Myd88-Dependent TLR Signaling Pathway Protein Kinase D1 Is

Protein Kinase D1 Is Essential for MyD88-Dependent TLR Signaling Pathway Jeoung-Eun Park, Young-In Kim and Ae-Kyung Yi This information is current as J Immunol 2009; 182:6316-6327; ; of September 28, 2021. doi: 10.4049/jimmunol.0804239 http://www.jimmunol.org/content/182/10/6316 Downloaded from References This article cites 42 articles, 19 of which you can access for free at: http://www.jimmunol.org/content/182/10/6316.full#ref-list-1

Why The JI? Submit online. http://www.jimmunol.org/ • Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication

*average by guest on September 28, 2021 Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2009 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

Protein Kinase D1 Is Essential for MyD88-Dependent TLR Signaling Pathway1

Jeoung-Eun Park,* Young-In Kim,* and Ae-Kyung Yi2*†

Protein kinase D1 (PKD1) has been shown to be involved in certain MAPK activation and cytokine expression by several TLR ligands. However, the precise physiological role of PKD1 in individual signaling from TLRs has not been fully addressed. In this study, we provide evidence that PKD1 is being activated by TLR ligands, except the TLR3 ligand. PKD1 activation by TLR ligands is dependent on MyD88, IL-1R-associated kinase 4 and 1, but independent of TNF-␣ receptor-associated factor 6. PKD1-knockdown macrophages and bone marrow-derived dendritic cells revealed that PKD1 is indispensable for the MyD88-dependent ubiquitination of TNF-␣ receptor-associated factor 6; activation of TGF-␤-activated kinase 1, MAPKs, and transcription factors; and expression of proinﬂammatory genes induced by TLR ligands, but is not involved in expression of type I IFNs induced by TLR

ligands and TRIF-dependent genes induced by TLR3 and TLR4 ligands. These results demonstrate that PKD1 is essential for Downloaded from MyD88-dependent proinﬂammatory immune responses. The Journal of Immunology, 2009, 182: 6316–6327.

hen the body is infected by microbial pathogens, host to each different TLR provides a molecular basis for the complex- innate defense responses are initiated by recognition ity of differences in gene expression profiles induced by individual W of specific structural motifs, known as pathogen-as- TLRs. MyD88, the first discovered TIR domain-containing adap- sociated molecular patterns, present in microbial pathogens by sev- tor molecule, is recruited to all TLRs, with the exception of TLR3, http://www.jimmunol.org/ eral groups of pattern recognition receptors, including TLRs, in and is essential for production of inflammatory cytokines induced host cells. The main response to pathogenic infection by TLRs is by those TLRs (2). MyD88 recruits IL-1R-associated kinase induction of proinflammatory cytokines to inhibit the growth and (IRAK) 4, IRAK1, and/or IRAK2 to the TLR/MyD88 signaling dissemination of invading pathogens and to promote acquired im- complex. IRAK1 or IRAK2 becomes rapidly phosphorylated by munity to specifically remove the pathogens. IRAK-4, leaves the receptor complex, and then associates with Each member of the TLR family, which is composed of at least TNF-␣ receptor-associated factor (TRAF) 6. Binding of TRAF6 to 13 family members, has an extracellular leucine-rich repeat do- IRAK1 or IRAK2 leads to the activation of TGF-␤-activated ki- main with a unique capacity for recognizing specific pathogen- nase 1 (TAK1) that ultimately results in activation of signaling associated molecular patterns, and an intracellular Toll/IL-1R cascades, leading to the activation of MAPKs and NF-␬B and sub- by guest on September 28, 2021 (TIR)3 domain with a capacity for recruiting and transducing sig- sequent expression of proinflammatory cytokines, chemokines, nals through adaptor(s) containing a TIR domain (1, 2). Recruit- and oncogenes (2–4). MyD88 is also essential for the activation of ment of different combinations of TIR domain-containing adaptors IFN regulatory factor (IRF) 7 by TLR7 and TLR9 in plasmacytoid dendritic cells (DCs) and activation of TRAF3 by TLR9 in macrophages and DCs, which lead to production of type I IFNs (5, 6). *Children’s Foundation Research Center, Le Bonheur Children’s Medical Center and MyD88 deficiency in macrophages and DCs results in lack of Department of Pediatrics, University of Tennessee Health Science Center, Memphis, NF-␬B activation, MAPK activation, and proinflammatory cyto- TN 38103; and †Department of Molecular Sciences, University of Tennessee Health Science Center, Memphis, TN 38163 kine production by TLR2, TLR5, TLR7, and TLR9 (7–10). Al- Received for publication December 17, 2008. Accepted for publication March though TLR4 ligand-mediated production of proinflammatory 11, 2009. cytokines is completely suppressed, TLR4 ligand-mediated acti- The costs of publication of this article were defrayed in part by the payment of page vation of NF-␬B and MAPKs is delayed, but not inhibited, and charges. This article must therefore be hereby marked advertisement in accordance production of IFN-␤ and IFN-␥-inducible protein 10 (IP-10) is not with 18 U.S.C. Section 1734 solely to indicate this fact. 1 affected in MyD88-deficient cells (11, 12). In addition, TLR3 li- A.-K.Y. was supported by the Children’s Foundation Research Center at Le Bon- ␣ heur Children’s Medical Center, and grants from National Institutes of Health gand-mediated TNF- production is normal in MyD88-deficient (AI053137) and the Children’s Foundation of Memphis. Y.-I.K. and J.-E.P. were cells (13). The presence of these MyD88-independent pathways supported by grants from Le Bonheur Children’s Medical Center. Animal experi- leads to the identification of other TIR domain-containing adaptor ments were supported in part by transgenic mice program grant from the Children’s Foundation of Memphis. proteins, as follows: MyD88 adaptor-like (MAL)/TIR domain- 2 Address correspondence and reprint requests to Dr. Ae-Kyung Yi, Department of containing adaptor protein (TIRAP; functions to recruit MyD88 Pediatrics, University of Tennessee Health Science Center, 50 North Dunlap Street, to TLR2 and TLR4), TIR domain-containing adaptor-inducing LBCMC Room 315, Memphis, TN 38103. E-mail address: [email protected] IFN-␤ (TRIF), and TRIF-related adaptor molecule (functions to 3 Abbreviations used in this paper: TIR, Toll/IL-1R; BMDC, bone marrow-derived recruit TRIF to TLR4) (13–19). TRIF is the TIR domain-contain- dendritic cell; DC, dendritic cell; FSL-1, diacylated synthetic lipopeptide; IP-10, IFN- ␥-inducible protein 10; IRAK, IL-1R-associated kinase; IRF, IFN regulatory factor; ing adaptor for TLR3 and is required for the TLR4-induced ISRE, IFN-stimulated responsive element; MAL, MyD88 adaptor-like; MDP, mu- MyD88-independent pathway (13, 16). TRIF recruits receptor-in- ramyl dipeptide; Pam3CSK4, palmitoyl-3-cysteine-serine-lysine-4; PGN, peptidoglycan; PKC, protein kinase C; PKD, protein kinase D; shRNA, small hairpin interfering teracting protein 1 and two TRAF family members, TRAF6 and RNA; siRNA, small interfering RNA; TAK1, TGF-␤-activated kinase 1; TIRAP, TIR TRAF3 (20–22). Receptor-interacting protein 1 and TRAF6 are domain-containing adaptor protein; TRAF, TNF-␣ receptor-associated factor; TRIF, required for the TRIF-dependent NF-␬B activation and proinflam- TIR domain-containing adaptor-inducing IFN-␤. matory cytokine production, whereas TRAF3 recruits TANK- Copyright © 2009 by The American Association of Immunologists, Inc. 0022-1767/09/$2.00 binding kinase 1 and I␬B kinase to activate IRF3, resulting in the www.jimmunol.org/cgi/doi/10.4049/jimmunol.0804239 The Journal of Immunology 6317

