅푁퐴) (1) 푇푢푚표푟표푖푑 푓표푟푚푎푡푖표푛 = ∗ 100% 푛표. 표푓 푡푢푚표푟표푖푑 푐표푢푛푡푒푑 (푁표푛푠푝푒푐푖푓푖푐 푒푠푖푅푁퐴)

(2) Radiosensitizing enhancement ratio 푇푢푚표푟표푖푑 푓표푟푚푎푡푖표푛 (푁표푛푠푝푒푐푖푓푖푐 푒푠푖푅푁퐴) = ∗ 100% 푇푢푚표푟표푖푑 푓표푟푚푎푡푖표푛 (퐹퐴푃 푔푒푛푒푠 푒푠푖푅푁퐴)

4.2.5 Chemotherapy treatment

The chemotherapeutic agent gemcitabine was used for in vitro experiment for chemosensitizing effect investigation. EC50 was detected by performing 3D tumoroid formation assay.

4.2.6 Radiation exposure

Irradiation on cultured cells was delivered at room temperature using two, four, or 6 Gy single doses of 200-kV x-ray (Yxlon Y.TU 320; Yxlon, Hamburg, Germany).The dose rate was prox- imately 1.3 Gy/min at 20 mA filtered with 0.5 mm Cu as published (Zienert et al., 2015). Duplex dosimeter (PTW, Freiburg, Germany) was used to measure the absorbed dose.

4.2.7 Colony formation assay

Colony formation assay is a method to detect cell behavior upon genotoxic stress, such as ionizing irradiation or cytotoxic reagent. The assay is predicated on the reproducing ability of a single cell to proliferate five-six generations into a colony. The colony is defined as 50 cells. This assay is considering as a gold standard in radiobiology to determine the reproductive integrity of cells after genotoxic effects (Puck and MARCUS, 1956). There are two important parameters for the analysis of this assay (1) the plating efficiency (PE) and (2) Surviving Frac- tion (SF). PE indicates the percentage of cells seeded grow into colonies. Here are the equations to calculate PE and SF.

Materials and Methods

푛표. 표푓 푐표푙표푛푖푒푠 푐표푢푛푡푒푑 (1) 푃푙푎푡푖푛푔 퐸푓푓푖푐푖푒푛푐푦 (푃퐸) = ∗ 100% 푛표. 표푓 퐶푒푙푙푠 푠푒푒푑푒푑

퐶표푙표푛푖푒푠 푐표푢푛푡푒푑 (2) 푆푢푟푣푖푣푖푛푔 퐹푟푎푐푡푖표푛 (푆퐹) = 퐶푒푙푙푠 푠푒푒푑푒푑 ∙ 푃퐸

4.2.7.1 2D colony formation assay

BxPC3 cells were seeded into the 6-well plate with specific cell number per well in a total of two ml cell culture medium (Table 4.14.). Incubation at 37 °C for twenty-four hours, cells were x-ray irradiated with 6 Gy or without irradiation as unirradiated condition (Un-IR) and incubated at 37°C until colonies formed. The assay was stopped after eight days incubation, when the majority of colony consists of more than 50 cells. The cell was fixed with 80 % ethanol for 10 min at RT. The Coomassie staining solution was added to the wells for 20 min at RT. Colonies with >50 cells were counted by using the binocular microscope.

Table 4.14. BxPC3 cell numbers and incubation period for 2D colony formation assay.

Cell numbers

Cell line Un-IR 6 Gy Incubation [d]

BxPC3 2000 8000 8

4.2.8 3D tumoroid formation

In addition to the 3D high-throughput screen, as described above, 3D tumoroid formation was determined under identical growth conditions after irradiation (2 – 6 Gy) or Gemcitabine treatment (for twenty-four hours; PBS as control) as published previously (Table 4.15.) (Eke et al., 2010). Then, media containing Gemcitabine were removed, cells were washed repeatedly, and fresh media was added to allow tumoroid growth. Each point on the survival curves represents the mean surviving fraction from at least three independent experiments.

Materials and Methods

Table 4.15. Cell numbers and incubation period for 3D tumoroid formation assay. Cell numbers and incubation period were adjusted by each different cell lines.

Cell numbers

Cell line Un-IR 6 Gy Incubation [d]

BxPC3 3000 3000 8

Capan-1 3000 3000 12

COLO357 1500 1500 9

MiaPaCa2 3000 3000 8

Panc-1 3000 3000 9

Patu8902 6000 6000 21

PacaDD119 3000 3000 9

PacaDD137 2000 2000 8

4.2.9 2D invasion assay

21,000 BxPC3 cells were seeded into the into the inner well of the 35 mm µ-Dish in a total of 70 µl cell culture medium each well. Incubation at 37 °C for 24 hours, the culture-insert was removed gently and 2 ml fresh medium was added. Images were taken by using Axioscope 2 microscope (Zeiss) immediately after culture-insert removing to define the cell-free gap and hourly until 24 hours.

4.2.10 Spheroid and 3D invasion assay

PDAC spheroid was generated by seeding the cells in 1 % agarose coated U-shape 96 well plate and incubated at 37°C, 48 hours. Spheroids were embedded in 1 mg/ml 3D collagen I. Images of spheroids were taken by using Axioscope 2 microscope (Zeiss) immediately after plating to define the spheroid perimeter and daily until 96 hours.

Table 4.16. Preparation for 1 ml collagen type I solution for the invasion assay.

Reagent Volume 10x Hank’s Buffered Salt Solution 100 µl 1 M NaOH solution 2.4 µl Collagen type I stock solution (9.67 mg/ml) 103 µl

Materials and Methods

Culture medium ad 1 ml

4.2.11 Sphere formation assay

To generate spheres, PDAC cells were seeded at a 1,000 cells per well in 96-well ultralow plate (CORNING 3474) in stem cell medium (SCM) consisting of DMEM, supplemented with 2% B27, 20 ng/ml epidermal growth factor and ten ng/ml basic fibroblasts growth factor. For the sphere formation assay, the size of spheres was measured, and spheres >70 μm in diameter were counted after seven days continuous culture.

4.2.12 Exosome isolation

Exosomes were isolated from medium conditioned by Patu8902 cells using the total exosome isolation reagent with the following modifications. Patu8902 cells were washed twice with PBS and incubated for one hour in serum-free medium. In our studies, this period of conditioning was initiated twenty-four hours after a single exposure to either 0 or 6 Gy. This conditioned medium was decanted, centrifuged at 3000 × g for 15 min to eliminate cell debris. The medium was collected and concentrated by using Amicon Ultra-15 Centrifugal Filter Devices (10K). Exosomes were sedimented by mixing with 0.5 volumes of the total exosome isolation reagent then incubate overnight. Centrifuge the exosomes at 10000g, one hour, at 4°C and collect the pellet. Lysis the pellet with RIPA buffer and perform Western blot

4.2.13 Proximity ligation assay

BxPC3 cells were grown on the coverslip and incubate for twenty-four hours. After washing with 1xPBS and fixation with 100 % ice-cold methanol for 15 min incubated at -20 °C, cells were blocked and incubated overnight with indicated antibodies. Proximity ligation was performed according to the manufacturer’s protocol using the Duolink Kit with PLA PLUS and MINUS Probes for mouse and rabbit (Sigma-Aldrich, Duo92101-1KT). Detection Samples were analyzed with a confocal microscope (Axioimager Z2; Carl Zeiss Inc.) under a 40x objective.

Materials and Methods

4.2.14 Protein biochemical analysis

4.2.14.1 Protein extraction from 2D and 3D cultivated cell

Protein cell lysates were prepared under 2D and 3D growth conditions depending on different purposes.

For preparing 2D cell lysate, cells were seed in a 60- or 100-mm cell culture plate with five or ten ml complete medium and incubated at 37 °C for one day. After the incubation period, the medium was removed and washed three times with five ml ice-cold PBS. For preparing the cell lysate, all the procedures were on ice. Cells were lysed using 100 μl 1X modified RIPA assay buffer and harvested by scraping.

For preparing 3D cell lysate, 24-well plates were precoated with 250 μl 1% agarose avoiding cell attach to the well. 50,000 cells were embedded in IrECM based matrix total volume in one ml incubated at 37 °C. At the proper time point, 200 μl cell lysates were collected by using 1000 μl pipette and mix with 100 μl 3X modified RIPA assay buffer.

For both 2D and 3D cell lysate, samples were transferred to Eppendorf Safe-Lock tubes and incubated on ice for 30 minutes. Next, to homogenate the lysate by using an insulin syringe four times and incubated on ice for one hour. Following the incubation, cell lysates were centrifuged for 20 minutes at 13000 g, 4 °C. Cell lysates supernatant were transferred to a new Eppendorf Safe-Lock tube and stored in the -80 °C . Protein concertation was determined by BCA assay for 2D cell lysates. Cell lysates were diluted with 1:10 ratio in RIPA buffer and using BSA, series dilution from two mg/ml, one mg/ml, 0.5 mg/ml, 0.25 mg/ml, 0.025 mg/ml, as standard curve to quantify the protein concertation of cell lysates. Next, preparing BCA reagent A and B with the ratio 1:50. All the samples were pipetted to a 96 well plate each well 20 μl and mix with BCA reagent mixture each well 200 μl. Incubate the 96 well plate at 37 °C for 30 minutes. Following the incubation, measure the protein concertation with TECAN Microplate- Reader at 560 nm. For 3D cell lysates, the protein concertation was determined by performing Western blot and immunoblot with β-actin as described in the following section.

4.2.14.2 Protein fractionation assay

Subcellular fractionation, allowing the separation of organelles based on their physical proper- ties, is commonly used in molecular biology to reveal the structural-functional relationships of proteins (Alberts et al., 2002). Subcellular fractionation has two major steps (1) to disrupt the

Materials and Methods

cellular organization (homogenization) and (2) separation of organelles. The Subcellular Pro- tein Fractionation Kit for Cultured Cells was used according to the manufacturer’s protocol. 5,000,000 cells were seeded in a 150 mm cell culture plate with 20 ml complete medium and incubated at 37 °C incubator for one day.

For preparing the subcellular protein fractionation, all the procedures were on ice. After the incubation, cells were removed from the medium and washed twice with two ml ice-cold wash buffer on an orbital shaker at 4 °C for five minutes. During the incubation period, mix 200 μl ice-cold Extraction Buffer I with one μl Protease Inhibitor Cocktail. Wash buffer was discarded carefully, and 200 μl ice-cold Extraction Buffer I mixture was added immediately to the 150 mm cell culture dish. The 150 mm cell culture dish was gently rotated on the orbital shaker at 4 °C for 10 minutes. In the meanwhile, preparing 200 μl ice-cold Extraction Buffer II with 1 μl Prote- ase Inhibitor Cocktail. Following the incubation, the supernatant was collected to a new Ep- pendorf Safe-Lock tube, labeled with fraction 1 (F1), and stored on ice. 200 μl ice-cold Extrac- tion Buffer II mixture was added immediately to the 150 mm cell culture dish. The 150 mm cell culture dish was gently rotated on the orbital shaker at 4 °C for 30 minutes.

Similarly, during the incubation time, preparing 200 μl ice-cold Extraction Buffer III with one μl Protease Inhibitor Cocktail and 0.6 μl (≥375 U) Benzonase® nuclease. Following the incubation, supernatant was collected to a new Eppendorf Safe-Lock tube, labeled with fraction 2 (F2), and stored on ice. 200 μl ice-cold Extraction Buffer III mixture was added immediately to the 150 mm cell culture dish. The 150 mm cell culture dish was gently rotated on the orbital shaker at 4 °C for 10 minutes. Upon the incubation time, preparing 200 μl room temperature Extraction Buffer IV with 1 μl Protease Inhibitor Cocktail. Following the incubation, supernatant was collected to a new Eppendorf Safe-Lock tube, labeled with fraction 3 (F3) and stored on ice. 200 μl room temperature Extraction Buffer IV mixture was added immediately to the 150 mm cell culture dish. The 150 mm cell culture dish was gently rotated on the orbital shaker until the remaining cell debris detached. The solution was collected to a new Eppendorf Safe- Lock tube, labeled with fraction 4 (F4), and stored on ice. Protein concentration was determined by BCA assay.

4.2.14.3 SDS polyacrylamide gel electrophoresis (SDS-PAGE)

SDS polyacrylamide gel electrophoresis was developed by Laemmli, is the most widely used method in molecular biology for separating protein mixtures according to their molecular mass. Hoefer Mini gel system was used to prepare SDS-PAGE, and the percentage of

Materials and Methods

polyacrylamide gel was determined based on the protein of interest molecular mass. In table 4.17., the composition is shown. The protein samples were used 25 μg per sample for 2D cell lysate and add RIPA buffer to 20 μl, for 3D cell lysates 20 μl was used. 2D and 3D cell lysate protein samples were mixed with 6x sample buffer with the ratio 1:6. Protein samples were denatured at 99 °C for 5 minutes and cooled down on ice. The polyacrylamide solution was prepared on ice and add TEMED before loading it to the gel caster. Finally, the protein samples were loaded with 24 μl, and five μl protein ladder was used as marker. Electrophoresis was accomplished at 25 mA per gel for approximately two hours.Table 4.17. Composition of stacking and separation gels for SDS PAGE.

5 % 8 % 10 % 12 % Stacking gel Separation gel [ml] [ml] [ml] [ml]

ddH2O 1.63 ddH2O 2.16 1.83 1.5

0,5 M Tris/HCL 3 M Tris/HCL pH 0,72 1.25 1.25 1.25 pH 6.8 8.8

Acryl amide 30 % 0.5 Acryl amide 30 % 1.33 1.67 2.00

50 % Glycerol 0.06 50 % Glycerol 0,10 0,10 0,10

10 % SDS 0.03 10 % SDS 0,05 0,05 0,05

10 % APS 0.06 10 % APS 0,10 0,10 0,10

TEMED 0.0048 TEMED 0,004 0,004 0,004

4.2.14.4 Western blot analysis

Western blot is a method to transfer the separated proteins from the PAGE to, nitrocellulose membrane, a porous membrane, between two parallel electrodes (Burnette, 1981; KURIEN and SCOFIELD, 2006; Mahmood and Yang, 2012).

Materials and Methods

A semi-dry blotter was used to transfer the proteins from the PAGE to nitrocellulose membrane (Figure 4.1.) with a current of 0.8 mA pro cm2 for 2 hours. After the transferring, the membrane was stained with PonceauS solution to check the transferring procedure and removed the un- wanted part of the membrane. The membrane was washed with TBST to destain the Pon- ceauS and blocked in 5% Non-fat dry Milk solution in TBST or 5 % BSA (depending on primary antibody), gently rotated on the orbital shaker at RT for one hour. The primary antibody was applied to the membranes and incubated overnight (ON) at 4 °C on the orbital shaker. After the antibody incubation, the membranes were washed three times for 10 minutes with TBST, incubated for one hour at RT on the orbital shaker with the secondary antibody, and washed again 6 times for 10 minutes in TBST. The detection was accomplished using the ECL Western Blotting Detection system. X-ray films were developed, fixed, washed in water and finally air- dried to detect the protein expression level. The films were scanned and protein signals den- sitometrically analyzed using the ImageJ software. Protein expression was normalized to β actin to corresponding total protein.

Figure 4.1. Schematic diagram of Western blot setup. Whatman papers and nitrocellulose membrane were immersed in the 1X transfer buffer. 3 sheets of Whatman paper were placed at anode and cover with nitrocellulose membrane and gel. Finally, 3 sheets of Whatman paper were covered on the top of gel.

4.2.15 Dot blot analysis

Dot blot is a method to detect, identify proteins similar to Western blot. Here, we used dot blot to detect the proteins in the condition medium.

Materials and Methods

Nitrocellulose membrane was prepared by washing with transfer buffer and marked with pencil to indicate the region for loading the protein samples. Condition medium preparation as men- tion above in the exosome isolation. Loading the protein samples by using 10 μl pipet tip, spot 1 μl of protein samples to the nitrocellulose membrane slowly to avoid penetration. After protein samples loading, wait until the membrane dry, remaining procedures follow Western blot.

4.2.16 Immunoprecipitation

Immunoprecipitation is a method for detection and analysis of protein-protein interaction based on the antibody-antigen interactions that increase the molecular size to precipitate from the solution (Kaboord and Perr, 2008).

4,500,000 cells were seeded to 100 mm plate with 10 ml complete medium and incubated at 37 °C for one day. Next, cells were irradiated with 6 Gy x-ray or without irradiation as unirradiated condition and incubated both at 37 °C for two hours. Then the cell lysis buffer was prepared by diluting 10x Cell Lysis Buffer with the ratio 1:10 and mix with 40 μl/ml complete protease inhibitors. Following the incubation, cell culture plates were washed three times with 10 ml ice-cold PBS. For preparing the cell lysate, all the procedures were on ice. Cells were lysed using 200 μl cell lysis buffer, harvested by scraping, and centrifuged detail as described in 4.2.13.3 protein extraction from 2D and 3D cultivated cells.

Next, 1 ml protein A/G sepharose slurry (50 % v/v) beads were transferred to an Eppendorf Safe-Lock tubes and centrifuged for five minutes at 500 g, 4 °C. The supernatant was discarded and resuspended with an equal amount of cell lysis buffer. The wash step was repeated once, resuspend the protein A/G sepharose slurry (50 % v/v) beads in cell lysis buffer and store on ice.

For precipitating the proteins of interest, first pre-clear the cell lysate was needed to decrease non-specific binders, for 1 mg protein from the cell lysate was used, mix with 100 μl protein A/G sepharose slurry (50 % v/v) beads in Eppendorf Safe-Lock tubes and gently rotated at 4 °C for one hour. Following the pre-clear, centrifuged the tubes for five minutes at 500 g, 4 °C and collect the supernatant to new tubes. Next, add ten μl β8 integrin antibody or rabbit normal IgG to the tubes and gently rotated at 4 °C for one hour. Following the antibody mixing, 100 μl protein A/G sepharose slurry (50 % v/v) beads were added and gently rotated at 4 °C overnight.

Materials and Methods

After the rotating, the tubes were centrifuged for five minutes at 500 g, 4 °C, discarded the supernatant carefully, and resuspended with cell lysis buffer with an equal amount. The wash step was repeated once, finally, resuspend with 50 μl 6x loading buffer and denatured at 95 °C for 15 minutes. Finally, the protein samples were loaded with 25 μl, and 5 μl protein ladder was used as marker. Electrophoresis was accomplished at 25 mA per gel. After the electrophoresis, stained the gel with Coomassie Blue, stored the gel in a 150 mm cell culture dish with ddH2O, and sent the gel to Max Planck Institute of Molecular Cell Biology and Genetics Mass Spectrometry (MPI-CBG MS) Facility (Dresden, Germany) for mass spectrometric analysis.

4.2.17 Mass spectrometric analysis

Mass spectrometry, to detect ionized molecule based on mass-to charger ratio (m/z), is an indispensable analysis tool for molecular and cell biology. Mass spectrometry-based immunoprecipitation proteomics provided a sensitive and large-scale protein-protein interactions between bait and interactors. (Free et al., 2009; Walther and Mann, 2010).

Immunoprecipitates were separated by gel electrophoresis, in-gel digested with trypsin, and peptides recovered from the gel matrix analyzed on an LTQ Orbitrap XL mass spectrometer (Thermo Fischer Scientific) coupled on-line to Ultima 3000 LC system (Dionex) via a TriVersa robotic ion source (Advion BioScience). PANTHER (Protein ANalysis THrough Evolutionary Relationships) classification system (http://www.pantherdb.org/) was used to category interac- tomes of β8 integrin according to their functions. Connections between the identified β8 integrin interactome and autophagy were analyzed by ARN (Autophagy Regulatory Network) (http://arn.elte.hu/).

4.2.18 Immunofluorescence and image analysis

The fixed cells were permeabilized with 0.25 % Triton X–100 at RT for 10 min, washed three times with PBS. Then cells on the cover slides were incubated with blocking buffer (1% BSA in PBS) at RT for 1 h, then with primary and secondary antibody in blocking buffer in the dark at RT for 1 h, respectively. The cells on the cover slides were washed three times in PBS between each step. Then the cover slides were mounted using ProLong™ Diamond Antifade Mountant with DAPI. The slides were krpt in the dark until being viewed by using LSM 510

Materials and Methods

meta (Zeiss) with a 63x objective or Axioscope1 plus fluorescence microscope (Zeiss) with 40x objective. Colocalization of β8 integrin with APPL2, Caveolin-1, GM130, and mitochondria were analyzed by Fiji distribution and the Coloc2 plugin to calculate Pearson’s correlation co- efficients. For the β8 integrin translocation and expression was analyzed by Fiji. In brief, phollidin staining stack was used to mark and measure the cell surface area. Then, the β8 integrin staining stack was used to measure the β8 integrin postive area and intensity in the cell and cauculate the percentage of β8 integrin postive area by dividing to the total cell surface area. Each condition was measured at least 100 cells.

4.2.19 Statistics

All results represent means ± standard deviation (SD) of three independent experiments. Stu- dent t-test was performed for statistical analysis, Microsoft Excel was used. A p-value is less than 0.05 was considered significant

Results

5 Results

5.1 3D tumoroid high-throughput esiRNA-based screening (3DHT- esiRNAs) in PDAC cells

5.1.1 3DHT-esiRNA in PDAC cells identifies potential focal adhesion protein targets involved in radioresistance

To construct the esiRNA-based high throughput screen targeting, we subdivided the 117 component molecules into functional groups including 12 actin regulation proteins, two actin-binding proteins, 58 adaptor proteins, 37 adhesion receptor proteins, three channel proteins, one chaperone protein, three cytoskeletal proteins, one transcription factor based on Zaidel-Bar et al. and Winograd-Katz et al.’s work (Zaidel-bar et al., 2007; Winograd-Katz et al., 2014). We sought to identify novel potential FAP candidates whose depletion potently reduced the basal tumoroid forming ability and/or the radioresistance of PDAC cells through employing the esiRNA-based high throughput screen. We found the basal tumoroid forming ability upon FAPs knockdown is significantly (p<0.05) reduced in comparison to esiRNA controls, which suggested that FAPs do influence PDAC tumoroid forming (Figure 1A). Besides, FAPs knockdown tumoroid formation ability upon 6 Gy x-ray single dose showed that silence FAPs could increase radiosensitizing effect in MiaPaCa2 cells. Among them, silencing PINCH1 (LIMS1) expression showed the most significant radiosensitizing effect in FAPs knockdown with a minimal tumoroid forming ability 20.8955 ± 10.596 % (Figure 1B). Although silencing PINCH1 expression showed a minimal tumoroid forming ability upon 6 Gy x-ray irradiation in our high throughput screen, but it also showed reducing tumoroid forming ability in the normal condition.

Here, we calculated the sensitizing enhancement ratio to reveal which genes are essential for PDAC radiosensitizing effect (Figure 1C). We selected the top ten percent with 117 FAPs from radiosensitizing enhancement ratio as potential targets for further filtering and selection.

Results

Figure 5.1. 3DHT-esiRNAs against focal adhesion proteins of pancreatic cancer cell line. (A) 3D tumoroid forming ability in unirradiated condition (B) 3D tumoroid forming ability upon 6 Gy X-ray irradiation (C) Radiosensi- tizing enhancement ratio (>1 = radiosensitization; 1 = no effect; <1 = radioprotection). All results show mean ± SD

(n=3, n.s.= no significant difference,* P<0.05, ** p<0.01, *** p<0.001) (Jin et al., 2019).

5.1.2. Top ranking candidates’ expression analysis on publicly available data

To validate the potential regulator of PDAC cell radioresistance, here, we nominated the candidates based on the following criteria: novelty in the context of radiosensitivity, current knowledge about the candidates and, expression level in PDAC compared to normal tissue based on publicly available database such as Oncomine and TCGA.

The mRNA expression level in human PDAC patients was analyzed by using Oncomine database. The top ten percent with 117 FAPs from radiosensitizing enhancement ratio was analyzed (Table 5.1). Among them, β8 integrin (ITGB8) and PINCH1 (LIMS1) drew our attention. β8 integrin, a type I transmembrane protein and forms heterodimer with αV integrin (Moyle et al., 1991; Nishimura et al., 1994), is highly overexpressed in human PDAC patients about 3.1 folds to the control samples (Figure2A). The mRNA expression in human PDAC patients of PINCH1, a regulator of FA function (Legate et al., 2006), slightly lower than β8 integrin, is three folds to the control samples (Figure 2B). Next, the OncoLnc database was used to analyze the mRNA expression level link to PDAC patients' prognosis (Table 5.2). The median survival of β8 integrin higher expression group is 517 days, and the lower group is 652 days, which shows higher β8 integrin expression level links to poor prognosis (Figure 2C). A similar result in PINCH1 expression level links to PDAC patient prognosis. The higher expression group's median survival is 592 days, and the lower group is 634 days (Figure 2D).

