Role of the Prefrontal Glucocorticoid Receptor in Synaptic, Neuroendocrine, and Behavioral Stress Adaptation

A dissertation submitted to the

Graduate School

of the University of Cincinnati

in partial fulfillment of the

requirements for the degree of

Doctor of Philosophy

in the Graduate Program in Neuroscience

of the College of Medicine

Jessica M. McKlveen

December 2014

B.A. Saint Vincent College

June 2008

Dissertation Committee: James C. Eliassen, Ph.D. (chair) James P. Herman, Ph.D. (adviser) Kim B. Seroogy, Ph.D. Stephen C. Benoit, Ph.D. Renu Sah, Ph.D. Eric G. Krause, Ph.D. General Abstract

Real or perceived threats to homeostasis activate the hypothalamic-pituitary- adrenocortical (HPA) axis, culminating in the secretion of glucocorticoids. Glucocorticoids promote energy redistribution and are critical for survival. While glucocorticoids initiate adaptive processes that generate energy for coping, prolonged glucocorticoid secretion may become deleterious. The medial prefrontal cortex (mPFC) expresses glucocorticoid receptors (GR) and is thought to be a key site for glucocorticoid-mediated regulation responses to stress. Notably,

Major Depressive Disorder (MDD) is commonly associated with alterations in Brodmann area 25 metabolism and hypercortisolemia, suggesting a link between aberrant glucocorticoid signaling and prefrontal function. Thus, understanding how glucocorticoid-mediated adaptation can ultimately lead to pathology is of paramount importance for the treatment of stress-related disorders, such as MDD.

The present dissertation tested the overarching hypothesis that the prefrontal GR mediates synaptic, neuroendocrine, and behavioral responses to stress. Using a shRNA- mediated approach to knockdown GR expression, we found that glucocorticoids act in a subregion-specific manner to regulate the HPA axis and mood. GR knockdown confined to the prelimbic prefrontal cortex (plPFC) impairs negative feedback of the axis to an acute stressor, increases basal glucocorticoid secretion under chronic stress, and induces hyperlocomotion in the open field. Conversely, knockdown of infralimbic prefrontal cortex (ilPFC) GR impairs acute and chronic stress reactivity and induces depression-like behavior in the forced swim test (FST).

Interestingly, the ilPFC is the rodent homolog of Brodmann Area 25, which is dysregulated in

MDD. Taken together, the data suggest that GR site-specifically regulates glucocorticoid actions and the ilPFC is important for the regulation of chronic stress and mood.

We next tested the hypothesis that chronic stress induces a shift toward inhibitory neurotransmission, providing a mechanism for prefrontal disengagement under chronic stress.

Using whole cell voltage-clamp, we found that chronic stress increases inhibition of

ii glutamatergic output neurons. This occurs in part through increased GABAergic innervation of glutamatergic output neurons. Further, GR immunoreactivity is downregulated specifically in interneurons, an effect observed only in parvalbumin interneurons, suggesting loss of GR- mediated brake on interneuron activity. Chronic stress also impairs behavioral flexibility in a prefrontal-mediated task, further supporting that chronic stress diminishes prefrontal engagement under chronic stress through an enhancement of prefrontal inhibition.

We also tested the ability of a GR overexpression vector to enhance inhibition of the

HPA axis and block the effects of chronic stress. Overexpression of the ilPFC GR enhances negative feedback of the HPA axis and decreases learned helplessness in the FST.

Overexpression of the ilPFC GR, however, was either insufficient or counterbalanced by compensatory mechanisms that prevented blockade of chronic stress effects. Thus, acutely the ilPFC GR is sufficient to regulate HPA axis responses and mood.

This body of work shows that prefrontal GR signaling is necessary and sufficient to regulate the HPA axis, as well as, behavior. Moreover, we demonstrate the effects of chronic stress on synaptic neurotransmission, which may provide a mechanism for chronic stress- induced disengagement of the prefrontal cortex. While these processes promote organismal survival, prolonged aberrant glucocorticoid signaling in the mPFC may underlie the transition from adaptation to pathology.

iii

Acknowledgements

There are a number of people that I need to thank for helping me prior to and throughout my graduate studies at UC. First of all, I would like to thank Jim Herman for allowing me the opportunity to complete my dissertation in his lab. I have grown so much as a scientist and cannot thank you enough for all that you have taught me and the opportunities that you have given me. Also, thank you to Susan Herman for essentially being my ‘lab mom,’ always knowing the perfect thing to say and always trying to make things easier for everyone around you.

Thank you also to Mark Baccei who has served as an unofficial mentor for me and for teaching me how to patch-clamp. I have thoroughly enjoyed ‘crossing over to the dark side,’ and look forward to many more years of patching. I think I will definitely take a break from adult, prefrontal slices for a while, though! Again, I truly appreciate your assistance in a project that has been both exciting and frustrating at times.

I would like to thank my committee members: Jim Eliassen, Kim Seroogy, Stephen

Benoit, Renu Sah, and Eric Krause. I have greatly appreciated all of your guidance throughout my graduate studies at UC and am grateful to have had a wonderful committee to work with.

Thank you to the entire Herman lab, past and present! As one of the award winners at the most recent SfN mentioned, it’s the people that you work with that will long outlive most of the achievements that we make in the lab. It has been a privilege to work with all of you and I will definitely miss each of you! To those that have already ‘graduated’ from the lab: Tia, Flak,

Annette, Karen, and Anne-Thank you for taking me under your wings and continuing to act as mentors to me. To the international trainees: Eduardo, Cris, Jana, Eduardo 2, and Evelin—I greatly enjoyed working with each of you and value your friendships! To Sri and Brent: I consider you my lab siblings and have enjoyed sharing all of the ups and downs with you! Also, thank you to Ben, Rachel, Kenny, Jessie, and Brittany for not only being great lab mates, but also great friends! Also, thank you to everyone at the MDI, past and present! Eric, Parinaz, Yve,

Amy, Abby, Randall, Diego, Nikki, Lauren, Reenie, Jenny, Jon, Jody, Brad, Saeed, etc.

Thank you to the Neuroscience graduate program, all of the coordinators, students, and faculty members!

I also have had the privilege to work with a number of great educators throughout my academic studies. I would especially like to thank my undergraduate adviser, Fr. Mark Gruber, and my undergraduate mentor, Dr. Michael Rhodes. Fr. Mark taught me how to think critically in a manner that facilitates deeper understanding of the world that we live in. If it weren’t for

Michael, I would not be here….period. My love for the HPA axis began in his lab. It is also fitting that Michael is the lead singer of Phineas Gage and my dissertation is focused on the prefrontal cortex. Coincidence? I think not.

I would like to thank my family and friends that are family. It is only through their support that I have been able to make it this far. I would especially like to thank my mom who instilled a strong work ethic in me and showed me that I could achieve anything that I wanted to if I worked hard enough. To my cousin, Brittany, thank you for being an inspiration and always having a positive attitude even in the worst of times. Thank you to my Aunt Sandy, Uncle Donny, and in- laws Judy and Bruce for also always supporting me. Thank you to Kristen, Kristy, Megan, and

Christina for always being there for me.

To my dogs, Spock and Frank, thank you for always knowing how to cheer me up when things aren’t going quite the way I want them to---like another failed virus or terrible western blot/qPCR fiasco. And thank you especially to Spock for not ‘killing’ my computer while I was writing my dissertation.

To my husband, Brian, thank you for all of your support and for cooking amazing dinners every night so we don’t starve. Thank you for everything you do day in and day out to support me and for your understanding and patience. I love you and am so glad that I got to marry my best friend and that I got you in my corner.

Finally, I would like to dedicate my dissertation to the memory of my grandfather. My grandfather was a very special person that left such a positive impact on every person that he

vi met. He also taught me the importance of working hard and I will always have fond memories of working on homework and science projects together. I will end with words of advice from my grandfather to me on my 13th birthday that I will always cherish:

“Always set your goals high and follow your dreams. Work hard and have faith in yourself and you will accomplish anything that you set out to do."

vii

Table of Contents

GENERAL ABSTRACT……………………………………………………………………….…………ii ACKNOWLEDGMENTS………………………………………………………………………………...v LIST OF FIGURES AND TABLES……………………………………………………………………..x LIST OF ABBREVIATIONS……………………………………………………………………………xiii

CHAPTER 1: General introduction to stress and the prefrontal cortex Introduction………………………………………………………………………………………………..1 Brief History of Stress Research………………………………………………………………………..2 Neuroendocrine and Autonomic Nervous System Responses to Stress…………………………..2 Prefrontal Cytoarchitecture and Neurochemical Makeup…………………………………………....7 Synaptic Actions of Glucocorticoids in the Prefrontal Cortex………………………………………..8 Prefrontal Connectivity and Integration of Glucocorticoid-Responsive Circuits………………….10 Prefrontal Regulation of the HPA axis………………………………………………………………...11 Prefrontal Regulation of Behavior……………………………………………………………………..12 Clinical Relevance of Glucocorticoid Signaling………………………………………………………14 Clinical Evidence of Prefrontal Involvement in Stress-Related Neuropsychiatric Disorders…....16 Public Health Relevance……………………………………………………………………………….18 Objectives of Dissertation………………………………………………………………………………19

CHAPTER 2: Role of the prefrontal glucocorticoid receptor in stress and emotion

Abstract…………………………………………………………………………………………………..24 Introduction………………………………………………………………………………………………25 Materials and Methods………………………………………………………………………………....27 Results…………………………………………………………………………………………………...34 Discussion……………………………………………………………………………………………….38

CHAPTER 3: Impact of chronic stress on excitatory and inhibitory neurotransmission in the prefrontal cortex

Abstract………………………………………………………………………………………………….54 Introduction……………………………………………………………………………………………...55 Materials and Methods…………………………………………………………………………………57 Results…………………………………………………………………………………………………...66 Discussion……………………………………………………………………………………………….69

CHAPTER 4: Sufficiency of the glucocorticoid receptor for prefrontal neuroendocrine and behavioral regulation Abstract………………………………………………………………………………………………..…88 Introduction……………………………………………………………………………………………....89 Materials and Methods………………………………………………………………………………….91 Results……………………………………………………………………………………………………97 Discussion………………………………………………………………………………………………100

CHAPTER 5: General Discussion and Future Directions Summary of Dissertation Research………………………………………………………………….117 Stress and Energetics: A New Framework for Understanding Adaptation………………………118 The Medial Prefrontal Cortex as a Coordinator of Stress Adaptation………...………………….122

viii

Glucocorticoids Act via the Glucocorticoid Receptor in Specific Prefrontal Subregions to Promote Synaptic, Neuroendocrine, and Behavioral Adaptation ………………………………..123 Linking Glucocorticoid Signaling to Energetics……………………………………………………..126 Future Directions and Considerations……………………………………………………………….127 Conclusions…………………………………………………………………………………………….129

BIBLIOGRAPHY……………………………………………………………………………………….133

LIST OF FIGURES AND TABLES

CHAPTER 1

Table 1.1. Site-specific effects of glucocorticoids on synaptic transmission and plasticity……..20

Table 1.2. Site-specific effects of glucocorticoids on limbic circuits regulating HPA axis activity…………………………………………………………………………………………………….21

Table 1.3. Site-specific effects of glucocorticoids on limbic circuits regulating depression-, anxiety-, and fear-related behaviors………………………………………………………………….22

CHAPTER 2

Figure 2.1. shRNA-GR 469 knocked down glucocorticoid receptor expression relative to two other constructs………………………………………………………………………………………….41

Figure 2.2. Verification and specificity of a short hairpin RNA targeting the glucocorticoid receptor (shRNA-GR)…………………………………………………………………………………..42

Figure 2.4. Neuronal viability and mineralocorticoid receptor immunoreactivity remains intact following shRNA-GR microinjection…………………………………………………………………...44

Figure 2.5. Increased helplessness behavior after GR knockdown in the ilPFC………………..45

Figure 2.6. Increased locomotor activity after GR knockdown in the plPFC relative to vector control-microinjected animals………………………………………………………………………….46

Figure 2.7. Differential impact of GR knockdown in the ilPFC vs. plPFC on hypothalamic- pituitary-adrenal axis reactivity after acute and chronic stress……………………………………..47

Figure 2.9. The GR knockdown in the plPFC but not ilPFC of chronically stressed animals significantly increased baseline corticosterone levels. ……………………………………………..49

Table 2.2. Duration and velocity in the center vs. periphery of the open field, freezing/inactivity, and number of rears following glucocorticoid receptor (GR) knockdown or vector control-

x microinjection in the infralimbic prefrontal cortex (ilPFC) or the prelimbic prefrontal cortex (plPFC) in the open field test………………………………………………………………………...... 51

CHAPTER 3

Figure 3.1. Representative Example of Cumulative eIPSC Amplitude vs. Stimulus Number plot………………………………………………………………………………………………………..75

Figure 3.2. Neuroanatomical location of patch clamping and representative traces……………76

Figure 3.3. Chronic stress increases inhibitory neurotransmission in the infralimbic cortex…..77 Figure 3.4. Chronic stress does not affect evoked responses in the ilPFC………………………78

Figure 3.5. Number of Gad65 appositions onto CaMKII-positive cells in the infralimbic cortex of naïve and chronically stressed animals……………………………………………………………....79 Figure 3.6. Percentage of GR and Gad67, CaMKII, or PV colocalization across all layers of the infralimbic mPFC in naïve and chronically stressed animals……………………………………….80

Figure 3.7. Lack of GR colocalization with calbindin and CCK interneurons………………….....81

Figure 3.8. Effect of chronic stress on GR and calretinin colocalization………………………….82

Figure 3.9. Chronic stress impairs initial behavioral flexibility……………………………………..83

Figure 3.10. Schematic of effects of acute stress vs. chronic stress on interneuronal plasticity and inhibitory neurotransmission in the ilPFC………………………..……………………………...84

Figure 3.11. Schematic of effects of acute and chronic stress on prefrontal engagement….....85

Table 3.1. Antibodies used in the present study………………………………………………….....86

CHAPTER 4

Figure 4.1. Lentiviral constructs used to express eGFP or GR, respectively…………………..104

Figure 4.2. pLV-GR upregulates GR expression and attenuates corticosterone response…..105

Figure 4.3. pLV-GR consistently upregulates GR expression in the ilPFC…………………….106

Figure 4.4. There were no significant differences in duration or distance traveled in the open field at the beginning or end of CVS…………………………………………………………………107

Figure 4.5. GR Overexpression increased closed arm duration and decreased distance traveled in the elevated plus maze (EPM) at the end of CVS……………………………………………....108

Figure 4.6. GR overexpression reverses chronic stress-induced increase in risk-assessment………………………………………………………………………………………..109

Figure 4.7. GR Overexpression decreases learned helplessness in the last 5 min of the FST……………………………………………………………………………………………………...110

Figure 4.8. GR Overexpression attenuates or increases corticosterone responses in animals without and with a history of chronic stress, respectively…………………………………………111

Table 4.1: 14 day Chronic Variable Stress (CVS) regime…………………………………………………………………………………………………..112

Table 4.2. Behaviors in the 5 min open field following pLV-GFP- or pLV-GR microinjection in the infralimbic prefrontal cortex (ilPFC) at the beginning and end of CVS…………………………..113

Table 4.4. Somatic markers of chronic stress……………………………………………………...115

CHAPTER 5

Figure 5.1. Stress, energetics, and adaptation…………………………………………………….131

Figure 5.2. Prefrontal Orchestration of Energetic Systems………………………………………132

xii

LIST OF ABBREVIATIONS

ACTH Adrenocorticotropic hormone

AVP Arginine vasopressin

ANOVA Analysis of variance

CaMKIIα Calcium calmodulin kinase II alpha

CCK Cholecystokinin

CRF Corticotropin-releasing factor

EPM Elevated plus maze eEPSC Evoked excitatory postsynaptic current eIPSC Evoked inhibitory postsynaptic current

FST Forced swim test

GABA Gamma-amino-butyric acid

GAD Glutamic acid decarboxylase

GFAP Glial fibrillary acidic protein

GR Glucocorticoid receptor

HPA Hypothalamic-pituitary-adrenocortical ilPFC Infralimbic prefrontal cortex mEPSC Miniature excitatory postsynaptic current mIPSC Miniature inhibitory postsynaptic current mPFC Medial prefrontal cortex

MR Mineralocorticoid receptor

PVN Paraventricular nucleus

PV Parvalbumin

PACAP Pituitary adenylate cyclase-activating peptide plPFC Prelimbic prefrontal cortex

PENK Pro-enkephalin

xiii

RT qPCR Real time quantitative polymerase chain reaction shRNA Short hairpin ribonucleic acid sEPSC Spontaneous excitatory postsynaptic current sIPSC Spontaneous inhibitory postsynaptic current

TTX Tetrodotoxin

VIP Vasoactive intestinal peptide

xiv

CHAPTER 1 General Introduction to Stress and the Prefrontal Cortex

Part of this chapter has been published and is used in this dissertation with permission from the publisher. The citation is: Myers, B.,* McKlveen, J.M.,* and Herman, J.P. (2014). Glucocorticoid actions on synapses, circuits, and behavior: Implications for the energetics of stress. Frontiers in Neuroendocrinology, 35(2): 180-196. *indicates co-first authorship.

Part of this chapter has been submitted for publication and was under review at the time of this dissertation submission. Stress responsiveness is a highly evolutionarily conserved process that promotes survival of the organism despite uncontrollable and often unpredictable changes in the environment (i.e. context). The stress response engages both autonomic and neuroendocrine systems to mobilize energy needed to meet the challenge at hand. Accordingly, these responses are both tightly regulated throughout the central nervous system and adaptable to the energetic needs of the individual.

Brief History of Stress Research

The scientific understanding of ‘stress’ and its ramifications for the organism have continually evolved. Based on Claude Bernard’s theory of the internal milieu, Walter Cannon first used the concept of homeostasis to explain the ‘fight-or-flight’ response of an organism presented with a threat (Cannon, 1932). In a biological sense, Hans Selye coined the term

‘stress’ as the non-specific response of the body to any homeostatic demand (Selye, 1936).

While it is still generally accepted that the physiological role of the stress response is to coordinate autonomic, neuroendocrine, and immune responses to potential homeostatic threats, an emerging concept in stress neurobiology suggests that the primary role of stress responding is to mobilize energy to promote context-specific survival and not necessarily sustain homeostatic systems at levels maintained prior to a challenge (Dallman et al., 2006; Nederhof and Schmidt, 2012). Given this framework, responses to both acute and chronic stress are considered adaptive, up to a point, and prepare the organism for current and future demands.

Thus, presently, stress will be defined as a stimulus that mobilizes energetic systems to respond to an ongoing or anticipated challenge.

Neuroendocrine and Autonomic Nervous System Responses to Stress

Responding to stress involves the concerted activity of multiple, interacting central stress-regulatory systems to mobilize energy for the organism. Activation of the stress response occurs either as a consequence of, or in anticipation of, a challenge (Myers and Herman, 2012).

Anticipatory responses require the organism to reference prior experiences to predict the need

2 for energy mobilization, primarily mediated by multi-synaptic forebrain projections to the medial parvocellular paraventricular nucleus (PVN) of the hypothalamus. Systemic challenges are largely reflexive responses to physiological disruption generated by direct projections from the hindbrain to the PVN, though there is considerable overlap and integration at various nodes throughout the brain ( Herman et al., 2003; Herman et al., 2012; Ulrich-Lai and Herman, 2009).

Thus, the neuroendocrine response to stress is a highly-regulated, temporal process, involving the integration of sensory information from multiple modalities to rapidly activate, as well as inhibit the secretion of glucocorticoids. The neuroendocrine stress cascade, comprising the hypothalamic–pituitary–adrenocortical (HPA) axis, begins with the release of adrencorticotropic hormone (ACTH) secretagogues from neurosecretory neurons in the medial parvocellular PVN, which project to hypophysial portal vessels in the external zone of the median eminence (Bruhn et al., 1984) . Secretagogues travel via the portal veins to the anterior pituitary gland, where they can access corticotropes (De wied et al., 1957; Gibbs and Vale, 1982; McCann and

Fruit,1957; Saffran and Schally, 1956).The pioneering work of Wylie Vale and colleagues provided initial identification of corticotropin releasing factor (CRF) as the primary driver of pituitary ACTH release (Bale and Chen, 2012; Rivier and Vale, 1983a, 1983b; Rivier et al.,

1982; Spiess et al., 1981; Swanson et al., 1983; Vale et al., 1981). Subsequent studies, also by

Vale and colleagues, revealed the existence of several co-secretagogues that synergize with

CRF, including arginine vasopressin (AVP) (Rivier and Vale, 1983a, 1983b; Sawchenko et al.,

1984; Vale et al., 1983, 1981). By way of the systemic circulation, ACTH acts at the level of the adrenal cortex to induce the release of glucocorticoids, cortisol in some species (e.g.,humans, non-human primates) and corticosterone in others (e.g.,rats, mice) (Dallman and Jones, 1973;

Dallman et al., 1987). At the adrenal gland, cortisol/corticosterone is released in pulses, the timing of which dictates the overall magnitude of both baseline activity and stress responses

(Lightman et al., 2008; Young et al., 2004). Pulsatile patterns of glucocorticoid release are dictated by ultradian rhythms (for review see de Kloet and Sarabdjitsingh, 2008; Sarabdjitsingh

3 et al., 2012). This rhythmicity of glucocorticoid release is essential for maintaining cellular responsiveness and promotes wide-ranging glucocorticoid actions from gene transcription to behavior (Conway-Campbell et al., 2010; Sarabdjitsingh et al., 2010). Glucocorticoids then travel throughout the body, exerting a multitude of effects in the periphery including glycogen breakdown and gluconeogenesis (Coderre et al., 1991; Exton, 1979; Munck et al., 1984);for detailed reviews of brain circuits regulating glucose homeostasis see (Schwartz et al., 2000;

Seeley and Woods, 2003; Woods et al., 1998). Glucocorticoids cross the blood–brain-barrier, and primarily bind to mineralocorticoid (MR) and glucocorticoid receptors (GR) in neurons and/or glia. Circulating glucocorticoids diffuse through cell membranes where they bind to intracellular MR and GR. Activated MR and GR dissociate from heat shock proteins and form dimer complexes with other activated MR and GR receptors, respectively (Almawi et al., 2002;

Prager and Johnson, 2009; Pratt and Dittmar, 1998; Wikstrom, 2003) The MR or GR dimers then translocate to the nucleus where they modify gene expression, via transcription or transrepression, by binding to glucocorticoid response elements (Beato and Sanchez-Pacheco,

1996). Glucocorticoids also bind to membrane-associated MRs and GRs, though the molecular underpinnings of this process are still being uncovered (see Prager and Johnson, 2009). In the brain, MR has high-binding affinity for corticosteroids and, consequently, is activated at basal levels (de Kloet and Sarabdjitsingh, 2008; De Kloet et al., 1998). Thus, MR is thought to sense resting levels of glucocorticoids and promote key functions associated with low glucocorticoid levels, including circadian drive of the HPA axis and mnemonic function (de Kloet et al., 2005).

Conversely, GR has a lower binding affinity for glucocorticoids and is largely unoccupied at basal levels. Thus, GR is thought to be particularly important in signaling mediated by stress levels of glucocorticoids (Boyle et al., 2005; De Kloet and Reul, 1987; de Kloet et al., 2005; Reul and de Kloet, 1985). GR is abundantly expressed throughout the brain, including the following primary stress-regulatory sites: medial prefrontal cortex (mPFC), hippocampus, amygdala, bed

4 nucleus of the stria terminalis (BST), hypothalamus, and hindbrain (Fuxe et al., 1987; Meaney et al., 1985; Reul and de Kloet, 1986). MR has a more restricted distribution that overlaps with that of GR in several key regions, including the mPFC, hippocampus, and amygdala (De Kloet and

Reul, 1987; Reul and de Kloet, 1985).

Energy mobilization following stress also occurs through activation of the autonomic nervous system. The sympathetic arm of the autonomic nervous system (ANS) is activated within seconds of stressor presentation, in order to prepare the individual to respond immediately, and rapidly subsides as the parasympathetic arm of the ANS is activated (Ulrich-

Lai and Herman, 2009, for review). Sympathetic activation is driven by activation of preganglionic neurons in the interomediolateral cell column (IML), which innervate specific sympathetic ganglion neurons and participate in somato- and viscerosympathetic reflexes with distinct afferent inputs, such as the rostral ventrolateral medulla (RVLM), paraventrincular nucles (PVN), the medullary raphe, locus coeruleus (LC), and lateral hypothalamus (LH)

(Benarroch, 2012; Janig and Habler, 2003; Ulrich-Lai and Herman, 2009). In addition, stress activates sympathetic inputs to the adrenal medulla, triggering the release of epinephrine and norepinephrine, and to the heart, which increases heart rate, cardiac output, and blood pressure

(Ziegler et al., 2012). These changes, along with others, promote energy mobilization and enable the individual to cope with the stressor at hand. Parasympathetic activation is mediated by preganglionic neurons in the dorsal motor nucleus of the vagus (DMV) and the ventrolateral portion of the nucleus ambiguous (NAmb) in the medulla. ‘Vagal tone’ to the respiratory tract and heart is provided by the DMV and NAmb, respectively, and is mediated in part from nucleus of the solitary tract (NTS) inputs (Benarroch, 2012; Ulrich-Lai and Herman, 2009). Spinal and medullary nuclei, in turn, coordinate appropriate autonomic responses with descending information from the limbic forebrain and hypothalamus, through crosstalk with autonomic integrative sites in the hindbrain (e.g. raphe pallidus, the lateral parabrachial nucleus, and the

Kolliker-Fuse nucleus), midbrain, and forebrain [e.g. dorsomedial hypothalamus (DMH)]

(Iversen et al., 2000; Ulrich-Lai and Herman, 2009). While it is important to recognize that the

ANS plays a large role in responses to stress and energy mobilization, the present dissertation will focus on the neuroendocrine component of the response to stress.

There is a vital need for glucocorticoid activity to be tightly regulated, requiring systems coordination from cellular to behavioral levels. In response to stress, glucocorticoid signaling promotes organismal adaptation to environmental conditions and helps to meet the resulting energetic demands. This adaptation requires the integration of multiple systems and engages key limbic-neuroendocrine circuits. Forebrain, hypothalamic, and hindbrain circuits are activated by glucocorticoids and participate in the coordination of physiological and behavioral output.

However, when energetic drive does not appropriately match environmental demand, or the organism is chronically activating these systems, risk factors emerge for a variety of stress- related pathologies. The present dissertation will start by first reviewing the actions of glucocorticoids in the prefrontal cortex, a key stress-regulatory region, focusing on the rodent literature, in the context of the adaptive role of the stress response for the organism.

Specifically, the role of central glucocorticoid actions on synaptic, neuroendocrine, and behavioral regulation will be summarized, highlighted by a discussion of the energetic integration of stress and the importance of context-specific regulation of glucocorticoids. The energy mobilizing effects of glucocorticoids require integration of cellular activity, circuit connectivity, and behavioral output to coordinate context-appropriate adaptation. We propose that glucocorticoid-mediated energetic drive generates an adaptive capacity in response to environmental demand; however, the cost of repeatedly or excessively driving adaptive systems may compromise performance under conditions of elevated environmental pressure. Thus, we will examine the integrative actions of glucocorticoids on the primary limbic sites mediating organismal stress responsiveness within the framework of context-specific adaptation.

Cytoarchitecture and Neurochemical Makeup of the Medial Prefrontal Cortex

The rodent mPFC is divided into three distinct subregions based on connectivity and cytoarchitecture: the anterior cingulate, prelimbic (plPFC), and infralimbic (ilPFC) cortices

(Uylings et al., 2003; Vertes, 2004). These three regions have homologous function and connectivity to human Brodmann areas 24b, 32, and 25, respectively (Gabbott et al., 2005;

Uylings et al., 2003). The mPFC is divided into 5 layers: layer I (mostly axons), layers II/III, and layers V/VI, medial-lateral, respectively. The deep layers of the mPFC are thought to represent the major output of the mPFC to subcortical structures; however, it is important to recognize that layers II/III also project outside of cortex (DeFelipe and Farinas, 1992; Gabbott et al., 2005).The plPFC projections [dorsal raphe, dorsal striatum, nucleus accumbens, basolateral complex of the amygdala (BLA), anterior bed nucleus of the stria terminalis (aBST)] are consistent with a role for the more dorsal mPFC in limbic and cognitive functions, while the ilPFC projections

[nucleus of the solitary tract (NTS), posterior hypothalamus (PH), intercalated cells of the BLA, parabrachial nucleus, rostral ventrolateral medulla (RVLM)] suggest a role in visceral/autonomic responses (see Gabbott et al., 2005; Myers et al., 2012; Radley et al., 2009; Vertes, 2004).

The prefrontal cortex is predominantly made up of glutamatergic pyramidal neurons

(~85%) and an array of local interneuron populations (~15%), including those expressing parvalbumin (PV), cholecystokinin (CCK), vasoactive intestinal polypeptide (VIP), calretinin, calbindin, and somatostatin (Gabbott et al., 1997; Kubota et al., 1994; Uematsu et al., 2008).

Parvalbumin makes up the majority of the GABAergic interneuron population (~52%), and is thought to primarily regulate glutamatergic output and regulate theta oscillations via perisomatic contacts onto pyradimal neurons (Courtin et al., 2014). Somatostatin neurons also are thought to regulate glutamatergic output via synaptic contacts onto the dendritic trees of glutamatergic pyramidal neurons (Pi et al., 2013). These two interneuron populations may in turn be regulated by another interneuron subtype, the VIP neurons (Pi et al., 2013). Thus, the prefrontal glutamatergic neurons are under tight regulatory control by local interneuron circuits.

Synaptic Actions of Glucocorticoids in the Prefrontal Cortex

The cellular actions of glucocorticoids are largely dependent on brain site and the relative expression of GR and MR (de Kloet, 2013a) (Table 1.1). Glucocorticoids can act in concert with monoaminergic and peptide neurotransmitters, particularly noradrenergic

(Quirarte et al., 1997;Roozendaal et al., 2002, 2006, 2008)and CRF systems (Bale and Vale,

2004; Bale, 2005; Meng et al., 2011), which have been reviewed elsewhere (de Kloet, 2013b;

Ferry and McGaugh, 2000; Heinrichs and Koob, 2004; Roozendaal, 2000). Further, the synaptic actions of glucocorticoids are critically affected by the recent stress history of the organism, a concept known as ‘metaplasticity’ (Schmidt et al., 2013). Acute and chronic stress often yield different effects on cellular function to meet context-specific energetic demands placed on the organism. Thus, we will discuss the effects of glucocorticoids on cellular function in light of these considerations.

We are only now just beginning to understand how glucocorticoids affect neurotransmission in the mPFC. As will be discussed further, glucocorticoids have profound effects on prefrontal-mediated learning and memory, which occurs through changes in neurotransmission at the synapse. Molecular and functional studies indicate that glucocorticoids acutely increase glutamatergic output from the mPFC (Popoli et al., 2012). Microdialysis and microelectrode sampling experiments indicate increased extracellular glutamate in vivo in the mPFC following acute stress (Bagley and Moghaddam, 1997; Hascup et al., 2010; Moghaddam,

1993). Acute foot shock increases depolarization-evoked release of glutamate in isolated synaptosomes via a GR-dependent mechanism and increases the amplitude of excitatory postsynaptic currents (EPSCs) in mPFC pyramidal neurons (Musazzi et al., 2010; Treccani et al., 2014a). In adolescent rats, acute stress also increases NMDA- and AMPA-mediated excitatory currents by up-regulating the expression of these receptors on the postsynaptic membrane (via serum- and glucocorticoid-inducible kinases) (Yuen et al., 2011, 2009).Thus,

8 existing data suggest that acute stress activates mPFC neurons, permitting down-stream activation of target regions (see below).

Very few studies have assayed inhibitory neurotransmission after acute corticosterone application. A recent study in mice found that corticosterone decreased miniature inhibitory postsynaptic currents (mIPSCs) and increased paired pulse inhibition, suggesting that acute glucocorticoid exposure disinhibits glutamatergic output from the mPFC (Hill et al., 2011). The effects of corticosterone on mIPSCs were prevented by cannabinoid receptor 1 (CB1) antagonism, suggesting that the effect of acute stress on disinhibition of mPFC pyramidal neurons is likely endocannabinoid-dependent (Hill et al., 2011). Overall, the present data suggest that glucocorticoids acutely increase glutamatergic neurotransmission and decrease inhibitory neurotransmission in the mPFC. It remains to be determined whether reduced inhibition contributes to enhanced mPFC excitability. The synaptic effects of glucocorticoids in the mPFC during chronic stress are not as well established, and the effects on excitatory and inhibitory neurotransmission are largely unknown. Repeated restraint stress, chronic unpredictable stress, or chronic corticosterone treatment decrease apical dendritic complexity of pyramidal neurons (Cerqueira et al., 2007, 2005; Cook and Wellman, 2004; Goldwater et al.,

2009; Liston et al., 2006; Radley et al., 2006b, 2004; Wellman, 2001). Conversely, repeated restraint stress increases the complexity and transcriptional activity of prefrontal GABAergic interneurons (Gilabert-Juan et al., 2013). While the functional consequence of these morphologic modifications is unknown, the direction of changes suggests both decreased pyramidal cell excitability and increased capacity for interneuron-mediated inhibition. Moreover, recent work correlates stress-induced decreases in glutamatergic pyramidal complexity in deep layer (V) of the mPFC with reduced excitatory neural responses to serotonin (Holmes and

Wellman, 2009; Liu and Aghajanian, 2008).Thus, overall it appears that acute stress increases excitatory neurotransmission in the mPFC, while chronic stress adaptation may promote a decrease in excitability of the prefrontal glutamatergic output neurons.

In adolescent rats, chronic stress decreases NMDA- and AMPAR-mediated currents in the mPFC through increased degradation of postsynaptic glutamate receptors (Yuen et al.,

2012). Notably, adolescence is a developmental period marked with pruning of prefrontal glutamatergic synapses, particularly those to the basolateral amygdala (BLA) (Cressman et al.,

2010).Therefore, it remains to be determined whether increased degradation of glutamate receptors is due to chronic stress or stress/development interactions (for review on adolescent synaptic plasticity, see Selemon, 2013). In adult animals, chronic corticosterone administration decreases expression of NMDA subunit NR2B and AMPA subunits GluR2/GluR3 in the ventral mPFC (Gourley et al., 2009). However, the impact of chronic stress on inhibitory neurotransmission in the mPFC has not been directly tested, further highlighting the need for a better understanding of chronic glucocorticoid effects on synaptic physiology in adult animals.

Thus, by altering the balance between excitatory and inhibitory neurotransmission, glucocorticoids are able to induce a shift toward excitation acutely and inhibition chronically, setting the gain of prefrontal influence on downstream targets, depending on context.

Connectivity and Integration of Glucocorticoid-Responsive Circuits

Stress integrative functions are regulated by forebrain circuits, primarily involving areas such as the mPFC (but also hippocampus and amygdala) (Ulrich-Lai and Herman, 2009).

