ANALYSES OF THE THYMIDYLATE SYNTHASE
PROMOTER AND AN RNA HELICASE REQUIRED FOR
mRNA EXPORT
DISSERTATION
Presented in Partial Fulfillment of the Requirements for
the Degree Doctor of Philosophy in the Graduate
School of The Ohio State University
By
Fehmida Kapadia, M.Sc
*****
The Ohio State University 2005
Dissertation Committee: Approved by Professor Lee Johnson, Advisor
Professor Mike Ostrowski
Professor Gustavo Leone ______Professor Jim DeWille Advisor Ohio State Biochemistry Program
ABSTRACT
Part 1: URH49 is a presumed mammalian RNA helicase that is 90% identical to UAP56, an essential mRNA splicing/export factor. Both proteins interact with the mRNA export factor Aly and both are able to rescue the loss of Sub2p (the yeast homolog of UAP56), indicating that both proteins have similar functions.
Both proteins have differential tissue and cell cycle expression profiles suggesting that they might be involved in regulating different mRNA populations.
The goal of my project was to define cellular functions of UAP56 and URH49 in mammalian cells using the RNA interference technology. Knockdown of both helicases resulted in necrosis within 72h whereas single helicase knockdowns had no effect on cell viability. Additionally, nuclear localization of poly (A+) RNA was observed in cells deficient of both UAP56 and URH49, but single helicase knockdowns had no significant nuclear accumulation. Knockdown of both helicases also strongly diminished reporter plasmid expression. Microarray analysis of cytoplasmic RNA isolated from cells knocked down of one helicase or the other showed no significant changes in the population of mRNA being exported. These observations suggest that both helicases are required in mammalian cells for cell viability and mRNA processing and/or export.
Part 2: The promoter of the mouse thymidylate synthase (TS) gene lacks a
TATAA box and an initiator element, is bidirectional and initiates transcription at ii multiple start sites across a 90-nucleotide initiation window. The essential region
of the TS promoter is 30 nucleotides in length and partially overlaps the 5’ end of
the initiation window. The goal of this study was to determine if the addition of a
TATAA box or an initiator element would have a significant effect on start-site pattern, promoter bidirectionality and S-phase regulation of the TS gene. A
TATAA box and/or an initiator element spaced 34 nucleotides apart were inserted downstream of the TS essential promoter region, which was used to
drive expression of appropriate indicator genes. The engineered genes were
transfected into cultured mammalian cells, and the effects of the mutations were
determined. Addition of the TATAA box and especially the initiator element had
a significant effect on the transcriptional start site pattern, indicating that the
elements were functional. Unexpectedly, addition of one or both of these
elements had no effect on promoter bidirectionality. However, inclusion of the
initiator element led to a significant reduction in S-phase regulation of TS mRNA
levels, indicating that changes in promoter architecture can perturb normal S-
phase regulation of TS gene expression.
iii
To my parents….. for being my stepping stones and everything in between
iv
ACKNOWLEDGMENTS
I would like to thank my advisor Dr. L.F. Johnson for letting my conduct my
doctoral research under his umbrella. He has always been understanding and
supportive whether it was getting an ACL fixed or learning horseback riding ☺ I
am also thankful to all my committee members for their valuable discussions and
support. I always enjoyed my committee meetings.
I’d also like to thank all the past and present lab members for their advice and
more importantly their valuable friendship. I’d like to thank Mike Zianni and all the
members at the PMGF facility for helping me out with real time PCR and
sequencing. I’d like to thank Bryan Mc Elwain and Mark Kotur for help with cell
sorting and flow cytometry. I’d like to thank Alan Bakaletz, Kathy Wolken and
Brian Kemmenoe for assistance with confocal microscopy. I’d like to thank
Komudi Singh and Dr. Berl Oakley for assistance with fluorescence microscopy.
I’d like to thank Chris Thompson for helping me out with the in situ hybridization
protocols. I’d like to thank Tasneem Motiwala for lending me reagents from her
lab and all my friends for constantly lending me their ears.
I’d also like to acknowledge Dr. Schoenberg for lending us cell lines and
plasmids. A special thanks to Dr. Andrea Dosseff and Oliver Voss for all their
help with apoptosis and flow cytometry experiments. v
VITA
December 21st 1973...... Born – Bombay, India
1991-1994...... B.Sc. Microbiology/ Biochemistry, University of Bombay, India
1994-1996...... M.Sc. Biochemistry, Univ. of Bombay, India
1996-1997...... Marketing Executive, CIPLA (India) Ltd
1997-1999...... Graduate Research Associate and Teaching Assistant, University of Maryland, Baltimore
1999-2005...... Graduate Research Associate and Teaching Assistant, The Ohio State University
PUBLICATIONS
1) Pryor A, Tung L, Yang Z, Kapadia F, Chang TH, Johnson LF (2004 Mar) Growth-regulated expression and G0-specific turnover of the mRNA that encodes URH49, a mammalian DexH/D box protein that is highly related to the mRNA export protein UAP56. Nucleic Acid Res. 32(6) 1857-65
2) Rush LJ, Heinonen K, Mrozek K, Wolf BJ, Abdel-Rahman M, Szymanska J, Peltomaki P, Kapadia F, Bloomfield CD, Caligiuri MA, Plass C (2002 Mar) Comprehensive cytogenetic and molecular genetic characterization of the TI-1 acute myeloid leukemia cell line reveals cross-contamination with K-562 cell line. Blood (5) 2874-6
vi
FIELDS OF STUDY
Major Field: Biochemistry
vii
TABLE OF CONTENTS
Page
ABSTRACT...... ii
ACKNOWLEDGMENTS ...... v
VITA ...... vi
LIST OF FIGURES...... xi
LIST OF TABLES ...... xiv
LIST OF ABBREVIATIONS ...... xv
CHAPTER 1 ...... 1
INTRODUCTION ...... 1
Transcription...... 1 RNA Processing ...... 6 Capping...... 6 Splicing...... 7 Cleavage and Polyadenylation ...... 7 Coupling transcription and processing...... 8 Role of promoter...... 9 Role of RNA polymerase II CTD...... 9 Effect of Splicing, Capping and 3’ processing on each other...... 12 Coupling Transcription and Export ...... 14 Coupling splicing to export, translation and NMD ...... 15 EJC and mRNA export ...... 16 EJC and mRNA localization ...... 19 EJC and translation ...... 20 EJC and NMD ...... 21 viii NMD and Translation ...... 23 Research projects and goals...... 24
CHAPTER 2 ...... 34
KNOCKDOWN OF UAP56 AND URH49 RESULTS IN CELL DEATH AND NUCLEAR LOCALIZATION OF POLY (A)+ RNA...... 34
INTRODUCTION ...... 34 DEXD/H-BOX HELICASES...... 34 UAP56 (U2AF65 ASSOCIATED PROTEIN - 56 KD) ...... 40 MATERIALS AND METHODS ...... 46 Cell Culture...... 46 siRNA selection and synthesis ...... 47 HeLa cell transient transfection and cell sorting ...... 48 Transient Transfection of HT 144 cells...... 49 siRNA transfection using TransIT TKO ...... 49 Transient transfection and stimulation of HeLa-S3 tet-off cells...... 50 Total RNA isolation, cDNA synthesis and Quantitative Real Time PCR...... 50 Fluorescent in situ hybridization (FISH)...... 52 Quantitation of nuclear-cytoplasmic distribution of poly (A+) RNA ...... 53 3H Uridine incorporation ...... 54 Total Protein Analysis...... 54 Apoptosis/necrosis assay using AnnexinV-EGFP and Propidium Iodide (PI) staining...... 55 Taxol treatment and DAPI staining for Apoptosis Induction in HeLa cells ... 55 Luciferase Assays ...... 56 RESULTS...... 57 siRNA efficiency and specificity...... 57 UAP56 and/or URH49 knockdown effect on cell viability and morphology.. 58 Cell death in double knockdown cells is not via the apoptotic pathway...... 60 Knockdown of UAP56 and URH49 results in nuclear accumulation of poly (A+) RNA...... 61 Localization of poly (A+) RNA in the nucleus ...... 63 3H Uridine incorporation ...... 64 Reporter gene expression in cells knocked down of UAP56 and/or URH4965 Generation of Stable Cell Lines...... 67 Microarray Analysis ...... 68 DISCUSSION ...... 70 Role of UAP56 and URH49 in cell viability ...... 71 Nuclear localization of poly (A+) RNA ...... 74 Protein- Protein interactions ...... 76 Protein Levels...... 77 Differential regulation of RNA populations...... 78 ix CHAPTER 3 ...... 116
INTRODUCTION OF AN INITIATOR ELEMENT IN THE MOUSE THYMIDYLATE SYNTHASE PROMOTER ALTERS S-PHASE REGULATION BUT HAS NO EFFECT ON PROMOTER BIDIRECTIONALITY...... 116
INTRODUCTION ...... 116 Biochemical role of Thymidylate Synthase...... 116 The mouse TS promoter...... 117 Regulation of the TS gene...... 118 Promoter Bidirectionality...... 119 MATERIALS AND METHODS ...... 123 Cell Culture...... 123 Vectors, Minigenes and Transfection ...... 123 Serum stimulation and qRealTime PCR...... 126 S1 Nuclease Protection Assay ...... 128 RESULTS...... 130 Initiator element and TATAA box condense transcription start sites ...... 130 Construction of the Dual-Luc vector ...... 131 TATAA box and/or initiator element do not affect bidirectionality ...... 132 Initiator element decreases S-phase stimulation of the TS gene...... 134 DISCUSSION ...... 136 Condensation of start site patterns...... 136 Spacing of the TATA box and the initiator element ...... 138 Initiator element affects S-phase regulation ...... 138 Identification of proteins associated with the promoter region...... 141
BIBLIOGRAPHY ...... 155
x
LIST OF FIGURES
Figure Page
Figure 1.1 Core Promoter Elements...... 26
Figure 1.2 Protein-protein and DNA-protein interactions during transcription initiation ...... 27
Figure 1.3 The Splicing Reaction ...... 28
Figure 1.4 Spliceosome assembly and the splicing reaction...... 29
Figure 1.5 Interaction of cis- and trans-acting factors during polyadenylation ...... 30
Figure 1.6 Coupling different steps of mRNA biogenesis ...... 31
Figure 1.7 Effect of mRNA processing reactions on each other ...... 32
Figure 1.8 Proteins associated with the EJC...... 33
Figure 2.1 Conserved motifs of DEAD-box proteins ...... 80
Figure 2.2 Role of RNA helicases in spliceosome assembly and splicing . . 81
Figure 2.3 Role of RNA helicases in translation and mRNA degradation . . 82
Figure 2.4 “Spring-loaded” model proposing the ATPase activity of UAP56. 83
Figure 2.5 Role Of UAP56 and Aly in splicing and export ...... 84
Figure 2.6 Sequences of DNA oligo templates and siRNA target sequence. 86
Figure 2.7 Schematic of Silencer siRNA construction Kit procedure ...... 87
Figure 2.8 Forward and reverse primers for Real Time PCR ...... 88
Figure 2.9 Efficiencies of primers used for Real time PCR ...... 89 xi Figure 2.10 Specificity and efficiency of UAP56 and URH49 siRNAs ...... 91
Figure 2.11 Scrambled siRNA does not affect expression of URH49 or UAP56...... 92
Figure 2.12 Knockdown of UAP56 and URH49 results in cell death...... 93
Figure 2.13 Morphology of cells devoid of UAP56 and URH49...... 95
Figure 2.14 Increased PI staining in HeLa cells knocked down of both helicases ...... 96
Figure 2.15 Cell death is not via an apoptotic pathway...... 97
Figure 2.16 Knockdown of helicases leads to nuclear localization of PolyA RNA...... 99
Figure 2.17 Quantitation of poly (A+) RNA distribution...... 102
Figure 2.18 Z-stacks of cells to show position of localized RNA in the nucleus...... 103
Figure 2.19 3H Uridine incorporation in HeLa cells at various time points. . . .106
Figure 2.20 3H Uridine incorporation to detect Poly (A+) localization...... 107
Figure 2.21 Knockdown of UAP56 and URH49 reduces reporter gene expression ...... 108
Figure 2.22 Effect of UAP56 and/or URH49 knockdown on luc expression in tet-regulated cells ...... 109
Figure 2.23 Sense and antisense siRNA strands in the pRETRO-SUPER vector...... 110
Figure 2.24 Different pathways of mRNA export from the nucleus ...... 111
Figure 3.1 Mouse TS essential promoter region and surrounding elements...... 143
Figure 3.2 Model for communication between TS promoter and RNA processing machinery...... 144
xii Figure 3.3 Mouse TS wild type and mutant promoter sequences...... 145
Figure 3.4 Initiator element and TATAA box condense start sites...... 147
Figure 3.5 Construction of the Dual-Luc vector...... 149
Figure 3.6 TATAA box and/or initiator element do not affect TS promoter bi-directionality...... 150
Figure 3.7 Initiator element diminishesTS S-phase stimulation by 3-fold. . . 152
xiii
LIST OF TABLES
Table 2.1 Microarray analysis of differential regulation by UAP56 and URH49 ...... 112
xiv
LIST OF ABBREVIATIONS
°C degrees Celsius cDNA complementary DNA
CS calf serum
Ct threshold
DAPI 4', 6-Diamidino-2-phenylindole
DEPC diethyl pyrocarbonate
DEPC-H2O DEPC treated water
DMEM Dulbecco’s Modified Eagle Medium
DNA deoxyribonucleic acid
DMSO dimethylsulfoxide
FACS Fluorescence activated cell sorting
EJC exon junction complex
FISH Fluorescent in situ hybridization
GFP green fluorescent protein
GT guanylyl transferase
3H Tritium
H hour(s)
KD Kilodalton
xv Luc luciferase uM micromolar
M Molar (moles per liter) min minute(s) ml milliliter mm millimeter mol mole(s) ng nanogram nM nanomolar
NMD nonsense-mediated decay
NPC nuclear pore complex
PBS phosphate buffered saline
PCR polymerase chain reaction
PFA paraformaldehyde
Poly (A+) polyadenylated q RT-PCR quantitative Real Time PCR
RFP red fluorescent protein
RNA ribonucleic acid
RPL4 ribosomal protein 4
RT room temperature, reverse transcriptase, real time
Scram scrambled siRNA
Sec second(s)
Ser serine
xvi siRNA small interfering RNA
SSC sodium chloride/sodium citrate buffer tet tetracycline
UAP56 U2AF65 – associated protein (56KD)
URH49 UAP56 related helicase (49KD)
ul microliter
X Magnification, fold concentration
xvii
CHAPTER 1
INTRODUCTION
Transcription
Information transfer in a cell occurs via DNA being transcribed to RNA and
RNA being translated to proteins. Transcription is a complex process involving a
plethora of proteins and regulated by various cis elements and trans-acting
factors. Transcription initiates by the binding of transcription factor IID (TFIID) to
the core promoter element. TFIID consists of the TATA-binding protein (TBP)
and TBP associated factors (TAFs) (Woychik and Hampsey, 2002). Binding of
TFIID nucleates assembly of the pre-initiation complex (PIC). The PIC is
comprised of RNA polymerase II (RNA Pol II) and the general transcription
factors (GTFs) TFIIA, TFIIB, TFIIE, TFIIF and TFIIH (Wassarman and Sauer,
2001). The helicase activity associated with TFIIH then initiates unwinding of the
DNA strands at the transcription start site and facilitates transcription initiation
(Dvir et al., 2001).
1 The core promoter element
The core promoter is the minimum DNA sequence that can direct accurate
transcription initiation by RNA Pol II (Butler and Kadonaga, 2002). There are no
universal core promoter elements but certain motifs are commonly found such as
the TATA box, the Inr element, TFIIB recognition element (BRE) and the
downstream promoter element (DPE) (Figure 1.1). These motifs can be found
independently or in combination with each other and are found in some but not
all core promoter elements (Butler and Kadonaga, 2002).
The TATA box
The TATA box was the first core promoter element to be identified. In
mammalian cells, it is generally found 25-30 nt upstream of the transcription start site (TSS) and has the consensus sequence TATAAA although many A/T rich sequences have been found to effectively function as TATA boxes (Hahn et al.,
1989; Singer et al., 1990). TATA box is recognized by the TBP, the binding of which nucleates formation of the PIC in TATA-containing promoters (Smale and
Kadonaga, 2003). TBP-related factors (TRFs), which are closely related to TBP
have also been found (Berk, 2000). Drosophila has at least two TRFs (TRF1 and
TRF2) and humans have at least one (TRF2). No TRFs have been found in
yeast. Drosophila TRF1 can bind the TATA box as well as another motif called
the TC box. TRF2 on the other hand cannot associate with the TATA box.
2 Initiator element
The Initiator element (Inr) is found surrounding the TSS in TATA-containing
as well as TATA-less promoters. It was first identified as a core promoter element in the murine terminal deoxynucleotidyltransferase (TdT) gene (Smale and
Baltimore, 1989) and has the 8nt consensus sequence Py-Py(C)-A+1-N-T/A-Py-
Py in mammalian cells. A number of proteins have been found to interact with the
Inr. TFIID has been found to associate with the Inr in a sequence-specific manner (Purnell et al., 1994; Kaufmann and Smale, 1994; Martinez et al., 1994;
Burke and Kadonaga, 1996) especially TAFII150 and TAFII250 (Verrijzer et al.,
1994; Verrijzer et al., 1995; Chalkley and Verrijzer, 1999). Also, purified RNA Pol
II or RNA Pol II associated with TBP, TFIIB and TFIIF can recognize the Inr and
mediate transcription from the Inr in the absence of TAFs (Carcamo et al., 1991).
TFII-I a basic helix-loop-helix protein has been found to bind Inr and E-box and
stimulate transcription in vitro (Roy et al., 1991; Cheriyath et al., 1998). The zinc
finger protein YY1 interacts with the Inr in AAV P5 and human DNA polymerase
β core promoters (Weis and Reinberg, 1997; Usheva and Shenk, 1994). Hence,
a number of different proteins or protein complexes can initiate transcription in an
initiator-dependent fashion.
Downstream core promoter element (DPE)
DPE was identified as a binding site for Drosophila TFIID (Burke and
Kadonaga, 1996). It is mainly found in TATA-less promoters and is located 28-32
3 nt downstream of A+1 position of the Inr (Butler and Kadonaga, 2002). In
Drosophila cells DPE is found as frequently as the TATA element. Of the examined promoters, ~29% had TATA box but no DPE, 26% had DPE and no
TATA box, 14% had both TATA box and DPE and 31% had neither (Kutach and
Kadonaga, 2000c). Although, DPE has been primarily studied in Drosophila cells, it is also found in human promoters (Burke and Kadonaga, 1997). The consensus sequence for the DPE is A/G+28-G-A/T-C/T-G/A/C with a preference for G at +24 (Kutach and Kadonaga, 2000b). DPE and Inr are required in DPE- containing promoters since the TFIID recognizes both these motifs simultaneously. Hence, the spacing between these two elements is critical with a single nucleotide change causing a severe reduction in TFIID binding and hence transcriptional activity (Burke and Kadonaga, 1996; Kutach and Kadonaga,
2000a).
DPE is recognized by the TAFs TAFII40 and TAFII60 but not by TBP (Burke and
Kadonaga, 1997). Additionally, transcription initiation from TATA-containing and
DPE-containing promoters is via different mechanisms. For example, negative cofactor 2 (NC2/Dr1/Drap1) stimulates transcription from DPE-dependent promoters but is a repressor of transcription from TATA-containing promoters
(Willy et al., 2000). In TATA-containing promoters NC2 forms a stable complex with the TBP on promoters and inhibits binding of TFIIA and TFIIB thereby inhibiting PIC formation and leading to repression of transcription (Pugh, 2000).
4 TFIIB recognition element (BRE)
The BRE is most commonly found in TATA-containing promoters and is located immediately upstream of the TATA box (Lagrange et al., 1998b). It is recognized by TFIIB in a sequence-specific manner. TFIIB is incorporated into the PIC following its binding to BRE (Lagrange et al., 1998a). The BRE consensus sequence is G/C-G/C-G/C-C-G-C-C where the 3’C of BRE is immediately followed by the 5’T of the TATA box. BRE can function as a transcriptional activator as well as a transcriptional repressor (Evans et al.,
2001).
CpG islands
These are relatively GC-rich DNA sequences found in TATA-less and DPE- less core promoters. These sequences are recognized by the Sp1 family of transcription factors (Macleod et al., 1994; Brandeis et al., 1994). Transcription from these promoters initiates at numerous weak start sites over a window of
~100 nt instead of a single start site. Almost half of the 1031 human gene promoters analyzed are located within CpG islands (Suzuki et al., 2001) but core promoter elements essential for transcription initiation have been difficult to identify.
In addition to core promoter elements, transcription activity is also modulated by enhancers and silencers located upstream or downstream of the promoter, activators that bind to these sequences and co-activators that bind to the activators. A myriad of DNA-protein and protein-protein interactions are
5 responsible for recruiting the transcription initiation complex and transcription initiation (Hampsey, 1998). Figure 1.2 illustrates some of these interactions.
RNA Processing
Transcription occurs in the nucleus whereas translation occurs in the cytoplasm. In order for the RNA to be transported from the nucleus to the cytoplasm it has to be processed into its mature form and associated with transport factors. This processing is termed as post-transcriptional modification. It was initially believed that transcription, post-transcriptional modification, export and translation occurred independent of each other. Recent research is changing our view about this. It has now been shown that all four processes are tightly coupled to each other and any anomaly in one can affect the others. Processing involves capping, splicing and cleavage/polyadenylation.
Capping
After the initial 20-30 nucleotides have been transcribed, a 5’ cap is added to the nascent transcript. Initially this cap structure serves to protect the transcript from nucleases. The cap is recognized by the cap-binding complex (CBC) which consists of CBP20 and CBP80. These proteins facilitate the export of the transcript from the nucleus (Proudfoot et al., 2002) and might also be involved in the pioneering round of translation. CBC can also interact with the splicing and 3’ processing factors to facilitate these reactions (Orphanides and Reinberg,
6 2002a). In fact an intact cap structure is required for these processing events
(Hirose and Manley, 2000; Shatkin and Manley, 2000)
Splicing
Splicing is the removal of introns and ligation of exons to yield a contiguous
message. This is a 2-step reaction, involving an initial nucleophilic attack by the
2’OH of the branch site adenosine (A) on the 5’phosphate of the 3’ splice site.
Cleavage of the 5’ exon is followed by a 2’-5’ phosphodiester bond formation between the 5’ guanosine and the branch site ‘A’ resulting in a lariat formation.
The 3’OH of the 5’ exon then attacks the phosphodiester bond at the 3’ splice site resulting in the displacement of the lariat and the ligation of exons (Figure
1.3). Splicing requires the assembly of the multicomponent spliceosome complex. Figure 1.4 illustrates the formation of the spliceosome and the concomitant splicing reaction. The splicing reaction is intimately coupled with capping and polyadenylation as well as transcription and export. Coupling will be discussed in the next section.
Cleavage and Polyadenylation
Polyadenylation involves addition of a 200nt poly (A+) tail to the 3’ end of the transcript. Prior to polyadenylation, the mRNA must be cleaved between the conserved AAUAAA and the downstream sequence element (DSE) which is a U-
or a GU-rich motif. Cleavage and polyadenylation is directed by the binding of
components of the hexameric polyadenylation complex to the cis-acting
sequences. Cleavage-polyadenylation specificity factor (CPSF) interacts with the 7 conserved AAUAAA sequence and cleavage stimulatory factor (CstF) interacts with the DSE (Proudfoot et al., 2002). Binding of CPSF and CstF is co-operative in that the binding of CstF to DSE greatly enhances the affinity of CPSF to the hexamer and vice versa (Colgan and Manley, 1997; Zhao et al., 1999). Two others factors, cleavage factor I (CF-I) and cleavage factor II (CF-II), are required for this reaction. CF-I directly interacts with the mRNA. CFII purification showed that it consists of two fractions (de Vries et al., 2000). CFIIAm is involved in splicing and can interact with both CPSF as well as CstF. CFIIBm has a stimulatory function only. Poly A polymerase (PAP) is required for the cleavage reaction. PAP and CPSF work in conjunction and direct the poly A tail addition.
Poly A binding protein (PABP II) interacts with the growing poly A tail and aids in increasing processivity of PAP (Wahle and Ruegsegger, 1999). Figure 1.5 illustrates the interaction of the polyadenylation complex proteins with the cis- acting elements to execute the cleavage/polyadenylation reaction.
3’end processing is coupled to splicing and is required for the export of mRNA from the nucleus. All these aspects are discussed in the subsequent sections.
Coupling transcription and processing
All the processes discussed above are coupled to each other as well as to other downstream processes like export, translation, NMD and RNA localization.
Figure 1.6 is a comprehensive Figure illustrating the coupling of all steps of mRNA biogenesis. Each step is discussed in further detail below.
8 Role of promoter
The promoter itself might recruit splicing factors like SR proteins by interaction with other transcription factors that bind to the promoter or enhancers
(Kornblihtt et al., 2004b). SR proteins have been implicated in coupling transcription to RNA export. Yeast poly (A+)-binding proteins GBp2 and Hrb1 which are SR-like proteins have been shown to be associated with the transcription-export (TREX) complex. These proteins are a part of the mRNP complex in the cytoplasm and their co-transcriptional recruitment might increase export efficiency (Hurt et al., 2004). Also, differences in promoter structure can influence alternative splicing of the transcript (Cramer et al., 1997) supporting the idea of transcription-splicing coupling. Stronger promoters and activators result in reduced inclusion of the fibronectin EDI alternative exon, due to a faster elongation rate of RNA Pol II (Kadener et al., 2001; Nogues et al., 2002). Three subunits of the cleavage-polyadenylation specificity factor (CPSF) are recruited into TFIID as TAFs. After transcription initiation these are recruited to the RNA polymerase II CTD.
Role of RNA polymerase II CTD
The C-terminal domain (CTD) of RNA Pol II has been shown to play a vital role in the coupling of transcription with processing, export and translation. The
CTD has the ability to “piggy-back” some of the factors involved in processing and export (Bentley, 2002). Processing involves capping, splicing and cleavage/polyadenylation. Capping enzymes (Cho et al., 1997; McCracken et al.,
9 1997a; Yue et al., 1997), cleavage/polyadenylation factors (Barilla et al., 2001;
Rodriguez et al., 2000; McCracken et al., 1997b) and splicing factors have all
been shown to be associated with (Greenleaf, 1993) and recruited to
transcription sites by CTD (Mortillaro et al., 1996) (Vincent et al., 1996; Yuryev et
al., 1996; Kim et al., 1997a; Misteli and Spector, 1999). In addition to recruiting
processing factors to their sites of action, CTD also serves to regulate their
activity.
The phosphorylation state of CTD determines the processing factors that will be associated with it. Unphosphorylated RNA Pol II assembles into the initiation
complex at the promoter. Hypophosphorylated CTD might interact with
transcription initiation factors (Komarnitsky et al., 2000). CTD phosphorylation is
necessary for both promoter clearance and transcript elongation. TFIIH kinase
phosphorylates CTD at Ser 5. Capping enzymes are bound only to
phosphorylated CTD and mammalian guanylyltransferase (GT) is allosterically
activated when CTD is phosphorylated at Ser 5 (Ho and Shuman, 1999). As the
polymerase starts elongating, it is dephosphorylated at Ser 5 leading to the
dissociation of capping enzymes. As elongation proceeds the CTD gets
phosphorylated at Ser 2 and perhaps recruits factors involved in elongation,
termination and 3’end processing. Some 3’ end processing factors are recruited
to the polymerase at the promoter and remain associated with it through
elongation of the entire transcript. Splicing components like SR proteins and
snRNP’s are associated with hypo-and hyperphosphorylated CTD. SR proteins
and the polyadenylation factor CPSF are perhaps transferred to the CTD of RNA
10 Pol II upon its phosphorylation. These factors then get loaded onto the nascent
pre-mRNA when the appropriate sites are transcribed (Robert et al., 2002). CTD
has been shown to enhance splicing in vitro by stimulating spliceosome
assembly (Zeng and Berget, 2000; Hirose and Manley, 1998). CTD has also
been shown to be required for splicing enhancers to work in vivo (Fong and
Bentley, 2001).
CTD phosphorylation is in turn controlled by transcription elongation factors
like the HIV TAT-SF1, which recruits the CTD kinase pTEFb. pTEFb is required for CTD phosphorylation, histone methylation and stable association of the transcription factor SPT5 (Zhou et al., 2004). TAT-SF1 also interacts with GT and enhances capping in vitro (Chiu et al., 2001). TAT-SF1 interacts with all five
UsnRNPs. The Tat-SF1-UsnRNP complex has been shown to stimulate transcription and splicing in vitro (Fong and Zhou, 2001b). The yeast prp40, a
U1snRNP subunit is also associated with the CTD (Morris and Greenleaf, 2000).
CTD also associates with SCAF’s (SR-like CTD associated factors), a peptidyl- prolyl isomerase and histone acetyltransferase. Role of SCAF’s and peptidyl- prolyl isomerase in transcription/processing in not yet known but acetylation of core histones is known to facilitate passage of the polymerase.
Proteomic analysis of the human spliceosome shows that at least 30 of the
145 proteins associated with the spliceosome are likely to be involved in coupling
between splicing and gene expression (Kornblihtt et al., 2004a). For example,
transcriptional co-activator TAT-SF1 and transcription factors CA150, XAB2 and
SKIP are a part of the spliceosomal complex. Additionally, several proteins have
11 been shown to have dual functions in both transcription and splicing. The thermogenic coactivator PGC-1 can affect alternative splicing only when it is recruited with complexes that interact with promoters (Monsalve et al., 2000).
Isoforms of the transcription factor Wt-1 that include the amino acids KTS, interact with the splicing factor U2AF65 (Davies et al., 1998). SAF-B which mediates attachment of chromatin to the nuclear matrix has also been shown to mediate coupling of transcription and splicing (Nayler et al., 1998). Rosonina et al
(Rosonina et al., 2003) showed that strong transcriptional activators like VP16 result in increased alternative and constitutive splicing and 3’ end cleavage due to the recruitment of processing factors to the promoter, perhaps via the Pol II
CTD.
Reciprocally, splicing factors have also been shown to control the rate of transcription. All five splicesosomal UsnRNPs interact with the transcription elongation factor TAT-SF1 and strongly stimulate transcription elongation (Fong and Zhou, 2001a).