To sum up, the analysis based on the criteria we mentioned above, β8 integrin and PINCH1 show the most potential candidates for further validation.

Results

Figure 5.2. ITGB8 and LIMS1 mRNA expression in PDAC patients. (A) Comparative mRNA expression analysis of ITGB8 and (B) LIMS1 between normal pancreas and PDAC using Oncomine data base (Badea et al., n.d.). (C) Kaplan Meier survival analysis of PDAC patients with low and high β8 integrin (ITGB8) expressing tumours. (D) Kaplan Meier survival analysis of PDAC patients with low and high PINCH1 (LIMS1) expressing tumours. Curves were generated using the Oncolnc database (http://www.oncolnc.org/) (Jin et al., 2019).

Results

Table 5.1. The mRNA expression level of the top ten percent most potential candidates’ data from Oncomine database (https://www.oncomine.org/).

Gene name Protein name Fold change P valve

No. of patients (N=78)

FBLIM1 Migfilin 1.577 2.53E-9

ITGB8 β8 integrin 3.095 4.80E-8

PARVA α Parvin 1.451 7.80E-7

ITGAD αD integrin -1.207 0.99

C20ORF42 Kindlin 1 3.269 2.34E-9

ITGAX αX integrin 1.352 2.17E-5

CFL1 Cofilin 1.757 1.01E-7

SVIL Supervillin 2.351 1.263E-9

THY1 CD90 4.023 1.54E-15

VCL Vinculin 2.15 2.95E-9

PLEKHC1 Kindlin 2 2.584 2.81E-7

LIMS1 PINCH 1 3.036 7.30E-11

Results

Table 5.2. The prognosis of the top 10 percent most potential candidates in comparison to low and high expression in PDAC patients from Oncolnc database (http://www.oncolnc.org).

Gene name Protein name Prognosis (Days) P valve

Low High No. of patients (104)

FBLIM1 Migfilin 652 691 0.745

ITGB8 β8 integrin 652 517 0.0421

PARVA α Parvin 732 598 0.104

ITGAD αD integrin 485 596 0.0869

C20ORF42 Kindlin 1 1059 517 0.00176

ITGAX αX integrin 607 634 0.831

CFL1 Cofilin 1502 511 0.0287

SVIL Supervillin 532 598 0.556

THY1 CD90 593 592 0.399

VCL Vinculin 1059 518 0.0037

PLEKHC1 Kindlin 2 661 596 0.647

LIMS1 PINCH 1 634 592 0.0213

5.2 Secondary validation in PDAC cell line panel

5.2.1 PINCH1 and β8 integrin expression in PDAC cells

First, we investigated the protein expression level of β8 integrin and PINCH1 in six commercial PDAC cell lines (BxPC3, Capan-1, COLO357, MiaPaCa2, Panc-1, Patu8902) and three patient-derived cell lines (PDC) (PacaDD119, PacaDD137, and PacaDD159) in an IrECM 3D tumoroid culture condition and examined the expression by Western blot (Figure 5.3. A and C) and quantified protein expression level by using densitometry analysis (Figure 5.3. B and D). All the panel's cell lines expressed β8 integrin and PINCH1, but the expression level is heterogeneous. BxPC3, Capan-1, COLO357, MiaPaCa2, and Panc-1 showed lower PINCH1 expression levels compare to other cell lines. BxPC3, Capan1, MiaPaCa2, showed lower β8 integrin expression level compare to other cell lines.

Results

Figure 5.3. PINCH1 and β8 integrin expression level in pancreatic cancer cell lines. (A) Western blot of PINCH1 expression level in whole cell lysates. β actin served as loading control. (B) Densitometry analysis of PINCH1 by using Image J. (C) Western blot of β8 integrin expression level in whole cell lysates. β actin served as loading control. (D) Densitometry analysis of β8 integrin by using ImageJ. All results show mean ± SD (n=3) (Jin et al., 2019).

5.2.2 Analysis of radiosensitivity upon PINCH1 silencing in PDAC cells

To verify the role of PINCH1 in regulating radioresistance in PDAC, we silenced PINCH1 in a panel of PDAC cell lines. How an efficient esiRNA-medicated PINCH1 depletion was detected by Western blot (Figure 5.4. A) and densitometry (Figure 5.4. B). EsiRNA-medicated PINCH1 depletion slightly affected 3D tumoroid forming ability (Figure 5.4. C), but significantly decreased 3D tumoroid forming ability upon 6 Gy irradiation (Figure 5.4. D) compared with cells treated with nonspecific esiRNA controls in BxPC3, Capan1, MiaPaCa2, and PacaDD137 cell lines.

Results

Figure 5.4. PINCH1 controls sensitivity to ionizing radiation in pancreatic cancer cell lines. (A) Western blot of esiRNA-mediated PINCH1 depletion in PDAC cells lines in whole cell lysates and (B) densitometry analysis. β actin served as loading control. (C) 3D tumoroid forming ability after esiRNA-mediated PINCH1 depletion in PDAC cells lines and (D) relative 3D tumoroid forming ability upon 6 Gy x-ray irradiation. (E) Representative phase contrast images of 3D tumoroid. Scale bar, 200 µm. All results show mean ± SD (n=3, * P<0.05, **P<0.01).

Results

5.2.3 Analysis of radiosensitivity upon β8 integrin silencing in PDAC cells

Next, to examine β8 integrin's essential role in PDAC radioresistance, we silenced β8 integrin in a panel of PDAC cell lines. How an efficient esiRNA-medicated β8 integrin depletion was detected by Western blot (Figure 5.5. A) and densitometry (Figure 5.5. B). EsiRNA-medicated β8 integrin depletion slightly affected 3D tumoroid forming ability (Figure 5.5. C), but significantly decreased 3D tumoroid forming ability upon 6 Gy irradiation (Figure 5.5. D) in comparison to cells treated with nonspecific esiRNA controls. Intriguingly, the tumoroid forming ability is dramatically decreased upon β8 integrin depletion with 6 Gy irradiation all the cell lines in our panel, suggesting that β8 integrin depletion induced radiosensitizing effect is a more common phenomenon in 3D IrECM based tumoroid culture system.

Results

Figure 5.5. β8 integrin controls sensitivity to ionizing radiation in pancreatic cancer cell lines. (A) Western blot of esiRNA-mediated β8 integrin depletion in PDAC cells lines in whole cell lysates and (B) densitometry analysis. β actin served as loading control. (C) 3D tumoroid forming ability after esiRNA-mediated β8 integrin depletion in PDAC cells lines and (D) relative 3D tumoroid forming ability upon 6 Gy x-ray irradiation. (E) Representative phase contrast images of 3D tumoroid. Scale bar, 200 µm. All results show mean ± SD (n=3, * P<0.05, **P<0.01, *** P<0.001) (Jin et al., 2019).

Results

Besides that, we found that β8 integrin depletion shows a radiosensitizing effect in both BxPC3 and Patu8902 cells 3D tumoroid forming ability in a dose-dependent manner (Figure 5.6. A and B). Similar result was observed in 2D clonogenic assay. (Figure 5.6. C, D, and E).

To recapitulate the results based on esiRNA-medicated gene depletion in 2D clonogenic assays and 3D tumoroid forming ability assays, β8 integrin is essential for PDAC radioresistance in our PDAC cell line panel. Our results favored β8 integrin over PINCH1 as a novel target for sensitizing PDAC cells to ionizing radiation.

Figure 5.6. β8 integrin knockdown shows radiosensitizing effect in a dose-dependent manner. (A) 3D tumoroid forming ability after esiRNA-mediated β8 integrin depletion in BxPC3 and (B) Patu8902 cell lines and treated with x-ray in different doses (2, 4, 6 Gy) (n=3). (C) Plating efficiency of β8 integrin knockdown in BxPC3 cell culture, and (D) survival fraction upon 6 Gy x-ray irradiation. (E) Representative phase contrast images of colony formation assay (n=1). All results show mean ± SD. (* P<0.05, *** P<0.001) (Jin et al., 2019).

5.2.4 Analysis of chemosensitivity upon β8 integrin silencing in PDAC cells

Accordingly, β8 integrin is a critical regulator for PDAC radioresistance, but the role of β8 integrin in chemoresistance is still unclear. Here, we tested the IC50 of gemcitabine in nonspecific esiRNA control and upon β8 integrin depletion in BxPC3 and Patu8902 cells. In both cell lines, the IC50 of gemcitabine upon β8 integrin depletion was decreased (Figure 5.7. A). In BxPC3

Results

Figure 5.7. 8 integrin critically controls sensitivity chemotherapy reagent in pancreatic cancer cell lines.

(A) 3D tumoroid forming ability upon gemcitabine treatment in BxPC3 and Patu8902 cell lines. (B) IC50 values of BxPC3 and Patu8902 cells with or without 8 integrin depletion. (C) 3D tumoroid forming ability after esiRNA- mediated β8 integrin depletion in BxPC3 and Patu8902 cell lines and (D) relative 3D tumoroid forming ability upon gemcitabine IC50 treatment. (E) Representative phase contrast images of 3D tumoroid. Scale bar, 200 µm. All results show mean ± SD (n=3, *** P<0.001) (Jin et al., 2019). cells, the IC50 of gemcitabine in nonspecific esiRNA control was 6.8 ± 4.14 nM and upon β8 integrin depletion was 4.47 ± 0.76 nM about 22 % less, in Patu8902 cells the IC50 of gemcitabine in nonspecific esiRNA control was 31.66 ± 9.56 nM and upon β8 integrin depletion was

13.04 ± 6.75 nM about 57 % less (Figure 5.7. B). Next, we treated the cells with their IC50 of gemcitabine in nonspecific esiRNA control to examine the chemosensitizing effect upon β8 integrin depletion. Tumoroid formation ability significantly showed about 60 % less in BxPC3 cells and about 70 % less in Patu8902 cells upon gemcitabine treatment esiRNA mediated β8

Results

integrin depletion (Figure 5.7. C, D, and E). These findings demonstrated that β8 integrin depletion not only increased radiosensitization, but also increased chemosensitization.

5.2.5 Analysis of stemness upon β8 integrin silencing in PDAC cells

Cancer stem cells (CSCs) are a subset of tumor cells with similar characteristics to normal tissue stem cells, such as self-renew ability, pluripotent, and capable of forming a tumor (Matsuda et al., 2012). CSCs also show strong resistance to chemo- and radiotherapy. Re- cently studies have shown that β8 integrin depletion declined the stemness and migration ability in glioblastoma cells (Guerrero et al., 2017; Malric et al., 2018). Here, we assessed the stemness by using sphere formation assay (SFA).

To study the mechanistic role of PDAC radiochemosensitizing effect upon β8 integrin depletion, we performed SFA based on CSCs’ self-renew ability in a non-adherent and serum-free condition to investigate the stemness upon different treatment (Tyagi et al., 2016; Swayden et al., 2018). First, we tested sphere formation ability in our PDAC cell line panel in CSCs medium. After seven days of incubation, BxPC3, COLO357, Patu8902, PacaDD137 cell lines could form spheres (Figure 5.8. A). Next, we chose BxPC3 and Patu8902 cell lines to further examine the stemness upon β8 integrin depletion.

β8 integrin depletion in both cell lines showed decreased sphere formation ability (Figure 5.8. B and C), specifically in Patu8902 cells, β8 integrin depletion significantly reduced the sphere formation, suggesting β8 integrin plays a role in PDAC stemness.

Results

Figure 5.8. β8 integrin inhibits tumor sphere formation in pancreatic cancer cell lines. (A) Representative microscopy images showing sphere formation assay in PDAC cell lines. Scale bars, 200 µm. (n=3) (B) Repre- sentative microscopy images showing sphere formation upon esiRNA-mediated β8 integrin depletion in BxPC3 and Patu8902 cell lines. Scale bars, 200 µm. (BxPC3, n=2; Patu8902, n=3,) (C) Sphere formation assay after esiRNA-mediated β8 integrin depletion in BxPC3 and Patu8902 cell lines. All results show mean ± SD (BxPC3, n=2; Patu8902, n=3, *** P<0.001).

5.2.6 Analysis of invasiveness upon β8 integrin silencing in PDAC cells

Integrins are known to be an essential player in cancer cell migration (Paul et al., 2015; Conway and Jacquemet, 2019), we consequently performed type I collagen-based 3D invasion assay in PDAC upon β8 integrin depletion. First, we tested the spheroid forming ability in a U- shape 96 well plate coated with agarose to identify which cell line is suitable for the 3D invasion

Results

assay (Figure 5.9. A). After 48 hours of incubation, we noticed that BxPC3, COLO357, Patu8902, PaCaDD137, and PaCaDD159 cell lines could form spheroid. We used BxPC3 and Patu8902 cell lines to assess the invasiveness upon β8 integrin depletion. We demonstrated that β8 integrin depletion decreased the invasion ability in type I collagen-based 3D invasion assay in both cell lines (Figure 5.9. B). The ligands for β8 integrin are laminin and vitronectin, but type I collagen is not, so we also performed 2D invasion assay in BxPC3 cell to test the migration ability upon β8 integrin depletion. A similar result was found as type I collagen-based 3D invasion assay; β8 integrin depletion reduced the migration ability in the BxPC3 cell line (Figure 5.9. C). Together, these results demonstrated β8 integrin as a potential candidate for PDAC therapeutic target, regulating PDAC radiocehmoresistance and PDAC stemness and migration ability.

Results

Figure 5.9. 8 integrin inhibits tumor cell migration. (A) Spheroid formation assay in PDAC cell lines. Scale bars, 200 µm. (n=3) (B) Representative microscopy images showing invading a 3D collagen type I matrix upon esiRNA- mediated β8 integrin depletion in BxPC3 and Patu8902 cell lines. Scale bars, 200 µm. (n=3) (C) Representative microscopy images of wound healing assay (IBIDI assay) upon esiRNA-mediated β8 integrin depletion in BxPC3 cell line. Scale bars, 200 µm. (n=1).

5.3 The location of β8 integrin in PDAC cells

5.3.1 β8 integrin is located in the perinuclear region in PDAC cells

To characterize the subcellular location of β8 integrin, immunofluorescence (IF) staining was performed in human pancreatic cancer cells. Interestingly, unlike other β integrins, we found that β8 integrin was located in the perinuclear region in BxPC3 cells (Figure 5.10. A). Recently studies have indicated that β8 integrin is highly expressed in glioblastoma (GBM), here we

Results

performed IF staining to compare the subcellular location of β8 integrin in U343MG, a commercial GBM cell line, and BxPC3 cells. In the GBM cells, β8 integrin was located on the plasma membrane and cytosol; however, in BxPC3 cells β8 integrin is in the perinuclear region (Figure 5.10. B). To confirm the subcellular location of β8 integrin in PDAC was in the perinuclear region, we performed IF staining in a panel of PDAC cell lines. All nine different PDAC cell lines staining showed that β8 integrin is in the perinuclear region (Figure 5.10. C). Although we confirmed that the subcellular location of β8 integrin is in the perinuclear region by IF, more examination needs to be done. Here we performed protein fractionation and Western blot to assess the subcellular location of β8 integrin in PDAC (Figure 5.10. D and E). As a result, it showed that β8 integrin was highly expressed in the cytosol and membrane fraction; neverthe- less, there was no plasma membrane staining in our IF staining result. We hypothesized that β8 integrin is located in membranous organelles, such as Golgi apparatus, near the nucleus with an unknown function that can regulate PDAC radiochoemoresistance.

Results

Figure 5.10. β8 integrin localization in cancer cell lines. (A) Comparison of the localization of β1 integrin (green) and β8 integrin (green) in BxPC3 cells. Scale bars, 10 µm. Phalloidin, red; nucleus, blue. (B) Comparison of the localization of β8 integrin in BxPC3 and U343MG cell lines. Scale bars, 10 µm. Phalloidin, red; nucleus, blue. (C) Subcellular localization of β8 integrin in pancreatic cancer cell lines (BxPC3, Capan-1, COLO357, MiaPaCa2, Panc- 1, Patu8902, PacaDD119, PacaDD137, PacaDD159 using immunofluorescence (IF) staining. Scale bars, 10 µm. β8 integrin, green; phalloidin, red; nucleus, blue. (D) Western blotting of β8 integrin expression level in different cell fractions. MEK1/2, β1 integrin, γH2AX served as cytosol, membrane and nucleus markers. (E) Densitometry analysis of β8 integrin expression level in different cell fractions. All results show mean ± SD (n=3) (Jin et al., 2019).

5.3.2 Subcellular localization of β8 integrin in PDAC cells

To elucidate the subcellular location of β8 integrin, we performed co-staining with β8 integrin and GM130, mitotracker, APPL2, αV integrin, and caveolin 1 (Figure 5.11. A). We analyzed

Results

the Pearson’s correlation coefficient by using Fiji software, which showed the subcellular location of β8 integrin was correlated with GM130 (0.55 ± 0.04) (Figure 5.11. B). However, the colocalization of proteins by IF does not necessarily mean interaction. Next, we performed proximity ligation assay (PLA), a multi-step technique to detect the proximity protein interaction, to examine β8 integrin and GM130 protein interaction. We confirmed the interaction of β8 integrin and GM130 in BxPC3 cell, and the secondary antibody only serves as negative control (Figure 5.11. C). In the PLA, we observed β8 integrin and GM130 associated in the perinuclear region indicating by red dot. Altogether, these data demonstrated that β8 integrin was located in the perinuclear region and interacted with GM130.

Results

Figure 5.11. β8 integrin co-localization in pancreatic cancer cells. (A) Comparison of the co-localization of β8 integrin in BxPC3 cells (n=3). Scale bars, 10 µm. (B) Pearson correlation analysis (n=3). (C) Representative microscopy images showing the β8 integrin and GM130 protein interaction by proximity ligation assay (PLA). IgG served as negative control (n=1). Scale bars, 10 µm. All results show mean ± SD (Jin et al., 2019)

5.4 β8 integrin translocated from perinuclear region to cytosol

Results

upon genotoxic stress

5.4.1 Subcellular localization of β8 integrin upon 6 Gy irradiation in PDAC cells

We observed that β8 integrin was located at the perinuclear region and associated with GM130; however, the location of β8 integrin upon 6 Gy irradiation is still unknown. We detected the β8 integrin positive particle via immunofluorescence staining (Figure 5.12. A, B, and C).

Under the normal condition, β8 integrin was located in the perinuclear region, and β8 integrin positive particle intensity was 44458.97 ± 18606.99 A.U. and the area in the cell was 3 ± 0.9 %. However, β8 integrin was transported to the cytosol and formed puncta in dynamic upon 6 Gy irradiation. Two hours after 6 Gy irradiation, the β8 integrin positive particle intensity increased to 123570.5 ± 65692.16 A.U. and the area in the cell was 15.9 ± 0.2 %, showing that β8 integrin was transporting. Twenty-four hours after 6 Gy irradiation, the β8 integrin positive particle intensity decreased to 44722.83 ± 28949.61 A.U. and the area in the cell was 6 ± 0.14 %, which suggested the translocation of β8 integrin could have an unknown function to recuse the PDAC cells upon irradiation-mediated stress response.

Results

Figure 5.12. β8 integrin subcellular location alters from perinuclear area to cytosol upon 6 Gy x-ray irradiation. (A) Subcellular localization of β8 integrin immunofluorescence (IF) staining in BxPC3 cells upon 6 Gy x-ray irradiation. Scale bars, 10 µm. β8 integrin, green; phalloidin, red; nucleus, gray.(B) Quantitative of β8 integrin positive puncta intensity. (C) β8 integrin positive puncta area ratio in the cell. Data are representative of 50 cells each condition. All results show mean ± SD (n=3, * P<0.05, *** P<0.001).

Results

5.4.2 Subcellular localization of β8 integrin upon gemcitabine treatment in PDAC cells

We observed that the translocation of β8 integrin positive particle upon 6 Gy x-ray irradiation mediated genotoxic stress, but the behavior upon gemcitabine treatment is still unknown. To investigate how β8 integrin reacts to gemcitabine mediated stress responses, we performed the immunofluorescence staining to detect the β8 integrin positive particle upon gemcitabine treatment (Figure 5.13. A, B, and C).

Interestingly, a similar result was found upon gemcitabine treatment. Under the normal condition, β8 integrin was located in the perinuclear region, and β8 integrin positive particle intensity was 27899.27 ± 4108.107 A.U., and the area in the cell was 3.4 ± 0.6 %. However, β8 integrin was transported to the cytosol and formed puncta in dynamic upon gemcitabine treatment. Two hours after gemcitabine treatment, the β8 integrin positive particle intensity increased to 131816.9 ± 84806.41 A.U. and the area in the cell was 19.5 ± 1.3 %. Twenty-four hours after gemcitabine treatment, the β8 integrin positive particle intensity decreased to 132821.5 ± 84806.41 A.U. and the area in the cell was 9.9 ± 2.7 %. Accordingly, we observed that in both stimulations, β8 integrin must have an unknown rescue function in the cytosol in PDAC cells.

Results

Figure 5.13. β8 integrin subcellular location alters from perinuclear area to cytosol upon gemcitabine treatment. (A) Subcellular localization of β8 integrin immunofluorescence (IF) staining in BxPC3 cells upon gemcitabine treatment. Scale bars, 10 µm. β8 integrin, green; Phalloidin, red; nucleus, gray. (B) Quantitative of β8 integrin positive puncta intensity. (C) β8 integrin positive puncta area ratio in the cell. Data are representative of 50 cells each condition. All results show mean ± SD (n=3, * P<0.05, *** P<0.001).

Results

5.4.3 β8 integrin positive exosome increased upon 6 Gy irradiation in PDAC cells

We noticed that β8 integrin positive particle translocated upon 6 Gy irradiation, we hypothesized that β8 integrin could be secreted by exosome upon stress condition.

First, we collected the condition medium from PDAC cells with or without 6 Gy irradiation. We observed that β8 integrin could be found in both conditions by performing dot blot to examine the secretion of β8 integrin (Figure 5.14. A). Recently research has shown that β8 integrin can be identified in the exosome in the cancer cells and urine samples (Gonzales et al., 2009; Liang et al., 2013; Lazar et al., 2015). The dot blot result showed that in the condition medium could detect CD81, HSP70, known exosomal component marker proteins, and β8 integrin in different dilution (Figure 5.14. B), which suggested that the secretion of β8 integrin via exosome. Next, to assess this hypothesis, we collected the condition medium from PDAC cells with or without 6 Gy irradiation, isolated the exosome by using exosomal isolation reagent and performing Western blot to detected the expression of β8 integrin and exosome markers. Not only β8 integrin but also HSP70, can be detected in the exosome fraction isolated from condition medium; however, GM130, a Golgi apparatus matrix protein, served as whole cell lysate control cannot be found in the exosome fraction, indicating no cell protein contamination (Fig- ure 5.14. C). Although we observed the expression of β8 integrin in the exosome, unfortunately, there is no significant difference of β8 integrin secretion by exosome in comparison to normal and stress conditions by the densitometry (Figure 5.14. D).

Results

Figure 5.14. Secretion of β8 integrin in pancreatic cancer cells. (A) Comparison of β8 integrin secretion from Patu8902 condition medium in normal cell condition (Unirradiated, Un-IR) and upon 6 Gy x-ray irradiation using dot blot (n=1). (B) Comparison of the component from Patu8902 condition medium in normal cell condition (Unirradiated, Un-IR) with different dilution (n=1). (C) Western blot of exosome isolated from Patu8902 condition medium. CD81, HSP70 served as exosome markers. (D) densitometry analysis (n=3). All results show mean ± SD (Jin et al., 2019).

5.4.4 Changes in the composition of the β8 integrin interactome to transport, catalysis and binding upon irradiation

To define the proteins, interact with β8 integrin with or without irradiation, a mass spectrometry- based immuno-precipitation proteomics (IP-MS) was used to analyze the β8 integrin interactome. GO analysis was performed based on these differential proteins according to protein analysis through evolutionary relationships (PANTHER) database. To identify the proteins interacted with β8 integrin, we omitted the proteins identified in the normal rabbit IgG from the list of proteins identified in β8 integrin pull down.