(Table 1.2). Notably, these interconnected limbic forebrain sites do not send substantial projections to stress-effector neurons in the PVN. Thus, their influence on HPA axis output is communicated through intervening PVN-projecting neurons. Inhibitory GABAergic inputs to the

PVN emanate from several structures in the basal forebrain and hypothalamus, including the

BST, preoptic area (POA), and DMH (Boudaba et al., 1996; Radley et al., 2009; Roland and

Sawchenko, 1993). In contrast, glutamatergic inputs to the PVN originate predominantly from hypothalamic nuclei, including the ventromedial hypothalamus (VMH), posterior hypothalamus

(PH), as well as DMH (Ulrich-Lai and Herman, 2009). Neurons in these regions, including those that project to the PVN, show pronounced activation by stressful stimuli (Cullinan et al., 1996,

1995), consistent with a role in stress regulation. All hypothalamic PVN-projecting regions receive mixed GABAergic and glutamatergic input from other hypothalamic nuclei (Myers et al.,

2014a), which may be responsible for intra-hypothalamic mechanisms governing the integration of forebrain limbic inputs and stress responsiveness based on metabolic demand. Importantly,

GR is expressed in numerous hypothalamic PVN-projecting neurons, including the POA, DMH, and arcuate nucleus (Fuxe et al., 1987). In the PVN, glucocorticoids signal by non-genomic mechanisms to rapidly inhibit activation of parvocellular neurons and consequent drive on the

HPA axis (Evanson et al., 2010; Tasker and Herman, 2011). These ‘fast feedback’ glucocorticoid effects are non-genomic in nature, acting through an endocannabinoid-dependent mechanism to inhibit glutamatergic drive (Tasker and Herman, 2011). Fast inhibitory effects of glucocorticoids are attenuated in animals with PVN GR deletion, consistent with action via GR

(Haam et al, 2010). However, the role of GR in other PVN projecting hypothalamic cell groups remains to be determined.

Prefrontal Regulation of the HPA axis

Glucocorticoids act at the mPFC to inhibit HPA axis responses to psychogenic stress

(e.g. restraint) (Akana et al., 2001; Diorio et al., 1993). Glucocorticoids also mobilize endocannabinoids in the mPFC in response to acute stress, and CB1 antagonism disinhibits the

HPA axis (Hill et al., 2011). Thus, glucocorticoids acutely inhibit the HPA axis via GR and consequent effects on endocannabinoid signaling. Glucocorticoids in the mPFC play a region- and context-specific role in HPA axis regulation during acute and chronic stress. Prefrontal output neurons are almost exclusively glutamatergic, and projections from the plPFC to

GABAergic neurons in the anterior BST mediate inhibition of HPA responses to acute stress

(Radley et al., 2009). The intervening structures relaying the influence of the ilPFC to the PVN have yet to be determined. Preliminary studies from our group indicate the PH may be important for integrating ilPFC output with HPA responses (Myers et al., 2012).

Prefrontal Regulation of Behavior

Activation of glucocorticoid responsive pathways, particularly within the limbic system, can lead to pronounced changes in behavior that have long-term implications for organismal well-being (Arnett et al., 2011) (Table 1.3). Functional changes at the synaptic and circuit levels affect a variety of neurobehavioral systems. For instance, mice with deletion of GR in the forebrain (mPFC, hippocampus, and BLA) exhibit increased despair-like behavior in the forced swim test (FST) and tail-suspension test (TST), as well as anhedonia in the sucrose preference test (Boyle et al., 2005). In addition, mice overexpressing MR in the forebrain exhibit decreased anxiety-like behavior in the open field test (OFT) and elevated-plus maze (EPM) (Rozeboom et al., 2007). These studies support a role for forebrain glucocorticoid signaling in inhibiting behavioral responses indicative of depression and anxiety. Although numerous psychiatric disorders are associated with dysregulation of stress systems, the precise role of glucocorticoid dyshomeostasis in pathology remains to be determined.

The prefrontal cortex has a number of signature behavioral functions, including working memory, behavioral flexibility, decision-making, and planning (Broersen, 2000). All of these processes require the ability to reference past experiences to prospectively plan an appropriate response for the given context. Working memory, in particular, requires the ability to transiently maintain a ‘mental sketch pad’ of recent information to direct subsequent actions (Baddeley et al., 1991; Goldman-Rakic, 1995). Stress has a profound effect on each of these processes, inducing changes that are important for adaptation in the face of ongoing stress.

It has been well documented that acute, as well as, chronic stress impair working memory (Arnsten et al., 2012; Barsegyan et al., 2010; Mika et al., 2012; Mizoguchi et al., 2004,

2000; Roozendaal et al., 2004; Shansky and Lipps, 2013). Acutely, glucocorticoids act through the cAMP pathway in the plPFC to impair working memory and enhance memory consolidation

(Barsegyan et al., 2010; Roozendaal et al., 2004). Thus, glucocorticoid signaling reinforces consolidation of emotionally salient events while minimizing competing information,

12 underscoring the context-specific actions of glucocorticoids. The dopamine system has also been implicated in impairments of spatial working memory, including both hyper- and hypodopaminergic function, suggesting that optimal dopamine function is essential for prefrontal regulation of working memory (Arnsten and Goldman-Rakic, 1998; Bubser and Schmidt, 1990;

Mizoguchi et al., 2000; Murphy et al., 1996; Zahrt et al., 1997). Moreover, chronic stress is thought to impair spatial working memory through a dopamine receptor-1-mediated hypodopaminergic mechanism in the prefrontal cortex (Mizoguchi et al., 2000).

Lesions of the mPFC have demonstrated the importance of the mPFC for flexibility and attentional set-shifting (Birrell and Brown, 2000; de Bruin et al., 1994; Floresco et al., 2009,

2008, 1997). Chronic unpredictable stress or repeated restraint stress also impair behavioral flexibility (set-shifting and/or reversal learning) in the extra-dimensional set-shifting task, which requires animals to inhibit a previously learned response (Birrell and Brown, 2000; Bondi et al.,

2008; Liston et al., 2006).

Decision-making and planning are also primary executive functions of the prefrontal cortex that are negatively impacted by stress (Graham et al., 2010; Graybeal et al., 2012;

Starcke and Brand, 2012). Acute restraint stress impairs the ability of animals to execute the delayed spatial win-shift task, a mPFC-mediated task, which relies on the ability to use information acquired prior to a delay to prospectively plan where to retrieve food in a radial arm maze (Butts et al., 2011). Moreover, acute administration of corticosterone systemically or directly into the infralimbic cortex rapidly impairs the decision-making ability of rats in a rodent version of the Iowa Gambling Task, a prototypic tool commonly used in humans to assess decision-making (Koot et al., 2014, 2013). Further, chronic stress favors habitual strategies in two instrumental operant tasks involving evaluation of outcome value and action-outcome contingency, reducing the ability of animals to employ flexible, goal-directed decision-making.

This shift to habitual behavior is accompanied by atrophy of the mPFC (Dias-Ferreira et al.,

2009). Moreover chronic corticosterone and GR blockade both impair decision-making based on action-outcome contingencies (Gourley et al., 2012; Swanson et al., 2013)

The mPFC has also been implicated in the regulation of mood. Deep brain stimulation

(DBS) of this region in rats has an ‘antidepressant’-like effect in the FST, a rodent assay of helplessness (Hamani et al., 2010ab; 2014). Further, DBS of the ventral mPFC ameliorates stress-induced anhedonia-like behavior in the sucrose preference test (Hamani et al., 2012). It is important to note, however, that ibotenate lesions of the ventral mPFC did not block the effects of DBS (Hamani et al., 2010). Thus, fibers nearby may be implicated in the effects of ventral mPFC DBS. However, optogenetic stimulation of mPFC cell bodies prevents social avoidance evoked by repeated social defeat and specific prefrontal glutamatergic projections to the raphe modulate coping style in the FST (Covington et al., 2010; Warden et al., 2012). These behaviors share a common ‘prefrontal cortex-related’ feature, in that the organism must coordinate an appropriate context-specific response by maintaining attention and flexibly inhibiting inappropriate responses.

In total, the behavioral data suggest that the mPFC is particularly important for coordinating an appropriate context- and temporal-specific decision (Myers et al., 2014b).

Chronic stress in particular seems to impair this process, taking the prefrontal cortex ‘offline,’ and induces a shift toward more habitual, less goal-oriented responses in rodents.

Clinical Relevance of Glucocorticoid Signaling

Recent technological advances have allowed for more in-depth analysis of glucocorticoid effects in humans. In healthy controls, glucocorticoids have profound time-dependent effects on memory and decision-making. For instance, the synthetic glucocorticoid hydrocortisone given

30 min prior to a memory encoding task impairs memory contextualization performance, whereas hydrocortisone given 210 min prior to the task has the opposite effect (van Ast et al.,

2013). These findings suggest that the rapid effects of glucocorticoids promote memory of the most emotionally salient aspects of an experience impairing less salient functions (e.g. decision-

14 making), whereas the delayed effects of glucocorticoids may enhance cognitive function.

Similarly, hydrocortisone given before sleep in the evening after the presentation of emotional imagery enhances memory consolidation of emotional information and suppresses amygdalar activation during retrieval (van Marle et al., 2013). Thus, the importance of glucocorticoids for regulating cognitive function and the brain regions mediating glucocorticoid activity during these processes are beginning to be characterized in humans. While there has been a recent increase in the number of studies assessing the central actions of glucocorticoids in humans, there is still a vital need to establish the mechanistic effects of glucocorticoids in health, as well as psychopathology.

Glucocorticoid signaling is essential for adaptation to stress and alterations in glucocorticoid activity may underlie transitions to pathology in humans. In fact, several polymorphisms of the glucocorticoid receptor gene have been reported in individuals with major depressive disorder (MDD). For instance, the single nucleotide polymorphism (SNP) Bcl-1

(C to G nucleotide change involving a restriction site in intron 2) is associated with glucocorticoid hypersensitivity and lower cortisol levels (Derijk and de Kloet, 2008; Derijk et al.,

2008; Hauer et al., 2011; Huizenga et al., 1998; Kumsta et al., 2008; van Rossum et al., 2006,

2003). Patients with MDD often display hypercortisolemia (Yehuda et al., 2004).

Hypometabolism (decreased uptake of fluorine deoxyglucose), as well as hypermetabolism

(increased regional cerebral blood flow) have been reported in the subgenual anterior cingulate cortex (Brodmann area 25) of patients with MDD (Drevets, 2000; Mayberg et al., 2005).

Additionally, hydrocortisone decreases subgenual cingulate cortex oxygen utilization evoked by sad stimuli, suggesting that this region is a key target for glucocorticoid-mediated effects on emotional processes (Sudheimer et al., 2013). Thus, the aggregate data suggest that glucocorticoids have pronounced effects on local metabolic activity within forebrain limbic circuits and alterations in glucocorticoid signaling within these areas may play a prominent role in stress-related neuropsychiatric disorders.

Clinical Evidence of Prefrontal Involvement in Stress-related Neuropsychiatric Disorders

Perhaps one of the best and probably most well-known representations of prefrontal cortical dysfunction lies in the case of Phineas Gage (Damasio et al., 1994; Harlow, 1868; Van

Horn et al., 2012). Indeed, damage to or lesions of the prefrontal cortex promote working memory impairment (Baier et al., 2010; Barbey et al., 2013; Muller et al., 2002; Tsuchida and

Fellows, 2013), cognitive inflexibility (Colvin et al., 2001; Milner et al., 1985; Schnyer et al.,

2009), impairments in decision making (Bechara et al., 2000, 1994; Clark et al., 2008; Levens et al., 2014; Manes et al., 2002; Waters-Wood et al., 2012), poor planning ability (Bechara et al.,

1996), and disrupted emotional processing (Bramham et al., 2009; Chaudhury et al., 2014; Dal

Monte et al., 2013; Damasio et al., 1994; Drevets et al., 2008; Levens et al., 2014; Sanchez-

Navarro et al., 2014). Phineas Gage displayed deficits in many of these mPFC-mediated functions, as documented by Harlow shortly after Gage’s accident, including decision-making, working memory, and planning. He also particularly had difficulty with emotional processing to the point that it was said that he was “no longer Gage.” Thus, Gage represents a prime example of how damage to the mPFC can lead to deficits in these signature mPFC-mediated tasks. As discussed previously, these are all executive functions that are affected by stress in rodents.

Numerous studies have demonstrated that these same behaviors are affected by stress in humans and are disrupted in patients with stress-related disorders, such as MDD, as will be discussed further (Drevets et al., 2008).

As discussed previously, the dopaminergic system has been implicated in working memory deficits following stress. Likewise, the dopaminergic system is thought to potentially be involved in the pathogenesis of MDD, as patients with Parkinson’s disease have a two- to fourfold increase in risk for developing MDD (Drevets et al., 2008; Santamaria et al., 1986).

Further, patients with MDD do tend to have significant impairments in working memory (Landro et al., 2001; Rose and Ebmeier, 2006; Stordal et al., 2004). Thus, stress may lead to

16 disturbances in the dopaminergic system that may contribute to these stress-related neuropsychiatric disorders.

The Wisconsin-card-sorting test (WCST) is the prototypic test for measuring cognitive flexibility in humans. Subjects must be able to flexibly alter their behavior by sorting a deck of cards according to rules that change randomly throughout the task (Goldberg and Bougakov,

2005). Thus, they must be able to flexibly switch their behavior and inhibit a previously correct response. As noted previously, patients with lesions of the mPFC notoriously are unable to complete this task successfully. Likewise, patients with MDD have significant impairment (i.e. increased perseveration) in the completion of the WCST (Fossati et al., 2002; Merriam et al.,

1999). Acute stress also impairs cognitive flexibility in humans as individuals exposed to the

Trier Social Stress Test (TSST) show impairments in cognitive flexibility (Plessow et al., 2012,

2011).

There is a significant amount of data suggesting that the mechanisms underlying stress- induced deficits in rodent prefrontal function may be the same in humans with MDD. Dendritic atrophy of glutamatergic neurons, as well as glial loss are commonly induced in the prefrontal cortex of chronically stressed rats, as discussed previously (Banasr and Duman, 2007;

Cerqueira et al., 2007, 2005; Cook and Wellman, 2004; Goldwater et al., 2009; Liston et al.,

2006; Radley et al., 2006b, 2004; Wellman, 2001). Similarly, in humans, MDD is associated with reductions of gray matter volume in the left subgenial cingulate cortex using both MRI (Botteron et al., 2002; Coryell et al., 2005; Drevets et al., 2008, 1997; Hirayasu et al., 1999) and histological measures (Baumann et al., 1999; Bowen et al., 1989; Ongur et al., 1998; Rajkowska et al., 1999). These changes in rodents following stress and in humans with MDD are thought to share a common mechanism (Drevets et al., 2008; McEwen and Magarinos, 2001). Moreover, the subgenual cingulate cortex (Broadmann area 25) shows hyper- or hypoactivation, depending on the population of patients tested (Drevets et al., 1997; Mayberg et al., 2005).

Chronic stress also decreases activation of associative areas, such as the mPFC, and is

17 associated with atrophy of the mPFC (Soares et al., 2012). Moreover, these same individuals have deficits in decision-making and successfully altering behavioral strategies to reach a goal.

Thus, these alterations in morphology, volume, and activation in response to stress may share a common mechanism with these same changes observed in patients with MDD. Further, these changes may underlie deficits in behavioral flexibility, decision-making, planning, and mood that are observed in patients with MDD and in chronically stressed individuals.

Public Health Relevance

MDD is characterized by intense depressed mood and anhedonia (loss of pleasure in things once found pleasurable). Many people with MDD have a lack of energy, sleep disturbances, loss of appetite, feelings of guilt, low self-esteem, and difficulty concentrating.

Globally, more than 350 million people have MDD and it is considered to be the leading cause of disability worldwide (World Health Organization, 2012). Despite the large number of people affected and the toll on quality of life, developing effective therapeutics for the treatment of MDD has been rather difficult and quite stagnant for the last several decades. While many patients benefit from antidepressant medications and/or cognitive therapy, as many as 10-40% do not respond to antidepressant treatment (Holtzheimer and Mayberg, 2011; Rush et al., 2006).

Moreover, around 1-3% of MDD patients are completely treatment-resistant (Holtzheimer and

Mayberg, 2012). Treatment-resistant patients do not have many options and often must turn to invasive procedures that do not always guarantee relief and remission (Holtzheimer and

Mayberg, 2012). Therefore, it is imperative to continue to try to understand the neurobiological underpinnings of MDD, in order to develop more effective treatments for patients with MDD. It is with this goal in mind that the following dissertation sought to add to our knowledge of stress- related adaptation that may lead down the path to pathology.

Dissertation Objectives

On the basis of the aggregate data from the literature, we hypothesize that glucocorticoids act via the glucocorticoid receptor to regulate synaptic, neuroendocrine, and behavioral adaptation to stress. This overarching hypothesis will be tested in the following set of experiments:

1. Aim 1 tests the necessity of the prelimbic and infralimbic medial prefrontal cortical

glucocorticoid receptor for acute and chronic HPA axis regulation, as well as mood

regulation.

2. Aim 2 assesses the impact of chronic stress on excitatory and inhibitory

neurotransmission using a multi-faceted approach, including whole cell voltage-clamp

electrophysiology, immunohistochemistry, and behavior.

3. Aim 3 tests the sufficiency of the infralimbic glucocorticoid receptor for acute stress

regulation, as well as the ability of glucocorticoid receptor overexpression to block

chronic stress-induced changes in HPA axis regulation and depression-like behavior.

CHAPTER 2 Role of the prefrontal cortex glucocorticoid receptors in stress and emotion

Chapter was previously published and used in this dissertation with permission from the publisher. The citation is: McKlveen, J.M., Myers, B., Flak, J,N., Bundzikova, J., Solomon, M.B., Seroogy, K.B., and Herman, J.P. (2013). Role of Prefrontal Cortex Glucocorticoid Receptors in Stress and Emotion. Biological Psychiatry, 74(9): 672-679.

Abstract

Background: Stress-related disorders (e.g., depression) are associated with hypothalamic- pituitary-adrenocortical axis dysregulation and prefrontal cortex (PFC) dysfunction, suggesting a functional link between aberrant prefrontal corticosteroid signaling and mood regulation.

Methods: We used a virally mediated knockdown strategy (short hairpin RNA targeting the glucocorticoid receptor [GR]) to attenuate PFC GR signaling in the rat PFC. Adult male rats received bilateral microinjections of vector control or short hairpin RNA targeting the GR into the prelimbic (n = 44) or infralimbic (n = 52) cortices. Half of the animals from each injection group underwent chronic variable stress, and all were subjected to novel restraint. The first 2 days of chronic variable stress were used to assess depression- and anxiety-like behavior in the forced swim test and open field.

Results: The GR knockdown confined to the infralimbic PFC caused acute stress hyperresponsiveness, sensitization of stress responses after chronic variable stress, and induced depression-like behavior (increased immobility in the forced swim test). Knockdown of GR in the neighboring prelimbic PFC increased hypothalamic-pituitary-adrenocortical axis responses to acute stress and caused hyperlocomotion in the open field, but did not affect stress sensitization or helplessness behavior.

Conclusions: The data indicate a marked functional heterogeneity of glucocorticoid action in the PFC and highlight a prominent role for the infralimbic GR in appropriate stress adaptation, emotional control, and mood regulation.

The prefrontal cortex plays a primary role in translating stressful emotional information into action. In human, the ventral prefrontal cortex is linked to multiple forms of stress-related psychopathologies, including major depressive disorder(MDD) and posttraumatic stress disorder. For example, the subgenual cingulate cortex (Brodmann area 25) is metabolically hyperactive in MDD, and deep brain stimulation in treatment-resistant patients is capable of quieting this area and alleviating depressive symptoms (e.g., feelings of helplessness and anhedonia) (Mayberg et al., 2005). In rodent, the ventral prefrontal cortex (comprising of prelimbic [plPFC] and infralimbic [ilPFC] subdivisions) has analogous functions, processing memories of negative life events and controlling the magnitude of physiologic responses to adversity, including secretion of glucocorticoid stress hormones. The plPFC is linked to the nucleus accumbens and basolateral amygdala (BLA) and plays a major role in control of stress response inhibition and reward. The ilPFC is connected to visceral/emotional effector systems

(central amygdaloid nucleus, hindbrain cardiovascular regulatory pathways) and is important for control of emotional responses to fear as well as activation of stress effector pathways (Vertes,

2004). Thus, in both human and rodent, the prefrontal cortical region is well-positioned to participate in neural mechanisms underlying stress adaptation and pathology.

The prefrontal cortex is directly targeted by stress hormones via resident glucocorticoid and mineralocorticoid receptors (GR and MR, respectively). Prefrontal GRs read stress levels of glucocorticoids and are implicated in feedback control of hypothalamic-pituitary-adrenocortical

(HPA) axis activity (Diorio et al., 1993; Fuxe et al., 1985; Meaney et al., 1985; Radley et al.,

2006a; Reul and de Kloet, 1986). Pathological activation of prefrontal cortical GR by chronic stress negatively impacts GR expression and causes dendritic atrophy and spine loss, suggesting both a loss of prefrontal feedback control and altered neuronal excitability (Cook and

Wellman, 2004; Goldwater et al., 2009; Mizoguchi et al., 2003; Radley et al., 2008, 2004).

Glucocorticoid dyshomeostasis (elevated basal hormone secretion and feedback resistance) is known to occur in stress-related diseases such as MDD, raising the possibility of a link between

25 excessive GR signaling and PFC dysfunction (Pariante and Miller, 2001; Price and Drevets,

2012).

In the current study, we test the role of PFC glucocorticoid signaling on behavior and stress reactivity, with virally mediated GR knockdown (short hairpin RNA targeting the glucocorticoid receptor [shRNA-GR]) in the ilPFC and plPFC. Our data provide evidence for a pronounced anatomical heterogeneity of prefrontal GR actions on behavior and stress responses and define a critical role of GR signaling in the ilPFC in control of depression-related behavior and stress adaptation. Given the link between area 25 and depression, our data provide new evidence for a dedicated PFC circuit responsible for glucocorticoid control of emotionality.

Materials and Methods

Lentiviral Constructs

Three different lentiviral constructs, each containing unique double-stranded, shRNA targeting a different position in the GR gene (shRNA-GR) (constructs 468, 469, and 470 targeting positions

+187, +1690, and +2245 in exon 1 of the GR gene) were obtained from America Pharma

Source (Gaithersburg, Maryland). The shRNA sequences were as follows: 5’- AATTCCAAAAA

GCAGCAGAGGATTCTCCTTGACTCTTGATCAAGGAGAATCCTCTGCTGCTG-3’ (468), 5’-

AATTCCAAAAAGGTGTTGTATGCAGGATATGACTCTTGATCATATCCTGCATACAACACCT

G-3’ (469), and

5’AATTCCAAAAAGGTGGTTGAGAATCTCCTTACCTCTTGAGTAAGGAGATTCT

CAACCACCTG (470). Nucleotide sequences specific to GR messenger RNA (mRNA) are displayed in boldface type. We also obtained a vector control (lacking a shRNA insert) and a scrambled-sequence control virus (shRNA-Sc; proprietary sequence). All constructs contained a human U6 promoter to drive shRNA expression and contained a green fluorescent protein

(GFP) cassette. For in vitro and in vivo studies, titers of 1 x 106 infection units (IU)/mL and of 1 x

109 IU/mL were used, respectively. All experimental procedures were approved by the

University of Cincinnati Institutional BioSafety Committee.

In Vitro Cell Culture and Transfection. The GR-expressing 4B cells (Dr. Toni Pak, Loyola

University, Chicago, Illinois) were seeded in HyClone Dulbecco's modified Eagle's medium

(DMEM)/high glucose media (with L-glutamine and L-glucose; Thermo Scientific, Waltham,

Massachusetts) and 10% heat-inactivated fetal bovine serum (Atlanta Biologicals,

Lawrenceville, Georgia). Cells were treated with trypsin (Invitrogen, Carlsbad, California) and subcultured and transferred to 6-well tissue-cultured plate such that they would reach 70% confluency overnight. Media was removed and replaced with 8 x 105 plaque forming units

(PFUs) (or 800 μL of 1 x 106 IU/mL), shRNA-GR 468, 8 x 105 PFUs shRNA-GR 469, 8 x 105

PFUs shRNA-GR 470, 800 μL media, or 2 mL media (to control for transfection volume). After

16 hours, the contents of the wells were aspirated and media was replaced (2 mL). Cells were harvested 5 days later for quantification of GR mRNA.

Real Time Quantitative Polymerase Chain Reaction. The RNA was isolated with an RNeasy kit, according to manufacturer protocol (Qiagen, Valencia, California). The RNA quantity and quality were determined with a NanoVue Plus spectrophotometer (General Electric Healthcare,

Piscataway, New Jersey). The RNA was treated with Turbo DNA-free to remove genomic DNA

(Ambion, Foster City, California) and reverse transcribed with an iScript complementary DNA synthesis kit according to manufacturer protocol (Bio-Rad, Hercules, California). Real time quantitative polymerase chain reaction (RT qPCR) analysis was performed in an iCycler iQ

Multi-Color Real Time PCR Detection System (Bio-Rad). Primers for GR mRNA (10 μmol/L)

(forward: 5’- CCACTGCAGGAGTCTCACAA-3’; and reverse: 5’-ACTGCTGCAATCACTTGACG-

3’) and the house-keeping gene L-32 (forward:5’-CATCGTAGAAAGAGCAGCAC-3’; and reverse: 5’-GCACACAAGCCATCTATTCAT-3’) were used (Integrated DNA Technologies,

Coralville,Iowa). Quantification of complementary DNA was determined with iQ SYBR Green

Supermix (Bio-Rad). Values were calculated with L-32 as an internal standard, and GR mRNA expression is presented as a percentage of control GR expression. Threshold cycle readings for each of the unknown samples were used, and the results were calculated with the ΔΔCt method

(Livak and Schmittgen, 2001). Negative RT samples were included to rule out genomic DNA contamination.

In Vivo

Subjects. Male Sprague Dawley rats from Harlan (Indianapolis, Indiana) weighing 250–275 g upon arrival were singly housed throughout the experiment in a temperature/humidity-controlled room on a 12-hour/12-hour light/dark cycle. Food (Teklad; Harlan) and water were available ad libitum. All experimental procedures were conducted in accordance with the National Institutes of Health Guidelines for the Care and Use of Animals and approved by the University of

Cincinnati Institutional Animal Care and Use Committee.

Stereotaxic Surgery. After 1 week of habituation, animals were anesthetized (90 mg/kg ketamine, 10 mg/kg xylazine), and preemptive analgesia (butorphanol) and antibiotic

(gentamicin) were administered. Animals received 1-μL bilateral microinjections into the ilPFC

(anterior-posterior [AP] = +3.0, medial-lateral [ML] ± 0.6, and dorsalventral [DV] = −4.3, Paxinos and Watson (Paxinos and Watson, 1998) coordinates) of shRNASc (n = 21) or shRNA-GR (n =

31) or 2-μL bilateral microinjections into the plPFC (AP = +3.0, ML ± 0.7, and DV = −3.3) of vehicle control (high glucose DMEM media with 4.5 g/L glucose, L-glutamine, and pyruvate

[Mediatech, Manassas, Virginia]) and 10% heat-inactivated fetal calf serum (Invitrogen; n = 21), empty vector control(n = 22), or shRNA-GR (targeting position 1690 in the GR gene; n = 22) with a 25-gauge, 2-μL Hamilton syringe (Reno, Nevada). To reduce tissue damage, each injection took place over 20 min. After the needle remained in place for 5 min, the virus was infused over 10 min with a microdriver (Model 5001; Kopf, Tujunga, California) and remained in place for 5 min to allow for complete diffusion. Animals recovered for at least 5–6 weeks before any experiments.

Chronic Variable Stress. Approximately half of the animals underwent chronic variable stress

(CVS) for 14 days (n = 11–16 from each microinjection group). The CVS was comprised of twice daily (AM and PM) repeated and unpredictable stressors, including cold swims (10 min,

16–18ºC), warm swims (20 min, 30–32ºC), cold room exposure (1 hour, 4ºC), shaker stress

(1 hour, 100 rpm), and hypoxia (30 min, 8% oxygen). Only animals undergoing CVS were used in the forced swim test (FST) and open field, and these tests were treated as morning stressors for the first 2 days of CVS.

Forced Swim Test. Approximately half of the animals from each microinjection group went through the modified FST, as described previously (Cryan et al., 2005; Wulsin et al., 2010), to assess depression-like behavior. Animals were placed in a cylindrical container (46 cm in height x 20 cm in diameter) filled with 30 cm of 29 - 31ºC water for 10 min. Behavior was video recorded and scored every 5 sec for 10 min. Scoring was done by an observer blinded to the

29 experimental condition. Mobility (swimming, climbing, headshakes, and diving) versus immobility was scored as previously described (Wulsin et al., 2010). Animals were not exposed to any swims before the FST, because the modified FST is a single exposure test.

Open Field Test. Animals were exposed to a novel open field to assess anxiety-like behavior and locomotor activity. Animals were placed in a 1-meter x 1-meter black opaque acrylic glass box with 30.48-cm-tall white opaque walls surrounding each side for 5 min. A video recording of the behavior of the animal was scored and analyzed with Clever TopScan Software

(CleverSys, Reston, Virginia). Time spent in the center versus the periphery of the open field was used as a measure of anxiety-like behavior (Belzung and Griebel, 2001).

Acute Restraint and Blood Collection. The morning after completion of CVS (at least 16 hours after last stress exposure), all animals were exposed to a novel 30-min restraint. Blood samples (approximately 250 μL) were collected in tubes containing 10 μL 100 mmol/L ethylenediamine tetraacetate by tail clip before (0 min) and 30, 60, and 120 min after onset of

30-min restraint and immediately placed on ice. Samples were collected in under 3 min before any rise in adrenocorticotropic hormone (ACTH) or corticosterone levels due to sampling (Vahl et al., 2005). Blood samples were centrifuged at 3000 x g for 15 min at 4ºC, and plasma was stored at −20C until time of radioimmunoassays (RIAs).

Tissue Collection. Animals were given an overdose of sodium pentobarbital and transcardialy perfused with 0.9% saline followed by 4% sodium phosphate-buffered paraformaldehyde.

Brains were postfixed in 4% sodium phosphate-buffered paraformaldehyde for 24 hours, then stored in 30% sucrose in diethylpyrocarbonatetreated water at 4ºC. Brains were sectioned on a mictotome in 30-μm coronal sections (Leica, Buffalo Grove, Illinois). Thymus and adrenal glands were dissected and weighed.

Immunohistochemistry. Sections were immunolabeled with primary antibodies against GR (M-

20) (1:1000; Santa Cruz Biotech, Santa Cruz, California), neuronal nuclei (NeuN) (1:200;

Millipore, Billerica, Massachusetts), MR (ID-5) (1:200 and 1:500; provided by Dr. Elise Gomez-

Sanchez from University of Mississippi, Jackson, Mississippi) (Gomez-Sanchez et al., 2006), or glial fibrillary acidic protein (GFAP) (1:2000; Dako, Carpinteria, California) with standard immunohistochemical procedures.

For glucocorticoid receptor (GR) and NeuN immunolabeling, free-floating sections stored in sodium phosphate-buffered diethylpyrocarbonate (DEPC)-treated cryoprotective solution, following sectioning, were rinsed 5 times with 50 mM potassium phosphate buffered saline

(KPBS) solution. Following all incubations, sections were rinsed with 50 mM KPBS 5 times unless otherwise indicated. Sections were blocked in 0.1% bovine serum albumin and 0.2%

Triton in 50 mM KPBS for 1 h prior to incubation in rabbit polyclonal anti-GR (M-20) (1:1000 dilution; Santa Cruz Biotech, Santa Cruz, CA) and mouse monoclonal anti-NeuN (1:200 dilution;

Millipore, Billerica, MA) primary antibodies for approximately 18 h at 4°C. Sections were incubated in Cy3 donkey anti-rabbit and Cy5 goat anti-mouse (each at 1:500 dilution;

JacksonImmuno, West Grove, PA) for 1 h at room temperature. Sections were rinsed 4 times in

50 mM KPBS and mounted in 50 mM potassium phosphate-buffered solution and 1% gelatin onto ultrastick slides (Gold Seal, Portsmouth, NH) and coverslipped with polyvinyl alcohol anti- fading medium with DABCO (Sigma-Aldrich, St. Louis, MO).

For GR and mineralocorticoid receptor (MR) immunolabeling, free-floating sections were rinsed 5 times in KPBS. Sections were blocked for 1 h, as described above, before incubation in

GR (M-20) and mouse monoclonal anti-MR (ID-5) (1:200 dilution; kindly provided by Dr. Gomez-

Sanchez from University of Mississippi, Jackson, MI) primary antibodies for approximately 18 h at 4°C (1). Sections were rinsed 5 times in 50 mM KPBS and incubated in Cy3 donkey anti- rabbit and Cy5 goat anti-mouse (each at 1:500 dilution; JacksonImmuno, West Grove, PA) for

1 h at room temperature. Sections were rinsed 4 times with 50 mM KPBS then mounted onto slides and coverslipped, as described above.

For GR and GFAP immunolabeling, free-floating sections stored in sodium phosphate- buffered DEPC-treated cryoprotective solution, were rinsed 5 times in KPBS. Sections were

31 blocked for 1 h, as described above, before incubation in anti-GR antibody (M-20) for approximately 18 h at 4°C. Sections were then incubated in Cy3 donkey anti-rabbit for 1 h at room temperature. Sections were subsequently incubated in rabbit anti- GFAP (1:2000 dilution;

Dako, Carpinteria, CA) primary antibody for 18 h at 4°C and then Cy5 donkey anti-rabbit (1:500 dilution; JacksonImmuno, West Grove, PA) for 1 h at room temperature. Sections were rinsed 4 times with 50 mM KPBS then mounted onto slides and coverslipped, as described above.

For GR, NeuN, and MR diaminobenzidine tetrahydrochloride (DAB) immunolabeling, sections stored in sodium phosphate-buffered DEPC-treated cryoprotective solution, were rinsed 5 times in 50 mM KPBS. Sections were incubated in 1% H2O2 for 10 min to remove endogenous peroxidases and then incubated in 1% sodium borohydride for 10 min. Sections were blocked for 1 h, as described above, before incubation in rabbit polyclonal anti-GR primary antibody (M-20), mouse monoclonal anti-NeuN (1:1000 dilution; Millipore, Billerica, MA) or mouse monoclonal anti-MR (1:500 dilution) approximately 18 h at 4°C. Sections were then incubated for 1 h in biotinylated anti-rabbit (1:500 dilution; Vector Laboratories, Burlingame, CA) or biotinylated anti-mouse (1:500 dilution, Vector Laboratories, Burlingame, CA) and subsequently incubated in Vectastain ABC (1:1000; Vector Laboratories, Burlingame, CA) for 1 h. Sections were incubated in 5 ml of a solution of DAB tablets (10 mg (or 1 tablet)/50 ml;

Sigma-Aldrich, St. Louis, MO) in 0.05% H2O2 in 50 mM KPBS, rinsed with KPBS, mounted onto slides, and coverslipped with DPX mounting medium (Sigma-Aldrich, St. Louis, MO).

RIA. Plasma ACTH was determined by a RIA that used a specific antiserum (1:120,000 dilution; donated by Dr. William Engeland University of Minnesota, Minneapolis, Minnesota) with 125I

ACTH (Amersham Biosciences, Piscataway, New Jersey) as labeled tracer. All samples were run in duplicate (when sample was sufficient) in the same assay. Plasma corticosterone levels were measured with an 125I RIA kit (MP Biomedicals, Solon, Ohio). All samples were run in duplicate and each time point was run in the same assay. In order to include all time points in the same analysis, the 0 min and 120 min data were normalized to the assay including the 30

32 min and 60 min samples using the ratio between the plasma pool (internal control sample from an acutely stressed animal) in the 0 min and 120 min assay to the plasma pool in the 30 min and 60 min assay to determine the normalization factor. The 0 min and 120 min data were multiplied by the normalization factor to include them in the same analysis as the 30 min and 60 min for samples collected following prelimbic prefrontal cortex GR knockdown.