Table I. Sequence of primers

Gene Forward/Sense Primer Reverse/Antisense Primer

shRNA IRAK4 GCAACAGTTTGATCAAGAA TTCTTGATCAAACTGTTGC TRAF6(A) AAGATGCAGAGGAATCACTTGGCACGACA TGTCGTGCCAAGTGATTCCTCTGCATCTT TRAF6(B) TTGGAGAGTCGCCTAGTAAGACAGGACCA TGGTCCTGTCTTACTAGGCGACTCTCCAA RT-PCR IP-10 CATCCTGCTGGGTCTGAGTG TGGCTTCACTCCAGTTAAGG MCP-1 AGGTCCCTGTCATGCTTCTG AAGTGCTTGAGGTGGTTGTG CCL5 GCGGGTACCATGAAGATCTC ACCCTCTATCCTAGCTCATCTC

production of IFN-␤ and chemokines. Although there is increasing Oligodeoxynucleotides and reagents information about signaling pathways of TLRs and TIR domain- Nuclease-resistant phosphorothioate oligodeoxynucleotides 1826 (CpG containing adaptors, the complete picture of the pathways down- DNA) were purchased from Coley Pharmaceutical Group. Pam3CSK4 stream of the individual TLRs and TIR domain-containing adap- (synthetic tripalmitoylated lipopeptide), peptidoglycan (PGN), diacylated tors remains yet to be revealed. synthetic lipoprotein (FSL-1) flagellin, imiquimod, and poly(I:C) were pur- The protein kinase D (PKD) family is a group of three struc- chased from InvivoGen. Ultrapure LPS (Escherichia coli 0111:B4) and muramyl dipeptide (MDP) were purchased from List Biological Labora- turally related serine/threonine kinases (PKD1/protein kinase C tories and Sigma-Aldrich, respectively. Recombinant murine cytokines Downloaded from (PKC) ␮, PKD2, and PKD3/PKC␯) that regulate diverse cellular (IL-1␤, IL-18, and IFN-␥) were purchased from R&D Systems. PMA was and subcellular processes, such as transportation of vesicles; reg- purchased from Calbiochem. ulation of cell shape, motility, and adhesion; activation of MAPKs and NF-␬B; and expression of various genes (23). Several studies Plasmids, generation of FLAG-tagged PKD-expressing have indicated that PKD family proteins might play a role in TLR macrophages and gene-specific knockdown macrophages, signaling. LPS-mediated p38 activation and TNF-␣ secretion in transient transfection, reporter gene assay, and RT-PCR http://www.jimmunol.org/ microglial cells are suppressed by a PKC/PKD inhibitor (inhibits FLAG-tagged PKD-expressing macrophages and gene-specific knockdown PKC␣, PKC␤I, and PKDs), Go¨6976 (24). PKD1 has been shown macrophages were generated, as described (27). Transient transfections, to bind and phosphorylate human TLR5, and Go¨6976 suppresses a reporter gene assays, and RT-PCR were done, as previously described (28). Luciferase activity was normalized using pRL-TK-luciferase activity (Re- TLR5 ligand flagellin-mediated p38 activation and IL-8 produc- nilla) in each sample. Actin or GAPDH was used as a loading control for tion in epithelial cells (25). TLR1/2 ligand palmitoyl-3-cysteine- all RT-PCR. All primers for cloning, gene-specific small hairpin interfering serine-lysine-4 (Pam3CSK4) induces activation of PKDs via a RNA (shRNA) targeting, and RT-PCR were purchased from Integrated DNA Technologies, and sequences of primers are listed in Table I or de- PKC-independent manner, and Pam3CSK4-induced expression of heat shock protein 27 and MCP-1, as well as activation of PKDs, scribed previously (27).

is inhibited by Go¨6976, but not by broad-spectrum PKC inhibitors, by guest on September 28, 2021 Generation of murine bone marrow-derived DCs (BMDCs) and in mouse bone marrow-derived mast cells (26). In addition to these small interfering RNA (siRNA) transfection studies, we recently found that PKD1, but not PKD2 and PKD3, is recruited to the TLR9/MyD88/IRAK/TRAF6 signaling complex Mouse bone marrow cells were obtained by flushing femoral and tibial and being activated upon the TLR9 ligand CpG DNA stimulation bone marrow cavities with PBS using a 10-ml syringe with a 25-gauge ␬ needle. After removing RBC, the bone marrow cells were resuspended in and required for activation of NF- B and MAPKs, and subsequent conditioned medium (RPMI 1640 supplemented with penicillin (100 IU/ expression of cytokines (27). In the present study, we investigated ml), streptomycin (100 ␮g/ml), 2-ME (50 ␮M), 10% heat-inactivated FBS, whether all TLR ligands induce activation of any PKD family and 20 ng/ml mouse rGM-CSF (BD Biosciences)) and plated at 2 ϫ 106 protein and physiological roles of PKD1 in individual signaling cells/10 ml in a 100-mm petri dish. On days 3 and 6, medium was replaced with fresh conditioned medium. On day 8, BMDCs (5 ϫ 105/ml) were from TLRs. cultured overnight in medium without antibiotics and then transfected with 100 nM nontarget siRNA (Dharmacon) or PKD1-specific siRNAs (5Ј- Materials and Methods CTCCTGATGTCTAAGGTGA-3Ј and 5Ј-CCATTGATCTTATCAATA Mice A-3Ј) using lipofectamine (Invitrogen), according to the manufacturer’s protocol. C57BL/6 and BALB/c mice at 4–5 wk of age were obtained from the Frederick Cancer Research and Development Center, National Cancer In- ELISA, Western blot assay, and EMSA stitute, and were used within 3 wk. TLR9 gene-deficient (TLR9Ϫ/Ϫ) mice and MyD88Ϫ/Ϫ mice were provided by S. Akira (Osaka University, Osaka, Concentrations of the selected cytokines in culture supernatants, levels or Japan). TLR2 gene-deficient (TLR2Ϫ/Ϫ, Tlr2tm1Kir) mice, TLR4 P712H phosphorylation status of specific proteins in whole cell extracts, and nu- mutant (Tlr4Lps-d/Lps-d) mice, and TRIF-defective mutant (the deletion of a clear DNA-binding activities of NF-␬B and AP-1 were analyzed by single guanine within codon 708 of TRIF gene, TrifLps2/Lps2) mice were ELISA, Western blot assay, and EMSA, respectively, as described previ- purchased from The Jackson Laboratory. All animal care and housing re- ously (27, 28). Actin was used as a loading control for all Western blot quirements set forth by the National Institutes of Health Committee on the assays. All recombinant murine cytokines and Abs specific for murine Care and Use of Laboratory Animals of Institute of Laboratory Animal cytokines were purchased from BD Biosciences. Ab specific for TLR9 was Resources were followed, and animal protocols were reviewed and ap- purchased from IMGENEX. Ab specific for IRAK4 was purchased from proved by the University of Tennessee Animal Care and Use Committee. ABGENT. Ab specific for IRAK1 was purchased from Upstate Biotech- nology. Abs specific for TLR4, MyD88, TRAF6, PKD, I␬B␣,orI␬B␤ Isolation of murine peritoneal macrophages, cell lines, and were purchased from Santa Cruz Biotechnology. All phospho-specific Abs culture conditions were purchased from Cell Signaling Technology.