Effect of Splicing, Capping and 3’ processing on each other
In addition to CTD coupling transcription and processing, each processing event in itself has a reciprocal effect on transcription and on other processing events.
Capping enzymes are recruited to the phosphorylated CTD. Once the transcript has been capped, it is bound by the cap-binding complex (CBC). CBC positively affects both splicing and polyadenylation. Depletion of CBC was shown
12 to significantly impair both these reactions (Lewis and Izaurralde, 1997). The
CBC stimulates splicing of the cap proximal intron by interacting with U1snRNP
and enhancing its association with the 5’ splice site (ss) of the cap proximal
intron. CBC also aids U6 snRNP interaction with the 5’ ss by perhaps aiding in
the displacement of U1snRNP from the 5’ss. Since capping occurs before
transcription of introns has initiated, splicing has no reciprocal effect on cap
formation (Le Hir et al., 2003a). CBC has a significant influence on the cleavage
reaction but very slightly affects the polyadenylation reaction. In both splicing and
polyadenylation, CBC aids to stabilize the interaction of the complex with the pre-
mRNA (Flaherty et al., 1997).
3’ end processing and splicing are also reciprocally linked to each other (Le
Hir et al., 2003b; Proudfoot et al., 2002). An upstream 3’ splice site significantly
enhances the use of a downstream polyadenylation site in vitro and the polyadenylation site in turn increases splicing of the 3’ intron. This is because the polyadenylation and splicing machineries directly interact with each other. The splicing factors snRNP U1A and SRm160 interact with the polyadenylation factor
CPSF (Lutz et al., 1996; McCracken et al., 2002). snRNP U1A also interacts with
Poly (A) polymerase (PAP) (Gunderson et al., 1998). PAP in turn interacts with the splicing factor U2AF65 and enhances 3’ splice site recognition.
13 Coupling Transcription and Export
The recently identified transcription-export (TREX) complex consists of the
THO complex and mRNA export factors Aly and UAP56. Members of the human
THO complex include Tho2, Hpr1, and Tex1, whilst the yeast THO complex is a heterotetramer consisting of Tho2, Hpr1, Mft1, Thp2. I will discuss the yeast
TREX complex in this section.
The THO complex is essential for transcription elongation and genome
stability and has also been implicated in mRNA export (Vinciguerra and Stutz,
2004a). The THO complex is recruited to the mRNA during transcription
elongation and travels the entire length of the transcript with RNA Pol II. It is
responsible for recruiting the export factor Yra1 and Sub2p to the mRNA during transcription. Yra1 interacts with Mex67p which is turn interacts with the NPC to promotes mRNA export. Components of the TREX complex are involved in the export of mRNAs transcribed from naturally intronless genes as well as bulk poly
A+ RNA (Strasser et al., 2002b). Hence the TREX complex provides a principal link between transcription and mRNA export.
Other export proteins have been found to be associated with components of
the transcription machinery. Sac3p - a Mex67p and nucleoporin-interacting
protein in yeast is also tightly bound to Thp1p (Fischer et al., 2002). Thp1p has
been implicated in transcription elongation and genome instability (Gallardo and
Aguilera, 2001). Sac3p has been shown to interact with the NPC, suggesting that
Thp1p-Sac3p associates with the mRNP at an early stage and participates in the
14 docking and translocation of Mex67p through the NPC (Vinciguerra and Stutz,
2004b).
Another protein, Sus1p has been shown to interact with the Thp1p-Sac3p complex (Rodriguez-Navarro et al., 2002). Sus1p also interacts with the SAGA complex, which is a histone acetylase complex involved in transcription initiation of a subset of Pol II genes (Lee et al., 2000). Sus1p is proposed to physically connect SAGA with Thp1p-Sac3p and is involved in both transcription and export. However, data supporting the role of Sus1p with this function is not universally applicable to all SAGA-dependent genes, suggesting that Sus1p recruits Thp1p-Sac3p to a subset of SAGA-dependent genes, Alternatively,
Sus1p might promote transport of SAGA-dependent genes by tethering them to the NPC via Thp1p-Sac3p.
Coupling splicing to export, translation and NMD
Splicing of nascent pre-mRNA’s and subsequent metabolism of mRNA is connected by a set of proteins referred to as the Exon-Junction Complex (EJC).
Initial studies indicated that splicing alters the mRNP structure and deposits proteins (REF/Aly, SRm160, Y14, and RNPS1) 20-24 nucleotides upstream of the exon-exon junction (Le Hir et al., 2000). We now know that the EJC is a highly dynamic structure consisting of a few core proteins and several peripherally associated factors, which perhaps join the complex only transiently when required (Tange et al., 2004a). Studies indicate that eIF4AIII, a nuclear
15 shuttling RNA helicase and an integral component of the EJC can be readily
cross-linked to spliced mRNA in the EJC area (Shibuya et al., 2004). It also
forms stable complexes with Y14 and Magoh when co-expressed in E-coli. This
suggests that eIF4AIII is perhaps the anchoring factor that associates with the
RNA and tethers the rest of the EJC to the spliced mRNA. Hence, Y14, magoh
and EIF4AIII might constitute the core proteins and all other proteins associate
transiently and peripherally.
Associated proteins of the EJC include splicing factors SRm160, pinin and
RNPS1, export factors UAP56, Ref/Aly, p15/TAP and NMD factors Upf1, 2 and 3
(Figure 1.8). Majority of the associated proteins dissociate from the EJC in the
cytoplasm after the “pioneering” round of translation, which determines whether
the mRNA will be translated or degraded by NMD (Ishigaki et al., 2001; Lejeune
et al., 2002). After the first round, the CBC is replaced with eIF4E and no EJC
factors are associated with eIF4A-bound mRNAs.
EJC and mRNA export
In mammalian cells, export factors like UAP56, REF/Aly and the TAP/p15 heterodimer have been shown to be associated with the EJC. The splicing factor
UAP56 (now implicated in export as well) interacts with REF/Aly which in turn interacts with the NPC- interacting proteins – TAP/p15 and promotes bulk mRNA export.
Although this seems to be the most likely mechanism of RNA export based on
protein interactions, several papers have reported that the knockdown of REF/Aly
16 does not affect nuclear export in Drosophila and C.elegans (Gatfield and
Izaurralde, 2002d; Stutz and Izaurralde, 2003; Longman et al., 2003; MacMorris et al., 2003). UAP56 and p15 on the other hand, have been shown to be required for the export of most transcripts (Gatfield et al., 2001h; Herold et al., 2003). This suggests that other adaptor molecules besides REF/Aly might mediate the interaction between mRNA and TAP/p15 and the function of UAP56 in export might not be limited to the recruitment of REF/Aly (Vinciguerra and Stutz, 2004c).
In support of this proposal, SR proteins Srp20 and 9G8, which are involved in the export of intronless RNA in Xenopus oocytes, have been shown to bind TAP in the same domain as REF/Aly. Also, the SR-like protein NpI3p directly interacts with Mex67p (TAP) in yeast and recruits it to the mRNP. Dephosphorylated
NpI3p associates with the nascent transcript while phosphorylated NpI3p associates with Mex67p. Phosphorylation of NpI3p results in the dissociation of the processing machinery from the 3’ end and recruitment of Mex67p. This phosphorylation-dephosphorylation cycle of NpI3p ensures that only properly
3’end processed transcripts get associated with the export factor Mex67p
(Vinciguerra and Stutz, 2004g).
In fact, knockdown of several EJC proteins individually or in combination, only partially affected mRNA export in Drosophila (Gatfield and Izaurralde, 2002c).
This suggests that splicing might not be a requirement for transport. UAP56 and yeast Yra1p (REF/Aly in mammals) have been shown to be essential for export of mRNA derived from intron-containing and intron-less genes suggesting that
17 these factors can bind mature RNAs via a splicing independent-mechanism
(Linder and Stutz, 2001).
In fact, studies have now established that the EJC plays a role in enhancing
3’ end processing/polyadenylation which increases the steady-state levels of
mRNA by increasing its association with polysomes (Nott et al., 2003; Lu and
Cullen, 2003a). This results in increased translational efficiency of spliced
transcripts versus intronless transcripts. Also, Dower and Rosbash (Dower and
Rosbash, 2002) studied export of transcripts generated by T7 RNA polymerase
and showed that transcription by Pol II is not necessary for export in yeast.
Proper 3’end processing/polyadenylation is required and satisfactory for RNA
export. Various studies in yeast have linked the poly (A) binding protein Pab1p
and the shuttling mRNA binding protein Nab2p to proper 3’end processing, poly
(A) tail length, transcriptional termination and export. 3’ end processing mutants
and mRNA processing mutants yield similar phenotypes suggesting that 3’end
processing and export are tightly linked (Green et al., 2002; Hammell et al., 2002;
Marfatia et al., 2003; Hector et al., 2002). Additionally Nab2p has been shown to
directly interact with the Mlp proteins (Green et al., 2003) which are anchored at
the nuclear basket of the NPC. Mlp proteins are not required for mRNA export
but instead have been implicated in docking and surveillance of mRNA (Kosova
et al., 2000; Strambio-de-Castillia et al., 1999) ensuring that only properly processed and assembled mRNP complexes are allowed through the NPC.
Since Nab2p is involved in poly (A) tail length regulation, it suggests that Nab2p
18 might signal proper 3’end formation and play a role in docking mRNPs to the Mlp
docking platform (Vinciguerra and Stutz, 2004f).
EJC and mRNA localization
Irrespective of the role of EJC in export, it has been shown to be important for the localization of at least one mRNA in the cytoplasm. In Drosophila, the
eIF4AIII and Y14/Magoh homologs are essential for the localization of the oskar
mRNA to the posterior pole of the developing oocyte during oogenesis (Palacios
et al., 2004d; Mohr et al., 2001; Hachet and Ephrussi, 2001). A recent study by
Hachet and Ephrussi (Hachet and Ephrussi, 2004) showed that localization of the
oskar RNA requires splicing-dependent recruitment of the EJC complex,
suggesting that in this case mRNA splicing and cytoplasmic localization are
coupled.
An additional factor named barentsz (MLN51 in mammals) has been recently
reported to interact with eIF4AIII and Y14/ magoh heterodimer in Drosophila and mammalian cells (Macchi et al., 2003a; Palacios et al., 2004c). In Drosophila, barentsz is cytoplasmic whilst eIF4AIII and Y14/Magoh are primarily nuclear, suggesting that in the splicing and localization of oskar RNA, eIF4AIII and
Y14/Magoh associate with the mRNA in the nucleus which is then transported to the cytoplasm where barentsz is recruited by eIF4AIII. In murine cells barentsz has been found to co-localize with staufen-containing RNP granules, which are postulated to localize mRNA to dendrites in mature neurons (Macchi et al.,
2003b). This suggests that the role of barentsz in RNA localization is conserved.
19 EJC and translation
Initial experiments done with Xenopus oocytes showed that the presence and
position of an intron in a pre-mRNA determines the translational efficiency of the
mature RNA (Matsumoto et al., 1998). Experiments done with mammalian cells
have shown that spliced mRNA produces greater amounts of protein as
compared to otherwise identical mRNA’s produced from cDNA (Lu and Cullen,
2003b; Nott et al., 2003; Noe et al., 2003). Nott et al (Nott et al., 2004) showed that this increase in translational yield is due to increased association of spliced
mRNA’s with polysomes, compared to transcripts obtained from intronless cDNA.
This increased association with polysomes could be achieved by the splicing
machinery by preventing association of repressive factors or increasing
association of activating factors or both to the spliced mRNA. The same study
showed that EJC proteins RNPS1, Y14 and magoh enhance translational yields
when tethered to a reporter plasmid. This shows that an EJC enhances uptake of
mRNA into the translational pool via a yet unknown mechanism. It might be that
the EJC has associated translational initiation factors or the EJC might target the
mRNPs to translationally active sites (Tange et al., 2004b). Certain EJC
components remain associated with the mRNA even after the RNA has been
exported to the cytoplasm. These include the Y14-Magoh heterodimer, Upf3 and
eIF4AIII. The presence of these proteins serves as a mark for the surveillance
machinery to detect premature stop codons (PTC). Dostie and Dreyfuss (Dostie
and Dreyfuss, 2002) have demonstrated that translation in the cytoplasm is
required to remove Y14 from the mRNA in vitro and in vivo. Also, Y14 was 20 present in polysome profile fractions corresponding to mRNAs associated with one ribosome.
Another factor that has been shown to be a part of the EJC which remains associated with the mRNA in the cytoplasm, is the DEAD-box RNA helicase eIF4AIII. This protein is homologous to the translation intiation factors eIF4A1 and eIF4A2. eIF4AIII has been shown to inhibit translation in an in vitro reticulocyte translation system (Li et al., 1999). Hence, this protein might act to prevent premature or aberrant translation in the nucleus as well as the cytoplasm. EIF4AIII has also been shown to weakly interact with the translation initiation factor eIF4G. Hence, eIF4AIII might indirectly stimulate translation in the cytoplasm by recruiting eIF4G and other initiation factors to the mRNP (Chan et al., 2004). Hence, according to this model eIF4AIII would have to remain associated with the mRNA till the first round of translation, suggesting that akin to
Y14, translation might be required to remove eIF4AIII from the mRNA.
EJC and NMD
Nonsense mediated decay (NMD) is a process by which eukaryotic cells can specifically degrade mRNA’s containing premature translation-termination codons (PTCs). NMD is an important surveillance mechanism in the cell and ensures that aberrant mRNAs are not translated. Several disease states have been reported due to the loss of NMD in the cell.
In order to activate the NMD pathway, the cell has to distinguish between normal stop codons and premature stop codons. A PTC is an in-frame stop
21 codon located at least 50nt upstream of the last exon-exon junction in a spliced
mRNA. Splicing deposits a mark near the exon-exon junction in the form of the
EJC for later surveillance by the translational machinery (Schell et al., 2002). The
NMD protein Upf3 is recruited to the nuclear EJC via interactions with Y14 and
RNPS1 (Lykke-Andersen et al., 2000; Kim et al., 1997b; Le Hir et al., 2001).
After mRNA export to the cytoplasm Upf3 recruits Upf2 to form an NMD
competent EJC (Singh and Lykke-Andersen, 2003). As the ribosome traverses
the mRNA during the pioneering round of translation, it displaces the EJCs in its
path. If the ribosome encounters a PTC, translation is terminated leaving at least
one EJC bound to the mRNA. This leads to the recruitment of Upf1 via its
interactions with Upf2. Activation of Upf1 via phosphorylation triggers NMD.
The EJC proteins RNPS1, eIF4AIII and Y14 have also been shown to be required for NMD via tethering experiments (Gehring et al., 2003; Palacios et al.,
2004b; Kim et al., 2001). Individual EJC components were tethered to the 3’UTR of β globin gene via the MS2 coat protein. If the tethered protein is involved in
NMD it should result in the recruitment of an active NMD complex and RNA degradation. Using this approach it has been found that RNPS1 elicits a robust
NMD response, whilst Y14 elicits a much milder NMD response. Y14 has been shown to be required for NMD triggered by tethered Upf3b, while eIF4AIII is indirectly implicated in NMD by virtue of its role in the recruitment of barentsz in the cytoplasm. Tethering experiments have shown a direct role of barentsz in
NMD (Palacios et al., 2004a). Recently another protein (PYM in Drosophila) was found to be recruited to the EJC in the cytoplasm by virtue of its interaction with
22 the Y14/magoh heterodimer. This protein- protein interaction has been found to be conserved from S.pombe to humans. Tethering experiments have shown
PYM to be involved in NMD as well (Bono et al., 2004).
NMD and Translation
A pioneering round of translation is required to determine whether the mRNA should be translated or degraded. When the mRNA is exported to the cytoplasm, certain factors (discussed above) remain associated with the EJC which in turn recruit other factors in the cytoplasm. All factors associated with the EJC in the cytoplasm have been implicated in NMD. Additionally, the same factors when tethered inside the Renilla luciferase ORF enhance translational yields as well
(Nott et al., 2004)
Several other studies have shown a link between NMD and translation.
Upf1p, whose activation triggers NMD has been shown to interact with the translation-termination factors eRF1 and eRF3 (Czaplinski et al., 1998b), linking
NMD to translation termination. Upf2 and 3 have also been documented to be required for both NMD and translation termination (Wang et al., 2001; Maderazo et al., 2000). Conversely, mutations in the translation initiation factor eIF3 also attenuate NMD. Structural similarities have also been reported between translation factors and NMD proteins. For example: hUpf2 contains an eIF4G homology domain (Aravind and Koonin, 2000; Ponting, 2000) and can interact with eIF4A1 and eIF3 suggesting that it possibly plays a role in translation initiation.
23 The translation initiation factor eIF4AIII that interacts with eIF4G and eIF4B is
an important component of the EJC and has been implicated in NMD.
Based on these observations, it can be concluded that components of NMD play
a role in the pioneering round of translation via their interaction with initiation factors and release factors. Since Upf1 has been shown to interact with the translation release factors, it can be postulated that Upf1 is associated with the ribosomes and is involved in translation termination during the pioneering round.
If the termination occurs >50 nucleotides upstream of an EJC, Upf1 is recruited
to the NMD complex and initiates mRNA degradation (Maquat, 2004).
The tight coupling of all processes from transcription to translation ensures that
the cell makes only functionally active proteins.
Research projects and goals
My doctoral thesis comprises of two projects.
The first project deals with studying the role of the RNA helicases UAP56 and
URH49 in splicing and nuclear export of mRNA. UAP56, the splicing-export
factor, has been shown to be essential for export in Drosophila and C.elegans.
However, similar studies in mammalian cells have not been yet reported. I have
been studying a protein that is 90% similar to UAP56 in mammalian cells named
URH49 (UAP56-Related Helicase- 49KD). I have been involved with elucidating
the role of UAP56 and URH49 in mammalian cells with respect to cell viability
and mRNA export.
24 My second project deals with the role of promoter elements in determining transcriptional directionality, transcription initiation and post-transcriptional processing in the mouse thymidylate synthase gene. Changes in the promoter structure might alter the DNA-protein interactions at the promoter and/or the host of factors being associated with the promoter. This could potentially affect transcription initiation as well as downstream processing events. Introducing elements like the TATA box and the inr that are classically known to impart directionality to the transcriptional complex might alter the TS bidirectional promoter to predominantly favor one direction over the other.
I will discuss each project in detail in my introduction for those chapters.
25
Figure 1.1: Core promoter elements Figure taken from (Butler and Kadonaga, 2002). See text for details
26
Figure 1.2: Protein-protein and DNA-protein interactions during transcription initiation The basal transcription complex is shown in yellow and co-activators are shown in dark blue. Co-activators are recruited by the activators (pink) to facilitate chromatin remodeling and to recruit the basal transcription machinery. Co- activators can be associated with the basal transcription complex (eg: TAFs, TFIIA and the mediator complex) or can assist in chromatin remodeling (eg: SAGA and SWI/SNF complex). Figure taken from (Martinez, 2002)
27
Figure 1.3: The splicing reaction Figure taken from (Kramer, 1996). See text for details.
28
Figure 1.4: Spliceosome assembly and the splicing reaction
Binding of the U1snRNP to the 5’ splice site and loose binding of U2snRNP via interaction with U2AF65 or U1snRNP results in the formation of E-complex. The ATP-dependent binding of U2snRNP to the branch site yields the pre-splicing complex A. The binding of U4/U6.U5 trisnRNP complex to complex A yields the splicing complex B which is converted to the catalytically active complex C after a conformational change. Figure taken from (Kramer, 1996)
29
Figure 1.5: Interaction of cis- and trans factors during polyadenylation Figure taken from (Proudfoot et al., 2002). See text for details.
30
Figure 1.6: Figure illustrating the coupling of the different steps of mRNA biogenesis. Each step is discussed in detail in the text. Figure taken from (Orphanides and Reinberg, 2002b)
31
r. cessing reactions on each othe al., 2002). See text for details Figure 1.7: Effect of mRNA pro Figure taken from (Proudfoot et
32 The Exon-Junction Complex
P15 TAP SRm160
Magoh UAP56 Pinin Upf3 Aly Y14 RNPS1
eIF4AIII Exon 1 Exon 2
Nucleus 20-24 nts
Magoh Upf2 Cytoplasm Upf3 Upf1 MLN51 Y14
eIF4AIII Exon 1 Exon 2
Export factors
NMD factors
Splicing factors
Figure 1.8 : Proteins associated with the EJC in the nucleus and the cytoplasm. See text for details
33
CHAPTER 2
KNOCKDOWN OF UAP56 AND URH49 RESULTS IN CELL DEATH
AND NUCLEAR LOCALIZATION OF POLY (A)+ RNA
INTRODUCTION
DEXD/H-BOX HELICASES
Enzymes that catalyze the separation of nucleic acid strands in an energy- dependent manner are defined as helicases. It is now known that helicases can also destabilize protein-nucleic acid interactions (Eisen and Lucchesi, 1998;
Staley and Guthrie, 1998; Tanner and Linder, 2001). DNA and RNA helicases are found in prokaryotes and eukaryotes and are involved in virtually all aspects of nucleic acid metabolism. Helicases have been classified based on the presence of conserved motifs. All helicases possess the Walker motif A (or motif
I) and Walker motif B (or motif II) (Walker et al., 1982). Depending upon the presence of other conserved motifs, helicases have been divided into 5 superfamilies (I-V) (Gorbalenya and Koonin, 1988; Gorbalenya et al., 1988;
Gorbalenya et al., 1989) The DExD/H-box helicases are members of superfamily
II which is the largest known family of RNA helicases (Rocak and Linder, 2004i).
34 Identified 15 years ago (Linder et al., 1989) the DEAD box family gets its
name from its conserved motif II (aspartate-glutamine-alanine-aspartate – DEAD
in one letter code). These proteins are found in all organisms including some viruses and can range in size from 400 to 1200 amino acids (Caruthers and
McKay, 2002b). They are involved in all steps of mRNA biogenesis from
transcription initiation to translation initiation and mRNA decay (Rocak and
Linder, 2004f). Many DEAD-box proteins are overexpressed in cancer (Adra et
al., 2000; Amler et al., 1996; Causevic et al., 2001; Miyaji et al., 2003; Godbout et
al., 1998; Karlsson et al., 2001). Also, RNA helicases are required for the propagation of disease-causing viruses in humans. Hence, understanding the structure, function and mechanism of these helicases may help us combat viral infections (Rocak and Linder, 2004b). Characterization of eIF4A and Hepatitis C virus NS3 helicase by Du et al (Du et al., 2002) has helped in the design of inhibitors against the Hepatitis C virus.
All proteins in the DExD/H-box family contain a core element that has 9
conserved motifs (Figure 2.1). The recently identified Q motif (Tanner et al.,
2003a) and motifs I and II are involved in ATP binding and hydrolysis. The Q
motif has a highly conserved glutamine residue, which forms hydrogen bonds
with N6 and N7 of adenine, and the adjacent aromatic residues stack with the adenine (Tanner, 2003). The Q motif and the conserved upstream phenylalanine residue have been postulated to regulate ATP binding and hydrolysis. The glutamine and serine/threonine residues in the Q-motif interact with conserved residues in
35 motif I via hydrogen bonding (Tanner et al., 2003b). Motif I interacts with ATP via the formation of the P-loop which encompasses the α and β phosphates of ATP.
The lysine residue of motif I interacts with the phosphates while the threonine residue interacts with Mg+2. Motif II is required for ATP hydolysis by virtue of its interaction with the β and γ phosphates via Mg+2. Motif III is responsible for linking conformational changes in the helicase with ATP hydrolysis (Rocak and
Linder, 2004g). Based on structural prediction, eIF4A motif II interacts with conserved residues in motif III via hydrogen bonding (Caruthers et al., 2000).
Motif VI is proposed to be involved in ATP binding and its second arginine residue might be involved in sensing the γ phosphate of ATP (Caruthers and
McKay, 2002a). Functions of the other motifs (Ia,Ib, IV and V) are not very well defined as yet, but structural analysis suggests that they might be involved in
RNA binding (Rocak and Linder, 2004d).
The core element is flanked by less conserved sequences, which are perhaps responsible for imparting functional specificity to these proteins. Based on diversity in the flanking sequences, over 500 different DEAD-box helicases have been identified so far (Rocak and Linder, 2004a)
As discussed in chapter one, all processes of mRNA biogenesis are coupled.
DExD/H box helicases are involved in all these processes including transcription, splicing, export, translation initiation and RNA decay. Additionally, they are involved in ribosome biogenesis and organelle gene expression. I will discuss the role of DEXD/H-box helicases in each step of mRNA biogenesis. Unless specified, the proteins discussed below are found in yeast. 36 Transcription
Various DExD/H-box helicases have been found to interact with the transcription machinery or colocalize with it. (Yan et al., 2003; Rajendran et al.,
2003; Rossow and Janknecht, 2003) DP97 is required for regulation of transcriptional activity of a nuclear receptor, DP103 is essential for transcription repression and p68 synergistically interacts with the transcriptional co-activators
CBP and p300. Although the role of DExD/H-box proteins in transcription has not been identified, it is possible that these proteins are associated with the transcription machinery in order to link transcription to other downstream processes.
Splicing
The assembled spliceosome consists of 70 different proteins, snRNA’s (small nuclear RNAs) and 8 RNA helicases (Rocak and Linder, 2004c). The RNA helicases are required for unwinding RNA-RNA duplexes formed intramolecularly within the pre-mRNA or intermolecularly between snRNA’s and pre-mRNA. Sub2
(yeast homolog of UAP56) and prp28 have been shown to be involved in disrupting ribonucleoprotein interactions as well (Kistler and Guthrie, 2001; Chen et al., 2001). The role of each RNA helicase in the splicing reaction is outlined in detail in Figure 2.2.
RNA export
The DExD/H-box helicase Dbp5 has been shown to be important for the export of poly (A+) RNA from the nucleus to the cytoplasm (Tseng et al., 1998; 37 Snay-Hodge et al., 1998). It is also localized to the NPC by interacting with the nucleoporins CAN/Nup159p (Schmitt et al., 1999). Dbp5 is recruited to the transcription complex via interactions with TFIIH (Estruch and Cole, 2003) and is loaded onto the nascent pre-mRNA itself. It perhaps remains associated with the transcript during processing and then docks it to the NPC via interactions with
CAN/Nup159p. DExD/H-box helicases that are involved in mRNA export might function to disrupt nucleoprotein interactions between the mRNA and nuclear factors, or facilitate export through the NPC or facilitate translation initiation
(Rocak and Linder, 2004k).
Translation Initiation
The RNA helicase eIF4A is a translation initiation factor and a part of the cap- binding complex (CBC). eIF4A might function to disrupt secondary RNA structures at the 5’ end and make it accessible to the ribosome or it might be involved in disrupting interactions between mRNA and the proteins associated with it from the upstream processes (Rocak and Linder, 2004h; de La et al.,
1999e). Another DExD/H-box helicase Ded-1p has been shown to be involved in translation initiation, although its exact role is not yet known (de La et al., 1999c;
Chuang et al., 1997; Noueiry et al., 2000; Grallert et al., 2000) Vasa is a DExD/H- box helicase required for activating translation of germline-specific mRNAs in higher eukaryotes undergoing embryonic development (Markussen et al., 1995).
The precise role of Vasa in this activation is not defined. Upf1p is an SF1 helicase involved in NMD that also interacts with translation release factors
38 (eRFs) and is perhaps involved in termination at nonsense codons. Its precise role is not yet defined (de La et al., 1999b). Figure 2.3a depicts the role of helicases discussed here in translation.
RNA degradation
Degradation of defective RNA commences with poly A tail shortening
followed by decapping and 5’-3’ exonucleolytic degradation (de La et al., 1999d).
An exosome is a multiprotein complex consisting of RNAses and helicases that
are involved in RNA degradation. The eukaryotic exosome consists DexH/D
proteins Ski3p, Ski8p and Ski2p (de La et al., 1998; Anderson and Parker, 1998).
These helicases are perhaps involved in unwinding the RNA to allow for
degradation. Recently, the DExD/H-box protein Dhh1 (Xp54 in Xenopus) has
also been shown to be required for RNA degradation as well as decapping
(Coller et al., 2001) in eukaryotes.
The nonsense-mediated decay (NMD) pathway which promotes degradation
of RNA containing premature stop codons also requires RNA helicases. The SF1
helicase Upf1p, which is required for translation termination is also a part of a
surveillance complex along with two other Upf proteins that scans the RNA
downstream of a stop codon for a downstream sequence element (DSE)
(Czaplinski et al., 1998a). In mammalian cells this DSE appears to be the EJC. If
the EJC is encountered, the mRNA is subjected to decapping and 5’-3’
endonuclytic attack. ATPase activity of Upf1p might aid in scanning and its
39 helicase activity might prevent stalling of the surveillance complex. Another RNA helicase Dbp2p has been found to interact with Upf1p and hence might also be involved in decay (He and Jacobson, 1995). Figure 2.3b illustrates the role of helicases in mRNA degradation.
UAP56 (U2AF65 ASSOCIATED PROTEIN - 56 KD)
The DExD/H-box helicase UAP56 was first identified and implicated in splicing by virtue of its interaction with U2AF65 in a yeast two-hybrid screen
(Fleckner et al., 1997b). U2AF65 is a splicing factor associated with the polypyrimidine tract (Figure 2.5). U2AF65 interacts co-operatively with the branchpoint binding protein (BBP) and facilitates its binding to the branchpoint sequence (BPS) (Berglund et al., 1998). Additionallly, during spliceosome assembly, U2AF65 promotes U2 snRNP binding to the BPS (Valcarcel et al.,
1996; Zamore and Green, 1989).
Homologs of UAP56 have been found in yeast, Drosophila melanogaster and
Caenorhabditis elegans. Sub2p, the yeast homolog of UAP56, shares 62% amino acid sequence identity and 78% similarity (Shi et al., 2004a). Human
UAP56 can functionally complement the defect of Sub2p in a genetic complementation assay (Zhang and Green, 2001). Sub2p has been shown to be essential for pre-mRNA splicing (Zhang and Green, 2001) similar to UAP56 in
HeLa cell extracts (Fleckner et al., 1997b). The Drosophila homolog of UAP56
(HEL) and the C.elegans homolog have been shown to be essential for cell
40 growth and viability respectively (Gatfield et al., 2001g; MacMorris et al., 2003).