Cell Counting. For analysis of GR-, NeuN-, or MR-positive immunoreactive nuclei, digital images of each side of the plPFC or ilPFC, as defined by the rat stereotaxic brain atlas of

Paxinos and Watson (1998), were captured at 5 x or 10 x magnification with a Carl Zeiss Imager

Z.1 (Carl Zeiss Microimaging, Thornwood, New York). Quantitative analysis of cell counts was performed with the Automatic Measurement Program, Axiovision 4.4 (Carl Zeiss Microimaging).

Images were captured on the same day with the same settings, and a uniform threshold was applied to all images in a given brain region.

Statistical Analysis. Data are expressed as mean ± SEM. Behavioral data, body weight before

CVS, and immunoreactive counts were analyzed with one-way analysis of variance (ANOVA).

Body weight (after CVS), organ weights, and baseline corticosterone levels were analyzed with a two-way ANOVA (microinjection [vector control or shRNA-GR]) x stress (acute stress or CVS).

Fisher’s least significant difference post hoc analyses were conducted. Hormonal data were analyzed with two-way repeated measures ANOVA (microinjection x time [0, 15, 30, 60 or 120 min]) or three-way repeated measures ANOVA (microinjection x stress x time [0, 30,60 or 120 min]), time being the repeated measure. Fisher’s least significant difference was used for a priori planned comparisons across microinjection and stress at each time point. Data were analyzed with GBStat (version 6.5.4) software (Dynamic Microsystems, Silver Spring,

Maryland), and statistical significance was set at p ≤ .05. Where appropriate, behavioral data failing Levene’s F, Hartley’s F-max, Cochran’s C, and Barlett’s χ2 homogeneity of variance tests were log transformed. Outliers were removed as outlined previously (McClave and Dietrich,

1994). Animals with unilateral or no GFP expression or injections outside the ilPFC or plPFC

33 were excluded (n = 21 or 6, respectively). For simplicity of presentation, results are graphed by acute stress only (No CVS) or chronic stress (CVS), although data were part of the same statistical analysis. Experiments targeting the plPFC or the ilPFC were conducted separately, and therefore statistical comparisons across experiments were not analyzed.

Results shRNA Validation

We first performed in vitro studies to identify an shRNA sequence that can specifically knockdown GR expression. We transfected immortalized, GR-expressing hypothalamic 4B cells with several different lentiviral-packaged shRNAs predicted to target GR mRNA (shRNA-GR)

(Przybycien-Szymanska et al., 2011). As determined by RT qPCR, GR mRNA expression was reduced after transfection with shRNA-GR 469 (99.8% reduction as shown by results from one

PCR experiment) (Figure 2.1). We next validated the ability of this shRNA to knockdown expression in vivo. Immunofluorescence analysis revealed reduced GR immunoreactivity at the site of injection in animals that received shRNA-GR, without loss of neuronal viability (NeuN immunolabeling is intact in GFP-positive neurons) (Figure 2.2A). Reduced GR was observed as a loss of GR immunoreactivity in GFP-positive (i.e., virus-infected) neurons (Figure 2.2B). No reduction in GR was observed in animals that received a scrambled-sequence control (shRNA-

Sc) (Figure 2.2C), empty vector control (Figure 2.2D), or vehicle control (data not shown). The

MR immunoreactivity was also intact in transduced neurons that lack GR, demonstrating that the shRNAGR does not downregulate expression of a closely related protein (Figure 2.2E).

Furthermore, shRNA-GR microinjection did not produce recruitment of astrocytes to the region beyond that of a control injection site. Importantly, astrocytes did not seem to incorporate the shRNA-GR (no co-localization of glial fibrillary acidic protein with GFP), and expression of the astrocytic GR was intact (Figure 2.2F). To assess the extent of GR knockdown in the ilPFC and plPFC, we quantified the number of GR-positive immunoreactive nuclei in the area of injection.

The GR expression was selectively knocked down in shRNA-GR-microinjected animals in the

34 ilPFC [F1,13 = 20.33, p = 0.0006] (Figure 2.3A,E) and in the plPFC [F1,10 = 59.48, p < .0001]

(Figure 2.3C,F) relative to vector control microinjected animals (Figures 2.3B,D–F), without affecting the number of NeuN [F1,10 = 1.06, p = 0.33] or MR [F1,11 = 0.168, p = 0.69] immunoreactive cells at the site of injection (as quantified in the plPFC) (Figure 2.4).

Knockdown of GR expression is mostly confined to the ilPFC or the plPFC (with minimal spread to adjacent areas) (Figure 2.3G,H).

Behavioral Testing

The medial PFC is thought to be an important mediator of depression-like behavior

(Clement Hamani et al., 2010; Scopinho et al., 2010). To test the effect of GR knockdown on depression-like behavior, we first examined performance in the FST, commonly used as an assay for behavioral helplessness. Animals that received microinjection with shRNA-GR in the ilPFC had significantly increased immobility in the FST compared with animals receiving vector control (F1,13 = 9.67, p = .008), suggestive of a depression-like phenotype (Figure 2.5A).

However, there were no significant differences in scored individual active behaviors (e.g., swimming [F1,13 = 0.46, p = 0.51], climbing [F1,14 = 0.75, p = 0.40], diving [F1,14 = 0.23, p = 0.64], or headshakes [F1,14 = 0.55, p = 0.47]). In contrast, knockdown of plPFC GR did not affect immobility (F1,17 =1.81, p = 0.20) or individually scored activities (e.g., swimming [F1,17 = 3.18, p

=0.09], climbing [F1,17 = 0.04, p = 0.85], diving [F1,18 = 0.39, p = 0.54], or headshakes [F1,16 =

0.88, p = 0.36]) (Table 2.1) in the FST (Figure 2.5B).

Previous studies indicate that electrolytic lesions of the ilPFC or the plPFC decrease time spent in the center of the open field (Jinks and McGregor, 1997). Therefore, we tested anxiety-related behavior and locomotion in the open field test, with the same cohorts of animals used in the FST. Microinjection of shRNA-GR in the ilPFC did not precipitate an anxiety-like phenotype (no main effect of microinjection on time spent in the center of the open field) (F1,11 =

1.69 p = 0.22) (Table 2.2). Furthermore, there were no significant differences in overall locomotor activity (F1,11 = 0.60, p = 0.46) or locomotor activity in the center (F1,11 = 2.98, p =

0.11) (Figure 2.6A) and the periphery (F1,12 = 0.04, p = 0.86) (Figure 2.6B) relative to vector control-microinjected animals. Similarly, injection of shRNAGR in the plPFC was without effect on anxiety-related open field behavior (F1,16 = 0.23, p = 0.64) (Table 2.2) but did cause a substantial increase in total locomotor activity (F1,17 = 7.59, p = 0.01), distance traveled in the center (F1,16 = 103.15, p < 0.0001) (Figure 2.6C), and in the periphery (F1,17 = 6.42, p = 0.02)

(Figure 2.6D) of the open field and a significant increase in rearing (F1,17 = 7.69, p = 0.01) (Table

2.2).

Body/Organ Weights

Rats were exposed to a 2-week CVS regimen to test the impact of GR signaling in prefrontal regions on physiological reactivity to prolonged adversity. As documented previously, attenuated weight gain, adrenal hypertrophy, and thymic involution are consistent attributes of chronically stressed rats (Herman et al., 1995). There was no main effect of microinjection on body weight gained before CVS in either the ilPFC (F1,30 = 0.13, p = 0.72) or plPFC (F1,35 = 0

.99, p = 0.33) of shRNA-GR-microinjected animals, indicating that PFC GR knockdown did not affect body weight. Gross somatic effects of chronic stress on adrenal hypertrophy were not affected by GR knockdown in either PFC subregion. However, thymic involution was selectively enhanced in the CVS-ilPFC group, consistent with greater cumulative exposure to glucocorticoids over the stress regimen (main effect of stress [F1,26 = 6.54, p = 0.02]) (Table 2.3).

Hormonal Responses

We next tested the role of ilPFC and plPFC in control of HPA axis responses to acute restraint stress. Both ilPFC and plPFC injections of shRNA-GR enhanced acute activation of the

HPA axis (increased peak corticosterone release; at 30 or 60 min post-stress time points, respectively) (Figure 2.7). Enhanced corticosterone release was accompanied by increased

ACTH release 15 min after acute restraint (measured in a separate study after plPFC GR knockdown [F4,40 = 6.80, p = 0.0003]) (Figure 2.8). After chronic stress, ilPFC GR knockdown potentiated the corticosterone response to a novel stressor, consistent with hypersensitization of

36 the HPA axis (F3,75 = 3.42, p = 0.02). Knockdown of GR in the plPFC did not affect the post-CVS peak HPA axis response to a novel stressor, and in fact corticosterone levels were significantly lower 60 min after restraint (F3,102 = 4.43, p = 0.006). Together, the data suggest differential roles of the ilPFC and plPFC in chronic stress processing.

Finally, we determined the impact of plPFC GR and ilPFC GR knockdown on baseline levels of stress hormones in unstressed animals or animals exposed to chronic stress. The shRNA-GR microinjection in the plPFC increased baseline levels of corticosterone in chronically stressed animals, reflected in a microinjection x stress interaction (F1,31 = 6.05, p = 0.02)

(Figure 2.9), suggesting selective involvement in control of basal glucocorticoid homeostasis under chronic stress.

Discussion

Our study indicates that glucocorticoid control of stress responsiveness and emotional reactivity is mediated by distinct prefrontal cortical mechanisms, with the ilPFC particularly important for mediating chronic stress adaptation and emotional reactivity to stress. Loss of infralimbic GR caused increased helplessness behavior and hormonal hypersensitivity to chronic stress, consistent with a role in integrating glucocorticoid signals into appropriate behavioral and physiological responses to prolonged challenge. Importantly, in human, area 25

(ilPFC homolog) is linked to depression, a disease that is characterized by helplessness behavior and reduced central sensitivity to glucocorticoids (Mayberg et al., 2005; Pariante and

Miller, 2001; Price and Drevets, 2012). The current data suggest that local glucocorticoid signaling in this confined prefrontal locus might be critical for appropriate control of mood.

The prelimbic cortex seems to play a very different role in chronic stress adaptation. Like the ilPFC, the plPFC participates in control of HPA responses to an acute stressful event. Our data suggest that, unlike the ilPFC, the plPFC GR does not seem to be involved in either regulation of HPA axis reactivity to chronic stress or control of initial emotional responses to stressors. However, plPFC GR knockdown induces a significant increment in basal morning corticosterone release during chronic stress, suggesting that this region participates in setting the basal tone of the HPA axis under chronic stress. Thus, the prelimbic and infralimbic cortices, anatomical neighbors in the prefrontal region, are both involved in processing glucocorticoid information with regard to prolonged adversity but play very different roles in regulating behavioral and physiological responses.

Previous studies have used multiple techniques to assess the role of the PFC in regulation of the HPA axis in rats, including ibotenic lesions, acute activation, and corticosterone implants (Akana et al., 2001; Diorio et al., 1993; Figueiredo et al., 2003; Jones et al., 2011;

Radley et al., 2006a; Sullivan and Gratton, 1999). The shRNA-mediated technique offers many advantages, because it allows for anatomical and molecular specificity through long-term

38 knockdown confined to the region of shRNA expression. The shRNA-GR is packaged in a lentiviral construct and is therefore useful for targeting nondividing cells (i.e., neurons) without eliciting an immune response (Sliva and Schnierle, 2010). Our data indicate that lentiviral delivery of shRNA-GR can effectively reduce GR immunoreactivity in virally transduced neurons locally in the region of the ilPFC or the plPFC, affording the ability to use this method to query the role of the GR in defined neural populations. Our data suggest that the lentiviral knockdown spares medial PFC astrocytes, which play a role in depression-like behavior (Banasr and

Duman, 2008). Additional studies are required to determine whether the glial GR is also involved in modulation of mood.

In patients with MDD, area 25 is hyperactive, and deep brain stimulation ameliorates depressive symptoms in patients with treatment-resistant MDD (Lozano et al., 2008). In rodent, the infralimbic cortex projects to regions implicated in visceral/autonomic control (e.g., the nucleus of the solitary tract, lateral septum, bed nucleus of the stria terminalis, central amygdaloid nucleus, and posterior hypothalamus) (Vertes, 2004), consistent with a role in mediating physical and emotional responses to chronic drive. Moreover, glucocorticoids are thought to inhibit limbic neuronal responses by reducing neural excitability and retracting dendritic trees (Joels and Karst, 2012; McEwen et al., 2012; Wellman, 2001). We hypothesize that the loss of a GR-mediated “brake” in the infralimbic cortex might allow prolonged activation of downstream targets, thereby promoting aberrant physical and emotional responses, as observed in the FST.

Despite its anatomic proximity to the infralimbic cortex, the prelimbic cortex has a markedly different efferent output, sending heavy projections to regions involved in limbic/cognitive processing, such as the nucleus accumbens, BLA, and raphe nuclei (Vertes,

2004). These sites have polysynaptic input to stress regulatory systems, such as the paraventricular nucleus, and might buffer the impact of altered plPFC GR signaling on HPA axis drive. For example, chronic stress causes morphological and functional neuroadaptation in

39 regions such as the BLA, which might be sufficient to diminish the overall impact of plPFC knockdown on HPA stress reactivity(Vyas et al., 2002). The effect of plPFC on basal morning corticosterone might either reflect modulation of processes relating to stress habituation (e.g., by the paraventricular thalamus)or energetic demands associated with stress-induced hyperactivity, as observed in the open field test (Bhatnagar et al., 2002; Jaferi and Bhatnagar,

2006).

Our work is consistent with dedicated roles of the GR within specific neurocircuits. Not surprisingly, total forebrain GR deletion (in mouse) has features in common with the lentiviral knockdown approach. Forebrain GR deletion (encompassing neocortex, hippocampus, and basolateral/cortical amygdala) produces glucocorticoid stress hyperresponsiveness, in response to acute restraint stress, characteristic of plPFC and ilPFC GR knockdown in the rat

(Furay et al., 2008). However, forebrain GR knockout does not cause chronic stress sensitization (like the plPFC but not ilPFC knockdown). The latter data suggest that GR signaling in other forebrain regions (such as the hippocampus) might negate or magnify effects of local changes in the prefrontal cortex.

The present study indicates a distinct role of ilPFC versus plPFC GR in acute versus chronic stress regulation. Human genetic studies link the GR to depression or posttraumatic stress disorder, either directly or via interactions with other proteins (e.g., FK506 binding protein

5, a chaperone protein that modulates GR function) (Binder et al., 2008). Given the overriding importance of area 25 (human ilPFC-equivalent) in affective disease states, our data suggest that stress-related GR signaling might be uniquely important in regulating resistance or resilience, with loss of function driving pathological behavioral and endocrine reactivity to situational adversity.

Figure 2.1. shRNA-GR 469 knocked down glucocorticoid receptor expression relative to two other constructs. We tested the ability of three short hairpin (sh)RNAs targeting different locations in the glucocorticoid receptor (GR) mRNA to knockdown GR mRNA expression in vitro. shRNA-GR 469 led to GR knockdown and (after in vivo validation) was used for all subsequent experiments. Data from one real time quantitative polymerase chain reaction run is shown.

Figure 2.2. Verification and specificity of a short hairpin RNA targeting the glucocorticoid receptor (shRNA-GR). (A) Representative NeuN (blue) immunolabeled sections after microinjection with shRNA-GR (green). After microinjection of shRNA-GR, NeuN immunoreactivity remained intact in transduced neurons, indicating that neuronal viability was not affected (see arrows). (B) Representative GR (red) immunolabeled sections after microinjection with shRNA-GR (green), (C) shRNA-scrambled control (green), and (D) empty vector control (green). The shRNA-GR reduced GR in green fluorescent protein colocalized cells (B) relative to animals that received microinjections of shRNA-scrambled control (C) or empty vector control (D) (see arrows). (E) Representative dual GR (red) and mineralocorticoid receptor (MR) (blue) immunolabeled sections after intracranial microinjection with shRNA-GR. Mineralocorticoid receptor expression is intact in cells in which GR immunoreactivity is knocked down (as demonstrated in the superficial layers II/III on the left of the image and deep layers V/VI of the prelimbic prefrontal cortex on the right of the image, where MR is typically expressed. The agranular layer between layers III and V typically has little MR expression) (see arrows). (F) Representative glial fibrillary acidic protein (purple) and GR (red) immunolabeled sections after intracranial injection with shRNA-GR. The shRNA-GR did not transduce astrocytes (no green fluorescent protein and glial fibrillary acidic protein colocalization) and did not seem to knockdown astrocytic GR. Scale bar = 50 μm.

Figure 2.3. Selective decreases in glucocorticoid receptor (GR) immunoreactive neurons in the infralimbic prefrontal cortex (ilPFC) and prelimbic prefrontal cortex (plPFC) after short hairpin RNA targeting the GR (shRNA-GR) microinjection. Representative GR-immunolabeled sections from vector control-microinjected animals in (B) the ilPFC and the (D) plPFC and shRNA-GR- microinjected animals in (A) the ilPFC and (C) the plPFC (representative areas of quantification are outlined in panels A–D). (E) Quantified GR expression from vector control-microinjected animals (n = 10) and shRNA-GR-microinjected animals (n = 5) in the ilPFC and (F) vector control-microinjected animals (n = 6) and shRNA-GR-microinjected animals (n = 6) in the plPFC. The GR immunoreactivity was significantly reduced in animals that received shRNA-GR relative to vector control-microinjected animals (p < 0.05). (G) Extent of GR knockdown in the ilPFC of all shRNA-GR-microinjected animals that were considered “hits” (n = 10) or (H) in the plPFC of all shRNA-GR-microinjected animals that were considered “hits” (n = 16) (reprinted from Paxinos and Watson [1997] with permission from Elsevier, copyright 1998). Green fluorescent protein (GFP) expression throughout the plPFC in each animal was traced onto stereotaxic images and compiled into one visual representation. Black circles indicate where GFP expression was most prominent (n ≥ 4 in the ilPFC and n ≥ 8 in the plPFC), whereas gray circles represent areas where GFP was less prominent in animals that received shRNA-GR and were considered “hits” (n ≤ 3 in the ilPFC or n ≤ 7 in the plPFC). Immunoreactive counts are mean ± SEM. Scale bar = 100 μm. *p < 0.05 vs. vector control-microinjected animals.

Figure 2.4. Neuronal viability and mineralocorticoid receptor immunoreactivity remains intact following shRNA-GR microinjection. Figure 2.4A shows NeuN immunoreactive cell counts following vector control- (n = 6) or shRNA-GR-microinjection (n = 6) in the prelimbic prefrontal cortex (plPFC). Figure 2.4B shows mineralocorticoid receptor (MR) immunoreactive cell counts following vector control- (n = 6) or shRNA-GR-microinjection (n = 7) in the plPFC. NeuN and MR immunoreactivity were unaltered following microinjection with shRNA-GR relative to vector control-microinjected animals (P > 0.05). Data are mean ± SEM. See Figure 2.1 for other abbreviations.

Figure 2.5. Increased helplessness behavior after GR knockdown in the ilPFC. (A) Immobility vs. activity in the modified forced swim test after vector control- or shRNA-GR-microinjection in the ilPFC (n = 10 or 5, respectively) or (B) in the plPFC (n = 11 or 8, respectively). Animals receiving shRNA-GR in the ilPFC but not the plPFC, exhibited increased immobility in the forced swim test relative to vector controls (p < 0.05). Data are mean ± SEM. *p < 0.05 vs. vector control-microinjected animals. Abbreviations as in Figure 2.2.

Figure 2.6. Increased locomotor activity after GR knockdown in the plPFC relative to vector control-microinjected animals. (A) Locomotor activity in the center and (B) periphery after vector control- or shRNA-GR microinjections in the ilPFC (n = 9–10 or 4, respectively). (C) Locomotor activity in the center and (D) periphery after microinjections of vector control or shRNA-GR in the plPFC (n = 11 or 7–8, respectively). Animals receiving shRNA-GR in the plPFC traveled significantly more throughout the center (C) and periphery (D) than vector controls (p < 0.05). Data are mean ± SEM. *p < 0.05 vs.vector control-microinjected animals. Abbreviations as in Figure 2.2.

Figure 2.7. Differential impact of GR knockdown in the ilPFC vs. plPFC on hypothalamic- pituitary-adrenal axis reactivity after acute and chronic stress. (A) Corticosterone responses after acute novel restraint in unstressed (no chronic variable stress [CVS]) and (B) CVS animals that received microinjections of vector control (n = 9–11/unstressed or stressed group) or shRNA-GR (n = 5/unstressed or stressed group) in the ilPFC. (C) Integrated area under the curve (AUC) for corticosterone responses (not including baseline values) after vector control- microinjections (n = 9–11/group) or shRNA-GR (n = 5/group) in the ilPFC. (D) Corticosterone responses after acute novel restraint in unstressed (No CVS) and (E) CVS animals that received microinjections of vector control (n = 10–11/ unstressed or stress group, respectively) or shRNA-GR (n = 7–9/unstressed or stressed group) in the plPFC. (F) Integrated AUC for corticosterone responses (not including baseline values) after vector control-microinjections (n = 10–11/group) or shRNA-GR (n = 7–9/group) or in the plPFC. After ilPFC microinjection of shRNA-GR, acute stress caused a significant elevation in corticosterone at 30 min compared with vector controls, an effect that is exacerbated in chronically stressed animals relative to acutely stressed shRNA-GR-microinjected animals and controls (p < 0.05). After microinjection of shRNA-GR in the plPFC, animals acutely stressed in the absence of CVS have significantly elevated corticosterone levels at 60 min compared with vector controls, whereas chronically stressed animals have significantly lower corticosterone responses at 60 min compared with vector control-microinjected animals (p < 0.05). Data are mean ± SEM. *p < 0.05 vs. vector control-microinjected animals or between groups indicated by the brackets. Abbreviations as in Figure 2.2.

Figure 2.8. Adrenocorticotropic hormone levels are significantly increased 15 and 30 min post restraint in animals receiving shRNA-GR in the prelimbic prefrontal cortex relative to vector controls in a separate study. Adrenocorticotropic hormone (ACTH) responses before (0) and 15, 30, 60, and 120 min following onset of 30-min acute novel restraint in previously unstressed animals receiving shRNA-scrambled-sequence control or shRNA-GR. ACTH responses are significantly increased 15 and 30 min following restraint in shRNA-GR microinjected animals relative to vector control-microinjected animals (n = 5-6 per group) (p < 0.05). Data are mean ± SEM. *p < 0.05 vs. vector control-microinjected animals. See Figure S1 for other abbreviations.

Figure 2.9. The GR knockdown in the plPFC but not ilPFC of chronically stressed animals significantly increased baseline corticosterone levels. (A) Baseline corticosterone levels in unstressed and chronically stressed animals receiving vector control (n = 10 or 11/group, respectively) or shRNA-GR (n = 5/group) in the ilPFC and (B) in unstressed and chronically stressed animals receiving vector-control (n = 10 or 11, respectively) or shRNA-GR (n = 7 or 9, respectively) in the plPFC. Baseline corticosterone levels were significantly different in chronically stressed animals receiving shRNA-GR in the plPFC only (relative to acutely stressed animals that received shRNA-GR) (p < 0.05). Data are mean ± SEM. *p < 0.05 vs. acutely stressed shRNA-GR-microinjected animals or between groups indicated by the brackets. Abbreviations as in Figures 2 and 5.

Table 2. 1: Active behaviors in the forced swim test following glucocorticoid receptor knockdown or vector control-microinjection in the infralimbic prefrontal cortex (ilPFC) or prelimbic prefrontal cortex (plPFC).

Forced Swim Test (ilPFC) (mean counts) Forced Swim Test (plPFC) (mean counts)

Micoinjection Swimming Climbing Diving Headshakes Swimming Climbing Diving Headshakes

Vector control 13.01.3 21.83.2 0.90.3 4.51.1 5.50.5 22.53.2 0.50.2 21.0

shRNA-GR 11.22.9 17.42.7 1.20.6 3.21.2 6.670.4 21.72.9 0.80.3 0.80.8

Table 2.1. Active behaviors in the forced swim test following glucocorticoid receptor (GR) knockdown or vector control-microinjection in the infralimbic prefrontal cortex (ilPFC) or prelimbic prefrontal cortex (plPFC). “Active” behaviors in the 10 min novel exposure to the forced swim test in animals receiving microinjections of vector control (n = 10-11) or shRNA-GR (n = 5) in the ilPFC or microinjections of vector control (n = 10-11) or shRNA-GR (n = 8-9) in the plPFC. There were no significant differences in any of the individual scored active behaviors (p > 0.05). Data are mean ± SEM.

Table 2.2: Duration and velocity in the center vs. periphery of the open field, freezing/inactivity,

and number of rears following glucocorticoid receptor knockdown or vector control-

microinjection in the infralimbic prefrontal cortex (ilPFC) or the prelimbic prefrontal cortex

(plPFC) in the open field test.

Open Field (ilPFC) Open Field (plPFC)

Center Peripher Center Periphery Freezing/ Center Center Periphery Freezing/ Micro - Rears Periphery Rears Time y Time Velocity Velocity Inactivity Time Velocity Velocity Inactivity injection (#) Time (%) (#) (%) (%) (mm/s) (mm/s) (s) (%) (mm/s) (mm/s) (s)

Vector 5.21.4 94.81.4 15.72.1 17.30.8 00 9.80.9 4.90.9 95.10.9 5.70.7 7.01.3 1.50.7 71.1 control shRNA- GR 2.30.9 97.70.9 9.41.9 161.7 0.50.5 7.32.1 8.52.7 91.52.7 7.81.1 11.31.0* 2.10.8 121.5*

Table 2.2. Duration and velocity in the center vs. periphery of the open field, freezing/inactivity, and number of rears following glucocorticoid receptor (GR) knockdown or vector control- microinjection in the infralimbic prefrontal cortex (ilPFC) or the prelimbic prefrontal cortex (plPFC) in the open field test. Infralimbic or prelimbic prefrontal glucocorticoid receptor knockdown does not induce anxiety-like behavior in the open field. There were no significant differences in time spent in the center vs. the periphery of the open field or time spent freezing/inactive in animals microinjected with vector control (n = 9) or shRNA-GR (n = 4) in the ilPFC or vector control (n = 10) or shRNA-GR (n = 8) in the plPFC. However, animals receiving shRNA-GR in the plPFC traveled faster in the periphery of the open field and reared significantly more than vector controls (P < 0.05). Data are mean ± SEM. *p < 0.05 vs. vector control- microinjected animals.

Table 2.3: Somatic measurements in acutely vs. chronically stressed animals following glucocorticoid receptor knockdown or vector control-microinjection in the infralimbic prefrontal cortex (ilPFC) or the prelimbic prefrontal cortex (plPFC).

Somatic Indices (ilPFC) Somatic Indices (plPFC)

Body Adrenal Thymus Body Adrenal Weight Weight Weight Weight Weight Thymus Change (mg per (mg per Change (mg per Weight Microinjection following 100g body 100g body following 100g body (mg per 100g and Stress CVS (g) weight) weight) CVS (g) weight) body weight)

Vector control and 35.71.4 13.70.4 70.63.5 31.01.6 12.30.4 75.311.1 No CVS shRNA-GR 42.92.8 13.10.5 79.44.4 29.62.8 12.50.5 79.67.3 and No CVS

Vector control and -10.52.9* 16.80.3* 67.53.6 -9.11.4* 15.70.3* 71.45.8 CVS shRNA-GR -4.083.4* 17.81.0* 60.54.8* -11.12.9* 15.80.4* 68.84.9 and CVS

Table 2.3. Somatic measurements in acutely vs. chronically stressed animals following glucocorticoid receptor (GR) knockdown or vector control-microinjection in the infralimbic prefrontal cortex (ilPFC) or the prelimbic prefrontal cortex (plPFC). Chronic stress led to significant reductions in body weight and adrenal hypertrophy regardless of microinjection received. Table S3 shows body weight following acute restraint only or chronic variable stress (CVS) (delta change from when half of the animals began CVS until after CVS) following vector control- (n = 9-10 per group) and shRNA-GR-microinjection (n = 5 per group) in the ilPFC and vector control- (n = 10-11 per group) and shRNA-GR-microinjection in the plPFC (n = 7-9 per group). Adrenal (averaged from both sides) and thymus weights are included (normalized to body weight and expressed as g/100 g bodyweight). Chronically stressed animals, regardless of microinjection, had attenuated weight gain following CVS and larger adrenal glands relative to unstressed animals. However, thymic involution was selectively enhanced in the CVS-ilPFC shRNA-GR microinjection group, consistent with greater cumulative exposure to glucocorticoids over the stress regimen. Data are mean ± SEM. *p< 0.05 vs. respective acutely stressed control.

CHAPTER 3 Chronic stress increases inhibitory neurotransmission in the prefrontal cortex: a potential mechanism for stress-induced prefrontal dysfunction

Abstract

Multiple neuropsychiatric disorders, e.g. depression, are linked to imbalances in excitatory and inhibitory neurotransmission and are concomitant with chronic stress. Presently, we used electrophysiological, neuroanatomical, and behavioral techniques to test the hypothesis that chronic stress increases inhibition of medial prefrontal cortex (mPFC) glutamatergic output neurons. Chronic stress selectively increases inhibitory neurotransmission and decreases glucocorticoid receptor immunoreactivity specifically in a subset of inhibitory neurons, suggesting that increased inhibitory tone in the mPFC following chronic stress may be due to loss of a GR-mediated brake on interneuron activity. Furthermore, inhibitory appositions onto glutamatergic cells are increased by chronic stress. During chronic stress, rats initially make significantly more errors in the delayed spatial win-shift task, a mPFC-mediated behavior, suggesting a diminished influence of the mPFC. Taken together, the data suggest that chronic stress increases inhibition of prefrontal glutamatergic output neurons, limiting the influence of the prefrontal cortex, which is detrimental when prefrontal engagement is needed.

The balance between excitatory and inhibitory neurotransmission in the brain is a delicate and fine-tuned process, such that shifts toward one or the other in the wrong context can have profound consequences for the individual. Indeed, an imbalance between excitatory and inhibitory neurotransmission is proposed to underlie multiple neuropsychiatric disorders, including major depressive disorder (MDD), schizophrenia, epilepsy, anxiety, Parkinson’s disease, and bipolar disorder (Luscher et al., 2011; Popoli et al., 2012; Sanacora et al., 2012;

Skolnick et al., 2009). Moreover, many of these disorders are comorbid with chronic stress and hypercortisolemia (Agid et al., 1999; Altamura et al., 1999; Barden, 2004; Corcoran et al., 2002;

Ryan et al., 2004; Ventura et al., 1989) and prefrontal cortical dysfunction (Lewis et al., 2004;

Monchi et al., 2004; Rogers et al., 2004; Shad et al., 2004). Thus, understanding how chronic stress affects the balance between excitatory and inhibitory neurotransmission in the prefrontal cortex is of paramount importance for understanding disorders linked to stress and prefrontal cortical dysfunction.

The medial prefrontal cortex (mPFC) is implicated in feedback control of the hypothalamic-pituitary-adrenocortical (HPA) axis activity, the neuroendocrine component of the stress response, (Diorio et al., 1993; Figueiredo et al., 2003; Jones et al., 2011; Radley et al.,

2006a). Recent studies from our group demonstrate that glucocorticoids act specifically at mPFC glucocorticoid receptors (GRs) to regulate the HPA axis and behavior (McKlveen et al.,

2013). Importantly, GR regulation of chronic stress reactivity occurs at the level of the infralimbic prefrontal cortex (ilPFC), the rodent homologue of Brodmann area 25, which is dysregulated in patients with MDD.

Morphological analysis of the mPFC following chronic stress suggests altered neuronal excitability as there is a decrease in the dendritic complexity of pyramidal neurons (Cook and

Wellman, 2004; Goldwater et al., 2009; Liston et al., 2006; Mizoguchi et al., 2003; Radley et al.,

2008, 2004) and an increase in interneuron arborization (Gilabert-Juan et al., 2013). Although the functional consequences of morphological rearrangements are presently unknown, the

55 directionality suggests a shift toward greater inhibition of glutamatergic pyramidal cells. Indeed, stress-induced decreases in glutamatergic complexity in layer V of the mPFC correlates with reduced excitatory neural responses to serotonin (Holmes and Wellman, 2009; Liu and

Aghajanian, 2008). Thus, it appears that chronic stress may alter the balance of excitatory and inhibitory neurotransmission, comprising the functionality of the mPFC.

The mPFC is critical in the regulation of cognitive function, including behavioral flexibility, strategic planning, rule learning, behavioral inhibition, and spatial memory (Holmes and Wellman, 2009). Previous studies have shown that chronic stress impairs these prefrontal- mediated tasks (Bondi et al., 2008; Cerqueira et al., 2007, 2005; Delatour and Gisquet-Verrier,

2000; Liston et al., 2006; Mizoguchi et al., 2000; Murphy et al., 1996; Nishimura et al., 1999;

Ragozzino et al., 1999).Thus, disruption of prefrontal neurotransmission due to chronic stress can have profound behavioral effects.

Herein, we use multiple approaches, including whole cell voltage-clamp and immunohistochemistry, to test the hypothesis that chronic stress shifts the balance between excitatory and inhibitory neurotransmission toward greater inhibition of infralimbic prefrontal glutamatergic output neurons. Further, we tested the hypothesis that chronic stress will impair prefrontal-mediated learning using a delayed spatial win-shift task, which requires prefrontal engagement. The present study demonstrates that chronic stress indeed shifts the balance in neurotransmission toward greater inhibition of glutamatergic output neurons in layer V of the infralimbic cortex via a presynaptic increase in GABA. This increase in inhibitory transmission appears to be due at least in part to in an increase in GABAergic innervation of glutamatergic output neurons. Further, chronic stress induces GR downregulation specifically in the parvalbumin subset of prefrontal interneurons, suggesting that the GR normally acts as a brake on interneuronal activity. Finally, we show that our chronic variable stress model impairs learning of a prefrontal-mediated task, which may be due to stress-induced increased inhibition of the prefrontal glutamatergic neurons and ultimately prefrontal disengagement.

Materials and Methods

Ex Vivo

Subjects. Male Sprague Dawley rats (n=10) from Harlan (Indianapolis, IN) age 54-57 days or

200-225 g upon arrival were doubly housed throughout the experiment in a temperature/humidity-controlled room on a 14:10 h light/dark cycle. Food (Teklad, Harlan) and water were available ad libitum.

Chronic Variable Stress. Approximately half of the animals were unhandled (naïve; n=5) or underwent chronic variable stress (CVS) for 14 days (n=5) beginning at ~PND60 (to obviate any developmental confounds). The CVS was comprised of twice daily (AM and PM) repeated and unpredictable stressors, including cold swims (10 min, 16–18ºC), warm swims (20 min, 30–

32ºC), cold room exposure (1 hour, 4ºC), shaker stress (1 hour, 100 rpm), open field (5 min), and hypoxia (30 min, 8% oxygen) (McKlveen et al., 2013).