738 proteins were quantified; among them, 133 proteins were associated with β8 integrin in the unirradiated condition. Intriguingly, proteins associated with β8 integrin in the two hours

Results

after 6 Gy x-ray irradiated condition was dramatically increased to 637 proteins, and only 32 proteins were associated with β8 integrin in both conditions (Figure 5.15.A). We annotated the function of 738 proteins using PANTHER database and categorized it to protein classes, molecular functions, cellular components, and biological processes.

We compared the protein number in the unirradiated condition versus 6 Gy x-ray irradiated condition. In the protein classes, the number of interacting proteins was categorized into 23 different groups (Figure 5.15.B). The largest group of β8 integrin interactome was nucleic acid binding proteins: 26 of these were in the unirradiated condition; 6 Gy x-ray irradiated condition was increased to 68. The second group was hydrolase: eleven of these were protease in the unirradiated condition; 6 Gy x-ray irradiated condition was increased to 26, one was phospha- tase in the unirradiated condition; 6 Gy x-ray irradiated condition was increased to eight. Intri- guingly, there were four deaminases in 6 Gy x-ray irradiated condition, one esterase, lipase, and pyrophosphatase increased to unirradiated condition. Another highly represented group was cytoskeletal proteins: five of these were microtubule family cytoskeletal protein in the unirradiated condition; 6 Gy x-ray irradiated condition was increased to 23, two of these were actin family cytoskeletal protein in the unirradiated condition; 6 Gy x-ray irradiated condition was increased to 16 (Table 5.3.).

Table 5.3. β8 integrin interactome analysis by protein class via PANTHER database (http://www.pantherdb. org/).

Number of proteins

Protein class Unirradi- Unirradiated ated+6 Gy x- 6 Gy x-ray ray

nucleic acid binding (PC00171) 25 9 68

hydrolase (PC00121) 15 4 58

cytoskeletal protein (PC00085) 8 5 43

Results

Number of proteins

Protein class Unirradi- Unirradiated ated+6 Gy x- 6 Gy x-ray ray

enzyme modulator (PC00095) 14 3 40

transferase (PC00220) 4 2 37

oxidoreductase (PC00176) 4 3 31

transporter (PC00227) 3 0 29

membrane traffic protein (PC00150) 5 0 15

receptor (PC00197) 2 0 15

signaling molecule (PC00207) 6 1 14

calcium-binding protein (PC00060) 3 0 12

ligase (PC00142) 2 1 11

transcription factor (PC00218) 7 0 10

lyase (PC00144) 2 2 10

isomerase (PC00135) 2 2 9

Results

Number of proteins

Protein class Unirradi- Unirradiated ated+6 Gy x- 6 Gy x-ray ray

transfer/carrier protein (PC00219) 1 0 8

cell junction protein (PC00070) 1 1 8

chaperone (PC00072) 1 1 6

defense/immunity protein (PC00090) 1 0 5

cell adhesion molecule (PC00069) 0 0 3

extracellular matrix protein (PC00102) 1 0 2

structural protein (PC00211) 1 0 2

transmembrane receptor regula- 1 1 1 tory/adaptor protein (PC00226)

Next, we also categorized the β8 integrin interactome according to the molecular functions, cellular component, and biological process. Proteins identified in the β8 integrin interactome were divided into nine categories of varying molecular functions (Table 5.4.), with the majority having binding and catalytic activity. In the binding activity group, 55 of these were in the unirradiated condition, and the proteins were increased to 188 in the 6 Gy x-ray irradiated

Results

Table 5.4. β8 integrin interactome analysis by molecular function via PANTHER database.

Number of proteins Protein class Unirradiated+6 Unirradiated 6 Gy x-ray Gy x-ray

binding (GO:0005488) 55 16 188

catalytic activity (GO:0003824) 24 7 166

transporter activity (GO:0005215) 2 0 42

structural molecule activity (GO:0005198) 8 6 34

molecular function regulator (GO:0098772) 3 1 31

molecular transducer activity 3 1 19 (GO:0060089)

transcription regulator activity 4 0 5 (GO:0140110)

translation regulator activity (GO:0045182) 0 0 2

cargo receptor activity (GO:0038024) 0 0 1

Results

Figure 5.15. IP-MS shows β8 integrin interactome changed upon 6 Gy x-ray irradiation. (A) β8 integrin interactome number changes post 6 Gy x-ray irradiation two hours. (B) The protein number of β8 integrin interactome annotates for protein class (Jin et al., 2019). condition. The second group was catalytic activity, twenty-four of these were in the unirradiated condition, and the proteins were increased to 166 in the 6 Gy x-ray irradiated condition. After

Results

comparing the components in both unirradiated and 6 Gy x-ray irradiated conditions, we found several motor proteins interacted with β8 integrin upon 6 Gy x-ray irradiation might explain the translocation of β8 integrin upon genotoxic stresses. For instance, kinesin family member 4A (KIF4A), related to anterograde axonal transport (Sekine et al., 1994), Dynein axonemal heavy chain 10 (DNAH10), on microtubule motor activity (Gaudet et al., 2011) and myosin VC (MYO5C), pertaining to actin-based membrane trafficking and exosome release (Rodriguez and Cheney, 2002; Principe et al., 2013) were found in the β8 integrin interactome upon 6 Gy x-ray irradiation.

Proteins identified in the β8 integrin interactome were divided into eight categories of cellular component (Table 5.5.), with the majority being involved in the cell part and organelle. In the cell part group, 45 of these were in the unirradiated condition, and the proteins were increased to 239 in the 6 Gy x-ray irradiated condition. The second group was in the organelle group, 32 of these were in the unirradiated condition, and the proteins were increased to 105 in the 6 Gy x-ray irradiated condition. Intriguingly, our previous results revealed β8 integrin was located in the perinuclear region and associated with GM130, indicating that β8 integrin may identify in the Golgi apparatus. We found ten proteins belong to Golgi apparatus in the unirradiated condition, and the proteins were increased to 34 in the 6 Gy x-ray irradiated condition (Table 5.6.). Among them, several proteins are related to intracellular trafficking, such as, coatomer subunit epsilon (COPE) was found in the unirradiated condition. Transmembrane emp 24 domain trafficking protein 2 (TMED2), Golgi brefeldin A resistant guanine nucleotide exchange factor 1 (GBF1), ADP-ribosylation factor 3 (ARF3), ER lumen protein-retaining receptor 2 (KDELR2), and exocyst complex component 7 (EXOC7) were found in the 6 Gy x-ray irradiated condition. Ras-associated protein RAB8 (RAB8A), a small GTPase, was found upon 6 Gy x-ray irradiated condition, played an essential role in the intracellular protein transport and control autophagy flux by forming a complex with C9ORF72 and RAB39B (Nachury et al., 2007; Gaudet et al., 2011; Webster et al., 2018).

Table 5.5. β8 integrin interactome analysis by cellular component via PANTHER database.

Number of proteins Protein class Unirradiated+6 Unirradiated 6 Gy x-ray Gy x-ray

cell (GO:0005623) 45 16 239

Results

Number of proteins Protein class Unirradiated+6 Unirradiated 6 Gy x-ray Gy x-ray

organelle (GO:0043226) 32 9 105

protein-containing complex (GO:0032991) 27 11 78

membrane (GO:0016020) 13 1 43

supramolecular complex (GO:0099080) 3 1 14

extracellular region (GO:0005576) 14 1 12

cell junction (GO:0030054) 2 1 11

synapse (GO:0045202) 1 0 6

Proteins identified in the β8 integrin interactome were divided into 14 categories of biological process (Table 5.8.), with the majority being involved in the metabolic process and biological regulation. In the metabolic process group, 35 of these were in the unirradiated condition and the proteins were increased to 170 in the 6 Gy x-ray irradiated condition. The second group was in the biological regulation group, 23 of these were in the unirradiated condition and the proteins were increased to 116 in the 6 Gy x-ray irradiated condition. RNA-Binding Motif Pro- tein, X Chromosome (RBMX), an RNA-binding protein, was found in the unirradiated condition, regulating autophagy related genes expression (Türei et al., 2015).

Table 5.6. β8 integrin interactome associated with Golgi apparatus in the unirradiated condition.

Protein Hits Molecular weight IgG β8 integrin RGPD3 0 1352100 197 kDa RGPD4 0 1352100 197 kDa

Results

SNX15 0 547050 38 kDa DPY19L2 0 366620 87 kDa COPE 0 131830 34 kDa MTTP 0 124990 99 kDa GOLGA8S 0 82333 48 kDa GOLGA8CP 0 82333 67 kDa GOLGA8DP 0 82333 48 kDa GOLGA8 KDA 0 82333 48 kDa

Table 5.7. β8 integrin interactome associated with Golgi apparatus upon 6 Gy x-ray irradiation.

Protein Hits Molecular weight IgG β8 integrin DAD1 0 811010 125 kDa TINAG 0 611040 55 kDa AR KDA4 0 369280 205 kDa NUT KDA2 0 324460 145 kDa GOLGA8M 0 294620 71.5 kDa GOLGA8IP 0 294620 71 kDa TSPO 0 247910 10.5 kDa RAB8A 0 212820 24 kDa RHBD KDA2 0 201170 97 kDa DPM1 0 199850 30 kDa SUM KDA1 0 189870 40.5 kDa DENND6B 0 177150 66 kDa TMED2 0 163500 23 kDa AR KDA5 0 158750 20.5 kDa CYP51A1 0 142580 57 kDa SEC22B 0 120520 25 kDa ND KDAIP1 0 114960 25 kDa DHCR7 0 96507 54 kDa HSPBP1 0 86360 39 kDa DNAJC28 0 84556 46 kDa KPNA1 0 80474 60 kDa KPNA5 0 80474 60 kDa KPNA6 0 80474 60 kDa KPNA4 0 71387 58 kDa KPNA3 0 71387 58 kDa UNC93B1 0 70816 67 kDa SEC61B 0 62437 10 kDa

Results

APMAP 0 61345 46 kDa CHMP3 0 53784 25 kDa KDELR2 0 48991 24 kDa ANKRD27 0 34307 117 kDa SEC13 0 27958 35.5 kDa NUP37 0 24345 37 kDa SEC23A 0 15525 86 kDa KLK10 0 8638.3 30 kDa

After analyzing the β8 integrin interactome in both unirradiated and 6 Gy x-ray irradiated condition, we found several protein complexes associated with β8 integrin, which can explain what we observed in the previous results. (i) β8 integrin is associated with several Golgi apparatus organization proteins in both unirradiated and 6 Gy x-ray irradiated condition. (ii) Among them, several proteins were associated with GM130, which could emphasize our previous results that β8 integrin located in the perinuclear region and interacted with GM130. (iii) We found upon 6 Gy x-ray irradiated condition, β8 integrin was associated with intracellular trafficking relate proteins, such as actin-related protein 2/3 complex subunit 5 (ARPC5), a component of the Arp2/3 complex, regulating actin filament network formation and endocytosis (Pollard, 2007). ADP-ribosylation factor 3 (ARF3), ADP-ribosylation factor 4 (ARF4) and ADP-ribosylation factor 5 (ARF5), ADP-ribosyltransferase, were found in the 6 Gy x-ray irradiated condition, involved in protein transport from the ER to the Golgi and the plasma membrane (Stearns et al., 1990; Stamnes and Rothman, 1993; Boman et al., 2000; Yu et al., 2014). Moreover, several COPII vesicle coating proteins, such as sec1 family domain containing 1 (SCFD1), vesicle- trafficking protein SEC22b (SEC22B), protein SEC13 homolog (SEC13), and protein transport protein SEC23A (SEC23A) were found in the 6 Gy x-ray irradiated condition. These proteins are membrane trafficking regulatory proteins which involved in COPII vesicle coating and transport proteins from ER (Swaroop et al., 1994; Paccaud et al., 1996; Bando et al., 2005; Mancias and Goldberg, 2007; Mancias and Goldberg, 2008; Gaudet et al., 2011; Renna et al., 2011). Intriguingly, vacuolar protein sorting-associated protein 4A (VPS4A) was found in the 6 Gy x-ray irradiated condition. VPS4A, an ATPases associated with diverse cellular activities (AAA) protein, is a component of endosomal sorting complex required for transport complex III (ESCRT-III) (Scheuring et al., 2001; Metcalf and Isaacs, 2010; Gu et al., 2017). VPS4A is involved in the late steps of the endosomal multivesicular bodies (MVB) (Hurley and Hanson, 2010). (iv) We also observed that there are several proteins associated with β8 integrin involved in exosome, such as heat shock protein beta-1 (HSPB1) in both unirradiated and 6 Gy x-ray irradiated condition, annexin A2 (ANXA2), CD9, CD44, heat shock 70 kDa protein 1-like

Results

(HSPA1L), Hsp70-binding protein 1 (HSPBP1), and tetraspanin-10 (TSPAN10) in the 6 Gy x- ray irradiated condition.

To sum up, based on our β8 integrin IP-MS results, the proteins associated with β8 integrin are related to the endomembrane system and play essential roles in responding to stress and maintain cellular hemostasis.

Table 5.8. β8 integrin interactome analysis by the biological process via PANTHER database.

Number of proteins

Protein class Unirradi- Unirradiated ated+6 Gy x- 6 Gy x-ray ray

metabolic process (GO:0008152) 35 10 170

biological regulation (GO:0065007) 23 0 116

cellular component organization or bio- 33 13 110 genesis (GO:0071840)

localization (GO:0051179) 20 4 77

cellular process (GO:0009987) 20 3 73

developmental process (GO:0032502) 4 1 39

multicellular organismal process 11 4 31 (GO:0032501)

response to stimulus (GO:0050896) 8 0 23

biological adhesion (GO:0022610) 9 5 14

signaling (GO:0023052) 2 0 10

growth (GO:0040007) 0 0 6

immune system process (GO:0002376) 5 1 6

Results

Number of proteins

Protein class Unirradi- Unirradiated ated+6 Gy x- 6 Gy x-ray ray

multi-organism process (GO:0051704) 0 0 4

reproduction (GO:0000003) 5 0 4

biological phase (GO:0044848) 0 0 2

cell proliferation (GO:0008283) 0 0 2

rhythmic process (GO:0048511) 0 0 1

5.5 Fluorescence-microscopy-based screen identifies small-molecule chemical compounds to block β8 integrin translocation upon genotoxic stress in PDAC cells

5.5.1 The fluorescence-microscopy-based screen upon 6 Gy irradiation

We performed a small molecule chemical compounds screening, to investigate the regulators for the translocation of β8 integrin in pancreatic cancer cells upon genotoxic stress. Here, we pretreated the cells with a list of small molecule chemical compounds, which can be categorized to polymerase inhibitor (aphidicolin), kinase inhibitors (DDR1-IN, erlotinib, imatinib, KU55933, Ly294002, PD98059, PF00573228, SB203580, SP600125, TAE226, UO126), anti- oxidants (carboxy-PTIO and MuTBAP), autophagy inhibitors (bafilomycin A1 and chloroquine), ATP synthase inhibitors (antimycin A and oligomycin), known ligand for β8 integrin (latent TGF- β1) and cytoskeletal inhibitor (latrunculin B, colchicine and paclitaxel). After the pretreatment, cells were irradiated with 6 Gy x-ray or treated with gemcitabine and incubated for two hours at the incubator. Cells were performed IF staining with β8 integrin and analyzed the β8 integrin positive particle intensity and the area in the cell by Fiji software upon genotoxic stress.

In the 6 Gy x-ray irradiation mediated stress condition, we separated the screening results into three groups, (1) increasing the β8 integrin positive particle area in the cell upon 6 Gy x-ray

Results

irradiation, erlotinib, aphidicolin, TAE226, PF00573228, Ly294002, PD98059, MuTBAP, imatinib, SB203580, and bafilomycin A1 are in this group, (2) no different, latent TGF-β1, UO126, DDR1-IN, carboxy-PTIO, chloroquine, KU55933, and SP600125 are in this group, and (3) decreasing, paclitaxel, latrunculin B, antimycin A, oligomycin and colchicine are in this group. We noticed that the compounds that could reduce the β8 integrin positive particle area in the cell belong to cytoskeletal inhibitors and ATP synthase inhibitors.

Results

Figure 5.16. The fluorescence-microscopy-based screen upon 6 Gy x-ray irradiation in pancreatic cancer cell line. (A) Subcellular localization of β8 integrin immunofluorescence (IF) staining in BxPC3 cells pretreated with small molecule chemical compounds upon 6 Gy x-ray irradiation. Data are representative of 100 cells each condition. Scale bars, 10 µm. β8 integrin, green; nucleus, gray (B) Quantitative of β8 integrin positive puncta intensity. (C) β8 integrin positive puncta area ratio in the cell. +, β8 integrin positive puncta area increased upon compound treatment; N, no effect; -, β8 integrin positive puncta area decreased. All results show mean (n=1).

5.5.2 The fluorescence-microscopy-based screen upon gemcitabine treatment

Accordingly, we found that cytoskeletal inhibitors and ATP synthase inhibitors can disturb the translocation of β8 integrin upon 6 Gy x-ray irradiation mediated stress, but which compounds can block the translocation of β8 integrin upon gemcitabine mediated stress is still unknown. Here, we also performed the screen in the gemcitabine mediated stress condition. We also separated the screening results into three groups, (1) increasing the β8 integrin positive particle area in the cell upon gemcitabine mediated stress, SB203580, TAE226, MuTBAP, aphidicolin, erlotinib, PF00573228, SP600125, UO126, imatinib, and bafilomycin A1 are in this group, (2) no different, PD98059, Ly294002, carboxy-PTIO, DDR1-IN, and latent TGF-β1 are in this group, and (3) decreasing, KU55933, chloroquine, paclitaxel, antimycin A, latrunculin B, oligomycin, and colchicine are in this group. Intriguingly, the compounds can reduce the β8 integrin positive particle area in the cell are belongs to cytoskeletal inhibitors and ATP synthase inhibitors.

Results

Figure 5.17. The fluorescence-microscopy-based screen upon gemcitabine treatment in pancreatic cancer cell line. (A) Subcellular localization of β8 integrin immunofluorescence (IF) staining in BxPC3 cells pretreated with small molecule chemical compounds upon gemcitabine treatment. Data are representative of 100 cells each condition. Scale bars, 10 µm. β8 integrin, green; nucleus, gray (B) Quantitative of β8 integrin positive puncta intensity. (C) β8 integrin positive puncta area ratio in the cell. +, β8 integrin positive puncta area increased upon compound treatment; N, no effect; -, β8 integrin positive puncta area decreased. All results show mean (n=1).

A scatter plot was created to summarize the results from the fluorescence-microscopy-based screen upon 6 Gy x-ray irradiation or gemcitabine mediated stress. This plot showed that colchicine, oligomycin, latrunculin B, antimycin A, and paclitaxel could block the translocation of β8 integrin in both genotoxic stresses (Figure5.18.). We used the β8 integrin interactome upon 6 Gy x-ray irradiation to category proteins according to the protein class, which belongs to cytoskeletal proteins, motor proteins, intracellular trafficking proteins, and ATP synthases (Ta- ble 5.9.). Intriguingly, 30 of 70 proteins are cytoskeletal proteins, 13 of 70 are motor proteins, 20 of 70 proteins are intracellular trafficking proteins, and 7 of 70 are ATP synthase. Among them, F1Fo-ATPase Synthase F Subunit (ATP5J2), is the target for oligomycin, colchicine inhibits the polymerization of the microtubule, paclitaxel inhibits the depolymerization of microtubule and latrunculin B inhibits the polymerization of microfilament. To combine the results from the fluorescence-microscopy-based screen upon 6 Gy x-ray irradiation or gemcitabine

Figure 5.18. The fluorescence-microscopy-based screen upon genotoxic stress in pancreatic cancer cell line. Scatter plot of β8 integrin positive puncta area ratio upon gemcitabine treatment (x-axis) versus 6 Gy x-ray irradiation (y-axis). Cells without any treatment were labeled in blue and cells treated with gemcitabine or 6 Gy x-ray irradiation were labeled in red. All results show mean (n=1).

Results

mediated stress and the findings in the β8 integrin interactome, we concluded that the translocation of β8 integrin upon genotoxic stress is related to intracellular trafficking and can be blocked by cytoskeletal inhibitors and ATP synthase inhibitors.

Table 5.9. β8 integrin interactome belongs to ATPase and motor proteins.

Protein Hits PANTHER Protein Class IgG β8 integrin ACTR1A 0 51998 actin and actin related protein(PC00039) MYH1 0 38653 actin binding motor protein(PC00040) MYH2 0 38653 actin binding motor protein(PC00040) MYH3 0 38653 actin binding motor protein(PC00040) MYH4 0 38653 actin binding motor protein(PC00040) MYH6 0 38653 actin binding motor protein(PC00040) MYH7 0 38653 actin binding motor protein(PC00040) MYH8 0 38653 actin binding motor protein(PC00040) MYH13 0 38653 actin binding motor protein(PC00040) MYO1F 0 33194 actin binding motor protein(PC00040) MYO1E 0 33194 actin binding motor protein(PC00040) MYO5C 0 30934 actin binding motor protein(PC00040) MYH11 0 17761 actin binding motor protein(PC00040) ARPC5 0 611550 actin family cytoskeletal protein(PC00041) ARPC5L 0 215100 actin family cytoskeletal protein(PC00041) MYL12A 0 163410 actin family cytoskeletal protein(PC00041) MYL12B 0 163410 actin family cytoskeletal protein(PC00041) ATP5J2 0 335490 ATP synthase(PC00002) ATP6V1G2 0 125440 ATP synthase(PC00002) ATP6V1G2- 0 125440 ATP synthase(PC00002) DDX39B ATP6V1G1 0 125440 ATP synthase(PC00002) ATP5MC2 0 96034 ATP synthase(PC00002) ATP5MC1 0 96034 ATP synthase(PC00002) ATP5MC3 0 96034 ATP synthase(PC00002) ATP-binding cassette (ABC) ABCA4 0 167690 transporter(PC00003) ATP-binding cassette (ABC) ABCA10 0 59681 transporter(PC00003) GSG1 0 49674 cytoskeletal protein(PC00085) RIBC2 0 38141 cytoskeletal protein(PC00085) IFT140 0 31522 cytoskeletal protein(PC00085) ATAD2 0 1549500 hydrolase(PC00121)

Results

intermediate filament binding PLEC 0 54848 protein(PC00130) microtubule family cytoskeletal NUDCD2 0 82287 protein(PC00157) microtubule family cytoskeletal NUDC 0 75696 protein(PC00157) microtubule family cytoskeletal SPAG16 0 62147 protein(PC00157) GOLGA8IP 0 294620 membrane traffic protein(PC00150) GOLGA8M 0 294620 membrane traffic protein(PC00150) AP1B1 0 150110 membrane traffic protein(PC00150) SNCG 0 78383 membrane traffic protein(PC00150) NAPA 0 40435 membrane traffic protein(PC00150) EXOC7 0 27649 membrane traffic protein(PC00150) CCDC88B 0 20258 membrane traffic protein(PC00150) membrane trafficking regulatory pro- SCFD1 0 210990 tein(PC00151) membrane trafficking regulatory pro- VAPB 0 164730 tein(PC00151) membrane trafficking regulatory pro- GAPVD1 0 18929 tein(PC00151) membrane trafficking regulatory pro- RABGEF1 0 12041 tein(PC00151) membrane-bound signaling mole- SEMA6A 0 32596 cule(PC00152) membrane-bound signaling mole- SEMA4F 0 966.26 cule(PC00152) microtubule binding motor KIF4A 0 6468.8 protein(PC00156) CTNNA1 0 133170 non-motor actin binding protein(PC00165) CTNNA2 0 133170 non-motor actin binding protein(PC00165) PLS1 0 122000 non-motor actin binding protein(PC00165) WDR1 0 79692 non-motor actin binding protein(PC00165) PDLIM5 0 31224 non-motor actin binding protein(PC00165) FSCN1 0 9131.6 non-motor actin binding protein(PC00165) TNNI2 0 7028.6 non-motor actin binding protein(PC00165) non-motor microtubule binding KATNAL2 0 480630 protein(PC00166) non-motor microtubule binding MAPRE1 0 374510 protein(PC00166) non-motor microtubule binding TPT1 0 314630 protein(PC00166) non-motor microtubule binding VPS4A 0 7893.9 protein(PC00166) ABCD2 0 43870 transporter(PC00227) TM9SF3 0 28962 transporter(PC00227)

Results

SLC44A4 0 14879 transporter(PC00227) TUBA8 0 647640 tubulin(PC00228) TUBB2A 0 452030 tubulin(PC00228) TUBB2B 0 452030 tubulin(PC00228) TUBA1C 0 251270 tubulin(PC00228) TUBB4A 0 67118 tubulin(PC00228) TUBB6 0 67118 tubulin(PC00228) TUBB1 0 67118 tubulin(PC00228) TMED2 0 163500 vesicle coat protein(PC00235) PICALM 0 88899 vesicle coat protein(PC00235) CEP97 0 4275900 RAB8A 0 212820 CEP41 0 150820 ATP5I 0 150240 SEC22B 0 120520 GBF1 0 17750

5.6 Correlation of β8 integrin and autophagy in PDAC cells

5.6.1 β8 integrin interactome connects to autophagy in PDAC cells

To investigate the role of β8 integrin in autophagy, we analyzed the β8 integrin interactome proteins via the ARN database (Türei et al., 2015). RNA-Binding Motif Protein, X Chromosome (RBMX), Thymopoietin (TMPO), and electron transfer flavoprotein alpha subunit (ETFA) were found to interact with β8 integrin in normal condition but lost the interaction post 6 Gy x-ray irradiation condition. The protein intensity of aldehyde dehydrogenase 9 family members A1 (ALDH9A1) and DnaJ homolog subfamily C member 7 (DNAJC7) were increased post 6 Gy x-ray irradiation condition (Figure 5.19.).