The requirement of UAP56 in mammalian cells is not yet known. Experiments
done by Fleckner et al (Fleckner et al., 1997b) in HeLa cell extracts showed that
depletion of UAP56 using polyclonal antibodies resulted in splicing-deficient
extracts. However, this result does not unequivocally implicate the necessity of
UAP56 in splicing. A protein 90% identical to UAP56 (termed URH49) was
recently reported by our lab (Pryor et al., 2004). This protein has been found only
in mammalian cells. Polyclonal antibodies against UAP56 might deplete URH49
levels as well, making it difficult to interpret whether the observed result is due to the knockdown of UAP56 or URH49 or both.
Recently, UAP56 has also been shown to be essential for poly (A+) RNA
export from the nucleus to the cytoplasm in yeast, Drosophila and C.elegans;
depletion of UAP56 in these organisms resulted in nuclear accumulation of poly
(A+) RNA (Strasser and Hurt, 2001; Gatfield et al., 2001f; Jensen et al., 2001;
MacMorris et al., 2003).
Recent structural insights into UAP56 suggest that full length UAP56 has
weak RNA-dependent ATPase activity. It has two domains, the N-terminal
domain and the C-terminal domain. Both these domains exhibit similarity to the
archael DEAD-box protein mjDEAD, yeast eIF4A and the prokaryotic excision
repair gene UvrB. Both domains are connected by a linker and in the open
conformation the domains form a pocket which contains the ATPase/helicase
motifs. The ADP-Mg+2 molecule is found to sit in this pocket. Figure 2.4 shows a
model explaining the ATPase activity of UAP56 (Shi et al., 2004b). A previous
41 crystal structure of UAP56 suggested the presence of a dimer interface (Zhao et
al., 2004a), but the study by Shi et al does not support this observation. Figure
2.4 illustrates the ATPase activity of UAP56 and its role in dissociating U2AF65 from the polypyrimidine tract.
Role of UAP56 in Splicing and Export
As discussed earlier, all processes of mRNA biogenesis from transcription
initiation to translation, mRNA decay or RNA localization are coupled. DEAD-box
helicases have been implicated in almost all of these processes. Although
UAP56 is implicated in splicing and export it has been shown to be recruited
during transcription elongation (Vinciguerra and Stutz, 2004e). Figure 2.5
outlines the co-transcriptional recruitment of UAP56 and its roles in splicing and
export.
Recruitment of UAP56 during transcription
UAP56 associates with all components of the THO complex (Strasser et al.,
2002a). The THO complex is involved in transcription elongation, genome
stability and mRNA export of poly (A+) RNA and intronless RNA (Vinciguerra and
Stutz, 2004d). The THO complex along with Aly and UAP56 is designated as the
TREX complex. Strasser et al (Strasser et al., 2002c) show that in yeast the
TREX complex is recruited to the transcript during elongation and traverses the length of the gene with RNA Pol II. Sub2p has also been shown to interact with the yeast export factor NpI3p (Inoue et al., 2000) which is recruited to the
42 transcript cotranscriptionally (Lei et al., 2001). Sub2p also interacts with Rad3p
which is a component of the TFIIH transcription factor (Jensen et al., 2001). All
the above observations indicated that UAP56 is recruited to the RNA molecule during transcription.
UAP56 and splicing
UAP56 was first identified due to its interaction with the splicing factor
U2AF65 (Fleckner et al., 1997b). UAP56 is postulated to be involved in the
recruitment of U2snRNP to the BPS (Figure 2.4) by displacing U2AF65 from the
polypyrimidine tract, suggesting that U2AF65 recruits UAP56 to the spliceosome
to facilitate binding of U2 snRNP. Although, identified as a splicing factor, the role
of UAP56 in splicing is not very clear since UAP56 is involved in the export of
intronless mRNA in yeast and Drosophila (Gatfield et al., 2001e; Strasser and
Hurt, 2001; Strasser and Hurt, 2001)
UAP56 and export
Over the past few years UAP56 has been strongly implicated in the export of poly (A+) mRNA and has been proposed to couple pre-mRNA splicing with export (Reed and Hurt, 2002; Stutz and Izaurralde, 2003; Zhou et al., 2000) by virtue of its interaction with the RNA export factor Aly (Luo et al., 2001). Aly in turn interacts with TAP/p15 which interacts with the NPC and facilitates mRNA export. Both UAP56 and Aly are members of the EJC which has been shown to couple splicing with export and translation initiation/NMD (Le Hir et al., 2000).
These data suggest that UAP56 is responsible for recruiting Aly to the EJC
43 thereby promoting export of mature RNA. But, recent studies have indicated that
Aly is not essential for export in Drosophila and C.elegans (Stutz and Izaurralde,
2003; Gatfield and Izaurralde, 2002a; Longman et al., 2003; MacMorris et al.,
2003).
URH49 (UAP56 Related Helicase – 49KD)
URH49 is a presumed DEAD-box helicase 90% identical to UAP56. This protein is found in mammalian cells (human and mouse) but not in yeast, Drosophila and
C.elegans. Both UAP56 and URH49 have been shown to interact with the export factor Aly in a GST pulldown assay. Both helicases can complement a Sub2p defect in yeast suggesting that both helicases can perform the functions of
Sub2p. Both helicases were found to be expressed at similar levels in all tissues examined except the testes where URH49 was expressed at much higher levels as compared to UAP56. An interesting observation was that UAP56 and URH49 mRNA’s were regulated differently in serum stimulated cells. Upon serum stimulation, URH49 mRNA increased 3-5 fold within the first 5 hours and then remained relatively constant throughout the cell cycle. On the other hand, UAP56 mRNA levels increased only about 2-fold through the cell cycle. This rapid burst of URH49 mRNA level might suggest that it perhaps has a role in the regulation of immediate early genes. Also, in quiescent cells the half life of URH49 mRNA was only about 4h whereas that of UAP56 was about 15h. In exponentially growing cells, UAP56 and URH49 RNAs were fairly stable. All these observations suggest that even the two proteins are highly similar they might
44 have different functions in the cell, perhaps involved in monitoring different populations of RNA (Pryor et al., 2004).
In order to delineate the roles of UAP56 and URH49 in mammalian cells, I silenced the expression of each gene using RNA interference. UAP56 is required for cell viability in C.elegans and cell growth in Drosophila. Knockdown of UAP56 in yeast, Drosophila and C.elegans results in accumulation of mRNA in the nucleus. My goals were to determine if either or both helicases were required for cell viability/cell growth and mRNA export in mammalian cells.
45 MATERIALS AND METHODS
Cell Culture
HeLa cells
HeLa (human cervical carcinoma cells) were maintained in Falcon tissue culture plastic petri dishes in Dulbecco’s Modified Eagle Medium (DMEM, Invitrogen inc.) supplemented with 10% calf serum (CS) (Colorado Serum Company). Cells were
0 incubated at 37 C with 5-10% CO2 and 90% humidity.
HT144
HT144 (Melanoma fibroblast cells) were maintained in Falcon tissue culture plastic petri dishes in Dulbecco’s Modified Eagle Medium (DMEM, Invitrogen inc.) supplemented with 10% Nu serum (Collaborative Research). Cells were
0 incubated at 37 C with 5-10% CO2 and 90% humidity.
HeLa S3 Tet-off cells
HeLa S3 tet-off cells (Clontech) were maintained in Falcon tissue culture plastic petri dishes in Dulbecco’s Modified Eagle Medium (DMEM) (Invitrogen inc.) supplemented with 10% calf serum (Colorado Serum Company) + 100ug/ml
0 G418. Cells were incubated at 37 C with 5-10% CO2 and 90% humidity.
46 siRNA selection and synthesis
In order to identify potential siRNA target sequences, URH49 and UAP56
cDNAs were scanned using Ambion’s siRNA Target Finder software. 21
nucleotide sequences beginning with the AA dinucleotide were identified. I manually compared the selected sequences and identified ~8 potential siRNA sequences based on the following criteria.
1. there should be at least 4-5 non-homologous bases between the selected
URH49 siRNA sequence and UAP56 sequence.
2. the GC content should be between 40-50%
3. Sequences should not be too close to AUG or exon-exon junctions. This is to
ensure that the translation initiation complex and the EJC do not interfere with
the siRNA binding.
Scrambled siRNA was used a negative control. This siRNA was designed to
have the same GC content as URH49 and UAP56 siRNA (i.e. 42.9%) but, the
bases were shuffled such that the sequence had no homology to any human sequences available in the BLAST database. Figure 2.6 shows the DNA oligo template and the target siRNA sequences.
The silencer siRNA construction Kit (Ambion) was used for the synthesis of
siRNA. Figure 2.7 outlines the procedure of siRNA sythesis using this kit.
The sequences for sense and antisense DNA template oligos were generated
using the siRNA template design tool on Ambion’s website. Since the kit uses a
T7 RNA polymerase, an 8 nucleotide T7 promoter overhang is incorporated in
47 the template DNA oligos. This overhang binds to the complementary T7 promoter primer (provided in the kit) and ds DNA oligos are synthesized. These ds DNA oligos are used as templates for T7 RNA polymerase to make sense and antisense siRNA strands, which are then annealed to yield double-stranded siRNA.
Sense and antisense template DNA oligos were ordered from Invitrogen Inc.
200uM of each sense and antisense template DNA was used to make ds DNA oligos. 2ul of each sense and antisense dsDNA oligo was used for siRNA synthesis.
HeLa cell transient transfection and cell sorting
HeLa cells were passaged at 2×106 cells/100mm plate in the evening and incubated overnight. The following day they were transfected with 1ug of pTracer-SV40 plasmid and 25nM (=2.8ug) (in the final vol of 8mls) each of
URH49 siRNA or UAP56 siRNA using Lipofectin and Plus reagent (Invitrogen) as outlined by the manufacturer. Briefly, the required amount of plasmid and siRNA were complexed with 160ul Plus reagent for 15min at RT in a final volume of
800ul of OptiMEM (Gibco). These complexes were added to 16ul Lipofectin +
384ul serum-free DMEM and incubated at RT for 15min. The volume was made up to 8ml with serum-free DMEM and added to HeLa cells. Medium was replaced with DMEM + 10% CS after 3 hours and the cells were incubated for 48 hours. At this time, cells were trypsinized and resuspended in 1ml DMEM + 10% CS as a single cell suspension. Cells were sorted for GFP on a BD FACS Vantage SE.
48 Transient Transfection of HT 144 cells
HT144 cells were passaged at 2×105 cells/35mm plate in the evening and incubated overnight. The following day they were transfected with 1ug of TLG or
TiLG plasmid and 25nM each of URH49 siRNA and/ or UAP56 siRNA using
Lipofectiamine and Plus reagent as outlined by the manufacturer. Briefly the required amount of plasmid and siRNA were complexed with 20ul Plus reagent for 15 mins at RT in a final volume of 100ul of OptiMEM (Gibco). These complexes were added to 2ul Lipofectamine + 98ul serum-free DMEM and incubated at RT for 15 min. The volume was made up to 800ul with serum-free
DMEM and added to HT144 cells. The medium was replaced with DMEM + 10%
CS after 3 hours and the cells were incubated for 24 hours.
siRNA transfection using TransIT TKO
TransIT-TKO transfection reagent (Mirus) has been formulated especially for
siRNA transfections and ensures high (~80%) transfection efficiency. Cells were passaged at 2×105 cells/35mm plates in the evening and incubated overnight.
The next day 8ul TransIT TKO reagent was allowed to complex with OptiMEM
(Gibco) for 15 mins. 25nM of URH49 or UAP56 siRNA individually or together were added to the mix. The final siRNA concentration was made up to 50nM with scrambled siRNA. The mixture was incubated at room temperature (RT) for 15 mins. Volume was made up to 1ml using DMEM + 10% CS. The transfection mix was added to cells and incubated for 24, 48 or 72 hours depending upon the
49 experiment. If cells were going to be incubated longer than 24 hours, medium
was replaced with DMEM + 10% CS after 24 hours to avoid toxicity.
Transient transfection and stimulation of HeLa-S3 tet-off cells
Cells were passaged at 2×105 cells/ 35mm plate in DMEM + 10% CS +
100ng/ml Doxycycline. Cells were co-transfected in DMEM +10% CS the
following day with 0.5ug of the tet-Luc SPA plasmid and 25nM each of UAP56
and/or URH49 siRNA using 8ul TransIT TKO/ plate as outlined above. Medium
was changed 4 hours later to DMEM + 10%CS + 100ng/ml doxycycline to
repress luciferase expression from the tet-luc plasmid. 24 hours later medium
was changed to DMEM +10% CS + 1ng/ml Doxycycline to stimulate luciferase
expression. 24h and 48h after stimulation cells were lysed and the cell lysate was
assayed for luciferase activity.
Total RNA isolation, cDNA synthesis and Quantitative Real Time PCR
Total RNA was isolated from siRNA transfected cells using the Qiagen
RNeasy minipreps kit as per manufacturer’s directions. Depending upon the
experiment and the RNA yield 0.1ug to 0.5 ug RNA was used for cDNA synthesis
using the Superscript II first strand cDNA synthesis kit (Gibco) as per
manufacturer’s instructions. Minus RT reactions were incorporated as negative controls. 0.25ul cDNA was used for Real Time PCR analysis in 96-well plates using the Biorad Supermix. PCR was done on the Biorad icycler IQ Realtime
Detection system. Cycling parameters are as follows: Single cycle of 950C for 5
50 min (enzyme activation), 40 cycles of 940C for 15 sec, 620C for 30sec and 720C
for 30sec. Since SyBr Green is used as the detection system, a melt curve was
incorporated at the end to detect non-specific binding and primer dimer formation.
The forward primer for both UAP56 and URH49 was located in exon 2 while
the reverse primer spanned the exon-exon junction of exons 2 and 3 (Figure 2.8).
The PCR product for both UAP56 and URH49 was 166 nts. Ribosomal protein 4
(RPL4) mRNA was used as an internal control to normalize for RNA levels. The
forward primer for RPL4 spanned the exon-exon junction of exons 2 and 3 and
the reverse primer was located in exon 3. The PCR product for RPL4 was 150
nucleotides. One primer spanning the exon-exon junction ensured that the
product detected was RNA and not contaminating DNA (if any).
UAP56 forward primer 5’gacagcagctgggggagatg3’
UAP56 reverse primer 5’ctcatgctggacttctgacg3’
URH49 forward primer 5’gccccaggctcctcaagaga 3’
URH49 reverse primer 5’ctcatgctggacctcagaag 3’
RPL4 forward primer 5’cttttggaaacatgtgtcgtgg3’
RPL4 reverse primer 5’ctttagacatgaccagtgctgg3’
To determine primer efficiencies, a standard curve was generated for each
primer pair using different volumes of cDNA from 0.1ul to 1ul. Efficiencies were
found to be 95% for both UAP56 and URH49 primer sets and 89% for the RPL4 primer set (Figure 2.9). In order to compare products generated by different 51 primer sets, efficiencies should be within 10% of each other. This is what I observed with our primer sets suggesting that direct comparisons could be made.
Real Time PCR data was analyzed by comparing the Ct values obtained for
scrambled siRNA transfected cells with URH49 and UAP56 siRNA transfected
cells. For example: If the threshold Ct of URH49 in scrambled siRNA transfected
cells was 20 cycles and threshold Ct of URH49 in URH49 siRNA transfected
cells was 21 cycles, it implies that there is a 50% knockdown of URH49 in
URH49 siRNA transfected cells as compared to control cells.
Fluorescent in situ hybridization (FISH)
Cells were passaged at 2×104 cells per chamber in a 4 well Lab-Tek II
Chamber Slide and incubated overnight. Cells were transiently co-transfected
with 0.2ug dsRed Express vector (Clontech) and 25nM each of URH49 and/or
UAP56 siRNA. siRNA concentration was made up to 50nM with scrambled
siRNA. The negative control was 50nM scrambled siRNA. Transfections were
done using the 1.6ul TransIT TKO reagent as outlined above, in a final volume of
400ul. FISH was done at 24 hours and 48 hours.
All FISH steps were done in the dark in since the cells have been transfected
with dsRed Express which expresses Red fluorescent protein. All glassware was
baked to 1100C to eliminate RNase and all solutions were made in 0.1% DEPC-
treated H2O.
Medium was aspirated and slides were washed twice with 1X PBS. Cells
were then fixed in 3.7% paraformaldehyde for 15 mins at RT. Cells were washed 52 twice with 1X PBS and then permeabilized in 0.3% TritonX-100 (in PBS) for 10
min at RT.
Cells were incubated with prehybridization buffer (2X SSC, 20% formamide,
0.2% BSA, 1mg/ml of total yeast tRNA) for 15 mins at 370C. After
prehybridization, cells were kept in hybridization buffer (prehybridization buffer +
10% dextran sulfate + 1pmol/ul OligoT-Alexa 488 probe) for a minimum of 4
hours at 370C in a humidified chamber. After hybridization cells were washed
with a number of reagents to eliminate non-specific probe binding. Washes were
done in the order listed.
2X SSC + 20% formamide at 420C – 3 times
2X SSC at 420C – 3 times
1X SSC at RT – 2 times
1X PBS at RT – 2 times
Slides were air dried and mounted with fluorescence mounting medium with
DAPI (diluted 1:5 with fluorescence mounting medium) from VectaShield.
Coverslips were sealed with nail polish and slides visualized at 40X and 63X magnification under a Zeiss LSM 510 multiphoton confocal inverted microscope.
Quantitation of nuclear-cytoplasmic distribution of poly (A+) RNA
Quantitation of nuclear-cytoplasmic distribution of poly (A+) RNA was done
using the Zeiss Meta 510 software. The cellular periphery was defined with the
help of phase contrast images and the nuclear periphery was defined with the
help of DAPI staining. Fluorescence intensity was quantitated in the cytoplasmic
53 and nuclear areas with the help of the software. The ratio of mean fluorescence intensities in the cytoplasmic and nuclear areas was calculated. On an average,
25-30 cells transfected with each combination of siRNA were quantitated.
3H Uridine incorporation
HeLa cells were transfected with 25nM URH49 and/or UAP56 siRNA. The siRNA concentration was made up to 50nM with scrambled siRNA. Transfections were done using the TransIT TKO reagent in 35mm plates as outlined above.
Cells were incubated for 48 hours. At this time 2uCi 3H Uridine was added to each plate. After 2 hours, cytoplasmic and nuclear RNA was isolated from each plate using the Qiagen RNeasy minipreps kit as per manufacturer’s directions. poly (A+) RNA was then isolated from each prep using the Oligotex mRNA mini kit as per manufacturer’s directions. Poly (A+) RNA was measured for 3H counts in a Beckman Coulter LS 6500 scintillation counter.
Total Protein Analysis
HeLa cells were transfected with UAP56 and/or URH49 siRNA using the TransIT
TKO transfection reagent as outlined above. Cell were lysed at 24, 48 and 72 hours in 200ul lysis buffer (50mMTris-pH8 + 0.5%NP-40). 20ul cell lysate was used for the assay.
The Biorad DC protein assay kit was used for total protein analysis. This assay is a colorimetric assay for total protein determination based on the Lowry assay (Biorad tech notes 1069). A standard curve was generated using BSA.
Reagent A was made fresh every time by adding 20ul Reagent S/1ml Reagent A. 54 20ul cell lysates were aliquoted into test tubes and 500ul Reagent A was
added to each tube and vortexed. 4 mls of Reagent B was then added to each tube, vortexed and incubated at RT for 15 mins. Absorbance was measured at
750nm on a Genesys 2 spectrophotometer (Thermo Spectronic). Concentrations were determined against the BSA standards.
Apoptosis/necrosis assay using AnnexinV-EGFP and Propidium
Iodide (PI) staining
HeLa cells were transiently transfected with 25nM each of URH49 and
UAP56 siRNA using the Trans IT TKO transfection reagent as outlined above.
Floating cells were collected by centrifugation and attached cells were collected
by trypsinization at 24, 48 and 72 hours and washed with DMEM +10% CS. Cells
were then stained with 5ul Annexin V-EGFP and 10ul PI using the Apoalert
EGFP-AnnexinV Apoptosis Kit (Clontech) as per manufacturer’s directions.
10,000 cells were analyzed by flow cytometry on the BD FACS Calibur to detect
Annexin V and PI staining. Cells undergoing early apoptosis should stain with
Annexin V while necrotic cells should take up PI. Healthy cells should not stain with either reagent.
Taxol treatment and DAPI staining for Apoptosis Induction in HeLa
cells
HeLa cells were treated with 25nM Taxol for 20-24 hours to induce apoptosis.
Cells were collected and washed in 1X in PBS and fixed in 2% paraformaldehyde 55 for 5 minutes. Cells were washed with PBS, treated with 0.2%TritonX-100 and washed again with PBS. Cells were then stained with 0.5ug/ml DAPI for 15 mins at 40C. Stained cells were visualized under the Olympus fluorescence microscope (excitation 300 nm; emission 461 nm) and the Image ProPlus software. Apoptotic cells were identified by nuclear fragmentation
Luciferase Assays
Cells were lysed in 1X luciferase reporter lysis buffer for 15 minutes. Cell lysate was collected and centrifuged. 10ul cell lysate was assayed for luciferase activity using 100ul luciferase assay reagent (Promega) as suggested by the manufacturer. Luminescence was measured in the Lumat LB 9507 (Berthold
Technologies) luminometer for 10 seconds.
56 RESULTS
siRNA efficiency and specificity
In order to knockdown UAP56 and URH49, six different siRNA sequences for
each gene were designed. Sequences were selected such that they were
dispersed throughout the gene, which might increase the likelihood of getting a
good (≥ 80%) knockdown efficiency with at least one of them. Of all the siRNA’s analyzed, the one that worked the best was located in exon 10 for both UAP56 and URH49. 80-90% knockdown of URH49 was obtained and 70-80%
knockdown of UAP56 was obtained with the selected siRNA. The siRNA’s had 5
non-homologous bases between them, which ensured that each siRNA was
specific for its target. Additionally, knockdown of one gene did not result in the up
regulation of the other (Figure 2.10).
Scrambled siRNA was designed as a control. This siRNA had the same GC
content as UAP56 and URH49 siRNA (42.9%) but had no similarities with any
sequences available in the database. A BLAST search yielded no candidates. A
test experiment was done comparing levels of UAP56 and URH49 expression in
HeLa cells transiently transfected with scrambled siRNA or mock transfected with
reagent only. No noticeable differences were observed in UAP56 and URH49
expression in cells transfected with scrambled siRNA (Figure 2.11), confirming
that the control siRNA did not alter expression of UAP56 and URH49 genes.
57 UAP56 and/or URH49 knockdown effect on cell viability and
morphology
Knockdown of UAP56 in Drosophila Schneider cells results in growth
inhibition and an accumulation of poly (A+) RNA in the nucleus (Gatfield et al.,
2001i). URH49, which is 90% similar to UAP56 is found in mammals (mouse and
humans) but is not found in Drosophila (Pryor et al., 2004). Effects of UAP56
knockdown in mammalian cells have not been yet published. I wanted to
determine if knockdown of either UAP56 or URH49 or both had any effect on cell
growth and viability.
HeLa cells were transiently co-transfected with pTRACER-SV40 and 25nM
each of UAP56 and/or URH49 siRNA and incubated for 24 hours. At 24 hours,
cells were sorted for GFP and replated to ensure an almost pure population of
transfected cells. At this time (24h) cells transfected with UAP56 and/or URH49
were healthy and dividing normally. At 48 hours, cells transfected with either
UAP56 or URH49 siRNA looked healthy and were dividing normally. Cells
transfected with both UAP56 and URH49 siRNA on the other hand, had some
dead (floating) cells at this time. At 72 hours, cells transfected with either UAP56 or URH49 siRNA looked healthy; however there were no attached cells on the double knockdown plate.
Total protein assay
In order to quantitate the amount of cell death observed with UAP56 and
URH49 knockdown, transiently transfected HeLa cells with UAP56 and/or
58 URH49 siRNA were incubated for 24, 48 and 72 hours. At the said time points, cells were lysed and the cell lysate was assayed for total protein amounts. Total
protein amounts were quantitated against a BSA standard. As observed with
microscopic visualization, cells transfected with UAP56 and URH49 siRNA
respectively, had a similar total protein profile as cells transfected with scrambled
siRNA. Cells transfected with both UAP56 and URH49 siRNA showed a 2-fold
decrease in protein levels from 48 hours to 72 hours (Figure 2.12)
Since cells were transiently transfected, I did not have a pure population of
transfected cells for this experiment. The untransfected cells (even if only 5-10%
of the total population) would continue to survive and multiply normally from 24 to
48 to 72 hours. For example, if the transfection efficiency was 95%, there would
be 5% untransfected cells.
0h 5% untransfected and 95% transfected
24h 10% untransfected and 90% transfected
48h 20% untransfected and 80% transfected
72h 40% untransfected and 60% transfected (dead)
Since cells knocked down of both helicases are not dividing, as the untransfected
cells multiply the % of transfected cells in the population decreases with time.
At 72h cells knocked down of both helicases would be dead and hence would
not contribute to the amount of total protein. Hypothetically, at 48h if the amount
of total protein was 100, at 72h the amount of total protein detected would drop to
40, which is ~2-fold decrease. The total protein amount detected at 72h is perhaps only due to the presence of untransfected cells.
59 Hence, the 2-fold decrease in total protein levels is not an accurate measure
of cell death. Microscopic observations have suggested that all cells knocked
down of UAP56 and URH49 were dead at 72 hours. This is in agreement with the
calculations shown above.
Cell morphology
As compared to cells transfected with scrambled siRNA, cells transfected
with both UAP56 and URH49 siRNAs were unusually long and “stretched out”
with a prominent nucleus (Figure 2.13).
Cell death in double knockdown cells is not via the apoptotic pathway
A) Annexin V-PI staining
In order to determine if cell death observed in cells transfected with both
UAP56 and URH49 siRNAs was via the apoptotic pathway, I analyzed cells for
annexin V (AV) and Propidium iodide (PI) staining. Cells undergoing early
apoptosis have the phosphatidylserine exposed on the outer surface of the cell.
AV binds to phosphatidylserine and hence cells undergoing early apoptosis
would stain positive with AV. PI binds to DNA. PI staining would be observed
only in cells whose membrane is no longer intact so as to allow the PI to enter the cells. Hence, necrotic cells will stain positive for PI.
HeLa cells were transiently transfected with both UAP56 and URH49 siRNA
and incubated for 24, 48 or 72 hours. At the said time points, cells were collected
and stained with AV and PI and analyzed using flow cytometry. No Annexin V
60 staining was observed from 24 to 72 hours. PI staining on the other hand
increases 30 fold going from 24 to 72 hours suggesting that the cells are probably undergoing necrosis (Figure 2.14). Cells transfected with scrambled
siRNA showed no change in PI staining over a period of 72h.
B) DAPI staining to detect DNA fragmentation
DNA fragmentation is the hallmark of apoptotic nuclei. The most popular
assay to detect apoptosis is the TUNEL assay, which detects DNA
fragmentation. This can also be detected microscopically by staining cells with
DAPI.
Figure 2.15a shows HeLa cells treated with Taxol depicting DNA
fragmentation. Figures 2.15c-f show HeLa cells transfected with scrambled,
URH49+UAP56, URH49 siRNA and incubated for 48 hours. None of the nuclei
show any DNA fragmentation reaffirming the observation that cell death induced
via UAP56 and URH49 knockdown is not via the apoptotic pathway.
Knockdown of UAP56 and URH49 results in nuclear accumulation of poly (A+) RNA
Knockdown of UAP56 in Drosophila schneider cells results in nuclear
retention of poly (A+) RNA (Gatfield et al., 2001i). This effect has not yet been
demonstrated in mammalian cells. Nuclear retention could be due to a defect in
the splicing or export machinery since UAP56 has been shown to be involved in
both these processes (Fleckner et al., 1997a; Luo et al., 2001). URH49 has been
shown to interact with the export factor Aly, just like UAP56 (Pryor et al., 2004). 61 Hence, URH49 might be involved in the EJC formation and/or export.
Knockdown of one or both of these genes could lead to nuclear retention of
poly (A+) RNA.
In order to study localization of poly (A+) RNA in HeLa cells knocked down for
one or both helicases, fluorescent in situ hybridization (FISH) analysis was
performed. Briefly, transfected cells were incubated for 24 or 48 hours and then
fixed, permeabilized and hybridized with the oligo (dT) 50 -Alexa 488 probe. Cells were washed, stained with DAPI and visualized under a confocal microscope.
Single sections through the middle of the cell and Z-sections of the entire cell were visualized.
Figure 2.16(i) shows sections through the middle of the cell. Cells transfected
with scram siRNA (panel A) show uniform poly (A+) RNA distribution throughout
the cell. Quantitation of cytoplasmic-nuclear (C/N) distribution in scram siRNA
transfected cells yielded a ratio of 1.03. Figure 2.17 illustrates the method used
to quantitate the cytoplasmic/nuclear ratio of poly (A+) RNA. Some nuclear
retention of poly (A+) RNA is detected in single knockdown cells (Figure2.16 (i), panels B and C), but quantitation yielded a C/N ratio of 0.9 for both URH49 and
UAP56 knocked-down cells. Cells in which both UAP56 and URH49 were knocked down (Figure 2.16(i), panel D) exhibited a significant amount of nuclear localization. Amount of poly (A+) RNA detected in the cytoplasm was much less with most cytoplasmic poly (A+) RNA located close to the nucleus. The C/N ratio of poly (A+) RNA in the double knockdown cells was calculated to be 0.5.
62 Nuclear localization showed a strikingly punctate pattern in both the single
and double knockdown cells. There was no poly (A+) RNA detected in the
nucleolus. Figure 2.16(ii) is a magnification of a couple of cells from figure 2.16(i)
panel D to illustrate the distribution of poly (A+) RNA in the nucleus and
cytoplasm. Compare with the phase images to determine cell boundaries.
78% of 123 cells analyzed showed nuclear retention of poly (A+) RNA in the
double knockdown cells. This suggests that the transfection efficiency was ~80%.
Even though cells have been co-transfected with the dsRed Express reporter
plasmid it was difficult to detect dsRed expression in double knockdown cells
since reporter plasmid expression was significantly reduced. Additionally,
transfection efficiency of a plasmid is generally lower than the transfection
efficiency of siRNA. Hence, all cells transfected with the siRNA might not be
transfected with the reporter plasmid.