Electrophysiology

Preparation of ilPFC slices. Approximately 16 hours after the last stressor, animals were anesthetized with sodium pentobarbital and perfused with cold dissection solution [(In mM): 250 sucrose, 2.5 KCl, 25 NaHCO3, 1.0 NaH2PO4, 6 MgCl2, 0.5 CaCl2, and 25 glucose] continuously bubbled with 95% O2 / 5% CO2. The prefrontal cortex was sectioned in 300 µm slices using a vibratome (7000smz-2; Campden Instruments, Lafayette, IN) and placed in in a recovery solution containing (in mM): 92 NMDG, 2.5 KCl, 1.2 NaH2PO4, 30 NaHCO3, 20 HEPES, 25 glucose, 5 Na ascorbate, 2 thiourea, 3 Na pyruvate, 10 MgSO4, and 0.5 CaCl2 (Ting et. al,

2011) for 15-20 min and then transferred to a chamber containing oxygenated artificial CSF

(aCSF) solution [(in mM): 125 NaCl, 2.5 KCl, 25 NaHCO3, 1.0 NaH2PO4, 1.0 MgCl2, 2.0 CaCl2, and 25 glucose] for ≥ 1 h at room temperature. After recovery, slices were transferred to a submersion-type recording chamber, mounted on the stage of an upright microscope (BX51WI,

Olympus, Center Valley, PA) and perfused with oxygenated aCSF at room temperature.

Patch clamp recordings. Patch electrodes were constructed from thin-walled single- filamented borosilicate glass (1.5 mm outer diameter; World Precision Instruments) using a microelectrode puller (P-97; Sutter Instruments, Novato, CA). Pipette resistances ranged from 4 to 6 M and seal resistances were >1 G. To record miniature excitatory and inhibitory postsynaptic currents (mEPSCs and mIPSCs), electrodes were filled with an intracellular

solution containing (in mM): 130 Cs-gluconate, 10 CsCl, 10 HEPES, 11 EGTA, 1.0 CaCl2, and

2.0 MgATP, pH 7.2 (290-300 mOsm). Evoked IPSCs were recorded using an intracellular solution containing (in mM): 130 CsCl, 10 HEPES, 2 MgCl2, 2 Na2ATP, 0.3 Na3GTP, 1 QX-314

(lidocaine), pH 7.2 (290-300 mosm).

Whole-cell patch clamp recordings were obtained from layer V pyramidal neurons in the ilPFC, which are easily identifiable in the slice on the basis of somal morphology and the presence of a prominent apical dendrite, using a Multiclamp 700B amplifier (Molecular Devices,

Sunnyvale, CA). mEPSCs and mIPSCs were recorded in the presence of tetrodotoxin (TTX;

500 nM) to block sodium channels and action potential discharge in the slice. mEPSCs were recorded at a holding potential of -70 mV and mIPSCs were recorded at a holding potential of 0 mV in the same cell (3 min each; n=21-25 cells per group). Bath application of 10 M gabazine

(SR 95531 hydrobromide; Tocris, Bristol, UK) abolished mIPSCs at a holding potential of 0 mV, showing that the IPSCs observed using this protocol are mediated by GABAARs (Figure 3.2).

In other experiments, IPSCs were evoked from a holding potential of -70 mV (using a

CsCl-based internal solution) by focal electrical stimulation delivered by a second patch electrode connected to a constant-current stimulator (Master-8, Jerusalem, Israel) which was placed close to the apical dendrite of the recorded neuron. GABAAR-mediated IPSCs were isolated via the bath application of D-AP5 (25 µM), NBQX (10µM) to glutamate receptor activation and strychnine (0.5 µM) to block glycine receptor activation. The amplitude of the evoked IPSC was plotted as a function of stimulus intensity (0-30 A at 100 s duration, in 5A

58 steps). Monosynaptic GABAAR-mediated IPSCs were repetitively evoked in layer V pyramidal cells as described above at an intensity of 1.2-1.8X threshold (where threshold is defined as the stimulus intensity that elicits an IPSC in 50% of the trials). To measure the paired-pulse ratio

(PPR), which is inversely proportional to the probability of release (Pr), pairs of identical stimuli

(at 1.2-1.8X threshold at a frequency of 0.10 Hz) were delivered at an inter-stimulus interval of

100 ms, and the PPR calculated as: PPR = Mean IPSC2 / Mean IPSC1. The coefficient of variation (CV) of the evoked IPSC amplitudes (across 30 trials), which is thought to inversely depend on both Pr and the number of synaptic release sites (n), will be defined as standard deviation / mean. As another method for measuring the number of synaptic inputs, we used a high frequency train protocol designed to estimate the readily releasable pool (RRP), as previously described (Abidin et al., 2008). This protocol was developed based on the fact that

IPSCs can be approximated by a binomial model of synaptic transmission (Katz, 1969). The model can be summarized using the following equation:

Mean eIPSC=Nsyn x Pr x q whereby ‘Nsyn’ refers to the number of synaptic release sites, ‘Pr’ refers to the probability of release, and ‘q’ refers to the quantal size. The model suggests that 1) there is a constant number of Nsyn that releases vesicles with an average Pr, 2) a single vesicle produces q, 3) all release sites are independent, and 4) each release site elicits a single vesicle or nothing in response to a stimulus (i.e. action potential). High-frequency stimulation (HFS) (40 pulses,

50Hz, at the same stimulation intensity used for PPR and CV) was delivered to the slice. Upon repetitive stimulation, the eIPSC amplitude decreases presumably due to a transient decrease in the readily releasable quanta (Kirischuk and Grantyn, 2003; Schneggenburger et al., 1999).

Thus, if all eIPSCs are plotted versus the stimulus number (using Origin software), where the eIPSC amplitudes reach a steady state (as evidenced by a linear slope), the cumulative RRP can be estimated by back-extrapolation to the start of the train (see Figure 3.1). This also assumes that 1) the number of release sites remains constant throughout the experiment and

59 that 2) the linear component reflects vesicle recycling (Baldelli et al., 2005). Thus, Pr can be estimated by the following equation:

Pr = first eIPSC/RRP whereby, the first eIPSC is the amplitude of the first eIPSC of the train and the RRP is equal to the cumulative IPSC amplitude calculated from the eIPSC amplitude plot (in the absence of vesicle recycling). In order to estimate q, spontaneous (s) IPSCs were recorded for 3-4 min following the HFS (in the absence of TTX). Because sIPSCs may contain responses greater than the quantal size, using the mean amplitude could skew q. Thus, the median sIPSC amplitude was used as an index of q, rather than the arithmetic mean (Kirischuk et al., 2005).

Using the same cells for the HFS and for the estimation of q, rather than sampling q from a separate subset of neurons, provides a better estimate of quantal amplitude for each neuron

(Abidin et al., 2008). After obtaining the values for the eIPSC amplitudes, Pr, and q, the

Nsyn can be calculated using the equation for the model mentioned previously.

Membrane voltages were adjusted for liquid junction potentials calculated using JPCalc software (P. Barry, University of New South Wales, Sydney, Australia; modified for Molecular

Devices). Currents were filtered at 4–6 kHz through a –3 dB, four-pole low-pass Bessel filter, digitally sampled at 20 kHz, and stored on a personal computer (ICT, Cincinnati, OH) using a commercially available data acquisition system (Digidata 1440A with pClamp 10.0 software;

Molecular Devices).

In Vivo

Neuroanatomical Studies

Subjects. Male Sprague Dawley rats from Harlan (Indianapolis, IN) age 250-275 g upon arrival were singly housed throughout the experiment in a temperature/humidity-controlled room on a

12:12 h light/dark cycle. Food (Teklad, Harlan) and water were available ad libitum.

Chronic Variable Stress. Approximately half of the animals were unhandled (naïve; n=8) or underwent chronic variable stress (CVS) for 14 days (n=8), as previously described.

Tissue Collection. Animals were given an overdose of sodium pentobarbital and transcardialy perfused with 0.9% saline followed by 4% sodium phosphate-buffered paraformaldehyde.

Brains were post-fixed in 4% sodium phosphate-buffered paraformaldehyde for 24 hours, then stored in 30% sucrose in DEPC-treated water at 4ºC. Brains were sectioned on a mictotome in 30-μm coronal sections (Leica, Buffalo Grove, Illinois).

Immunohistochemistry. Sections were immunolabeled with primary antibodies against GR (M-

20) (1:1000; Santa Cruz Biotech, Santa Cruz, CA), glutamic acid decarboxylase (GAD) GAD67

(1:1000; Millipore, Billerica, MA), calcium calmodulin kinase II alpha (CaMKIIα) (1:200; Abcam,

Cambridge, MA), GAD65 (1:100; Developmental Studies Hybridoma Bank, University of Iowa,

Iowa City, IA), parvalbumin (PV) (1:2000; Sigma Life Science, St. Louis, Missouri), cholecystokinin (CCK) (1:1000; Abcam), somatostatin (SST) (1:250; MAB354; Millipore,

Billerica, MA), calretinin (1:500; Swant, Switzerland), and calbindin (1:1000; D-28k; Sigma Life

Science), using standard immunohistochemical procedures, as described previously (McKlveen et al., 2013).

For double-label glucocorticoid receptor (GR) and GAD67, PV, CCK, calretinin, or calbindin immunolabeling, free-floating sections stored in sodium phosphate-buffered

DEPC-treated cryoprotective solution, following sectioning, were rinsed 5 times with 50 mM potassium phosphate buffered saline (KPBS) solution. Following all incubations, sections were rinsed with 50 mM KPBS 5 times unless otherwise indicated. Sections were blocked in 0.1% bovine serum albumin (BSA) and 0.2% Triton-X in 50 mM KPBS for 1 h prior to incubation in rabbit polyclonal anti-GR (M-20) primary antibody and mouse antibodies targeting GAD67, PV,

CCK, calretinin, or calbindin for approximately 18 h at 4°C. Sections were incubated in Cy3 anti- rabbit and Cy5 anti-mouse secondary antibodies (each at 1:500; JacksonImmuno, West Grove,

PA) for 1 h at room temperature. For SST and GR co-immunolabeling, sections were incubated

61 in rat monoclonal anti-SST for 24 h at 4°C before addition of rabbit anti-GR for an additional 24 h at 4°C. Sections were then incubated in Cy5 anti-rabbit and biotinylated anti-rat for 1 h at room temperature (each at 1:500; JacksonImmuno and Vector Laboratories, Burlingame, CA, respectively). Sections were next amplified with avidin-biotin complex (1:1000 in KPBS; 1 h at room temperature; Vector Laboratories) and then incubated with Cy3 strepavidin for 1 h at room temperature (1:250; JacksonImmuno). Sections were rinsed 4 times in 50 mM KPBS and mounted in 50 mM potassium phosphate-buffered solution and 1% gelatin onto ultrastick slides

(Gold Seal, Portsmouth, NH) and coverslipped with polyvinyl alcohol anti-fading medium with

DABCO (Sigma-Aldrich, St. Louis, MO).

For CaMKIIα and GAD65 immunolabeling, free-floating sections stored in sodium phosphate-buffered DEPC-treated cryoprotective solution, following sectioning, were washed and blocked for 1 h in 0.1% BSA without Triton-X. Sections were then incubated overnight in anti-CaMKIIα primary antibody for approximately 18 h at 4°C. Sections were next incubated in

Cy3 donkey anti-mouse (1:500; JacksonImmuno) for 1 h at room temperature and then blocked for 1 h in 0.1% BSA and 0.2% Triton-X in 50 mM KPBS. Sections were then incubated in

GAD65 primary antibody for approximately 18 h at 4°C. Next, sections were incubated in donkey anti-mouse Alexa 488 (1:500; JacksonImmuno), mounted, and coverslipped, as described above.

Imaging and Analysis. For analysis of GAD65 appositions onto CamKIIα-positive cells, 3 z- stacks (at a 0.5 µm interval) of each side of the ilPFC at the rostral (AP ~ +3.2 mm from bregma), middle (AP ~ +2.7 mm from bregma, and caudal (AP~+2.2 mm from bregma) extent, as defined by the rat stereotaxic brain atlas of Paxinos and Watson (1998), were captured at

63x magnification with a Carl Zeiss Imager Z.1 (Carl Zeiss Microimaging, Thornwood, New

York). Images were captured on the same day with the same settings, and a uniform threshold was applied to all images in a given brain region. The criteria for inclusion for each cell was: 1) definitive CaMKIIα-positive immunoreactivity, 2) the total z-plane of the soma visible within the

z-stack, 3) sufficient separation from other cells in order to clearly identify appositions on that particular cell, as previously described (Flak et al., 2009). Immunoreactive cells were identified by scrolling through the z-stacks. All cells within the z-stack that met criteria were selected and analyzed. The total number of GAD65-positive boutons in apposition to the CaMKIIα-positive soma through the complete z-axis of each of the cells was quantified. Appositions were defined by immunoreactive boutons with absolutely no visible space between the bouton and the edge of the CaMKIIα-positive cell (see Figure 3.5). Immunoreactive labeling on the soma within a given z-plane was not included. To ensure that each bouton was only counted once, appositions were counted while scrolling back and forth through the z-stack. Due to insufficient immunoreactive labeling of the dendrites, only appositions onto CaMKII-positive soma were analyzed. The number of appositions for each cell was normalized to the cell volume. In order to estimate the volume of each cell, we used the unbiased “nucleator” method (Gundersen et al.,

1998). Using Axiovision 4.4, we focused on the CaMKIIα-positive cell at the level of the nucleolus and measured the distance from the center to the edge of the cell along a randomly selected angle between 1-90 and again 90, 180, and 270 degrees away from the original angle.

These radii measurements were then average and used to estimate cellular volume using the equation for the volume of a sphere: v=πr3.

For analysis of GR colocalization with GAD67, calretinin, calbindin, CCK, SST, and PV, z-stacks of each side of the ilPFC were captured at ~ +3.2mm (rostral), ~ +2.7mm (middle), and

~ +2.2mm (caudal) from bregma, as defined by Paxinos and Watson (1998), at 20x magnification. The criteria for colocalization of GR with each of the interneuron subtypes was as follows: 1) at the largest part of the GAD-positive cell GR immunoreativity must also be present,

2) the largest radius of the GAD-positive cell must match with the largest radius of the GR- positive cell, 3) the threshold for positive GR-immunoreactivity was set at 50% above background using Image J Analysis. All image capturing and quantification was conducted by

63 an experimenter blinded to experimental treatments. After all quantification had taken place, images presented in the article were cropped and contrast and brightness were adjusted

to enhance publication quality without altering the presence or absence of immunolabeling.

Behavioral Studies

Subjects. Male Sprague Dawley rats from Harlan (Indianapolis, IN) age 54-57 days upon arrival were singly-housed throughout the experiment in a temperature/humidity-controlled room on a

12:12 h reverse light/dark cycle. Animals were allowed to habituate to the vivarium for one week prior to experimentation. Food and water were available ad libitum during habituation to the vivarium and during the initial 14 days of CVS only. Otherwise, animals were restricted to 70% of their ab libitum baseline food intake throughout the study. All experimental procedures conducted below were conducted in accordance with the National Institutes of Health

Guidelines for the Care and Use of Animals and approved by the University of Cincinnati

Institutional Animal Care and Use Committee.

Chronic Variable Stress. Approximately half of the animals underwent chronic variable stress

(CVS) for 14 days (n = 12) during the light phase, as previously described.

Delayed Spatial Win-Shift Task. Animals were pre-exposed to semi-sweet chocolate morsels in their home cage for 2 nights prior to 2 days of 10 min habituation to a dimly lit 8-arm radial arm maze (RAM), the 1st and 2nd day without and with chocolate placed in the center of the maze, respectively. Animals began training on the delayed spatial win-shift (DSWS) task on the

15th day of CVS. The task consisted of three phases (training, delay, and testing), daily, and was conducted during the dark-phase when animals typically consume the majority of their caloric intake. During the training phase, animals were placed in the RAM with 4 blocked arms and 4 baited arms for a maximum of 5 min. After successfully visiting each baited arm, animals were returned to their home cage, with no view of the RAM, for the 5 min delay phase. During the testing or retrieval phase, the previously blocked arms were the only 4 baited arms. Again, the animals had to visit each baited arm to complete the task in a maximum of 5 min before

64 being removed from the RAM. Each day the baited arms for the training and test phase were randomly selected. The RAM was cleaned with 20% EtOH each time an animal was introduced to the RAM to disrupt any olfactory cues, forcing the animal to rely on spatial cues presented around the room. Animals were trained daily on the task until all animals reach the criterion of visiting the 4 baited arms during the testing phase in 5 or fewer choices, 2 consecutive days in a row.

Statistical Analysis

Electrophysiological data were analyzed using Clampfit (Molecular Devices) and MiniAnalysis

(v6.0.3, Synaptosoft, Decatur, Georgia) software. The evoked experiments were conducted in two cohorts. There were no significant differences between cohorts, therefore, data were averaged for each of the measurements. The frequency, amplitude, and kinetics of the mEPSCs and mIPSCs were compared between naïve and CVS animals using t-test or Mann-Whitney.

Data failing the Shapiro-Wilk test of normality were log transformed. Behavioral data were analyzed using 2-way repeated measures (RM) analysis of variance (ANOVA) [time(days) x number of errors], with time as the repeated measure or t-test. Apposition and cell counting data were analyzed with t-test, one-way ANOVA, or nonparametric tests, where appropriate. Data failing the Shapiro-Wilk test of normality were log transformed. Significance was set at p≤0.05.

Results

We first tested the hypothesis that chronic stress would shift the balance between excitatory and inhibitory balance toward greater inhibitory neurotransmission in the ilPFC. Using a whole-cell voltage clamp configuration, we recorded mIPSCs and mEPSCs in layer V ilPFC of the same pyramidal neurons (see Figure 3.2). Chronic stress significantly increased mIPSC frequency (t42=2.318, p=0.03, t-test on transformed data) with no effect on mIPSC amplitude

(t(42)=0.2825, p=0.78, t-test) or excitatory neurotransmission [amplitude (t43=1.217, p=0.23, t- test) or frequency (U=247.0, p=0.92, Mann-Whitney test)] (Figure 3.3). Further, inhibitory synaptic drive was significantly increased following chronic stress (t43=2.133, p=0.04, t-test on transformed data), as well as the ratio of mIPSC to mEPSC frequency (t41=3.055, p=.004, t-test on transformed data) (Figure 3.3). Taken together, the data suggest increased inhibitory neurotransmission in the ilPFC following chronic stress.

Since miniature (i.e. action-potential independent) and evoked (i.e. action potential- dependent) transmitter release may be regulated by different mechanisms in the CNS (Fredj and Burrone, 2009; Maeda et al., 2009; Sara et al., 2005), it is important to verify that chronic stress also potentiates evoked GABAergic responses in PFC pyramidal neurons. Furthermore, the higher frequency of GABAergic mIPSCs observed in layer V pyramidal cells after CVS may reflect an increase in the probability of GABA release (Pr) in the PFC and/or an increase in the number of GABAergic synapses (n) onto pyramidal neurons. Therefore, monosynaptic

GABAAR-mediated IPSCs were isolated in layer V pyramidal cells following focal electrical stimulation within layer V near the apical dendrite in the presence of aCSF. We found no differences in the stimulus-response curve of evoked IPSCs (no stimulus x response interaction,

F6,198=0.59, p= 0.74, 2-way RM ANOVA), no difference in Pr (U=103, p=0.72, Mann-Whitney), and no differences in the coefficient of variation (U=164, p= 0.65, Mann-Whitney) or Nsyn

(t28=0.8531, p=0.4, t-test on transformed data) following chronic stress (Figure 3.4).

Since chronic stress increases inhibitory neurotransmission in the ilPFC and chronic

restraint stress increases arborization of prefrontal interneurons (Gilabert-Juan et al., 2013), we analyzed the number of GAD65 appositions onto CaMKIIα-positive glutamatergic cells using dual-label immunohistochemistry. Indeed, chronic stress increases the number of GAD65 appositions onto glutamatergic soma in all layers of the ilPFC (t10=2.27, p=0.05, t-test) and specifically in layers II-III [t11=2.12, p=0.03, one-tailed t-test] and layers V-VI (t10=2.297, p=0.04, t-test), suggesting that chronic stress is increasing GABAergic innervation of prefrontal output neurons (Figure 3.5).

It was previously demonstrated that chronic stress downregulates GR expression via western blot and in situ hybridization in the mPFC; however, the specific phenotype of the neurons exhibiting this downregulation is unknown (Mizoguchi et al., 2003). Therefore, we used dual-label immunohistochemistry to test the hypothesis that GR downregulation is specific to interneurons. Following chronic stress, GR colocalization with GAD67-positive neurons is significantly decreased (F1,14=12.417, p=0.003, one-way ANOVA), with no effect on GR and

CaMKII colocalization (H1=0.044, p=0.88, Kruskal-Wallis one-way ANOVA) (Figure 3.6). Next, we dual-labeled GR with antibodies targeting distinct inhibitory neuronal populations, including:

PV (Figure 3.6), SST (not shown), CCK (Figure 3.7), calretinin (Figure 3.8), and calbindin

(Figure 3.7). Notably, GR colocalization was significantly decreased only in PV-positive interneurons (F1,15= 12.14, p=0.003, one-way ANOVA). GR colocalization was absent in calbindin-, SST-, and CCK-positive cells and unaffected in calretinin-positive cells (F1,10= 0.27, p=0.62, one-way ANOVA), suggesting that GR downregulation is specific to a subset of interneurons, and that the receptor is not present in all interneuron populations.

While the effects of chronic stress on executive functioning have been tested previously

(Bondi et al., 2008; Cerqueira et al., 2007, 2005), whether or not the chronic variable stress paradigm that our lab employs affects a predominantly prefrontal-mediated task is unknown.

The prefrontal cortex is particularly important for behavioral flexibility, a process that requires

67 the individual to continually update their behavioral strategies based on the context (Birrell and

Brown, 2000; Cerqueira et al., 2007, 2005; Lapiz and Morilak, 2006; Stalnaker et al., 2009). We used the delayed spatial win-shift paradigm, developed and commonly used by Floresco and colleagues (Butts et al., 2011; Floresco et al., 1997; Seamans et al., 1995), to test the hypothesis that CVS impairs learning of a prefrontal-mediated task. This task requires animals to use information garnered during the training phase to prospectively plan and alter their behavior during the testing phase (see Figure 3.9 for illustration of the task). Chronically stressed animals initially had significantly impaired learning on the 2nd and 3rd day of the DSWS task (higher total errors), as indicated by a stress x time interaction (F15,360 = 1.8, p = 0.03).

Thus, chronically stressed animals are impaired at learning the ‘shift’ contingency. Total errors included both within-phase (revisiting the same arm during the testing phase) and across-phase errors (visiting un-baited arms during the testing phase that were previously baited during the training phase). Chronically stressed animals made significantly more across-phase (on the 3rd

nd rd day) (main effect of stress, F1, 25 = 4.13, p = 0.05) and within-phase errors (on the 2 and 3 days) (stress x time interaction; F15, 350 = 2.02, p = 0.01). Notably, chronically stressed animals made more within-phase errors, indicating that these animals had impaired working memory, a prefrontal-mediated function. There was no significant difference in acquisition of the task overall (F1,23 = 1.14, p = 0.30). Taken together, this impairment in cognitive flexibility and goal- directed behavior may be the result of diminished prefrontal involvement under chronic stress.

Discussion

Our study provides evidence for a profound shift in the balance between excitatory and inhibitory neurotransmission in the ilPFC following chronic stress. Stress biases toward greater inhibition of glutamatergic output neurons, manifest as increased frequency of mIPSCs and enhanced GABAergic innervation of principle output neurons. Morphological analysis reveals a selective loss of GR immunoreactivity in PV-expressing populations of interneurons, suggesting a connection between loss of interneuron glucocorticoid signaling and enhanced inhibition.

Morphological and physiological plasticity is accompanied by deficits in prefrontal-mediated spatial learning observed in this chronic stress model, verifying reduced functional activation of prefrontal circuitry.

Increased inhibitory neurotransmission following chronic stress is in stark contrast to the increased excitatory and decreased inhibitory neurotransmission observed following acute stress (Hill et al., 2011; Musazzi et al., 2010; Treccani et al., 2014a, 2014b; Yuen et al., 2011,

2009). It is important to note that another group has shown that acute stress rapidly increases spontaneous and mIPSCs in the mPFC via the nitric oxide and phospholipase-C-diaclglycerol pathways (Teng et al., 2013). However, timing is of utmost importance when studying the effects of glucocorticoids and the aforementioned studies were likely looking at genomic effects of glucocorticoids (Joels and Karst, 2012). Given the fact that mIPSCs were measured approximately 16-18 hours following the last stressor, our effects are likely also genomic in nature. Thus, it appears that acute stress initially rapidly inhibits prefrontal glutamatergic neurons and over time GR activation (genomic) leads to endocannabinoid inhibition of the interneurons allowing for prefrontal glutamatergic regulation of downstream targets to regulate the HPA axis, as well, as behavior (Hill et al., 2011). Under chronic stress, however, this brake on interneuron activity is significantly attenuated, leading to increased inhibition of glutamatergic output and diminished influence of the prefrontal cortex.

Chronic stress leads to a downregulation of the GR in the prefrontal cortex (Mizoguchi et al., 2003). Our studies suggest that stress-induced downregulation of GR immunoreactivity was specific to GAD-positive neurons, and has no effect on colocalization of GR in glutamatergic projection neurons (identified by CaMKIIα staining in layer V). We next looked at various interneuronal subtypes and GR colocalization. Stress-induced colocalization of GR was observed only in PV-positive neurons. Parvalbumin is the most predominant interneuron subtype in cortex, making up over half of the interneuron population in layer V of the cortex, and it does not colocalize with any other known interneuron subtype (Kubota et al., 1994; Uematsu et al., 2008). Thus, a decrease in GR specifically in parvalbumin neurons could affect a significant proportion of the interneuron population and have profound effects on inhibitory neurotransmission, as observed in the present study. Moreover, PV regulates the glutamatergic pyramidal neurons and is therefore well-positioned to serve as a target for glucocorticoids (Pi et al., 2013). We also found that many of the interneuron subtypes did not colocalize with the GR

(e.g. SST, CCK, calbindin), suggesting that glucocorticoids may not directly affect their activity.

Indeed, we propose that under acute stress glucocorticoids act at the GR (genomically) to brake interneuron activity, decreasing the excitability of the neurons leading to disinhibition of prefrontal glutamatergic output neurons (see Figure 3.10). Under chronic stress, downregulation of the GR removes the brake on interneuronal activity, leading to increased inhibition of the glutamatergic output neurons, diminishing the output of the prefrontal cortex (see Figure 3.11).

Prior studies of chronic stress-induced morphological plasticity have focused on dendritic retraction in glutamatergic pyramidal neurons (Cook and Wellman, 2004; Radley and Morrison,

2005; Radley et al., 2006b, 2004; Seib and Wellman, 2003; Wellman, 2001). More recently, however, Nacher and colleagues found increased interneuron arborization using a transgenic mouse line that expressed enhanced green fluorescent protein (eGFP) under the GAD67 promoter (Gilabert-Juan et al., 2013). It is important to note that in cortex expression of the

70 eGFP is confined mainly to the SST-positive Martinotti cells (Gilabert-Juan et al., 2013). Thus, whether chronic stress leads to a general or subset-specific increase of interneuron arborization is still unknown. Given these changes in interneuronal morphology and the increased inhibitory neurotransmission observed in the present study, we tested the hypothesis that chronic stress increases GABAergic innervation of the glutamatergic output neurons. We quantified GAD65- positive (marker of inhibitory terminals) appositions on glutamatergic (CaMKIIα-positive) cells and found that chronic stress increases the number of inhibitory appositions onto the glutamatergic output neurons across all layers of the ilPFC. Thus, it appears that chronic stress increases inhibitory neurotransmission, at least in part, through interneuronal synaptic plasticity.

Increased inhibitory neurotransmission could be the result of either increased probability of GABA release or due to an increase in GABA release sites. We, therefore, sought to distinguish between these two possibilities by evoking inhibitory responses in layer V of the prefrontal cortex. However, we failed to see any differences in the paired-pulse responses, coefficient of variation, or responses generated from high-frequency trains. There are a number of reasons why differences were potentially not detected. First of all, we may not have been stimulating inhibitory neurons that synapse onto patched glutamatergic neurons. Since we were unable to visualize the inhibitory neurons that were making synapses onto patched pyramidal neurons, stimulation near the soma of the recorded neuron was a somewhat blind approach.

We chose to stimulate directly in layer V after pilot stimulation in layers II/III failed to induce any changes and PV neurons tend to innervate neurons within the layer that they are located and in the perisomatic region of pyramidal neurons (Freund and Katona, 2007; Kubota et al., 1994;

Uematsu et al., 2008). As mentioned previously, evoked (i.e. action potential-dependent) and miniature (i.e. action-potential independent) transmitter release may also be regulated by different mechanisms in the CNS (Fredj and Burrone, 2009; Maeda et al., 2009; Sara et al.,

2005). Therefore, the observed increase in mIPSC frequency may occur independently of action potential-dependent neurotransmitter release. Finally, the size (as estimated in pF) of the

71 recorded neurons was significantly smaller with the evoked experiment compared to the approximate size of the neurons from the mIPSC and mEPSC experiment. Consequently, the most likely explanation is that different population of neurons were queried in each of the experiments. Future experiments, outside of the scope of the present study, are needed to ensure that the change in mIPSC is action potential-independent and delineate the exact physiological mechanism for increased inhibitory neurotransmission following chronic stress.

Although, our neuroantamoical data at the very least suggests an increase in GABA release sites (increased GABAergic innervation of glutamatergic output neurons) following chronic stress, whether this increase in GABAergic innervation is the sole explanation for the increase in inhibitory neurotransmission remains to be determined.

We found that chronic stress increased inhibitory neurotransmission in the infralimbic mPFC. This is in contrast to findings from Yan and colleagues who found that chronic restraint and unpredictable stress decreased excitatory neurotransmission with no effect on inhibitory neurotransmission (Yuen et al., 2012). Notably, these studies were conducted in adolescent rats, when the mPFC is actively undergoing development, including glutamatergic pruning and increasing GABAergic signaling (Cressman et al., 2010; Selemon, 2013). For that reason, we ensured that animals were at least PND60 before beginning CVS in order to confirm that we were able to study the effects of stress in the absence of potential developmental confounds.

Therefore, the present study highlights the fact that chronic stress affects the adult brain much differently than the adolescent brain and the importance of not generalizing changes found in adolescence to adulthood (Jankord et al., 2011).

The prefrontal cortex is known to be important for executive functions, including behavioral flexibility, strategic planning, and decision making. It is also important for spatial and working memory. Likewise, the GABAergic system is known to regulate excitability, neural circuits, and ultimately contributes to learning and memory (Castillo et al., 2011). GABA

72 agonists impair memory and antagonists facilitate recall (Zarrindast et al., 2002, 2004). As discussed previously, acute stress diminishes GABAergic signaling, which facilitates learning and memory (Sharma and Kulkarni, 1990, 1993; Zheng et al., 2007). Given that chronic stress increases inhibitory neurotransmission, we used the delayed spatial win-shift paradigm to test the hypothesis that chronic stress impairs prefrontal-mediated cognitive flexibility. We found that animals initially were impaired at learning the contingency and flexibly changing their behavior, suggesting that CVS does impair prefrontal engagement. Notably, chronically stressed animals had greater working memory impairment, also indicating prefrontal dysfunction. Overall, however, chronically stressed animals are not significantly impaired at acquiring this task. Thus, chronic stress-induced inhibition of prefrontal output may account for stress-induced deficits in prefrontal-mediated behaviors.

The ilPFC is well positioned to regulate both neuroendocrine and behavioral responses to stress. Though the prefrontal cortex does not directly project to the paraventricular nucleus (PVN) of the hypothalamus, the ilPFC sends projections to the PVN via multisynaptic projections to the posterior hypothalamus (PH) and the nucleus of the solitary tract (NTS) to regulate the HPA axis and behavior (Myers et al., 2012; Vertes, 2004). Stress levels of glucocorticoids bind to the ilPFC GR and can at least partially regulate stress reactivity and feedback of the HPA axis (McKlveen et al., 2013). In a previous study from our group, we found that knockdown of the GR alone induces depression-like behavior, and that the ilPFC appears to be particularly important for HPA axis regulation under chronic stress (McKlveen et al., 2013).

Taken together, glucocorticoids act at the infralimbic GR to inhibit interneuronal inhibition of the glutamatergic output neurons, allowing the prefrontal cortex to become engaged, activating downstream targets such as the PH and NTS to regulate the HPA axis and behavior (see Figure

3.11). Under chronic stress, downregulation of GR diminishes the ability of glucocorticoids to dampen the GABAergic system, resulting in increased inhibition of the glutamatergic output

73 neurons. In turn, prefrontal cortical output is presumably diminished, which offers a potential mechanism for dysregulation of the HPA axis under chronic stress and the depression-like phenotype observed following ilPFC GR knockdown (Figure 3.11). The ilPFC also projects to the basolateral complex of the amygdala (BLA) specifically targeting inhibitory neurons, which then elicit feed-forward inhibition of excitatory BLA projection neurons (Hubner et al., 2014;

Pinard et al., 2012; Rosenkranz and Grace, 2002; Sotres-Bayon and Quirk, 2010). Under chronic stress, there is less activation of the mPFC and heightened activation of the BLA. It is proposed that hyperactivation of the BLA under chronic stress is the result of loss/diminished top-down regulation from the mPFC (Correll et al., 2005). Thus, diminished prefrontal regulation of the BLA under chronic stress could be due to loss of the inhibitory brake (GR) on interneuron activity in the ilPFC. Herry and colleagues have recently demonstrated a similar phenomenon in the dorsal mPFC, whereby inactivation of PV neurons permits pyramidal cell firing primarily to

BLA neurons, enables neural synchrony, and induces freezing in a discriminative fear conditioning task (Courtin et al., 2014). Whether chronic stress, through loss of a brake on PV activity, diminishes the excitability or firing of glutamatergic output neurons in the mPFC and

BLA remains to be determined.

In summary, we found that chronic stress increases inhibitory neurotransmission in the ilPFC, which may underlie chronic stress-induced deficits in mPFC function. Thus, restoring the balance between excitatory and inhibitory neurotransmission may attenuate stress-induced effects on mPFC function. Therapeutics designed to achieve this goal may prove useful in the treatment of neuropsychiatric disorders linked to stress and mPFC dysfunction, e.g. MDD, schizophrenia, PTSD, etc.

Figure 3.1. Representative Example of Cumulative eIPSC Amplitude vs. Stimulus Number plot. All eIPSCs are plotted versus the stimulus number (using Origin software) and where the eIPSC amplitudes reach a steady state (as evidenced by a linear slope), the cumulative RRP can be estimated by back-extrapolation to the start of the train (y-intercept of best fit line).

Figure 3.2. Neuroanatomical location of patch clamping and representative traces. (A) Large pyramidal (>100pF on average) neurons (presumably mostly glutamatergic) were recorded from Layer V of the infralimbic prefrontal cortex near Bregma +3.2 - + 2.2 (Paxinos and Watson, 1998). (B) mIPSCS recorded at a holding potential of 0 mV before and after 10 µM gabazine (GABAAR antagonist) bath application. (C-D) Representative mIPSC and mEPSC traces, respectively, from naïve and chronically stressed animals.

Figure 3.3. Chronic stress increases inhibitory neurotransmission in the infralimbic cortex. (A- B) mIPSC and mEPSC frequencies in slices from naïve and chronically stressed animals. Chronic stress significantly increases mIPSC frequency (p<0.05), with no effect on mEPSC frequency (p>0.05). (C-D) show mIPSC and mEPSC amplitdues in slices from naïve and chronically stressed animals. There are no statistical differences in mIPSC (p>0.05) or mEPSC (p>0.05) amplitude in chronically stressed vs. naïve animals. (E-F) show increased mIPSC synaptic drive (p<0.05), with no effect of stress on excitatory synaptic drive in slices from chronically stressed animals (p>0.05). (G) The ratio of mIPSC:mEPSC in each cell was significantly shifted toward more mIPSCs following chronic stress (p<0.05). (H) ’Bursting,’ defined as a cluster of 3 or more mIPSCs separated by less 150 ms, was also significantly higher in chronically stressed animals (p<0.05) (n=21-25 cells per group, 5 animals per group). *=p<0.05.