Results

Figure 5.19. β8 integrin interaction with autophagy proteins in PDAC cells. β8 integrin interactome associates to autophagy categories by ARN database (http://arn.elte.hu/) (Jin et al., 2019).

5.6.2 Depletion of β8 integrin reduces autophagy induction

Next, to test how β8 integrin regulating autophagy in PDAC, we knocked down β8 integrin and performed LC3B staining to examine the autophagy flux in PDAC. After β8 integrin depletion, cells were pre-treated with microtubule inhibitors (colchicine, COL and paclitaxel, PTX) and autophagy inhibitor (chloroquine, CQ) thirty minutes before 6 Gy x-ray irradiation. The LC3B fluorescence intensity in unirradiated esiRNA control cells showed no significant elevation in both colchicine and chloroquine treated cells and slightly reduced in the paclitaxel treated cells. On the other hand, we found that in the β8 integrin silenced cells the LC3B fluorescence intensity was significantly decreased in three agents, including PBS, relative to unirradiated esiRNA control (Figure 5.20. A and C). Upon irradiation, the intensity of LC3B was not significantly increased in esiRNA control cells independent of PBS or a specific agent relative to unirradiated esiRNA controls. Similar to non-irradiated cells, β8 integrin-depleted and irradiated cells showed a significant reduction in LC3B intensity (Figure 5.20. B and D).

Results

100

Results

Figure 5.20. β8 integrin knockdown inhibits LC3B expression in PDAC cells. (A and C) Double staining of β8 integrin and LC3B after esiRNA-mediated β8 integrin depletion in BxPC3 cell line in the presence of colchicine (5 nM), paclitaxel (1 nM), or chloroquine (25 µM) and without or with 6 Gy x-ray irradiation. (B and D) Quantitative of LC3B intensity by Fiji software. Data are representative of 50 cells each condition. Scale bar, 10 µm. β8 integrin, green; LC3B, red; nucleus, gray. All results show mean ± SD (n=3, * P<0.05, *** P<0.001) (Jin et al., 2019).

5.6.3 β8 integrin regulating autophagy induction leads to radiosensitizing effect

Next, to determine whether the conditions tested for LC3B fluorescence intensity impacts on PDAC cell survival and tumoroid formation, we knocked down β8 integrin and performed 3D IrECM tumoroid forming assay with microtubule-inhibiting agents (colchicine, COL and paclitaxel, PTX) or autophagy inhibitor (chloroquine, CQ). Intriguingly, 3D lrECM PDAC tumoroid formation remained unaffected upon treatment (Figure 5.21. A), while irradiated and treated PDAC cell cultures under β8 integrin depletion showed significant lower tumoroid formation. Cells treated with two microtubule-inhibiting agents (colchicine or paclitaxel) showed significant reduction of tumoroid formation. However, this effect has no significantly different between the

Figure 5.21. β8 integrin regulates cytoprotective autophagy in PDAC cells. (A) 3D tumoroid forming ability after esiRNA-mediated β8 integrin depletion in BxPC3 cell line in the presence of colchicine (5 nM), paclitaxel (1 nM), chloroquine (25 µM) without or (B) with 6 Gy x-ray irradiation. All results show mean ± SD (n=3, * P<0.05, *** P<0.001) (Jin et al., 2019).

101

Results

two microtubule-inhibiting agents but markedly lower for chloroquine (Figure 5.21. B) upon β8 integrin depletion. The striking findings are that (i) β8 integrin regulates LC3B expression in a microtubule-independent manner, (ii) β8 integrin and autophagy measured by LC3B intensity is essential for PDAC cell survival only upon stress as induced here by x-ray irradiation.

102

Discussion

6 Discussion

To overcome therapy resistance is a formidable challenge for patients with PDAC. Because of the desmoplasia of PDAC, the microenvironmental factors impact PDAC therapy resistance not only as a physical barrier (Narayanan and Weekes, 2016) but also via cancer cells binding to the ECM signaling pathways (Eke and Cordes, 2015; Weniger et al., 2018). Focal adhesions (FA) facilitating cell–ECM contact and connection between ECM and actin cytoskeleton play a mechanistically crucial role, as they structurally and functionally control the cell’s morphology and cytoplasmic signaling for survival, proliferation, differentiation, motility, and therapy resistance (Legate et al., 2009; Eke and Cordes, 2015). For instance, targeting β1 integrin with inhibitory antibody has been reported promoting cancer cells radiosensitizing effect (Eke et al., 2012) and an adapter protein FHL2 determines survival and radioresistance in PDAC (Zienert et al., 2015). Owing an abundant and dense stroma in PDAC, we conducted the high-throughput esiRNA-based screening in 3D tumoroid culture to identify the novel focal adhesion targets. In the present project, it is shown that β8 integrin (i) is over-expressed in PDAC relative to normal pancreatic tissue, (ii) is critically involved in cell survival, tumoroid formation, invasion and radiochemoresistance, (iii) co-localizes with the Golgi apparatus perinuclearly in PDAC cells, (iv) translocates from perinuclear region to cytoplasmic upon 6 Gy x-ray irradiation or gemcitabine treatment via microtubule and substantial changes in its proteomic interactome regarding the cell functions transport, catalysis and binding upon radiogenic genotoxic injury, and (v) connects with parts of its interactome to autophagy.

6.1 High-throughput RNAi screen identify novel focal adhesion protein targets in 3D PDAC cells

Our high-throughput esiRNA-based screening identified two novel focal adhesion proteins, namely, PINCH1 and β8 integrin, that contribute to radioresistance in PDAC. Both PINCH1

103

Discussion

and β8 integrin are highly significantly overexpressed in PDAC patients, resulting in poor prognosis. Interestingly, the expression levels of both PINCH1 and β8 integrin in our 3D IrECM PDAC culture model were variable. We also observed that the expression levels of both PINCH1 and β8 integrin are higher in the patient-derived PDAC cell lines than the commercially acquired cell lines, with no known underlying mechanism.

PINCH1, an adopter protein, is a vital regulator of integrin-mediated signaling, together with integrin-linked kinase (ILK) and Parvin (Legate et al., 2006). This heterotrimeric complex is referred to as the IPP complex, named according to their discovery (Legate et al., 2006), and has been reported in regulation of several cellular behavior and fate, such as survival, proliferation, migration, invasion, and angiogenesis (Sandfort et al., 2010). The expression levels of PINCH1 is a highly elevated frequent tumor entities, including lung, colon, breast, and pancreas (Eke et al., 2010). In our previous studies, we have shown that PINCH1 enhances radioresistance by regulating Akt1 activation and inhibiting PP1α, as evidenced in both adhesion and suspension cell culture conditions (Eke et al., 2010; Sandfort et al., 2010). Moreover, PINCH1 has been reported as a poor prognosis marker in laryngeal carcinoma (Tsinias et al., 2018). Recently, Ren et al. have shown that PINCH1 promotes PDAC survival under conditions of oxygen-glucose deprivation by activating AKT/mTOR signaling and enhancing HIF-1α protein translation (Huang et al., 2019). In our secondary PDAC cell panel validation, depletion of PINCH1 showed a reduction of tumoroid formation ability upon 6 Gy x-ray irradiation in all PDAC cell lines. However, not all cell lines exhibited a significant radiosensitizing effect. Based on this observation, we posit that PINCH1 is an important factor for PDAC radioresistance, but not a crucial mediator.

Similar to many other cancers originating from brain (Malric et al., 2018), lung (Garber et al., 2001), the ovaries (He et al., 2018), and gastrointestinal tract (Wang et al., 2015), here we found that β8 integrin is overexpressed in PDAC. β8 integrin has central roles in promoting GBM initiation in vitro and in vivo (Reyes et al., 2013; Malric et al., 2018). Moreover, inhibiting β8 integrin curtailed GBM cell self-renewal ability, stemness, and migration (Tchaicha et al., 2011; Guerrero et al., 2017). β8 integrin depletion also reverse resistance to gefitinib in HepG2 cell line (Wang et al., 2015). Consistent with these studies, our study reveals that inhibition of β8 integrin not only induces a dose-dependent radiochemosensitizing effect in the 3D tumoroid model, but also in 2D colorogenic survival assay treated with 6 Gy x-ray irradiation. Further- more, β8 integrin depletion not only increased the radiochemosensitizing effect in PDAC, but also affected the PDAC stemness and invasion, as examined via sphere formation assay and in both 2D and type I collagen-based 3D invasion assays, respectively.

104

Discussion

In summary, these data establish β8 integrin, but not PINCH1, as an essential driver of PDAC radiochemoresistance and invasion.

6.2 β8 integrin subcellular location in PDAC

Growing body of evidence has indicated that cell surface receptors can be transported via endosomal trafficking to the trans-Golgi network, the perinuclear region of the nucleus (Alanko et al., 2015; Rainero and Norman, 2015; Hanyaloglu, 2018). This cellular process is common in cancer to increase retrotranslocation and reduce the degradation of activated receptors, resulting in cancer metastasis (Hamidi and Ivaska, 2018). In 2015, Ivaska et al. revealed that β1 integrin can be translocated to the cytosol via endosomal trafficking, giving rise to increased anoikis resistance (Alanko et al., 2015). We observed that β8 integrin is localized to the perinuclear area in six commercial and three patient-derived PDAC cell lines and is colocalized with a cis-Golgi matrix protein, GM130 (Nakamura et al., 1995). GM130 is a peripheral membrane protein firmly attached to the membrane of the Golgi apparatus. It facilitates vesicle fusion to the Golgi membrane as a vesicle “tethering factor” and is involved in the control of glycosylation, cell cycle progression, cell polarization, and migration (Nakamura, 2010). GM130 interacts with p115/USO1, giantin, GRASP65, and Rab GTPases, among which p115/USO1 is the most essential partner protein (Barroso et al., 1995; Nakamura et al., 1997; Nakamura, 2010). P115/USO1-GM130-giantin complex forms a tethering factor to support ER- to-Golgi transport (Grabski et al., 2012; Witkos andLowe, 2017). In the β8 integrin interactome data, we found several proteins interacting with p115/USO1, especially transmembrane emp 24 domain trafficking protein 2 (TMED2) and ER lumen protein-retaining receptor 2 (KDELR2) are included in both GM130 and p115/USO1 interactome. TMED2 is involved in COPI and COPII vesicle coating, cargo loading, vesicle transporting, and early secretory pathway (Goldberg, 2000; Luo et al., 2007; Bonnon et al., 2010; Stepanchick and Breitwieser, 2010; Luo et al., 2011). Moreover, KDELR2 is located at ER and Golgi apparatus, involved in ER-to- Golgi trafficking, autophagy, and Golgi-mediated secretion (Lewis and Pelham, 1992; Gaudet et al., 2011; Tapia et al., 2019). Regarding the function of GM130, recently an elegant study has revealed that GM130 regulates the activation of ULK kinase and autophagy (Joachim et al., 2015), which indicates that β8 integrin-GM130 association may partake in autophagy.

Together, these findings establish that β8 integrin is located in the perinuclear region and associated with GM130.

105

Discussion

6.3 β8 integrin translocation upon genotoxic stress

Exposure to ionizing radiation induces various physiological responses, including DNA repair, cell cycle arrest, signal transduction, cell death, and cell differentiation. The changes in the interaction profile of many proteins play a significant role in these processes (Hall and Giaccia, 2012). Little is known about how β8 integrin regulates cancer survival and if/how it can confer therapeutic resistance. To this end, we collected protein samples from the PDAC cells in both unirradiated and 6 Gy x-ray irradiated samples and immunoprecipitated with a β8 integrin antibody for mass spectrometry to probe for any changes in β8 integrin interactome upon 6 Gy x-ray irradiation. β8 integrin interactome, categorized by molecular function catalytic, binding, structural molecule, and transporter activity are highly increased upon 6 Gy x-ray.

When comparing the β8 integrin interactome in unirradiated versus 6 Gy x-ray irradiated, we detected there are many proteins increased in the 6 Gy x-ray irradiated condition and associated with vesicle-mediated transport. ARPC5 is the most abundant protein in β8 integrin 6 Gy x-ray irradiated interactome. ARPC5, a component of Arp 2/3 complex mediating actin polymerization via nucleation-promoting factor (NPF) regulation (Goley et al., 2004). Actin filament not only provides cell shape change and cell edge protrusion but also plays essential roles in the organization and dynamics of endosomal vesicles and organelles (Skau and Waterman, 2015; Rottner et al., 2017; Svitkina, 2018). Arp 2/3 complex is the crucial actin nucleator in vesicle dynamics, which is activated by different WASP families of NPFs, including N-WASP (MACHESKY et al., 1997; Miki et al., 1998; Gournier et al., 2001). N-WASP is activated by Cdc42, a small GTPase, which activates the Arp 2/3 complex that mediates the formation of branched actin networks in the cytoplasm (Welch et al., 1997; Miki et al., 1998; Wu et al., 2006). Recently, an elegant study has shown that β8 integrin regulates Cdc42 activation and drives glioblastoma cell invasion (Reyes et al., 2013), suggesting that β8 integrin is involved in Arp 2/3 complex via regulating its effector, N-WASP, by Cdc42.

Additionally, recently studies have shown that small GTPases govern integrin trafficking (DeFranceschi et al., 2015). Small GTPases are important signaling molecules that controlled by cycles of GTP binding, catalyzed by guanine nucleotide exchange factors (GEFs), and GTP hydrolysis, catalyzed by GTPase-activating proteins (GAPs). Among them, members of the Rab, Rho, and Arf families regulate integrin trafficking (DeFranceschi et al., 2015). Rab proteins are the largest the largest family of Ras-related small GTPase molecules each of them

106

Discussion

has a unique function that facilitate cargo sorting, motor protein binding, tethering, docking and fusion of transport vesicles (DeFranceschi et al., 2015; Paul et al., 2015; Zhen and Stenmark, 2015). In the integrin trafficking process, several members of Rab protein are found in the specific endosomal membrane which ensure the spatiotemporal regulation of integrin traffic (Stenmark, 2009; DeFranceschi et al., 2015; Paul et al., 2015). For instance, integrin endocytosis from the plasma membrane to the early endosomes is regulated by Rab5 and Rab21 (Onodera et al., 2012; Sandri et al., 2012). Integrins recycle back to the plasma membrane through two distinct mechanisms (i) short-loop pathway, which is Rab4 dependent and rapid transport the integrins back to the plasma membrane and (ii) long-loop pathway, which is Rab11 dependent and transport integrins through the perinuclear recycling compartments (PNRC); other GTPases (Rab8, Rab10, Rab22a, and Arf6) also been discribed (Caswell et al., 2008; Bridgewater et al., 2012; DeFranceschi et al., 2015). Several small GTPases are found in our β8 integrin 6 Gy x-ray irradiated interactome. Rab8, a regulator of endosomal recycle route (Grant and Donaldson, 2009; Bridgewater et al., 2012; Anon 2015), is found in our β8 integrin 6 Gy x-ray irradiated interactome. Rab8 mediates constitutive biosynthetic trafficking from the trans-Golgi network (TGN) to the plasma membrane and mediates exocytosis of MT1- matrix metalloproteinase (MT1-MMP) involved in breast cancer cell invasion (Bravo-Cordero et al., 2007; Stenmark, 2009). Moreover, Rab8 has been reported overexpression lead to cisplatin resistance in human epidermoid carcinoma cells (Shen and Gottesman, 2012). Taken together, the translocation of β8 integrin upon genotoxic stress and β8 integrin regulate PDAC radiochemoresistance may correlate with Rab8.

Except Rab8, RhoA is also found in our β8 integrin 6 Gy x-ray irradiated interactome. RhoA has been described as the main regulator in actin cytoskeleton reorganization; aﬀecting integrin endocytosis and traﬃcking, cell adhesion migration, cancer cell proliferation, and survival (Jaffe and Hall, 2005; Ridley, 2006; DeFranceschi et al., 2015; Shibata et al., 2019). Overex- pression of RhoA is found in various cancer entities including liver, skin, colon, ovarian, head and neck, bladder and gastric cancers (Fritz et al., 1999; Abraham et al., 2001; Fukui et al., 2006; Li et al., 2006). Increased expression of RhoA is correlated to poor prognosis in prostate cancer (CHEN et al., 2016) and tumor progression in ovarian, breast, lung, liver, and astrocy- tomas (Fritz et al., 1999; Horiuchi et al., 2003; Varker et al., 2003; Fukui et al., 2006; Li et al., 2006). Growing evidences have pointed out RhoA is involved in both radio- and chemoresistance such as, Sharma et al. showed RhoA induced ovarian cancer cell stiffness via actin cytoskeleton organization with a positive correlation between a higher cisplatin resistance

107

Discussion

(Sharma et al., 2012; Sharma et al., 2014) and McLaughlin et al. have shown that RhoA regulate GBM redioresistance via modulating Survivin activity (McLaughlin et al., 2006). RhoA has many downstream target effectors including Rho-associated kinases (ROCK I and II) regulating actomyosin contractility by controlling the phosphorylation state of myosin light chains (MLC) (Zaidel-Bar et al., 2015). Interestingly, both ROCK I and II are found in β8 integrin 6 Gy x-ray irradiated interactome. Recently, Fujimura et al. showed that the expression level of RhoA and ROCK II modulated by Eukaryotic Translation Initiation Factor 5A (EIF5A) regulate PDAC metastasis (Fujimura et al., 2015). We also observed that depletion β8 integrin expression inhibiting PDAC invasion in both 2D and 3D invasion assays and induing radiochemosensitivity. Together these findings suggest that β8 integrin regulating PDAC radiochemoresistance and invasion via RhoA/ROCK pathways.

Furthermore, we observed that β8 integrin can be isolated from the condition medium of PDAC and their exosomes. Exosomes, a type of extracellular vesicle (EV) with a diameter between 50-100 nm, originate from the endocytic pathway (Pegtel and Gould, 2019). Exosomes have been reported to contribute to metastasis of several types of cancer, including PDAC (Azmi et al., 2013; Richards et al., 2016), and induction of drug resistance. We also noted that upon 6 Gy x-ray irradiation, there was a slight increase in the preponderance of β8 integrin-positive exosomes. In our β8 integrin interactome data, we found that several exosome components in the 6 Gy x-ray irradiated condition, among them CD9 is the most abundant protein. CD9, a surface glycoprotein with four transmembrane domains that form multimeric complexes with other transmembrane proteins including integrins, plays a pivotal role in exosome biogenesis, cargo selection, and target cell uptake (Gonzalez-Begne et al., 2009; Kowal et al., 2016; Pegtel and Gould, 2019).

In conclusion, the translocation of β8 integrin and the secretion of β8 integrin positive exosome upon genotoxic stress are correlated to interaction with small GTPase (Rab8 and RhoA) and ARPC5 mediating actin reorganization to increase radiochemoresistnace.

6.4 β8 integrin regulates autophagy

Macroautophagy (autophagy) is a highly regulated catabolic pathway induced to degrade cellular organelles and macromolecules (Janku et al., 2011; Levy et al., 2017). In the established tumors, autophagy can function as a pro-survival pathway in response to stress, such as, starvation, hypoxia, absence of growth factors, and the presence of chemo- and radiotherapy that might mediate resistance to anticancer therapies (Janku et al., 2011; Sui et al., 2013; Kenific

108

Discussion

and Debnath, 2015; Wang et al., 2018). The formation of autophagosome is originated from the ER, Golgi apparatus, ER-Golgi intermediate compartment (ERGIC), mitochondria, endosome, and plasma membrane (Ravikumar et al., 2009; Kast and Dominguez, 2017). These sources ascribe an essential role to autophagosome elongation process via Atg9, a transmembrane protein, cycling between trans-Golgi network and endosome (Dikic and Elazar, 2018). The transportation of membranes depends on microtubule and actin filaments (Mackeh et al., 2013; Coutts and LaThangue, 2016; Kruppa et al., 2016; Kast and Dominguez, 2017). Moreo- ver, there are growing evidences that membrane-trafficking proteins play important roles in regulating autophagy process (Bento et al., 2013). It has gotten to be progressively clear that autophagy intersects with numerous steps of the endocytic and exocytic pathways, sharing many molecules, such as, small GTPases Rab, Rho family proteins (Aguilera et al., 2012; Bento et al., 2013; Ao et al., 2014). For instance, Rab1, controlling the membrane trafficking from ER to Golgi, is found to participate in the early stages of autophagy; Rab7 controls autophagosome-lysosome fusion, and Rab8 controls the IL1β secretion and Annexin A2 containing exosome secretion in the autophagy‐based unconventional secretory pathway (Dupont et al., 2011; Chen et al., 2017). RhoA, a small GTPases of Rho family, has been reported positively regulating starvation-induced autophagy in actin participating membrane remodeling (Aguilera et al., 2012).

Previously, we have posited that β8 integrin may play a role in the autophagy process via association with GM130. To test this hypothesis, we used ARN database (Türei et al., 2015) to identify the β8 integrin interactome proteins involved in autophagy. We found eighteen proteins involved in autophagy, among which was Rheb, a small GTPase that has been reported to interact with β8 integrin (Huttlin et al., 2015). Rheb induces p27-dependent activation of autophagy, which promotes cancer cell survival (Campos et al., 2016). Rheb also promotes mitophagy through its interaction with mitochondrial autophagy receptors Nix /BNIP3L and LC3B (Melser et al., 2013). Interestingly, Annexin A2, RhoA, and Rab8 are found in our β8 integrin 6 Gy x-ray irradiated interactome. Annexin A2 regulates autophagosome formation by controlling Atg9-containing vesicles trafficking, likely acting as a tether between recycling endosomes and actin networks assembled by the Arp2/3 complex (Kast and Dominguez, 2017). Recently, Chen et al. have shown that Annexin A2 can be secreted via exosome regulated by Rab8 in IFN-γ-stimulated lung epithelial cells (Chen et al., 2017), suggesting that β8 integrin regulating autophagy and unconventional autophagy secretion in association with Annexin A2 and Rab8.

109

Discussion

β8 integrin seems to be a critical autophagy regulator and autophagy is a cytoprotective mechanism in PDAC. Accordingly, the β8 integrin expression in PDAC appears to correlate to autophagy with LC3 intensity. LC3 intensity corresponds to β8 integrin expression, however, neither of the two microtubule inhibitors, colchicine and paclitaxel, nor chloroquine, an autophagy inhibitor, showed significant effects. As for tumoroid forming capacity, pre-treatment with these three compounds does not impact the radiosensitivity in PDAC; it only depends on the expression of β8 integrin. To conclude, we found that β8 integrin is associated with autophagy process and inhibition of it curtails the formation of autophagosome, in a microtubule independent manner.