Localization of poly (A+) RNA in the nucleus
Since, UAP56 has been shown to play a role in mRNA export (Gatfield et al.,
2001i) and URH49 has been found to interact with the export factor Aly (Pryor et
al., 2004), nuclear accumulation of poly (A+) RNA might be because the RNA cannot be exported through the NPC. Hence, the mRNA might be localized along the nuclear periphery in association with the NPC but cannot be exported.
To ascertain the position of nuclear speckles, I analyzed Z-sections of cells
transfected with UAP56 and/or URH49 siRNA. Sections were taken through the
cells, from the top of the cell to the bottom (Figure 2.18). Nuclear speckles were
63 observed in sections 4-6 which is through the center of the nucleus, suggesting
that the poly (A+) RNA is not associated with the NPC, but present throughout the nucleus in a non-uniform pattern, with no poly (A+) mRNA detected in the nucleolus.
3H Uridine incorporation
Since, nuclear retention of poly (A+) was observed at steady state I wanted to determine if the same was true for pulse-labeled mRNA. In order to study this I analyzed incorporation of 3H uridine in cells transfected with UAP56 and/or
URH49 siRNA.
In order to determine the optimum time at which nuclear and cytoplasmic
distribution of poly (A+) RNA would be almost 1:1, untransfected HeLa cells were
treated with 3H Uridine for 1h, 1.5h, 2h, 3h and 4h. Following 3H uridine
incorporation, nuclear and cytoplasmic RNA was purified followed by poly (A+)
RNA isolation from each fraction. Amount of 3H uridine incorporated into Poly
(A+) RNA was determined. Figure 2.19 shows the nuclear-cytoplasmic distribution of labeled poly (A+) RNA at the mentioned time points. Based on
these results, I decided that 2h would be the optimum time at which RNA should
be harvested.
The initial experiment that I did to study 3H Uridine incorporation, yielded the
expected results. Figure 2.20A shows that 44% of pulse-labeled poly (A+) RNA
was retained in the nucleus in cells knocked down of both UAP56 and URH49.
64 This was in agreement with the microscopy data which showed 50% nuclear
localization.
Unfortunately, I could never reproduce this experiment. I changed several
parameters including time of 3H uridine addition (24h or 48h post-transfection), time of incubation after 3H uridine addition (1,5h, 2h, 3h), different cell types,
different siRNA preps, different transfection reagents. Figure 2.20B shows
representative data of subsequent experiments, which shows no nuclear
retention of poly (A+) RNA in this experiment. The reason for these unexpected
observations in not known.
Reporter gene expression in cells knocked down of UAP56 and/or
URH49
Certain observations made during the course of co-transfection experiments done with reporter plasmids inspired me to do a direct analysis of reporter gene expression in cells knocked down of both helicases. I will discuss these observations first that led to the actual experiment.
Cells co-transfected with a reporter plasmid expressing GFP or RFP and
siRNA to knockdown expression of both UAP56 and URH49, showed very low
levels of reporter plasmid expression. Figure 2.21 shows levels of GFP
expression in HeLa cells co-transfected with scrambled, UAP56, URH49 or both
UAP56 and URH49 siRNA’s. These cells were being sorted for GFP to obtain a
pure population of transfected cells. In control cells (scram) 52% of the cells were
expressing GFP.The same result was seen with cells transfected with UAP56
65 siRNA. Cells transfected with URH49 siRNA had a reduced population of GFP
positive cells (20%), but the most drastic change was observed in cells
transfected with both UAP56 and URH49 siRNAs. In this population only 2% of
cells were positive for GFP expression.
The same observation was made microscopically as discussed previously.
Cells co-transfected with dsRed Express (which expresses RFP) and
UAP56+URH49 siRNA’s and then analyzed for poly (A+) RNA localization,
showed very few red cells. Double knockdown cells that did exhibit RFP
expression had very low signal intensity. Cells transfected with scrambled,
UAP56 or URH49 siRNAs showed a robust expression of RFP.
Based on these observations, I conducted some experiments where cells
were co-transfected with a luciferase gene driven by the tet promoter and
siRNA’s. These experiments were performed with HeLa S3 tet-off cells which
are stably transfected with the tet transactivator (tet-TA) gene. In the presence of
doxycycline, expression of luciferase would be inhibited since tet-TA is inactive.
Upon withdrawal of doxycyline from the medium, luciferase expression would be stimulated. This system was used to analyze luciferase gene expression after
UAP56 and URH49 proteins have been significantly reduced. Hence, doxycycline was withdrawn from the medium 24h post-transfection. 48h after doxycycline withdrawal, cells were collected, lysed and assayed for luciferase expression.
Figure 2.22A shows that in cells where both UAP56 and URH49 are knocked down, luciferase expression was reduced by 65% as compared to cells transfected with scrambled siRNA. Cells knocked down for either UAP56 or
66 URH49 only showed a 15-35% reduction in luciferase expression. This data is a
compilation of 5 individual experiments.
Generation of Stable Cell Lines
Since, transfection efficiency is crucial in order to observe an effect of
knockdown, transient transfection is not the optimum way of conducting the
experiments discussed above. Therefore, I wished to generate stable cell lines
expression UAP56 or URH49 siRNA. I could not stably transfect both UAP56 and
URH49 siRNA’s since that would lead to cell death.
These experiments were done in collaboration with Zhe Yang. Our approach
was to construct pRETRO-SUPER (pRS) plasmids containing sense and
antisense siRNA strands with a short hairpin in between (Figure 2.23).
Transcription of this shRNA (short hairpin RNA) is driven by RNA polymerase III
from a H1 promoter. Termination signal is a stretch of 5Ts. pRS plasmid has a puromycin resistance gene. Plasmids were transfected into packaging cells to package them into the viral particles. HeLa cells were infected with these viral particles and selected for puromycin resistance. Resistant clones were pooled and grown as a mass culture.
Unfortunately, real time PCR analysis of these stable cell lines showed no
knockdown of the respective mRNAs. This observation was puzzling since both
siRNA’s knockdown the expression of their respective genes by 75- 80% in
transient transfection experiments. Closer examination revealed that the
termination signal for T7 polymerase is a stretch of T’s. I have 4T’s at the 3’ end
67 of the URH49 siRNA and 3T’s at the end of the UAP56 siRNA (Figure 2.6b).
Therefore, it is likely that transcription prematurely terminates at the end of the
sense strand itself. So no functional siRNA is made. Hence, we could not create stable cell lines with the existing siRNA’s.
Microarray Analysis
To determine if each helicase was responsible for regulating the expression
of a different subset of RNAs, cytoplasmic RNA isolated from HeLa cells
transiently transfected with UAP56 or URH49 siRNA was analyzed using
microarrays.
A ratio of cytoplasmic RNA in cells knocked down of URH49/UAP56 yielded a
few candidates that might be differentially affected by one helicase or the other.
Sialic acid binding Ig-like lectin 5 (SIGLEC5) mRNA, sorting nexin 2 (SNX2)
mRNA, B-cell receptor-associated protein BAP29 (BAP29) mRNA and
nucleoporin 98kDa (NUP98) transcript variant 3 mRNA exhibited URH49/UAP56
ratios between 0.26 and 0.4. Cytoplasmic levels of these transcripts are lower in
cells knocked down of URH49 as compared to cells knocked down of UAP56.
This implies that these proteins require URH49 for export from the nucleus.
Cytochrome P450 subfamily XXVIIA (steroid 27-hydroxylase, cerebrotendinous
xanthomatosis) polypeptide 1 mRNA on the other hand had a URH49/UAP56
ratio of 10.66. Cytoplasmic levels of this message are greatly reduced in UAP56
knockdown cells suggesting that this message requires UAP56 for its export.
Also, HLA-B associated transcript 1 (BAT1) mRNA exhibits a URH49/UAP56
68 ratio of ~3. BAT-1 is another name for UAP56. This shows that a 75% knockdown of UAP56 mRNA which is in agreement with our knockdown efficiency of the UAP56 siRNA. Table 2.1 outlines all the genes that had a
URH49/UAP56 ratio greater than 2 or less that 0.5.
Although a few genes have been found to be differentially regulated by
UAP56 or URH49, majority of the population seems to be similarly affected by
both helicases, suggesting that these helicases have the same function in the
cell.
69 DISCUSSION
UAP56 is a DEAD-box helicase thought to be required for splicing and export of
all mRNAs in all eukaryotes. This helicase has been shown to be essential for
cell viability and mRNA export in yeast, Drosophila and C.elegans. (Zhang and
Green, 2001; Gatfield et al., 2001d; MacMorris et al., 2003). However, the
indispensability of UAP56 has not yet been demonstrated in mammalian cells.
Depletion of UAP56 in HeLa cell extracts using polyclonal antibodies resulted in
splicing-deficient extracts (Fleckner et al., 1997b). However, since UAP56 and
URH49 proteins are 90% identical, the likelihood of the polyclonal antibodies
being specific to UAP56 is very low. The only region that showed significant non-
homology between the two proteins was the N-terminal end between amino acids
41 and 51. Izaurralde’s lab reported in a meeting abstract that knockdown of
UAP56 in HeLa cells using RNA interference led to some nuclear accumulation
of poly (A+) RNA (Izaurralde et al., 2002). This can mean one of two things. The siRNA designed was specific for UAP56 and did not knockdown URH49 activity.
(Note: When these experiments were done, the existence of URH49 in mammalian cells was not known). Alternatively, siRNA designed did not efficiently knockdown UAP56 and URH49 and the residual amount of proteins were sufficient to mediate splicing and export of most poly (A+) RNA’s. Since, this data was presented at a meeting and never was published; it is not possible to determine which of these two possibilities is true.
70 Based on sequence analysis URH49 is a DExD/H-box RNA helicase since it
has all the conserved motifs (Pryor et al., 2004). However, its ATPase/helicase
activity has not been demonstrated. The biological role of URH49 is not known.
Since, it is 90% similar to UAP56; it is likely that this protein has the same
biological functions as UAP56. But, work done by Pryor et al has demonstrated
that the expression of URH49 is different from UAP56 in different tissues and in
growth-stimulated cells. Level of URH49 mRNA increases 3-5 fold upon serum
stimulation within the first 5h, whereas UAP56 mRNA levels remain relatively
constant throughout the cell cycle. Also, the half life of URH49 mRNA in
quiescent cells is much shorter (~4h) than that of UAP56 (~15h). All these
observations motivated us to believe that UAP56 and URH49 might indeed have
independent roles in the cell. They might have the same biological activity
namely splicing and export, but might regulate different populations of RNA.
My project was to futher explore the biological significance of UAP56 and
URH49 in human cells.
Role of UAP56 and URH49 in cell viability
Specific knockdown of UAP56 and URH49 individually had little effect on cell
viability. Cells were healthy and dividing just like control cells. In contrast, when cells were transfected with both UAP56 and URH49 siRNA simultaneously, cell death was observed by 72h. Most cells detached from the culture dish. Flow
cytometry and nuclear fragmentation analysis showed that cell death was not via the apoptotic pathway.
71 Based on these observations, it is possible that UAP56 and URH49 perform
the same functions in the cell. Hence, in the absence of one, the other protein can complement the defect and allow cells to survive and proliferate. In support of this idea, both UAP56 and URH49 have been shown to complement a Sub2p defect in a yeast complementation assay (Pryor et al., 2004). Yeast, Drosophila and C.elegans have only one protein corresponding to UAP56. Knockdown of
UAP56 in these organisms blocks mRNA production and affects cell viability or growth (MacMorris et al., 2003; Zhang and Green, 2001; Gatfield et al., 2001c).
In contrast, in human cells, the presence of either UAP56 or URH49 is sufficient for cell viability. Both helicases must be eliminated to observe major effects on mRNA production and cell viability.
Two observations were extremely intriguing in this study. Firstly, the rapid
onset of cell death (within 72h) after knockdown of both helicases suggests the
absolute necessity of these proteins for cell survival. Knockdown of HEL in
Drosophila cells (Gatfield et al., 2001b) results in significant growth inhibition
from 3-10 days post-transfection, but no cell death was reported. This implies that HEL is required for cell growth but not for cell survival. Alternatively, it is possible that the cells were dead but still remain attached to plate and hence attributed to the cell count. No viability assays were reported. In Drosophila cells,
there was a significant reduction in HEL protein levels by 48h post-knockdown. If
the same hold true in mammalian cells, then depletion of URH49 and UAP56
protein levels by 48h induces cell death within 72h which is in agreement with
growth inhibition seen in Drosophila cells by Day 3.
72 Secondly, HeLa cell death is not via the apoptotic pathway. Apoptosis or programmed cell death is stimulated in response to an “insult” to the cell. The apoptotic pathway eventually terminates in necrosis and hence, it is difficult to distinguish an apoptotic cell from a necrotic cell during later stages of apoptosis.
Cell death in the double knockdown was monitored at 24h, 48h and 72h. No signs of apoptosis were ever detected. Cell nuclei remained uniformly stained suggesting that there was no DNA fragmentation. There was no annexin V staining from 24h-72h but increased PI staining from 48h to 72h suggesting cell necrosis. Cell morphology analysis also showed that HeLa cells transfected with both UAP56 and URH49 siRNA were much larger and had a pronounced nucleus. The observations suggest that the cell senses the absence of UAP56 and URH49 leading to reduced production of mRNA and undergoes necrosis.
It might be worth noting, that the apoptotic pathway is an energy consuming pathway, involving a multitude of enzymes. It is a mechanism to protect surrounding cells from the toxic insults incurred by the apoptotic cell (eg infectious agent), which is why the cell shrivels and implodes instead of exploding. Knockdown of UAP56 and URH49 is not an effect that is harmful to surrounding cells. Absence of these proteins merely makes it impossible for the cell to survive and hence it undergoes cell death via the energy efficient necrotic pathway.
73 Nuclear localization of poly (A+) RNA
Knockdown of UAP56 and URH49 via RNA interference leads to ~50% retention of poly (A+) RNA in the nucleus. A speckled pattern of retention was observed rather than a uniform distribution of mRNA. No mRNA was detected in the nucleolus. Single knockdowns on the other hand showed a slightly speckled pattern in the nucleus but quantitation revealed only 10% nuclear retention. This observation shows that presence of either UAP56 or URH49 is sufficient for the export of 90% RNA’s from the nucleus to the cytoplasm. This result is in agreement with the observations made earlier regarding cell viability. Either helicase seems to be sufficient to support mRNA export, but the absence of both leads to cell death.
Knockdown of HEL in Drosophila and UAP56 in C.elegans, which do not possess URH49 also resulted in nuclear accumulation of poly (A+) RNA
(MacMorris et al., 2003; Gatfield et al., 2001a). The pattern of nuclear localization in Drosophila cells matches the pattern I observed. They did not report any quantitative data, but nuclear localization observed was not absolute. Some mRNA was found in the cytoplasm.
This is not entirely surprising as other mRNA export pathways are still functional in the cell (Figure 2.24). Crm1 is a receptor for leucine-rich nuclear export signals (NES) and is involved in the export of Rev proteins, UsnRNA’s,
60S and 40S ribosomal subunits and 5S rRNA (Rodriguez et al., 2004a).
Recently, a TAP family member, NXF3 was shown to contain an NES and postulated to be exported via the Crm1 pathway (Yang et al., 2001). Exportin-t is 74 a receptor for t-RNA’s in higher eukaryotes. Exportin -5 is a receptor for viral transcripts that also serves as an alternative transport pathway for tRNA export.
It has also been shown to mediate export of interleukin enhancer binding factor
(ILF3) and the elongation factor eEF1A in eukaryotes. Interestingly, this receptor has also been shown to be involved in the export of pre-miRNA’s, playing an important role in miRNA biogenesis (Rodriguez et al., 2004b).
Z-sections through the cells reveal that the RNA is localized in speckles
throughout the nucleus and not at the periphery. If the RNA had been recruited to
the NPC, I would expect to see accumulation at the nuclear periphery. But, if
UAP56 and URH49 are involved in the splicing of pre-mRNA, knockdown of
these proteins would result in inhibition of the splicing reaction. Additionally,
UAP56 is a part of the EJC, which implies that absence of UAP56 might not
result in the recruitment of a functional EJC. The absence of UAP56 would not
allow the downstream interaction with Aly and hence TAP/p15, which is known to
facilitate transport through the NPC. Hence, the absence of UAP56 would result
in the inhibition of all the upstream processes, resulting in RNA accumulation
within the nucleus.
I do not observe absolute nuclear retention of poly (A+) RNA. Even if I argue
that there are other transport mechanisms in the cell, only fully processed RNA
can be exported. If UAP56 is essential for splicing, then unspliced RNA should
accumulate in the nucleus, and no export should be observed. This reopens the
question of how important is UAP56 in the splicing reaction. Recent data seems
to strongly implicate UAP56 in the export of mRNA, but not much has been
75 published lately about the role of UAP56 in splicing. Additionally, it is noteworthy, that UAP56 has been shown to be involved in the export of intronless RNA as well (Gatfield et al., 2001j; Jensen et al., 2001; Strasser and Hurt, 2001; Kiesler et al., 2002), which implies that the splicing reaction is not essential for the recruitment of UAP56 to the EJC. Considering all these factors, it is important to re-examine the effect of UAP56 and/or URH49 on the splicing reaction. This can be done by measuring (by PCR) the accumulation of unspliced or spliced transcripts in the nucleus.
I used a tet-regulatable system to control luciferase gene expression. In this
experiment luciferase expression was turned off for the first 24h to allow for the
knockdown of the helicases. At this time, luciferase expression was stimulated
and cells analyzed 24-48h after stimulation. A 60% reduction in reporter gene
activity was observed when both helicases were knocked down. This is also
consistent with nuclear localization.
Protein- Protein interactions
A more biochemical approach would be to study if UAP56 and or URH49 are
a part of the spliceosome complex. Also, it would be interesting to know if these
proteins interact with each other to form homodimers or heterodimers, A recent paper elucidating the structure of UAP56 suggests the presence of a dimer interface (Zhao et al., 2004b). UAP56 could dimerize to itself or other interacting
proteins like U2AF65 or Aly via this interface. Another study with a yeast two-
hybrid system using UAP56 as a bait, identified the most frequent interacting
76 partner to be UAP56 itself or URH49. Another protein NM_138394 was also identified as an interacting partner. This protein has 3 RNA recognition motifs
(RRMs) and is similar to hnRNP L suggesting that it might play a role in splicing and export (Lehner et al., 2004). These observations need to be corroborated biochemically. Additionally, experiments need to be done to identify if URH49 interacts with UAP56 interacting proteins like U2AF65. URH49 has already been shown to interact with Aly, but its association with the spliceosome, EJC and
TREX complex should be determined. Also, recent studies have shown that Aly is not required for nuclear export of mRNAs (Gatfield and Izaurralde, 2002b).
This imples that UAP56 might interact with other adaptor/effector proteins besides Aly to facilitate transport. SR-rich proteins Srp20 and 9G8 involved in the export of intronless RNAs in Xenopus interact with the TAP via the same domain as Aly (Huang et al., 2003). Additionally, NpI3, the SR-like protein in yeast was shown to directly interact with Mex67p and recruit it to the mRNP (Gilbert and
Guthrie, 2004). It would be important to determine if these SR-proteins interact with UAP56 and/or URH49 to recruit TAP to the EJC.
Protein Levels
All my experiments and Annie Pryor’s experiments have dealt with mRNA. In order to get an overview of events in the cell it is necessary to determine protein levels. Since the two helicases are so similar, it was hard to design specific antibodies against each protein. I did try to design antibodies that would target each helicase individually, but the only non-homologous region between the two
77 helicases that can potentially be targeted is between amino acids 41 and 51.
Given the slim chance of the large investment paying off, I did not look into this
further. Instead, TAP-tagged versions of UAP56 and URH49 were designed. This
cloning experiment was initiated by Rebecca Kohnz and completed by Zhe Yang.
Currently, TAP-tagged versions of both helicases are stably transfected into
HeLa cells. GST-tagged versions of the protein are also available to study formation of homodimers and heterodimers between UAP56 and URH49. It would also be important to determine the half life of UAP56 and URH49 proteins.
Also, interactions of UAP56 and URH49 with components of the splicing and export machinery can now be studied.
Differential regulation of RNA populations
It is important to determine if both these helicases have independent
functions in the cell. Silencing of individual helicases has shown some retention
of poly (A+) RNA in the nucleus. This might suggest that both these helicases
might have their specific targets in addition to the general targets shared by both.
To determine this, I did microarray analysis in collaboration with Zhe Yang.
Cytoplasmic RNA isolated from HeLa cells knocked down of either helicase was analyzed to determine if different population of messages are being inefficiently exported from the nucleus in the absence of the respective helicases. A few mRNAs were found to be inefficiently exported in the absence of one helicase or the other, but the vast majority of mRNA’s analyzed seemed to be equally
78 affected by knocking down either helicase suggesting that the helicases have the same function in the cell.
This leaves us with the perplexing query as why are there two helicases in mammalian cells but not in lower organisms. One reason might be to “jump start” mRNA biogenesis at the G1-S phase interphase. Since, most genes need to be synthesized at this time, higher levels of the helicase would be required, and hence having a second helicase whose levels increase rapidly during the initial phases of the cell cycle would ensure transcription of all the crucial genes at this time. Also, experiments have shown that overexpression (aswell as underexpression) of UAP56 is toxic in C.elegans (MacMorris et al., 2003).
Hence, having constitutively high levels of UAP56 (or overexpression of UAP56) in the cells might not be conducive to cell viability. As a result, the cells have a second helicase that performs the same functions as UAP56 and whose levels increase at required times to ensure proper mRNA biogenesis from all the required genes.
79 ATP
Figure 2.1: Conserved Motifs of DEAD-box proteins and their interactions with substrate (RNA) and ATP Figure shows the 9 conserved motifs found in DEAD-box proteins and the interaction of each motif with ATP binding and hydrolysis. Postulated interactions of motif with the RNA also depicted. See text for details. Figure taken from (Rocak and Linder, 2004e)
80
Figure 2.2: Role of RNA helicases in spliceosome assembly and splicing. Recruitment of U1snRNP is an energy-independent step. Addition of U2 snRNP on the other hand requires ATP and might be assisted by Prp5p. Sub2 (UAP56) is also implicated in this step. It is involved in the displacement of Mud 2 from the polypyrimidine tract (Kistler and Guthrie, 2001). Addition of the U4-U5-U6 tri-snRNP complex and displacement of U1snRNP requires RNA-RNA and RNA- protein remodeling and is an ATP-dependent step. Prp28 is suggested to aid this step. Dissociation of U4snRNP from U6snRNP requires the Ski2-family protein brr2 (Raghunathan and Guthrie, 1998). The first and second transesterificaton steps require the DEAH-box proteins Prp2p and Prp16p respectively. The release of mature RNA and spliceosome disassembly is facilitated by Prp22p and Prp43p respectively (Rocak and Linder, 2004j). Figure taken from (de La et al., 1999a) 81
Dhh1
Figure 2.3: Role of RNA helicases in Translation and mRNA degradation a) Helicases involved in translation initiation and termination b) Helicases involved in mRNA degradation via the exosome and the NMD pathway See text for details. Figure adapted from (de La et al., 1999f)
82
Figure 2.4: “Spring-loaded” model proposing the ATPase activity of UAP56 i) UAP56 has two domains, the N-terminal and the C-terminal. ii) In the presence of ATP UAP56 interacts with RNA-bound U2AF65 or SF1 resulting in a conformational change to the productive ATPase conformation. iii) Since both RNA and the RNA binding protein contact both domains of UAP56, the energy coupled movement of the large domain results in the RNA being ripped apart from the RNA binding protein. Figure taken from (Shi et al., 2004c)
83 Figure 2.5: Role Of UAP56 and Aly in splicing and export
1. UAP56 and Aly get recruited to the TREX complex co-transcriptionally 2. At the brancj point, UAP56 dissociates U2AF65 and recruits U2 snRNP 3. Following splicing, the spliceosome deposits the EJC 20-24 nt upstream of the exon-exon junction 4. UAP56 dissociates 5. Aly interacts with TAP/P15 and the mRNP complex is exported through the NPC
Figure adapted from Annie Pryor’s dissertation. See text for additional details
84 DNADNA Pol II CTD TRETREXX PrPree -m- mRNARNA AlAlyy UAP5UAP566 CBC
Aly
U2 U1 U2AF65 UAP56 Exon 1 Exon 2 BBP
EJC
UAP56 Aly Exon 1 Exon 2 TATAP p15 2 n o x E
1 y l n A o C x J E E P A 5 T 1 p
Nucleus NPC
Cytoplasm DBP5 eIF4A
85 a)
Scrambled Sense DNA Template 5’ aaaaagtagcaaacgcgactgcctgtctc 3’
Scrambled antisense DNA Template 5’ aacagtcgcgtttgctactttcctgtctc 3’
Scrambled siRNA target sequence 5’ aacagtcgcgtttgctacttt3’
URH49 sense DNA template 5’ aaaaaagtgatggctaggcctcctgtctc3’
URH49 antisense DNA template 5’ aaaggcctagccatcacttttcctgtctc 3’
URH49 siRNA Target Sequence 5’ aaaggcctagccatcactttt 3’
UAP56 sense DNA template 5’ aaaaatgtgatagccaagccccctgtctc 3’
UAP56 antisense DNA template 5’ aagggcttggctatcacatttcctgtctc 3’
UAP56 siRNA target sequence 5’ aagggcttggctatcacattt 3’
b)
AH49 siRNA target sequence 5’AAAGGCCTAGCCATCACTTTT 3’
UAP56 siRNA target sequence 5’AAGGGCTTGGCTATCACATTT 3’
Figure 2.6: Sequences of DNA oligo templates and siRNA target sequence a) sense and antisense DNA oligo templates that were ordered from Invitrogen and the siRNA target sequence for the successful siRNA’s is shown. b) Successful URH49 and UAP56 siRNAs were at the exact same location for both genes. Nucleotides in red depict the non-homologous nucleotides between URH49 and UAP56 target sequence, ensuring that the siRNA’s are specific.
86
Figure 2.7: Schematic of Silencer siRNA construction Kit procedure. The Figure has been directly taken from Ambion’s technical resources. DNA template oligos were annealed with T7 promoter primer and elongated using the Klenow fragment of DNA polymerase to make double stranded DNA oligos. These DNA oligos were used as templates to make sense and antisense siRNA strands, which were allowed to anneal to yield double-stranded siRNA. The prep was digested with DNase and RNase to eliminate primers and overhangs and then cleaned up using a column and eluted in RNase-free water. OD was measured at 260nm.
87 Exon 2 Exon 3
Figure 2.8: Position of forward and reverse real time primers for UAP56 and URH49 detection. The orange arrow represents the forward primer located in exon 2 and the green arrow represents the reverse primer located at the exon- exon junction of exons 2 and 3. The forward and reverse primers were located at the exact same position in both genes.
88
Figure 2.9: Efficiencies of primers used for Real time PCR A standard curve was generated with each set of primers using 0.1ul, 0.25ul, 0.5ul and 1ul of cDNA. Primer efficiency was determined based on the slope of the graph. Efficiencies were calculated by the icycler iQ Real Time Detection system software. Each concentration was done in triplicate, and the standard curve was repeated with different batches of cDNA. 12.5ul Biorad iQ SyBr green supermix and 10uM primers were used for each reaction in a final volume of 25ul.
A) Standard curve generated with URH49 primers B) Standard curve generated with UAP56 primers C) Standard curve generated with RPL4 primers
89 A) URH49
B) UAP56
C) RPL4
90
1.4
1.2
1
0.8 URH49 UAP56 0.6 mRNA levels mRNA
0.4
0.2
0 control UAP56 URH49
Figure 2.10: Specificity and efficiency of UAP56 and URH49 siRNAs HeLa cells were transiently co-transfected with pSV40-TRACER and 25nM of each siRNA. In order to analyze an almost pure population of transfected cells, cells were sorted for GFP 24 hours post-transfection. Total RNA was isolated from the GFP positive cells and analyzed for UAP56 and URH49 levels using Real time PCR. The data above is a compilation of 3 different experiments. On a average 80-90% knockdown was observed for URH49 and 70-80% knockdown was observed for UAP56.
91
1.2
1.0
0.8
Mock 0.6 Scrambled Fold change 0.4
0.2
0.0 URH49 UAP56
Figure 2.11: Scrambled siRNA does not affect expression of URH49 or UAP56 URH49 and UAP56 expression levels were analyzed by real time PCR after scrambled siRNA transfection and compared to mock transfected cells (with transfection reagent only) to ascertain that the scrambled siRNA did not affect the expression of these genes.
92 Figure 2.12: Knockdown of UAP56 and URH49 results in cell death
HeLa cells were transiently transfected with URH49 and/or UAP56 siRNA and incubated for 24, 48 or 72 hours. At the said time point, cells were lysed and assayed for total protein levels based on Lowry assay. Protein levels were quantitated against BSA standards. A) Total protein levels in cells transfected with URH49 or UAP56 siRNA respectively as compared to cells transfected with scrambled siRNA B) Total protein levels in cells transfected with both URH49 and UAP56 siRNA as compared to cells transfected with scrambled siRNA.
93 A)
120
110
100
90 Scrambled 80 URH49 70 UAP56
Total ProteinTotal 60
50
40
30 0244872 Time (hours)
B)
120
110 100 90
80 Scrambled Double 70
Total Protein Total 60 50 40
30 0244872 Time (hours)
94
Double Scram
Figure 2.13: Morphology of cells knocked down of both UAP56 and URH49 HeLa cells transfected with scrambled siRNA or UAP56 and URH49 siRNA and incubated for 48 hours. Left panel shows morphology of cells transfected with both UAP56 and URH49 siRNA. Right panel shows morphology of cells transfected with scrambled siRNA.
95 35
30
25
20 knockdown control 15
10 PIstaining (% cells) 5
0 20 40 60 80 Time (hours)
Figure 2.14: Increased PI staining in HeLa cells knocked down of both helicases suggests necrosis HeLa cells were transiently transfected with UAP56 and URH49 siRNA and incubated for 24h, 48h and 72h. At the said times, attached and floating cells were collected and stained with Annexin V and PI and analysed using FACS. Figure is a compilation of two independent experiements. Data was normalized to staining observed in HeLa cells transfected with scrambled siRNA. Since no change in AV staining was observed, only PI staining data is shown here.