Figure 3.4. Chronic stress does not affect evoked responses in the ilPFC. Panels A-D show the stimulus-response currents evoked following local stimulation of layer V of the infralimbic mPFC, paired-pulse ratio (PPR), coefficient of variation (CV), and estimated number of synapses (Nsyn). There were no significant differences in any evoked responses (p>0.05) (n=18-20 cells per group, n=12 animals per group).

Figure 3.5. Number of Gad65 appositions onto CaMKII-positive cells in the infralimbic cortex of naïve and chronically stressed animals. (A) Representative CaMKIIα-immunolabeled cell (red) with Gad65-positive terminals (green). Arrows denote Gad-65 terminals that were counted as appositions. (B-D) Chronic stress significantly increases the number of Gad65 appositions onto CamKII cells in all layers of the infralimbic mPFC (p<0.05) and specifically in layers II-III (p<0.05, one-tailed t-test) and layers V-VII (p<0.05). *=p<0.05. #=p<0.05, one-tailed t-test (n=7- 9 animals per group, approximately 6 slices per animal). Scale bar = 5 µm.

Figure 3.6. Percentage of Gad67, CaMKII, or PV colocalization with GR-positive neurons across all layers of the infralimbic mPFC in naïve and chronically stressed animals. Panels A and B show representative GR immunoreactivity (red) in naïve and chronically stressed animals respectively (20 x magnification). Chronic stress significantly decreases GR immunoreactivity (red) in GAD67-positive neurons (green) (p<0.05) (n=8 animals per group, 6 slices per animal). Arrows indicate Gad67 cells that have (A) or lack colocalization with GR (B). Panels D and E show representative GR (red) immunoreactivity in CaMKII-positive neurons (green), respectively (20x magnification). Chronic stress does not affect GR expression in CaMKII-positive neurons (p>0.05) (n=8 animals per group, 6 slice per animal). Panels G and H show representative GR immunoreactivity (red) in PV-positive neurons (green) (10x magnification). Arrows indicate PV- positive neurons that have (G) or lack colocalization with GR (H). Chronic stress significantly decreases GR immunoreactivity in PV-positive neurons (p<0.05) (n=7-10 animals per group, 6 slices per animal). Arrows indicate PV-positive cells that have or lack colocalization with GR. *=p<0.05. Scale bar= 50 µm.

Figure 3.7. Lack of GR colocalization with calbindin and CCK interneurons. Panels A-D show the lack of colocalization of GR (red) and calbindin (green) (20x magnification) (A-B) and GR (red) and CCK (green) (5x magnification) (C-D). Further, CCK interneurons appear to be located mainly in layers II and III of the ilPFC. Arrows indicate calbindin or CCK neurons that lack GR colocalization. Scale bar= 50 µm.

Figure 3.8. Effect of chronic stress on GR and calretinin colocalization. Panels A-B and C-D show colocalization of GR (red) and calretinin (green) (20x magnification) and lack of GR (red) and calretinin (green) colocalization in subsets of neurons (20x magnification), respectively. Chronic stress does not affect GR colocalization with calretinin (p>0.05) (n=6 animals per group, 6 slices per animal). Arrows indicate calretinin-positive neurons that have or lack colocalization with GR. Scale bar= 50 µm.

Figure 3.9. Chronic stress impairs initial behavioral flexibility. Panel (A) Schematic detailing the training, delay, and testing phases of the Delayed Spatial Win-Shift (DSWS) task. Panel B shows total errors made in the DSWS task. The graph is truncated to 7 days as there were no significant differences after day 5. Chronically stress animals initially made significantly made more errors during acquisition of the DSWS task (p<0.05). *=p<0.05.

Figure 3.10. Schematic of effects of acute stress vs. chronic stress on interneuronal plasticity and inhibitory neurotransmission in the ilPFC. We propose that acute stress induces genomic GR-dependent inhibition of parvalbumin-positive interneurons in the infralimbic prefrontal cortex, diminishing inhibitory neurotransmission, allowing the prefrontal cortex to excite downstream targets. Chronic stress increases GABAergic innervation of glutamatergic output neurons and decreases GR in parvalbumin-positive neurons. Taken together, these changes lead to an increase in inhibitory neurotransmission and diminish the influence of the prefrontal cortex on downstream targets.

Figure 3.11. Schematic of effects of acute and chronic stress on prefrontal engagement. Glucocorticoids act the infralimbic GR to inhibit interneuron inhibition of the glutamatergic projection neurons, allowing the mPFC to become engaged, activating downstream targets such as the basolateral complex of the amygdala (BLA), posterior hypothalamus (PH) and nucleus of the solitary tract (NTS). Under chronic stress, GR downregulation diminishes the ability of glucocorticoids to dampen PV-mediated inhibition, resulting in increased inhibition of the glutamatergic neurons. In turn, mPFC output is presumably diminished, which offers a potential mechanism for dysregulation of the HPA axis under chronic stress, the depression-like phenotype observed following infralimbic GR knockdown, and general dysfunction of prefrontal- mediated behaviors under chronic stress.

Table 3.1. Antibodies used in the present study.

Antigen Immunogen Dilution Company, Species, Type, Clone GR N-Terminus of the GRα of 1:1000 Santa Cruz Biotech, rabbit, mouse origin polyclonal antibody, M20 GAD65 Adult rat glutamic acid 1:100 Developmental Studies Hybridoma decaryboxylase, purified Bank; mouse; monoclonal antibody GAD67 Glutamic acid 1:1000 Millipore, mouse, monoclonal decaryboxylase antibody, 1G10.2 PV Frog muscle parvalbumin 1:2000 Sigma Life Science, mouse; monoclonal antibody, PARV-19 Calretinin Human calretinin-22k 1:500 Swant, mouse, monoclonal antibody, 6B3 Calbindin Bovine kidney calbindin-D 1:1000 Sigma Life Science, mouse, monoclonal antibody, CB-955 SST Synthetic peptide 1:250 Millipore, rat, monoclonal corresponding to amino antibody,YC7 accids 1-14 of cyclie SST conjugated to bovine thyroglobulin using carbodiimide CaMKIIα Partially purified full length 1:200 Abcam; mouse, monoclonal native rat protein antibody, 6G9 CCK CCK-8 fragment 26-33 1:1000 Abcam; mouse, monoclonal antibody, HYB 345-02

CHAPTER 4

Sufficiency of the glucocorticoid receptor for prefrontal neuroendocrine and behavioral regulation

Abstract

Dysregulation of the hypothalamic-pituitary-adrenocortical (HPA) axis, as well as polymorphisms of the glucocorticoid receptor are associated with neuropsychiatric disorders, e.g. Major Depressive Disorder (MDD). In the present study, we test the hypothesis that infralimbic medial prefrontal cortical (ilPFC) GR overexpression is sufficient to inhibit the HPA axis, as well as attenuate depression-like behavior. Moreover, we hypothesized that ilPFC GR overexpression will block the effects of chronic stress on HPA axis dysregulation and immobility in the forced swim test (FST), a rodent assay for learned helplessness. We found that GR overexpression indeed is sufficient to inhibit the HPA axis and decrease learned helplessness in the last 5 min of the FST. Overexpression of ilPFC GR is not sufficient to block the effects of chronic stress on HPA axis activity and immobility in the FST. Chronically stressed animals with

GR overexpression have increased corticosterone responses 15 min following the onset of restraint, suggesting that the axis is primed to respond to an acute novel stressor. Taken together, the data suggest that ilPFC GR overexpression is sufficient to regulate the HPA axis and behavior, at least under unstressed conditions.

Dysregulation of the hypothalamic-pituitary-adrenocortical (HPA) axis resulting in hypercortisolemia is commonly associated with Major Depressive Disorder (MDD) (Holsboer and Barden, 1996; Holsboer, 2000; Yehuda et al., 2004, 1996; Zobel et al., 1999). The subgenual cingulate cortex (Broadman area 25) is an important region for inhibition of the HPA axis and dysregulation of metabolic activity within this region is associated with MDD (Drevets et al., 1997; Mayberg et al., 2005). Moreover, the glucocorticoid receptor (GR) (which primarily binds stress-induced levels of glucocorticoids) is downregulated in the frontal cortex of patients with MDD (Webster et al., 2002). Single nucleotide polymorphisms of the GR gene are also associated with MDD (Derijk et al., 2008; Hauer et al., 2011; Huizenga et al., 1998; Kumsta et al., 2008; van Rossum et al., 2006, 2003). Thus, it appears that deficits in glucocorticoid signaling may represent an important target in the treatment of MDD.

Previous studies in our group have found that knockdown of the glucocorticoid receptor specifically in the infralimbic division of the medial prefrontal cortex (ilPFC) (the rodent homologue of Broadman area 25) increases HPA axis responses in acutely and chronically stressed animals. Further, knockdown of the GR within this region induces depression-like behavior in the forced swim test (FST), a rodent test of learned helplessness (Cryan et al.,

2005; McKlveen et al., 2013). Chronic stress is also associated with downregulation of the GR

(Mizoguchi et al., 2003), as well as increased depression-like behavior (Chiba et al., 2012).

These studies further suggest that downregulation of the prefrontal GR may underlie deficits in

HPA axis regulation and mood.

Given the apparent deficit of glucocorticoid signaling in MDD, previous studies have used forebrain- and whole body-transgenic mouse strategies to upregulate the GR (Ridder et al., 2005; Wei et al., 2004). Whole body GR overexpression decreases learned helplessness in the FST and attenuates activation of the HPA axis. Forebrain-specific GR overexpression, in contrast, increases depression-like behavior. These studies have yielded opposite effects on

HPA axis regulation and behavior, most likely due to differences in specificity of the GR overexpression.

In the present study, we tested the hypothesis that prefrontal-specific GR overexpression will attenuate acute HPA axis responses to stress and decrease learned helplessness in the FST. Moreover, we tested the hypothesis that GR overexpression would block the effects of chronic stress on HPA axis activity and depression-like behavior. We found that GR overexpression indeed increases feedback of the HPA axis and decreases learned helplessness in the FST in unstressed animals, but is insufficient to block the effects of chronic stress.

Materials and Methods

Subjects. Male Sprague-Dawley rats from Harlan (Indianapolis, Indiana) weighing 250–275 g upon arrival were singly-housed throughout the experiment in a temperature/humidity-controlled room on a 12-hour/12-hour light/dark cycle. Food (Teklad; Harlan) and water were available ad libitum. All experimental procedures were conducted in accordance with the National Institutes of Health Guidelines for the Care and Use of Animals and approved by the University of

Cincinnati Institutional Animal Care and Use Committee. eGFP and GR Lentiviral Expression Construct. The lentiviral GFP plasmid (pLV-GFP) was derived from the corresponding component of DNA, and GFP was placed under the control of the elongation factor-1α promoter [Elongation Factor 1(Ef1)α], as previously described

(Kolber et al., 2008; Laryea et al., 2013). The full-length mouse GR cDNA (generously given by

J. Bodwell, Dartmouth, NH) was inserted into the BamHI site of pLenti-III-EF1α (Applied

Biological Materials, Richmond, BC, Canada) to generate pLV-GR, a GR expression vector.

Due to size of the full-length GR, it was not possible to transfect with a GFP cassette. For the packaging of each LV vector, individual plasmids were prepared and sent to the Hope

Center Viral Vector Core (Washington University, St. Louis, MO). Plasmids were packaged using three helper plasmids (pMD-Lg, pCMV-G, and RSV-Rev) in 293-T cells into replication deficient virions. The lentiviral construct is a third-generation vector, containing a 5’ self- inactivating (SIN) element to prevent replication, 3’ and 5’ long-terminal repeats (LTR), and woodchuck post-transcriptional regulatory element (WPRE) to enhance protein expression.

The enhanced GFP (eGFP) cassette in the control vector is driven by an internal cytomegalovirus (CMV) promoter and the human u6 promoter drives expression of the sequence. Forty-two h after transfection, the culture supernatant was collected, passed through a 0.45 m filter, concentrated by ultracentrifugation through a 20% sucrose cushion, and stored at -80ºC until use. Viral vector titers were determined by transduction of HT1080 cells and assayed for reporter expression using flow cytometry or real time PCR. Titers of 107–109

91 infectious units/mL for each LV were reliably obtained. The ability of the pLV-GR to express GR in vitro was previously queried using Chinese hamster ovarian cells (CHO)-K1 cells (ATCC,

CCL-61). The pLV-GR was able to generate GR expression in CHO-K1 cells, which typically do not express GR (Laryea et al., 2013). The pLV-GR was also piloted in vivo and reliably increased GR protein expression following microinjection in the ilPFC of adult rats, as assayed via Western blot (methods described below). All experimental procedures were approved by the

University of Cincinnati Institutional BioSafety Committee.

Stereotaxic Surgery. After 1 week of habituation, animals were anesthetized (90 mg/kg ketamine, 10 mg/kg xylazine), and preemptive analgesia (butorphanol) and antibiotic

(gentamicin) were administered. Animals received 1-μL bilateral microinjections into the ilPFC

[AP = +2.7, ML ± 0.7, and DV = −4.0, Paxinos and Watson (1998) coordinates) of LV-GFP

(n=35) or LV-GR (n=37) with a 25-gauge, 2-μL Hamilton syringe (Reno, Nevada). To reduce tissue damage, each injection took place over 5-7 min. After the needle remained in place for 5 min, the virus was infused over 5-7 min with a microdriver (Model 5001; Kopf, Tujunga,

California) and remained in place for 5 min to allow for complete diffusion. Animals recovered for at least 5–6 weeks before any experiments.

Chronic Variable Stress. Animals underwent chronic variable stress (CVS) for 14 days (n = 12 from each microinjection group). The CVS was comprised of twice daily (AM and PM) repeated and unpredictable stressors and some overnight stressors, including cold room exposure (1 hour, 4ºC), shaker stress (1 hour, 100 rpm), open field (5 min), elevated plus maze (5 min), overnight crowding (16-18 hours, 6 rats per cage), overnight novel mouse cage (16-18hours, 1 rat per cage), and hypoxia (30 min, 8% oxygen) (see Table 4.1). Overnight stressors began immediately after cessation of the afternoon stressor and ended with the initiation of the morning stressor the following day. Only animals undergoing CVS were used in the elevated plus maze (EPM) and open field, and these tests were treated as morning stressors for the first and the 12th and 13th days of CVS, respectively. The forced swim test was conducted on the 14th

92 day of CVS and served as the morning stressor for that day (see below).

Behavioral Assays

(CleverSys, Reston, Virginia). Time spent in the center versus the periphery of the open field was used as a measure of anxiety-like behavior (Belzung and Griebel, 2001). Each animal was placed in the same place, facing the center of the open field. The open field was cleaned with

20% EtOH between each animal. Behavior was recorded and scored by an observer blinded to the experimental condition.

Elevated Plus Maze. Rats were placed in the center of a plus-shaped Elevated Plexiglas maze and allowed to explore for 5 min. The maze consisted of two closed arms, bordered by black opaque Plexiglas walls and two open arms. Each animal was placed in the maze in the same direction, facing an open arm. The EPM was cleaned with 20% EtOH between each animal.

Behavior was recorded and scored by an observer blinded to the experimental condition.

Forced Swim Test. Chronically stressed and non-stressed controls from each microinjection group (n=12-13) went through the modified FST, as described previously (Cryan et al., 2005;

Wulsin et al., 2010) to assess depression-like behavior. Animals were placed in a cylindrical container (46 cm in height x 20 cm in diameter) filled with 30 cm of 29 - 31ºC water for 10 min.

Behavior was video recorded and scored every 5 sec for 10 min. Scoring was done by an observer blinded to the experimental condition. Mobility (swimming, climbing, headshakes, and diving) versus immobility was scored as previously described (Wulsin et al., 2010). Animals were not exposed to any swims before the FST, because the modified FST is a single exposure test.

Neuroendocrine Experiment

RIA. Plasma corticosterone levels were measured with an 125I RIA kit (MP Biomedicals, Solon,

Ohio). All samples were run in duplicate and each time point was run in the same assay. In order to include all time points in the same analysis, the 0 min and 120 min data were normalized to the assay including the 15, 30, and 60 min samples using the ratio between the plasma pool (internal control sample from an acutely stressed animal) in the 0 min and 120 min assay to the plasma pool in the 15, 30, and 60 min assay to determine the normalization factor.

The 0 min and 120 min data were multiplied by the normalization factor to include them in the same analysis as the 15, 30, and 60 min for samples.

Tissue Collection. Brains were collected following rapid decapitation and flash frozen in isopentane (approximately −40C). Animals were not anesthetized prior to the procedure, as this may alter gene expression. Thymus and adrenal glands were dissected and weighed.

Assessment of GR Overexpression

Tissue Punches. Brains were placed in the cryostat and were allowed to equilibrate to the temperature of the cryostat (approximately -13C) for 1 h. A 1 mm thick section was taken at approximately 3.0 mm in front of bregma. Bilaterally neuronanatomical punches, according to

94 the brain atlas of Paxinos and Watson (1998), of the prelimbic and infralimbic prefrontal cortices were taken, frozen on dry ice, and placed in a -80C freezer until RNA or protein isolation.

Western Blot. Protein was isolated from prefrontal punches by adding 100 µl of homogenization buffer (10 mM Hepes, 150 mM NaCl, 0.6% Igepal, 1 mM EDTA, and 1 Roche

Tablet) and disrupted with a microtube pestle. Homogenized tissue was then passed through a

23 gauge needle several times, spun for 30 minutes at 6000 x g, and supernatant was collected.

Protein concentration of each sample was determined using the Pierce BCA protein assay kit

(Thermo Scientific), according to the manufacturer’s protocol for limited sample size, microplate procedure. After determining protein concentration, 5µg of protein per sample was loaded into the gel. Proteins were separated using the NuPage electrophoresis system and pre-cast

NuPage Novex Bis-Tris gel cassette with MOPS SDS running buffer. Protein was transferred to a polyvintlidene difluoride (PVDF) membrane (30 V for 1 h). Membranes were blocked overnight at 4ºC in 10% non-fat dry milk in Tris-buffered saline with 1% Tween 20 (TBST). Membranes were then incubated with anti-GR antibody (Santa Cruz Biotechnolgies, Dallas, TX; 1:1000) or anti-β-actin (1:500 Seven Hills, Cincinnati, OH) for 2 h at room temperature, diluted in TBST.

Nuclear lysate from K-Ras-transformed kidney cells was loaded as a positive control (KNRK;

Santa Cruz Biotechnologies). Membranes were washed 5 times for 5 min in TBST and then incubated for 1 h in horseradish peroxidase-conjugated secondary antibodies (anti-rabbit and anti-mouse, respectively; 1:10,000) (Amersham Biosciences, Corp., Piscataway, NJ), diluted in

TBST. Membranes were washed 3 times for 5 min in TBST, 3 times for 5 min in TBS, and then water for 1 min. Membranes were then blotted in enhanced chemiluminescence (ECL) Plus chemiluminescent reagents (Amersham Biosciences Corp.) and placed onto film. Membranes were stripped for 15 min and the immunoblot described above was repeated with the anti-β- actin antibody. All groups were represented on each gel.

Western blot protein expression was semi-quantified using SCION Image software

(Frederick, MD). Images of each of the bands and negative region right above the band

(background) were captured and gray level values of optical density were measured. The same area was captured for each band and background measurement. The background optical density was then subtracted from each sample band measurement to determine the corrected gray level (CGL) for each sample. Samples were normalized according to β-actin loading control and positive control.

Statistical Analysis. The groups for the present study consisted of animals that received pLV-

GFP or pLV-GR and were acutely restrained only (n=11-12 per group), were subjected to the

FST only (n=12-13 per group), or were chronically stressed and subjected to the FST and acute restraint (n=12 per group). Data are expressed as mean ± SEM. Behavioral data, and body weight before CVS were analyzed with one-way analysis of variance (ANOVA). Body weight

(after CVS), organ weights, and baseline corticosterone levels were analyzed with a two-way

ANOVA [microinjection (pLV-GFP or pLV-GR) x stress (acute stress or CVS)]. Fisher’s least significant difference post hoc analyses were conducted. Hormonal data were analyzed with two-way ANOVA (area under the curve) [microinjection x stress (acute stress or CVS)] or three- way repeated measures ANOVA [microinjection x stress x time (0, 15, 30,60 or 120 min), time being the repeated measure]. Fisher’s least significant difference was used for a priori planned comparisons across microinjection and stress at each time point. Data were analyzed with

GBStat (version 6.5.4) software (Dynamic Microsystems, Silver Spring, Maryland), and statistical significance was set at p ≤ .05. Where appropriate, behavioral data failing Levene’s F,

Hartley’s F-max, Cochran’s C, and Barlett’s χ2 homogeneity of variance tests were log transformed. Outliers were removed as outlined previously (McClave & Dietrich, 1994). For simplicity of presentation, results are graphed by acute stress only (No CVS) or chronic stress

(CVS), although data were part of the same statistical analysis.

Results pLV-GR Validation

We first verified the ability of the pLV-GR to overexpress the GR in rat (see Figure 4.2).

In a pilot experiment, unilateral microinjection of the pLV-GR shows a strong trend toward overexpression compared to the non-injected side (n=3 per group) [t(4)=2.007, p=0.0576, one- tailed t-test]. In a larger pilot study (n=6 per group), we found that bilateral microinjection of the pLV-GR into the ilPFC significantly attenuates corticosterone responses at 60 min following restraint [main effect of time, F4,36=15.33, p<0.0001] (Figure 4.2). This finding is in line with previous findings following corticosterone implants in the mPFC and was expected in light of increased corticosterone levels following ilPFC GR knockdown (Akana et al., 2001; Diorio et al.,

1993; McKlveen et al., 2013). In a larger cohort of animals (n=6), we again verified that the pLV-

GR significantly overexpresses GR compared to a pLV-GFP control vector [(t(10)=2.586, p =

0.027]. (see Figure 4.3). Thus, having verified the ability of pLV-GR to overexpress GR, we used this vector for all experiments in the present study.

Behavioral Testing

We took advantage of the first two days of CVS to look at anxiety-like behaviors that may be affected by GR overexpression alone and in the context of chronic stress. We used the open field and elevated plus maze to assess locomotor activity and anxiety-like behavior. In a previous study, knockdown of the prelimbic GR induced hyperlocomotor activity in the open field. Knockdown confined to the ilPFC GR had no effect on locomotor activity. Therefore, we did not predict an effect on locomotor activity following GR overexpression and an effect might indicate an off-target injection site. There were no significant differences in time spent in the center [no stress x microinjection interaction, F1,40=0.633, p=0.43] or the periphery [no stress x microinjection interaction, F1,40= 0.65, p=0.42, 2-way RM ANOVA] of the maze, in either microinjection group at the beginning or end of CVS (see Table 4.2). Moreover, there were no

97 significant differences in total locomotor activity at the beginning or end of CVS [no stress x microinjection interaction, F1,22=0.46, p=0.50, 2-way RM ANOVA] (Figure 4.4).

We used the elevated plus maze (EPM) to assess the effect of GR overexpression on anxiety-like behavior at the beginning and end of chronic stress exposure. There was a significant stress x microinjection interaction manifest by decreased and increased duration in the closed arm at the end of CVS in pLV-GFP- and pLV-GR-microinjected animals, respectively

[F1,20=4.289, p=.05, 2-way RM ANOVA]. Chronically stressed animals receiving the pLV-GR also traveled significantly less overall [stress x microinjection interaction, F1,20=19.0188, p=

0.0003, 2-way RM ANOVA] and in the closed arms of the EPM [stress x microinjection interaction, F1,21=17.53, p= 0.0004, 2-way RM ANOVA]. Similar to their more exploratory patterns, pLV-GFP-microinjected chronically stressed animals had significantly more and pLV-

GR had significantly less stretch-attend posture toward the center of the EPM (body in arm of

EPM with nose in the center of the EPM) [stress x microinjection interaction, F1,21=13.5, p=0.0014, 2-way RM ANOVA] (Figure 4.6). Thus, it appears that GR overexpression in the face of chronic stress may actually promote an anxiety-like phenotype, whereas chronic stress seems to lead to greater exploration.

As mentioned previously, the ilPFC is particularly important for the regulation of depression-like behavior. Following knockdown of the ilPFC GR or CVS, animals exhibit increased immobility (McKlveen et al., 2013). Thus, we tested the hypothesis that overexpression of the ilPFC GR would reverse this effect in animals with and without a history of chronic stress. Overexpression of the ilPFC GR did not affect overall immobility counts in the

FST, although there was a main effect of microinjection [F1,42=3.76, p=.049, 2-way ANOVA].

Interestingly, however, animals receiving pLV-GR were significantly more active in the last five minutes of the FST [main effect of microinjection, F1,42= 4.67, p=.036, 2-way ANOVA] (Figure

4.7). There was no main effect of stress on total immobility counts [F1,42=0.63, p= 0.43, 2-way

ANOVA] or in the last 5 min of the FST [F1,42=2.39, p=.13, 2=way ANOVA]. It appears that ilPFC

GR overexpression prevents learned helplessness in the FST, but is insufficient to decrease immobility under chronic stress. Moreover there were no differences in active behaviors, including climbing [no stress x microinjection interaction, F1,43= 1.02, p=0.32, 2-way ANOVA], diving [no stress x microinjection interaction, F1,44=1.9855, p=0.17, 2-way ANOVA], swimming

[no stress x microinjection interaction, F1,42=2.78, p=0.10, 2-way ANOVA], or headshakes [no stress x microinjection interaction, F1,44=0.44, p=0.51, 2-way ANOVA] (see Table 4.3).

Hormonal Responses

Based on our pilot experiments, we hypothesized that pLV-GR-microinjected animals exposed to a novel acute restraint would have an attenuated corticosterone response. Indeed, we did find that pLV-GR-microinjected animals had significantly lower corticosterone at 120 min following restraint onset [stress x microinjection x time interaction, F4,172=3.02, p=0.02, 3-way

RM ANOVA]. In contrast, chronically stressed animals microinjected with pLV-GR had a significantly higher corticosterone response 15 min following restraint onset. Chronically stressed animals in general had a significantly higher baseline corticosterone response that was not affected by microinjection [main effect of stress, F1,40=26.55, p<0.0001, 2-way ANOVA]

(Figure 4.8).

Body/Organ Weights

Chronically stressed animals exhibited nearly all of the somatic markers of chronic stress. Attenuated weight gain, adrenal hypertrophy, and thymic involution are consistent attributes of chronically stressed rats (Herman et al., 1995).Regardless of microinjection, chronically stressed animals had decreased body weight [main effect of stress, F2,64=146.76, p<0.0001, 2-way ANOVA], adrenal hypertrophy [main effect of stress, F2,64=19.41, p<0.0001, 2- way ANOVA], and decreased food intake [main effect of stress, F2,62=16.59, p<0.0001, 2-way

ANOVA]. Thymic involution was not observed in chronically stressed animals [no main effect of stress, F2,64=1.02, p=0.36, 2-way ANOVA] (characteristic of Sprague-Dawley rats). Thus, chronic stress induced typical somatic changes, regardless of microinjection (see Table 4.4).

Discussion

In the current study, we found that GR overexpression in the ilPFC is sufficient to attenuate corticosterone secretion and decrease learned helplessness in the FST, in animals without a history of stress. Overexpression of the ilPFC GR in chronically stressed animals is not sufficient to block the effects of chronic stress and actually induces a significant increase in corticosterone response and decreases locomotor activity and stretch-attends in the EPM.

Collectively, the data suggest that the ilPFC GR is sufficient to inhibit corticosterone responses and regulate depression-like behavior. Overexpression of GR in chronically stressed animals highlights the fact that optimal GR signaling is required for regulating stress reactivity. Thus, excessive GR signaling may also prove deleterious for the individual.

The finding that ilPFC GR overexpression attenuates corticosterone secretion is in line with previous studies which implanted corticosterone implants into the mPFC or overexpressed the GR in mice (Akana et al., 2001; Diorio et al., 1993; Ridder et al., 2005). Moreover, knockdown of the ilPFC GR increases corticosterone levels, which is exactly the opposite of GR overexpression (McKlveen et al., 2013). Thus, it appears that within the context of acute stress the ilPFC inhibits the HPA axis most likely via multisynaptic projections to the PVN.

We also found that pLV-GR induced hypersecretion of corticosterone in response to novel stress exposure in chronically stressed animals. There are several reasons that may account for this finding. First of all, GR overexpression is ‘on board’ prior to when CVS begins.

Thus, chronic stress-induced glucocorticoid hypersecretion may trigger autoreceptor downregulation of the GR, leading to a decrease in endogenous GR that may counteract upregulation via the viral vector (Oakley and Cidlowski, 2013; Pedersen et al., 2004). This enhanced feedback signal could block the ability of the ilPFC to attenuate corticosterone responses and lead to increased corticosterone release, as seen with GR knockdown and in the chronically stressed pLV-GR-microinjected rats in this study. Thus, future studies may want to

100 begin CVS before the overexpression ‘kicks in,’ in order to express GR in cells that have a chronic stress-induced reduction in GR. Another method would be to place a ‘tetracycline on’ promoter in the vector construct, so that the vector could be inducible after chronic stress.

Increased GR expression may also increase the sensitivity of the ilPFC to circulating glucocorticoid levels during chronic stress, leading to a priming effect of the HPA axis. Future studies could assess if there are compensatory mechanisms due to the overabundance of ilPFC

GR. For instance, CRF levels in the BLA or CeA (known projections of the ilPFC) could be assessed or GR expression in other brain regions.

Despite a main effect of microinjection, we failed to detect any differences in total immobility time in the FST. However, animals with ilPFC GR overexpression and no history of chronic stress were more active during the last 5 minutes of the FST compared to pLV-GFP- microinjected controls. This finding is consistent with the large body of literature regarding the prefrontal cortex and controllability led by Steve Maier and colleagues (Maier and Watkins,

2010). They hypothesize that activation of the ventral mPFC confers behavioral immunization, such that the organism is better able to cope with the stressor at hand (Amat et al., 2008).

These data also match decreased immobility following whole body GR overexpression in mice

(Ridder et al., 2005). Taken together, the data suggest that GR overexpression leads to a greater activation and engagement of the ilPFC.

We failed to detect an effect of GR overexpression on immobility in the FST after chronic stress exposure. Again, this may be due to compensatory mechanisms that prevent GR overexpression in chronically stressed animals, as discussed previously. Conversely, there are a wide range of other neuropeptides (e.g. corticotrophin-releasing hormone) and catecholamines, e.g. norepinephrine from the locus coeruleus (Heidbreder and Groenewegen,

2003; Meng et al., 2011) that may override the ability of GR overexpression to decrease immobility in chronically stressed animals.

101

In the elevated plus maze, chronically stressed animals microinjected with pLV-GR stayed in the closed arm longer, were less active, and conducted less risk-assessment than chronically stressed animals microinjected with pLV-GFP. There are several interpretations that may account for this general decrease in locomotion and increased duration in the EPM in the chronically stress pLV-GR-microinjected animals. The most straight forward interpretation is that

GR overexpression in the context of chronic stress promotes anxiety-like behavior. This interpretation seems somewhat unlikely, given that studies implicating the mPFC in anxiety-like behavior are rather lacking. These findings do, however, corroborate previous findings that forebrain GR overexpression in mice increases anxiety-like behavior in the EPM (Wei et al.,

2004). These mice also displayed an increase in immobility in the FST, so it is unclear how generalizable the findings of that study are to the present work. A second interpretation may relate to the importance of the GR for the consolidation of newly acquired information (Joels et al., 2012). Since animals were exposed to the EPM twice, it could be that animals receiving the pLV-GR had greater consolidation of the memory compared to chronically stressed animals receiving pLV-GFP. Thus, the behavior of the chronically stressed pLV-GR animals may be confounded by their memory for the test.

Presently, we characterized the use of a GR overexpression vector for the first time in rat. Our collaborators have shown that pLV-GR is able to induce a physiological level of expression in non-GR expressing cells (Laryea et al., 2013). We found that GR upregulation was “modest,” but able to exert physiological effects in our pilot study. In order to induce more robust expression of the GR, a ‘stronger’ promoter (other than elongation factor-1 alpha) could be used in future studies. With a more robust promoter, GR overexpression may be increased both acutely and in the face of chronic stress, potentially leading to a clearer picture of GR function during chronic stress.

Glucocorticoids are known to have potent effects on learning and memory, especially with regard to consolidation (Joels et al., 2012; Roozendaal and McGaugh, 2011; Sandi, 2011).

102

Thus, glucocorticoids are now becoming increasingly used for extinction therapy for patients with PTSD and phobias (Aerni et al., 2004; Cai et al., 2006; de Quervain et al., 2011; Delahanty et al., 2013; Hauer et al., 2014; Schelling et al., 2001, 1999) Glucocorticoids have also been shown to decrease subgenual cingulate oxygen utilization evoked by sad stimuli, suggesting that the mPFC is also a target for emotional behavior (Sudheimer et al., 2013). Our data suggests that GR activation is important for the regulation of the HPA axis and mood. Thus, the efficacy of these treatments may be related to glucocorticoid recruitment of the ventral mPFC.

In summary, we have shown that the ilPFC GR is sufficient to attenuate corticosterone responses and improve learned helplessness in the FST. Glucocorticoid therapies are rapidly gaining favor in the treatment of neuropsychiatric disorders, e.g. PTSD, because of their effectiveness in extinction therapy. Thus, glucocorticoids may promote active coping due to an activation of the ventral mPFC, which acts to dampen the HPA axis and regulate behavior.

103

5’ 3’ ψ LTR gag RRE cPPT eF1α eGFP SIN-LTR

5’ 3’ ψ LTR gag RRE cPPT eF1α GR SIN-LTR

Figure 4.1. Lentiviral constructs used to express eGFP or GR, respectively. Figure 4.1 shows the lentiviral backbones of the constructs used in the present study to express eGFP or GR. Abbreviations are as follows: LTR= long terminal repeats, ψ=packaging signal, gag=group- specific antigen, RRE=rev response element, cPPT=central polyurine tract, eF1α=elongation factor 1 alpha (promoter), eGFP=enhanced green fluorescent protein, SIN=self-inactivating, GR=glucocorticoid receptor.

104

Figure 4.2. pLV-GR upregulates GR expression and attenuates corticosterone response. (A) Representative bands from control (uninjected) and pLV-GR-microinjected animals at approximately 95 kDa. (B) Quantified optical density, with a strong trend toward increased optical density in pLV-GR-microinjected animals (p=.058) (n=3 per group). (C) Corticosterone responses to an acute novel restraint. Overexpression of the ilPFC GR significantly attenuates corticosterone responses at 60 min following restraint onset (p<0.05) (n=3-6 per group). *=p<0.05 vs. pLV-GFP-microinjected control. Data are mean ± SEM.

105

Figure 4.3. pLV-GR consistently upregulates GR expression in the ilPFC. (A) Representative bands from pLV-GFP- and pLV-GR-microinjected animals at approximately 95 kDa for GR and 42 kDa for β-actin). (B) Quantified optical density of GR expression normalized to β-actin expression. Following injection of pLV-GR, GR expression is increased in the ilPFC (p<0.05) (n=6 per group). *=p<0.05 vs. pLV-GFP-microinjected control. Data are mean ± SEM.