Taken together, β8 integrin is over-expressed in PDAC and plays an essential role in the 3D tumoroid formation and radiochemosensitivity in human pancreatic cancer cell lines. Based on its translocation and regulation of autophagy upon 6 Gy irradiation, targeting of β8 integrin itself or a druggable key interactor may be effective to improve overall survival in patients with PDAC. Therefore, future studies are warranted to comprehensively unravel the β8 integrin-related molecular circuitry and the pro-survival signaling networks.

110

Summary

7 Summary

Background: Pancreatic ductal adenocarcinoma (PDAC), one of the fourth most lethal malignancies in the world, has a less than 5% five-year relative overall survival rate. Thus, there is a great need for novel therapies. PDAC is characterized as a stroma rich malignancy, composed of a large amount of extracellular matrix and pancreatic stellate cells. Accordingly, cell- matrix adhesion is crucial for cancer cell survival, invasion, and therapy resistance. We em- barked on a high-throughput assay to identify the function of 117 focal adhesion proteins (FAP) in PDAC cell radiochemoresistance.

Material and methods: We generated and performed a 3D tumoroid high-throughput esiRNA- based screening assay (3DHT-esiRNAs) in PDAC cell cultures (established and PDC) grown in laminin-rich extracellular matrix (IrECM). In addition to characterizing the β8 integrin expression, distribution, and co-localization with other cellular organelles, such as Golgi apparatus, we also performed 3D tumoroid formation assay, sphere formation assay, type I collagen- based 3D invasion assay, and 2D clonogenic survival assay following esiRNA-mediated knockdown, 6 Gy x-ray irradiation and gemcitabine treatment. Image analysis was performed to determine Pearson's correlation coefficient, vesicle distribution and expression patterns upon irradiation or gemcitabine treatment by Fiji software (NIH). Immunoprecipitation-mass spectrometry (IP-MS) was performed to investigate the interactome of β8 integrin in the normal versus 6 Gy x-ray irradiation group. Inhibitor screen was conducted following 6 Gy x-ray irradiation or gemcitabine treatment to identify pathways involved in changes of β8 integrin localization upon treatment Autophagy flux was detected by monitoring LC3B puncta.

Results: We identified a series of novel targets, including β8 integrin and PINCH1. Intriguingly, depletion of either β8 integrin or PINCH1 both showed radiosensitizing effect, with β8 integrin knockdown exerting a more profound radiosensitizing effect in a panel of PDAC cell lines. Without cytotoxicity, β8 integrin depletion evoked radiochemosensitization in PDAC, PDCs cell lines, and reduced sphere formation and 3D invasion into collagen-I. Intriguingly, β8 integrin

111

Summary

was found to be located in the perinuclear region where it co-localized with the cis-Golgi matrix protein, GM130. Upon irradiation and gemcitabine treatment, β8 integrin was translocated from the perinuclear region to the cytosol, showing a slightly increased compartmentalization in the exosome; a process that was abrogated by treatment with cytoskeletal inhibitors (paclitaxel, latrunculin B, and colchicine) and ATP synthase inhibitors (antimycin A and oligomycin). De- pletion of β8 integrin influenced the autophagy via decreasing the LC3B puncta in a microtubule independent manner.

Conclusion: Our results generated in 3D lrECM PDAC cell cultures, propose that β8 integrin, but not PINCH1, is a novel determinant of PDAC radiochemoresistance. Moreover, β8 integrin, although not localized to the cell membrane to facilitate cell adhesion, has a critical role in regulating intracellular vesicle trafficking under stress conditions and autophagy flux.

112

Zusammenfassung

8 Zusammenfassung

Hintergrund: Das duktale Adenokarzinom des Pankreas (PDAC) ist die vierttödlichste bösartige Tumorerkrankung der Welt und weist eine relative 5-Jahres-Überlebensrate von weniger als 5 % auf. Es besteht daher ein großer Bedarf an neuen Therapien. PDAC ist eine stroma-reiche Tumorentität, dessen Mikromilieu sich aus einer großen Menge extrazellulärer Matrix und Pankreas-Sternzellen zusammensetzt. Die Zell-Matrix-Adhäsion ist entscheidend für das Überleben, die Invasion und die Therapieresistenz von Krebszellen. Aus diesem Grund haben wir einen Hochdurchsatzverfahren eingesetzt, um die Rolle von 117 fokalen Adhäsionsproteinen (FAP) für die Radiochemoresistenz von PDAC-Zellen zu identifizieren.

Material und Methoden: Es wurde ein esiRNA-basiertes Hochdurchsatz-Screening (3DHT- esiRNAs) in 3D PDAC-Zellkulturen (etablierte sowie aus Patientenmaterial isolierte (PDC)), die in lamininreicher extrazellulärer Matrix (IrECM) wuchsen, durchgeführt. Zusätzlich zur Charakterisierung der β8-Integrinexpression, Lokalisation sowie Co-Lokalisation mit anderen zellulären Organellen wie dem Golgi-Apparat, wurden 3D-Tumoroid-Bildungsassays, Kollagen-I-basierte 3D-Invasionsassays und 2D-Koloniebildungsassay nach Knockdown, 6 Gy Röntgenstrahlung und Behandlung mit Gemcitabin durchgeführt. Die Bildanalyse mit der Software Fiji wurde verwendet, um den Pearson‘schen Korrelationskoeffizienten, die Vesikelverteilung und das Expressionsmuster nach Radiochemotherapie zu bestimmen. Eine Massenspektrometrie an Immunpräzipitaten (IP-MS) wurde durchgeführt, um das Interaktom des β8 Integrin unbehandelt und nach 6 Gy Röntgenstrahlung zu untersuchen. Es folgte ein Screen mit unterschiedlichen Inhibitoren nach 6 Gy Röntgenstrahlung oder Gemcitabin, um Veränderungen der β8-Integrinlokalisation zu analysieren. Autophagie wurde mittels LC3B- Puncta charakterisiert.

Ergebnisse: Eine Reihe neuer Zielproteine zur potentiellen Strahlensensibilisierung wurden identifiziert, darunter β8 Integrin und PINCH1. Interessanterweise zeigt die Depletion sowohl von β8 Integrin als auch PINCH1 eine strahlensensibilisierende Wirkung, wobei der β8

113

Zusammenfassung

Integrin-Knockdown stärker strahlensensibilisierte. Ohne Zytotoxizität aufzuweisen, bewirkte die Depletion des β8 Integrins eine Radiochemosensibilisierung in PDAC- und PDC-Zelllinien und verringerte die Sphere-Bildung und die 3D-Invasion in Kollagen-I. Interessanterweise wurde β8 Integrin im perinukleären Bereich gefunden, wo es mit dem cis-Golgi-Matrixprotein GM130 kolokalisiert. Nach Bestrahlung und Behandlung mit Gemcitabin bewegte sich das β8 Integrin von der perinuklearen Region weg und verbreitete sich im Zytosol ohne dabei verstärkt auf Exosomen vorzukommen. Dieser Vorgang wurde durch Zytoskelett-Inhibitoren (Paclitaxel, Latrunculin B und Colchicin) und ATP-Synthase-Inhibitoren (Antimycin A und Oligomycin) aufgehoben. Die Depletion von β8 Integrin zeigte einen Einfluss auf die Autophagie, indem die Bildung von LC3B-Puncta auf mikrotubulusunabhängige Weise verringert wurden.

Schlussfolgerung: Die in 3D-lrECM-PDAC-Zellkulturen gewonnenen Erkenntnisse legen nahe, dass β8 Integrin, jedoch nicht PINCH1, ein neuartiger Mediator der PDAC- Radiochemoresistenz ist. Darüber hinaus scheint β8 Integrin, ohne membranständig und demzufolge ohne offensichtliche Funktion in der Zelladhäsion zu sein, eine kritische Rolle beim intrazellulären Vesikelverkehr unter Stressbedingungen und bei der Regulierung des Autophagie zu spielen.

114

Figures

9 Figures

Figure 2.1. Incidence and mortality rates of pancreatic cancer in the world and Germany...... 5 Figure 2.2. The progression model of pancreatic cancer...... 5 Figure 2.3. Direct and indirect DNA damage induced by ionising radiation...... 10 Figure 2.4. The diversity of integrin subunits and their interactions...... 15 Figure 4.1. Schematic diagram of Western blot setup...... 50 Figure 5.1. 3DHT-esiRNAs against focal adhesion proteins of pancreatic cancer cell line. ... 56 Figure 5.2. ITGB8 and LIMS1 mRNA expression in PDAC patients...... 57 Figure 5.3. PINCH1 and β8 integrin expression level in pancreatic cancer cell lines...... 60 Figure 5.4. PINCH1 controls sensitivity to ionizing radiation in pancreatic cancer cell lines. . 61 Figure 5.5. β8 integrin controls sensitivity to ionizing radiation in pancreatic cancer cell lines...... 63 Figure 5.6. β8 integrin knockdown shows radiosensitizing effect in a dose-dependent manner...... 64 Figure 5.7. β8 integrin critically controls sensitivity chemotherapy reagent in pancreatic cancer cell lines...... 65 Figure 5.8. β8 integrin inhibits tumor sphere formation in pancreatic cancer cell lines...... 67 Figure 5.9. 8 integrin inhibits tumor cell migration...... 69 Figure 5.10. β8 integrin localization in cancer cell lines...... 71 Figure 5.11. β8 integrin co-localization in pancreatic cancer cells...... 73 Figure 5.12. β8 integrin subcellular location alters from perinuclear area to cytosol upon 6 Gy x-ray irradiation...... 75 Figure 5.13. β8 integrin subcellular location alters from perinuclear area to cytosol upon gemcitabine treatment...... 77 Figure 5.14. Secretion of β8 integrin in pancreatic cancer cells...... 79

115

Figures

Figure 5.15. IP-MS shows β8 integrin interactome changed upon 6 Gy x-ray irradiation...... 84 Figure 5.16. The fluorescence-microscopy-based screen upon 6 Gy x-ray irradiation in pancreatic cancer cell line...... 93 Figure 5.17. The fluorescence-microscopy-based screen upon gemcitabine treatment in pancreatic cancer cell line...... 95 Figure 5.18. The fluorescence-microscopy-based screen upon genotoxic stress in pancreatic cancer cell line...... 95 Figure 5.19. β8 integrin interaction with autophagy proteins in PDAC cells...... 99 Figure 5.20. β8 integrin knockdown inhibits LC3B expression in PDAC cells...... 101 Figure 5.21. β8 integrin regulates cytoprotective autophagy in PDAC cells...... 101

116

Tables

10 Tables

Table 4.1. Devices used for biochemical, molecular-biological, and cell culture applications...... 18 Table 4.2. Materials used for biochemical, molecular-biological, and cell culture applications...... 19 Table 4.3. Enzymatically-prepared siRNA (esiRNA) used to silence the indicated genes. Corresponding sequences are shown...... 20 Table 4.4. Inhibitors used for cell culture experiments ...... 34 Table 4.5. Chemotherapeutics used for cell culture experiments...... 35 Table 4.6. Method kits used for biochemical applications...... 35 Table 4.7. Primary antibodies used for Western blot, immunoprecipitation, and immunofluorescence applications...... 35 Table 4.8. Secondary antibodies used for Western blot, immunoprecipitation, immunofluorescence or immunohistochemical applications...... 36 Table 4.9. Solutions used for cell biological applications. The detailed composition for each solution is shown...... 37 Table 4.10. Solutions used for protein-biochemical and molecular-biological applications. The composition for each solution is shown...... 38 Table 4.11. Solutions used for immunofluorescence applications. The composition for each solution is shown...... 40 Table 4.12. Other solutions and chemicals used for biochemical, molecular-biological or in vivo applications...... 40 Table 4.13. PC programs for data analysis and presentation...... 41 Table 4.14. BxPC3 cell numbers and incubation period for 2D colony formation assay...... 44 Table 4.15. Cell numbers and incubation period for 3D tumoroid formation assay. Cell numbers and incubation period were adjusted by each different cell lines...... 45 Table 4.16. Preparation for 1 ml collagen type I solution for the invasion assay...... 45

117

Tables

Table 4.17. Composition of stacking and separation gels for SDS PAGE...... 49 Table 5.1. The mRNA expression level of the top ten percent most potential candidates’ data from Oncomine database...... 58 Table 5.2. The prognosis of the top 10 percent most potential candidates in comparison to low and high expression in PDAC patients from Oncolnc database...... 59 Table 5.3. β8 integrin interactome analysis by protein class via PANTHER database...... 80 Table 5.4. β8 integrin interactome analysis by molecular function via PANTHER database. 83 Table 5.5. β8 integrin interactome analysis by cellular component via PANTHER database.85 Table 5.6. β8 integrin interactome associated with Golgi apparatus in the unirradiated condition...... 86 Table 5.7. β8 integrin interactome associated with Golgi apparatus upon six Gy x-ray irradiation...... 87 Table 5.8. β8 integrin interactome analysis by the biological process via PANTHER database...... 89 Table 5.9. β8 integrin interactome belongs to ATPase and motor proteins...... 96

118

References

11 References

AbrahamMT, KuriakoseMA, SacksPG, YeeH, ChiribogaL, BearerEL, DelacureMD. 2001. Motility-Related Proteins as Markers for Head and Neck Squamous Cell Cancer. Laryngoscope, 111(7):1285–1289 DOI: 10.1097/00005537-200107000-00027.

AdamskaA, DomenichiniA, FalascaM. 2017. Pancreatic Ductal Adenocarcinoma: Current and Evolving Therapies. Int J Mol Sci, 18(7) DOI: 10.3390/ijms18071338.

AguileraMO, BerónW, ColomboMI. 2012. The actin cytoskeleton participates in the early events of autophagosome formation upon starvation induced autophagy. Autophagy, 8(11):1590–1603 DOI: 10.4161/auto.21459.

AlankoJ, MaiA, JacquemetG, SchauerK, KaukonenR, SaariM, GoudB, IvaskaJ. 2015. Integrin endosomal signalling suppresses anoikis. Nat Cell Biol, (October) DOI: 10.1038/ncb3250.

AlbertsB, JohnsonA, LewisJ, RaffM, RobertsK, WalkerP. 2002. Fractionation of Cells. Mol Biol Cell DOI: 10.1007/978-1-61779-821-4_38.

AndersenDK, KorcM, PetersenGM, EiblG, LiD, RickelsMR, ChariST, AbbruzzeseJL. 2017. Diabetes, Pancreatogenic Diabetes, and Pancreatic Cancer. Diabetes, 66(5):1103– 1110 DOI: 10.2337/db16-1477.

Anon. 2015. Endocytic Trafficking of Integrins in Cell Migration. Curr Biol, 25(22):R1092– R1105 DOI: 10.1016/J.CUB.2015.09.049.

AoX, ZouL, WuY. 2014. Regulation of autophagy by the Rab GTPase network. Cell Death Differ, 21(3):348–58 DOI: 10.1038/cdd.2013.187.

119

References

ApteMV., WilsonJS, LugeaA, PandolSJ. 2013. A Starring Role for Stellate Cells in the Pancreatic Cancer Microenvironment. Gastroenterology, 144(6):1210–1219 DOI: 10.1053/j.gastro.2012.11.037.

AsgharU, WitkiewiczAK, TurnerNC, KnudsenES. 2015. The history and future of targeting cyclin-dependent kinases in cancer therapy. Nat Rev Drug Discov, 14(2):130–46 DOI: 10.1038/nrd4504.

AzmiAS, BaoB, SarkarFH. 2013. Exosomes in cancer development, metastasis, and drug resistance: a comprehensive review. Cancer Metastasis Rev, 32(3–4):623–42 DOI: 10.1007/s10555-013-9441-9.

BadeaL, HerleaV, DimaSO, DumitrascuT, PopescuI. Combined gene expression analysis of whole-tissue and microdissected pancreatic ductal adenocarcinoma identifies genes specifically overexpressed in tumor epithelia. Hepatogastroenterology, 55(88):2016–27 [accessed: 01/29/2020] URL: http://www.ncbi.nlm.nih.gov/pubmed/19260470.

BandoY, KatayamaT, TaniguchiM, IshibashiT, MatsuoN, OgawaS, TohyamaM. 2005. RA410/Sly1 suppresses MPP+ and 6-hydroxydopamine-induced cell death in SH-SY5Y cells. Neurobiol Dis, 18(1):143–151 DOI: 10.1016/j.nbd.2004.09.008.

BarczykM, CarracedoS, GullbergD. 2010. Integrins. Cell Tissue Res, 339(1):269–280 DOI: 10.1007/s00441-009-0834-6.

BarrosoM, NelsonDS, SztulE. 1995. Transcytosis-associated protein (TAP)/p115 is a general fusion factor required for binding of vesicles to acceptor membranes. Proc Natl Acad Sci U S A, 92(2):527–31 DOI: 10.1073/pnas.92.2.527.

BellRB, FernandesRP, AndersenPE, ElliottDA, NabavizadehN, SeungSK, HansenEK, HollandJM. 2018. Radiation Therapy. Oral, Head Neck Oncol Reconstr Surg:268–290 DOI: 10.1016/B978-0-323-26568-3.00013-0.

BentoCF, PuriC, MoreauK, RubinszteinDC. 2013. The role of membrane-trafficking small GTPases in the regulation of autophagy. J Cell Sci, 126(Pt 5):1059–69 DOI: 10.1242/jcs.123075.

BlackfordA, SerranoOK, WolfgangCL, ParmigianiG, JonesS, ZhangX, ParsonsDW, LinJCH, LearyRJ, EshlemanJR, GogginsM, JaffeeEM, Iacobuzio-DonahueCA, MaitraA, CameronJL, OlinoK, SchulickR, WinterJ, HermanJM, LaheruD, KleinAP, VogelsteinB,

120

References

KinzlerKW, VelculescuVE, HrubanRH. 2009. SMAD4 gene mutations are associated with poor prognosis in pancreatic cancer. Clin Cancer Res, 15(14):4674–4679 DOI: 10.1158/1078-0432.CCR-09-0227.

BomanAL, ZhangC, ZhuX, KahnRA. 2000. A Family of ADP-Ribosylation Factor Effectors That Can Alter Membrane Transport through the trans -Golgi. In: PelhamHRB (ed) Mol Biol Cell, 11(4):1241–1255 DOI: 10.1091/mbc.11.4.1241.

BonnonC, WendelerMW, PaccaudJ-P, HauriH-P. 2010. Selective export of human GPI- anchored proteins from the endoplasmic reticulum. J Cell Sci, 123(10):1705–1715 DOI: 10.1242/jcs.062950.

BosettiC, LucenteforteE, SilvermanDT, PetersenG, BracciPM, JiBT, NegriE, LiD, RischHA, OlsonSH, GallingerS, MillerAB, Bueno-de-MesquitaHB, TalaminiR, PoleselJ, GhadirianP, BaghurstPA, ZatonskiW, FonthamE, BamletWR, HollyEA, BertuccioP, GaoYT, HassanM, YuH, KurtzRC, CotterchioM, SuJ, MaisonneuveP, DuellEJ, BoffettaP, LaVecchiaC. 2012. Cigarette smoking and pancreatic cancer: an analysis from the International Pancreatic Cancer Case-Control Consortium (Panc4). Ann Oncol, 23(7):1880–1888 DOI: 10.1093/annonc/mdr541.

BosettiC, RosatoV, LiD, SilvermanD, PetersenGM, BracciPM, NealeRE, MuscatJ, AndersonK, GallingerS, OlsonSH, MillerAB, Bas Bueno-de-MesquitaH, SceloG, JanoutV, HolcatovaI, LagiouP, SerrainoD, LucenteforteE, FabianovaE, GhadirianP, BaghurstPA, ZatonskiW, ForetovaL, FonthamE, BamletWR, HollyEA, NegriE, HassanM, PrizmentA, CotterchioM, ClearyS, KurtzRC, MaisonneuveP, TrichopoulosD, PoleselJ, DuellEJ, BoffettaP, LaVecchiaC. 2014. Diabetes, antidiabetic medications, and pancreatic cancer risk: an analysis from the International Pancreatic Cancer Case- Control Consortium. Ann Oncol, 25(10):2065–2072 DOI: 10.1093/annonc/mdu276.

Bravo-CorderoJJ, Marrero-DiazR, MegíasD, GenísL, García-GrandeA, GarcíaMA, ArroyoAG, MontoyaMC. 2007. MT1-MMP proinvasive activity is regulated by a novel Rab8- dependent exocytic pathway. EMBO J, 26(6):1499–510 DOI: 10.1038/sj.emboj.7601606.

BridgewaterRE, NormanJC, CaswellPT. 2012. Integrin trafficking at a glance. J Cell Sci, 125(Pt 16):3695–701 DOI: 10.1242/jcs.095810.

121

References

BurnetteWN. 1981. “Western Blotting”: Electrophoretic transfer of proteins from sodium dodecyl sulfate-polyacrylamide gels to unmodified nitrocellulose and radiographic detection with antibody and radioiodinated protein A. Anal Biochem, 112(2):195–203 DOI: 10.1016/0003-2697(81)90281-5.

CambierS, MuD, ConnellDO, BoylenK, TravisW, LiuW, BroaddusVC, NishimuraSL. 2000. A Role for the Integrin αvβ8 in the Negative Regulation of Epithelial Cell Growth 1. :7084– 7093.

CamposT, ZieheJ, PalmaM, EscobarD, TapiaJC, PincheiraR, CastroAF. 2016. Rheb promotes cancer cell survival through p27Kip1-dependent activation of autophagy. Mol Carcinog, 55(2):220–229 DOI: 10.1002/mc.22272.

CandidoS, AbramsSL, SteelmanL, LertpiriyapongK, MartelliAM, CoccoL, RattiS, FolloMY, MurataRM, RosalenPL, LombardiP, MontaltoG, CervelloM, GizakA, RakusD, SuhP-G, LibraM, McCubreyJA. 2018. Metformin influences drug sensitivity in pancreatic cancer cells. Adv Biol Regul, 68:13–30 DOI: 10.1016/J.JBIOR.2018.02.002.

CascettaP, CavaliereA, PiroG, TorroniL, SantoroR, TortoraG, MelisiD, CarboneC. 2018. Pancreatic Cancer and Obesity: Molecular Mechanisms of Cell Transformation and Chemoresistance. Int J Mol Sci, 19(11):3331 DOI: 10.3390/ijms19113331.

CaswellPT, ChanM, LindsayAJ, McCaffreyMW, BoettigerD, NormanJC. 2008. Rab-coupling protein coordinates recycling of α5β1 integrin and EGFR1 to promote cell migration in 3D microenvironments. J Cell Biol, 183(1):143–155 DOI: 10.1083/jcb.200804140.

ChariST, LeibsonCL, RabeKG, TimmonsLJ, RansomJ, deAndradeM, PetersenGM. 2008. Pancreatic Cancer–Associated Diabetes Mellitus: Prevalence and Temporal Association With Diagnosis of Cancer. Gastroenterology, 134(1):95–101 DOI: 10.1053/j.gastro.2007.10.040.

CHENW, DELONGCHAMPSNB, MAOK, BEUVONF, PEYROMAUREM, LIUZ, DINH- XUANAT. 2016. High RhoA expression at the tumor front in clinically localized prostate cancer and association with poor tumor differentiation. Oncol Lett, 11(2):1375–1381 DOI: 10.3892/ol.2015.4070.

ChenY-D, FangY-T, ChengY-L, LinC-F, HsuL-J, WangS-Y, AndersonR, ChangC-P, LinY-S. 2017. Exophagy of annexin A2 via RAB11, RAB8A and RAB27A in IFN-γ-stimulated lung epithelial cells. Sci Rep, 7(1):5676 DOI: 10.1038/s41598-017-06076-4.

122

References

ClarkCE, HingoraniSR, MickR, CombsC, TuvesonDA, VonderheideRH. 2007. Dynamics of the Immune Reaction to Pancreatic Cancer from Inception to Invasion. Cancer Res, 67(19):9518–9527 DOI: 10.1158/0008-5472.CAN-07-0175.

ConroyT, DesseigneF, YchouM, BouchéO, GuimbaudR, BécouarnY, AdenisA, RaoulJ-L, Gourgou-BourgadeS, dela FouchardièreC, BennounaJ, BachetJ-B, Khemissa-AkouzF, Péré-VergéD, DelbaldoC, AssenatE, ChauffertB, MichelP, Montoto-GrillotC, DucreuxM, Groupe Tumeurs Digestives of Unicancer, PRODIGE Intergroup. 2011. FOLFIRINOX versus Gemcitabine for Metastatic Pancreatic Cancer. N Engl J Med, 364(19):1817– 1825 DOI: 10.1056/NEJMoa1011923.