Peritoneal macrophages were isolated, as described (27). Peritoneal mac- In vitro kinase assays rophages and RAW264.7 cells (American Type Culture Collection) were cultured in DMEM supplemented with 10% (v/v) heat-inactivated FCS, 1.5 Each FLAG-tagged PKD protein in whole-cell lysates was immunopre- mM L-glutamine, 100 U/ml penicillin, and 100 ␮g/ml streptomycin at 37°C cipitated with anti-FLAG Ab. The resulting immune complexes were sub- ina5%CO2-humidiﬁed incubator. All culture reagents were purchased jected to in vitro kinase assay using Syntide-2 (Sigma-Aldrich) as a PKD from Invitrogen and Sigma-Aldrich. substrate, as previously described (29). 6318 PKD1 IN MyD88-DEPENDENT SIGNALING Downloaded from http://www.jimmunol.org/ by guest on September 28, 2021

FIGURE 1. TLR ligands induce activation of PKD1 in macrophages. A, RAW264.7 cells were stimulated with medium (med), CpG DNA (12 ␮g/ml), ␮ ␮ ␮ ␮ ␮ LPS (50 ng/ml), Pam3Cys (Pam3CSK4,1 g/ml), PGN (10 g/ml), FSL-1 (0.1 g/ml), ﬂagellin (1 g/ml), imiquimod (10 g/ml), poly(I:C) (PIC; 50 ␮g/ml), MDP (10 ␮g/ml), or PMA (10 ng/ml) for 45 min. B, RAW264.7 cells were stimulated with poly(I:C) (PIC; 50 ␮g/ml) or MDP (10 ␮g/ml) for the indicated time period. CpG DNA (12 ␮g/ml) or PMA (10 ng/ml) was used as positive control. Activation status of PKDs was detected by Western blot assay using Abs speciﬁc for the phosphorylated forms of PKDs (pPKDs744/748, pPKDs916). Phosphorylation of p38 was detected as an indication that each stimulus was functional. C and D, RAW264.7 cells stably expressing empty vector, FLAG-tagged PKD1, FLAG-tagged PKD2, or FLAG-tagged PKD3 were stimulated as indicated for 45 min. Each PKD family protein in whole-cell lysates was immunoprecipitated with anti-FLAG Ab. Kinase activity of PKDs was analyzed by in vitro kinase assay using syntide-2 as a PKD substrate (top). Expression and phosphorylation status of each PKD were analyzed by immunoblotting with anti-FLAG and anti-phospho-PKD Abs, respectively (bottom). E, Control luciferase-knockdown (Luc shRNA) or PKD1-knockdown (PKD1 shRNA) macrophages were stimulated as indicated for 45 min. Activation status of PKDs was detected by Western blot assay. The Journal of Immunology 6319

Flow cytometric analysis To analyze cell surface expression of CD86, cells were stained with allophycocyanin-conjugated rat anti-mouse CD86 or allophycocyanin-conjugated isotype control. CD86 expression was analyzed with BD FACSAria II flow cytometer (BD Biosciences). All Abs were purchased from BD Biosciences. Results TLR ligands, except TLR3 ligand, induce activation of PKD1 Recent studies using pharmacological inhibitor of PKC/PKD indicate that PKD family proteins may be implicated in TLR signaling (24–26). In addition, we found that PKD1 is being activated by TLR9 ligands and plays a pivotal role in TLR9-mediated innate immune cell activation (27). However, it is currently not known whether PKD1 functions in other TLR signaling pathways. Using Abs specific for phosphorylated forms of PKD family proteins (pPKDs744/748-specific Ab detects phosphorylation of all PKD family proteins, and pPKDs916-specific Ab detects phosphorylation of PKD1 and PKD2 (27)), we have investigated whether TLR Downloaded from ligands activate any PKD family member in macrophages. As demonstrated in Fig. 1A, TLR1/2 (Pam3CSK4), TLR2 (PGN), TLR2/6 (FSL-1), TLR4 (LPS), TLR5 (flagellin), TLR7 (imiquimod), and TLR9 (CpG DNA) ligands induced phosphorylation of PKDs. However, the TLR3 ligand poly(I:C) and the NOD2

ligand MDP did not induce phosphorylation of PKDs, although http://www.jimmunol.org/ they induced phosphorylation of MAPK p38 (Fig. 1, A and B). This result indicates that the TLR ligand that induces recruitment of MyD88 to its receptor activates one or more PKD family member(s). We further investigated which PKD family member(s) is being activated by these TLR ligands using macrophages that ex- press each FLAG-tagged PKD family member (27). Phosphoryla- tion status and kinase activity of PKD family members were detected by phospho-PKD-specific Western blot analysis and in vitro kinase assay, respectively, following immunoprecipitation by guest on September 28, 2021 of each FLAG-tagged PKD family member. As shown in Fig. FIGURE 2. TLR ligands induce activation of PKD1 through a MyD88- 1C, all ligands for TLRs that use MyD88, including CpG DNA, dependent pathway. A–C, Peritoneal macrophages isolated from wild-type, LPS, PGN, flagellin, and imiquimod, induced both kinase ac- TLR2 gene-deficient (TLR2Ϫ/Ϫ), TLR4 P712H (Tlr4Lps-d/Lps-d) mutant, TLR9 tivity and phosphorylation of PKD1 in RAW264.7 cells, gene-deficient (TLR9Ϫ/Ϫ), MyD88 gene-deficient (MyD88Ϫ/Ϫ), or TRIF-de- whereas TLR3 ligand poly(I:C), which transduces its signal fective mutant (TrifLps2/Lps2) mice were stimulated as indicated for 45 min. through TRIF, did not. In contrast, these TLR ligands induced Phosphorylation status of PKD1 was detected by Western blot analysis. Phos- kinase activity and phosphorylation of neither PKD2 nor PKD3. phorylation of JNK was detected as an indication that each stimulus was Of note, PMA induced activation of all three PKD family mem- functional. bers. These results indicate that PKD1 may be a common downstream target for signaling mediated through MyD88. In addition to TLRs, IL-1R and IL-18R contain a TIR domain whether TLR ligands activate PKD1 through a MyD88-depen- and transduce the signal through MyD88 (30). Therefore, we fur- dent manner. As shown in Fig. 2A, Pam3CSK4, LPS, and CpG ther investigated whether IL-1␤ and IL-18 also induce activation DNA failed to activate PKD1 in macrophages lacking their own of PKD1. As shown in Fig. 1D, both IL-1␤ and IL-18 induced functional receptor. In addition, PKD1 activation by TLR li- kinase activity and phosphorylation of PKD1, but not PKD2 or gands (CpG DNA, LPS, Pam3CSK4, PGN, flagellin, and imi- PKD3. Moreover, all TLR ligands, IL-1␤, and IL-18 failed to in- quimod), IL-1␤, and IL-18 was ablated in MyD88Ϫ/Ϫ macro- duce phosphorylation of PKDs in PKD1-knockdown macrophages (Fig. 2B). In contrast, activation of PKD1 by CpG DNA phages, further confirming that they only activate PKD1, not and LPS in macrophages lacking functional TRIF was compa- PKD2 or PKD3 (Fig. 1E). Of note, mRNA and protein levels of rable to that in wild-type macrophages (Fig. 2C). Taken to- TLR signaling molecules, PKD2, and PKD3 in PKD1-knockdown gether, these results provide direct evidence that TLR ligands macrophages were comparable to those in control luciferase- induce PKD1 activation through a MyD88-dependent, but not knockdown macrophages (27). Taken together, our results dem- TRIF-dependent, signaling pathway. onstrate that TLR/IL-1R/IL-18R ligands, except for the TLR3 ligand, activate PKD1, and suggest that PKD1 activation by these Activation of PKD1 by TLR ligands requires IRAK4 and IRAK1, ligands may facilitate the signals transduced through MyD88. but not TRAF6 Because our results indicated that activation of PKD1 by TLR TLR ligands activate PKD1 via a MyD88-dependent pathway ligands is dependent on MyD88, we further investigated Because our results demonstrated that PKD1 is being activated whether this activation is dependent on MyD88-downstream by TLR ligands and cytokines that use adaptor molecule molecules IRAK4, IRAK1, and/or TRAF6. As shown in Fig. 3, MyD88 to transduce their signals, we further investigated C and D, TLR ligands CpG DNA, LPS, and PGN failed to 6320 PKD1 IN MyD88-DEPENDENT SIGNALING Downloaded from http://www.jimmunol.org/ by guest on September 28, 2021 FIGURE 3. IRAK4 and IRAK1, but not TRAF6, are required for activation of PKD1 by TLR ligands. A and B, RAW264.7 cells were stably transfected with vectors expressing control luciferase-shRNA or IRAK4-shRNA under control of the H1 promoter, as described previously (27). mRNA levels (A) and protein levels (B) of the selected molecules in TLR signaling, PKD family, and PKC family in control and IRAK4-knockdown RAW264.7 cells were analyzed by RT-PCR and Western blot assay, respectively. C and D, Control luciferase-knockdown (Luc shRNA), IRAK4- knockdown (IRAK4 shRNA), or IRAK1-knockdown (IRAK1 shRNA) macrophages were stimulated as indicated. Phosphorylation status of PKD1 was detected by Western blot analysis. E and F, RAW264.7 cells were stably transfected with vectors expressing control luciferase-shRNA or TRAF6-shRNA under control of the H1 promoter, as described previously (27). mRNA levels (E) and protein levels (F) of the selected molecules in TLR signaling, PKD family, and PKC family in control and TRAF6-knockdown RAW264.7 cells were analyzed by RT-PCR and Western blot assay, respectively. G, Control luciferase-knockdown (Luc shRNA) or TRAF6-knockdown (TRAF6 shRNA) macrophages were stimulated as indicated. Phosphorylation status of PKD1 was detected by Western blot analysis. Phosphorylation of JNK and TAK1 (pTAK1 Thr184/187) was detected to verify functional effectiveness of TRAF6 knockdown by TRAF6-shRNA. induce activation of PKD1 in both IRAK4-knockdown macro- MyD88-dependent TLR ligands failed to induce ubiquitination phages and IRAK1-knockdown macrophages. In contrast, of TRAF6 in PKD1-knockdown macrophages PKD1 activation by these TLR ligands was not inhibited in Because our results indicate the possibility that TRAF6 may TRAF6-knockdown macrophages (Fig. 3G). Activation of either be a signaling partner or a downstream signaling effector TRAF6-downstream kinases, TAK1 and JNK, by these TLR of PKD1 in TLR/MyD88-signaling pathway, we further inves- ligands was substantially suppressed in TRAF6-knockdown tigated whether PKD1 is required for TLR ligand-mediated ac- macrophages. Expression of TLRs, MyD88, and PKD1 was normal in IRAK4-knockdown macrophages, IRAK1-knock- tivation of TRAF6. Ubiquitination of TRAF6 has been shown to down macrophages, and TRAF6-knockdown macrophages (Fig. be required for activation of all TRAF6 downstream signaling 3, A, B, E, and F) (31). Of note, PMA-mediated PKD activation events (3). Therefore, we detected ubiquitination of TRAF6 as in IRAK4-knockdown, IRAK1-knockdown, or TRAF6-knock- an indication of TRAF6 activation. As shown in Fig. 4, CpG down macrophages was comparable with that in the control DNA, LPS, and PGN induced ubiquitination of TRAF6 in con- luciferase-knockdown macrophages. These results indicate that trol cells. However, CpG DNA and PGN (TLR ligands that use IRAK4 and IRAK1, but not TRAF6, are necessary for TLR only the MyD88-dependent pathway) failed to induce ubiquiti- ligand-mediated PKD1 activation and that TRAF6 may either nation of TRAF6 in PKD1-knockdown macrophages. In con- be a signaling partner or a downstream signaling effector of trast, LPS (which uses both MyD88-dependent and TRIF-de- PKD1 rather than an upstream activator of PKD1 in TLR/ pendent pathways)-mediated ubiquitination of TRAF6 was MyD88 signaling. delayed and attenuated, but not abolished in PKD1-knockdown The Journal of Immunology 6321