106

Figure 4.4. There were no significant differences in duration or distance traveled in the open field at the beginning or end of CVS. Panels A and B shows duration in the periphery of the open field at the beginning and end of CVS (n=12 per group). There were no significant differences in duration (p > 0.05). Panels C and D show distance traveled in the open field at the beginning and end of CVS. There were no significant differences in distance traveled between the groups (p > 0.05). Data are mean ± SEM.

107

Figure 4.5. GR overexpression increased closed arm duration and decreased distance traveled in the elevated plus maze (EPM) at the end of CVS. Panels A and B show duration in the closed arm of the EPM at the beginning and end of CVS (n=12 per group). Chronically stressed pLV- GFP-microinjected animals spent significantly less time in the closed arm (p<0.05), while pLV- GR-microinjected animals spent significantly more time in the closed arm of the EPM at the end of CVS (p<0.05). Panels C and D show total distance traveled in the EPM at the beginning and end of CVS. At the end of CVS, pLV-GR-microinjected animals traveled significantly less in the EPM (p<0.05). *=p<0.05 vs. pLV-GFP control at end. #=p<0.05 vs. beginning Data are mean ± SEM.

108

Figure 4.6. GR overexpression reverses chronic stress-induced increase in risk-assessment. Chronically stressed pLV-GFP-microinjected make increased stretch-attends into the center of the EPM (p<0.05), whereas GR overexpression decreases stretch-attends at the end of CVS (p<0.05) (n=12 per group). *=p<0.05 vs. pLV-GR at beginning. #=p<0.05 vs. pLV-GFP at beginning. Data are mean ± SEM.

109

Figure 4.7. GR Overexpression decreases learned helplessness in the last 5 min of the FST. Panels A and B show immobility and activity throughout the full 10 min duration of the FST. There were no significant differences in total immobility or activity, despite a main effect of microinjection (p=0.049). Panels C and D show immobility and activity in animals exposed to the FST without and with a history of chronic stress, respectively. GR overexpression alone decreases immobility in the last 5 min of the FST (p<0.05) (n=12-13 per group). *=p<0.05 vs. pLV-GFP control. Data are mean ± SEM.

110

Figure 4.8. GR overexpression attenuates or increases corticosterone responses in animals without and with a history of chronic stress, respectively. Panels A and B show corticosterone responses to a novel acute restraint in animals without and with a history of chronic stress, respectively. GR overexpression attenuates corticosterone responses at 120 min following the onset of restraint in animals without a history of chronic stress (p<0.05). Conversely, animals with a history of chronic stress show a significantly corticosterone response 15 min following restraint onset (p<0.05). Panel C shows that there were significant differences in area under the curve (AUC) of the corticosterone responses (p>0.05) (n=11-12 per group). *=p<0.05 vs. pLV- GFP control at given timepoint. Data are mean ± SEM.

111

Table 4.1: Outline of 14-day Chronic Variable Stress Paradigm.

Day AM Stressor PM Stressor 1 Open Field Shaker 2 Elevated Plus Maze (EPM) Cold Room 3 Hypoxia Shaker 4 Shaker Cold Room; Overnight (OVN) Mouse Cage 5 Shaker Hypoxia 6 Cold Room Hypoxia; OVN Crowding 7 Shaker Cold Room 8 Hypoxia Shaker; OVN Mouse Cage 9 Shaker Cold Room 10 Hypoxia Cold Room; OVN Crowding 11 Cold room Shaker 12 EPM Hypoxia; OVN Mouse Cage 13 Open Field Cold Room 14 Forced Swim Test Hypoxia

Table 4.1: 14 day Chronic Variable Stress (CVS) regime. Table 4.1 shows the temporal sequence of the stressors that were applied to the CVS groups. The CVS was comprised of twice daily (AM and PM) repeated and unpredictable stressors, including cold room exposure (1 hour, 4ºC), shaker stress (1 hour, 100 rpm), open field (5 min), elevated plus maze (5 min), overnight crowding (16-18 hours, 6 rats per cage), overnight novel mouse cage (16-18 hours, 1 rat per cage), hypoxia (30 min, 8% oxygen), and forced swim test (27-29ºC, 10 minutes). The novel restraint stress challenge occurred on Day 15.

112

Table 4.2: Behaviors in the open field following pLV-GFP- or pLV-GR-microinjection in the infralimbic prefrontal cortex at the beginning and end of CVS.

Open Field (beginning CVS) Open Field (during CVS)

Center Center Periphery Center Periphery Center Center Periphery Center Periphery Micro - Time Distance Distance Velocity Velocity Time Distance Distance Velocity Velocity injection (s) (mm) (mm) (mm/s) (mm/s) (s) (mm) (mm) (mm/s) (mm/s) pLV- 0.11±0. 2084.86±29 1948.39±5 6.31±6.31 31.8±10 7±1.03 0±0 0±0 0±0 6.58±1.81 GFP 11 8.03 35.78

0.59±0. 11.83±11. 2139.39±44 1685.39±3 pLV-GR 12±3.31 7.21±1.5 0±0 0±0 0±0 5.62±1.07 59 83 6.81 21.56

Table 4.2. Behaviors in the 5 min open field following pLV-GFP- or pLV-GR microinjection in the infralimbic prefrontal cortex (ilPFC) at the beginning and end of CVS. There were no significant differences in any of the individual scored behaviors (p >0.05) (n=12 per group). Data are mean ± SEM.

113

Table 4.3: Active behaviors in the forced swim test following pLV-GFP- or pLV-GR- microinjection in the infralimbic prefrontal cortex in animals only exposed to the FST or chronically stressed animals.

Forced Swim Test (Acute) Forced Swim Test (Following CVS) (mean counts) (mean counts)

Micoinjection Swimming Climbing Diving Headshakes Swimming Climbing Diving Headshakes

pLV-GFP 6.55±0.69 13.45±2.74 1.42±0.29 5.09±0.98 7.17±0.82 12.17±1.6 1.58±1.6 4.5±0.85

pLV-GR 9.33±2.12 12.17±2.5 1.38±0.37 6.38±1.03 5.64±0.82 15.75±2.67 0.64±0.2 7.08±1.01

Table 4.3. Active behaviors in the forced swim test following pLV-GFP- or pLV-GR microinjection in the infralimbic prefrontal cortex (ilPFC) in animals only exposed to the FST or chronically stressed animals. “Active” behaviors in the 10 min novel exposure to the forced swim test in animals receiving microinjections of pLV-GFP (n = 12) or pLV-GR (n = 13) in the ilPFC and chronically stressed animals receiving pLV-GFP (n=12) or pLV-GR (n=12). There were no significant differences in any of the individual scored active behaviors (p >0.05). Data are mean ± SEM.

114

Table 4.4: Somatic markers of chronic stress, including: body, adrenal, and thymus weight and food intake from acutely and chronically stressed animals receiving microinjections of pLV-GFP or LV-GR.

Somatic Indices of Chronic Stress

Body Weight Adrenal Weight Thymus Weight Microinjection Change Following (% per 100g body (% per 100g body Food Intake Change and Stress CVS (g) weight) weight) Following CVS (g) pLV-GFP and 17.69±1.44 0.5±0.02 6.67±0.28 0.18±0.78 FST pLV-GFP and Acute 17.46±1.17 0.53±0.02 6.9±0.29 1.33±0.84 Restraint pLV-GFP and -5.6±1.72* 0.61±0.02* 6.72±0.27 -4.58±1.89* CVS pLV-GR and 16.33±1.09 0.54±0.01 6.83±0.27 1.8±0.62 FST pLV-GR and Acute 15.52±1.65 0.54±0.02 7.07±0.29 1.575±1.07 Restraint pLV-GR and -5.0±1.66* 0.66±0.02* 7.25±0.23 -5.93±1.77* CVS

Table 4.4. Somatic markers of chronic stress. Regardless of microinjection, chronic stress significantly decreases body weight, increases adrenal weight, and decreases food intake (p<0.05) (n=11-13 per group). Data are mean ± SEM.

115

CHAPTER 5

General Discussion and Future Directions

Part of this chapter has been submitted for publication and was under review at the time of this dissertation submission.

116

Summary of Dissertation

This dissertation was designed to test the role of prefrontal glucocorticoid receptors

(GRs) in synaptic, neuroendocrine, and behavioral stress adaptation. Chapter 2 established that glucocorticoids act via the prefrontal GRs to regulate the HPA axis and behavior. We found that the prelimbic medial prefrontal cortex (plPFC) GR regulates acute inhibition of the HPA axis and locomotor activity in the open field using a shRNA-mediated technique to specifically knockdown the GR in a spite-specific manner. The infralimbic medial prefrontal cortex (ilPFC) not only regulates acute inhibition of the HPA axis, but is also recruited to regulate responses to a novel stressor under chronic stress. Moreover, knockdown of the ilPFC GR alone increases depression-like behavior in the FST, indicating that that the infralimbic cortex is particularly important for the regulation of mood. These findings led us to question how glucocorticoids might differentially regulate chronic stress at the synaptic level in the prefrontal cortex. In

Chapter 3, we assessed the impact of chronic stress on excitatory and inhibitory neurotransmission and the consequences for a prefrontal-mediated task requiring prefrontal engagement. We found that chronic stress increases inhibitory neurotransmission perhaps due to loss of GR-mediated brake on interneuronal activity. In turn, increased inhibition of the mPFC under chronic stress impairs the ability of animals to learn a task requiring cognitive flexibility/engagement of the mPFC. Finally, in Chapter 4 we tested the ability of a GR overexpression vector in the ilPFC to inhibit the HPA axis and depression-like behavior acutely, and to block the effects of chronic stress on HPA axis dysregulation and learned helplessness.

We found that GR overexpression was sufficient to inhibit the HPA axis and decrease depression-like behavior in the latter half of the FST. Taken together, the data indicate the importance of the GR-mediated regulation for synaptic, neuroendocrine, and behavioral stress adaptation. Moreover, this body of work suggests that signaling of the ilPFC GR may be particularly important for chronic stress adaptation, and dysfunctional GR signaling in the ilPFC

117 may underlie neuropsychiatric disorders, e.g. major depressive disorder (MDD) and posttraumatic stress disorder (PTSD).

Stress and Energetics: A New Framework for Understanding Adaptation

Since beginning my dissertation work, we have begun to think differently about what adaptation means for the individual and the role played by prefrontal-mediated glucocorticoid signaling in this process based largely on work from this dissertation. I will first discuss this new framework of understanding adaptation and then delve into specifically how my dissertation research supports this framework for understanding adaptation to stress.

Responses to stress occur at the level of the individual, requiring both appraisal systems (limbic forebrain) and effector sites (hypothalamus and hindbrain) in the brain, as well as peripheral physiological systems. Consequently, regulation of the HPA axis is a distributed process integrated by multiple sites with considerable overlap and redundancy to permit compensation. For example, both the prelimbic medial prefrontal cortex (plPFC) and the ventral hippocampus provide inhibition of the HPA axis via convergent projections onto PVN-projecting neurons in the anterior bed nucleus of the stria terminalis (aBST) (Radley and Sawchenko,

2011). Neuroendocrine responses to stress are initiated by the brain and result in the secretion of glucocorticoids to promote energy mobilization for current or anticipated needs. In turn, glucocorticoids act as a signal that influences cellular function, gene transcription, circuit activity, and, ultimately, behavior. Thus, responses to both acute and chronic stress promote context- specific adaptation based on the real or perceived needs of the individual.

Although responses to chronic stress may promote adaptation, it comes at a cost. This adaptive cost may be deleterious for the organism when stress effector systems are repeatedly activated to meet the energetic demands of severe or prolonged stress. The physiological and behavioral consequences of driving energetic systems may encompass both stress resilience/resistance, as well as the transition to pathology. Thus, the stress response leads to a

118 redistribution of energy resources to meet emergent or anticipated needs driven by a glucocorticoid signal that influences cellular function, neurocircuits, and behavior. This signal pushes physiological systems to adapt until the adaptive cost becomes greater than the adaptive capacity of the individual. In this framework, the adaptive capacity can be defined as the degree to which the organism can deploy energy mobilizing systems (e.g. HPA axis) to successfully meet current or anticipated needs.

The relationship between stress and energetics can be summarized by examining the relationship between systems performance, environmental demand, and energy input (Figure

5.1). The performance of the individual is largely dependent on energetic status, environmental demand (i.e. context), adaptive capacity and adaptive cost. Glucocorticoids regulate the energetic status of the individual and are a crucial determinant of both adaptive capacity and cost. In turn, the adaptive capacity and cost directly influence the performance of the individual across varying ranges of environmental demand.

The actions of glucocorticoids have been proposed to follow an inverted U-shape, such that high or low levels of glucocorticoids can impair systems performance (de Kloet et al., 1999;

Herman, 2013). This is especially true for processes dependent on the hippocampus, but also seems to hold true for other areas, such as the mPFC (Joels, 2006; Mizoguchi et al., 2004). For example, both a high dose of corticosterone and adrenalectomy (which removes circulating glucocorticoids) increase behavioral reactivity to novel versus familiar objects, whereas a low dose of corticosterone normalizes this behavior (Oitzl et al., 1994). Glucocorticoid secretion must also be context appropriate. Hypersecreting glucocorticoids under conditions of low demand can be detrimental, but so can hyposecretion in the face of high demand. Therefore, the same concentration of glucocorticoids could be considered deleterious or beneficial depending on the energetic status of the individual. For instance, the same dose of exogenous corticosterone improves performance in a water maze task when animals are trained in warm water, but not cold water (Sandi et al., 1997).Thus, an optimal context-specific amount of

119 glucocorticoid secretion is necessary for maintaining optimal performance (de Kloet et al., 1999;

Herman, 2013; Joels, 2006).

Energy regulatory systems must work in concert to meet the needs of the individual and use overlapping mechanisms to control and fine-tune energy reallocation (multiple feedback sites and pathways). As a result, the individual is able to maintain adaptive capacity across a broad range of environmental demand. For example, the behavioral and physiological changes accompanying responses to chronic stress are typically considered maladaptive. However, if these changes are interpreted based on the environmental context of the individual experiencing chronic stress, many responses could be considered adaptive for organismal survival.

Chronic stress can be a time of high energetic need, and glucocorticoids activate glycogen metabolism and glucose synthesis. Glucocorticoids also inhibit energy utilization by systems that are not necessary for immediate survival, including growth, immune, and reproductive processes (Munck et al., 1984). These steps in energy redistribution and reallocation are essential for increasing the adaptive capacity of the individual. In terms of behavior, the effects of chronic glucocorticoids on measures of anxiety, depression, and behavioral flexibility may be deleterious in some environmental contexts; however, in the face of chronic stress, diminished behavioral output could be considered beneficial. For instance, the neophobia and behavioral withdrawal assessed by many tests of anxiety- and depression-like behavior may serve to minimize risk exposure and energy expenditure in contexts of prolonged challenge. Further, a switch to habitual strategies under chronic stress may lead to greater efficiency in predictable tasks by allowing the individual to respond instinctually and bypass the appraisal process (Dias-Ferreira et al., 2009; Schwabe et al., 2013). Thus, limiting risky or energy-demanding behaviors and energy-intensive physiologic processes (e.g. growth, reproduction, immune responses, etc.) represent major components of the organismal adaptive

120 capacity. However, when these responses are inappropriate to environmental demand or are sustained of prolonged time periods, the individual generates an adaptive cost that can decrease overall performance.

Glucocorticoid responses promote survival during periods of environmental demand but, over longer time frames, glucocorticoid secretion can impair behavioral and physiological health.

There is a certain cost of adaptation that is likely dependent on how the individual’s genetic background and life history interact with their appraisal of environmental demand. Thus, inappropriate regulatory balance in stress systems may comprise a risk factor for pathology (increasing adaptive cost). Adaptive cost may be further increased by energy depletion due to overdrive of energetic systems, physiological energy ‘sinks’ (e.g. infection, inflammation, metabolic disease, etc.), design faults (inefficient energy redistribution systems, genetic polymorphisms), or poor decision making (misinterpretation of energetic need). As mentioned previously, habitual strategies are beneficial under chronic stress when the task and environment remain the same. However, if the environment changes to a context that requires appraisal and flexible strategies, individuals that have adopted habitual strategies may be at a disadvantage. For example, a recent study found that chronically stressed humans are unable to appropriately appraise outcome values. Further, this behavior is associated with a shift from activation of associative areas to increased activation of sensorimotor areas, mPFC and caudate atrophy, and increased putamen volume (Soares et al., 2012). Similarly, in the present dissertation, we found that chronically stressed animals initially have difficulty learning the switch contingency in the delayed spatial win-shift paradigm, indicating a deficit in cognitive flexibility. In these cases, misappraisal and energy depletion likely increase the adaptive cost.

Depression and PTSD are stress-related disorders characterized by cognitive, affective, and physiological responses that are inappropriate to environmental context. Thus, psychopathologies may emerge when adaptive costs outweigh adaptive capacity, leading to a

‘break point’ in the process of adaptation.

121

The Prefrontal Cortex as a Coordinator of Stress Adaptation

Herein, we propose that the mPFC acts as a coordinator of stress adaptation planning, developing, and integrating the efforts of multiple brain regions and energetic systems to generate a context-specific, appropriate behavioral response. The mPFC is well-positioned to act as a coordinator of autonomic and neuroendocrine responses, supporting the energetic mobilization needed for behavioral adaptation (Figure 5.2). As discussed above, context-specific energetics are vital to successful adaptation and chronic stress may lead to pathology by exceeding the adaptive capacity of the individual. More specifically, we propose that prolonged activation of energetic systems or misappraisal of energetic need represent two adaptive costs that could underlie pathology. Further, stress-related illnesses, including MDD and PTSD, are characterized by physiological, cognitive, and affective responses that are inappropriate to environmental context, indicating that adaptive costs may contribute to neuropsychiatric disorders. Given the role of the mPFC in appraisal (i.e. decision-making), the area may serve as an important integrator of energetic systems (i.e. HPA axis and ANS) that support appropriate behavioral response to context.

An example of prefrontal orchestration of responses to stress comes from groups of men and women with mPFC damage. These individuals report more subjective ‘stress’ in the Trier

Social Stress Test (TSST). Despite reporting more stress, men with greater mPFC damage have decreased cortisol accompanied by increased heart rate. Women, in contrast, have an increased cortisol response to the TSST, with no effect on autonomic regulation (Buchanan et al., 2010). Thus, damage to the mPFC results in a disconnect between subjective experience

(i.e. behavior), neuroendocrine responses, and autonomic regulation. Thus, misappraisal of contextual circumstance severely compromises the ability of these individuals to appropriately coordinate behavior with the physiological systems driving energy mobilization. Similarly, patients with mPFC damage are severely impaired in a gambling task, making the wrong decision long after they know the correct strategy (Bechara et al., 1997). Individuals without

122 mPFC damage generate a sympathetically mediated skin conductance response when they are considering a risky decision, whereas patients with mPFC damage do not generate this anticipatory response (Bechara et al., 1997). In spite of knowing the strategy that they should adopt, patients with mPFC damage are unable to execute effective behavioral responses, perhaps related to an inability to mobilize energetic resources to generate behavioral flexibility.

In summary, the mPFC is an important integrator of the neuroendocrine and autonomic energetic systems that drive appropriate responding in specific contexts. Dysregulated activity of the mPFC prevents appropriate responses to stress, and the inability to correctly orchestrate these responses may lie at the heart of neuropsychiatric disorders linked to stress and prefrontal dysfunction.

Glucocorticoids Act via the Glucocorticoid Receptor in Specific Prefrontal Subregions to Promote Synaptic, Neuroendocrine, and Behavioral Adaptation

In the present dissertation, we showed that glucocorticoids act in the prefrontal cortex to inhibit HPA axis responses to stress and regulate behavior. We then sought to understand how glucocorticoids might differently be regulating synaptic activity under chronic stress and the consequences that this could have for behavior. Finally, since aberrant glucocorticoid signaling is thought to underlie disorders linked to stress, such as MDD, we tested the ability of a GR overexpression vector to site-specifically (in mPFC) inhibit the HPA axis and ameliorate the effects of chronic stress. This body of work has highlighted the importance and has contributed to our understanding of the role of the prefrontal GR in synaptic, neuroendocrine, and behavioral adaptation.

First of all, we found that glucocorticoid regulation of the HPA axis and behavior is subregion-specific in the mPFC. Previous studies have not differentiated between the more dorsal prelimbic mPFC (plPFC) and the ventral infralimbic (ilPFC) cortices (Diorio et al., 1993;

Sullivan and Gratton, 1999). Based mainly on the work of Radley and colleagues, we specifically targeted the plPFC vs. the ilPFC in our studies (Radley et al., 2006a). Via shRNA-

123 mediated GR knockdown in Chapter 2 and lentiviral-mediated GR Overexpression in Chapter 4, we found that acutely both the plPFC and ilPFC inhibit the HPA axis. However, the plPFC seemed to be involved in the regulation of basal corticosterone, whereas the ilPFC was recruited to regulate the HPA axis under chronic stress. Moreover, the behavioral phenotypes associated with GR knockdown were subregoin-specific, as well. Knockdown of GR confined to the plPFC induced hyperactivity of locomotor activity in the open field, whereas ilPFC GR knockdown led to increased depression-like behavior in the forced swim test (FST) and ilPFC overexpression in animals without a history of stress ameliorated this phenotype. We postulate that these subregion-specifc differences in physiological and behavioral regulation relate to the connectivity of the plPFC and the ilPFC. The plPFC projects to more limbic/cognitive processing areas (e.g. nucleus accumbens, BLA, raphe nuclei), whereas the ilPFC projects to more visceral/autonomic areas (e.g. nucleus of the solitary tract, lateral septum, bed nucleus of the stria terminalis, central amydaloid nucleus, and posterior hypothalamus), which may underlie apparent differences in subregion-specific knockdown of the GR (Vertes, 2004). Nevertheless, the data highlight the importance of targeting subregion-specific circuits when studying the role of the mPFC in stress adaptation. Furthermore, the data suggest that prefrontal engagement via

GR activation is critical for neuroendocrine regulation.

As stated previously, after identifying the ilPFC circuit as particularly important for chronic stress regulation, we were interested in understanding how glucocorticoids regulate ilPFC synaptic transmission. In Chapter 3, we used whole cell voltage-clamp electrophysiology to assess the effects of chronic stress on excitatory and inhibitory neurotransmission in the ilPFC. We found that chronically stressed animals exhibited significantly more inhibition of glutamatergic output neurons, suggesting that this region is inhibited under basal conditions during chronic stress. We next demonstrated that this change in synaptic neurotransmission may be at least in part due to an increase in GABAergic innervation of glutamatergic output neurons. Further, the GR may be implicated in this shift toward greater inhibition, as chronic

124 stress specifically downregulates GR overexpression in inhibitory interneurons, an effect only observed in parvalbumin-positive interneurons. Parvalbumin neurons are well-positioned to regulate the effects of glucocorticoids due to their proximity to the soma and involvement in regulation of pyramidal glutamatergic neurons normally (Pi et al., 2013; Wen et al., 2010). Thus, we have demonstrated that chronic stress induces a shift toward greater inhibition of glutamatergic output neurons, providing a synaptic mechanism for prefrontal disengagement under chronic stress.

Finally, in this dissertation we sought to understand how prefrontal glucocorticoid signaling leads to an orchestrated behavioral response to stress. As mentioned above, we showed in Chapter 2 that the ilPFC is important for regulation of appropriate mood, whereas the plPFC is important for regulation of locotomotor activity. Even though we found that the prefrontal cortex is important for regulation of both of these behaviors, other brain regions have been implicated in the regulation of mood and locomotor activity (e.g. Ghosal et al., 2014).

Therefore, we chose a task that was specifically regulated by the prefrontal cortex, the delayed spatial win-shift (DSWS) task. This task requires the animal to use information obtained during a training phase each day to flexibly change and prospectively plan their behavior during a testing phase (which occurs 5 min after the training phase). In order to master this task, the animal must successfully learn the switch contingency and flexibly change their behavior each day.

This task, therefore, requires inputs from the prefrontal cortex to the ventral subiculum to generate goal-directed behavior (Floresco et al., 1997). We found that chronically stressed rats are initially impaired at learning this switch contingency, suggesting that increased synaptic inhibition of the prefrontal cortex may have behavioral consequences for behavioral adaptation.

Thus, prefrontal disengagement due to aberrant glucocorticoid signaling may underlie deficits in behavior that require appraisal from higher brain regions. Further, aberrant glucocorticoid signaling may underlie disorders linked to misappraisal of energetic need, including MDD.

125

Linking Glucocorticoid Signaling to Energetics

Presently, we show that glucocorticoid signaling plays an important role in engaging the mPFC in the regulation of neuroendocrine and behavioral responses to stress. Indeed, the appropriate amount of glucocorticoid signaling in the mPFC appears to be important for the coordination of a suitable mobilization of energetic resources to meet the environmental demand placed on the individual. We found that if glucocorticoids are acutely and chronically unable to signal to the ilPFC via activation of the GR that animals have dysregulated HPA axis responses, as well as an inappropriate regulation of mood. Conversely, potentially excessive glucocorticoid signaling in chronically stressed animals with GR overexpression may also induce inappropriate behaviors, such as increased anxiety-like behavior and decreased exploration. Thus, glucocorticoid signaling and context must be tightly linked in a ‘goldilocks- type’ scenario, whereby glucocorticoid signaling must be ‘just right’ to coordinate appropriate responses to stressful stimuli.

Our whole cell voltage-clamp and neuroanatomical studies highlight the consequences of diminished glucocorticoid signaling for prefrontal orchestration of responses to environmental stimuli. We found that chronic stress downregulates GR immunoreactivity in prefrontal interneurons. We propose that glucocorticoids are then less able to exert their inhibitory brake on interneurons, leading to increased inhibition of the glutamatergic output neurons and less engagement of the mPFC during chronic stress. Ultimately, we show that this may underlie the shift from flexible to habitual strategies under chronic stress. This shift is initially an adaptive response, limiting energetic resources and appraisal, in a context that is predictable in nature.

However, this shift in adaptation may prove deleterious when the individual is placed in a new context that requires mobilization of energetic resources, appraisal, and ultimately flexible behavioral strategies. Thus, the work presented in this dissertation highlights the link between prefrontal glucocorticoid signaling, energetics, and coordination of appropriate responses to environmental stimuli.

126

Future Directions and Considerations

Arguably, the mark of any good study is when more questions are generated than can be answered in any reasonable amount of time (i.e. in the timespan of a single dissertation).

There are a number of unanswered questions that this dissertation has generated, as well as, some considerations for future work studying the role of the mPFC in stress adaptation.

First of all, one of the most exciting findings in my dissertation was that chronic stress induces an increase in inhibition of glutamatergic output neurons, which may be due to an attenuated GR-mediated ‘brake’ on parvalbumin activity. The obvious next step in this experiment is to test the hypothesis that glucocorticoids act via the parvalbumin GR to regulate synaptic inhibition of the prefrontal glutamatergic output neurons. Further, teasing out how exactly the GR exerts its influence on parvalbumin would be of interest. For instance, do glucocorticoids alter the excitability of the interneurons, as our pilot data might suggest? How exactly might glucocorticoids achieve this? Do glucocorticoids alter chloride homeostasis, as demonstrated in other parts of the brain, e.g. hypothalamus (Inoue and Bains, 2014)? These are all questions that will aid in our understanding of how glucocorticoids alter synaptic neurotransmission in the mPFC.

In each of the studies within my dissertation, we were interested in how glucocorticoids mediate effects on neuroendocrine, synaptic, and behavioral function via the GR. It would be interesting to understand how exactly the GR is mediating these effects. For instance, Hill and colleagues show that endocannabinoids are mobilized following stress in a GR-dependent manner. They also show that endocannabinoids regulate termination of the HPA axis response and synaptic inhibition of glutamatergic output neurons (Hill et al., 2011). Thus, understanding how the GR exerts its effects, such as through mobilization of endocannbinoids, would aid in our understanding of the mechanistic underpinnings of stress adaptation.

Another future objective should be to develop an effective strategy for GR overexpression in chronically stressed animals. In the present dissertation, GR overexpression

127 was induced while chronic stress was occurring. Perhaps a more effective strategy to test the ability of GR overexpression to ameliorate the effects of chronic stress would be to either chronically stress the rats before overexpression occurs or to place an inducible promoter within the vector construct. Since the full length GR sequence is packaged in a lentiviral construct, we found in pilot studies that it takes about 5 ½-6 weeks before GR overexpression leads to functional changes in physiology. Thus, chronic stress could occur 1-2 weeks following surgery, in order to assess the ability of GR overexpression to enhance recovery from chronic stress.

The only other caveat is that many of the effects of chronic stress on the mPFC do not persist

(e.g. morphological changes, some behaviors, etc.), thus there may only be a small window of time to observe enhanced recovery following chronic stress (Goldwater et al., 2009).

Glucocorticoids are known to play an important role in learning and memory

(Roozendaal, 2000). There are data that suggest that the chronic glucocorticoids and/or chronic stress impair extinction learning and extinction recall (Gourley et al., 2009; Miracle et al., 2006), whereas postreactivation delivery of glucocorticoids can reduce subsequent recall of fear memory (Cai et al., 2006). The role of the prefrontal GR in this process is still unknown and represents another avenue for further research. Studies of this nature will aid in our understanding of how glucocorticoids/stress can affect fear learning and memory acutely, as well as chronically. Moreover, these studies are important for understanding how a traumatic event can lead to fear-related disorders, e.g. PTSD, as well as how we can better treat individuals with impairments in fear learning and memory.

The mPFC is also an important regulator of the autonomic nervous system (ANS),

(Frysztak and Neafsey, 1994, 1991; Resstel and Correa, 2006; Resstel et al., 2004; Tavares et al., 2009; Verberne, 1996; Verberne et al., 1997). As mentioned previously, the mPFC is critically involved in coordinating autonomic and neuroendocrine activity to initiate appropriate behavioral responses. Thus, it would also be of interest to understand how glucocorticoids alter mPFC-mediated ANS responses to stress, both acutely and chronically. There is a clear link

128 between MDD and cardiovascular disease, thus understanding how glucocorticoids in the mPFC cross-talk with the ANS may be of importance to understanding the comorbidity of these disorders (Lichtman et al., 2014; Martinac et al., 2014).

One of the things that became apparent to me during my dissertation is the need for better tests of prefrontal-mediated behavior that are not confounded by other variables. For instance, many tests of prefrontal function require a motivating factor, such as a reward or escaping a stressful stimulus. As discussed above, the energetic status of the individual is particularly important for regulating interpretation of energetic need. Generally, animals need to be food-restricted in order to motivate them to work for the reward. We found this to be the case in the DSWS task as animals that were not food-restricted did not learn the task at the same rate as animals that were food-restricted. Thus, we are studying the effects of chronic stress on prefrontal function in an animal that has a different energetic status than a ‘normal’ chronically stressed animal. Understanding how energetic status interacts with stress is an important line of research that needs to be undertaken, so that we may better interpret our findings in light of these considerations.

Conclusions

A substantial and evolving body of work indicates that glucocorticoids are vital for central stress integration. Accordingly, we propose that the actions of glucocorticoids on neural systems from synapses to circuits generate the energetic resources to promote behavioral stress adaptation. These actions also illustrate the importance of appropriate context appraisal for successful adaptive responses and highlight an important role of the mPFC in coordinating appropriate responses to stress. Misappraisal and/or inadequate adaptive capacity increase the risk for stress-related disorders, including MDD. Future studies addressing the mechanisms by which chronic stress diminishes prefrontal engagement may aid in our understanding of disorders, such as MDD. In order to meet this challenge we must consider the appropriateness of current models and endpoints for assessing the transition from adaptive to deleterious stress

129 responses, as well as ways to increase translation of these findings into improved clinical treatments.

130

Figure 5.1. Stress, energetics, and adaptation. The relationship between stress and energetic can be explained visually by examining the relationship between systems performance and environmental demand. Under conditions of low environmental demand, high levels of systems performance can be achieved without an energetic cost to the individual. With increasing demand, maintaining systems performance requires energetic input to generate an adaptive capacity (indicated by green shaded area), which is opposed by the adaptive cost (yellow shaded area). Without the acquired limitations that generate the adaptive cost, organismal performance could hypothetically be maintained at high levels across a wide range of environmental demand (depicted by the yellow line). Conversely, the absence of energy input would lead to poor performance even under conditions of moderate environmental pressure (depicted by the green line). The actual response (depicted by the blue line) falls between these two theoretical extremes and is determined for each individual as a function of their adaptive capacity and adaptive cost. With optimal energy redistribution and appropriate appraisal of context, the organism is able to maintain systems performance across a wide range of demand. As the adaptive cost of the organism grows, greater energy input will be required to generate systems performance over a more narrow range of demand. Ultimately, the adaptive cost may be greater than the adaptive capacity, leading to a breaking point where systems performance is compromised and risk factors for pathology emerge.

131

Figure 5.2. Prefrontal coordination of energetic systems. The medial prefrontal cortex coordinates activity between the hypothalamic-pituitary-adrenocortical (HPA) axis and the autonomic nervous system in order to drive both emotional and executive functions in everyday life, as well as in response to stressful stimuli.

132

Bibliography

Abidin, I., Eysel, U.T., Lessmann, V., Mittmann, T., 2008. Impaired GABAergic inhibition in the visual cortex of brain-derived neurotrophic factor heterozygous knockout mice. J. Physiol. 586, 1885–1901.

Aerni, A., Traber, R., Hock, C., Roozendaal, B., Schelling, G., Papassotiropoulos, A., Nitsch, R.M., Schnyder, U., de Quervain, D.J.-F., 2004. Low-dose cortisol for symptoms of posttraumatic stress disorder. Am. J. Psychiatry 161, 1488–1490.

Agid, O., Shapira, B., Zislin, J., Ritsner, M., Hanin, B., Murad, H., Troudart, T., Bloch, M., Heresco-Levy, U., Lerer, B., 1999. Environment and vulnerability to major psychiatric illness: a case control study of early parental loss in major depression, bipolar disorder and schizophrenia. Mol. Psychiatry 4, 163–172.

Akana, S.F., Chu, A., Soriano, L., Dallman, M.F., 2001. Corticosterone exerts site-specific and state-dependent effects in prefrontal cortex and amygdala on regulation of adrenocorticotropic hormone, insulin and fat depots. J. Neuroendocrinol. 13, 625–637.

Almawi, W.Y., Abou Jaoude, M.M., Li, X.C., 2002. Transcriptional and post-transcriptional mechanisms of glucocorticoid antiproliferative effects. Hematol. Oncol. 20, 17–32.

Altamura, A.C., Boin, F., Maes, M., 1999. HPA axis and cytokines dysregulation in schizophrenia: potential implications for the antipsychotic treatment. Eur. Neuropsychopharmacol. 10, 1–4.

Amat, J., Paul, E., Watkins, L.R., Maier, S.F., 2008. Activation of the ventral medial prefrontal cortex during an uncontrollable stressor reproduces both the immediate and long-term protective effects of behavioral control. Neuroscience 154, 1178–1186.

Arnett, M.G., Kolber, B.J., Boyle, M.P., Muglia, L.J., 2011. Behavioral insights from mouse models of forebrain--and amygdala-specific glucocorticoid receptor genetic disruption. Mol. Cell. Endocrinol. 336, 2–5.

Arnsten, A.F., Goldman-Rakic, P.S., 1998. Noise stress impairs prefrontal cortical cognitive function in monkeys: evidence for a hyperdopaminergic mechanism. Arch. Gen. Psychiatry 55, 362–368.

Arnsten, A.F.T., Wang, M.J., Paspalas, C.D., 2012. Neuromodulation of thought: flexibilities and vulnerabilities in prefrontal cortical network synapses. Neuron 76, 223–239.