96
Figure 2.15: Cell death in HeLa cells transfected with both URH49 and UAP56 siRNA is not via an apoptotic pathway A and B) HeLa cells were treated with 25nM Taxol for 20 hours to induce apoptosis (internal communication with Dr. Doseff and Oliver Voss). Treated cells were collected, fixed in 2% PFA and stained with DAPI (0.5ug/ml). Cells were visualized on Olympus fluorescence microscope at 40X lens magnification. The image was futher magnified by the software. C-F) HeLa cells were transiently transfected with the indicated siRNA using TransIT TKO and incubated for 48 hours. At this time cells were subjected to the fluorescent in situ hybridization (FISH) procedure. Images were captured on a confocal microscope at 40X. Images were analyzed to determine if apoptotic nuclei were observed (since cell detach from the plates between 48h and 72h). Data shown here is at 48 hours. Images were taken at 24 hours and 72 hours as well and the same nuclear phenotype was observed.
97
A B
Taxol HeLa
C D
Scram Double
E F
URH49 UAP56
98 Figure 2.16: Knockdown of UAP56 and URH49 results in nuclear localization of Poly (A+) RNA i) HeLa cells were transiently co-transfected with 25nM of the mentioned siRNA’s and the dsRed Express plasmid (Clontech). 24, 48 and 72 hours later cells were fixed and hybridized with oligo (dT)50-Alexa488 probe. Cells were stained with DAPI and visualized under the confocal microscope at 63X magnification. Data shown here is at 48 hours, at which time nuclear localization is observed. ii) Magnification of a couple of cells transfected with both URH49 and UAP56 siRNA to clearly detect position of speckles compared with the position of the nucleus and the rest of the cell.
99 i)
A) Scram
phase DAPI Alexa 488
B) UAP56
DAPI phase Alexa 488
C) URH49
phase DAPI Alexa 488
D) Double
phase DAPI Alexa 488
100 ii)
101
Double scram
Figure 2.17: Quantitation of poly (A+) RNA distribution. Representative data showing how cells were quantitated for distribution of poly (A+) RNA between nucleus and cytoplasm. Left panel shows cells transfected with both UAP56 and URH49 siRNA, right panel shows cells transfected with scrambled siRNA. Cell boundaries and nuclear boundaries were defined based on phase images and DAPI staining. Fluorescence intensity was quantitated within the nucleus and cytoplasm using the Zeiss Meta 510 software. Ratios of the intensities in the cytoplasm to nucleus were determined.
102 Figure 2.18: Z-stacks of cells to show position of localized RNA in the nucleus HeLa cells were transiently co-transfected with 25nM of the mentioned siRNA’s and the dsRed Express plasmid (Clontech). 24, 48 and 72 hours later cells were fixed and hybridized with oligo (dT) 50-Alexa488 probe. Cells were stained with DAPI and visualized under the confocal microscope at 63X magnification. Sections were taken from the top of the cell to the bottom. Frames 4-6 are sections through the middle of the nucleus where most of the localization is observed. Data shown here is at 48 hours. Top and bottom indicate top and bottom of the cell.
103 TOP 1 2 3
4 5 6
7 8 9
BOTTOM
104
TOP 1 2 3
4 56
7 8 9
BOTTOM 2 3
4 5 6
7 8 9 105 8000
7000
6000
5000
4000 nuclear 3000 Cytoplasm 3H incorporation 2000
1000
0 012345 time (hours)
Figure 2.19: 3H Uridine incorporation in HeLa cells at various time points. HeLa cells were treated with 2uCi 3H Uridine and incubated for 1 hour, 1.5 hours, 2 hours, 3 hours and 4 hours. At each time point nuclear and cytoplasmic RNA was isolated from the cells. Poly (A+) RNA was then isolated from each fraction. 3H counts were measured in each poly (A+) RNA fraction. Almost equal amounts of counts observed in the nuclear and cytoplasmic fraction at 2 hours.
106
A 1.0
0.9
0.8
0.7
0.6
0.5
0.4
0.3 cytoplasmic/nuclear ratio 0.2
0.1
0.0 control UAP56 URH49 Double
B 1.6
1.4
1.2
1.0
0.8
0.6
0.4 cytoplasmic/nuclear ratio 0.2
0.0 scram URH49 UAP 56 Double
Figure 2.20: 3H Uridine incorporation to detect Poly (A+) localization HeLa cells were transiently transfected with 25nM of the mentioned siRNA’s. 24 hours post-transfection, 2-10uCi 3H Uridine was added to each plate and cells incubated for 2 hours. At this time, nuclear and cytoplasmic RNA was isolated from the cells. Poly (A+) RNA was isolated from each fraction and 3H counts were measured in each poly (A+) RNA sample. A) First experiment done that exhibited 50% nuclear localization in the double knockdown cells B) Representative data of all subsequent experiments done where no nuclear localization was observed.
107 scram: 52% 800 AH49: 20%
UAP56: 59% AH49 +UAP56 1.86%
Figure 2.21: Knockdown of UAP56 and URH49 reduces reporter gene expression HeLa cells were co-transfected with pTracer-SV40 and mentioned siRNA’s. Cells were sorted for GFP expressing cells. The different histograms show the levels of GFP expression in cells transfected with the mentioned siRNA’s. X-axis indicates GFP expression and Y-axis indicates cell number.
108
A Cells in Doxycycline 100 siRNA + plasmid transfection 90 4h 80 70 Add doxycycline to turn off Luc
60 expression
50 24h 40 35 30 Remove doxycycline to induce
Reporter gene expression gene Reporter Luc expression 20
10 48h 0 scram URH49 UAP56 Double Assay for luciferase expression
Figure 2.22: Effect of UAP56 and/or URH49 knockdown on luciferase expression in tet-regulated cells HeLa S3-tet off cells were transiently co-transfected with tet-luc SPA vector and 25nM of each UAP56 and URH49 or both for the double. Cells were incubated in 100ng/ml for 24 hours to suppress luciferase expression and to allow for the knockdown of the respective genes. 24 hours later doxycycline was taken off from the medium to stimulate luciferase expression. Luciferase activity was measured 48 hours post-stimulation. Data is a compilation of 5 independent experiments showing 65% reduction in luciferase gene expression in the double knockdown. Single knockdowns showed 15-35% reduction in luciferase expression.
109
hairpin Sense strand Antisense strand
Figure 2.23 : Depiction of the sense and antisense siRNA strands in the pRETRO-SUPER vector. The sense and antisense strand were oriented in the 5’-3’ orientation separated by a defined hairpin structure. This entire oligo sequence sense strand-hairpin- antisense strand was commercially ordered and cloned into the pRETRO- SUPER vector. The rest of the vector structure is not shown.
110
Figure 2.24: Different pathways of mRNA export from the nucleus Figure taken from (Rodriguez et al., 2004c)
111 Table 2.1: Microarray analysis of differential regulation by UAP56 and URH49 Cytoplasmic RNA isolated from HeLa cells transiently transfected with UAP56 or URH49 siRNA was analyzed using microarrays. A ratio of URH49/UAP56 determines the amount of cytoplasmic RNA present after URH49 knockdown and UAP56 knockdown. Ratios between 0.5 and 2 were considered insignificant since a two-fold increase or decrease lies withing experimental error. Candidates showing a significant change are indicated in bold.
112 URH49 / URH49 URH49 UAP56 UAP56 UAP56 F635 F635 Compare Name of mRNA/gene Genbank ID Median NormalizeRatio Median NormalizeRatio ratio Homo sapiens sialic acid binding Ig-like lectin 5 (SIGLEC5), mRNA. NM_003830 175 0.745 579 2.797 0.266 Homo sapiens sorting nexin 2 (SNX2), mRNA. NM_003100 736 3.132 1851 8.942 0.350 Homo sapiens B-cell receptor-associated protein BAP29 (BAP29), mRNA. NM_018844 352 1.498 806 3.894 0.385 Homo sapiens nucleoporin 98kDa (NUP98), transcript variant 3, mRNA. NM_005387 419 1.783 927 4.478 0.398 Homo sapiens calumenin (CALU), mRNA. NM_001219 955 4.064 2088 10.087 0.403 Homo sapiens deoxycytidine kinase (DCK), mRNA. NM_000788 1209 5.145 2495 12.053 0.427
Homo sapiens NAD(P)H dehydrogenase, quinone 1 (NQO1), mRNA. NM_000903 747 3.179 1540 7.440 0.427 Human MAP kinase kinase 6 (MKK6) mRNA, complete cds. U39657 341 1.451 691 3.338 0.435 Homo sapiens ubiquitin- conjugating enzyme E2D 3 (UBC4/5 homolog, yeast) (UBE2D3), mRNA. NM_003340 2168 9.226 4367 21.097 0.437 Homo sapiens hypothetical protein FLJ20047 (FLJ20047), mRNA. NM_017639 1737 7.391 3472 16.773 0.441 Homo sapiens tubulin, alpha, ubiquitous (K- ALPHA-1), mRNA. NM_006082 32792 139.540 65535 316.594 0.441 Homo sapiens uncharacterized hypothalamus protein HT010 (HT010), mRNA. NM_018471 2963 12.609 5887 28.440 0.443 Homo sapiens BTB (POZ) domain containing 3 (BTBD3), mRNA. NM_014962 4252 18.094 8276 39.981 0.453 Homo sapiens 15 kDa selenoprotein (SEP15), mRNA. NM_004261 1557 6.626 2953 14.266 0.464
113 Homo sapiens Down syndrome critical region gene 2 (DSCR2), mRNA. NM_003720 1085 4.617 2027 9.792 0.471 Homo sapiens proteasome (prosome, macropain) subunit, beta type, 2 (PSMB2), mRNA. NM_002794 4492 19.115 8361 40.391 0.473 Human mRNA for KIAA0338 gene, partial cds. AB002336 756 3.217 1407 6.797 0.473
Human HepG2 3' region cDNA, clone hmd3a09. D16906 1722 7.328 3190 15.411 0.475 Homo sapiens glial fibrillary acidic protein (GFAP), mRNA. NM_002055 294 1.251 538 2.599 0.481 Homo sapiens cDNA FLJ13150 fis, clone NT2RP3003353, weakly similar to HYPOTHETICAL 26.2 KD PROTEIN IN GDI1- COX15 INTERGENIC REGION. AK023212 318 1.353 575 2.778 0.487 Homo sapiens zinc ribbon domain containing, 1 (ZNRD1), mRNA. NM_014596 445 1.894 793 3.831 0.494
Continuation of data, High end of the ratios
URH49 / URH49 URH49 UAP56 UAP56 UAP56
F635 F635 Compare Name of mRNA/gene Genbank ID Median NormalizeRatio Median NormalizeRatio ratio Homo sapiens mRNA; cDNA DKFZp586G2222 (from clone DKFZp586G2222). AL080111 1992 8.477 866 4.184 2.026 Homo sapiens thrombospondin 3 (THBS3), mRNA. NM_007112 212 0.902 92 0.444 2.030 Homo sapiens mRNA for FLJ00052 protein, partial cds. AK024460 1133 4.821 491 2.372 2.033
Homo sapiens clone PP3051 unknown mRNA. AF218006 2814 11.974 1196 5.778 2.073
114 Homo sapiens mRNA from chromosome 5q21- 22, clone:LI26. AB002441 288 1.226 120 0.580 2.114 Human alpha-1- antitrypsin (alpha-1-AT) mRNA, 3' end. M26123 243 1.034 101 0.488 2.119 Homo sapiens kallikrein 11 (KLK11), transcript variant 1, mRNA. NM_006853 238 1.013 93 0.449 2.254 Homo sapiens HLA-B associated transcript 1 (BAT1), transcript variant 1, mRNA. NM_004640 1322 5.626 391 1.889 2.978 Homo sapiens, cytochrome P450, subfamily XXVIIA (steroid 27-hydroxylase, cerebrotendinous xanthomatosis), polypeptide 1, clone, mRNA. BC017044 2010 8.553 166 0.802 10.666
115
CHAPTER 3
INTRODUCTION OF AN INITIATOR ELEMENT IN THE
MOUSE THYMIDYLATE SYNTHASE PROMOTER ALTERS
S-PHASE REGULATION BUT HAS NO EFFECT ON
PROMOTER BIDIRECTIONALITY
INTRODUCTION
Biochemical role of Thymidylate Synthase
Thymidylate synthase (TS) catalyzes the reductive methylation of
deoxyuridylic acid (dUMP) to form deoxythymidylic acid (dTMP) in the de novo
biosynthesis of thymidine. Thymidine is then incorporated into the growing DNA strand. TS is an essential enzyme required for cell survival. As a result TS has
been a preferred target for cancer chemotherapy (Lehman, 2002). In fact recent
studies report increased levels of TS in certain cancers, and indications that it
might potentially act as an oncogene as well (Rahman et al., 2004). Hence,
studying the regulation of this gene is important in order to design new or more
effective chemotherapeutic strategies.
116 The mouse TS promoter
The mouse TS promoter (Figure 3.1) is unlike most typical promoters. It does
not have a TATAA box, CCAAT box or an initiator element. It is a GC-rich,
bidirectional promoter exhibiting many transcription initiation sites within a 90nt
window. It has been found that the start site pattern can be condensed by the insertion of the TdT initiator element in the TS promoter region. The insertion of a
TATA box also affects the TSS pattern by eliminating all TSS upstream of it
(Geng and Johnson, 1993). Hence, introduction of both the TATA box and the initiator element might condense the start sites further, maybe into a single start site.
Promoter deletion analyses have mapped the essential core promoter to a
30nt region between -105 and -75 (Geng and Johnson, 1993; Deng et al., 1986).
Several cis-acting elements have been located in this essential promoter region.
There are two GGA boxes at -100 and -85 which are potential binding sites for
the ets transcription factors (ets up and ets down) (Wasylyk et al., 1993). There is
a GC rich Sp1 binding site immediately downstream of Ets down (Sp1 down).
Overlapping the Ets down and Sp1 binding sites is the LSF binding site.
Mutations in these ets and Sp1 sites resulted in a 3-fold decrease in promoter
activity while mutations in the ets up binding site resulted in a 10-fold decrease in
promoter activity (Geng and Johnson, 1993; Jolliff et al., 1991).There is an
additional upstream Sp1 site and a couple of Ets sites downstream of the
essential promoter region. A potential E2F binding site is also present just
upstream of the essential promoter region. Additionally there are 3 Med-1 117 elements found surrounding the ATG. All the cis-acting elements present
surrounding the essential promoter region are not required for TS activity, since
mutation or deletion of these sites had no effect on TS expression (Deng et al.,
1989; Geng and Johnson, 1993; Rudge and Johnson, 1999).
Regulation of the TS gene
TS levels increase 10-20 fold as the cells traverse from the G1-S phase of the
cell cycle (Jenh et al., 1985; Ash et al., 1995c). This increase is due to post-
transcriptional processing and not due to increased transcription since
transcription activity increased less than 2-fold during this time (Ash et al.,
1995b).
The promoter and a spliceable intron are required for S-phase regulation of
the TS gene. Replacement of the TS promoter with the SV40 promoter resulted
in loss of regulation (Li et al., 1991). Similarly, an intronless TS minigene containing the TS promoter region was not S-phase regulated (Ash et al., 1993).
Altering splice donor and acceptor sites such that splicing is inhibited also
resulted in the loss of regulation (Ke et al., 1996). This data suggests that the
promoter and the splicing machinery somehow communicate to execute S-phase
regulation of the TS gene. As discussed earlier, all processes of mRNA
biogenesis are coupled. The CTD of RNA Pol II binds to many factors required
for processing and deposits them at the site of action. Our model for
communication suggests that the binding of processing factors like SR proteins
118 to RNA Pol II CTD might be regulated by a S-phase specific promoter factor (eg:
LSF), which remains inactive (or has low levels of activity) during the G0/G1 phase of the cell cycle. Hence, processing factors cannot be recruited to the transcription complex and the TS transcript is not efficiently processed during the
G0/G1 phase of the cell cycle. When the cell enters S-phase, this factor (LSF) is activated somehow (eg phosphorylation or removal of inhibitory factors) and binds to its cis-element. Binding of LSF to its cis-element might attract binding of processing factors to the PIC which get recruited to the CTD of the transcribing polymerase. These factors would then be transferred to the nascent transcript at the site of action (eg: splice sites) and facilitate processing and/or export of the
TS transcript. This model is illustrated in Figure 3.2.
Since many processing factors are recruited during transcription initiation itself the promoter structure might play an important role in determining the factors that would be recruited to the promoter and hence the transcribing polymerase CTD. Introduction of a TATA box and/or initiator element might potentially change the factors recruited to the promoter for transcription initiation.
Proteins involved in the PIC formation would bind a defined set of interacting proteins including processing factors. This might alter the S-phase regulation of the TS gene.
Promoter Bidirectionality
Traditionally, it was thought that promoters were unidirectional and contained both a TATA box and an initiator element. The TATA box and/or initiator element
119 were presumably responsible for conferring directionality to the promoters.
However, many bi-directional promoters have now been studied. Genome-wide
analysis of the human genome has identified possible bidirectional promoters in
more than 10% of all human genes (Trinklein et al., 2004). These have been
identified based on computational studies only. Promoter bidirectionality has not
been biochemically tested. These promoters were identified based on the
location of genes separated by less than 1000bp. Hence, bidirectional promoters
like the TS promoter which does not have an upstream gene would not be
detected by this approach. Hence, the percentage of genes driven by bidirectional promoters might be more or less than 10%. DNA repair genes
(Adachi and Lieber, 2002), chaperone proteins (Ryan et al., 1997), mitochondrial genes (Hansen et al., 2003b; Orii et al., 1999; Zhang et al., 2003) and a class of
DEAD box RNA helicases (Lee and Song, 2000) are driven by bidirectional
promoters. Several genes encoding housekeeping proteins like dihydrofolate
reductase (DHFR), thymidine kinase (TF), surf, glycerol-3-phosphate
acyltransferase (GPAT), histones H2A/H2B and proliferating cell nuclear antigen
(PCNA) also have bidirectional promoters (Linton et al., 1989; Weichselbraun et
al., 1990; Sturm et al., 1988; Lennard and Fried, 1991; Gavalas et al., 1993;
Rizzo et al., 1990). Some bi-directional promoters have TATAA boxes in both
orientations but most lack TATA box and initiator element in either direction and
stimulate transcriptional initiation at multiple start sites over broad initiation windows. Genome-wide analysis has shown that only 8% of the bidirectional promoters contain a well-defined TATA box on either strand. Also, bidirectional
120 promoters were found to be GC-rich with an average GC content of 66%
(Trinklein et al., 2004).
Normally, a bidirectional promoter is located between two genes, which are
positioned in a head-to-head orientation and are less than 1000 bp apart. The
bidirectional promoter is responsible for transcribing both these genes. Genes
that need to be co-ordinately expressed in a cell eg: to maintain a stoichiometric balance like histone genes (Maxson et al., 1983; Ahn and Gruen, 1999; Albig et al., 1997), genes involved in the same biological pathway like collagen genes
(Momota et al., 1998), genes required for cell cycle point regulation (Guarguaglini et al., 1997) and heat shock genes (Hansen et al., 2003a) are frequently driven by bidirectional promoters.
Upstream transcripts obtained via transcription from the bidirectional TS
promoter have been analyzed and found to lack a significant open reading frame.
This transcript extends into the LINE element found upstream of the TS gene.
Hence, the bidirectional TS promoter does not transcribe a functional RNA in the
upstream direction (Lee and Johnson, 1998). Bidirectionality of the TS promoter
does not seem to have a biological function. This led us to speculate that
promoter bidirectionality is purely due to promoter composition. Since the
promoter lacks the TATA box and the initiator element, it has no obvious cis-
acting elements defining the direction of transcription. Insertion of the TATA box
and/or initiator element might help the transcription machinery orient itself
thereby conferring directionality to the mouse TS promoter.
121 The goal of this project was to determine how changes in the promoter structure (insertion of TATA box and initiator element) would affect start site pattern, promoter bidirectionality and S-phase regulation of the TS gene.
122 MATERIALS AND METHODS
Cell Culture
3T6 cells
3T6 cells (mouse embryonic fibroblast cells) were maintained in Falcon tissue
culture plastic petri dishes in Dulbecco’s Modified Eagle Medium (DMEM,
Invitrogen inc.) supplemented with 10% calf serum (Colorado Serum Company).
0 Cells were incubated at 37 C with 5-10% CO2 and 90% humidity.
V79(ts-) cells
V79 (ts-) are thymidylate synthase-deficient Chinese hamster fibroblast cells
(Nussbaum et al., 1985). These cells were maintained on Falcon tissue culture
plastic petridishes in Dulbecco’s Modified Eagle Medium (DMEM) supplemented
with 10% NuSerum (Collaborative Research) and 10μM thymidine. Cells were
0 incubated at 37 C with 5-10% CO2 and 90% humidity.
Vectors, Minigenes and Transfection
Dual Luc Vector Construction and transient transfections
pRL-CMV was used as the vector backbone. The CMV immediate early
enhancer-promoter, T7 promoter and intron were digested out using Bgl II and
Nhe1. The firefly luciferase gene along with the SV40 polyA signal was digested out of the pGL3 basic vector using Nhe1 and BamH1. The luciferase gene was ligated into the pRL-CMV vector backbone. Dual-Luc vector constructs which
123 have the firefly luciferase gene and the renilla luciferase gene in a head-to-head
orientation were selected after sequencing with GL-primer 2 which binds within
the firefly luciferase gene and is supplied by Promega along with the pGL3 basic
vector.
Wild-type or mutant TS promoter was amplified from the (TI5,6T)lb minigene
using forward primer containing an Xba1 site and reverse primer containing a Bgl
II site. PCR products were ligated into the Dual-Luc vector in between the two
luciferase genes at the Nhe1/BglII sites such that the promoter was oriented in a
5’-3’ position facing the firefly gene. Wild type TS promoter and a TS promoter containing the TATAA box only were also amplified from the (TI5,6T)lb minigene
using forward primers containing an Xba1 site and reverse primer containing a
Nhe1 site. These constructs were ligated into the Dual-Luc vector such that the
promoter could be oriented in the 5’-3’ direction facing the firefly gene or the
renilla gene. All Dual Luc - promoter constructs were verified by sequencing with
GL primer 2.
The CMV promoter-enhancer region was amplified from the pRL-CMV vector
and ligated into the Dual-Luc vector as a unidirectional control. Forward and
reverse PCR primers had an Nhe1 site engineered to ligate the fragment into the
Dual-Luc vector. Primers used were
(forward) 5’GCTCGACGCTAGCTCAATATTGGCCATTAGCCA3’ and
(reverse) 5’GTTGTGTGCTAGCCACTGACTGCGTTAGCAATT3’
V79(ts-) cells were transiently co-transfected with 40ng Dual Luc vector constructs and 10ng SV40-βgal vector using Lipofectamine (Invitrogen) as per
124 the manufacturer’s directions. DNA concentration was made up to 1ug using the carrier plasmid pUC19. Cell lysates were harvested 40-48h post-transfection in
200ul 1X passive lysis buffer.10ul cell lysate was assayed for firefly and renilla luciferase expression using the Dual Luciferase Assay Kit (Promega) as per the manufacturer’s directions. Luminescence was measured in a Lumat LB 9507 luminometer (Berthold Technologies) for 10s each. Expression was normalized to β-galactosidase activity in the same cell extract, which was measured using the Galactolight chemiluminescence kit from Tropix.
(TI5,6T)lb Minigenes and transient transfection
The (TI5,6T)lb minigene contains the TS 5’ region up to –985 bp, TS coding region, TS introns 5 and 6 and the TS polyadenylation signal. The minigenes were tagged by deleting a 57nt BamH1 fragment from exon 3. Wild type, m21(Inr2) and m27(TATAA) minigenes were constructed by Yiping Geng (Geng and Johnson, 1993).
The m21 /Inr2/TATAA (TI5,6T)lb minigene was constructed using the m21(Inr2) (TI5,6T)lb minigene as the parent vector. TATAA box was introduced 90 bases upstream of ATG using the Quick Change Site-Directed Mutagenesis kit
(Stratagene). TTGGA in the parent vector was mutated to TATAA. Primers used are (forward) 5’GGCGGGCTGGTGTATAAGGAAAAGAGCGCC3’ and
(reverse) 3’ CCGCCCGACCACATATTCCTTTTCTCGCGG 5’
Sequences of wild type and mutant TS promoter region are shown in Figure 3.3.
125 0.6ug minigenes were transfected into V79(ts-) cells using lipofectamine as
described by the manufacturer. Cytoplasmic RNA was harvested 40-48h post- transfection using the RNAeasy miniprep kit (Qiagen) as per the manufacturer’s directions.
(TI1,2dT)lb Minigenes and stable transfection
The (TI1,2dT)lb minigene contains the TS 5’ region upto –985 bp, TS coding region, TS intron 1 and internally deleted TS intron 2 and the TS polyadenylation signal. The minigene was tagged by deleting a 57nt BamH1 fragment in exon 3.
200bp of the TS wild type (or mutant) promoter amplified from the Dual-Luc
vector. The primers were designed to introduce Xba1 sites at either end. The 5’
985bp TS promoter region in the minigene was replaced with the 233bp TS
wildtype (or mutant) promoter.
3T6 cells were stably co-transfected with 10-80ug of linearized TS (TI1,2dT)lb minigene and 1μg pSV2neo (Clontech) plasmid using electroporation at 960uF
and 250volts. ≥25 colonies were pooled after 3weeks and maintained as a mass
culture in DMEM+10%CS+400ug/mlG418.
Serum stimulation and qRealTime PCR
3T6 cells stably transfected with the TS-(TI1,2dT)lb minigenes were rested in
DMEM+0.5%CS+400ug/mlG418 for 7 days with medium change every 48h. After
7 days cells were stimulated to reenter the cell cycle by the addition of
DMEM+10%CS+400ug/ml G418. Cytoplasmic RNA was harvested at 0h, 5h, 126 17h or 22h using the RNeasy miniprep kit (Qiagen) as per the manufacturer’s
directions. cDNA was synthesized using the Superscript II first strand cDNA
synthesis kit (Invitrogen) as per the manufacturer’s directions. Minus RT
reactions were incorporated as negative controls.
Primers for quantitative real time PCR were designed to distinguish between
mRNA derived from the minigene and the endogenous TS gene. The forward
primer for TS endogenous mRNA was designed in between the two BamH1 sites
and for the minigene spanning the BamH1 deletion region. The reverse primer
for the minigene spanned the exon-exon junction of exons 3 and 4 to eliminate detection of genomic DNA. The minigene and endogenous primers were
designed such that the PCR product obtained would be of almost the same size
(~120bp) so that an accurate quantitation can be made. RPL4 mRNA was used as the internal control since its levels were found to remain constant through the cell cycle. Primer efficiencies of all 3 primer sets were analyzed and found to be
within 10% of each other, which would allow for accurate comparison and
quantitation. Minigene and endogenous primer specificity was ascertained using
real time PCR. Minigene 2 (MG2) is similar to TS endogenous gene and MG2lb
is similar to TS minigene in that is lacks 57 nt between the BamH1 sites.
Endogenous primers did not yield any product with MG2lb and Minigene primers
did not yield any product with MG2.
HotStarTaq PCR master mix (Qiagen) with Mg++ concentration made up to
3μM was used. SyBr Green (Molecular Probes) was used at a final concentration
127 of 1:125,000 for product detection. Primers were used at a final concentration of
0.25μM. Real-time PCR was performed in 96-well plates using the BioRad iCycler iQ Real-Time Detection System.
Primers used for detection of endogenous TS mRNA are
(Forward) 5’GCTAAAGAATTGTCCTCAAAG3’ and
(Reverse) 5’GGAAACCATAAACTGGGC3’
Mingene mRNA detection
(Forward) 5’GTTTATCAAGGGATCCCG3’ and
(Reverse) 5’CCGAGTAATCTGAATCCAT3’
RPL4 mRNA detection
(Forward) 5’CCTTTGGAAATATGTGTCGTGG3’ and
(Reverse) 5’TTTAGACATCACCAAAGCTGG3’
S1 Nuclease Protection Assay
Cytoplasmic RNA was isolated using the RNeasy miniprep kit (Qiagen) as per the manufacturer’s recommendations. S1 nuclease assays were performed as described previously (Favaloro et al., 1980) with 40ug cytoplasmic RNA and
105cpm of 5’ end labeled 32P probe. The TS 5’ flanking region was either the wildtype or the mutant TS promoter region.
DNA fragments resistant to S1 nuclease digestion were analyzed on a 6% denaturing polyacrylamide gel. The Maxam-Gilbert G-reaction ladders (Maxam and Gilbert, 1977) of the wild type probe were used as size markers. The dried 128 gel was analyzed using a phosphorimager (Molecular Dynamics, Sunnyvale, CA) and by autoradiography.
129 RESULTS
Initiator element and TATAA box condense transcription start sites
The TATA-less and initiator-less mouse TS promoter initiates transcription at
multiple sites from -92 to -14. The absence of a TATA box and/or initiator
element might be responsible for these multiple start sites. To address this possibility, previous studies were done in the lab with the mouse TS promoter
containing the initiator element from the terminal deoxynucleotidyltransferase
(TdT) gene, or a TATAA box. The presence of a synthetic TdT initiator in the
middle of the initiation window at –43, resulted in transcription initiation at a
predominant single site within the initiator element (Geng and Johnson, 1993).
Creation of a TATAA box at –69 led to a decrease in the use of start sites
upstream of it. I wanted to investigate if the presence of both, the TATA box and
initiator element would condense the start sites into a single transcription
initiation site.
In order to analyze this, V79(ts-) cells were transiently transfected with the
(TI5,6T)lb minigenes containing either wildtype TS promoter or TS promoter with
TATAA box and/or initiator element. Cytoplasmic RNA was analyzed by S1-
nuclease protection assay for transcription start sites. As seen before and shown
in Figure 3.4, the initiator element condensed the start sites into a single strong
site and the TATAA box eliminated start sites upstream of it. A new start site was
observed in close proximity to the TATAA box insertion site (indicated by arrows
in Figure 3.4a), not observed in the wildtype pattern. Previous studies of 130 transcription initiation by the TATAA box have shown that transcription generally
initiates 25-30 nucleotides downstream of the TATAA box. A new weak start site was observed approximately 30nt downstream of the TATAA box (indicated by a block arrow in figure 3.4a) indicating that transcription inititation at this site might be directed by the TATAA box. The double mutant showed a combination of these effects, with a single strong start site originating from within the initiator element and a new start site close to the TATAA box and a few additional relatively weak start sites. Since, the initiator element is ~30nt downstream of the
TATAA box in the double mutant; the weak start site directed by the TATAA element in the TATAA only mutant is not detected in the double mutant. This result suggests that the initiator element plays a key role in start site determination and the TATAA box ensures that all transcription initiates downstream of it in addition to directing weak transcription initiation 30nt downstream of it. Hence, the TATAA box might be responsible for imparting some amount of transcriptional directionality to the TS promoter.