ConwayJRW, JacquemetG. 2019. Cell matrix adhesion in cell migration. Essays Biochem:EBC20190012 DOI: 10.1042/EBC20190012.

CouttsAS, LaThangueNB. 2016. Regulation of actin nucleation and autophagosome formation. Cell Mol Life Sci, 73(17):3249–3263 DOI: 10.1007/s00018-016-2224-z.

CoxD, BrennanM, MoranN. 2010. Integrins as therapeutic targets: lessons and opportunities. Nat Rev Drug Discov, 9(10):804–820 DOI: 10.1038/nrd3266.

DavidCJ, HuangY-H, ChenM, SuJ, ZouY, BardeesyN, Iacobuzio-DonahueCA, MassaguéJ. 2016. TGF-β Tumor Suppression through a Lethal EMT. Cell, 164(5):1015–1030 DOI: 10.1016/j.cell.2016.01.009.

DikicI, ElazarZ. 2018. Mechanism and medical implications of mammalian autophagy. Nat Rev Mol Cell Biol, 19(6):349–364 DOI: 10.1038/s41580-018-0003-4.

DonohueE, ThomasA, MaurerN, ManisaliI, Zeisser-LabouebeM, ZismanN, AndersonHJ, NgSSW, WebbM, BallyM, RobergeM. 2013. The Autophagy Inhibitor Verteporfin Moderately Enhances the Antitumor Activity of Gemcitabine in a Pancreatic Ductal Adenocarcinoma Model. J Cancer, 4(7):585–596 DOI: 10.7150/jca.7030.

DupontN, JiangS, PilliM, OrnatowskiW, BhattacharyaD, DereticV. 2011. Autophagy-based unconventional secretory pathway for extracellular delivery of IL-1β. EMBO J, 30(23):4701–11 DOI: 10.1038/emboj.2011.398.

EdderkaouiM, XuS, ChhedaC, MorvaridiS, HuRW, GrippoPJ, MascariñasE, PrincipeDR, KnudsenB, XueJ, HabtezionA, UyeminamiD, PinkertonKE, PandolSJ. 2016. HDAC3

123

References

mediates smoking-induced pancreatic cancer. Oncotarget, 7(7):7747–60 DOI: 10.18632/oncotarget.6820.

EiblAS and G. 2015. Pancreatic Ductal Adenocarcinoma. Pancreapedia Exocrine Pancreas Knowl Base DOI: 10.3998/PANC.2015.14.

EkeI, CordesN. 2015. Focal adhesion signaling and therapy resistance in cancer. Semin Cancer Biol, 31:65–75 DOI: 10.1016/j.semcancer.2014.07.009.

EkeI, DeuseY, HehlgansS, GurtnerK, KrauseM, BaumannM, ShevchenkoA, SandfortV, CordesN. 2012. β1Integrin/FAK/cortactin signaling is essential for human head and neck cancer resistance to radiotherapy. J Clin Invest, 122(4):1529–40 DOI: 10.1172/JCI61350.

EkeI, KochU, HehlgansS, SandfortV, StanchiF, ZipsD, BaumannM, ShevchenkoA, PilarskyC, HaaseM, BarettonGB, CallejaV, LarijaniB, FässlerR, CordesN. 2010. PINCH1 regulates Akt1 activation and enhances radioresistance by inhibiting PP1alpha. J Clin Invest, 120(7):2516–27 DOI: 10.1172/JCI41078.

EserS, SchniekeA, SchneiderG, SaurD. 2014. Oncogenic KRAS signalling in pancreatic cancer. Br J Cancer, 111(5):817–822 DOI: 10.1038/bjc.2014.215.

FeigC, GopinathanA, NeesseA, ChanDS, CookN, TuvesonDA. 2012. The pancreas cancer microenvironment. Clin Cancer Res, 18(16):4266–76 DOI: 10.1158/1078-0432.CCR-11- 3114.

FerdekPE, JakubowskaMA. 2017. Biology of pancreatic stellate cells-more than just pancreatic cancer. Pflugers Arch, 469(9):1039–1050 DOI: 10.1007/s00424-017-1968-0.

FerlayJ, SoerjomataramI, DikshitR, EserS, MathersC, RebeloM, ParkinDM, FormanD, BrayF. 2015. Cancer incidence and mortality worldwide: Sources, methods and major patterns in GLOBOCAN 2012. Int J Cancer, 136(5):E359–E386 DOI: 10.1002/ijc.29210.

FerreiraRMM, SanchoR, MessalHA, NyeE, Spencer-DeneB, StoneRK, StampG, RosewellI, QuagliaA, BehrensA. 2017. Duct- and Acinar-Derived Pancreatic Ductal Adenocarcinomas Show Distinct Tumor Progression and Marker Expression. Cell Rep, 21(4):966–978 DOI: 10.1016/j.celrep.2017.09.093.

FitzgeraldTL, LertpiriyapongK, MartelliAM, LibraM, CandidoS, MontaltoG, CervelloM, SteelmanL, AbramsSL, McCubreyJA. 2015. Roles of EGFR and KRAS and their

124

References

downstream signaling pathways in pancreatic cancer and pancreatic cancer stem cells. Adv Biol Regul, 59:65–81 DOI: 10.1016/j.jbior.2015.06.003.

FokasE, O’NeillE, Gordon-WeeksA, MukherjeeS, McKennaWG, MuschelRJ. 2015. Pancreatic ductal adenocarcinoma: From genetics to biology to radiobiology to oncoimmunology and all the way back to the clinic. Biochim Biophys Acta - Rev Cancer, 1855(1):61–82 DOI: 10.1016/j.bbcan.2014.12.001.

DeFranceschiN, HamidiH, AlankoJ, SahgalP, IvaskaJ. 2015. Integrin traffic - the update. J Cell Sci, 128(5):839–52 DOI: 10.1242/jcs.161653.

FreeRB, HazelwoodLA, SibleyDR. 2009. Identifying Novel Protein-Protein Interactions Using Co-Immunoprecipitation and Mass Spectroscopy. In: Current Protocols in Neuroscience. John Wiley & Sons, Inc., Hoboken, NJ, USA, pp. 5.28.1-5.28.14 DOI: 10.1002/0471142301.ns0528s46.

Freed-PastorWA, PrivesC. 2012. Mutant p53: one name, many proteins. Genes Dev, 26(12):1268–86 DOI: 10.1101/gad.190678.112.

FritzG, JustI, KainaB. 1999. Rho GTPases are over-expressed in human tumors. Int J Cancer, 81(5):682–687 DOI: 10.1002/(SICI)1097-0215(19990531)81:5<682::AID- IJC2>3.0.CO;2-B.

FujimuraK, ChoiS, WyseM, StrnadelJ, WrightT, KlemkeR. 2015. Eukaryotic Translation Initiation Factor 5A (EIF5A) Regulates Pancreatic Cancer Metastasis by Modulating RhoA and Rho-associated Kinase (ROCK) Protein Expression Levels. J Biol Chem, 290(50):29907–19 DOI: 10.1074/jbc.M115.687418.

FukuiK, TamuraS, WadaA, KamadaY, SawaiY, ImanakaK, KudaraT, ShimomuraI, HayashiN. 2006. Expression and prognostic role of RhoA GTPases in hepatocellular carcinoma. J Cancer Res Clin Oncol, 132(10):627–633 DOI: 10.1007/s00432-006-0107-7.

GaianigoN, MelisiD, CarboneC. 2017. EMT and Treatment Resistance in Pancreatic Cancer. Cancers (Basel), 9(9) DOI: 10.3390/cancers9090122.

GarberME, TroyanskayaOG, SchluensK, PetersenS, ThaeslerZ, Pacyna-GengelbachM, van deRijnM, RosenGD, PerouCM, WhyteRI, AltmanRB, BrownPO, BotsteinD, PetersenI. 2001. Diversity of gene expression in adenocarcinoma of the lung. Proc Natl Acad Sci U S A, 98(24):13784–9 DOI: 10.1073/pnas.241500798.

125

References

Garrido-LagunaI, HidalgoM. 2015. Pancreatic cancer: from state-of-the-art treatments to promising novel therapies. Nat Rev Clin Oncol, 12(6):319–334 DOI: 10.1038/nrclinonc.2015.53.

GaudetP, LivstoneMS, LewisSE, ThomasPD. 2011. Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium. Brief Bioinform, 12(5):449– 462 DOI: 10.1093/bib/bbr042.

GoldbergJ. 2000. Decoding of sorting signals by coatomer through a GTPase switch in the COPI coat complex. Cell, 100(6):671–9 DOI: 10.1016/s0092-8674(00)80703-5.

GoleyED, RodenbuschSE, MartinAC, WelchMD. 2004. Critical Conformational Changes in the Arp2/3 Complex Are Induced by Nucleotide and Nucleation Promoting Factor. Mol Cell, 16(2):269–279 DOI: 10.1016/J.MOLCEL.2004.09.018.

GolubovskayaVM, CanceWG. 2007. Focal Adhesion Kinase and p53 Signaling in Cancer Cells. In: International review of cytology. pp. 103–153 DOI: 10.1016/S0074- 7696(07)63003-4.

GonzalesPA, PisitkunT, HoffertJD, TchapyjnikovD, StarRA, KletaR, WangNS, KnepperMA. 2009. Large-Scale Proteomics and Phosphoproteomics of Urinary Exosomes. J Am Soc Nephrol, 20(2):363–379 DOI: 10.1681/ASN.2008040406.

Gonzalez-BegneM, LuB, HanX, HagenFK, HandAR, MelvinJE, Yates,JR. 2009. Proteomic Analysis of Human Parotid Gland Exosomes by Multidimensional Protein Identification Technology (MudPIT). J Proteome Res, 8(3):1304–1314 DOI: 10.1021/pr800658c.

GournierH, GoleyED, NiederstrasserH, TrinhT, WelchMD. 2001. Reconstitution of human Arp2/3 complex reveals critical roles of individual subunits in complex structure and activity. Mol Cell, 8(5):1041–52 DOI: 10.1016/s1097-2765(01)00393-8.

GrabskiR, HayJ, SztulE. 2012. Tethering factor P115: a new model for tether-SNARE interactions. Bioarchitecture, 2(5):175–80 DOI: 10.4161/bioa.21702.

GrantBD, DonaldsonJG. 2009. Pathways and mechanisms of endocytic recycling. Nat Rev Mol Cell Biol, 10(9):597–608 DOI: 10.1038/nrm2755.

GuM, LaJoieD, ChenOS, VonAppenA, LadinskyMS, ReddMJ, NikolovaL, BjorkmanPJ, SundquistWI, UllmanKS, FrostA. 2017. LEM2 recruits CHMP7 for ESCRT-mediated

126

References

nuclear envelope closure in fission yeast and human cells. Proc Natl Acad Sci U S A, 114(11):E2166–E2175 DOI: 10.1073/pnas.1613916114.

GuerreroPA, TchaichaJH, ChenZ, MoralesJE, McCartyN, WangQ, SulmanEP, FullerG, LangFF, RaoG, McCartyJH. 2017. Glioblastoma stem cells exploit the αvβ8 integrin- TGFβ1 signaling axis to drive tumor initiation and progression. Oncogene, 36(47):6568– 6580 DOI: 10.1038/onc.2017.248.

HahnSA, SchutteM, HoqueATMS, MoskalukCA, daCostaLT, RozenblumE, WeinsteinCL, FischerA, YeoCJ, HrubanRH, KernSE. 1996. DPC4, A Candidate Tumor Suppressor Gene at Human Chromosome 18q21.1. Science (80- ), 271(5247):350–353 DOI: 10.1126/science.271.5247.350.

HallEJ, GiacciaAJ. 2012. Radiobiology for the radiologist / Eric J. Hall, Amato J. Giaccia. - Version details - Trove. [accessed: 10/21/2019] URL: https://trove.nla.gov.au/work/9970501?selectedversion=NBD46579610.

HamidiH, IvaskaJ. 2018. Every step of the way: integrins in cancer progression and metastasis. Nat Rev Cancer, 18(9):533–548 DOI: 10.1038/s41568-018-0038-z.

HanahanD, WeinbergRA. 2011. Hallmarks of Cancer: The Next Generation. Cell, 144(5):646–674 DOI: 10.1016/j.cell.2011.02.013.

HanyalogluAC. 2018. Advances in Membrane Trafficking and Endosomal Signaling of G Protein-Coupled Receptors. In: International review of cell and molecular biology. pp. 93–131 DOI: 10.1016/bs.ircmb.2018.03.001.

HaqqJ, HowellsLM, GarceaG, MetcalfeMS, StewardWP, DennisonAR. 2014. Pancreatic stellate cells and pancreas cancer: Current perspectives and future strategies. Eur J Cancer, 50(15):2570–2582 DOI: 10.1016/j.ejca.2014.06.021.

HartwigW, WernerJ, JägerD, DebusJ, BüchlerMW. 2013. Improvement of surgical results for pancreatic cancer. Lancet Oncol, 14(11):e476–e485 DOI: 10.1016/S1470- 2045(13)70172-4.

HeJ, LiuY, ZhangL, ZhangH. 2018. Integrin Subunit beta 8 (ITGB8) Upregulation Is an Independent Predictor of Unfavorable Survival of High-Grade Serous Ovarian Carcinoma Patients. Med Sci Monit, 24:8933–8940 DOI: 10.12659/MSM.911518.

127

References

HehlgansS, HaaseM, CordesN. 2007. Signalling via integrins: Implications for cell survival and anticancer strategies. Biochim Biophys Acta - Rev Cancer, 1775(1):163–180 DOI: 10.1016/j.bbcan.2006.09.001.

HertzerKM, XuM, MoroA, DawsonDW, DuL, LiG, ChangH-H, StarkAP, JungX, HinesOJ, EiblG. 2016. Robust Early Inflammation of the Peripancreatic Visceral Adipose Tissue During Diet-Induced Obesity in the KrasG12D Model of Pancreatic Cancer. Pancreas, 45(3):458–65 DOI: 10.1097/MPA.0000000000000497.

HezelAF, DeshpandeV, ZimmermanSM, ContinoG, AlagesanB, O’DellMR, RiveraLB, HarperJ, LonningS, BrekkenRA, BardeesyN. 2012. TGF- and v 6 Integrin Act in a Common Pathway to Suppress Pancreatic Cancer Progression. Cancer Res, 72(18):4840–4845 DOI: 10.1158/0008-5472.CAN-12-0634.

HidalgoM. 2010. Pancreatic Cancer. N Engl J Med, 362(17):1605–1617 DOI: 10.1056/NEJMra0901557.

VonHoffDD, RamanathanRK, BoradMJ, LaheruDA, SmithLS, WoodTE, KornRL, DesaiN, TrieuV, IglesiasJL, ZhangH, Soon-ShiongP, ShiT, RajeshkumarNV, MaitraA, HidalgoM. 2011. Gemcitabine Plus nab -Paclitaxel Is an Active Regimen in Patients With Advanced Pancreatic Cancer: A Phase I/II Trial. J Clin Oncol, 29(34):4548–4554 DOI: 10.1200/JCO.2011.36.5742.

HondaR, YasudaH. 1999. Association of p19ARF with Mdm2 inhibits ubiquitin ligase activity of Mdm2 for tumor suppressor p53. EMBO J, 18(1):22–27 DOI: 10.1093/emboj/18.1.22.

HoriuchiA, ImaiT, WangC, OhiraS, FengY, NikaidoT, KonishiI. 2003. Up-Regulation of Small GTPases, RhoA and RhoC, Is Associated with Tumor Progression in Ovarian Carcinoma. Lab Investig, 83(6):861–870 DOI: 10.1097/01.LAB.0000073128.16098.31.

HrubanRH, GogginsM, ParsonsJ, KernSE. 2000. Progression Model for Pancreatic Cancer. Clin Cancer Res, 6(8) [accessed: 03/30/2017] URL: http://clincancerres.aacrjournals.org/content/6/8/2969.

HuW, FengZ, LevineAJ. 2012. The Regulation of Multiple p53 Stress Responses is Mediated through MDM2. Genes Cancer, 3(3–4):199–208 DOI: 10.1177/1947601912454734.

HuangC, LiY, LiZ, XuY, LiN, GeY, DongJ, ChangA, ZhaoT, WangX, WangH, YangS, XieK, HaoJ, RenH. 2019. LIMS1 Promotes Pancreatic Cancer Cell Survival under Oxygen-

128

References

Glucose Deprivation Conditions by Enhancing HIF1A Protein Translation. Clin Cancer Res DOI: 10.1158/1078-0432.CCR-18-3533.

HurleyJH, HansonPI. 2010. Membrane budding and scission by the ESCRT machinery: it’s all in the neck. Nat Rev Mol Cell Biol, 11(8):556–566 DOI: 10.1038/nrm2937.

HutchingsD, WatersKM, WeissMJ, WolfgangCL, MakaryMA, HeJ, CameronJL, WoodLD, HrubanRH. 2018. Cancerization of the Pancreatic Ducts. Am J Surg Pathol, 42(11):1556–1561 DOI: 10.1097/PAS.0000000000001148.

HuttlinEL, TingL, BrucknerRJ, GebreabF, GygiMP, SzpytJ, TamS, ZarragaG, ColbyG, BaltierK, DongR, GuaraniV, VaitesLP, OrdureauA, RadR, EricksonBK, WührM, ChickJ, ZhaiB, KolippakkamD, MintserisJ, ObarRA, HarrisT, Artavanis-TsakonasS, SowaME, DeCamilliP, PauloJA, HarperJW, GygiSP. 2015. The BioPlex Network: A Systematic Exploration of the Human Interactome. Cell, 162(2):425–440 DOI: 10.1016/j.cell.2015.06.043.

HynesRO. 2002. Integrins: bidirectional, allosteric signaling machines. Cell, 110(6):673–87 DOI: 10.1016/s0092-8674(02)00971-6.

Iacobuzio-DonahueCA, SongJ, ParmiagianiG, YeoCJ, HrubanRH, KernSE. 2004. Missense mutations of MADH4: characterization of the mutational hot spot and functional consequences in human tumors. Clin Cancer Res, 10(5):1597–604 [accessed: 10/19/2019] URL: http://www.ncbi.nlm.nih.gov/pubmed/15014009.

JaffeAB, HallA. 2005. RHO GTPASES: Biochemistry and Biology. Annu Rev Cell Dev Biol, 21(1):247–269 DOI: 10.1146/annurev.cellbio.21.020604.150721.

JankuF, McConkeyDJ, HongDS, KurzrockR. 2011. Autophagy as a target for anticancer therapy. Nat Rev Clin Oncol, 8(9):528–539 DOI: 10.1038/nrclinonc.2011.71.

JinS, LeeW-C, AustD, PilarskyC, CordesN. 2019. β8 Integrin Mediates Pancreatic Cancer Cell Radiochemoresistance. Mol Cancer Res:molcanres.1352.2018 DOI: 10.1158/1541- 7786.MCR-18-1352.

JoachimJ, JefferiesHBJ, RaziM, FrithD, SnijdersAP, ChakravartyP, JudithD, ToozeSA. 2015. Activation of ULK Kinase and Autophagy by GABARAP Trafficking from the Centrosome Is Regulated by WAC and GM130. Mol Cell, 60(6):899–913 DOI: 10.1016/j.molcel.2015.11.018.

129

References

JoinerM, KogelA van der. 2009. Basic clinical radiobiology. Hodder Arnold [accessed: 10/21/2019] URL: https://books.google.de/books?id=D54TAQAAMAAJ&hl=de&source=gbs_book_other_v ersions_r&cad=2.

JonesS, ZhangX, ParsonsDW, LinJC-H, LearyRJ, AngenendtP, MankooP, CarterH, KamiyamaH, JimenoA, HongS-M, FuB, LinM-T, CalhounES, KamiyamaM, WalterK, NikolskayaT, NikolskyY, HartiganJ, SmithDR, HidalgoM, LeachSD, KleinAP, JaffeeEM, GogginsM, MaitraA, Iacobuzio-DonahueC, EshlemanJR, KernSE, HrubanRH, KarchinR, PapadopoulosN, ParmigianiG, VogelsteinB, VelculescuVE, KinzlerKW. 2008. Core signaling pathways in human pancreatic cancers revealed by global genomic analyses. Science, 321(5897):1801–6 DOI: 10.1126/science.1164368.

JuH-Q, GochoT, AguilarM, WuM, ZhuangZ-N, FuJ, YanagaK, HuangP, ChiaoPJ. 2015. Mechanisms of Overcoming Intrinsic Resistance to Gemcitabine in Pancreatic Ductal Adenocarcinoma through the Redox Modulation. Mol Cancer Ther, 14(3):788–798 DOI: 10.1158/1535-7163.MCT-14-0420.

KaboordB, PerrM. 2008. Isolation of Proteins and Protein Complexes by Immunoprecipitation. In: Humana Press, pp. 349–364 DOI: 10.1007/978-1-60327-064- 9_27.

KamisawaT, WoodLD, ItoiT, TakaoriK. 2016. Pancreatic cancer Seminar. Lancet, 388(10039):73–85 DOI: 10.1016/S0140-6736(16)00141-0.

KangR, TangD, SchapiroNE, LiveseyKM, FarkasA, LoughranP, BierhausA, LotzeMT, ZehHJ. 2010. The receptor for advanced glycation end products (RAGE) sustains autophagy and limits apoptosis, promoting pancreatic tumor cell survival. Cell Death Differ, 17(4):666–676 DOI: 10.1038/cdd.2009.149.

KantetiR, BatraSK, LennonFE, SalgiaR. 2016. FAK and paxillin , two potential targets in pancreatic cancer.

KastDJ, DominguezR. 2017. The Cytoskeleton–Autophagy Connection. Curr Biol, 27(8):R318–R326 DOI: 10.1016/j.cub.2017.02.061.

KenificCM, DebnathJ. 2015. Cellular and metabolic functions for autophagy in cancer cells. Trends Cell Biol, 25(1):37–45 DOI: 10.1016/J.TCB.2014.09.001.

130

References

KimS-H, KimS-C, KuJ-L. 2017. Metformin increases chemo-sensitivity via gene downregulation encoding DNA replication proteins in 5-Fu resistant colorectal cancer cells. Oncotarget, 8(34):56546–56557 DOI: 10.18632/oncotarget.17798.

KleeffJ, KorcM, ApteM, LaVecchiaC, JohnsonCD, BiankinAV., NealeRE, TemperoM, TuvesonDA, HrubanRH, NeoptolemosJP. 2016. Pancreatic cancer. Nat Rev Dis Prim, 2:16022 DOI: 10.1038/nrdp.2016.22.

KlimstraDS, LongneckerDS. 1994. K-ras mutations in pancreatic ductal proliferative lesions. Am J Pathol, 145(6):1547–50 [accessed: 10/28/2019] URL: http://www.ncbi.nlm.nih.gov/pubmed/7992857.

KoenigA, MuellerC, HaselC, AdlerG, MenkeA. 2006. Collagen Type I Induces Disruption of E-Cadherin–Mediated Cell-Cell Contacts and Promotes Proliferation of Pancreatic Carcinoma Cells. Cancer Res, 66(9):4662–4671 DOI: 10.1158/0008-5472.CAN-05- 2804.

KolesnickR, FuksZ. 2003. Radiation and ceramide-induced apoptosis. Oncogene, 22(37):5897–5906 DOI: 10.1038/sj.onc.1206702.

KorcM, JeonCY, EdderkaouiM, PandolSJ, PetrovMS. 2017. Tobacco and alcohol as risk factors for pancreatic cancer. Best Pract Res Clin Gastroenterol, 31(5):529–536 DOI: 10.1016/J.BPG.2017.09.001.

KowalJ, ArrasG, ColomboM, JouveM, MorathJP, Primdal-BengtsonB, DingliF, LoewD, TkachM, ThéryC. 2016. Proteomic comparison defines novel markers to characterize heterogeneous populations of extracellular vesicle subtypes. Proc Natl Acad Sci U S A, 113(8):E968-77 DOI: 10.1073/pnas.1521230113.

KruppaAJ, Kendrick-JonesJ, BussF. 2016. Myosins, Actin and Autophagy. Traffic, 17(8):878–890 DOI: 10.1111/tra.12410.

KURIENB, SCOFIELDR. 2006. Western blotting. Methods, 38(4):283–293 DOI: 10.1016/j.ymeth.2005.11.007.