Baddeley, A.D., Bressi, S., Della Sala, S., Logie, R., Spinnler, H., 1991. The decline of working memory in Alzheimer’s disease. A longitudinal study. Brain 114 Pt 6, 2521–2542.

Bagley, J., Moghaddam, B., 1997. Temporal dynamics of glutamate efflux in the prefrontal cortex and in the hippocampus following repeated stress: effects of pretreatment with saline or diazepam. Neuroscience 77, 65–73.

133

Baier, B., Karnath, H.-O., Dieterich, M., Birklein, F., Heinze, C., Muller, N.G., 2010. Keeping memory clear and stable--the contribution of human basal ganglia and prefrontal cortex to working memory. J. Neurosci. 30, 9788–9792.

Baldelli, P., Hernandez-Guijo, J.-M., Carabelli, V., Carbone, E., 2005. Brain-derived neurotrophic factor enhances GABA release probability and nonuniform distribution of N- and P/Q-type channels on release sites of hippocampal inhibitory synapses. J. Neurosci. 25, 3358–3368.

Bale, T.L., 2005. Sensitivity to stress: dysregulation of CRF pathways and disease development. Horm. Behav. 48, 1–10.

Bale, T.L., Chen, A., 2012. Minireview: CRF and Wylie Vale: a story of 41 amino acids and a Texan with grit. Endocrinology 153, 2556–2561.

Bale, T.L., Vale, W.W., 2004. CRF and CRF receptors: role in stress responsivity and other behaviors. Annu. Rev. Pharmacol. Toxicol. 44, 525–557.

Banasr, M., Duman, R.S., 2007. Regulation of neurogenesis and gliogenesis by stress and antidepressant treatment. CNS Neurol. Disord. Drug Targets 6, 311–320.

Banasr, M., Duman, R.S., 2008. Glial loss in the prefrontal cortex is sufficient to induce depressive-like behaviors. Biol. Psychiatry 64, 863–870.

Barbey, A.K., Koenigs, M., Grafman, J., 2013. Dorsolateral prefrontal contributions to human working memory. Cortex. 49, 1195–1205.

Barden, N., 2004. Implication of the hypothalamic-pituitary-adrenal axis in the physiopathology of depression. J. Psychiatry Neurosci. 29, 185–193.

Barsegyan, A., Mackenzie, S.M., Kurose, B.D., McGaugh, J.L., Roozendaal, B., 2010. Glucocorticoids in the prefrontal cortex enhance memory consolidation and impair working memory by a common neural mechanism. Proc. Natl. Acad. Sci. U. S. A. 107, 16655– 16660.

Baumann, B., Danos, P., Krell, D., Diekmann, S., Leschinger, A., Stauch, R., Wurthmann, C., Bernstein, H.G., Bogerts, B., 1999. Reduced volume of limbic system-affiliated basal ganglia in mood disorders: preliminary data from a postmortem study. J. Neuropsychiatry Clin. Neurosci. 11, 71–78.

Beato, M., Sanchez-Pacheco, A., 1996. Interaction of steroid hormone receptors with the transcription initiation complex. Endocr. Rev. 17, 587–609.

Bechara, A., Damasio, A.R., Damasio, H., Anderson, S.W., 1994. Insensitivity to future consequences following damage to human prefrontal cortex. Cognition 50, 7–15.

Bechara, A., Damasio, H., Tranel, D., Damasio, A.R., 1997. Deciding advantageously before knowing the advantageous strategy. Science 275, 1293–1295.

134

Bechara, A., Tranel, D., Damasio, H., 2000. Characterization of the decision-making deficit of patients with ventromedial prefrontal cortex lesions. Brain 123 Pt 1, 2189–2202.

Bechara, A., Tranel, D., Damasio, H., Damasio, A.R., 1996. Failure to respond autonomically to anticipated future outcomes following damage to prefrontal cortex. Cereb. Cortex 6, 215– 225.

Belzung, C., Griebel, G., 2001. Measuring normal and pathological anxiety-like behaviour in mice: a review. Behav. Brain Res. 125, 141–149.

Benarroch, E.E., 2012. Primer on the Autonomic Nervous System, 3rd ed. Academic Press Inc., San Diego, CA.

Benarroch, E.E., 2012. Postural tachycardia syndrome: a heterogeneous and multifactorial disorder. Mayo Clin. Proc. 87, 1214–1225.

Bhatnagar, S., Huber, R., Nowak, N., Trotter, P., 2002. Lesions of the posterior paraventricular thalamus block habituation of hypothalamic-pituitary-adrenal responses to repeated restraint. J. Neuroendocrinol. 14, 403–410.

Binder, E.B., Bradley, R.G., Liu, W., Epstein, M.P., Deveau, T.C., Mercer, K.B., Tang, Y., Gillespie, C.F., Heim, C.M., Nemeroff, C.B., Schwartz, A.C., Cubells, J.F., Ressler, K.J., 2008. Association of FKBP5 polymorphisms and childhood abuse with risk of posttraumatic stress disorder symptoms in adults. JAMA 299, 1291–1305.

Birrell, J.M., Brown, V.J., 2000. Medial frontal cortex mediates perceptual attentional set shifting in the rat. J. Neurosci. 20, 4320–4324.

Bondi, C.O., Rodriguez, G., Gould, G.G., Frazer, A., Morilak, D.A., 2008. Chronic unpredictable stress induces a cognitive deficit and anxiety-like behavior in rats that is prevented by chronic antidepressant drug treatment. Neuropsychopharmacology 33, 320–331.

Botteron, K.N., Raichle, M.E., Drevets, W.C., Heath, A.C., Todd, R.D., 2002. Volumetric reduction in left subgenual prefrontal cortex in early onset depression. Biol. Psychiatry 51, 342–344.

Boudaba, C., Szabo, K., Tasker, J.G., 1996. Physiological mapping of local inhibitory inputs to the hypothalamic paraventricular nucleus. J. Neurosci. 16, 7151–7160.

Bowen, D.M., Najlerahim, A., Procter, A.W., Francis, P.T., Murphy, E., 1989. Circumscribed changes of the cerebral cortex in neuropsychiatric disorders of later life. Proc. Natl. Acad. Sci. U. S. A. 86, 9504–9508.

Boyle, M.P., Brewer, J.A., Funatsu, M., Wozniak, D.F., Tsien, J.Z., Izumi, Y., Muglia, L.J., 2005. Acquired deficit of forebrain glucocorticoid receptor produces depression-like changes in adrenal axis regulation and behavior. Proc. Natl. Acad. Sci. U. S. A. 102, 473–478.

135

Bramham, J., Morris, R.G., Hornak, J., Bullock, P., Polkey, C.E., 2009. Social and emotional functioning following bilateral and unilateral neurosurgical prefrontal cortex lesions. J. Neuropsychol. 3, 125–143.

Broersen, L.M., 2000. Attentional processes and learning and memory in rats: the prefrontal cortex and hippocampus compared. Prog. Brain Res. 126, 79–94.

Bruhn, T.O., Plotsky, P.M., Vale, W.W., 1984. Effect of paraventricular lesions on corticotropin- releasing factor (CRF)-like immunoreactivity in the stalk-median eminence: studies on the adrenocorticotropin response to ether stress and exogenous CRF. Endocrinology 114, 57– 62.

Bubser, M., Schmidt, W.J., 1990. 6-Hydroxydopamine lesion of the rat prefrontal cortex increases locomotor activity, impairs acquisition of delayed alternation tasks, but does not affect uninterrupted tasks in the radial maze. Behav. Brain Res. 37, 157–168.

Buchanan, T.W., Driscoll, D., Mowrer, S.M., Sollers, J.J. 3rd, Thayer, J.F., Kirschbaum, C., Tranel, D., 2010. Medial prefrontal cortex damage affects physiological and psychological stress responses differently in men and women. Psychoneuroendocrinology 35, 56–66.

Butts, K.A., Weinberg, J., Young, A.H., Phillips, A.G., 2011. Glucocorticoid receptors in the prefrontal cortex regulate stress-evoked dopamine efflux and aspects of executive function. Proc. Natl. Acad. Sci. U. S. A. 108, 18459–18464.

Cai, W.-H., Blundell, J., Han, J., Greene, R.W., Powell, C.M., 2006. Postreactivation glucocorticoids impair recall of established fear memory. J. Neurosci. 26, 9560–9566.

Cannon, W.B., 1932. The Wisdom of the Body. WW Norton & Co., New York, New York.

Castillo, P.E., Chiu, C.Q., Carroll, R.C., 2011. Long-term plasticity at inhibitory synapses. Curr. Opin. Neurobiol. 21, 328–338.

Cerqueira, J.J., Mailliet, F., Almeida, O.F.X., Jay, T.M., Sousa, N., 2007. The prefrontal cortex as a key target of the maladaptive response to stress. J. Neurosci. 27, 2781–2787.

Cerqueira, J.J., Pego, J.M., Taipa, R., Bessa, J.M., Almeida, O.F.X., Sousa, N., 2005. Morphological correlates of corticosteroid-induced changes in prefrontal cortex-dependent behaviors. J. Neurosci. 25, 7792–7800.

Chaudhury, S., Aurbach, E.L., Sharma, V., Blandino, P., Turner, C. a, Watson, S.J., Akil, H., 2014. FGF2 is a target and a trigger of epigenetic mechanisms associated with differences in emotionality: partnership with H3K9me3. Proc. Natl. Acad. Sci. U. S. A. 111, 11834–9.

Chiba, S., Numakawa, T., Ninomiya, M., Richards, M.C., Wakabayashi, C., Kunugi, H., 2012. Chronic restraint stress causes anxiety- and depression-like behaviors, downregulates glucocorticoid receptor expression, and attenuates glutamate release induced by brain- derived neurotrophic factor in the prefrontal cortex. Prog. Neuropsychopharmacol. Biol. Psychiatry 39, 112–119.

136

Clark, L., Bechara, A., Damasio, H., Aitken, M.R.F., Sahakian, B.J., Robbins, T.W., 2008. Differential effects of insular and ventromedial prefrontal cortex lesions on risky decision- making. Brain 131, 1311–1322.

Coderre, L., Srivastava, A.K., Chiasson, J.L., 1991. Role of glucocorticoid in the regulation of glycogen metabolism in skeletal muscle. Am. J. Physiol. 260, E927–32.

Colvin, M.K., Dunbar, K., Grafman, J., 2001. The effects of frontal lobe lesions on goal achievement in the water jug task. J. Cogn. Neurosci. 13, 1129–1147.

Conway-Campbell, B.L., Sarabdjitsingh, R.A., McKenna, M.A., Pooley, J.R., Kershaw, Y.M., Meijer, O.C., De Kloet, E.R., Lightman, S.L., 2010. Glucocorticoid ultradian rhythmicity directs cyclical gene pulsing of the clock gene period 1 in rat hippocampus. J. Neuroendocrinol. 22, 1093–1100.

Cook, S.C., Wellman, C.L., 2004. Chronic stress alters dendritic morphology in rat medial prefrontal cortex. J. Neurobiol. 60, 236–248.

Corcoran, C., Mujica-Parodi, L., Yale, S., Leitman, D., Malaspina, D., 2002. Could stress cause psychosis in individuals vulnerable to schizophrenia? CNS Spectr. 7, 33–38,41–42.

Correll, C.M., Rosenkranz, J.A., Grace, A.A., 2005. Chronic cold stress alters prefrontal cortical modulation of amygdala neuronal activity in rats. Biol. Psychiatry 58, 382–391.

Coryell, W., Nopoulos, P., Drevets, W., Wilson, T., Andreasen, N.C., 2005. Subgenual prefrontal cortex volumes in major depressive disorder and schizophrenia: diagnostic specificity and prognostic implications. Am. J. Psychiatry 162, 1706–1712.

Courtin, J., Chaudun, F., Rozeske, R.R., Karalis, N., Gonzalez-Campo, C., Wurtz, H., Abdi, A., Baufreton, J., Bienvenu, T.C.M., Herry, C., 2014. Prefrontal parvalbumin interneurons shape neuronal activity to drive fear expression. Nature 505, 92–96.

Covington, H.E. 3rd, Lobo, M.K., Maze, I., Vialou, V., Hyman, J.M., Zaman, S., LaPlant, Q., Mouzon, E., Ghose, S., Tamminga, C.A., Neve, R.L., Deisseroth, K., Nestler, E.J., 2010. Antidepressant effect of optogenetic stimulation of the medial prefrontal cortex. J. Neurosci. 30, 16082–16090.

Cressman, V.L., Balaban, J., Steinfeld, S., Shemyakin, A., Graham, P., Parisot, N., Moore, H., 2010. Prefrontal cortical inputs to the basal amygdala undergo pruning during late adolescence in the rat. J. Comp. Neurol. 518, 2693–2709.

Cryan, J.F., Page, M.E., Lucki, I., 2005. Differential behavioral effects of the antidepressants reboxetine, fluoxetine, and moclobemide in a modified forced swim test following chronic treatment. Psychopharmacology (Berl). 182, 335–344.

Cullinan, W.E., Helmreich, D.L., Watson, S.J., 1996. Fos expression in forebrain afferents to the hypothalamic paraventricular nucleus following swim stress. J. Comp. Neurol. 368, 88–99.

137

Cullinan, W.E., Herman, J.P., Battaglia, D.F., Akil, H., Watson, S.J., 1995. Pattern and time course of immediate early gene expression in rat brain following acute stress. Neuroscience 64, 477–505.

Dal Monte, O., Krueger, F., Solomon, J.M., Schintu, S., Knutson, K.M., Strenziok, M., Pardini, M., Leopold, A., Raymont, V., Grafman, J., 2013. A voxel-based lesion study on facial emotion recognition after penetrating brain injury. Soc. Cogn. Affect. Neurosci. 8, 632– 639.

Dallman, M.F., Akana, S.F., Cascio, C.S., Darlington, D.N., Jacobson, L., Levin, N., 1987. Regulation of ACTH secretion: variations on a theme of B. Recent Prog. Horm. Res. 43, 113–173.

Dallman, M.F., Jones, M.T., 1973. Corticosteroid feedback control of ACTH secretion: effect of stress-induced corticosterone ssecretion on subsequent stress responses in the rat. Endocrinology 92, 1367–1375.

Dallman, M.F., Pecoraro, N.C., La Fleur, S.E., Warne, J.P., Ginsberg, A.B., Akana, S.F., Laugero, K.C., Houshyar, H., Strack, A.M., Bhatnagar, S., Bell, M.E., 2006. Glucocorticoids, chronic stress, and obesity. Prog. Brain Res. 153, 75–105.

Damasio, H., Grabowski, T., Frank, R., Galaburda, A.M., Damasio, A.R., 1994. The return of Phineas Gage: clues about the brain from the skull of a famous patient. Science 264, 1102–1105.

De Bruin, J.P., Sanchez-Santed, F., Heinsbroek, R.P., Donker, A., Postmes, P., 1994. A behavioural analysis of rats with damage to the medial prefrontal cortex using the Morris water maze: evidence for behavioural flexibility, but not for impaired spatial navigation. Brain Res. 652, 323–333.

De Kloet, E.R., 2013a. Functional profile of the binary brain corticosteroid receptor system: mediating, multitasking, coordinating, integrating. Eur. J. Pharmacol. 719, 53–62.

De Kloet, E.R., 2013b. Lifetime achievement from a brain-adrenal perspective: on the CRF- urocortin-glucocorticoid balance. J. Chem. Neuroanat. 54, 42–49.

De Kloet, E.R., Joels, M., Holsboer, F., 2005. Stress and the brain: from adaptation to disease. Nat. Rev. Neurosci. 6, 463–475.

De Kloet, E.R., Oitzl, M.S., Joels, M., 1999. Stress and cognition: are corticosteroids good or bad guys? Trends Neurosci. 22, 422–426.

De Kloet, E.R., Reul, J.M., 1987. Feedback action and tonic influence of corticosteroids on brain function: a concept arising from the heterogeneity of brain receptor systems. Psychoneuroendocrinology 12, 83–105.

De Kloet, E.R., Sarabdjitsingh, R.A., 2008. Everything has rhythm: focus on glucocorticoid pulsatility. Endocrinology 149, 3241–3243.

138

De Kloet, E.R., Vreugdenhil, E., Oitzl, M.S., Joels, M., 1998. Brain corticosteroid receptor balance in health and disease. Endocr. Rev. 19, 269–301.

De Quervain, D.J.-F., Bentz, D., Michael, T., Bolt, O.C., Wiederhold, B.K., Margraf, J., Wilhelm, F.H., 2011. Glucocorticoids enhance extinction-based psychotherapy. Proc. Natl. Acad. Sci. U. S. A. 108, 6621–6625.

De Wied, D., Bouman, P.R., Smelik, P.G., 1957. The influence of a hypothalamus extract and of pitressin on the release of ACTH from the pituitary gland. Acta Physiol. Pharmacol. Neerl. 5, 489–490.

DeFelipe, J., Farinas, I., 1992. The pyramidal neuron of the cerebral cortex: morphological and chemical characteristics of the synaptic inputs. Prog. Neurobiol. 39, 563–607.

Delahanty, D.L., Gabert-Quillen, C., Ostrowski, S.A., Nugent, N.R., Fischer, B., Morris, A., Pitman, R.K., Bon, J., Fallon, W., 2013. The efficacy of initial hydrocortisone administration at preventing posttraumatic distress in adult trauma patients: a randomized trial. CNS Spectr. 18, 103–111.

Delatour, B., Gisquet-Verrier, P., 2000. Functional role of rat prelimbic-infralimbic cortices in spatial memory: evidence for their involvement in attention and behavioural flexibility. Behav. Brain Res. 109, 113–128.

Derijk, R.H., de Kloet, E.R., 2008. Corticosteroid receptor polymorphisms: determinants of vulnerability and resilience. Eur. J. Pharmacol. 583, 303–311.

Derijk, R.H., van Leeuwen, N., Klok, M.D., Zitman, F.G., 2008. Corticosteroid receptor-gene variants: modulators of the stress-response and implications for mental health. Eur. J. Pharmacol. 585, 492–501.

Dias-Ferreira, E., Sousa, J.C., Melo, I., Morgado, P., Mesquita, A.R., Cerqueira, J.J., Costa, R.M., Sousa, N., 2009. Chronic stress causes frontostriatal reorganization and affects decision-making. Science 325, 621–625.

Diorio, D., Viau, V., Meaney, M.J., 1993. The role of the medial prefrontal cortex (cingulate gyrus) in the regulation of hypothalamic-pituitary-adrenal responses to stress. J. Neurosci. 13, 3839–3847.

Drevets, W.C., 2000. Neuroimaging studies of mood disorders. Biol. Psychiatry 48, 813–829.

Drevets, W.C., Price, J.L., Furey, M.L., 2008. Brain structural and functional abnormalities in mood disorders: implications for neurocircuitry models of depression. Brain Struct. Funct. 213, 93–118.

Drevets, W.C., Price, J.L., Simpson, J.R.J., Todd, R.D., Reich, T., Vannier, M., Raichle, M.E., 1997. Subgenual prefrontal cortex abnormalities in mood disorders. Nature 386, 824–827.

139

Evanson, N.K., Tasker, J.G., Hill, M.N., Hillard, C.J., Herman, J.P., 2010. Fast feedback inhibition of the HPA axis by glucocorticoids is mediated by endocannabinoid signaling. Endocrinology 151, 4811–4819.

Exton, J.H., 1979. Regulation of gluconeogenesis by glucocorticoids. Monogr. Endocrinol. 12, 535–546.

Ferry, B., McGaugh, J.L., 2000. Role of amygdala norepinephrine in mediating stress hormone regulation of memory storage. Acta Pharmacol. Sin. 21, 481–493.

Figueiredo, H.F., Bruestle, A., Bodie, B., Dolgas, C.M., Herman, J.P., 2003. The medial prefrontal cortex differentially regulates stress-induced c-fos expression in the forebrain depending on type of stressor. Eur. J. Neurosci. 18, 2357–2364.

Flak, J.N., Ostrander, M.M., Tasker, J.G., Herman, J.P., 2009. Chronic stress-induced neurotransmitter plasticity in the PVN. J. Comp. Neurol. 517, 156–165.

Floresco, S.B., Block, A.E., Tse, M.T.L., 2008. Inactivation of the medial prefrontal cortex of the rat impairs strategy set-shifting, but not reversal learning, using a novel, automated procedure. Behav. Brain Res. 190, 85–96.

Floresco, S.B., Seamans, J.K., Phillips, A.G., 1997. Selective roles for hippocampal, prefrontal cortical, and ventral striatal circuits in radial-arm maze tasks with or without a delay. J. Neurosci. 17, 1880–1890.

Floresco, S.B., Zhang, Y., Enomoto, T., 2009. Neural circuits subserving behavioral flexibility and their relevance to schizophrenia. Behav. Brain Res. 204, 396–409.

Fossati, P., Ergis, A.M., Allilaire, J.F., 2002. Executive functioning in unipolar depression: a review. Encephale. 28, 97–107.

Fredj, N. Ben, Burrone, J., 2009. A resting pool of vesicles is responsible for spontaneous vesicle fusion at the synapse. Nat. Neurosci. 12, 751–758.

Freund, T.F., Katona, I., 2007. Perisomatic inhibition. Neuron 56, 33–42.

Frysztak, R.J., Neafsey, E.J., 1991. The effect of medial frontal cortex lesions on respiration, “freezing,” and ultrasonic vocalizations during conditioned emotional responses in rats. Cereb. Cortex 1, 418–425.

Frysztak, R.J., Neafsey, E.J., 1994. The effect of medial frontal cortex lesions on cardiovascular conditioned emotional responses in the rat. Brain Res. 643, 181–193.

Furay, A.R., Bruestle, A.E., Herman, J.P., 2008. The role of the forebrain glucocorticoid receptor in acute and chronic stress. Endocrinology 149, 5482–5490.

Fuxe, K., Cintra, A., Agnati, L.F., Harfstrand, A., Wikstrom, A.C., Okret, S., Zoli, M., Miller, L.S., Greene, J.L., Gustafsson, J.A., 1987. Studies on the cellular localization and distribution of glucocorticoid receptor and estrogen receptor immunoreactivity in the central nervous

140

system of the rat and their relationship to the monoaminergic and peptidergic neurons of the brain. J. Steroid Biochem. 27, 159–170.

Fuxe, K., Wikstrom, A.C., Okret, S., Agnati, L.F., Harfstrand, A., Yu, Z.Y., Granholm, L., Zoli, M., Vale, W., Gustafsson, J.A., 1985. Mapping of glucocorticoid receptor immunoreactive neurons in the rat tel- and diencephalon using a monoclonal antibody against rat liver glucocorticoid receptor. Endocrinology 117, 1803–1812.

Gabbott, P.L., Dickie, B.G., Vaid, R.R., Headlam, A.J., Bacon, S.J., 1997. Local-circuit neurones in the medial prefrontal cortex (areas 25, 32 and 24b) in the rat: morphology and quantitative distribution. J. Comp. Neurol. 377, 465–499.

Gabbott, P.L.A., Warner, T.A., Jays, P.R.L., Salway, P., Busby, S.J., 2005. Prefrontal cortex in the rat: projections to subcortical autonomic, motor, and limbic centers. J. Comp. Neurol. 492, 145–177.

Gibbs, D.M., Vale, W., 1982. Presence of corticotropin releasing factor-like immunoreactivity in hypophysial portal blood. Endocrinology 111, 1418–1420.

Gilabert-Juan, J., Castillo-Gomez, E., Guirado, R., Molto, M.D., Nacher, J., 2013. Chronic stress alters inhibitory networks in the medial prefrontal cortex of adult mice. Brain Struct. Funct. 218, 1591–1605.

Goldberg, E., Bougakov, D., 2005. Neuropsychologic assessment of frontal lobe dysfunction. Psychiatr. Clin. North Am. 28, 567–580,578–579.

Goldman-Rakic, P.S., 1995. Cellular basis of working memory. Neuron 14, 477–485.

Goldwater, D.S., Pavlides, C., Hunter, R.G., Bloss, E.B., Hof, P.R., McEwen, B.S., Morrison, J.H., 2009. Structural and functional alterations to rat medial prefrontal cortex following chronic restraint stress and recovery. Neuroscience 164, 798–808.

Gomez-Sanchez, C.E., de Rodriguez, A.F., Romero, D.G., Estess, J., Warden, M.P., Gomez- Sanchez, M.T., Gomez-Sanchez, E.P., 2006. Development of a panel of monoclonal antibodies against the mineralocorticoid receptor. Endocrinology 147, 1343–1348.

Gourley, S.L., Kedves, A.T., Olausson, P., Taylor, J.R., 2009. A history of corticosterone exposure regulates fear extinction and cortical NR2B, GluR2/3, and BDNF. Neuropsychopharmacology 34, 707–716.

Gourley, S.L., Swanson, A.M., Jacobs, A.M., Howell, J.L., Mo, M., Dileone, R.J., Koleske, A.J., Taylor, J.R., 2012. Action control is mediated by prefrontal BDNF and glucocorticoid receptor binding. Proc. Natl. Acad. Sci. U. S. A. 109, 20714–20719.

Graham, L.K., Yoon, T., Kim, J.J., 2010. Stress impairs optimal behavior in a water foraging choice task in rats. Learn. Mem. 17, 1–4.

141

Graybeal, C., Kiselycznyk, C., Holmes, A., 2012. Stress-induced impairments in prefrontal- mediated behaviors and the role of the N-methyl-D-aspartate receptor. Neuroscience 211, 28–38.

Gundersen, V., Chaudhry, F.A., Bjaalie, J.G., Fonnum, F., Ottersen, O.P., Storm-Mathisen, J., 1998. Synaptic vesicular localization and exocytosis of L-aspartate in excitatory nerve terminals: a quantitative immunogold analysis in rat hippocampus. J. Neurosci. 18, 6059– 6070.

Haam, J., Halmos, K., Muglia, L., Tasker, J., 2010. Rapid synaptic modulation of hypothalamic neurons by glucocorticoids requires the glucocorticoid receptor. Society for Neuroscience Meeting Abstract, San Diego, CA.

Hamani, C., Amorim, B.O., Wheeler, A.L., Diwan, M., Driesslein, K., Covolan, L., Butson, C.R., Nobrega, J.N., 2014. Deep brain stimulation in rats: different targets induce similar antidepressant-like effects but influence different circuits. Neurobiol. Dis. 71, 205–214.

Hamani, C., Diwan, M., Isabella, S., Lozano, A.M., Nobrega, J.N., 2010a. Effects of different stimulation parameters on the antidepressant-like response of medial prefrontal cortex deep brain stimulation in rats. J. Psychiatr. Res. 44, 683–687.

Hamani, C., Machado, D.C., Hipolide, D.C., Dubiela, F.P., Suchecki, D., Macedo, C.E., Tescarollo, F., Martins, U., Covolan, L., Nobrega, J.N., 2012. Deep brain stimulation reverses anhedonic-like behavior in a chronic model of depression: role of serotonin and brain derived neurotrophic factor. Biol. Psychiatry 71, 30–35.

Hamani, C., Nobrega, J.N., Lozano, A.M., 2010b. Deep brain stimulation in clinical practice and in animal models. Clin. Pharmacol. Ther. 88, 559–562.

Harlow, J.M., 1868. Passage of an Iron Road Through the Head. Bost. Med. Surg. J. 39, 389– 393.

Hascup, E.R., Hascup, K.N., Stephens, M., Pomerleau, F., Huettl, P., Gratton, A., Gerhardt, G.A., 2010. Rapid microelectrode measurements and the origin and regulation of extracellular glutamate in rat prefrontal cortex. J. Neurochem. 115, 1608–1620.

Hauer, D., Kaufmann, I., Strewe, C., Briegel, I., Campolongo, P., Schelling, G., 2014. The role of glucocorticoids, catecholamines and endocannabinoids in the development of traumatic memories and posttraumatic stress symptoms in survivors of critical illness. Neurobiol. Learn. Mem. 112, 68–74.

Hauer, D., Weis, F., Papassotiropoulos, A., Schmoeckel, M., Beiras-Fernandez, A., Lieke, J., Kaufmann, I., Kirchhoff, F., Vogeser, M., Roozendaal, B., Briegel, J., de Quervain, D., Schelling, G., 2011. Relationship of a common polymorphism of the glucocorticoid receptor gene to traumatic memories and posttraumatic stress disorder in patients after intensive care therapy. Crit. Care Med. 39, 643–650.

Heidbreder, C.A., Groenewegen, H.J., 2003. The medial prefrontal cortex in the rat: evidence for a dorso-ventral distinction based upon functional and anatomical characteristics. Neurosci. Biobehav. Rev. 27, 555–579.

142

Heinrichs, S.C., Koob, G.F., 2004. Corticotropin-releasing factor in brain: a role in activation, arousal, and affect regulation. J. Pharmacol. Exp. Ther. 311, 427–440.

Herman, J.P., 2013. Neural control of chronic stress adaptation. Front. Behav. Neurosci. 7, 61.

Herman, J.P., Adams, D., Prewitt, C., 1995. Regulatory changes in neuroendocrine stress- integrative circuitry produced by a variable stress paradigm. Neuroendocrinology 61, 180– 190.

Herman, J.P., Figueiredo, H., Mueller, N.K., Ulrich-Lai, Y., Ostrander, M.M., Choi, D.C., Cullinan, W.E., 2003. Central mechanisms of stress integration: hierarchical circuitry controlling hypothalamo-pituitary-adrenocortical responsiveness. Front. Neuroendocrinol. 24, 151–180.

Herman, J.P., McKlveen, J.M., Solomon, M.B., Carvalho-Netto, E., Myers, B., 2012. Neural regulation of the stress response: glucocorticoid feedback mechanisms. Braz. J. Med. Biol. Res. 45, 292–298.

Hill, M.N., McLaughlin, R.J., Pan, B., Fitzgerald, M.L., Roberts, C.J., Lee, T.T.-Y., Karatsoreos, I.N., Mackie, K., Viau, V., Pickel, V.M., McEwen, B.S., Liu, Q., Gorzalka, B.B., Hillard, C.J., 2011. Recruitment of prefrontal cortical endocannabinoid signaling by glucocorticoids contributes to termination of the stress response. J. Neurosci. 31, 10506–10515.

Hirayasu, Y., Shenton, M.E., Salisbury, D.F., Kwon, J.S., Wible, C.G., Fischer, I.A., Yurgelun- Todd, D., Zarate, C., Kikinis, R., Jolesz, F.A., McCarley, R.W., 1999. Subgenual cingulate cortex volume in first-episode psychosis. Am. J. Psychiatry 156, 1091–1093.

Holmes, A., Wellman, C.L., 2009. Stress-induced prefrontal reorganization and executive dysfunction in rodents. Neurosci. Biobehav. Rev. 33, 773–783.

Holsboer, F., 2000. The corticosteroid receptor hypothesis of depression. Neuropsychopharmacology 23, 477–501.

Holsboer, F., Barden, N., 1996. Antidepressants and hypothalamic-pituitary-adrenocortical regulation. Endocr. Rev. 17, 187–205.

Holtzheimer, P.E., Mayberg, H.S., 2011. Stuck in a rut: rethinking depression and its treatment. Trends Neurosci. 34, 1–9.

Holtzheimer, P.E., Mayberg, H.S., 2012. Neuromodulation for treatment-resistant depression. F1000 Med. Rep. 4, 22.

Hubner, C., Bosch, D., Gall, A., Luthi, A., Ehrlich, I., 2014. Ex vivo dissection of optogenetically activated mPFC and hippocampal inputs to neurons in the basolateral amygdala: implications for fear and emotional memory. Front. Behav. Neurosci. 8, 64.

Huizenga, N.A., Koper, J.W., De Lange, P., Pols, H.A., Stolk, R.P., Burger, H., Grobbee, D.E., Brinkmann, A.O., De Jong, F.H., Lamberts, S.W., 1998. A polymorphism in the

143

glucocorticoid receptor gene may be associated with and increased sensitivity to glucocorticoids in vivo. J. Clin. Endocrinol. Metab. 83, 144–151.

Inoue, W., Bains, J.S., 2014. Beyond inhibition: GABA synapses tune the neuroendocrine stress axis. Bioessays 36, 561–569.

Iversen, S., Iversen, L., Saper, C.B., 2000. Principles of Neural Science. McGraw-Hill, New York, New York.

Jaferi, A., Bhatnagar, S., 2006. Corticosterone can act at the posterior paraventricular thalamus to inhibit hypothalamic-pituitary-adrenal activity in animals that habituate to repeated stress. Endocrinology 147, 4917–4930.

Janig, W., Habler, H.-J., 2003. Neurophysiological analysis of target-related sympathetic pathways--from animal to human: similarities and differences. Acta Physiol. Scand. 177, 255–274.

Jankord, R., Solomon, M.B., Albertz, J., Flak, J.N., Zhang, R., Herman, J.P., 2011. Stress vulnerability during adolescent development in rats. Endocrinology 152, 629–638.

Jinks, A.L., McGregor, I.S., 1997. Modulation of anxiety-related behaviours following lesions of the prelimbic or infralimbic cortex in the rat. Brain Res. 772, 181–190.

Joels, M., 2006. Corticosteroid effects in the brain: U-shape it. Trends Pharmacol. Sci. 27, 244– 250.

Joels, M., Baram, T.Z., 2009. The neuro-symphony of stress. Nat. Rev. Neurosci. 10, 459–466.

Joels, M., Karst, H., 2012. Corticosteroid effects on calcium signaling in limbic neurons. Cell Calcium 51, 277–283.

Joels, M., Sarabdjitsingh, R.A., Karst, H., 2012. Unraveling the time domains of corticosteroid hormone influences on brain activity: rapid, slow, and chronic modes. Pharmacol. Rev. 64, 901–938.

Jones, K.R., Myers, B., Herman, J.P., 2011. Stimulation of the prelimbic cortex differentially modulates neuroendocrine responses to psychogenic and systemic stressors. Physiol. Behav. 104, 266–271.

Katz, B., 1969. The Release of Neural Transmission Substances. Liverpool University Press, Liverpool, UK.

Kirischuk, S., Grantyn, R., 2003. Intraterminal Ca2+ concentration and asynchronous transmitter release at single GABAergic boutons in rat collicular cultures. J. Physiol. 548, 753–764.

Kirischuk, S., Juttner, R., Grantyn, R., 2005. Time-matched pre- and postsynaptic changes of GABAergic synaptic transmission in the developing mouse superior colliculus. J. Physiol. 563, 795–807.

144

Kolber, B.J., Roberts, M.S., Howell, M.P., Wozniak, D.F., Sands, M.S., Muglia, L.J., 2008. Central amygdala glucocorticoid receptor action promotes fear-associated CRH activation and conditioning. Proc. Natl. Acad. Sci. U. S. A. 105, 12004–12009.

Koot, S., Baars, A., Hesseling, P., van den Bos, R., Joels, M., 2013. Time-dependent effects of corticosterone on reward-based decision-making in a rodent model of the Iowa Gambling Task. Neuropharmacology 70, 306–315.

Koot, S., Koukou, M., Baars, A., Hesseling, P., van ’t Klooster, J., Joels, M., van den Bos, R., 2014. Corticosterone and decision-making in male Wistar rats: the effect of corticosterone application in the infralimbic and orbitofrontal cortex. Front. Behav. Neurosci. 8, 127.

Kubota, Y., Hattori, R., Yui, Y., 1994. Three distinct subpopulations of GABAergic neurons in rat frontal agranular cortex. Brain Res. 649, 159–173.