FIGURE 4. TLR ligand-mediated MyD88-dependent ubiquitination of TRAF6 is dependent on PKD1. Con- trol (Luc-shRNA) and PKD1-knockdown (PKD1-shRNA) RAW264.7 cells were stimulated as indicated for 1h(A) or stimulated with CpG DNA or LPS for indicated time periods (B and C). Whole-cell lysates were prepared and immunoprecipitated with anti-TRAF6 Ab, and the resulting im- munoprecipitates were analyzed by Western blot using anti-ubiquitine (UBQ) to detect the ubiquitinated form of TRAF6. Downloaded from

macrophages. Taken together, our results indicate that PKD1 is duced by LPS. To further determine whether PKD1 is involved required for MyD88-dependent ubiquitination of TRAF6. Our only in MyD88-dependent signaling pathways, we examined the

results also suggest the possibility that PKD1 may link IRAKs expression of various cytokines and chemokines by TLR ligands in http://www.jimmunol.org/ and TRAF6. PKD1-knockdown macrophages and PKD1-knockdown BMDCs. Expression of TLRs, TLR signaling downstream molecules, PKC PKD1 is essential for MyD88-dependent pathway, but not family proteins, PKD2, and PKD3 was normal in PKD1-knock- TRIF-dependent pathway down macrophages and PKD1-knockdown BMDCs (Fig. 7, A and Activation of TAK1 in TLR signaling is dependent on a MyD88/ B) (27). As shown in Figs. 6, A and B, and 7, C and D, expression IRAK4/IRAK1/TRAF6 pathway as well as a TRIF/TRAF6 path- of cytokines TNF-␣, IL-6, IL-10, and IL-12p40 at both mRNA and way (32–34). Activation of TAK1, in turn, leads to activation of protein levels in response to CpG DNA, LPS, or PGN was com- NF-␬B and MAPKs that regulate expression of proinflammatory pletely inhibited in PKD1-knockdown macrophages and PKD1- cytokines and chemokines. To determine the precise physiological knockdown BMDCs. In addition, a TLR9 ligand CpG DNA failed by guest on September 28, 2021 role of PKD1 in individual TLR signaling, we generated PKD1- to induce expression of IP-10, MCP-1, CCL5, and CD86 in PKD1- knockdown macrophages and investigated whether PKD1 is re- knockdown macrophages and PKD1-knockdown BMDCs (Fig. 6, quired for the activation of TAK1 and its downstream MAPKs and C and D, and Fig. 7, D and E). However, CpG DNA-mediated NF-␬B. Expression of TLRs and TLR-downstream signaling mod- IFN-␤ expression that is dependent on TRAF3, not TRAF6, was ulators in PKD1-knockdown macrophages was comparable to that not suppressed in PKD1-knockdown BMDCs (Fig. 7D). LPS-me- in control luciferase-knockdown macrophages (27). CpG DNA-, diated expression of IFN-␤, IP-10, MCP-1, CCL5, and CD86 was PGN-, or IL-1␤ (which uses only the MyD88-dependent pathway)- not altered in PKD1-knockdown macrophages and PKD1-knock- mediated activation of TAK1, MAPKs (ERK, JNK, and p38), and down BMDCs compared with those in the control cells (Fig. 6, C transcriptional factors (NF-␬B, AP-1, CREB, and STAT1) was and D, and Fig. 7, D and E). Moreover, expression levels of cy- ablated in PKD1-knockdown macrophages (Fig. 5, A, C, E, and tokines (TNF-␣, IL-6, IL-10, IL-12p40, and IFN-␤), chemokines G). However, LPS (which uses both MyD88-dependent and TRIF- (IP-10, MCP-1, and CCL5), and surface molecule CD86 induced dependent pathways)-mediated activation of TAK1, MAPKs, and in response to TLR3 ligand poly(I:C) were comparable in both transcription factors (NF-␬B, AP-1, CREB, and STAT1) was de- PKD1-knockdown cells and control cells (Fig. 6 and Fig. 7, C–E). layed and attenuated, but not abolished in PKD1-knockdown mac- These results demonstrate that PKD1 is essential for the MyD88- rophages (Fig. 5). In addition, activation of TRIF-dependent tran- dependent, but not TRIF-dependent, signaling pathways in mac- scription factor IFN-stimulated responsive element (ISRE) by LPS rophages and DCs. was not altered in PKD1-knockdown macrophages (Fig. 5G). As We further investigated whether PKD1 is also critical in TLR expected, poly(I:C)- or IFN-␥-mediated activation of transcription ligand-mediated MyD88-dependent activation of signaling modu- factors (NF-␬B, AP-1, CREB, and ISRE) was not suppressed in lators and expression of cytokines and chemokines in vivo. PKD1-knockdown macrophages (Fig. 5G). These results suggest C57BL/6 mice were stimulated with CpG DNA, LPS, or poly(I:C) that PKD1 is required only for the MyD88-dependent activation of in the presence or absence of PKC/PKD inhibitor Go¨6976 for in- TAK1, MAPKs, and transcription factors. dicated time periods. Activation of MAPKs, degradation of I␬B MyD88 is essential for gene expression induced by TLR2, (as an indication of NF-␬B activation), and expression of the se- TLR5, TLR7, TLR8, and TLR9, whereas TRIF is essential for lected cytokines and chemokines in spleen cells were analyzed. gene expression by TLR3 (1). However, TLR4-mediated gene ex- Systemic production of the selected cytokines (TNF-␣, IL-6, IL- pression is dependent on MyD88 and/or TRIF (12, 16, 35). The 10, and IL-12) in serum was also detected. As demonstrated in Fig. TLR4 ligand LPS-mediated expression of proinflammatory cyto- 8A, systemic administration of Go¨6976 effectively inhibited CpG kines requires both MyD88 and TRIF, whereas LPS-mediated ex- DNA- and LPS-mediated PKD1 activation in vivo. CpG DNA pression of IFN-␤, IP-10, MCP-1, and CCL5 requires only TRIF, failed to induce activation of JNK, p38, and ERK; degradation of and either MyD88 or TRIF is sufficient for CD86 expression in- I␬B␣ and I␬B␤; and expression of proinflammatory cytokines and 6322 PKD1 IN MyD88-DEPENDENT SIGNALING Downloaded from http://www.jimmunol.org/ by guest on September 28, 2021