Lakhe-ReddyS, KhanS, KonieczkowskiM, JaradG, WuKL, ReichardtLF, TakaiY, BruggemanLA, WangB, SedorJR, SchellingJR. 2006. Beta8 integrin binds Rho GDP dissociation inhibitor-1 and activates Rac1 to inhibit mesangial cell myofibroblast differentiation. J Biol Chem, 281(28):19688–99 DOI: 10.1074/jbc.M601110200.

131

References

LazarI, ClementE, Ducoux-PetitM, DenatL, SoldanV, DauvillierS, BalorS, Burlet-SchiltzO, LarueL, MullerC, NietoL. 2015. Proteome characterization of melanoma exosomes reveals a specific signature for metastatic cell lines. Pigment Cell Melanoma Res, 28(4):464–475 DOI: 10.1111/pcmr.12380.

LegateKR, MontañezE, KudlacekO, FässlerR. 2006. ILK, PINCH and parvin: The tIPP of integrin signalling. Nat Rev Mol Cell Biol, 7(1):20–31 DOI: 10.1038/nrm1789.

LegateKR, WickströmSA, FässlerR. 2009. Genetic and cell biological analysis of integrin outside-in signaling. Genes Dev, 23(4):397–418 DOI: 10.1101/gad.1758709.

LevyJMM, TowersCG, ThorburnA. 2017. Targeting autophagy in cancer. Nat Rev Cancer, 17(9):528–542 DOI: 10.1038/nrc.2017.53.

LewisMJ, PelhamHR. 1992. Sequence of a second human KDEL receptor. J Mol Biol, 226(4):913–6 DOI: 10.1016/0022-2836(92)91039-r.

LiXR, JiF, OuyangJ, WuW, QianLY, YangKY. 2006. Overexpression of RhoA is associated with poor prognosis in hepatocellular carcinoma. Eur J Surg Oncol, 32(10):1130–4 DOI: 10.1016/j.ejso.2006.05.012.

LiY, BianX, WeiS, HeM, YangY. 2019. The relationship between pancreatic cancer and type 2 diabetes: cause and consequence. Cancer Manag Res, 11:8257–8268 DOI: 10.2147/CMAR.S211972.

LiangB, PengP, ChenS, LiL, ZhangM, CaoD, YangJ, LiH, GuiT, LiX, ShenK. 2013. Characterization and proteomic analysis of ovarian cancer-derived exosomes. J Proteomics, 80:171–182 DOI: 10.1016/j.jprot.2012.12.029.

LuoW, WangY, ReiserG. 2007. p24A, a type I transmembrane protein, controls ARF1- dependent resensitization of protease-activated receptor-2 by influence on receptor trafficking. J Biol Chem, 282(41):30246–55 DOI: 10.1074/jbc.M703205200.

LuoW, WangY, ReiserG. 2011. Proteinase-activated receptors, nucleotide P2Y receptors, and μ-opioid receptor-1B are under the control of the type I transmembrane proteins p23 and p24A in post-Golgi trafficking. J Neurochem, 117(1):71–81 DOI: 10.1111/j.1471-4159.2011.07173.x.

LüttgesJ, GalehdariH, BröckerV, Schwarte-WaldhoffI, Henne-BrunsD, KlöppelG, SchmiegelW, HahnSA. 2001. Allelic Loss Is Often the First Hit in the Biallelic

132

References

Inactivation of the p53 and DPC4 Genes During Pancreatic Carcinogenesis. Am J Pathol, 158(5):1677–1683 DOI: 10.1016/S0002-9440(10)64123-5.

MACHESKYML, REEVESE, WIENTJESF, MATTHEYSEJF, GROGANA, TOTTYFN, BURLINGAMELA, HSUANJJ, SEGALWA. 1997. Mammalian actin-related protein 2/3 complex localizes to regions of lamellipodial protrusion and is composed of evolutionarily conserved proteins. Biochem J, 328(1):105–112 DOI: 10.1042/bj3280105.

MackehR, PerdizD, LorinS, CodognoP, PousC. 2013. Autophagy and microtubules - new story, old players. J Cell Sci, 126(5):1071–1080 DOI: 10.1242/jcs.115626.

MaesH, RubioN, GargAD, AgostinisP. 2013. Autophagy: shaping the tumor microenvironment and therapeutic response. Trends Mol Med, 19(7):428–446 DOI: 10.1016/j.molmed.2013.04.005.

MahmoodT, YangP-C. 2012. Western blot: technique, theory, and trouble shooting. N Am J Med Sci, 4(9):429–34 DOI: 10.4103/1947-2714.100998.

MalricL, MonferranS, DelmasC, ArnauducF, DahanP, BoyrieS, DeshorsP, LubranoVF, Ferreira Da MotaD, GilhodesJ, FilleronT, SiegfriedA, EvrardSM, Kowalski-ChauvelA, Cohen-Jonathan MoyalE, ToulasC, LemariéA. 2018. Inhibiting Integrin β8 to Differentiate and Radiosensitize Glioblastoma-initiating Cells. Mol Cancer Res:molcanres.0386.2018 DOI: 10.1158/1541-7786.MCR-18-0386.

ManciasJD, GoldbergJ. 2008. Structural basis of cargo membrane protein discrimination by the human COPII coat machinery. EMBO J, 27(21):2918–2928 DOI: 10.1038/emboj.2008.208.

ManciasJD, GoldbergJ. 2007. The Transport Signal on Sec22 for Packaging into COPII- Coated Vesicles Is a Conformational Epitope. Mol Cell, 26(3):403–414 DOI: 10.1016/j.molcel.2007.03.017.

MassaguéJ, SeoaneJ, WottonD. 2005. Smad transcription factors. Genes Dev, 19(23):2783– 810 DOI: 10.1101/gad.1350705.

MatsudaY, KureS, IshiwataT. 2012. Nestin and other putative cancer stem cell markers in pancreatic cancer. Rev Med Mol Morphol, 45:59–65 DOI: 10.1007/s00795-012-0571-x.

133

References

McCartyJH, CookAA, HynesRO. 2005. An interaction between {alpha}v{beta}8 integrin and Band 4.1B via a highly conserved region of the Band 4.1 C-terminal domain. Proc Natl Acad Sci U S A, 102(38):13479–83 DOI: 10.1073/pnas.0506068102.

McLaughlinN, AnnabiB, BouzeghraneM, TemmeA, BaharyJ-P, MoumdjianR, BéliveauR. 2006. The Survivin-mediated radioresistant phenotype of glioblastomas is regulated by RhoA and inhibited by the green tea polyphenol (−)-epigallocatechin-3-gallate. Brain Res, 1071(1):1–9 DOI: 10.1016/J.BRAINRES.2005.10.009.

MelserS, ChatelainEH, LavieJ, MahfoufW, JoseC, ObreE, GoordenS, PriaultM, ElgersmaY, RezvaniHR, RossignolR, BénardG. 2013. Rheb regulates mitophagy induced by mitochondrial energetic status. Cell Metab, 17(5):719–30 DOI: 10.1016/j.cmet.2013.03.014.

MetcalfD, IsaacsAM. 2010. The role of ESCRT proteins in fusion events involving lysosomes, endosomes and autophagosomes. In: Biochemical Society Transactions. pp. 1469– 1473 DOI: 10.1042/BST0381469.

MikiH, SasakiT, TakaiY, TakenawaT. 1998. Induction of filopodium formation by a WASP- related actin-depolymerizing protein N-WASP. Nature, 391(6662):93–96 DOI: 10.1038/34208.

MiyamotoH, MurakamiT, TsuchidaK, SuginoH, MiyakeH, TashiroS. 2004. Tumor-Stroma Interaction of Human Pancreatic Cancer: Acquired Resistance to Anticancer Drugs and Proliferation Regulation Is Dependent on Extracellular Matrix Proteins. Pancreas, 28(1):38–44 DOI: 10.1097/00006676-200401000-00006.

ModingEJ, KastanMB, KirschDG. 2013. Strategies for optimizing the response of cancer and normal tissues to radiation. Nat Rev Drug Discov, 12(7):526–542 DOI: 10.1038/nrd4003.

MooreMJ, GoldsteinD, HammJ, FigerA, HechtJR, GallingerS, AuHJ, MurawaP, WaldeD, WolffRA, CamposD, LimR, DingK, ClarkG, Voskoglou-NomikosT, PtasynskiM, ParulekarW, National Cancer Institute of Canada Clinical Trials Group. 2007. Erlotinib Plus Gemcitabine Compared With Gemcitabine Alone in Patients With Advanced Pancreatic Cancer: A Phase III Trial of the National Cancer Institute of Canada Clinical Trials Group. J Clin Oncol, 25(15):1960–1966 DOI: 10.1200/JCO.2006.07.9525.

134

References

MorrisJP, WangSC, HebrokM. 2010. KRAS, Hedgehog, Wnt and the twisted developmental biology of pancreatic ductal adenocarcinoma. Nat Rev Cancer, 10(10):683–695 DOI: 10.1038/nrc2899.

MoyleM, NapierM a, McLeanJW. 1991. Cloning and expression of a divergent integrin subunit beta 8. J Biol Chem, 266(29):19650–19658.

MurrowL, DebnathJ. 2013. Autophagy as a Stress-Response and Quality-Control Mechanism: Implications for Cell Injury and Human Disease. Annu Rev Pathol Mech Dis, 8(1):105–137 DOI: 10.1146/annurev-pathol-020712-163918.

NachuryMV., LoktevAV., ZhangQ, WestlakeCJ, PeränenJ, MerdesA, SlusarskiDC, SchellerRH, BazanJF, SheffieldVC, JacksonPK. 2007. A Core Complex of BBS Proteins Cooperates with the GTPase Rab8 to Promote Ciliary Membrane Biogenesis. Cell, 129(6):1201–1213 DOI: 10.1016/j.cell.2007.03.053.

NakamuraN. 2010. Emerging New Roles of GM130, a cis-Golgi Matrix Protein, in Higher Order Cell Functions. J Pharmacol Sci, 112(3):255–264 DOI: 10.1254/JPHS.09R03CR.

NakamuraN, LoweM, LevineTP, RabouilleC, WarrenG. 1997. The Vesicle Docking Protein p115 Binds GM130, a cis-Golgi Matrix Protein, in a Mitotically Regulated Manner. Cell, 89(3):445–455 DOI: 10.1016/S0092-8674(00)80225-1.

NakamuraN, RabouilleC, WatsonR, NilssonT, HuiN, SlusarewiczP, KreisTE, WarrenG. 1995. Characterization of a cis-Golgi matrix protein, GM130. J Cell Biol, 131(6):1715–1726 DOI: 10.1083/jcb.131.6.1715.

NarayananV, WeekesCD. 2016. Molecular therapeutics in pancreas cancer. World J Gastrointest Oncol, 8(4):366–79 DOI: 10.4251/wjgo.v8.i4.366.

NeillT, SchaeferL, IozzoRV. 2014. Instructive roles of extracellular matrix on autophagy. Am J Pathol, 184(8):2146–53 DOI: 10.1016/j.ajpath.2014.05.010.

NeoptolemosJP, KleeffJ, MichlP, CostelloE, GreenhalfW, PalmerDH. 2018. Therapeutic developments in pancreatic cancer: current and future perspectives. Nat Rev Gastroenterol Hepatol, 15(6):333–348 DOI: 10.1038/s41575-018-0005-x.

NishimuraSL, SheppardD, PytelaR. 1994. Integrin alpha v beta 8. Interaction with vitronectin and functional divergence of the beta 8 cytoplasmic domain. J Biol Chem,

135

References

269(46):28708–15 [accessed: 04/19/2017] URL: http://www.ncbi.nlm.nih.gov/pubmed/7525578.

Nolan-StevauxO, LauJ, TruittML, ChuGC, HebrokM, Fernandez-ZapicoME, HanahanD. 2009. GLI1 is regulated through Smoothened-independent mechanisms in neoplastic pancreatic ducts and mediates PDAC cell survival and transformation. Genes Dev, 23(1):24–36 DOI: 10.1101/gad.1753809.

OettleH, NeuhausP, HochhausA, HartmannJT, GellertK, RidwelskiK, NiedergethmannM, ZülkeC, FahlkeJ, ArningMB, SinnM, HinkeA, RiessH. 2013. Adjuvant Chemotherapy With Gemcitabine and Long-term Outcomes Among Patients With Resected Pancreatic Cancer. JAMA, 310(14):1473 DOI: 10.1001/jama.2013.279201.

OettleH, PostS, NeuhausP, GellertK, LangrehrJ, RidwelskiK, SchrammH, FahlkeJ, ZuelkeC, BurkartC, GutberletK, KettnerE, SchmalenbergH, Weigang-KoehlerK, BechsteinW-O, NiedergethmannM, Schmidt-WolfI, RollL, DoerkenB, RiessH. 2007. Adjuvant Chemotherapy With Gemcitabine vs Observation in Patients Undergoing Curative-Intent Resection of Pancreatic Cancer. JAMA, 297(3):267 DOI: 10.1001/jama.297.3.267.

OlivaresO, MayersJR, GouirandV, TorrenceME, GicquelT, BorgeL, LacS, RoquesJ, LavautM-N, BerthezèneP, RubisM, SecqV, GarciaS, MoutardierV, LombardoD, IovannaJL, TomasiniR, GuillaumondF, VanderHeidenMG, VasseurS. 2017. Collagen- derived proline promotes pancreatic ductal adenocarcinoma cell survival under nutrient limited conditions. Nat Commun, 8(1):16031 DOI: 10.1038/ncomms16031.

OnoderaY, NamJ-M, HashimotoA, NormanJC, ShiratoH, HashimotoS, SabeH. 2012. Rab5c promotes AMAP1–PRKD2 complex formation to enhance β1 integrin recycling in EGF- induced cancer invasion. J Cell Biol, 197(7):983–996 DOI: 10.1083/jcb.201201065.

OrthM, MetzgerP, GerumS, MayerleJ, SchneiderG, BelkaC, SchnurrM, LauberK. 2019. Pancreatic ductal adenocarcinoma: biological hallmarks, current status, and future perspectives of combined modality treatment approaches. Radiat Oncol, 14(1):141 DOI: 10.1186/s13014-019-1345-6.

OzakiT, NakagawaraA. 2011. Role of p53 in Cell Death and Human Cancers. Cancers (Basel), 3(1):994–1013 DOI: 10.3390/cancers3010994.

136

References

OzawaA, SatoY, ImabayashiT, UemuraT, TakagiJ, SekiguchiK. 2016. Molecular Basis of the Ligand Binding Specificity of αvβ8 Integrin. J Biol Chem, 291(22):11551–65 DOI: 10.1074/jbc.M116.719138.

PaccaudJP, ReithW, CarpentierJL, RavazzolaM, AmherdtM, SchekmanR, OrciL. 1996. Cloning and functional characterization of mammalian homologues of the COPII component Sec23. Mol Biol Cell, 7(10):1535–1546 DOI: 10.1091/mbc.7.10.1535.

PannalaR, BasuA, PetersenGM, ChariST. 2009. New-onset diabetes: a potential clue to the early diagnosis of pancreatic cancer. Lancet Oncol, 10(1):88–95 DOI: 10.1016/S1470- 2045(08)70337-1.

ParkinDM. 2011. 2. Tobacco-attributable cancer burden in the UK in 2010. Br J Cancer, 105(S2):S6–S13 DOI: 10.1038/bjc.2011.475.

PaulNR, JacquemetG, CaswellPT. 2015. Endocytic Trafficking of Integrins in Cell Migration. Curr Biol, 25(22):R1092–R1105 DOI: 10.1016/J.CUB.2015.09.049.

PegtelDM, GouldSJ. 2019. Exosomes. Annu Rev Biochem, 88(1):487–514 DOI: 10.1146/annurev-biochem-013118-111902.

PereraRM, BardeesyN. 2015. Pancreatic Cancer Metabolism: Breaking It Down to Build It Back Up. Cancer Discov, 5(12):1247–61 DOI: 10.1158/2159-8290.CD-15-0671.

PlowEF, HaasTA, ZhangL, LoftusJ, SmithJW. 2000. Ligand binding to integrins. J Biol Chem, 275(29):21785–8 DOI: 10.1074/jbc.R000003200.

PollardTD. 2007. Regulation of Actin Filament Assembly by Arp2/3 Complex and Formins. Annu Rev Biophys Biomol Struct, 36(1):451–477 DOI: 10.1146/annurev.biophys.35.040405.101936.

PrincipeS, JonesEE, KimY, SinhaA, NyalwidheJO, BrooksJ, SemmesOJ, TroyerDA, LanceRS, KislingerT, DrakeRR. 2013. In-depth proteomic analyses of exosomes isolated from expressed prostatic secretions in urine. Proteomics, 13(10–11):1667–1671 DOI: 10.1002/pmic.201200561.

ProvenzanoPP, CuevasC, ChangAE, GoelVK, VonHoffDD, HingoraniSR. 2012. Enzymatic targeting of the stroma ablates physical barriers to treatment of pancreatic ductal adenocarcinoma. Cancer Cell, 21(3):418–29 DOI: 10.1016/j.ccr.2012.01.007.

137

References

PuckTT, MARCUSPI. 1956. ACTION OF X-RAYS ON MAMMALIAN CELLS. J Exp Med, 103(5):653–666 DOI: 10.1084/jem.103.5.653.

Raab-WestphalS, MarshallJF, GoodmanSL. 2017. Integrins as Therapeutic Targets: Successes and Cancers. Cancers (Basel), 9(9) DOI: 10.3390/cancers9090110.

RadfarA, UnnikrishnanI, LeeHW, DePinhoRA, RosenbergN. 1998. p19(Arf) induces p53- dependent apoptosis during abelson virus-mediated pre-B cell transformation. Proc Natl Acad Sci U S A, 95(22):13194–9 DOI: 10.1073/pnas.95.22.13194.

RaineroE, NormanJC. 2015. Endosomal integrin signals for survival. Nat Publ Gr, 17 DOI: 10.1038/ncb3261.

RatnikovBI, PartridgeAW, GinsbergMH. 2005. Integrin activation by talin. In: Journal of Thrombosis and Haemostasis. pp. 1783–1790 DOI: 10.1111/j.1538-7836.2005.01362.x.

RavikumarB, FutterM, JahreissL, KorolchukVI, LichtenbergM, LuoS, MasseyDCO, MenziesFM, NarayananU, RennaM, Jimenez-SanchezM, SarkarS, UnderwoodB, WinslowA, RubinszteinDC. 2009. Mammalian macroautophagy at a glance. J Cell Sci, 122(Pt 11):1707–11 DOI: 10.1242/jcs.031773.

RawlaP, SunkaraT, GaduputiV. 2019. Epidemiology of Pancreatic Cancer: Global Trends, Etiology and Risk Factors. World J Oncol, 10(1):10–27 DOI: 10.14740/wjon1166.

ReboursV, GaujouxS, d’AssigniesG, SauvanetA, RuszniewskiP, LevyP, ParadisV, BedossaP, CouvelardA. 2015. Obesity and Fatty Pancreatic Infiltration Are Risk Factors for Pancreatic Precancerous Lesions (PanIN). Clin Cancer Res, 21(15):3522–3528 DOI: 10.1158/1078-0432.CCR-14-2385.

RennaM, SchaffnerC, WinslowAR, MenziesFM, PedenAA, FlotoRA, RubinszteinDC. 2011. Autophagic substrate clearance requires activity of the syntaxin-5 SNARE complex. J Cell Sci, 124(3):469–482 DOI: 10.1242/jcs.076489.

ReyesSB, NarayananAS, LeeHS, TchaichaJH, AldapeKD, LangFF, ToliasKF, McCartyJH. 2013. αvβ8 integrin interacts with RhoGDI1 to regulate Rac1 and Cdc42 activation and drive glioblastoma cell invasion. In: ChernoffJ (ed) Mol Biol Cell, 24(4):474–482 DOI: 10.1091/mbc.e12-07-0521.

RhimAD, MirekET, AielloNM, MaitraA, BaileyJM, McAllisterF, ReichertM, BeattyGL, RustgiAK, VonderheideRH, LeachSD, StangerBZ. 2012. EMT and Dissemination

138

References

Precede Pancreatic Tumor Formation. Cell, 148(1):349–361 DOI: 10.1016/j.cell.2011.11.025.

RichardsK, ZeleniakA, FishelM, WuJ, LittlepageL, HillR. 2016. Cancer-associated fibroblast exosomes regulate survival and proliferation of pancreatic cancer cells. Nat Publ Gr, 36:1770–1778 DOI: 10.1038/onc.2016.353.

RidleyAJ. 2006. Rho GTPases and actin dynamics in membrane protrusions and vesicle trafficking. Trends Cell Biol, 16(10):522–529 DOI: 10.1016/J.TCB.2006.08.006.

RodriguezOC, CheneyRE. 2002. Human myosin-Vc is a novel class V myosin expressed in epithelial cells. J Cell Sci, 115(Pt 5):991–1004 [accessed: 10/23/2019] URL: http://www.ncbi.nlm.nih.gov/pubmed/11870218.

RottnerK, FaixJ, BogdanS, LinderS, KerkhoffE. 2017. Actin assembly mechanisms at a glance. J Cell Sci, 130(20):3427–3435 DOI: 10.1242/jcs.206433.

SaikiY, HoriiA. 2014. Molecular pathology of pancreatic cancer. Pathol Int, 64(1):10–19 DOI: 10.1111/pin.12114.

SandfortV, EkeI, CordesN. 2010. The role of the focal adhesion protein PINCH1 for the radiosensitivity of adhesion and suspension cell cultures. PLoS One, 5(9) DOI: 10.1371/journal.pone.0013056.

SandriC, CaccavariF, ValdembriD, CamilloC, VeltelS, SantambrogioM, LanzettiL, BussolinoF, IvaskaJ, SeriniG. 2012. The R-Ras/RIN2/Rab5 complex controls endothelial cell adhesion and morphogenesis via active integrin endocytosis and Rac signaling. Cell Res, 22(10):1479–1501 DOI: 10.1038/cr.2012.110.

Santana-CodinaN, ManciasJD, KimmelmanAC. 2017. The Role of Autophagy in Cancer. Annu Rev Cancer Biol, 1(1):19–39 DOI: 10.1146/annurev-cancerbio-041816-122338.

SatoN, KohiS, HirataK, GogginsM. 2016. Role of hyaluronan in pancreatic cancer biology and therapy: Once again in the spotlight. Cancer Sci, 107(5):569–75 DOI: 10.1111/cas.12913.

SchallerMD, BorgmanCA, CobbBS, VinesRR, ReynoldsAB, ParsonsJT. 1992. pp125FAK a structurally distinctive protein-tyrosine kinase associated with focal adhesions. Proc Natl Acad Sci U S A, 89(11):5192–6 DOI: 10.1073/pnas.89.11.5192.

139

References

ScheuringS, RöhrichtRA, Schöning-BurkhardtB, BeyerA, MüllerS, AbtsHF, KöhrerK. 2001. Mammalian Cells Express Two VPS4 Proteins Both of Which are Involved in Intracellular Protein Trafficking. J Mol Biol, 312(3):469–480 DOI: 10.1006/JMBI.2001.4917.

SchindelinJ, Arganda-CarrerasI, FriseE, KaynigV, LongairM, PietzschT, PreibischS, RuedenC, SaalfeldS, SchmidB, TinevezJ-Y, WhiteDJ, HartensteinV, EliceiriK, TomancakP, CardonaA. 2012. Fiji: an open-source platform for biological-image analysis. Nat Methods, 9(7):676–82 DOI: 10.1038/nmeth.2019.

SchneiderG, SivekeJT, EckelF, SchmidRM. 2005. Pancreatic cancer: Basic and clinical aspects. Gastroenterology, 128(6):1606–1625 DOI: 10.1053/j.gastro.2005.04.001.

SchutteM, HrubanRH, GeradtsJ, MaynardR, HilgersW, RabindranSK, MoskalukCA, HahnSA, Schwarte-WaldhoffI, SchmiegelW, BaylinSB, KernSE, HermanJG. 1997. Abrogation of the Rb/p16 tumor-suppressive pathway in virtually all pancreatic carcinomas. Cancer Res, 57(15):3126–30 [accessed: 10/18/2019] URL: http://www.ncbi.nlm.nih.gov/pubmed/9242437.