Construction of the Dual-Luc vector
In order to study bidirectionality of the TS promoter I constructed the Dual-Luc
vector which would allow the simultaneous analysis of promoter activity in both
directions. The Dual-Luc vector was engineered for this purpose to contain two luciferase genes (firefly luciferase and renilla luciferase) in a head-to-head orientation (Figure 3.5). Both enzymes catalyze bioluminescent reactions
131 wherein substrate conversion is accompanied by light emission. But, since both
enzymes have different substrate requirements it is possible to distinguish
between their respective bioluminescent reactions. Light emitted due to the
activity of enzymes encoded by firefly and renilla genes can be assayed in a
single tube using the Dual-Luc luciferase assay system (Promega).
I cloned the firefly luciferase gene into the pRL-CMV vector backbone
containing the renilla luciferase gene. A bidirectional promoter region cloned in between these two genes could simultaneously drive expression of both genes.
The TS promoter was cloned in between the two genes at the Nhe 1 site.
Constructs containing the promoter oriented in the 5’-3’ direction towards the firefly gene were denoted as “F” and constructs containing the promoter oriented in the 5’-3’ direction towards the renilla gene were denoted as “R”. These constructs were transiently transfected into V79(ts-) cells and firefly and renilla luciferase activity was measured using the Dual-Luc assay system to ascertain promoter directionality.
Since, more than 10% of all human genes have been identified to contain
bidirectional promoters (Trinklein et al., 2004) this construct will prove to be a
valuable tool for the analysis of these promoters.
TATAA box and/or initiator element do not affect bidirectionality
The mouse TS promoter is a bidirectional promoter exhibiting approximately
equal strength in both directions. Since, a gene has not been detected upstream
132 of the TS promoter, the biological significance for the strong bidirectionality of this promoter cannot be accounted for. The TS promoter might be bidirectional due to purely physical reasons, namely absence of a TATAA box and/or initiator element in the promoter region, which are generally thought to be responsible for imparting directionality to the transcription apparatus. Hence, I investigated the roles of the initiator element and/or the TATAA box on promoter bidirectionality.
Wild type TS promoter or TS promoter containing TATAA box and/ or initiator element was cloned in between the two reporter genes of the Dual-Luc vector.
These constructs were transiently transfected into V79(ts-) cells. Cell lysates were assayed for firefly and renilla luciferase expression 40-48 hours post- transfection. Our expectation was that the introduction of TATAA box or initiator element or both might render directionality to the TS promoter. Surprisingly, as shown in Figure 3.6a neither the TATAA box nor the initiator element nor both together had any effect on promoter bidirectionality. As observed previously
(Geng and Johnson, 1993) there was no effect on promoter strength either with the initiator element and/or TATAA box.
V79(ts-) cells were also transfected with control Dual-luc vectors containing the unidirectional CMV promoter-enhancer region driving either the firefly gene or the renilla gene. These constructs displayed unidirectional activity as shown in
Figure 3.6b, confirming that the bi-directional activity observed with the TS promoter constructs was not an artifact of the Dual-Luc vector construction.
133 Initiator element decreases S-phase stimulation of the TS gene
Our model for communication between TS promoter and RNA processing
machinery for the TS gene suggests that RNA processing factors are recruited to
the promoter during the S-phase along with the transcription factors. These
factors are transferred to the RNA polymerase II CTD during transcription leading
to efficient RNA processing and export (Johnson, 1994). This is in agreement
with evidence supporting co-transcriptional processing of pre-mRNA with mature
transcripts being produced through a “mRNA factory” as proposed by
(McCracken et al., 1997b).
If transcription and splicing are interdependent, altering the structure of the
TS promoter might alter the pool of transcription/processing factors being
recruited to the promoter. The presence of the initiator element results in
transcription initiation at a single strong start site. This implies that the initiator
element plays a role in nucleating the transcription apparatus. Its likely that the
pool of factors being recruited via the initiator or their interaction with each other might be altered as compared to those recruited by the wild type TS promoter.
I studied the effects of introducing an initiator element and/or a TATAA box on
the levels of mature TS mRNA in growth stimulated cells. (TI1,2dT)lb minigenes
containing the wild type TS promoter or TS promoter containing TATAA box
and/or initiator element were stably transfected into 3T6 cells. The cells were
synchronized in G0 by serum deprivation and then serum stimulated to re-enter the cell cycle. Cytoplasmic RNA was isolated at different time points within a 24h period and the level of endogenous and minigene expression was analyzed 134 using qReal Time PCR. In agreement with my hypothesis, minigenes containing the initiator element and minigenes containing the initiator element + TATAA box
showed a 3-fold decrease in S-phase stimulation as compared to endogenous
stimulation (Figure 3.7). Minigenes containing the TATAA box only did not
display reduced S-phase stimulation as compared to endogenous TS.
Surprisingly, I could not coax the 3T6 cells stably transfected with TATAA box
(TI1,2dT)lb minigene to undergo complete cell cycle arrest. Their proliferative
activity was greatly reduced in reduced serum, but they never completely
arrested in G0. As a result, the endogenous TS stimulation is only 4-fold after
serum stimulation.
The observed results suggest that the initiator element but not the TATAA box
might alter the promoter biochemistry thereby altering levels of S-phase
stimulation.
135 DISCUSSION
My experiments have led to three major conclusions.
Condensation of start site patterns
The initiator element and the TATAA box condense multiple transcriptional start sites into a single strong start site from within the initiator element and another start site in close proximity to the TATAA box. Additionally, a few other weak start sites are also observed. Previous studies done by Geng and Johnson
(Geng and Johnson, 1993) had shown that insertion of the initiator element at -43 resulted in strong transcription initiation at a single start site from within the initiator element. A new start site was observed in close proximity to the TATA box itself. It is possible that the introduction of an AT-rich region in a relatively
GC-rich promoter results in transcription initiation at this site. A weak start site is also observed ~30nt downstream of the TATAA box. Previous studies in which a
TATA box was centered at -102 resulted in a new start site 30 nucleotides downstream of it (Jolliff et al., 1991). Hence, the inserted TATAA box does recruit
TFIID and initiates transcription 30nt downstream of it. However, presence of the
TATAA box does not eliminate other start sites. In the double mutant, since the initiator is 34nt downstream of the TATAA box (calculated from the 5’T of TATAA to the A+1 of inr), and gives rise to a very strong start site at this location, the weak contribution of TATAA cannot be detected.
136 No effect on bidirectionality
TATAA box and initiator element do not affect bidirectionality of the TS
promoter. This result was extremely surprising. Bidirectional promoters are
present in 10% of all human genes. Only 8% of all bidirectional promoters have a
TATAA box in either orientation (Trinklein et al., 2004) suggesting that the lack of
a TATAA box might be responsible for the bidirectional nature of the promoter.
Albeit, several studies have indicated that the orientation of the TATAA box itself does not determine the direction of transcription initiation. For example, transcription start site from the adenovirus IVa2 promoter is located 210 nucleotides upstream of the ML promoter. Transcription from these promoters occurs on opposite strands (i.e. in opposite directions) although both promoters have a TATAA box in the same direction. It was found that the initiator elements
of these promoters were oriented in opposite directions resulting in the
transcription complex recognizing the initiator in an orientation-dependent fashion
(Carcamo et al., 1990).
Depending upon the promoter, either the TATAA box or the initiator element
or both have been thought to impart transcriptional directionality. I expected that
introduction of one or both elements would make the bidirectional TS promoter
more unidirectional. However, the lack of effect on promoter bidirectionality
suggests that it is likely that transcriptional directionality might be determined by
the location of the TATAA and initiator relative to upstream activator sequences
like the Sp1 and E2F binding sites. Computational detection of transcription start
sites (TSS) by Down and Hubbard (Down and Hubbard, 2002) show that the
137 TATAA box by itself has little or no role in TSS determination. On the other hand,
a TATAA box in combination with flanking GC- rich regions results in a weak
TSS. Inactivation of Sp1 at -130 and -80 individually, results in a 3-fold reduction
in RNA levels suggesting that both of these sites are important for transcription
from the mouse TS promoter (Deng et al., 1989; Jolliff et al., 1991). Since, Sp1
can promote transcription initiation in both directions in the absence of a TATAA
box or initiator element (O'Shea-Greenfield and Smale, 1992) it is possible that if
the initiator element and TATAA box were not located at an optimal distance from
the Sp1 sites, they could not affect transcription initiation directed by Sp1.
Spacing of the TATA box and the initiator element
The spacing between the TATA box and initiator element is critical for these
two elements to function synergistically. When spaced 25nt apart in an in vitro
system these elements exhibited synergistic activity. When the spacing was increased to 30nt or more transcription activation was less efficient (O'Shea-
Greenfield and Smale, 1992). In our system, the TATAA box and Inr element
were spaced 34nt apart. Maybe, changing the spacing might help condense the start sites further or result in an effect on promoter bidirectionality.
Initiator element affects S-phase regulation
The initiator element at -43 (which is >40nt downstream of the essential
promoter region) affects levels of S-phase stimulation of TS mRNA. Serum
stimulation of TS minigenes containing the initiator element was 3-fold lower than
stimulation of wild type TS minigene. Since introduction of the initiator element 138 results in a strong transcription initiation site from within the initiator, it is my
hypothesis that the transcription initiation complex is nucleated by the initiator
element. If this complex is different from the initiation complex nucleated by the
wild type TS promoter, it would alter the subset of processing factors that interact
with the transcription complex. This is turn would alter S-phase regulation of the
TS gene.
Our model for TS regulation suggests that some form of communication
between the promoter and the RNA processing machinery is necessary for
proper regulation of mature TS mRNA production during the G1-S phase transition. In vivo, mRNA processing has been shown to occur co- transcriptionally in Pol II promoters (Bauren et al., 1998; Beyer and Osheim,
1988). Transcription, splicing and cleavage-polyadenylation were first proposed to be coupled through the CTD suggesting the presence of a “mRNA factory” for the production of mature transcripts (McCracken et al., 1997b). It has been since shown that the CTD of RNA polymerase II stimulates capping, polyadenylation and splicing of pre-mRNA (Fong and Bentley, 2001). Promoter structure has been shown to influence alternative splicing of the ED1 exon of the fibronectin gene suggesting that differences in binding sites for basal and regulatory transcription factors plays a role in the alternative splicing of this exon (Cramer et al., 1997). Reciprocally, splicing factors also affect transcriptional levels. All five splicesosomal UsnRNPs has been found to interact with the transcription elongation factor TAT-SF1 and strongly stimulate transcription elongation (Fong and Zhou, 2001c). Considering all these factors, it was not surprising to see an
139 effect on levels of S-phase stimulation with the initiator element. Previous studies by Ash et al (Ash et al., 1995a) have also shown that changes in the TS promoter
region, such as inactivation of the E2F site or the Ets site at -100 and -85 results
in decreased levels of S-phase stimulation.
Diverse promoter recognition complexes have been found within eukaryotic
cells. These contain different combination of TBP- and TAF-like factors that
perform different functions (Muller and Tora, 2004a). Different TAF’s have
different functions and cell-type specificity. TAF6 gets alternatively spliced to
TAF6δ in response to apoptotic stimuli and is recruited into a TFIID-like complex lacking TAF9 (Bell et al., 2001). Hence, depending upon promoter composition and cellular signals, the composition of TFIID is dynamic and changes in living cells. This suggests that depending upon the composition of the TFIID complex recruited to a promoter, it can have different functions, including recognition of promoter elements, interaction with different transcription factors and modulation of responses from activators to PIC (Muller and Tora, 2004b).
Introduction of an initiator element might have changed the TFIID composition
being recruited to the TS promoter which in turn might affect the various
transcription and processing factors being recruited, thus affecting transcription
or post-transcriptional processing of the TS gene. Since TBP requires an AT-rich
region to bind, it is possible that the wild type GC-rich TS-promoter recruits a
TBP-free TAF-containing complex (TFTC) (Hardy et al., 2002). Introduction of an
initiator element results in the recruitment of TFIID via TAF-1 and TAF-2
interaction with the initiator (Hilton and Wang, 2003).
140 Identification of proteins associated with the promoter region
The observed change in S-phase regulation after insertion of an initiator
element is postulated to occur as a result of changes in the factors being
recruited to the transcription complex. It would be very interesting to identify the
proteins associated with the TS wild type promoter and mutated TS promoter.
Identification of proteins would help us delineate the composition of TFIID being
recruited to the wild type and mutant promoters. This would give us further
insights into the regulation of wild type TS gene as well as the role of initiator element and TATA box in recruiting the TFIID complex.
To sum up, transcription is an extremely complex process with a large
number of proteins involved and coupled to all downstream processes including
processing, mRNA export and even translation. All the proteins involved in
mRNA biogenesis closely interact with each other making it a highly fine-tuned
process. Here, I have investigated the role of some promoter elements in
regulating downstream processes. The observed effect might be due to altered
communication between the promoter and the splicing apparatus due a change
in the promoter structure. This might lead to a different set of transcription factors
being recruited to the promoter which in turn might alter the pool of processing
factors being recruited thereby altering processing of the TS RNA.
TS bidirectionality on the other hand might be a function of the essential
promoter region and since no changes were made in this region, no effect was
observed on promoter bidirectionality. Although more than 10% of all human
genes are driven by bidirectional promoters (Trinklein et al., 2004), elements 141 responsible for promoter bidirectionality are yet to be identified. More studies in this area are required to address the question “what makes a promoter bidirectional?”
142 essential promoter region -105 -75 LSF ACGTGGGGGCGGGGTCTGCCACGGATTCTGGCGGCCGGAAGTTTCCCAGCAGGAAGAGGCGGGCTG
Ets Sp1 E2F? Ets Sp1 down down up Ets Ets GTGTTGGAGGAAAAGAGCGCCAGGAAGGTCCTGGTTTTGTCGCTGACTACACTGCTGCCAGACTGCT transcription initiation window Med-1 Med-1
CCGTTATGCTGGTGGTTGGCTCCGAGCTGC +1 Med-1
Figure 3.1: Mouse TS essential promoter region and surrounding elements Figure shows the mouse TS promoter sequence with the essential promoter region and the transcription initiation window designated. Binding sites for various trans-acting factors is indicated.
143 Promoter G0/G1 phase Pol II TS Gene
RNA Inefficient processing No export to the (Transcription rate remains cytoplasm constant) RNA degraded in nucleus
Promoter S phase Pol II TS
= RNA processing factor Efficient processing Export to the cytoplasm (stable)
Figure 3.2: Model for communication between TS promoter and RNA processing machinery See text for details
144 Figure 3.3: Mouse TS wild type and mutant promoter sequences
a) Wild type TS promoter b) TS promoter containing the TATAA box at -69 c) TS promoter containing the TdT initiator sequence at -43 d) TS promoter containing the TATAA box at -90 and the initiator element -69. Nucleotide positions and the essential promoter region are indicated. (*) indicates the Adenine at which transcription initiates predominantly directed by the TdT initiator sequence.
a) Essential promoter region
ACGTGGGGGCGGGGTCTGCCACGGATTCTGGCGGCCGGAAGTTTCCCAGCAGGAAGAGGCG 145 -105 -75
GGCTGGTGTTGGAGGAAAAGAGCGCCAGGAAGGTCCTGGTTTTGTCGCTGACTACACTGCTG
CCAGACTGCTCCGTTATG +1
b) Essential promoter region
ACGTGGGGGCGGGGTCTGCCACGGATTCTGGCGGCCGGAAGTTTCCCAGCAGGAAGAGGCG -105 -75
GGCTGGTGTATAAGGAAAAGAGCGCCAGGA AGGTCCTGGTTTTGTCGCTGACTACACTGCTG
CCAGACTGCTCCGTTATG +1 c) Essential promoter region
ACGTGGGGGCGGGGTCTGCCACGGATTCTGGCGGCCGGAAGTTTCCCAGCAGGAAGAGGCG -105 -75 * GGCTGGTGTTGGAGGAAAAGAGCGCCAGGAAGCTAGCCCTCATTCTGGAGACGCTAGCGGTT
-68 -57 -43 TTGTCGCTGACTACACTGCTGCCAGACTGCTCCGTTATG +1
d) Essential promoter region
ACGTGGGGGCGGGGTCTGCCACGGATTCTGGCGGCCGGAAGTTTCCCAGCAGGAAGAGGCG -105 -75 * GGCTGGTGTATAAGGAAAAGAGCGCCAGGA AGCTAGCCCTCATTCTGGAGACGCTAGCGGTT
-90 -68 -57 -43
TTGTCGCTGACTA CACTGCTGCCAGACTGCTCCGTTATG +1
146 Figure 3.4: Initiator element and TATAA box condense start sites V79 (ts-) cells were transiently transfected with the (TI5,6T)lb minigenes containing wildtype TS promoter or TS promoter with the indicated mutations. Cytoplasmic RNA harvested 40-48h post-transfection was subjected to S1 nuclease protection assay with a 5’ 32P-labeled probe derived from each minigene used for transfection. Maxam-Gilbert G-reaction ladders of wild type probes were used to indicate positions of G-residues. Panel A shows the effect of the TATA box and/or initiator element on transcription initiation patterns. Positions of TdT initiator insertion and TATAA box mutation are indicated. Arrows indicate the new start site created due to the creation of a TATAA box in close proximity to the TATAA box. The block arrow indicates another start site ~30nt downstream of the TATAA box. Panel B shows the positive and negative controls. Cytoplasmic RNA isolated from V79 (ts-) cells was used as the negative control and 3T6 cytoplasmic RNA was used as the positive control.
147 Xba (-233) BamH1 (+262)
TS 5’ Flanking region TS coding region + introns 5 and 6 * Probe
a)
-92 TATAA (-90) -75 TATAA (-69)
-55 Inr (-43 to -68) -42 -32 -23 -14
-4
+4
25 bp DNA ladder Inr/TATA Inr TATA WT G-reaction b)
-92
-55
-23
-4
V79 (ts-) 3T6 G-reaction
148 R Luc F Luc
Nhe 1 Bgl II F R
Figure 3.5: Construction of the Dual-Luc vector Luciferase gene was cloned into the pRL-CMV vector backbone containing the renilla gene. The two genes were cloned in a head-to-head confirmation such that a promoter region can be cloned in between the two reporter genes facing either the firefly gene or the renilla gene. Promoters facing the firefly gene are denoted as “F” and promoters facing the renilla gene are denoted as “R.”
149 Figure 3.6: TATAA box and/or initiator element do not affect the bi- directional nature of the TS promoter. 1a) V79 (ts-) cells were transiently transfected with the Dual Luc-TS vectors, which contained either the wildtype TS promoter region or TS promoter containing the TATAA box and/or initiator element. Promoter constructs facing the firefly gene are denoted as “F”. Promoter constructs facing the renilla gene are denoted as “R”. Cell lysate was harvested 24 hours post-transfection and analyzed for firefly and renilla luciferase expression using the Dual-Luciferase assay kit. Data was normalized to β-gal expression and then to the wild type promoter activity which was set to 100 1b) shows V79 (ts-) cells transfected with Dual-Luc-CMV vectors which contained the CMV Promoter-Enhancer region driving either the firefly gene or the Renilla gene. Transfections and analysis done as in Figure 1(a)
150
a)
300
250
200
Firef ly 150 Renilla
100
50
0 Wt (F) Inr (F) Inr- TATAA Wt (R) TATAA TATAA (F) (R) (F)
b)
140
120
100
80 Firefly Renilla 60 Fold ChangeFold
40
20
0 F R
151 Figure 3.7: Initiator element diminishes S-phase stimulation of TS by 3-fold
A) Primers used for TS minigene and TS endogenous detection by realtime PCR. i) Endogenous primer locations. The forward primer lies within the BamH1 deletion fragment and the reverse primer spans exons 3 and 4. ii) Minigene primer locations. The forward primer spans the BamH1 deletion and the reverse primer spans exons 3 and 4. Solid arrow depicts the TS cDNA, which has 7 exons. Primers are represented by dotted arrows. B) 3T6 cells were stably transfected with (TI1,2dT)lb minigenes containing either the wildtype TS promoter or TS promoter containing the Initiator element and/or TATAA box. ≥25 colonies were pooled as a cell line. Cells were synchronized in G0 for a week and then stimulated to enter the cell cycle. Cytoplasmic RNA was harvested at the indicated time points and analyzed for minigene and endogenous TS expression using qReal-time PCR. Data was normalized to RPL4. Data shown here represents a single cell line. Each cell line was stimulated at least 3-times and at least 3 independent batches of cDNA were synthesized from each batch of RNA. At least 2 different stable cell lines were created with each minigene.
152 A) i) BamH1 deletion E1 E2 E3 E4 E5
ii) BamH1 deletion
E1 E2 E3 E4 E5
B) i)
Wild type
16 14 12 10 TS Mini 8 TS Endo d Change 6 Fol 4 2 0 0102030 Time (hours)
ii)
Initiator Element
18
15
12
9 TS mini TS endo 6 Fold increase 3
0 0 102030 Time (hours)
153 iii)
Initiator Element + TATAA box
21
18
15
12 TS Mini TS Endo 9
6 Fold Increase
3
0 0 5 10 15 20 25 Time (hours)
iv)
TATAA box
6
5
4
TS Mini 3 TS Endo
2 Fold changeFold
1
0 0 5 10 15 20 25 Time (hours)
154
BIBLIOGRAPHY
1. Adachi,N. and Lieber,M.R. (2002). Bidirectional Gene Organization: A Common Architectural Feature of the Human Genome. Cell 109, 807-809.
2. Adra,C.N., Donato,J.L., Badovinac,R., Syed,F., Kheraj,R., Cai,H., Moran,C., Kolker,M.T., Turner,H., Weremowicz,S., Shirakawa,T., Morton,C.C., Schnipper,L.E., and Drews,R. (2000). SMARCAD1, a novel human helicase family-defining member associated with genetic instability: cloning, expression, and mapping to 4q22-q23, a band rich in breakpoints and deletion mutants involved in several human diseases. Genomics 69, 162- 173.
3. Ahn,J. and Gruen,J.R. (1999). The genomic organization of the histone clusters on human 6p21.3. Mamm. Genome 10, 768-770.
4. Albig,W., Kioschis,P., Poustka,A., Meergans,K., and Doenecke,D. (1997). Human histone gene organization: nonregular arrangement within a large cluster. Genomics 40, 314-322.
5. Amler,L.C., Schurmann,J., and Schwab,M. (1996). The DDX1 gene maps within 400 kbp 5' to MYCN and is frequently coamplified in human neuroblastoma. Genes Chromosomes Cancer 15, 134-137.
6. Anderson,J.S. and Parker,R.P. (1998). The 3' to 5' degradation of yeast mRNAs is a general mechanism for mRNA turnover that requires the SKI2 DEVH box protein and 3' to 5' exonucleases of the exosome complex. EMBO J 17, 1497-1506.
7. Aravind,L. and Koonin,E.V. (2000). Eukaryote-specific domains in translation initiation factors: implications for translation regulation and evolution of the translation system. Genome Res. 10, 1172-1184.
8. Ash,J., Ke,Y., Korb,M., and Johnson,L.F. (1993). Introns are essential for growth-regulated expression of the mouse thymidylate synthase gene. Mol. Cell. Biol. 13, 1565-1571.
9. Ash,J., Liao,W.C., Ke,Y., and Johnson,L.F. (1995c). Regulation of mouse thymidylate synthase gene expression in growth-stimulated cells: upstream S phase control elements are indistinguishable from the essential promoter elements. Nucleic Acids Res. 23, 4649-4656.
155 10. Ash,J., Liao,W.C., Ke,Y., and Johnson,L.F. (1995b). Regulation of mouse thymidylate synthase gene expression in growth-stimulated cells: upstream S phase control elements are indistinguishable from the essential promoter elements. Nucleic Acids Res. 23, 4649-4656.
11. Ash,J., Liao,W.C., Ke,Y., and Johnson,L.F. (1995a). Regulation of mouse thymidylate synthase gene expression in growth-stimulated cells: upstream S phase control elements are indistinguishable from the essential promoter elements. Nucleic Acids Res. 23, 4649-4656.
1 2. Barilla,D., Lee,B.A., and Proudfoot,N.J. (2001). Cleavage/polyadenylation factor IA associates with the carboxyl-terminal domain of RNA polymerase II in Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. U. S. A 98, 445-450.
13. Bauren,G., Belikov,S., and Wieslander,L. (1998). Transcriptional termination in the Balbiani ring 1 gene is closely coupled to 3'-end formation and excision of the 3'-terminal intron. Genes Dev. 12, 2759-2769.
14. Bell,B., Scheer,E., and Tora,L. (2001). Identification of hTAF(II)80 delta links apoptotic signaling pathways to transcription factor TFIID function. Mol. Cell 8, 591-600.
15. Bentley,D. (2002). The mRNA assembly line: transcription and processing machines in the same factory. Curr. Opin. Cell Biol. 14, 336-342.
16. Berglund,J.A., Abovich,N., and Rosbash,M. (1998). A cooperative interaction between U2AF65 and mBBP/SF1 facilitates branchpoint regionárecognition. Genes Dev. 12, 858-867.
17. Berk,A.J. (2000). TBP-like factors come into focus. Cell 103, 5-8.
1 8. Beyer,A.L. and Osheim,Y.N. (1988). Splice site selection, rate of splicing, and alternative splicing on nascent transcripts. Genes Dev. 2, 754-765.
19. Bono,F., Ebert,J., Unterholzner,L., Guttler,T., Izaurralde,E., and Conti,E. (2004). Molecular insights into the interaction of PYM with the Mago-Y14 core of the exon junction complex. EMBO Rep. 5, 304-310.
20. Brandeis,M., Frank,D., Keshet,I., Siegfried,Z., Mendelsohn,M., Nemes,A., Temper,V., Razin,A., and Cedar,H. (1994). Sp1 elements protect a CpG island from de novo methylation. Nature 371, 435-438.
21. Burke,T.W. and Kadonaga,J.T. (1996). Drosophila TFIID binds to a conserved downstream basal promoter element that is present in many TATA-box-deficient promoters. G&D 10, 711-724.
22. Burke,T.W. and Kadonaga,J.T. (1997). The downstream core promoter element, DPE, is conserved from Drosophila to humans and is recognized by TAFII60 of Drosophila. Genes Dev. 11, 3020-3031.
156 23. Butler,J.E. and Kadonaga,J.T. (2002). The RNA polymerase II core promoter: a key component in the regulation of gene expression. Genes Dev. 16, 2583-2592.
24. Carcamo,J., Maldonado,E., Ahn,M., Ha,I., Kasai,Y., Flint,J., and Reinberg,D. (1991). The initiator directs the assembly of a transcription factor IID- dependent transcription complex. Proc. Natl. Acad. Sci. USA 88, 8052-8056.
25. Carcamo,J., Maldonado,E., Cortes,P., Ahn,M.H., Ha,I., Kasai,Y., Flint,J., and Reinberg,D. (1990). A TATA-like sequence located downstream of the transcription initiation site is required for expression of an RNA polymerase II transcribed gene. Genes Dev. 4, 1611-1622.
26. Caruthers,J.M., Johnson,E.R., and McKay,D.B. (2000). Crystal structure of yeast initiation factor 4A, a DEAD-box RNA helicase. Proc. Natl. Acad. Sci. U. S. A 97, 13080-13085.
27. Caruthers,J.M. and McKay,D.B. (2002a). Helicase structure and mechanism. Curr. Opin. Struct. Biol. 12, 123-133.
28. Caruthers,J.M. and McKay,D.B. (2002b). Helicase structure and mechanism. Curr. Opin. Struct. Biol. 12, 123-133.
29. Causevic,M., Hislop,R.G., Kernohan,N.M., Carey,F.A., Kay,R.A., Steele,R.J., and Fuller-Pace,F.V. (2001). Overexpression and poly-ubiquitylation of the DEAD-box RNA helicase p68 in colorectal tumours. Oncogene 20, 7734- 7743.
30. Chalkley,G.E. and Verrijzer,C.P. (1999). DNA binding site selection by RNA polymerase II TAFs: a TAF(II)250-TAF(II)150 complex recognizes the initiator. EMBO J 18, 4835-4845.
31. Chan,C.C., Dostie,J., Diem,M.D., Feng,W., Mann,M., Rappsilber,J., and Dreyfuss,G. (2004). eIF4A3 is a novel component of the exon junction complex. RNA. 10, 200-209.
32. Chen,J.Y., Stands,L., Staley,J.P., Jackups,R.R., Jr., Latus,L.J., and Chang,T.H. (2001). Specific alterations of U1-C protein or U1 small nuclear RNA can eliminate the requirement of Prp28p, an essential DEAD box splicing factor. Mol. Cell 7, 227-232.
33. Cheriyath,V., Novina,C.D., and Roy,A.L. (1998). TFII-I regulates Vbeta promoter activity through an initiator element. Mol. Cell Biol. 18, 4444-4454.
34. Chiu,Y.L., Coronel,E., Ho,C.K., Shuman,S., and Rana,T.M. (2001). HIV-1 Tat Protein Interacts with Mammalian Capping Enzyme and Stimulates Capping of TAR RNA. J. Biol. Chem. 276, 12959-12966.
157 35. Cho,E.J., Takagi,T., Moore,C.R., and Buratowski,S. (1997). mRNA capping enzyme is recruited to the transcription complex by phosphorylation of the RNA polymerase II carboxy-terminaládomain. Genes Dev. 11, 3319-3326.
36. Chuang,R.Y., Weaver,P.L., Liu,Z., and Chang,T.H. (1997). Requirement of the DEAD-Box protein ded1p for messenger RNA translation. Science 275, 1468-1471.