FIGURE 5. PKD1 is required for MyD88-dependent activation of TAK1, MAPKs, and transcription factors. A–F, Control luciferase-knockdown (Luc shRNA) or PKD1-knockdown (PKD1 shRNA) macrophages were stimulated as indicated for 45 min (A, C, and E),1h(E, for NF-␬B),or4h(E, for AP-1), or stimulated with LPS for indicated time periods (B, D, and F). Phosphorylation of TAK1, JNK, p38, ERK, CREB, and STAT1 was detected by Western blot analysis. DNA-binding activities of transcription factor, NF-␬B, or AP-1, in equal amounts of nuclear extracts (3 ␮g/lane), were analyzed by EMSA (gel shift), and degradation of I␬B␣ and I␬B␤ in cytosolic extracts was detected by Western blot analysis (WB). G, Cells were transiently transfected with AP-1-␤-galactosidase, or pRL-TK-luciferase plus NF-␬B-luciferase, CREB-luciferase, or ISRE-luciferase reporter genes and then stimulated as indicated for 12 h. Luciferase (NF-␬B, CREB, or ISRE) or ␤-galactosidase (AP-1) activities in cell extracts were analyzed. Data represent the mean relative luciferase unit (RLU) Ϯ SD of triplicates. The Journal of Immunology 6323 Downloaded from http://www.jimmunol.org/ by guest on September 28, 2021

FIGURE 6. PKD1 is essential for the expression of MyD88-dependent genes, but dispensable for the expression of TRIF-dependent genes in RAW264.7 cells. Control luciferase-knockdown or PKD1-knockdown RAW264.7 cells were stimulated as indicated for 24 h (A and D)or4h(B and C). Levels of the indicated proteins in the culture supernatant (A) and mRNA (B and C) were analyzed by ELISA and RT-PCR, respectively. Surface expression levels of CD86 were detected by flow cytometric analysis (D). ELISA data represent the mean cytokine concentration (pg/ml) Ϯ SD of triplicates. chemokines (TNF-␣, IL-6, IL-10, IL-12, IP-10, MCP-1, and Discussion CCL5) in mice pretreated with Go¨6976 (Fig. 8). However, CpG In this study, we identified PKD1 as one of the critical proximal ␤ DNA-mediated IFN- expression was not suppressed in mice signaling molecules in the TLR signal transduction pathway and pretreated with Go¨6976 (Fig. 8B). In comparison, LPS-mediated determined the physiological role of PKD1 in the signal transduc- ␬ ␣ ␬ ␤ activation of MAPKs and degradation of I B and I B were tion pathways used by TLR family members. Among the three partially (but to a substantial degree) inhibited in mice pretreated PKD family proteins, only PKD1 is activated by all TLRs that with Go¨6976 (Fig. 8A). LPS-mediated expression of proinflamma- recruit MyD88 and is required for MyD88-dependent activation of tory cytokines (TNF-␣, IL-6, IL-10, IL-12) was completely ablated MAPKs and transcription factors and subsequent expression of in mice pretreated with Go¨6976 (Fig. 8, B and C). In contrast, proinflammatory cytokine and chemokine genes by the TLR fam- LPS-mediated expression of IFN-␤, IP-10, MCP-1, and CCL5 was not suppressed in mice pretreated with Go¨6976 compared with that ily members regardless of involvement of MAL/TIRAP. In con- in the control mice (Fig. 8B). Moreover, levels of MAPK activa- trast, PKD1 is not activated by TLR3 and is not necessary for tion, I␬B␣ and I␬B␤ degradation, and cytokine (TNF-␣, IL-6, IL- signaling via the TRIF-dependent pathway of TLR3 and TLR4. 10, IL-12p40, and IFN-␤) and chemokine (IP-10, MCP-1, and Using Abs specific for the phosphorylated forms of PKD family CCL5) expression induced in response to TLR3 ligand poly(I:C) proteins and pharmacological inhibitor Go¨6976 (inhibits PKC␣, were comparable in both control mice and mice pretreated with PKC␤I, and PKD), several recent studies have suggested that Go¨6976 (Fig. 8). Collectively, these results indicate that PKD1 is members of PKD family proteins may be implicated in activation essential for the MyD88-dependent, but not TRIF-dependent, sig- of MAPKs and production of cytokines and chemokines in re- naling pathway that leads to expression of proinflammatory cyto- sponse to ligands for TLR1/2, TLR4, TLR5, and TLR9 (24–27). kines and chemokines in vitro and in vivo. However, to date, it is not known whether all TLR ligands induce 6324 PKD1 IN MyD88-DEPENDENT SIGNALING Downloaded from http://www.jimmunol.org/ by guest on September 28, 2021