SchwartzDL, BanksonJA, LemosR, LaiSY, ThittaiAK, HeY, HostetterG, DemeureMJ, VonHoffDD, PowisG. 2010. Radiosensitization and stromal imaging response correlates for the HIF-1 inhibitor PX-478 given with or without chemotherapy in pancreatic cancer. Mol Cancer Ther, 9(7):2057–2067 DOI: 10.1158/1535-7163.MCT-09-0768.

SekineY, OkadaY, NodaY, KondoS, AizawaH, TakemuraR, HirokawaN. 1994. A novel microtubule-based motor protein (KIF4) for organelle transports, whose expression is regulated developmentally. J Cell Biol, 127(1):187–201 DOI: 10.1083/jcb.127.1.187.

SharmaA, ChariST. 2018. Pancreatic Cancer and Diabetes Mellitus. Curr Treat Options Gastroenterol, 16(4):466–478 DOI: 10.1007/s11938-018-0197-8.

SharmaS, SantiskulvongC, BentolilaLA, RaoJ, DorigoO, GimzewskiJK. 2012. Correlative nanomechanical profiling with super-resolution F-actin imaging reveals novel insights into mechanisms of cisplatin resistance in ovarian cancer cells. Nanomedicine Nanotechnology, Biol Med, 8(5):757–766 DOI: 10.1016/J.NANO.2011.09.015.

SharmaS, SantiskulvongC, RaoJ, GimzewskiJK, DorigoO. 2014. The role of Rho GTPase in cell stiffness and cisplatin resistance in ovarian cancer cells. Integr Biol, 6(6):611–617 DOI: 10.1039/C3IB40246K.

140

References

ShenD-W, GottesmanMM. 2012. RAB8 enhances TMEM205-mediated cisplatin resistance. Pharm Res, 29(3):643–50 DOI: 10.1007/s11095-011-0562-y.

ShenW, TaoG-Q, ZhangY, CaiB, SunJ, TianZ-Q. 2017. TGF-β in pancreatic cancer initiation and progression: two sides of the same coin. Cell Biosci, 7:39 DOI: 10.1186/s13578- 017-0168-0.

ShibataS, TeshimaY, NiimiK, InagakiS. 2019. Involvement of ARHGEF10, GEF for RhoA, in Rab6/Rab8-mediating membrane traffic. Small GTPases, 10(3):169–177 DOI: 10.1080/21541248.2017.1302550.

SinghiAD, KoayEJ, ChariST, MaitraA. 2019. Early Detection of Pancreatic Cancer: Opportunities and Challenges. Gastroenterology, 156(7):2024–2040 DOI: 10.1053/J.GASTRO.2019.01.259.

SkauCT, WatermanCM. 2015. Specification of Architecture and Function of Actin Structures by Actin Nucleation Factors. Annu Rev Biophys, 44:285 DOI: 10.1146/ANNUREV- BIOPHYS-060414-034308.

SpratlinJ, SanghaR, GlubrechtD, DabbaghL, YoungJD, DumontetC, CassC, LaiR, MackeyJR. 2004. The absence of human equilibrative nucleoside transporter 1 is associated with reduced survival in patients with gemcitabine-treated pancreas adenocarcinoma. Clin Cancer Res, 10(20):6956–6961 DOI: 10.1158/1078-0432.CCR- 04-0224.

SrichaiMB, ZentR. 2010. Integrin structure and function. In: Cell-Extracellular Matrix Interactions in Cancer. Springer New York, New York, NY, pp. 19–41 DOI: 10.1007/978- 1-4419-0814-8_2.

StamnesMA, RothmanJE. 1993. The binding of AP-1 clathrin adaptor particles to Golgi membranes requires ADP-ribosylation factor, a small GTP-binding protein. Cell, 73(5):999–1005 DOI: 10.1016/0092-8674(93)90277-W.

StearnsT, WillinghamMC, BotsteinD, KahnRA. 1990. ADP-ribosylation factor is functionally and physically associated with the Golgi complex. Proc Natl Acad Sci U S A, 87(3):1238–42 DOI: 10.1073/pnas.87.3.1238.

StenmarkH. 2009. Rab GTPases as coordinators of vesicle traffic. Nat Rev Mol Cell Biol, 10(8):513–525 DOI: 10.1038/nrm2728.

141

References

StepanchickA, BreitwieserGE. 2010. The cargo receptor p24A facilitates calcium sensing receptor maturation and stabilization in the early secretory pathway. Biochem Biophys Res Commun, 395(1):136–140 DOI: 10.1016/j.bbrc.2010.03.156.

SuiX, ChenR, WangZ, HuangZ, KongN, ZhangM, HanW, LouF, YangJ, ZhangQ, WangX, HeC, PanH. 2013. Autophagy and chemotherapy resistance: a promising therapeutic target for cancer treatment. Cell Death Dis, 4 DOI: 10.1038/cddis.2013.350.

SulzmaierFJ, JeanC, SchlaepferDD. 2014a. FAK in cancer: mechanistic findings and clinical applications. Nat Rev Cancer, 14(9):598–610 DOI: 10.1038/nrc3792.

SulzmaierFJ, JeanC, SchlaepferDD. 2014b. Focal Adhesion Kinase (FAK) is a multifunctional regulator of cell signalling within the tumour microenvironment. Nat Publ Gr, 14 DOI: 10.1038/nrc3792.

SvitkinaT. 2018. The Actin Cytoskeleton and Actin-Based Motility. Cold Spring Harb Perspect Biol, 10(1) DOI: 10.1101/cshperspect.a018267.

SwaroopA, Yang-FengTL, LiuW, GieserL, BarrowLL, ChenK-C, AgarwalN, MeislerMH, SmithDI. 1994. Molecular characterization of a novel human gene, SEC13R, related to the yeast secretory pathway gene SEC13, and mapping to a conserved linkage group on human chromosome 3p24-p25 and mouse chromosome 6. Hum Mol Genet, 3(8):1281–1286 DOI: 10.1093/hmg/3.8.1281.

SwaydenM, IovannaJ, SoubeyranP. 2018. Pancreatic cancer chemo-resistance is driven by tumor phenotype rather than tumor genotype. Heliyon, 4(12):e01055 DOI: 10.1016/j.heliyon.2018.e01055.

TakahashiM, HoriM, IshigamoriR, MutohM, ImaiT, NakagamaH. 2018. Fatty pancreas: A possible risk factor for pancreatic cancer in animals and humans. Cancer Sci, 109(10):3013–3023 DOI: 10.1111/cas.13766.

TamkunJW, DeSimoneDW, FondaD, PatelRS, BuckC, HorwitzAF, HynesRO. 1986. Structure of integrin, a glycoprotein involved in the transmembrane linkage between fibronectin and actin. Cell, 46(2):271–82 [accessed: 04/24/2019] URL: http://www.ncbi.nlm.nih.gov/pubmed/3487386.

TapiaD, JiménezT, ZamoraC, EspinozaJ, RizzoR, González-CárdenasA, FuentesD, HernándezS, CavieresVA, SozaA, GuzmánF, ArriagadaG, YuseffMI, MardonesGA,

142

References

BurgosPV., LuiniA, GonzálezA, CancinoJ. 2019. KDEL receptor regulates secretion by lysosome relocation- and autophagy-dependent modulation of lipid-droplet turnover. Nat Commun, 10(1):735 DOI: 10.1038/s41467-019-08501-w.

TchaichaJH, ReyesSB, ShinJ, HossainMG, LangFF, McCartyJH. 2011. Glioblastoma angiogenesis and tumor cell invasiveness are differentially regulated by β8 integrin. Cancer Res, 71(20):6371–6381 DOI: 10.1158/0008-5472.CAN-11-0991.

ToufektchanE, ToledoF. 2018. The Guardian of the Genome Revisited: p53 Downregulates Genes Required for Telomere Maintenance, DNA Repair, and Centromere Structure. Cancers (Basel), 10(5) DOI: 10.3390/cancers10050135.

TrutyMJ, UrrutiaR. 2007. Basics of TGF-ß and Pancreatic Cancer. Pancreatology, 7(5– 6):423–435 DOI: 10.1159/000108959.

TsiniasG, NikouS, PapadasT, PitsosP, PapadakiH, BravouV. 2018. High PINCH1 Expression in Human Laryngeal Carcinoma Associates with Poor Prognosis. Anal Cell Pathol (Amst), 2018:2989635 DOI: 10.1155/2018/2989635.

TüreiD, Földvári-NagyL, FazekasD, MódosD, KubischJ, KadlecsikT, DemeterA, LentiK, CsermelyP, VellaiT, KorcsmárosT. 2015. Autophagy Regulatory Network — A systems- level bioinformatics resource for studying the mechanism and regulation of autophagy. Autophagy, 11(1):155–165 DOI: 10.4161/15548627.2014.994346.

TyagiN, MarimuthuS, BhardwajA, DeshmukhSK, SrivastavaSK, SinghAP, McClellanS, CarterJE, SinghS. 2016. p-21 activated kinase 4 (PAK4) maintains stem cell-like phenotypes in pancreatic cancer cells through activation of STAT3 signaling. Cancer Lett, 370(2):260–267 DOI: 10.1016/j.canlet.2015.10.028.

VarkerKA, PhelpsSH, KingMM, WilliamsCL. 2003. The small GTPase RhoA has greater expression in small cell lung carcinoma than in non-small cell lung carcinoma and contributes to their unique morphologies. Int J Oncol, 22(3):671–81 [accessed: 03/30/2020] URL: http://www.ncbi.nlm.nih.gov/pubmed/12579323.

WalshD. 1897. Deep Tissue Traumatism from Roentgen Ray Exposure. Br Med J, 2(1909):272–3 DOI: 10.1136/bmj.2.1909.272.

WaltherTC, MannM. 2010. Mass spectrometry-based proteomics in cell biology. J Cell Biol, 190(4):491–500 DOI: 10.1083/jcb.201004052.

143

References

WangF, XiaX, YangC, ShenJ, MaiJ, KimH-C, KiruiD, KangY, FlemingJB, KoayEJ, MitraS, FerrariM, ShenH. 2018. SMAD4 gene mutation renders pancreatic cancer resistance to radiotherapy through promotion of autophagy. Clin Cancer Res, 24(13):3176 DOI: 10.1158/1078-0432.CCR-17-3435.

WangJ, DongX, ZhaoB, LiJ, LuC, SpringerTA. 2017. Atypical interactions of integrin αVβ8 with pro-TGF-β1. Proc Natl Acad Sci U S A, 114(21):E4168–E4174 DOI: 10.1073/pnas.1705129114.

WangW-W, WangY-B, WangD-Q, LinZ, SunR-J. 2015. Integrin beta-8 (ITGB8) silencing reverses gefitinib resistance of human hepatic cancer HepG2/G cell line. Int J Clin Exp Med, 8(2):3063–71 [accessed: 10/18/2018] URL: http://www.ncbi.nlm.nih.gov/pubmed/25932283.

WangZ, LiY, AhmadA, BanerjeeS, AzmiAS, KongD, SarkarFH. 2011. Pancreatic cancer: understanding and overcoming chemoresistance. Nat Rev Gastroenterol Hepatol, 8(1):27–33 DOI: 10.1038/nrgastro.2010.188.

WATARIN, HOTTAY, MABUCHIY. 1982. Morphological Studies on a Vitamin A-Storing Cell and its Complex with Macrophage Observed in Mouse Pancreatic Tissues following Excess Vitamin A Administration. Okajimas Folia Anat Jpn, 58(4–6):837–857 DOI: 10.2535/ofaj1936.58.4-6_837.

WatersAM, DerCJ. 2018. KRAS: The Critical Driver and Therapeutic Target for Pancreatic Cancer. Cold Spring Harb Perspect Med, 8(9) DOI: 10.1101/cshperspect.a031435.

WebsterCP, SmithEF, GriersonAJ, DeVosKJ. 2018. C9orf72 plays a central role in Rab GTPase-dependent regulation of autophagy. Small GTPases, 9(5):399–408 DOI: 10.1080/21541248.2016.1240495.

WelchMD, DePaceAH, VermaS, IwamatsuA, MitchisonTJ. 1997. The Human Arp2/3 Complex Is Composed of Evolutionarily Conserved Subunits and Is Localized to Cellular Regions of Dynamic Actin Filament Assembly. J Cell Biol, 138(2):375–384 DOI: 10.1083/jcb.138.2.375.

WenigerM, HonselmannKC, LissAS. 2018. The Extracellular Matrix and Pancreatic Cancer: A Complex Relationship. Cancers (Basel), 10(9) DOI: 10.3390/cancers10090316.

144

References

WhatcottCJ, PosnerRG, VonHoffDD, HanH. 2012. Desmoplasia and chemoresistance in pancreatic cancer. Transworld Research Network [accessed: 10/20/2019] URL: http://www.ncbi.nlm.nih.gov/pubmed/22876390.

Winograd-KatzSE, FässlerR, GeigerB, LegateKR. 2014. The integrin adhesome: from genes and proteins to human disease. Nat Rev Mol Cell Biol, 15(4):273–288 DOI: 10.1038/nrm3769.

WitkosTM, LoweM. 2017. Recognition and tethering of transport vesicles at the Golgi apparatus. Curr Opin Cell Biol, 47:16–23 DOI: 10.1016/j.ceb.2017.02.003.

WuX, YooY, OkuhamaNN, TuckerPW, LiuG, GuanJ-L. 2006. Regulation of RNA- polymerase-II-dependent transcription by N-WASP and its nuclear-binding partners. Nat Cell Biol, 8(7):756–763 DOI: 10.1038/ncb1433.

YangS, WangX, ContinoG, LiesaM, SahinE, YingH, BauseA, LiY, StommelJM, Dell’antonioG, MautnerJ, TononG, HaigisM, ShirihaiOS, DoglioniC, BardeesyN, KimmelmanAC. 2011. Pancreatic cancers require autophagy for tumor growth. Genes Dev, 25(7):717–29 DOI: 10.1101/gad.2016111.

YingH, DeyP, YaoW, KimmelmanAC, DraettaGF, MaitraA, DePinhoRA. 2016. Genetics and biology of pancreatic ductal adenocarcinoma. Genes Dev, 30(4):355–85 DOI: 10.1101/gad.275776.115.

YuJ, ChiaJ, CanningCA, JonesCM, BardFA, VirshupDM. 2014. WLS Retrograde Transport to the Endoplasmic Reticulum during Wnt Secretion. Dev Cell, 29(3):277–291 DOI: 10.1016/j.devcel.2014.03.016.

Zaidel-barR, ItzkovitzS, MaA, IyengarR, GeigerB. 2007. Functional atlas of the integrin adhesome. , 9(8).

Zaidel-BarR, ZhenhuanG, LuxenburgC. 2015. The contractome--a systems view of actomyosin contractility in non-muscle cells. J Cell Sci, 128(12):2209–17 DOI: 10.1242/jcs.170068.

ZhaoT, RenH, JiaL, ChenJ, XinW, YanF, LiJ, WangX, GaoS, QianD, HuangC, HaoJ. 2015. Inhibition of HIF-1α by PX-478 enhances the anti-tumor effect of gemcitabine by inducing immunogenic cell death in pancreatic ductal adenocarcinoma. Oncotarget, 6(4):2250 DOI: 10.18632/ONCOTARGET.2948.

145

References

ZhenY, StenmarkH. 2015. Cellular functions of Rab GTPases at a glance. J Cell Sci, 128(17) [accessed: 07/04/2017] URL: http://jcs.biologists.org/content/128/17/3171.

ZienertE, EkeI, AustD, CordesN. 2015. LIM-only protein FHL2 critically determines survival and radioresistance of pancreatic cancer cells. Cancer Lett, 364(1):17–24 DOI: 10.1016/j.canlet.2015.04.019.

146

Appendix

12 Acknowledgements

For doing this project and writing the thesis, there are too many people to thank, without your help, I would not have been able to finish this project.

First, I would like to thank Prof. Dr. Nils Cordes for giving me this opportunity to work with him and providing this fascinating project. Also, for kind instructions and scientific thinking, you are an excellent mentor, Nils!

Special thanks to Dr. Sha Jin for encouraging my project for the remarkable comments and suggestions. Thank you for teaching me how do quantify and analyze the image data and taking care about the details.

I also want to thank our collaborator Prof. Dr. Daniela Aust for providing the PDAC patient samples and histology support.

I would especially like to thank my colleagues in the MCR group for the support, the discus- sions and all the fun we have had in the last few years. Special thanks for Ms. Josephine Görte, for your kindly support and German translation for all the silly questions such as forget to pay the electricity bill, etc. Special thanks for Ms. Inga Lange, for your excellent technical assistance, German teaching, and delicious cookies. Special thanks for Ms. Sara Sofia Deville, for the practicing and preparing for the RADIATE meetings and the most important thing, to remind me booking the ticket for the RADIATE meetings. Special thanks for Mr. Vasyl Lukiyanchuk, for the assistance of plasmid cloning.

Here I would like to thank the European Union RADIATE-ITN for the financing support and special thanks for the RADIATE-ITN Project Manager, Dr. Nagma Khan.

Last but not least, thanks for my family and friends Dr. Yong Xu, Meiying Cui, Dr. Daxiao Sun, Dr. Jie Wang, and Dr. Lei Xing without your support I cannot make this happen.

147

Appendix

Curriculum vitae

Personal data:

Name: Wei-Chun Lee

Address: Rothenburger Str. 18

01099 Dresden, Germany

Birthplace: 15 August 1984 in Taipei, Taiwan, ROC.

Education:

2015- present Doctorate at the Medical Faculty of the Dresden University of Technology.

Ph.D. thesis on „β8 integrin regulates pancreatic cancer cell radiochemoresistance“ at OncoRay Dresden, Department of Mo- lecular and Cellular Radiation Biology, Dresden University of Technology.

2008-2010 Master studies at National Defense Medical Center (NDMC), Taipei, Taiwan, ROC.

2004-2008 Bachelor studies at Fu Jen Catholic University, Taipei, Taiwan, ROC.

Work experience:

August 2014-July 2015 Research Assistant at National Yang Ming University, Taipei, Taiwan, ROC

148

Appendix

April 2013-June 2014 Research Assistant at National Research Institute of Chinese Medi- cine (NRICM), Taipei, Taiwan, ROC

January 2013-April 2013 Intern at Rhode Island Hospital Department of Pathology, Prov- idence, Rhode Island, USA

August 2010-January Research Assistant at National Research Institute of Chinese Medi- 2012 cine (NRICM), Taipei, Taiwan, ROC

149

Appendix

Publications

Publication:

1. Chun-Tang Chiou, Wei-Chun Lee, Jiahn-Haur Liao, Jing-Jy Cheng, Lie-Chwen Lin, Chih-Yu Chen, Jen-Shin Song, Ming-Hsien Wu, Kak-Shan Shia, Wen-Tai Li. Synthesis and Evaluation of 3-Ylideneoxindole Acetamides as Potent Anticancer Agents. Euro- pean journal of medicinal chemistry 98, 1-12 2. Sha Jin, Wei-Chun Lee, Daniela Aust, Christian Pilarsky, Nils Cordes. β8 integrin mediates pancreatic cancer cell radiochemoresistance. Molecular Cancer Research 17 (10), 2126-2138

Oral presentations:

1. Lee W.C., Ka S.M., Cheng C.W., Tsai P.Y., Yang S.M., Yeh Y.C., Yu C.P., Liang C.T. and Chen A. Therapeutic Evaluation of Anti-oxidation on Acute Tubular Necrosis in a Mouse Model. JAPANESE ASSOCIATION FOR LABORATORY ANIMAL SCIENCES, Kyoto, Japan 2009 2. Lee W.C, Jin S. and Cordes N. β8 integrin determines radiochemoresistance in pancreatic cancer cells by regulating autophagy and intracellular vesicle trafficking. INTERNA- TIONAL MARIE SKLODOWSKA-CURIE MEETING 2018, Paris, France 2018

Poster presentations:

1. Lee W.C, Jin S. and Cordes N. β8 integrin critically contributes to pancreatic cancer cell radiochemoresistance and intracellular vesicle trafficking under stress conditions. 25TH BIENNIAL CONGRESS OF THE EUROPEANASSOCIATION FOR CANCER RE- SEARCH. Amsterdam, Nederland 2018 2. Lee W.C, Jin S. and Cordes N. Identification of β8 integrin as novel determinant of pancreatic cancer cell radioresistance. ERRS/GBS. Essen, Germany 2017

150

Appendix

Anlage 1

Technische Universität Dresden Medizinische Fakultät Carl Gustav Carus Promotionsordnung vom 24. Juli 2011

Erklärungen zur Eröffnung des Promotionsverfahrens

1. Hiermit versichere ich, dass ich die vorliegende Arbeit ohne unzulässige Hilfe Dritter und ohne Benutzung anderer als der angegebenen Hilfsmittel angefertigt habe; die aus fremden Quellen direkt oder indirekt übernommenen Gedanken sind als solche kenntlich gemacht.

2. Bei der Auswahl und Auswertung des Materials sowie bei der Herstellung des Manuskripts habe ich Unterstützungsleistungen von folgenden Personen erhalten:

Herr Prof. Dr. med. Nils Cordes, Frau Dr. rer. nat. Sha Jin

3. Weitere Personen waren an der geistigen Herstellung der vorliegenden Arbeit nicht beteiligt. Insbesondere habe ich nicht die Hilfe eines kommerziellen Promotionsberaters in Anspruch genommen. Dritte haben von mir weder unmittelbar noch mittelbar geldwerte Leistungen für Arbeiten erhalten, die im Zusammenhang mit dem Inhalt der vorgelegten Dissertation stehen.

4. Die Arbeit wurde bisher weder im Inland noch im Ausland in gleicher oder ähnlicher Form einer anderen Prüfungsbehörde vorgelegt.

5. Die Inhalte dieser Dissertation wurden in folgender Form veröffentlicht:

Sha Jin, Wei-Chun Lee, Daniela Aust, Christian Pilarsky, Nils Cordes. β8 integrin mediates pancreatic cancer cell radiochemoresistance. Molecular cancer research. 2019

6. Ich bestätige, dass es keine zurückliegenden erfolglosen Promotionsverfahren gab.

7. Ich bestätige, dass ich die Promotionsordnung der Medizinischen Fakultät der Technischen Universität Dresden anerkenne.

8. Ich habe die Zitierrichtlinien für Dissertationen an der Medizinischen Fakultät der Technischen Universität Dresden zur Kenntnis genommen und befolgt.

Dresden, den 15.02.2021

151

Appendix

Anlage 2

Hiermit bestätige ich die Einhaltung der folgenden aktuellen gesetzlichen Vorgaben im Rahmen meiner Dissertation Erklärungen zur Eröffnung des Promotionsverfahrens

1. das zustimmende Votum der Ethikkommission bei klinischen Studien, epidemiologischen Untersuchungen mit Personenbezug oder Sachverhalten, die das Medizinproduktegesetz betreffen Aktenzeichen der zuständigen Ethikkommission

Technische Universität Dresden: EK 378092017

2. die Einhaltung des Gentechnikgesetzes

Alle gentechnischen Arbeiten wurden in den gentechnischen Anlagen der Sicherheitsstufe S1 mit den Aktenzeichen Az: 54-8451/248 beziehungsweise Az: 54-8451/243 durchgeführt.

3. die Einhaltung von Datenschutzbestimmungen der Medizinischen Fakultät und des Universitätsklinikums Carl Gustav Carus.

Dresden, den 15.02.2021

152

Appendix

Darstellung des Eigenanteils

Hiermit versichere ich, Wei-Chun Lee, dass ich die vorliegende Dissertation ohne unzulässige Hilfe Dritter und ohne Benutzung anderer als der angegebenen Hilfsmittel selbstständig angefertigt habe. Die aus fremden Quellen direkt oder indirekt übernommenen Gedanken sind als solche kenntlich gemacht. Die Arbeit wurde bisher weder im Inland noch im Ausland in gleicher oder ähnlicher Form einer anderen Prüfungsbehörde vorgelegt. Die Arbeit wurde in der Gruppe „Molekulare und Zelluläre Strahlenbiologie“ am „OncoRay - Nationalen Zentrum für Strahlenforschung in der Onkologie”, Medizinische Fakultät Carl Gustav Carus, Technische Universität Dresden unter der wissenschaftlichen Leitung von Herrn Prof. Dr. Nils Cordes angefertigt. Die Promotionsordnung wird anerkannt.

Dresden, den 15.02.2021

153