37. Colgan,D.F. and Manley,J.L. (1997). Mechanism and regulation of mRNA polyadenylation. Genes Dev. 11, 2755-2766.
38. Coller,J.M., Tucker,M., Sheth,U., Valencia-Sanchez,M.A., and Parker,R. (2001). The DEAD box helicase, Dhh1p, functions in mRNA decapping and interacts with both the decapping and deadenylase complexes. RNA. 7, 1717-1727.
39. Cramer,P., Pesce,C.G., Baralle,F.E., and Kornblihtt,A.R. (1997). Functional association between promoter structure and transcript alternative splicing. Proc. Natl. Acad. Sci. USA 94, 11456-11460.
40. Czaplinski,K., Ruiz-Echevarria,M.J., Paushkin,S.V., Han,X., Weng,Y., Perlick,H.A., Dietz,H.C., Ter Avanesyan,M.D., and Peltz,S.W. (1998b). The surveillance complex interacts with the translation release factors to enhance termination and degrade aberrant mRNAs. Genes Dev. 12, 1665- 1677.
41. Czapli nski,K., Ruiz-Echevarria,M.J., Paushkin,S.V., Han,X., Weng,Y., Perlick,H.A., Dietz,H.C., Ter Avanesyan,M.D., and Peltz,S.W. (1998a). The surveillance complex interacts with the translation release factors to enhance termination and degrade aberrant mRNAs. Genes Dev. 12, 1665- 1677.
42. Davies,R.C., Calvio,C., Bratt,E., Larsson,S.H., Lamond,A.I., and Hastie,N.D. (1998). WT1 interacts with the splicing factor U2AF65 in an isoform- dependent manner and can be incorporated into spliceosomes. Genes Dev. 12, 3217-3225.
43. de La,C.J., Kressler,D., and Linder,P. (1999e). Unwinding RNA in Saccharomyces cerevisiae: DEAD-box proteins and related families. Trends Biochem. Sci. 24, 192-198.
44. de La,C.J., Kressler,D., and Linder,P. (1999a). Unwinding RNA in Saccharomyces cerevisiae: DEAD-box proteins and related families. Trends Biochem. Sci. 24, 192-198.
45. de La,C.J., Kressler,D., and Linder,P. (1999b). Unwinding RNA in Saccharomyces cerevisiae: DEAD-box proteins and related families. Trends Biochem. Sci. 24, 192-198.
158 46. de La,C.J., Kressler,D., and Linder,P. (1999f). Unwinding RNA in Saccharomyces cerevisiae: DEAD-box proteins and related families. Trends Biochem. Sci. 24, 192-198.
47. de La,C.J., Kressler,D., and Linder,P. (1999d). Unwinding RNA in Saccharomyces cerevisiae: DEAD-box proteins and related families. Trends Biochem. Sci. 24, 192-198.
48. de La,C.J., Kressler,D., and Linder,P. (1999c). Unwinding RNA in Saccharomyces cerevisiae: DEAD-box proteins and related families. Trends Biochem. Sci. 24, 192-198.
49. de La,C.J., Kressler,D., Tollervey,D., and Linder,P. (1998). Dob1p (Mtr4p) is a putative ATP-dependent RNA helicase required for the 3' end formation of 5.8S rRNA in Saccharomyces cerevisiae. EMBO J. 17, 1128-1140.
50. de Vries,H., Ruegsegger,U., Hubner,W., Friedlein,A., Langen,H., and Keller,W. (2000). Human pre-mRNA cleavage factor II(m) contains homologs of yeast proteins and bridges two other cleavage factors. EMBO J 19, 5895-5904.
51. Deng,T., Li,D., Jenh,C.-H., and Johnson,L.F. (1986). Structure of the gene for mouse thymidylate synthase: Locations of introns and multiple transcriptional start sites. J. Biol. Chem. 261, 16000-16005.
52. Deng,T., Li,Y., Jolliff,K., and Johnson,L.F. (1989). The mouse thymidylate synthase promoter: essential elements are in close proximity to the transcriptional initiation sites. Mol. Cell. Biol. 9, 4079-4082.
53. Dostie,J. and Dreyfuss,G. (2002). Translation is required to remove Y14 from mRNAs in the cytoplasm. Curr. Biol. 12, 1060-1067.
54. Dower,K. and Rosbash,M. (2002). T7 RNA polymerase-directed transcripts are processed in yeast and link 3' end formation to mRNA nuclear export. RNA. 8, 686-697.
55. Down,T.A. and Hubbard,T.J.P. (2002). Computational Detection and Location of Transcription Start Sites in Mammalian Genomic DNA. Genome Res. 12, 458-461.
56. Du,M.X., Johnson,R.B., Sun,X.L., Staschke,K.A., Colacino,J., and Wang,Q.M. (2002). Comparative characterization of two DEAD-box RNA helicases in superfamily II: human translation-initiation factor 4A and hepatitis C virus non-structural protein 3 (NS3) helicase. Biochem. J 363, 147-155.
57. Dvir,A., Conaway,J.W., and Conaway,R.C. (2001). Mechanism of transcription initiation and promoter escape by RNA polymerase II. Curr. Opin. Genet. Dev. 11, 209-214.
159 58. Eisen,A. and Lucchesi,J.C. (1998). Unraveling the role of helicases in transcription. BioEssays 20, 634-641.
59. Estruch,F. and Cole,C.N. (2003). An early function during transcription for the yeast mRNA export factor Dbp5p/Rat8p suggested by its genetic and physical interactions with transcription factor IIH components. Mol. Biol. Cell 14, 1664-1676.
60. Evans,R., Fairley,J.A., and Roberts,S.G. (2001). Activator-mediated disruption of sequence-specific DNA contacts by the general transcription factor TFIIB. Genes Dev. 15, 2945-2949.
61. Favaloro,J., Treisman,R., and Kamen,R. (1980). Transcription maps of polyoma virus-specific RNA: Analysis by two-dimensional nuclease S1 gel mapping. Meth. Enzymol. 65, 718-749.
62. Fischer,T., Strasser,K., Racz,A., Rodriguez-Navarro,S., Oppizzi,M., Ihrig,P., Lechner,J., and Hurt,E. (2002). The mRNA export machinery requires the novel Sac3p-Thp1p complex to dock at the nucleoplasmic entrance of the nuclear pores. EMBO J 21, 5843-5852.
63. Flaherty,S.M., Fortes,P., Izaurralde,E., Mattaj,I.W., and Gilmartin,G.M. (1997). Participation of the nuclear cap binding complex in pre-mRNA 3' processing. Proc. Natl. Acad. Sci. U. S. A 94, 11893-11898.
64. Fleckner,J., Zhang,M., Valcarcel,J., and Green,M.R. (1997b). U2AF65 recruits a novel human DEAD box protein required for the U2 snRNP- branchpoint interaction. Genes Dev. 11, 1864-1872.
65. Fleckner,J., Zhang,M., Valcarcel,J., and Green,M.R. (1997a). U2AF65 recruits a novel human DEAD box protein required for the U2 snRNP- branchpoint interaction. Genes Dev. 11, 1864-1872.
66. Fong,N. and Bentley,D.L. (2001). Capping, splicing, and 3' processing are independently stimulated by RNA polymerase II: different functions for different segments of the CTD. Genes Dev. 15, 1783-1795.
67. Fong,Y.W. and Zhou,Q. (2001a). Stimulatory effect of splicing factors on transcriptional elongation. Nature 414, 929-933.
68. Fong,Y.W. and Zhou,Q. (2001c). Stimulatory effect of splicing factors on transcriptional elongation. Nature 414, 929-933.
69. Fong,Y.W. and Zhou,Q. (2001b). Stimulatory effect of splicing factors on transcriptional elongation. Nature 414, 929-933.
70. Gallardo,M. and Aguilera,A. (2001). A new hyperrecombination mutation identifies a novel yeast gene, THP1, connecting transcription elongation with mitotic recombination. Genetics 157, 79-89.
160 71. Gatfield,D. and Izaurralde,E. (2002a). REF1/Aly and the additional exon junction complex proteins are dispensable for nuclear mRNA export. J. Cell Biol. 159, 579-588.
72. Gatfield,D. and Izaurralde,E. (2002c). REF1/Aly and the additional exon junction complex proteins are dispensable for nuclear mRNA export. J. Cell Biol. 159, 579-588.
73. Gatfield,D. and Izaurralde,E. (2002b). REF1/Aly and the additional exon junction complex proteins are dispensable for nuclear mRNA export. J. Cell Biol. 159, 579-588.
74. Gatfield,D. and Izaurralde,E. (2002d). REF1/Aly and the additional exon junction complex proteins are dispensable for nuclear mRNA export. J. Cell Biol. 159, 579-588.
75. Gatfield,D., Le Hir,H., Schmitt,C., Braun,I.C., Kocher,T., Wilm,M., and Izaurralde,E. (2001i). The DExH/D box protein HEL/UAP56 is essential for mRNA nuclear export in Drosophila. Curr. Biol. 11, 1716-1721.
76. Gatfield,D., Le Hir,H., Schmitt,C., Braun,I.C., Kocher,T., Wilm,M., and Izaurralde,E. (2001b). The DExH/D box protein HEL/UAP56 is essential for mRNA nuclear export in Drosophila. Curr. Biol. 11, 1716-1721.
77. Gatfield,D., Le Hir,H., Schmitt,C., Braun,I.C., Kocher,T., Wilm,M., and Izaurralde,E. (2001c). The DExH/D box protein HEL/UAP56 is essential for mRNA nuclear export in Drosophila. Curr. Biol. 11, 1716-1721.
78. Gatfield,D., Le Hir,H., Schmitt,C., Braun,I.C., Kocher,T., Wilm,M., and Izaurralde,E. (2001d). The DExH/D box protein HEL/UAP56 is essential for mRNA nuclear export in Drosophila. Curr. Biol. 11, 1716-1721.
79. Gatfield,D., Le Hir,H., Schmitt,C., Braun,I.C., Kocher,T., Wilm,M., and Izaurralde,E. (2001e). The DExH/D box protein HEL/UAP56 is essential for mRNA nuclear export in Drosophila. Curr. Biol. 11, 1716-1721.
80. Gatfield,D., Le Hir,H., Schmitt,C., Braun,I.C., Kocher,T., Wilm,M., and Izaurralde,E. (2001f). The DExH/D box protein HEL/UAP56 is essential for mRNA nuclear export in Drosophila. Curr. Biol. 11, 1716-1721.
81. Gatfield,D., Le Hir,H., Schmitt,C., Braun,I.C., Kocher,T., Wilm,M., and Izaurralde,E. (2001g). The DExH/D box protein HEL/UAP56 is essential for mRNA nuclear export in Drosophila. Curr. Biol. 11, 1716-1721.
82. Gatfield,D., Le Hir,H., Schmitt,C., Braun,I.C., Kocher,T., Wilm,M., and Izaurralde,E. (2001h). The DExH/D box protein HEL/UAP56 is essential for mRNA nuclear export in Drosophila. Curr. Biol. 11, 1716-1721.
161 83. Gatfield,D., Le Hir,H., Schmitt,C., Braun,I.C., Kocher,T., Wilm,M., and Izaurralde,E. (2001a). The DExH/D box protein HEL/UAP56 is essential for mRNA nuclear export in Drosophila. Curr. Biol. 11, 1716-1721.
84. Gatfield,D., Le Hir,H., Schmitt,C., Braun,I.C., Kocher,T., Wilm,M., and Izaurralde,E. (2001j). The DExH/D box protein HEL/UAP56 is essential for mRNA nuclear export in Drosophila. Curr. Biol. 11, 1716-1721.
85. Gavalas,A., Dixon,J.E., Brayton,K.A., and Zalkin,H. (1993). Coexpression of two closely linked avian genes for purine nucleotide synthesis from a bidirectional promoter. Mol. Cell. Biol. 13, 4784-4792.
86. Gehring,N.H., Neu-Yilik,G., Schell,T., Hentze,M.W., and Kulozik,A.E. (2003). Y14 and hUpf3b form an NMD-activating complex. Mol. Cell 11, 939-949.
87. Geng,Y. and Johnson,L.F. (1993). Lack of an initiator element is responsible for multiple transcriptional initiation sites of the TATA-less mouse thymidylate synthase promoter. Mol. Cell. Biol. 13, 4894-4903.
88. Gilbert,W. and Guthrie,C. (2004). The Glc7p nuclear phosphatase promotes mRNA export by facilitating association of Mex67p with mRNA. Mol. Cell 13, 201-212.
89. Godbout,R., Packer,M., and Bie,W. (1998). Overexpression of a DEAD Box Protein (DDX1) in Neuroblastoma and Retinoblastoma Cell Lines. J. Biol. Chem. 273, 21161-21168.
90. Gorbalenya,A.E. and Koonin,E.V. (1988). One more conserved sequence motif in helicases. Nucleic Acids Res. 16, 7734.
91. Gorbalenya,A.E., Koonin,E.V., Donchenko,A.P., and Blinov,V.M. (1988). A conserved NTP-motif in putative helicases. Nature 333, 22.
92. Gorbalenya,A.E., Koonin,E.V., Donchenko,A.P., and Blinov,V.M. (1989). Two related superfamilies of putative helicases involved in replication, recombination, repair and expression of DNA and RNA genomes. Nucleic Acids Res. 17, 4713-4730.
93. Grallert,B., Kearsey,S.E., Lenhard,M., Carlson,C.R., Nurse,P., Boye,E., and Labib,K. (2000). A fission yeast general translation factor reveals links between protein synthesis and cell cycle controls. J Cell Sci. 113 ( Pt 8), 1447-1458.
94. Green,D.M., Johnson,C.P., Hagan,H., and Corbett,A.H. (2003). The C- terminal domain of myosin-like protein 1 (Mlp1p) is a docking site for heterogeneous nuclear ribonucleoproteins that are required for mRNA export. Proc. Natl. Acad. Sci. U. S. A 100, 1010-1015.
95. Green,D.M., Marfatia,K.A., Crafton,E.B., Zhang,X., Cheng,X., and Corbett,A.H. (2002). Nab2p is required for poly(A) RNA export in 162 Saccharomyces cerevisiae and is regulated by arginine methylation via Hmt1p. J Biol. Chem. 277, 7752-7760.
96. Greenleaf,A.L. (1993). Positive patches and negative noodles: linking RNA processing to transcription. Trends Biochem. Sci. 18, 117-119.
97. Guarguaglini,G., Battistoni,A., Pittoggi,C., Di Matteo,G., Di Fiore,B., and Lavia,P. (1997). Expression of the murine RanBP1 and Htf9-c genes is regulated from a shared bidirectional promoter during cell cycle progression. Biochem. J 325 ( Pt 1), 277-286.
98. Gunderson,S.I., Polycarpou-Schwarz,M., and Mattaj,I.W. (1998). U1 snRNP inhibits pre-mRNA polyadenylation through a direct interaction between U1 70K and poly(A) polymerase. Mol. Cell 1, 255-264.
99. Hachet,O. and Ephrussi,A. (2001). Drosophila Y14 shuttles to the posterior of the oocyte and is required for oskar mRNA transport. Curr. Biol. 11, 1666-1674.
1 00. Hachet,O. and Ephrussi,A. (2004). Splicing of oskar RNA in the nucleus is coupled to its cytoplasmic localization. Nature 428, 959-963.
101. Hahn,S., Buratowski,S., Sharp,P.A., and Guarente,L. (1989). Yeast TATA- binding protein TFIID binds to TATA elements with both consensus and nonconsensus DNA sequences. Proc. Natl. Acad. Sci. U. S. A 86, 5718- 5722.
1 02. Hammell,C.M., Gross,S., Zenklusen,D., Heath,C.V., Stutz,F., Moore,C., and Cole,C.N. (2002). Coupling of termination, 3' processing, and mRNA export. Mol. Cell Biol. 22, 6441-6457.
103. Hampsey,M. (1998). Molecular genetics of the RNA polymerase II general transcriptional machinery. Microbiol. Mol. Biol. Rev. 62, 465-503.
104. Hansen,J.J., Bross,P., Westergaard,M., Nielsen,M.N., Eiberg,H., Borglum,A.D., Mogensen,J., Kristiansen,K., Bolund,L., and Gregersen,N. (2003a). Genomic structure of the human mitochondrial chaperonin genes: HSP60 and HSP10 are localised head to head on chromosome 2 separated by a bidirectional promoter. Hum. Genet. 112, 71-77.
105. Hansen,J.J., Bross,P., Westergaard,M., Nielsen,M.N., Eiberg,H., Borglum,A.D., Mogensen,J., Kristiansen,K., Bolund,L., and Gregersen,N. (2003b). Genomic structure of the human mitochondrial chaperonin genes: HSP60 and HSP10 are localised head to head on chromosome 2 separated by a bidirectional promoter. Hum. Genet. 112, 71-77.
106. Hardy,S., Brand,M., Mittler,G., Yanagisawa,J., Kato,S., Meisterernst,M., and Tora,L. (2002). TATA-binding protein-free TAF-containing complex (TFTC) and p300 are both required for efficient transcriptional activation. J Biol. Chem. 277, 32875-32882. 163 107. He,F. and Jacobson,A. (1995). Identification of a novel component of the nonsense-mediated mRNA decay pathway by use of an interacting protein screen. Genes Dev. 9, 437-454.
108. Hector,R.E., Nykamp,K.R., Dheur,S., Anderson,J.T., Non,P.J., Urbinati,C.R., Wilson,S.M., Minvielle-Sebastia,L., and Swanson,M.S. (2002). Dual requirement for yeast hnRNP Nab2p in mRNA poly(A) tail length control and nuclear export. EMBO J 21, 1800-1810.
109. Herold,A., Teixeira,L., and Izaurralde,E. (2003). Genome-wide analysis of nuclear mRNA export pathways in Drosophila. EMBO J. 22, 2472-2483.
110. Hilton,T.L. and Wang,E.H. (2003). Transcription factor IID recruitment and Sp1 activation. Dual function of TAF1 in cyclin D1 transcription. J Biol. Chem. 278, 12992-13002.
111. Hirose,Y. and Manley,J.L. (1998). RNA polymerase II is an essential mRNA polyadenylation factor. Nature (London) 395, 93-96.
112. Hirose,Y. and Manley,J.L. (2000). RNA polymerase II and the integration of nuclear events. Genes Dev. 14, 1415-1429.
113. Ho,C.K. and Shuman,S. (1999). Distinct roles for CTD Ser-2 and Ser-5 phosphorylation in the recruitment and allosteric activation of mammalian mRNA capping enzyme. Mol. Cell 3, 405-411.
114. Huang,Y., Gattoni,R., Stevenin,J., and Steitz,J.A. (2003). SR splicing factors serve as adapter proteins for TAP-dependent mRNA export. Mol. Cell 11, 837-843.
115. Hurt,E., Luo,M.J., Rother,S., Reed,R., and Strasser,K. (2004). Cotranscriptional recruitment of the serine-arginine-rich (SR)-like proteins Gbp2 and Hrb1 to nascent mRNA via the TREX complex. Proc. Natl. Acad. Sci. U. S. A 101, 1858-1862.
116. Inoue,K., Mizuno,T., Wada,K., and Hagiwara,M. (2000). Novel RING finger proteins, Air1p and Air2p, interact with Hmt1p and inhibit the arginine methylation of Npl3p. J. Biol. Chem. 275, 32793-32799.
117. Ishigaki,Y., Li,X., Serin,G., and Maquat,L.E. (2001). Evidence for a pioneer round of mRNA translation: mRNAs subject to nonsense-mediated decay in mammalian cells are bound by CBP80 and CBP20. Cell 106, 607-617.
118. Izaurralde, E., Braun, I. C., Gatfield, D., and Herold, A. The mRNA export pathway: a systematic functional analysis of export factors by dsRNAi in Drosophilia and human cells. 2002. Madison, Wisconsin. Ref Type: Conference Proceeding
164 119. Jenh,C.-H., Geyer,P.K., and Johnson,L.F. (1985). Control of thymidylate synthase mRNA content and gene transcription in an overproducing mouse cell line. Mol. Cell. Biol. 5, 2527-2532.
120. Jensen,T.H., Boulay,J., Rosbash,M., and Libri,D. (2001). The DECD box putative ATPase Sub2p is an early mRNA export factor. Curr. Biol. 11, 1711- 1715.
121. Johnson,L.F. (1994). Regulation of thymidylate synthase gene expression in growth-stimulated cells. The Cell Cycle 15, 141-147.
122. Jolliff,K., Li,Y., and Johnson,L.F. (1991). Multiple protein-DNA interactions in the TATAA-less mouse thymidylate synthase promoter. Nucleic Acids Res. 19, 2267-2274.
123. Kadener,S., Cramer,P., Nogues,G., Cazalla,D., de la,M.M., Fededa,J.P., Werbajh,S.E., Srebrow,A., and Kornblihtt,A.R. (2001). Antagonistic effects of T-Ag and VP16 reveal a role for RNA pol II elongation on alternative splicing. EMBO J 20, 5759-5768.
124. Karlsson,A., Helou,K., Walentinsson,A., Hedrich,H.J., Szpirer,C., and Levan,G. (2001). Amplification of Mycn, Ddx1, Rrm2, and Odc1 in rat uterine endometrial carcinomas. Genes Chromosomes Cancer 31, 345-356.
125. Kaufmann,J. and Smale,S.T. (1994). Direct recognition of initiator elements by a component of the transcription factor IID complex. Genes Dev. 8, 821- 829.
126. Ke,Y., Ash,J., and Johnson,L.F. (1996). Splicing signals are required for S phase regulation of the mouse thymidylate synthase gene. Mol. Cell. Biol. 16, 376-383.
127. Kiesler,E., Miralles,F., and Visa,N. (2002). HEL/UAP56 binds cotranscriptionally to the Balbiani ring pre-mRNA in an intron-independent manner and accompanies the BR mRNP to the nuclear pore. Curr. Biol. 12, 859-862.
128. Kim,E., Du,L., Bregman,D.B., and Warren,S.L. (1997a). Splicing Factors Associate with Hyperphosphorylated RNA Polymerase II in the Absence of Pre-mRNA. J. Cell Biol. 136, 19-28.
129. Kim,E., Du,L., Bregman,D.B., and Warren,S.L. (1997b). Splicing Factors Associate with Hyperphosphorylated RNA Polymerase II in the Absence of Pre-mRNA. J. Cell Biol. 136, 19-28.
130. Kim,V.N., Kataoka,N., and Dreyfuss,G. (2001). Role of the nonsense- mediated decay factor hUpf3 in the splicing-dependent exon-exon junction complex. Science 293, 1832-1836.
165 131. Kistler,A.L. and Guthrie,C. (2001). Deletion of MUD2, the yeast homolog of U2AF65, can bypass the requirement for sub2, an essential spliceosomal ATPase. Genes Dev. 15, 42-49.
132. Komarnitsky,P., Cho,E.J., and Buratowski,S. (2000). Different phosphorylated forms of RNA polymerase II and associated mRNA processing factors during transcription [In Process Citation]. Genes Dev. 14, 2452-2460.
133. Kornblihtt,A.R., de la,M.M., Fededa,J.P., Munoz,M.J., and Nogues,G. (2004b). Multiple links between transcription and splicing. RNA. 10, 1489- 1498.
134. Kornblihtt,A.R., de la,M.M., Fededa,J.P., Munoz,M.J., and Nogues,G. (2004a). Multiple links between transcription and splicing. RNA. 10, 1489- 1498.
135. Kosova,B., Pante,N., Rollenhagen,C., Podtelejnikov,A., Mann,M., Aebi,U., and Hurt,E. (2000). Mlp2p, a component of nuclear pore attached intranuclear filaments, associates with nic96p. J Biol. Chem. 275, 343-350.
136. Kramer,A. (1996). The structure and function of proteins involved in mammalian pre-mRNA splicing. Ann. Rev. Biochem. 65, 367-409.
137. Kutach,A.K. and Kadonaga,J.T. (2000a). The downstream promoter element DPE appears to be as widely used as the TATA box in Drosophila core promoters. Mol. Cell Biol. 20, 4754-4764.
138. Kutach,A.K. and Kadonaga,J.T. (2000b). The downstream promoter element DPE appears to be as widely used as the TATA box in Drosophila core promoters. Mol. Cell Biol. 20, 4754-4764.
139. Kutach,A.K. and Kadonaga,J.T. (2000c). The downstream promoter element DPE appears to be as widely used as the TATA box in Drosophila core promoters. Mol. Cell Biol. 20, 4754-4764.
140. Lagrange,T., Kapanidis,A.N., Tang,H., Reinberg,D., and Ebright,R.H. (1998a). New core promoter element in RNA polymerase II-dependent transcription: sequence-specific DNA binding by transcription factor IIB. Genes Dev. 12, 34-44.
141. Lagrange,T., Kapanidis,A.N., Tang,H., Reinberg,D., and Ebright,R.H. (1998b). New core promoter element in RNA polymerase II-dependent transcription: sequence-specific DNA binding by transcription factor IIB. Genes Dev. 12, 34-44.
142. Le Hir,H., Gatfield,D., Izaurralde,E., and Moore,M.J. (2001). The exon-exon junction complex provides a binding platform for factors involved in mRNA export and nonsense-mediated mRNA decay. EMBO J. 20, 4987-4997.
166 143. Le Hir,H., Izaurralde,E., Maquat,L.E., and Moore,M.J. (2000). The spliceosome deposits multiple proteins 20-24 nucleotides upstream of mRNA exon-exon junctions. EMBO J. 19, 6860-6869.
144. Le Hir,H., Nott,A., and Moore,M.J. (2003b). How introns influence and enhance eukaryotic gene expression. Trends Biochem. Sci. 28, 215-220.
145. Le Hir,H., Nott,A., and Moore,M.J. (2003a). How introns influence and enhance eukaryotic gene expression. Trends Biochem. Sci. 28, 215-220.
146. Lee,S.G. and Song,K. (2000). Identification and characterization of a bidirectional promoter from the intergenic region between the human DDX13 and RD genes. Mol. Cells 10, 47-53.
147. Lee,T.I., Causton,H.C., Holstege,F.C., Shen,W.C., Hannett,N., Jennings,E.G., Winston,F., Green,M.R., and Young,R.A. (2000). Redundant roles for the TFIID and SAGA complexes in global transcription. Nature 405, 701-704.
148. Lee,T.X. and Johnson,L.F. (1998). Analysis of transcripts derived from sequences upstream of the bidirectional mouse thymidylate synthase promoter. Exp. Cell Res. 242, 222-227.
149. Lehman,N.L. (2002). Future potential of thymidylate synthase inhibitors in cancer therapy. Expert. Opin. Investig. Drugs 11, 1775-1787.
150. Lehner,B., Semple,J.I., Brown,S.E., Counsell,D., Campbell,R.D., and Sanderson,C.M. (2004). Analysis of a high-throughput yeast two-hybrid system and its use to predict the function of intracellular proteins encoded within the human MHC class III region. Genomics 83, 153-167.
151. Lei,E.P., Krebber,H., and Silver,P.A. (2001). Messenger RNAs are recruited for nuclear export during transcription. Genes Dev. 15, 1771-1782.
152. Lejeune,F., Ishigaki,Y., Li,X., and Maquat,L.E. (2002). The exon junction complex is detected on CBP80-bound but not eIF4E-bound mRNA in mammalian cells: dynamics of mRNP remodeling. EMBO J 21, 3536-3545.
153. Lennard,A.C. and Fried,M. (1991). The bidirectional promoter of the divergently transcribed mouse Surf-1 and Surf-2 genes. Mol. Cell. Biol. 11, 1281-1294.
154. Lewis,J.D. and Izaurralde,E. (1997). The role of the cap structure in RNA processing and nuclear export. Eur. J. Biochem. 247, 461-469.
155. Li,Q., Imataka,H., Morino,S., Rogers,G.W., Jr., Richter-Cook,N.J., Merrick,W.C., and Sonenberg,N. (1999). Eukaryotic translation initiation factor 4AIII (eIF4AIII) is functionally distinct from eIF4AI and eIF4AII. Mol. Cell Biol. 19, 7336-7346.
167 156. Li,Y., Li,D., Osborn,K., and Johnson,L.F. (1991). The 5'-flanking region of the mouse thymidylate synthase gene is necessary but not sufficient for normal regulation in growth-stimulated cells. Mol. Cell Biol. 11, 1023-1029.
157. Linder,P., Lasko,P.F., Ashburner,M., Leroy,P., Nielsen,P.J., Nishi,K., Schnier,J., and Slonimski,P.P. (1989). Birth of the D-E-A-D box. Nature 337, 121-122.
158. Linder,P. and Stutz,F. (2001). mRNA export: travelling with DEAD box proteins. Curr. Biol. 11, R961-R963.
159. Linton,J.P., Yen,J.-Y.J., Selby,E., Chen,Z., Chinsky,J.M., Liu,K., Kellems,R.E., and Crouse,G.F. (1989). Dual bidirectional promoters at the mouse dhfr locus: cloning and characterization of two mRNA classes of the divergently transcribed Rep-1 gene. Mol. Cell. Biol. 9, 3058-3072.
160. Longman,D., Johnstone,I.L., and Caceres,J.F. (2003). The Ref/Aly proteins are dispensable for mRNA export and development in Caenorhabditis elegans. RNA. 9, 881-891.
161. Lu,S. and Cullen,B.R. (2003b). Analysis of the stimulatory effect of splicing on mRNA production and utilization in mammalian cells. RNA. 9, 618-630.
162. Lu,S. and Cullen,B.R. (2003a). Analysis of the stimulatory effect of splicing on mRNA production and utilization in mammalian cells. RNA. 9, 618-630.
163. Luo,M.L., Zhou,Z., Magni,K., Christoforides,C., Rappsilber,J., Mann,M., and Reed,R. (2001). Pre-mRNA splicing and mRNA export linked by direct interactions between UAP56 and Aly. Nature 413, 644-647.
164. Lutz,C.S., Murthy,K.G.K., Schek,N., O'Connor,J.P., Manley,T.L., and Alwine,J.C. (1996). Interaction between the U1 snRNP-A protein and the 160-kD subunit of cleavage-polyadenylation specificity factor increases polyadenylation efficiency in vitro. Genes Dev. 10, 325-337.
165. Lykke-Andersen,J., Shu,M.D., and Steitz,J.A. (2000). Human Upf proteins target an mRNA for nonsense-mediated decay when bound downstream of a termination codon. Cell 103, 1121-1131.