FIGURE 7. PKD1 is essential for the expression of MyD88-dependent genes, but dispensable for the expression of TRIF-dependent genes in bone marrow-derived DCs. A and B, BMDCs were transiently transfected with 100 nM nontarget siRNA (NT siRNA) or PKD1-sepcific siRNA (PKD1 siRNA) using lipofectamine. mRNA levels (A) and protein levels (B) of the selected molecules in TLR signaling, PKD family, and PKC family in control and PKD1-knockdown BMDCs were analyzed by RT-PCR and Western blot assay, respectively. C–E, Control or PKD1-knockdown BMDCs were stimulated as indicated for 24 h (C and E)or4h(D). Levels of the indicated proteins in the culture supernatant (C) and mRNA (D) were analyzed by ELISA and RT-PCR, respectively. Surface expression levels of CD86 were detected by flow cytometric analysis (E). ELISA data represent the mean cytokine concentration (pg/ml) Ϯ SD of triplicates. activation of one or more PKD family members, and which PKD tion (3, 36–39). IRAK4 has shown to induce phosphorylation of family member(s) plays a physiological role in individual signal- IRAK1, which reveals hidden three TRAF6-binding motifs present ing from TLRs. Our experiments showed that with exception of in C-terminal region of IRAK1, and phosphorylated IRAK1 is dis- TLR3 ligand, all TLR ligands tested induced increased phosphor- sociated from MyD88 and binds to TRAF6 (39). Upon CpG DNA ylation and kinase activity of PKD1, but not PKD2 and PKD3. In (or LPS) stimulation, PKD1 physically interacts with TLR9 (or addition, we found that PKD1 was activated in macrophages in TLR4), MyD88, IRAK4, IRAK1, and TRAF6, but not with response to IL-1␤ and IL-18, cytokines that use MyD88 for trans- TRAF3, in macrophages (data not shown) (27). However, PKD1 ducing signals from their receptors. These indicate the possibility failed to interact with MyD88 and TRAF6 in either IRAK4-knock- that PKD1 might be activated through and functioning in the down macrophages or IRAK1-knockdown macrophages (data not MyD88-dependent pathway. Indeed, MyD88Ϫ/Ϫ macrophages shown). In addition, our results showed that PKD1 activation by showed defects in PKD1 activation in response to TLR ligands, TLR ligands is dependent on both IRAK4 and IRAK1, whereas it IL-1␤, and IL-18. In contrast, activation of PKD1 by TLR ligands is independent of TRAF6. Instead, PKD1 is appeared to be re- was normal in TRIF-defective mutant (TrifLps2/Lps2) macrophages. quired for MyD88-dependent ubiquitination of TRAF6. Although These results demonstrate that MyD88, but not TRIF, is necessary the precise mechanism by which IRAK family proteins interact for TLR-mediated PKD1 activation. and activate PKD1 upon TLR ligand stimulation has yet to be Previous studies have shown that IRAK family proteins interact revealed, our findings indicate that recruitment of PKD1 to the with MyD88 and TRAF6 and play a critical role in MyD88-de- TLR/MyD88 receptor complex is indirect via its binding to IRAK4 pendent TRAF6 ubiquitination and downstream signal transduc- and IRAK1, and that PKD1 might play a critical role in linking The Journal of Immunology 6325

IRAK family proteins to TRAF6. Recently using HEK293T cells and overexpression system, Bowie and colleagues (3) demonstrated that IRAK2 is involved in TRAF6 ubiquitination and NF-␬B activation via a mechanism dependent on MyD88 and MAL/TIRAP, but independent of TRIF, and plays a role in TLR3-, TLR4-, and TLR8-mediated cytokine production. In addition, Akira and colleagues (4) reported that IRAK2 is dispensable for activation of the initial TLR signaling cascades, but essential for sustaining TLR-induced activation of NF-␬B and expression of genes encoding cytokines. Similar to what Akira and colleagues found in IRAK2Ϫ/Ϫ macrophages, we also found that IRAK2 is dispensable for activation of the initial TLR signaling cascades and early-phase gene expression, but contributes to the sustained (late- phase) NF-␬B activation using IRAK2-knockdown RAW264.7 cells (Y. I. Kim, J. E. Park, and A. K. Yi manuscript in preparation). In our hand, the levels of CpG DNA-mediated PKD1 activation, as well as activation of all three MAPKs, in IRAK2-knockdown RAW264.7 cells were comparable to those in the control

RAW264.7 cells, indicating that IRAK2 is not involved in the, at Downloaded from least, initial phase of TLR-mediated PKD1 activation in macrophages. It is possible that IRAK2 may function as a PKD1-downstream signaling effector that connects PKD1 to TRAF6. However, physical interaction between PKD1 and IRAK2 was not detected in RAW264.7 cells within 45 min after CpG DNA stimulation,

indicating that IRAK2 may be not essential for the, at least, early http://www.jimmunol.org/ phase of TRAF6 ubiquitination in macrophages. Different ﬁndings between Bowie’s group and our laboratory may be due to different experimental systems used. However, we cannot rule out the possibilities that IRAK2 may be involved in the PKD1-independent late-phase TRAF6 ubiquitination induced by LPS in macrophages and/or IRAK2 may be a factor that substitutes both IRAK1 and PKD1 in the late-phase TLR responses. These possibilities are warranted to be investigated in future studies. Similar to those observed in MyD88Ϫ/Ϫ cells (11, 16), activation of by guest on September 28, 2021 TAK1, MAPKs, and NF-␬B by TLR2 ligand, TLR9 ligand, or IL-1␤ was completely suppressed in PKD1-knockdown macrophages. In addition, TLR4 ligand-mediated activation of TAK1, MAPKs, and NF- ␬B, which can be mediated through either MyD88-dependent or TRIF-dependent pathways, was delayed and attenuated in PKD1- knockdown macrophages. Furthermore, activation of TRIF-dependent transcription factor ISRE by LPS and activation of NF-␬B, AP-1, CREB, and ISRE by TLR3 ligand were not altered in PKD1-knockdown macrophages. Because ubiquitination of TRAF6 is necessary for activation of TAK1, which leads to activation of NF-␬B and MAPK pathways in both MyD88-dependent and TRIF-dependent pathways (32–34), and PKD1 is required for MyD88-dependent ubiquitination of TRAF6, effects of PKD1 on TLR ligand-mediated activation of MAPKs and NF-␬B might be indirect due to its contribution on ubiquitination of TRAF6 and subsequent TAK1 activation. Taken together, these results demonstrated that PKD1 is essential for MyD88-dependent, but not TRIF-dependent, activation of TAK1 and its downstream signaling pathways, irrespective of involvement of MAL/TIRAP. Production of proinﬂammatory cytokines, chemokines, and type I IFNs, which are critical for host defense against invading pathogens, by individual TLRs is differently regulated by signaling

FIGURE 8. Effect of pharmacological PKC/PKD inhibitor Go¨6976 on whole spleen cell lysates were prepared. Phosphorylation of PKD1, JNK, TLR ligand-mediated cytokine and chemokine expression. C57BL/6 mice p38, and ERK and presence of I␬B␣ and I␬B␤ in whole spleen cell lysates were injected i.p. with DMSO or Go¨6976 (2.5 mg/kg body weight) at 4 and were detected by Western blot analysis (A). mRNA levels of the indicated 1 h before the TLR ligand stimulation. DMSO- or Go¨6976-pretreated mice cytokines and chemokines in spleen were analyzed by RT-PCR (B). Levels were injected i.p. with PBS, CpG DNA (30 ␮g/mouse), LPS (2 ␮g/mouse), of the indicated cytokines in serum were analyzed by cytokine-speciﬁc or poly(I:C) (150 ␮g/mouse). Two hours later, mice were bled to obtain ELISAs (C). Data represent the mean concentration (pg/ml) Ϯ SD of serum and then euthanized. Spleen was isolated. Total spleen RNA and triplicates. 6326 PKD1 IN MyD88-DEPENDENT SIGNALING

interacts with TRAF6, but not with TRAF3, upon CpG DNA stimulation (5, 6, 27). In addition, we previously found that TLR9- mediated IFN-␣ expression, which is dependent on IRF, in plasmacytoid DCs is independent of PKD1 (27). These findings collectively indicate that although it is essential for MyD88-dependent expression of proinflammatory cytokines and chemokines, PKD1 does not play a role in MyD88-dependent type I IFN expression. A hypothetical model for PKD1 involvement in MyD88- dependent proinflammatory gene expression in TLR signaling is shown in Fig. 9. Collectively, our results demonstrate that PKD1 is a critical kinase that connects TLR/MyD88 signaling to TRAF6 and plays an indispensable role in MyD88-dependent gene expression. In summary, the present study provides the first direct evidence for MyD88-dependent PKD1 activation by TLR ligands and cytokines, and uncovers the physiological role of PKD1 in the MyD88-dependent signaling pathway.