166. Macchi,P., Kroening,S., Palacios,I.M., Baldassa,S., Grunewald,B., Ambrosino,C., Goetze,B., Lupas,A., St Johnston,D., and Kiebler,M. (2003b). Barentsz, a new component of the Staufen-containing ribonucleoprotein particles in mammalian cells, interacts with Staufen in an RNA-dependent manner. J Neurosci. 23, 5778-5788.
167. Macchi,P., Kroening,S., Palacios,I.M., Baldassa,S., Grunewald,B., Ambrosino,C., Goetze,B., Lupas,A., St Johnston,D., and Kiebler,M. (2003a). Barentsz, a new component of the Staufen-containing ribonucleoprotein particles in mammalian cells, interacts with Staufen in an RNA-dependent manner. J Neurosci. 23, 5778-5788. 168 168. Macleod,D., Charlton,J., Mullins,J., and Bird,A.P. (1994). Sp1 sites in the mouse aprt gene promoter are required to prevent methylation of the CpG island. Genes Dev. 8, 2282-2292.
169. MacMorris,M., Brocker,C., and Blumenthal,T. (2003). UAP56 levels affect viability and mRNA export in Caenorhabditis elegans. RNA. 9, 847-857.
170. Maderazo,A.B., He,F., Mangus,D.A., and Jacobson,A. (2000). Upf1p control of nonsense mRNA translation is regulated by Nmd2p and Upf3p. Mol. Cell Biol. 20, 4591-4603.
171. Maquat,L.E. (2004). Nonsense-mediated mRNA decay: splicing, translation and mRNP dynamics. Nat. Rev. Mol. Cell Biol. 5, 89-99.
172. Marfatia,K.A., Crafton,E.B., Green,D.M., and Corbett,A.H. (2003). Domain analysis of the Saccharomyces cerevisiae heterogeneous nuclear ribonucleoprotein, Nab2p. Dissecting the requirements for Nab2p- facilitated poly(A) RNA export. J Biol. Chem. 278, 6731-6740.
173. Markussen,F.H., Michon,A.M., Breitwieser,W., and Ephrussi,A. (1995). Translational control of oskar generates short OSK, the isoform that induces pole plasma assembly. Development 121, 3723-3732.
174. Martinez,E. (2002). Multi-protein complexes in eukaryotic gene transcription. Plant Mol. Biol. 50, 925-947.
175. Martinez,E., Chiang,C.M., Ge,H., and Roeder,R.G. (1994). TATA-binding protein-associated factor(s) in TFIID function through the initiator to direct basal transcription from a TATA-less class II promoter. EMBO J. 13, 3115- 3126.
176. Matsumoto,K., Wassarman,K.M., and Wolffe,A.P. (1998). Nuclear history of a pre-mRNA determines the translational activity of cytoplasmic mRNA. EMBO J. 17, 2107-2121.
177. Maxam,A.M. and Gilbert,W. (1977). A new method for sequencing DNA. Proc. Natl. Acad. Sci. USA 74, 560-564.
178. Maxson,R., Cohn,R., Kedes,L., and Mohun,T. (1983). Expression and organization of histone genes. Annu. Rev. Genet. 17, 239-277.
179. McCracken,S., Fong,N., Rosonina,E., Yankulov,K., Brothers,G., Siderovski,D., Hessel,A., Foster,S., Shuman,S., and Bentley,D.L. (1997a). 5'- Capping enzymes are targeted to pre-mRNA by binding to the phosphorylated carboxy-terminal domain of RNA polymerase II. Genes Dev. 11, 3306-3318.
180. McCracken,S., Fong,N., Yankulov,K., Ballantyne,S., Pan,G.H., Greenblatt,J., Patterson,S.D., Wickens,M., and Bentley,D.L. (1997b). The C-terminal
169 domain of RNA polymerase II couples mRNA processing to transcription. Nature (London) 385, 357-361.
181. McCracken,S., Lambermon,M., and Blencowe,B.J. (2002). SRm160 splicing coactivator promotes transcript 3'-end cleavage. Mol. Cell Biol. 22, 148-160.
182. Misteli,T. and Spector,D.L. (1999). RNA polymerase II targets pre-mRNA splicing factors to transcription sites in vivo. Mol. Cell 3, 697-705.
183. Miyaji,K., Nakagawa,Y., Matsumoto,K., Yoshida,H., Morikawa,H., Hongou,Y., Arisaka,Y., Kojima,H., Inoue,T., Hirata,I., Katsu,K., and Akao,Y. (2003). Overexpression of a DEAD box/RNA helicase protein, rck/p54, in human hepatocytes from patients with hepatitis C virus-related chronic hepatitis and its implication in hepatocellular carcinogenesis. Journal of Viral Hepatitis 10, 241-248.
184. Mohr,S.E., Dillon,S.T., and Boswell,R.E. (2001). The RNA-binding protein Tsunagi interacts with Mago Nashi to establish polarity and localize oskar mRNA during Drosophila oogenesis. Genes Dev. 15, 2886-2899.
185. Momota,R., Sugimoto,M., Oohashi,T., Kigasawa,K., Yoshioka,H., and Ninomiya,Y. (1998). Two genes, COL4A3 and COL4A4 coding for the human alpha3(IV) and alpha4(IV) collagen chains are arranged head-to-head on chromosome 2q36. FEBS Lett. 424, 11-16.
186. Monsalve,M., Wu,Z., Adelmant,G., Puigserver,P., Fan,M., and Spiegelman,B.M. (2000). Direct coupling of transcription and mRNA processing through the thermogenic coactivator PGC-1. Mol. Cell 6, 307- 316.
187. Morris,D.P. and Greenleaf,A.L. (2000). The splicing factor, prp40, binds the phosphorylated carboxyl-terminal domain of RNA polymerase II [In Process Citation]. J. Biol. Chem. 275, 39935-39943.
188. Mortillaro,M.J., Blencowe,B.J., Wei,X., Nakayasu,H., Du,L., Warren,S.L., Sharp,P.A., and Berezney,R. (1996). A hyperphosphorylated form of the large subunit of RNA polymerase II is associated with splicing complexes and the nuclear matrix. Proc. Natl. Acad. Sci. U. S. A 93, 8253-8257.
189. Muller,F. and Tora,L. (2004a). The multicoloured world of promoter recognition complexes. EMBO J 23, 2-8.
190. Muller,F. and Tora,L. (2004b). The multicoloured world of promoter recognition complexes. EMBO J 23, 2-8.
191. Nayler,O., Stratling,W., Bourquin,J.P., Stagljar,I., Lindemann,L., Jasper,H., Hartmann,A.M., Fackelmayer,F.O., Ullrich,A., and Stamm,S. (1998). SAF-B protein couples transcription and pre-mRNA splicing to SAR/MAR elements. Nucleic Acids Res. 26, 3542-3549.
170 192. Noe,V., MacKenzie,S., and Ciudad,C.J. (2003). An intron is required for dihydrofolate reductase protein stability. J Biol. Chem. 278, 38292-38300.
193. Nogues,G., Kadener,S., Cramer,P., Bentley,D., and Kornblihtt,A.R. (2002). Transcriptional activators differ in their abilities to control alternative splicing. J Biol. Chem. 277, 43110-43114.
194. Nott,A., Le Hir,H., and Moore,M.J. (2004). Splicing enhances translation in mammalian cells: an additional function of the exon junction complex. Genes Dev. 18, 210-222.
195. Nott,A., Meislin,S.H., and Moore,M.J. (2003). A quantitative analysis of intron effects on mammalian gene expression. RNA. 9, 607-617.
196. Noueiry,A.O., Chen,J., and Ahlquist,P. (2000). A mutant allele of essential, general translation initiation factor DED1 selectively inhibits translation of a viral mRNA. Proc. Natl. Acad. Sci. U. S. A 97, 12985-12990.
197. Nussbaum,R.L., Walmsley,R.M., Lesko,J.G., Airhart,S.D., and Ledbetter,D.H. (1985). Thymidylate synthase-deficient Chinese hamster cells: a selection system for human chromosome 18 and experimental system for the study of thymidylate synthase regulation and fragile X expression. Am. J. Hum. Genet. 37, 1192-1205.
198. O'Shea-Greenfield,A. and Smale,S.T. (1992). Roles of TATA and initiator elements in determining the start site location and direction of RNA polymerase II transcription. J. Biol. Chem. 267, 1391-1402.
199. Orii,K .E., Orii,K.O., Souri,M., Orii,T., Kondo,N., Hashimoto,T., and Aoyama,T. (1999). Genes for the human mitochondrial trifunctional protein alpha- and beta-subunits are divergently transcribed from a common promoter region. J Biol. Chem. 274, 8077-8084.
200. Orphanides,G. and Reinberg,D. (2002a). A Unified Theory of Gene Expression. Cell 108, 439-451.
201. Orphanides,G. and Reinberg,D. (2002b). A Unified Theory of Gene Expression. Cell 108, 439-451.
202. Palacios,I.M., Gatfield,D., St Johnston,D., and Izaurralde,E. (2004b). An eIF4AIII-containing complex required for mRNA localization and nonsense- mediated mRNA decay. Nature 427, 753-757.
203. Palacios,I.M., Gatfield,D., St Johnston,D., and Izaurralde,E. (2004d). An eIF4AIII-containing complex required for mRNA localization and nonsense- mediated mRNA decay. Nature 427, 753-757.
204. Palacios,I.M., Gatfield,D., St Johnston,D., and Izaurralde,E. (2004c). An eIF4AIII-containing complex required for mRNA localization and nonsense- mediated mRNA decay. Nature 427, 753-757. 171 205. Palacios,I.M., Gatfield,D., St Johnston,D., and Izaurralde,E. (2004a). An eIF4AIII-containing complex required for mRNA localization and nonsense- mediated mRNA decay. Nature 427, 753-757.
206. Ponting,C.P. (2000). Novel eIF4G domain homologues linking mRNA translation with nonsense-mediated mRNA decay. Trends Biochem. Sci. 25, 423-426.
207. Proudfoot,N.J., Furger,A., and Dye,M.J. (2002). Integrating mRNA processing with transcription. Cell 108, 501-512.
208. Pryor,A., Tung,L., Yang,Z., Kapadia,F., Chang,T.H., and Johnson,L.F. (2004). Growth-regulated expression and G0-specific turnover of the mRNA that encodes URH49, a mammalian DExH/D box protein that is highly related to the mRNA export protein UAP56. Nucleic Acids Res. 32, 1857-1865.
209. Pugh,B.F. (2000). Control of gene expression through regulation of the TATA-binding protein. Gene 255, 1-14.
210. Purnell,B.A., Emanuel,P.A., and Gilmour,D.S. (1994). TFIID sequence recognition of the initiator and sequences farther downstream in Drosophila class II genes. Genes Dev. 8, 830-842.
211. Raghunathan,P.L. and Guthrie,C. (1998). RNA unwinding in U4/U6 snRNPs requires ATP hydrolysis and the DEIH-box splicing factor Brr2. Curr. Biol. 8, 847-855.
212. Rahman,L., Voeller,D., Rahman,M., Lipkowitz,S., Allegra,C., Barrett,J.C., Kaye,F.J., and Zajac-Kaye,M. (2004). Thymidylate synthase as an oncogene: a novel role for an essential DNA synthesis enzyme. Cancer Cell 5, 341-351.
213. Rajendran,R.R., Nye,A.C., Frasor,J., Balsara,R.D., Martini,P.G., and Katzenellenbogen,B.S. (2003). Regulation of nuclear receptor transcriptional activity by a novel DEAD box RNA helicase (DP97). J Biol. Chem. 278, 4628-4638.
214. Reed,R. and Hurt,E. (2002). A conserved mRNA export machinery coupled to pre-mRNA splicing. Cell 108, 523-531.
215. Rizzo,M.G., Ottavio,L., Travali,S., Chang,C.D., Kaminska,B., and Baserga,R. (1990). The promoter of the human proliferating cell nuclear antigen (PCNA) gene is bidirectional. Exp. Cell Res. 188, 286-293.
216. Robert,F., Blanchette,M., Maes,O., Chabot,B., and Coulombe,B. (2002). A Human RNA Polymerase II-containing Complex Associated with Factors Necessary for Spliceosome Assembly. J. Biol. Chem. 277, 9302-9306.
217. Rocak,S. and Linder,P. (2004g). DEAD-box proteins: the driving forces behind RNA metabolism. Nat. Rev. Mol. Cell Biol. 5, 232-241. 172 218. Rocak,S. and Linder,P. (2004i). DEAD-box proteins: the driving forces behind RNA metabolism. Nat. Rev. Mol. Cell Biol. 5, 232-241.
219. Rocak,S. and Linder,P. (2004k). DEAD-box proteins: the driving forces behind RNA metabolism. Nat. Rev. Mol. Cell Biol. 5, 232-241.
220. Rocak,S. and Linder,P. (2004h). DEAD-box proteins: the driving forces behind RNA metabolism. Nat. Rev. Mol. Cell Biol. 5, 232-241.
221. Rocak,S. and Linder,P. (2004e). DEAD-box proteins: the driving forces behind RNA metabolism. Nat. Rev. Mol. Cell Biol. 5, 232-241.
222. Rocak,S. and Linder,P. (2004d). DEAD-box proteins: the driving forces behind RNA metabolism. Nat. Rev. Mol. Cell Biol. 5, 232-241.
223. Rocak,S. and Linder,P. (2004a). DEAD-box proteins: the driving forces behind RNA metabolism. Nat. Rev. Mol. Cell Biol. 5, 232-241.
224. Rocak,S. and Linder,P. (2004c). DEAD-box proteins: the driving forces behind RNA metabolism. Nat. Rev. Mol. Cell Biol. 5, 232-241.
225. Rocak,S. and Linder,P. (2004f). DEAD-box proteins: the driving forces behind RNA metabolism. Nat. Rev. Mol. Cell Biol. 5, 232-241.
226. Rocak,S. and Linder,P. (2004j). DEAD-box proteins: the driving forces behind RNA metabolism. Nat. Rev. Mol. Cell Biol. 5, 232-241.
227. Rocak,S. and Linder,P. (2004b). DEAD-box proteins: the driving forces behind RNA metabolism. Nat. Rev. Mol. Cell Biol. 5, 232-241.
228. Rodriguez,C.R., Cho,E.J., Keogh,M.C., Moore,C.L., Greenleaf,A.L., and Buratowski,S. (2000). Kin28, the TFIIH-associated carboxy-terminal domain kinase, facilitates the recruitment of mRNA processing machinery to RNA polymerase II. Mol. Cell Biol. 20, 104-112.
229. Rodriguez,M.S., Dargemont,C., and Stutz,F. (2004a). Nuclear export of RNA. Biol. Cell 96, 639-655.
230. Rodriguez,M.S., Dargemont,C., and Stutz,F. (2004c). Nuclear export of RNA. Biol. Cell 96, 639-655.
231. Rodriguez,M.S., Dargemont,C., and Stutz,F. (2004b). Nuclear export of RNA. Biol. Cell 96, 639-655.
232. Rodriguez-Navarro,S., Strasser,K., and Hurt,E. (2002). An intron in the YRA1 gene is required to control Yra1 protein expression and mRNA export in yeast. EMBO Rep. 3, 438-442.
173 233. Rosonina,E., Bakowski,M.A., McCracken,S., and Blencowe,B.J. (2003). Transcriptional activators control splicing and 3'-end cleavage levels. J. Biol. Chem. 278, 43034-43040.
234. Rossow,K.L. and Janknecht,R. (2003). Synergism between p68 RNA helicase and the transcriptional coactivators CBP and p300. Oncogene 22, 151-156.
235. Roy,A.L., Meisterernst,M., Pognonec,P., and Roeder,R.G. (1991). Cooperative interaction of an initiator-binding transcription initiation factor and the helix-loop-helix activator USF. Nature (London) 345, 245-248.
236. Rudge,T.L. and Johnson,L.F. (1999). Inactivation of MED-1 elements in the TATA-less, initiator-less mouse thymidylate synthase promoter has no effect on promoter strength or the complex pattern of transcriptional start sites. J. Cell. Biochem. 73, 90-96.
237. Ryan,M.T., Herd,S.M., Sberna,G., Samuel,M.M., Hoogenraad,N.J., and Hoj,P.B. (1997). The genes encoding mammalian chaperonin 60 and chaperonin 10 are linked head-to-head and share a bidirectional promoter. Gene 196, 9-17.
238. Schell,T., Kulozik,A.E., and Hentze,M.W. (2002). Integration of splicing, transport and translation to achieve mRNA quality control by the nonsense-mediated decay pathway. Genome Biol. 3, REVIEWS1006.
239. Schmitt,C., von Kobbe,C., Bachi,A., Pante,N., Rodrigues,J.P., Boscheron,C., Rigaut,G., Wilm,M., Seraphin,B., Carmo-Fonseca,M., and Izaurralde,E. (1999). Dbp5, a DEAD-box protein required for mRNA export, is recruited to the cytoplasmic fibrils of nuclear pore complex via a conserved interaction with CAN/Nup159p. EMBO J. 18, 4332-4347.
240. Shatkin,A.J. and Manley,J.L. (2000). The ends of the affair: capping and polyadenylation. Nat. Struct. Biol. 7, 838-842.
241. Shi,H., Cordin,O., Minder,C.M., Linder,P., and Xu,R.M. (2004a). Crystal structure of the human ATP-dependent splicing and export factor UAP56. Proc. Natl. Acad. Sci. USA 101, 17628-17633.
242. Shi,H., Cordin,O., Minder,C.M., Linder,P., and Xu,R.M. (2004b). Crystal structure of the human ATP-dependent splicing and export factor UAP56. Proc. Natl. Acad. Sci. USA 101, 17628-17633.
243. Shi,H., Cordin,O., Minder,C.M., Linder,P., and Xu,R.M. (2004c). Crystal structure of the human ATP-dependent splicing and export factor UAP56. Proc. Natl. Acad. Sci. USA 101, 17628-17633.
244. Shibuya,T., Tange,T.O., Sonenberg,N., and Moore,M.J. (2004). eIF4AIII binds spliced mRNA in the exon junction complex and is essential for nonsense- mediated decay. Nat. Struct. Mol. Biol. 11, 346-351. 174 245. Singer,V.L., Wobbe,C.R., and Struhl,K. (1990). A wide variety of DNA sequences can functionally replace a yeast TATA element for transcriptional activation. Genes Dev. 4, 636-645.
246. Singh,G. and Lykke-Andersen,J. (2003). New insights into the formation of active nonsense-mediated decay complexes. Trends Biochem. Sci. 28, 464- 466.
247. Smale,S.T. and Baltimore,D. (1989). The "initiator" as a transcription control element. Cell 57, 103-113.
248. Smale,S.T. and Kadonaga,J.T. (2003). The RNA polymerase II core promoter. Annu. Rev. Biochem. 72, 449-479.
249. Snay-Hodge,C.A., Colot,H.V., Goldstein,A.L., and Cole,C.N. (1998). Dbp5p/Rat8p is a yeast nuclear pore-associated DEAD-box protein essential for RNA export. EMBO J. 17, 2663-2676.
250. Staley,J.P. and Guthrie,C. (1998). Mechanical devices of the spliceosome: motors, clocks, springs, and things. Cell 92, 315-326.
251. Strambio-de-Castillia,C., Blobel,G., and Rout,M.P. (1999). Proteins Connecting the Nuclear Pore Complex with the Nuclear Interior. J. Cell Biol. 144, 839-855.
252. Strasser,K. and Hurt,E. (2001). Splicing factor Sub2p is required for nuclear mRNA export through its interaction with Yra1p. Nature 413, 648-652.
253. Strasser,K., Masuda,S., Mason,P., Pfannstiel,J., Oppizzi,M., Rodriguez- Navarro,S., Rondon,A.G., Aguilera,A., Struhl,K., Reed,R., and Hurt,E. (2002b). TREX is a conserved complex coupling transcription with messenger RNA export. Nature 417, 304-308.
254. Strasser,K., Masuda,S., Mason,P., Pfannstiel,J., Oppizzi,M., Rodriguez- Navarro,S., Rondon,A.G., Aguilera,A., Struhl,K., Reed,R., and Hurt,E. (2002a). TREX is a conserved complex coupling transcription with messenger RNA export. Nature 417, 304-308.
255. Strasser,K., Masuda,S., Mason,P., Pfannstiel,J., Oppizzi,M., Rodriguez- Navarro,S., Rondon,A.G., Aguilera,A., Struhl,K., Reed,R., and Hurt,E. (2002c). TREX is a conserved complex coupling transcription with messenger RNA export. Nature 417, 304-308.
256. Sturm,R.A., Dalton,S., and Wells,J.R.E. (1988). Conservation of histone H2A/H2B intergene regions: a role for the H2B specific element in divergent transcription. Nucleic Acids Res. 16, 8571-8586.
257. Stutz,F. and Izaurralde,E. (2003). The interplay of nuclear mRNP assembly, mRNA surveillance and export. Trends Cell Biol. 13, 319-327.
175 258. Suzuki,Y., Tsunoda,T., Sese,J., Taira,H., Mizushima-Sugano,J., Hata,H., Ota,T., Isogai,T., Tanaka,T., Nakamura,Y., Suyama,A., Sakaki,Y., Morishita,S., Okubo,K., and Sugano,S. (2001). Identification and Characterization of the Potential Promoter Regions of 1031 Kinds of Human Genes. Genome Res. 11, 677-684.
259. Tang e,T.O., Nott,A., and Moore,M.J. (2004b). The ever-increasing complexities of the exon junction complex. Curr. Opin. Cell Biol. 16, 279- 284.
260. Tange,T.O., Nott,A., and Moore,M.J. (2004a). The ever-increasing complexities of the exon junction complex. Curr. Opin. Cell Biol. 16, 279- 284.
261. Tanner,N.K. (2003). The newly identified Q motif of DEAD box helicases is involved in adenine recognition. Cell Cycle 2, 18-19.
262. Tanner,N.K., Cordin,O., Banroques,J., Doere,M., and Linder,P. (2003a). The Q motif: a newly identified motif in DEAD box helicases may regulate ATP binding and hydrolysis. Mol. Cell 11, 127-138.
263. Tanner,N.K., Cordin,O., Banroques,J., Doere,M., and Linder,P. (2003b). The Q motif: a newly identified motif in DEAD box helicases may regulate ATP binding and hydrolysis. Mol. Cell 11, 127-138.
264. Tanner,N.K. and Linder,P. (2001). DExD/H box RNA helicases: from generic motors to specific dissociation functions. Mol. Cell 8, 251-262.
265. Trinklein,N.D., Aldred,S.F., Hartman,S.J., Schroeder,D.I., Otillar,R.P., and Myers,R.M. (2004). An abundance of bidirectional promoters in the human genome. Genome Res. 14, 62-66.
266. Tseng,S.S.I., Weaver,P.L., Liu,Y., Hitomi,M., Tartakoff,A.M., and Chang,T.H. (1998). Dbp5p, a cytosolic RNA helicase, is required for poly(A)+ RNA export. EMBO J. 17, 2651-2662.
267. Usheva,A. and Shenk,T. (1994). TATA-binding protein-independent initiation: YY1, TFIIB, and RNA polymerase II direct basal transcription on supercoiled template DNA. Cell 76, 1115-1121.
268. Valcarcel,J., Gaur,R.K., Singh,R., and Green,M.R. (1996). Interaction of U2AF65 RS region with pre-mRNA branch point and promotion of base pairing with U2 snRNA [corrected]. Science 273, 1706-1709.
269. Verrijzer,C.P., Chen,J.L., Yokomori,K., and Tjian,R. (1995). Binding of TAFs to core elements directs promoter selectivity by RNA polymerase II. Cell 81, 1115-1125.
176 270. Verrijzer,C.P., Yokomori,K., Chen,J.L., and Tjian,R. (1994). Drosophila TAFII150: similarity to yeast gene TSM-1 and specific binding to core promoter DNA. Science 264, 933-941.
271. Vincent,M., Lauriault,P., Dubois,M.F., Lavoie,S., Bensaude,O., and Chabot,B. (1996). The nuclear matrix protein p255 is a highly phosphorylated form of RNA polymerase II largest subunit which associates with spliceosomes. Nucleic Acids Res. 24, 4649-4652.
272. Vinciguerra,P. and Stutz,F. (2004d). mRNA export: an assembly line from genes to nuclear pores. Curr. Opin. Cell Biol. 16, 285-292.
273. Vinci guerra,P. and Stutz,F. (2004c). mRNA export: an assembly line from genes to nuclear pores. Curr. Opin. Cell Biol. 16, 285-292.
274. Vinciguerra,P. and Stutz,F. (2004e). mRNA export: an assembly line from genes to nuclear pores. Curr. Opin. Cell Biol. 16, 285-292.
275. Vinciguerra,P. and Stutz,F. (2004g). mRNA export: an assembly line from genes to nuclear pores. Curr. Opin. Cell Biol. 16, 285-292.
276. Vinciguerra,P. and Stutz,F. (2004a). mRNA export: an assembly line from genes to nuclear pores. Curr. Opin. Cell Biol. 16, 285-292.
277. Vinciguerra,P. and Stutz,F. (2004f). mRNA export: an assembly line from genes to nuclear pores. Curr. Opin. Cell Biol. 16, 285-292.
278. Vinciguerra,P. and Stutz,F. (2004b). mRNA export: an assembly line from genes to nuclear pores. Curr. Opin. Cell Biol. 16, 285-292.
279. Wahle,E. and Ruegsegger,U. (1999). 3'-End processing of pre-mRNA in eukaryotes. FEMS Microbiol. Rev. 23, 277-295.
280. Walker,J.E., Saraste,M., Runswick,M.J., and Gay,N.J. (1982). Distantly related sequences in the alpha- and beta-subunits of ATP synthase, myosin, kinases and other ATP-requiring enzymes and a common nucleotide binding fold. EMBO J. 1, 945-951.
281. Wang,W., Czaplinski,K., Rao,Y., and Peltz,S.W. (2001). The role of Upf proteins in modulating the translation read-through of nonsense-containing transcripts. EMBO J 20, 880-890.
282. Wassarman,D.A. and Sauer,F. (2001). TAF(II)250: a transcription toolbox. J Cell Sci. 114, 2895-2902.
283. Wasylyk,B., Hahn,S.L., and Giovane,A. (1993). The Ets family of transcription factors. Eur. J. Biochem. 211, 7-18.
177 284. Weichselbraun,I., Ogris,E., and Wintersberger,E. (1990). Bidirectional promoter activity of the 5' flanking region of the mouse thymidine kinase gene. Febs Letters 275, 49-52.
285. Weis,L. and Reinberg,D. (1997). Accurate positioning of RNA polymerase II on a natural TATA-less promoter is independent of TATA-binding-protein- associated factors and initiator-binding proteins. Mol. Cell Biol. 17, 2973- 2984.
286. Willy,P.J., Kobayashi,R., and Kadonaga,J.T. (2000). A basal transcription factor that activates or represses transcription. Science 290, 982-985.
287. Woychik,N.A. and Hampsey,M. (2002). The RNA polymerase II machinery: structure illuminates function. Cell 108, 453-463.
288. Yan,X., Mouillet,J.F., Ou,Q., and Sadovsky,Y. (2003). A novel domain within the DEAD-box protein DP103 is essential for transcriptional repression and helicase activity. Mol. Cell Biol. 23, 414-423.
289. Yang,J., Bogerd,H.P., Wang,P.J., Page,D.C., and Cullen,B.R. (2001). Two closely related human nuclear export factors utilize entirely distinct export pathways. Mol. Cell 8, 397-406.
290. Yue,Z., Maldonado,E., Pillutla,R., Cho,H., Reinberg,D., and Shatkin,A.J. (1997). Mammalian capping enzyme complements mutant Saccharomyces cerevisiae lacking mRNA guanylyltransferase and selectively binds the elongating form of RNA polymerase II. Proc. Natl. Acad. Sci. U. S. A 94, 12898-12903.
291. Yuryev,A., Patturajan,M., Litingtung,Y., Joshi,R.V., Gentile,C., Gebara,M., and Corden,J.L. (1996). The C-terminal domain of the largest subunit of RNA polymerase II interacts with a novel set of serine/arginine-rich proteins. Proc. Natl. Acad. Sci. USA 93, 6975-6980.
292. Zamore,P.D. and Green,M.R. (1989). Identification, purification, and biochemical characterization of U2 small nuclear ribonucleoprotein auxiliary factor. Proc. Natl. Acad. Sci. U. S. A 86, 9243-9247.
293. Zeng,C. and Berget,S.M. (2000). Participation of the C-terminal domain of RNA polymerase II in exon definition during pre-mRNA splicing [In Process Citation]. Mol. Cell Biol. 20, 8290-8301.
294. Zhang,L.F., Ding,J.H., Yang,B.Z., He,G.C., and Roe,C. (2003). Characterization of the bidirectional promoter region between the human genes encoding VLCAD and PSD-95. Genomics 82, 660-668.
295. Zhang,M. and Green,M.R. (2001). Identification and characterization of yUAP/Sub2p, a yeast homolog of the essential human pre-mRNA splicing factor hUAP56. Genes Dev. 15, 30-35.
178 296. Zhao,J., Hyman,L., and Moore,C. (1999). Formation of mRNA 3' ends in eukaryotes: Mechanism, regulation, and interrelationships with other steps in mRNA synthesis. Microbiol. Mol. Biol. Rev. 63, 405-445.
297. Zhao,R., Shen,J., Green,M.R., MacMorris,M., and Blumenthal,T. (2004a). Crystal structure of UAP56, a DExD/H-box protein involved in pre-mRNA splicing and mRNA export. Structure. (Camb. ) 12, 1373-1381.
298. Zhao,R., Shen,J., Green,M.R., MacMorris,M., and Blumenthal,T. (2004b). Crystal structure of UAP56, a DExD/H-box protein involved in pre-mRNA splicing and mRNA export. Structure. (Camb. ) 12, 1373-1381.
299. Zhou,M., Deng,L., Lacoste,V., Park,H.U., Pumfery,A., Kashanchi,F., Brady,J.N., and Kumar,A. (2004). Coordination of transcription factor phosphorylation and histone methylation by the P-TEFb kinase during human immunodeficiency virus type 1 transcription. J Virol. 78, 13522- 13533.
300. Zhou,Z., Luo,M.J., Straesser,K., Katahira,J., Hurt,E., and Reed,R. (2000). The protein Aly links pre-messenger-RNA splicing to nuclear export in metazoans. Nature 407, 401-405.
179