FIGURE 9. Hypothetical model for PKD1 involvement in TLR/MyD88 Acknowledgments Downloaded from signaling pathway. Ligand-bound TLR recruits MyD88. TLR-bound We thank Dr. S. Akira (Osaka University, Osaka, Japan) for providing MyD88 interacts with several proteins, including IRFs, TRAF3, IRAK4, TLR9Ϫ/Ϫ and MyD88Ϫ/Ϫ mice. We also thank Andrea Patters for excellent and IRAK1. On one hand, activated IRFs and TRAF3 initiates signaling assistance with preparation of the manuscript. cascades that lead to production of type I IFNs. In contrast, IRAK1 is activated by IRAK4 in the TLR/MyD88/IRAK receptor complex. Subse- quently, PKD1 is recruited to the TLR/MyD88 receptor complex by inter- Disclosures acting with IRAK4 and IRAK1 and then activated by IRAKs. IRAK1- The authors have no financial conflict of interest. http://www.jimmunol.org/ bound activated PKD1 leaves the TLR/MyD88 receptor complex and binds to TRAF6, which allows TRAF6 to interact with IRAK1, and leads to the References ubiquitination of TRAF6. Ubiquitinated TRAF6 leads to the activation of 1. Kawai, T., and S. Akira. 2006. TLR signaling. Cell Death Differ. 13: 816–825. TAK1, which in turn activates signaling cascades that lead to activation of 2. O’Neill, L. A., and A. G. Bowie. 2007. The family of five: TIR-domain-contain- MAPKs and NF-␬B, and subsequent production of proinflammatory cyto- ing adaptors in Toll-like receptor signalling. Nat. Rev. Immunol. 7: 353–364. 3. Keating, S. E., G. M. Maloney, E. M. Moran, and A. G. Bowie. 2007. IRAK-2 kines and chemokines. participates in multiple Toll-like receptor signaling pathways to NF␬B via activation of TRAF6 ubiquitination. J. Biol. Chem. 282: 33435–33443. 4. Kawagoe, T., S. Sato, K. Matsushita, H. Kato, K. Matsui, Y. Kumagai, T. Saitoh, T. Kawai, O. Takeuchi, and S. Akira. 2008. Sequential control of Toll-like re- transduced through TIR domain-containing adaptors used by each ceptor-dependent responses by IRAK1 and IRAK2. Nat. Immunol. 9: 684–691. by guest on September 28, 2021 different TLR. TLR2-, TLR5-, TLR7-, TLR8-, and TLR9-medi- 5. Kawai, T., S. Sato, K. J. Ishii, C. Coban, H. Hemmi, M. Yamamoto, K. Terai, M. Matsuda, J. Inoue, S. Uematsu, et al. 2004. Interferon-␣ induction through ated expression of cytokine/chemokine genes is dependent on Toll-like receptors involves a direct interaction of IRF7 with MyD88 and TRAF6. MyD88, whereas TLR3-mediated gene expression is dependent on Nat. Immunol. 5: 1061–1068. TRIF (2, 40). Both MyD88 and TRIF are required for production 6. Hacker, H., V. Redecke, B. Blagoev, I. Kratchmarova, L. C. Hsu, G. G. Wang, M. P. Kamps, E. Raz, H. Wagner, G. Hacker, et al. 2006. Specificity in Toll-like of proinflammatory cytokines, including TNF-␣, IL-6, and IL-10, receptor signalling through distinct effector functions of TRAF3 and TRAF6. induced by TLR4, whereas only TRIF is necessary for TLR4-me- Nature 439: 204–207. ␤ 7. Hayashi, F., K. D. Smith, A. Ozinsky, T. R. Hawn, E. C. Yi, D. R. Goodlett, diated expression of IP-10, MCP-1, CCL5, and IFN- , and either J. K. Eng, S. Akira, D. M. Underhill, and A. Aderem. 2001. The innate immune MyD88 or TRIF is sufficient for CD86 expression induced by response to bacterial flagellin is mediated by Toll-like receptor 5. Nature 410: TLR4 (16, 35, 41, 42). We found that either inhibition of PKD1 1099–1103. 8. Hemmi, H., T. Kaisho, O. Takeuchi, S. Sato, H. Sanjo, K. Hoshino, T. Horiuchi, activation by pharmacological inhibitor Go¨6976 or knockdown of H. Tomizawa, K. Takeda, and S. Akira. 2002. Small anti-viral compounds acti- PKD1 messages by siRNA or shRNA inhibited the expression of vate immune cells via the TLR7 MyD88-dependent signaling pathway. Nat. Im- TNF-␣, IL-6, IL-10, and IL-12 by TLR2, TLR4, or TLR9, whereas munol. 3: 196–200. 9. Schnare, M., A. C. Holt, K. Takeda, S. Akira, and R. Medzhitov. 2000. Recog- they had no effect on the expression of these cytokine genes by nition of CpG DNA is mediated by signaling pathways dependent on the adaptor TLR3. In addition, inhibition of PKD1 activation or knockdown of protein MyD88. Curr. Biol. 10: 1139–1142. 10. Takeuchi, O., A. Kaufmann, K. Grote, T. Kawai, K. Hoshino, M. Morr, PKD1 messages ablated the expression of IP-10, MCP-1, CCL5, P. F. Muhlradt, and S. Akira. 2000. Cutting edge: preferentially the R-stereoiso- and CD86 by TLR9, whereas they did not suppress the expression mer of the mycoplasmal lipopeptide macrophage-activating lipopeptide-2 acti- of these genes induced by TLR3 or TLR4. With the exception of vates immune cells through a Toll-like receptor 2- and MyD88-dependent signaling pathway. J. Immunol. 164: 554–557. expression of type I IFNs induced by TLR9 ligand, these expres- 11. Kawai, T., O. Adachi, T. Ogawa, K. Takeda, and S. Akira. 1999. Unresponsive- sion profiles of the selected proinflammatory cytokines, chemo- ness of MyD88-deficient mice to endotoxin. Immunity 11: 115–122. kines, and type I IFNs induced by different TLR ligands in PKD1- 12. Kawai, T., O. Takeuchi, T. Fujita, J. Inoue, P. F. Muhlradt, S. Sato, K. Hoshino, and S. Akira. 2001. Lipopolysaccharide stimulates the MyD88-independent path- knockdown BMDCs and PKD1-knockdown macrophages were way and results in activation of IFN-regulatory factor 3 and the expression of a Ϫ Ϫ identical with those observed in MyD88 / macrophages/DCs. subset of lipopolysaccharide-inducible genes. J. Immunol. 167: 5887–5894. Although we cannot completely rule out the possibility of PKD1 to 13. Hoebe, K., X. Du, P. Georgel, E. Janssen, K. Ta␤, S. O. Kim, J. Goode, P. Lin, N. Mann, S. Mudd, et al. 2003. Identification of Lps2 as a key transducer of contribute on MyD88-dependent gene expression through an al- MyD88-independent TIR signalling. Nature 424: 743–748. ternative pathway yet to be discovered, our results suggest that 14. Horng, T., G. M. Barton, and R. Medzhitov. 2001. TIRAP: an adapter molecule in the Toll signaling pathway. Nat. Immunol. 2: 835–841. contribution of PKD1 to MyD88-dependent gene expression is pri- 15. Fitzgerald, K. A., E. M. Palsson-McDermott, A. G. Bowie, C. A. Jefferies, marily via TRAF6/TAK1-dependent activation of MAPKs and A. S. Mansell, G. Brady, E. Brint, A. Dunne, P. Gray, M. T. Harte, et al. 2001. transcription factors, including NF-␬B, AP-1, and CREB. Of note, Mal (MyD88-adapter-like) is required for Toll-like receptor-4 signal transduc- ␤ tion. Nature 413: 78–83. it has been shown that TLR9-mediated IFN- expression is de- 16. Yamamoto, M., S. Sato, H. Hemmi, K. Hoshino, T. Kaisho, H. Sanjo, pendent on MyD88 and TRAF3, but not TRAF6, and that PKD1 O. Takeuchi, M. Sugiyama, M. Okabe, K. Takeda, and S. Akira. 2003. Role of The Journal of Immunology 6327

adaptor TRIF in the MyD88-independent Toll-like receptor signaling pathway. 29. Waldron, R. T., and E. Rozengurt. 2003. Protein kinase C phosphorylates protein Science 301: 640–643. kinase D activation loop Ser744 and Ser748 and releases autoinhibition by the 17. Oshiumi, H., M. Sasai, K. Shida, T. Fujita, M. Matsumoto, and T. Seya. 2003. pleckstrin homology domain. J. Biol. Chem. 278: 154–163. TIR-containing adapter molecule (TICAM)-2, a bridging adapter recruiting to 30. Adachi, O., T. Kawai, K. Takeda, M. Matsumoto, H. Tsutsui, M. Sakagami, Toll-like receptor 4 TICAM-1 that induces interferon-␤. J. Biol. Chem. 278: K. Nakanishi, and S. Akira. 1998. Targeted disruption of the MyD88 gene results 49751–49762. in loss of IL-1- and IL-18-mediated function. Immunity 9: 143–150. 18. Kagan, J. C., and R. Medzhitov. 2006. Phosphoinositide-mediated adaptor re- 31. Kim, Y. I., J. E. Park, A. Martinez-Hernandez, and A. K. Yi. 2008. CpG DNA cruitment controls Toll-like receptor signaling. Cell 125: 943–955. prevents liver injury and shock-mediated death by modulating expression of IL- 1R-associated kinases. J. Biol. Chem. 283: 15258–15270. 19. Kagan, J. C., T. Su, T. Horng, A. Chow, S. Akira, and R. Medzhitov. 2008. 32. Ninomiya-Tsuji, J., K. Kishimoto, A. Hiyama, J. Inoue, Z. Cao, and TRAM couples endocytosis of Toll-like receptor 4 to the induction of interfer- K. Matsumoto. 1999. The kinase TAK1 can activate the NIK-I ␬B as well as the on-␤. Nat. Immunol. 9: 361–368. MAP kinase cascade in the IL-1 signalling pathway. Nature 398: 252–256. 20. Meylan, E., K. Burns, K. Hofmann, V. Blancheteau, F. Martinon, M. Kelliher, 33. Wang, C., L. Deng, M. Hong, G. R. Akkaraju, J. Inoue, and Z. J. Chen. 2001. and J. Tschopp. 2004. RIP1 is an essential mediator of Toll-like receptor 3-in- TAK1 is a ubiquitin-dependent kinase of MKK and IKK. Nature 412: 346–351. ␬ duced NF- B activation. Nat. Immunol. 5: 503–507. 34. Jiang, Z., T. W. Mak, G. Sen, and X. Li. 2004. Toll-like receptor 3-mediated 21. Jiang, Z., M. Zamanian-Daryoush, H. Nie, A. M. Silva, B. R. Williams, and activation of NF-␬B and IRF3 diverges at Toll-IL-1 receptor domain-containing X. Li. 2003. Poly(I-C)-induced Toll-like receptor 3 (TLR3)-mediated activation adapter inducing IFN-␤. Proc. Natl. Acad. Sci. USA 101: 3533–3538. of NF␬B and MAP kinase is through an interleukin-1 receptor-associated kinase 35. Hirotani, T., M. Yamamoto, Y. Kumagai, S. Uematsu, I. Kawase, O. Takeuchi, (IRAK)-independent pathway employing the signaling components TLR3- and S. Akira. 2005. Regulation of lipopolysaccharide-inducible genes by MyD88 TRAF6-TAK1-TAB2-PKR. J. Biol. Chem. 278: 16713–16719. and Toll/IL-1 domain containing adaptor inducing IFN-␤. Biochem. Biophys. 22. Oganesyan, G., S. K. Saha, B. Guo, J. Q. He, A. Shahangian, B. Zarnegar, Res. Commun. 328: 383–392. A. Perry, and G. Cheng. 2006. Critical role of TRAF3 in the Toll-like receptor- 36. Muzio, M., J. Ni, P. Feng, and V. M. Dixit. 1997. IRAK (Pelle) family member dependent and -independent antiviral response. Nature 439: 208–211. IRAK-2 and MyD88 as proximal mediators of IL-1 signaling. Science 278: 23. Rozengurt, E., O. Rey, and R. T. Waldron. 2005. Protein kinase D signaling. 1612–1615. J. Biol. Chem. 280: 13205–13208. 37. Li, S., A. Strelow, E. J. Fontana, and H. Wesche. 2002. IRAK-4: a novel member Downloaded from 24. Jeohn, G. H., C. L. Cooper, K. J. Jang, B. Liu, D. S. Lee, H. C. Kim, and of the IRAK family with the properties of an IRAK-kinase. Proc. Natl. Acad. Sci. J. S. Hong. 2002. Go6976 inhibits LPS-induced microglial TNF␣ release by USA 99: 5567–5572. suppressing p38 MAP kinase activation. Neuroscience 114: 689–697. 38. Lye, E., C. Mirtsos, N. Suzuki, S. Suzuki, and W. C. Yeh. 2004. The role of interleukin 1 receptor-associated kinase-4 (IRAK-4) kinase activity in IRAK-4- 25. Ivison, S. M., N. R. Graham, C. Q. Bernales, A. Kifayet, N. Ng, L. A. Shobab, mediated signaling. J. Biol. Chem. 279: 40653–40658. and T. S. Steiner. 2007. Protein kinase D interaction with TLR5 is required for 39. Nguyen, T., D. De Nardo, P. Masendycz, J. A. Hamilton, and G. M. Scholz. 2009. inﬂammatory signaling in response to bacterial ﬂagellin. J. Immunol. 178: Regulation of IRAK-1 activation by its C-terminal domain. Cell. Signal. 21: 5735–5743. 719–727. 26. Murphy, T. R., H. J. Legere III, and H. R. Katz. 2007. Activation of protein

40. O’Neill, L. A. 2003. The role of MyD88-like adapters in Toll-like receptor signal http://www.jimmunol.org/ kinase D1 in mast cells in response to innate, adaptive, and growth factor signals. transduction. Biochem. Soc. Trans. 31: 643–647. J. Immunol. 179: 7876–7882. 41. Sato, N., N. Takahashi, K. Suda, M. Nakamura, M. Yamaki, T. Ninomiya, 27. Park, J. E., Y. I. Kim, and A. K. Yi. 2008. Protein kinase D1: a new component Y. Kobayashi, H. Takada, K. Shibata, M. Yamamoto, et al. 2004. MyD88 but not in TLR9 signaling. J. Immunol. 181: 2044–2055. TRIF is essential for osteoclastogenesis induced by lipopolysaccharide, diacyl 28. Yeo, S. J., J. G. Yoon, and A. K. Yi. 2003. Myeloid differentiation factor 88- lipopeptide, and IL-1␣. J. Exp. Med. 200: 601–611. dependent post-transcriptional regulation of cyclooxygenase-2 expression by 42. Kaisho, T., O. Takeuchi, T. Kawai, K. Hoshino, and S. Akira. 2001. Endotoxin- CpG DNA: tumor necrosis factor-␣ receptor-associated factor 6, a diverging induced maturation of MyD88-deﬁcient dendritic cells. J. Immunol. 166: point in the Toll-like receptor 9-signaling. J. Biol. Chem. 278: 40590–40600. 5688–5694. by guest on September 28, 2021