Kumsta, R., Entringer, S., Koper, J.W., van Rossum, E.F.C., Hellhammer, D.H., Wust, S., 2008. Glucocorticoid receptor gene polymorphisms and glucocorticoid sensitivity of subdermal blood vessels and leukocytes. Biol. Psychol. 79, 179–184.

Landro, N.I., Rund, B.R., Lund, A., Sundet, K., Mjellem, N., Asbjornsen, A., Thomsen, T., Ersland, L., Lundervold, A., Smievoll, A.I., Egeland, J., Stordal, K., Roness, A., Sundberg, H., Hugdahl, K., 2001. Honig’s model of working memory and brain activation: an fMRI study. Neuroreport 12, 4047–4054.

Lapiz, M.D.S., Morilak, D.A., 2006. Noradrenergic modulation of cognitive function in rat medial prefrontal cortex as measured by attentional set shifting capability. Neuroscience 137, 1039–1049.

Laryea, G., Arnett, M.G., Wieczorek, L., Muglia, L.J., 2013. Site-specific modulation of brain glucocorticoid receptor and corticotropin-releasing hormone expression using lentiviral vectors. Mol. Cell. Endocrinol. 371, 160–165.

Levens, S.M., Larsen, J.T., Bruss, J., Tranel, D., Bechara, A., Mellers, B.A., 2014. What might have been? The role of the ventromedial prefrontal cortex and lateral orbitofrontal cortex in counterfactual emotions and choice. Neuropsychologia 54, 77–86.

Lewis, D.A., Volk, D.W., Hashimoto, T., 2004. Selective alterations in prefrontal cortical GABA neurotransmission in schizophrenia: a novel target for the treatment of working memory dysfunction. Psychopharmacology (Berl). 174, 143–150.

Lichtman, J.H., Froelicher, E.S., Blumenthal, J.A., Carney, R.M., Doering, L. V, Frasure-Smith, N., Freedland, K.E., Jaffe, A.S., Leifheit-Limson, E.C., Sheps, D.S., Vaccarino, V., Wulsin, L., 2014. Depression as a risk factor for poor prognosis among patients with acute coronary syndrome: systematic review and recommendations: a scientific statement from the American Heart Association. Circulation 129, 1350–1369.

Lightman, S.L., Wiles, C.C., Atkinson, H.C., Henley, D.E., Russell, G.M., Leendertz, J.A., McKenna, M.A., Spiga, F., Wood, S.A., Conway-Campbell, B.L., 2008. The significance of glucocorticoid pulsatility. Eur. J. Pharmacol. 583, 255–262.

145

Liston, C., Miller, M.M., Goldwater, D.S., Radley, J.J., Rocher, A.B., Hof, P.R., Morrison, J.H., McEwen, B.S., 2006. Stress-induced alterations in prefrontal cortical dendritic morphology predict selective impairments in perceptual attentional set-shifting. J. Neurosci. 26, 7870– 7874.

Liu, R.-J., Aghajanian, G.K., 2008. Stress blunts serotonin- and hypocretin-evoked EPSCs in prefrontal cortex: role of corticosterone-mediated apical dendritic atrophy. Proc. Natl. Acad. Sci. U. S. A. 105, 359–364.

Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402–408.

Lozano, A.M., Mayberg, H.S., Giacobbe, P., Hamani, C., Craddock, R.C., Kennedy, S.H., 2008. Subcallosal cingulate gyrus deep brain stimulation for treatment-resistant depression. Biol. Psychiatry 64, 461–467.

Luscher, B., Shen, Q., Sahir, N., 2011. The GABAergic deficit hypothesis of major depressive disorder. Mol. Psychiatry 16, 383–406.

Maeda, M., Tanaka, E., Shoudai, K., Nonaka, K., Murayama, N., Ito, Y., Akaike, N., 2009. Differential effects of divalent cations on spontaneous and evoked glycine release from spinal interneurons. J. Neurophysiol. 101, 1103–1113.

Maier, S.F., Watkins, L.R., 2010. Role of the medial prefrontal cortex in coping and resilience. Brain Res. 1355, 52–60.

Manes, F., Sahakian, B., Clark, L., Rogers, R., Antoun, N., Aitken, M., Robbins, T., 2002. Decision-making processes following damage to the prefrontal cortex. Brain 125, 624–639.

Martinac, M., Pehar, D., Karlovic, D., Babic, D., Marcinko, D., Jakovljevic, M., 2014. Metabolic syndrome, activity of the hypothalamic-pituitary-adrenal axis and inflammatory mediators in depressive disorder. Acta Clin. Croat. 53, 55–71.

Mayberg, H.S., Lozano, A.M., Voon, V., McNeely, H.E., Seminowicz, D., Hamani, C., Schwalb, J.M., Kennedy, S.H., 2005. Deep brain stimulation for treatment-resistant depression. Neuron 45, 651–660.

McCann, S.M., Fruit, A., 1957. Effect of synthetic vasopressin on release of adrenocorticotrophin in rats with hypothalamic lesions. Proc. Soc. Exp. Biol. Med. 96, 566– 567.

McClave, J.T., Dietrich, F.H., 1994. Statistics, 6th ed. Macmillan College Publishing Company, Inc., Englewood, NJ.

McEwen, B.S., Eiland, L., Hunter, R.G., Miller, M.M., 2012. Stress and anxiety: structural plasticity and epigenetic regulation as a consequence of stress. Neuropharmacology 62, 3– 12.

146

McEwen, B.S., Magarinos, A.M., 2001. Stress and hippocampal plasticity: implications for the pathophysiology of affective disorders. Hum. Psychopharmacol. 16, S7–S19.

McKlveen, J.M., Myers, B., Flak, J.N., Bundzikova, J., Solomon, M.B., Seroogy, K.B., Herman, J.P., 2013. Role of prefrontal cortex glucocorticoid receptors in stress and emotion. Biol. Psychiatry 74, 672–679.

Meaney, M.J., Sapolsky, R.M., McEwen, B.S., 1985. The development of the glucocorticoid receptor system in the rat limbic brain. II. An autoradiographic study. Brain Res. 350, 165– 168.

Meng, Q.-Y., Chen, X.-N., Tong, D.-L., Zhou, J.-N., 2011. Stress and glucocorticoids regulated corticotropin releasing factor in rat prefrontal cortex. Mol. Cell. Endocrinol. 342, 54–63.

Merriam, E.P., Thase, M.E., Haas, G.L., Keshavan, M.S., Sweeney, J.A., 1999. Prefrontal cortical dysfunction in depression determined by Wisconsin Card Sorting Test performance. Am. J. Psychiatry 156, 780–782.

Mika, A., Mazur, G.J., Hoffman, A.N., Talboom, J.S., Bimonte-Nelson, H.A., Sanabria, F., Conrad, C.D., 2012. Chronic stress impairs prefrontal cortex-dependent response inhibition and spatial working memory. Behav. Neurosci. 126, 605–619.

Milner, B., Petrides, M., Smith, M.L., 1985. Frontal lobes and the temporal organization of memory. Hum. Neurobiol. 4, 137–142.

Miracle, A.D., Brace, M.F., Huyck, K.D., Singler, S.A., Wellman, C.L., 2006. Chronic stress impairs recall of extinction of conditioned fear. Neurobiol. Learn. Mem. 85, 213–218.

Mizoguchi, K., Ishige, A., Aburada, M., Tabira, T., 2003. Chronic stress attenuates glucocorticoid negative feedback: involvement of the prefrontal cortex and hippocampus. Neuroscience 119, 887–897.

Mizoguchi, K., Ishige, A., Takeda, S., Aburada, M., Tabira, T., 2004. Endogenous glucocorticoids are essential for maintaining prefrontal cortical cognitive function. J. Neurosci. 24, 5492–5499.

Mizoguchi, K., Yuzurihara, M., Ishige, A., Sasaki, H., Chui, D.H., Tabira, T., 2000. Chronic stress induces impairment of spatial working memory because of prefrontal dopaminergic dysfunction. J. Neurosci. 20, 1568–1574.

Moghaddam, B., 1993. Stress preferentially increases extraneuronal levels of excitatory amino acids in the prefrontal cortex: comparison to hippocampus and basal ganglia. J. Neurochem. 60, 1650–1657.

Monchi, O., Petrides, M., Doyon, J., Postuma, R.B., Worsley, K., Dagher, A., 2004. Neural bases of set-shifting deficits in Parkinson’s disease. J. Neurosci. 24, 702–710.

147

Muller, N.G., Machado, L., Knight, R.T., 2002. Contributions of subregions of the prefrontal cortex to working memory: evidence from brain lesions in humans. J. Cogn. Neurosci. 14, 673–686.

Munck, A., Guyre, P.M., Holbrook, N.J., 1984. Physiological functions of glucocorticoids in stress and their relation to pharmacological actions. Endocr. Rev. 5, 25–44.

Murphy, B.L., Arnsten, A.F., Jentsch, J.D., Roth, R.H., 1996. Dopamine and spatial working memory in rats and monkeys: pharmacological reversal of stress-induced impairment. J. Neurosci. 16, 7768–7775.

Musazzi, L., Milanese, M., Farisello, P., Zappettini, S., Tardito, D., Barbiero, V.S., Bonifacino, T., Mallei, A., Baldelli, P., Racagni, G., Raiteri, M., Benfenati, F., Bonanno, G., Popoli, M., 2010. Acute stress increases depolarization-evoked glutamate release in the rat prefrontal/frontal cortex: the dampening action of antidepressants. PLoS One 5, e8566.

Myers, B., Mark Dolgas, C., Kasckow, J., Cullinan, W.E., Herman, J.P., 2014a. Central stress- integrative circuits: forebrain glutamatergic and GABAergic projections to the dorsomedial hypothalamus, medial preoptic area, and bed nucleus of the stria terminalis. Brain Struct. Funct. 219, 1287–1303.

Myers, B., McKlveen, J.M., Herman, J.P., 2012. Neural regulation of the stress response: The many faces of feedback. Cell. Mol. Neurobiol. 32(5): 683-694.

Myers, B., McKlveen, J.M., Herman, J.P., 2014b. Glucocorticoid actions on synapses, circuits, and behavior: Implications for the energetics of stress. Front. Neuroendocrinol. 35(2): 180- 196.

Myers, B, Carvalho-Netto, E.F., Wu, C., Wick, D., Solomon, M.B., Ulrich-Lai, Y.M., Herman, J.P., 2012. Stress-activated corticolimbic efferents innervate the posterior hypothalamic nucleus: a novel circuit for stimulating neuroendocrine stress responses.Society for Neuroscience Meeting Abstract, New Orleans, LA.

Nederhof, E., Schmidt, M. V, 2012. Mismatch or cumulative stress: toward an integrated hypothesis of programming effects. Physiol. Behav. 106, 691–700.

Nishimura, J., Endo, Y., Kimura, F., 1999. A long-term stress exposure impairs maze learning performance in rats. Neurosci. Lett. 273, 125–128.

Oakley, R.H., Cidlowski, J.A., 2013. The biology of the glucocorticoid receptor: new signaling mechanisms in health and disease. J. Allergy Clin. Immunol. 132, 1033–1044.

Oitzl, M.S., Fluttert, M., de Kloet, E.R., 1994. The effect of corticosterone on reactivity to spatial novelty is mediated by central mineralocorticosteroid receptors. Eur. J. Neurosci. 6, 1072– 1079.

Ongur, D., Drevets, W.C., Price, J.L., 1998. Glial reduction in the subgenual prefrontal cortex in mood disorders. Proc. Natl. Acad. Sci. U. S. A. 95, 13290–13295.

148

Organization, W.H., 2012. Depression. www.who.int/mediacentre/factsheets/fs369/en/

Pariante, C.M., Miller, A.H., 2001. Glucocorticoid receptors in major depression: relevance to pathophysiology and treatment. Biol. Psychiatry 49, 391–404.

Paxinos, G., Watson, C., 1998. The Rat Brain in Stereotaxic Coordinates., 4th ed. Academic Press Inc., San Diego, CA.

Pedersen, K.B., Geng, C., Vedeckis, W. V, 2004. Three mechanisms are involved in glucocorticoid receptor autoregulation in a human T-lymphoblast cell line. Biochemistry 43, 10851–10858.

Pi, H.-J., Hangya, B., Kvitsiani, D., Sanders, J.I., Huang, Z.J., Kepecs, A., 2013. Cortical interneurons that specialize in disinhibitory control. Nature 503, 521–524.

Pinard, C.R., Mascagni, F., McDonald, A.J., 2012. Medial prefrontal cortical innervation of the intercalated nuclear region of the amygdala. Neuroscience 205, 112–124.

Plessow, F., Fischer, R., Kirschbaum, C., Goschke, T., 2011. Inflexibly focused under stress: acute psychosocial stress increases shielding of action goals at the expense of reduced cognitive flexibility with increasing time lag to the stressor. J. Cogn. Neurosci. 23, 3218– 3227.

Plessow, F., Kiesel, A., Kirschbaum, C., 2012. The stressed prefrontal cortex and goal-directed behaviour: acute psychosocial stress impairs the flexible implementation of task goals. Exp. brain Res. 216, 397–408.

Popoli, M., Yan, Z., McEwen, B.S., Sanacora, G., 2012. The stressed synapse: the impact of stress and glucocorticoids on glutamate transmission. Nat. Rev. Neurosci. 13, 22–37.

Prager, E.M., Johnson, L.R., 2009. Stress at the synapse: signal transduction mechanisms of adrenal steroids at neuronal membranes. Sci. Signal. 2, re5.

Pratt, W.B., Dittmar, K.D., 1998. Studies with Purified Chaperones Advance the Understanding of the Mechanism of Glucocorticoid Receptor-hsp90 Heterocomplex Assembly. Trends Endocrinol. Metab. 9, 244–252.

Price, J.L., Drevets, W.C., 2012. Neural circuits underlying the pathophysiology of mood disorders. Trends Cogn. Sci. 16, 61–71.

Przybycien-Szymanska, M.M., Mott, N.N., Pak, T.R., 2011. Alcohol dysregulates corticotropin- releasing-hormone (CRH) promoter activity by interfering with the negative glucocorticoid response element (nGRE). PLoS One 6, e26647.

Quirarte, G.L., Roozendaal, B., McGaugh, J.L., 1997. Glucocorticoid enhancement of memory storage involves noradrenergic activation in the basolateral amygdala. Proc. Natl. Acad. Sci. U. S. A. 94, 14048–14053.

149

Radley, J.J., Arias, C.M., Sawchenko, P.E., 2006a. Regional differentiation of the medial prefrontal cortex in regulating adaptive responses to acute emotional stress. J. Neurosci. 26, 12967–12976.

Radley, J.J., Gosselink, K.L., Sawchenko, P.E., 2009. A discrete GABAergic relay mediates medial prefrontal cortical inhibition of the neuroendocrine stress response. J. Neurosci. 29, 7330–7340.

Radley, J.J., Morrison, J.H., 2005. Repeated stress and structural plasticity in the brain. Ageing Res. Rev. 4, 271–287.

Radley, J.J., Rocher, A.B., Miller, M., Janssen, W.G.M., Liston, C., Hof, P.R., McEwen, B.S., Morrison, J.H., 2006b. Repeated stress induces dendritic spine loss in the rat medial prefrontal cortex. Cereb. Cortex 16, 313–320.

Radley, J.J., Rocher, A.B., Rodriguez, A., Ehlenberger, D.B., Dammann, M., McEwen, B.S., Morrison, J.H., Wearne, S.L., Hof, P.R., 2008. Repeated stress alters dendritic spine morphology in the rat medial prefrontal cortex. J. Comp. Neurol. 507, 1141–1150.

Radley, J.J., Sawchenko, P.E., 2011. A common substrate for prefrontal and hippocampal inhibition of the neuroendocrine stress response. J. Neurosci. 31, 9683–9695.

Radley, J.J., Sisti, H.M., Hao, J., Rocher, A.B., McCall, T., Hof, P.R., McEwen, B.S., Morrison, J.H., 2004. Chronic behavioral stress induces apical dendritic reorganization in pyramidal neurons of the medial prefrontal cortex. Neuroscience 125, 1–6.

Ragozzino, M.E., Wilcox, C., Raso, M., Kesner, R.P., 1999. Involvement of rodent prefrontal cortex subregions in strategy switching. Behav. Neurosci. 113, 32–41.

Rajkowska, G., Miguel-Hidalgo, J.J., Wei, J., Dilley, G., Pittman, S.D., Meltzer, H.Y., Overholser, J.C., Roth, B.L., Stockmeier, C.A., 1999. Morphometric evidence for neuronal and glial prefrontal cell pathology in major depression. Biol. Psychiatry 45, 1085–1098.

Resstel, L.B.M., Correa, F.M.A., 2006. Medial prefrontal cortex NMDA receptors and nitric oxide modulate the parasympathetic component of the baroreflex. Eur. J. Neurosci. 23, 481–488.

Resstel, L.B.M., Fernandes, K.B.P., Correa, F.M.A., 2004. Medial prefrontal cortex modulation of the baroreflex parasympathetic component in the rat. Brain Res. 1015, 136–144.

Reul, J.M., de Kloet, E.R., 1985. Two receptor systems for corticosterone in rat brain: microdistribution and differential occupation. Endocrinology 117, 2505–2511.

Reul, J.M., de Kloet, E.R., 1986. Anatomical resolution of two types of corticosterone receptor sites in rat brain with in vitro autoradiography and computerized image analysis. J. Steroid Biochem. 24, 269–272.

Ridder, S., Chourbaji, S., Hellweg, R., Urani, A., Zacher, C., Schmid, W., Zink, M., Hortnagl, H., Flor, H., Henn, F.A., Schutz, G., Gass, P., 2005. Mice with genetically altered

150

glucocorticoid receptor expression show altered sensitivity for stress-induced depressive reactions. J. Neurosci. 25, 6243–6250.

Rivier, C., Brownstein, M., Spiess, J., Rivier, J., Vale, W., 1982. In vivo corticotropin-releasing factor-induced secretion of adrenocorticotropin, beta-endorphin, and corticosterone. Endocrinology 110, 272–278.

Rivier, C., Vale, W., 1983a. Modulation of stress-induced ACTH release by corticotropin- releasing factor, catecholamines and vasopressin. Nature 305, 325–327.

Rivier, C., Vale, W., 1983b. Interaction of corticotropin-releasing factor and arginine vasopressin on adrenocorticotropin secretion in vivo. Endocrinology 113, 939–942.

Rogers, M.A., Kasai, K., Koji, M., Fukuda, R., Iwanami, A., Nakagome, K., Fukuda, M., Kato, N., 2004. Executive and prefrontal dysfunction in unipolar depression: a review of neuropsychological and imaging evidence. Neurosci. Res. 50, 1–11.

Roland, B.L., Sawchenko, P.E., 1993. Local origins of some GABAergic projections to the paraventricular and supraoptic nuclei of the hypothalamus in the rat. J. Comp. Neurol. 332, 123–143.

Roozendaal, B., 2000. 1999 Curt P. Richter award. Glucocorticoids and the regulation of memory consolidation. Psychoneuroendocrinology 25, 213–238.

Roozendaal, B., McGaugh, J.L., 2011. Memory modulation. Behav. Neurosci. 125, 797–824.

Roozendaal, B., McReynolds, J.R., McGaugh, J.L., 2004. The basolateral amygdala interacts with the medial prefrontal cortex in regulating glucocorticoid effects on working memory impairment. J. Neurosci. 24, 1385–1392.

Roozendaal, B., Okuda, S., de Quervain, D.J.-F., McGaugh, J.L., 2006. Glucocorticoids interact with emotion-induced noradrenergic activation in influencing different memory functions. Neuroscience 138, 901–910.

Roozendaal, B., Okuda, S., Van der Zee, E.A., McGaugh, J.L., 2006. Glucocorticoid enhancement of memory requires arousal-induced noradrenergic activation in the basolateral amygdala. Proc. Natl. Acad. Sci. U. S. A. 103, 6741–6746.

Roozendaal, B., Quirarte, G.L., McGaugh, J.L., 2002. Glucocorticoids interact with the basolateral amygdala beta-adrenoceptor--cAMP/cAMP/PKA system in influencing memory consolidation. Eur. J. Neurosci. 15, 553–560.

Roozendaal, B., Schelling, G., McGaugh, J.L., 2008. Corticotropin-releasing factor in the basolateral amygdala enhances memory consolidation via an interaction with the beta- adrenoceptor-cAMP pathway: dependence on glucocorticoid receptor activation. J. Neurosci. 28, 6642–6651.

Rose, E.J., Ebmeier, K.P., 2006. Pattern of impaired working memory during major depression. J. Affect. Disord. 90, 149–161.

151

Rosenkranz, J.A., Grace, A.A., 2002. Cellular mechanisms of infralimbic and prelimbic prefrontal cortical inhibition and dopaminergic modulation of basolateral amygdala neurons in vivo. J. Neurosci. 22, 324–337.

Rozeboom, A.M., Akil, H., Seasholtz, A.F., 2007. Mineralocorticoid receptor overexpression in forebrain decreases anxiety-like behavior and alters the stress response in mice. Proc. Natl. Acad. Sci. U. S. A. 104, 4688–4693.

Rush, A.J., Trivedi, M.H., Wisniewski, S.R., Nierenberg, A.A., Stewart, J.W., Warden, D., Niederehe, G., Thase, M.E., Lavori, P.W., Lebowitz, B.D., McGrath, P.J., Rosenbaum, J.F., Sackeim, H.A., Kupfer, D.J., Luther, J., Fava, M., 2006. Acute and longer-term outcomes in depressed outpatients requiring one or several treatment steps: a STAR*D report. Am. J. Psychiatry 163, 1905–1917.

Ryan, M.C.M., Sharifi, N., Condren, R., Thakore, J.H., 2004. Evidence of basal pituitary-adrenal overactivity in first episode, drug naive patients with schizophrenia. Psychoneuroendocrinology 29, 1065–1070.

Saffran, M., Schally, A. V, 1956. Effect of histamine, hog vasopressin, and corticotropin- releasing factor (CRF) on ACTH release in vitro. Proc. Soc. Exp. Biol. Med. 92, 636–637.

Sanacora, G., Treccani, G., Popoli, M., 2012. Towards a glutamate hypothesis of depression: an emerging frontier of neuropsychopharmacology for mood disorders. Neuropharmacology 62, 63–77.

Sanchez-Navarro, J.P., Driscoll, D., Anderson, S.W., Tranel, D., Bechara, A., Buchanan, T.W., 2014. Alterations of attention and emotional processing following childhood-onset damage to the prefrontal cortex. Behav. Neurosci. 128, 1–11.

Sandi, C., 2011. Glucocorticoids act on glutamatergic pathways to affect memory processes. Trends Neurosci. 34, 165–176.

Sandi, C., Loscertales, M., Guaza, C., 1997. Experience-dependent facilitating effect of corticosterone on spatial memory formation in the water maze. Eur. J. Neurosci. 9, 637– 642.

Santamaria, J., Tolosa, E., Valles, A., 1986. Parkinson’s disease with depression: a possible subgroup of idiopathic parkinsonism. Neurology 36, 1130–1133.

Sara, Y., Virmani, T., Deak, F., Liu, X., Kavalali, E.T., 2005. An isolated pool of vesicles recycles at rest and drives spontaneous neurotransmission. Neuron 45, 563–573.

Sarabdjitsingh, R.A., Conway-Campbell, B.L., Leggett, J.D., Waite, E.J., Meijer, O.C., de Kloet, E.R., Lightman, S.L., 2010. Stress responsiveness varies over the ultradian glucocorticoid cycle in a brain-region-specific manner. Endocrinology 151, 5369–5379.

Sarabdjitsingh, R.A., Joels, M., de Kloet, E.R., 2012. Glucocorticoid pulsatility and rapid corticosteroid actions in the central stress response. Physiol. Behav. 106, 73–80.

152

Sawchenko, P.E., Swanson, L.W., Vale, W.W., 1984. Co-expression of corticotropin-releasing factor and vasopressin immunoreactivity in parvocellular neurosecretory neurons of the adrenalectomized rat. Proc. Natl. Acad. Sci. U. S. A. 81, 1883–1887.

Schelling, G., Briegel, J., Roozendaal, B., Stoll, C., Rothenhausler, H.B., Kapfhammer, H.P., 2001. The effect of stress doses of hydrocortisone during septic shock on posttraumatic stress disorder in survivors. Biol. Psychiatry 50, 978–985.

Schelling, G., Stoll, C., Kapfhammer, H.P., Rothenhausler, H.B., Krauseneck, T., Durst, K., Haller, M., Briegel, J., 1999. The effect of stress doses of hydrocortisone during septic shock on posttraumatic stress disorder and health-related quality of life in survivors. Crit. Care Med. 27, 2678–2683.

Schmidt, M. V., Abraham, W.C., Maroun, M., Stork, O., Richter-Levin, G., 2013. Stress-induced metaplasticity: From synapses to behavior. Neuroscience 250, 112–120.

Schneggenburger, R., Meyer, A.C., Neher, E., 1999. Released fraction and total size of a pool of immediately available transmitter quanta at a calyx synapse. Neuron 23, 399–409.

Schnyer, D.M., Maddox, W.T., Ell, S., Davis, S., Pacheco, J., Verfaellie, M., 2009. Prefrontal contributions to rule-based and information-integration category learning. Neuropsychologia 47, 2995–3006.

Schwabe, L., Tegenthoff, M., Hoffken, O., Wolf, O.T., 2013. Mineralocorticoid receptor blockade prevents stress-induced modulation of multiple memory systems in the human brain. Biol. Psychiatry 74, 801–808.

Schwartz, M.W., Woods, S.C., Porte, D.J., Seeley, R.J., Baskin, D.G., 2000. Central nervous system control of food intake. Nature 404, 661–671.

Scopinho, A.A., Scopinho, M., Lisboa, S.F., Correa, F.M. de A., Guimaraes, F.S., Joca, S.R.L., 2010. Acute reversible inactivation of the ventral medial prefrontal cortex induces antidepressant-like effects in rats. Behav. Brain Res. 214, 437–442.

Seamans, J.K., Floresco, S.B., Phillips, A.G., 1995. Functional differences between the prelimbic and anterior cingulate regions of the rat prefrontal cortex. Behav. Neurosci. 109, 1063–1073.

Seeley, R.J., Woods, S.C., 2003. Monitoring of stored and available fuel by the CNS: implications for obesity. Nat. Rev. Neurosci. 4, 901–909.

Seib, L.M., Wellman, C.L., 2003. Daily injections alter spine density in rat medial prefrontal cortex. Neurosci. Lett. 337, 29–32.

Selemon, L.D., 2013. A role for synaptic plasticity in the adolescent development of executive function. Transl. Psychiatry 3, e238.

Selye, H., 1936. A syndrome produced by diverse nocuous agents. Nature 138, 32–32.

153

Shad, M.U., Muddasani, S., Prasad, K., Sweeney, J.A., Keshavan, M.S., 2004. Insight and prefrontal cortex in first-episode Schizophrenia. Neuroimage 22, 1315–1320.

Shansky, R.M., Lipps, J., 2013. Stress-induced cognitive dysfunction: hormone-neurotransmitter interactions in the prefrontal cortex. Front. Hum. Neurosci. 7, 123.

Sharma, A.C., Kulkarni, S.K., 1990. Evidence for GABA-BZ receptor modulation in short-term memory passive avoidance task paradigm in mice. Methods Find. Exp. Clin. Pharmacol. 12, 175–180.

Sharma, A.C., Kulkarni, S.K., 1993. (+/-)Baclofen sensitive scopolamine-induced short-term memory deficits in mice. Indian J. Exp. Biol. 31, 348–352.

Skolnick, P., Popik, P., Trullas, R., 2009. Glutamate-based antidepressants: 20 years on. Trends Pharmacol. Sci. 30, 563–569.

Sliva, K., Schnierle, B.S., 2010. Selective gene silencing by viral delivery of short hairpin RNA. Virol. J. 7, 248.

Soares, J.M., Sampaio, A., Ferreira, L.M., Santos, N.C., Marques, F., Palha, J.A., Cerqueira, J.J., Sousa, N., 2012. Stress-induced changes in human decision-making are reversible. Transl. Psychiatry 2, e131.

Sotres-Bayon, F., Quirk, G.J., 2010. Prefrontal control of fear: more than just extinction. Curr. Opin. Neurobiol. 20, 231–235.

Spiess, J., Rivier, J., Rivier, C., Vale, W., 1981. Primary structure of corticotropin-releasing factor from ovine hypothalamus. Proc. Natl. Acad. Sci. U. S. A. 78, 6517–6521.

Stalnaker, T.A., Takahashi, Y., Roesch, M.R., Schoenbaum, G., 2009. Neural substrates of cognitive inflexibility after chronic cocaine exposure. Neuropharmacology 56 Suppl 1, 63– 72.

Starcke, K., Brand, M., 2012. Decision making under stress: a selective review. Neurosci. Biobehav. Rev. 36, 1228–1248.

Stordal, K.I., Lundervold, A.J., Egeland, J., Mykletun, A., Asbjornsen, A., Landro, N.I., Roness, A., Rund, B.R., Sundet, K., Oedegaard, K.J., Lund, A., 2004. Impairment across executive functions in recurrent major depression. Nord. J. Psychiatry 58, 41–47.

Sudheimer, K.D., Abelson, J.L., Taylor, S.F., Martis, B., Welsh, R.C., Warner, C., Samet, M., Manduzzi, A., Liberzon, I., 2013. Exogenous glucocorticoids decrease subgenual cingulate activity evoked by sadness. Neuropsychopharmacology 38, 826–845.

Sullivan, R.M., Gratton, A., 1999. Lateralized effects of medial prefrontal cortex lesions on neuroendocrine and autonomic stress responses in rats. J. Neurosci. 19, 2834–2840.

154

Swanson, A.M., Shapiro, L.P., Whyte, A.J., Gourley, S.L., 2013. Glucocorticoid receptor regulation of action selection and prefrontal cortical dendritic spines. Commun. Integr. Biol. 6, e26068.

Swanson, L.W., Sawchenko, P.E., Rivier, J., Vale, W.W., 1983. Organization of ovine corticotropin-releasing factor immunoreactive cells and fibers in the rat brain: an immunohistochemical study. Neuroendocrinology 36, 165–186.

Tasker, J.G., Herman, J.P., 2011. Mechanisms of rapid glucocorticoid feedback inhibition of the hypothalamic-pituitary-adrenal axis. Stress 14, 398–406.

Tavares, R.F., Correa, F.M.A., Resstel, L.B.M., 2009. Opposite role of infralimbic and prelimbic cortex in the tachycardiac response evoked by acute restraint stress in rats. J. Neurosci. Res. 87, 2601–2607.

Teng, Z., Zhang, M., Zhao, M., Zhang, W., 2013. Glucocorticoid exerts its non-genomic effect on IPSC by activation of a phospholipase C-dependent pathway in prefrontal cortex of rats. J. Physiol. 591, 3341–53.

Treccani, G., Musazzi, L., Perego, C., Milanese, M., Nava, N., Bonifacino, T., Lamanna, J., Malgaroli, a, Drago, F., Racagni, G., Nyengaard, J.R., Wegener, G., Bonanno, G., Popoli, M., 2014a. Stress and corticosterone increase the readily releasable pool of glutamate vesicles in synaptic terminals of prefrontal and frontal cortex. Mol. Psychiatry 19, 433–43.

Treccani, G., Musazzi, L., Perego, C., Milanese, M., Nava, N., Bonifacino, T., Lamanna, J., Malgaroli, A., Drago, F., Racagni, G., Nyengaard, J.R., Wegener, G., Bonanno, G., Popoli, M., 2014b. Acute stress rapidly increases the readily releasable pool of glutamate vesicles in prefrontal and frontal cortex through non-genomic action of corticosterone. Mol. Psychiatry 19, 401.

Tsuchida, A., Fellows, L.K., 2013. Are core component processes of executive function dissociable within the frontal lobes? Evidence from humans with focal prefrontal damage. Cortex. 49, 1790–1800.

Uematsu, M., Hirai, Y., Karube, F., Ebihara, S., Kato, M., Abe, K., Obata, K., Yoshida, S., Hirabayashi, M., Yanagawa, Y., Kawaguchi, Y., 2008. Quantitative chemical composition of cortical GABAergic neurons revealed in transgenic venus-expressing rats. Cereb. Cortex 18, 315–330.

Ulrich-Lai, Y.M., Herman, J.P., 2009. Neural regulation of endocrine and autonomic stress responses. Nat. Rev. Neurosci. 10, 397–409.

Uylings, H.B.M., Groenewegen, H.J., Kolb, B., 2003. Do rats have a prefrontal cortex? Behav. Brain Res. 146, 3–17.

Vahl, T.P., Ulrich-Lai, Y.M., Ostrander, M.M., Dolgas, C.M., Elfers, E.E., Seeley, R.J., D’Alessio, D.A., Herman, J.P., 2005. Comparative analysis of ACTH and corticosterone sampling methods in rats. Am. J. Physiol. Endocrinol. Metab. 289, E823–8.

155

Vale, W., Spiess, J., Rivier, C., Rivier, J., 1981. Characterization of a 41-residue ovine hypothalamic peptide that stimulates secretion of corticotropin and beta-endorphin. Science 213, 1394–1397.

Vale, W., Vaughan, J., Smith, M., Yamamoto, G., Rivier, J., Rivier, C., 1983. Effects of synthetic ovine corticotropin-releasing factor, glucocorticoids, catecholamines, neurohypophysial peptides, and other substances on cultured corticotropic cells. Endocrinology 113, 1121– 1131.

Van Ast, V.A., Cornelisse, S., Meeter, M., Joels, M., Kindt, M., 2013. Time-dependent effects of cortisol on the contextualization of emotional memories. Biol. Psychiatry 74, 809–816.

Van Horn, J.D., Irimia, A., Torgerson, C.M., Chambers, M.C., Kikinis, R., Toga, A.W., 2012. Mapping connectivity damage in the case of Phineas Gage. PLoS One 7, e37454.

Van Marle, H.J.F., Hermans, E.J., Qin, S., Overeem, S., Fernandez, G., 2013. The effect of exogenous cortisol during sleep on the behavioral and neural correlates of emotional memory consolidation in humans. Psychoneuroendocrinology 38, 1639–1649.

Van Rossum, E.F.C., Binder, E.B., Majer, M., Koper, J.W., Ising, M., Modell, S., Salyakina, D., Lamberts, S.W.J., Holsboer, F., 2006. Polymorphisms of the glucocorticoid receptor gene and major depression. Biol. Psychiatry 59, 681–688.

Van Rossum, E.F.C., Koper, J.W., van den Beld, A.W., Uitterlinden, A.G., Arp, P., Ester, W., Janssen, J.A.M.J.L., Brinkmann, A.O., de Jong, F.H., Grobbee, D.E., Pols, H.A.P., Lamberts, S.W.J., 2003. Identification of the BclI polymorphism in the glucocorticoid receptor gene: association with sensitivity to glucocorticoids in vivo and body mass index. Clin. Endocrinol. (Oxf). 59, 585–592.

Ventura, J., Nuechterlein, K.H., Lukoff, D., Hardesty, J.P., 1989. A prospective study of stressful life events and schizophrenic relapse. J. Abnorm. Psychol. 98, 407–411.

Verberne, A.J., 1996. Medullary sympathoexcitatory neurons are inhibited by activation of the medial prefrontal cortex in the rat. Am. J. Physiol. 270, R713–9.

Verberne, A.J., Lam, W., Owens, N.C., Sartor, D., 1997. Supramedullary modulation of sympathetic vasomotor function. Clin. Exp. Pharmacol. Physiol. 24, 748–754.

Vertes, R.P., 2004. Differential projections of the infralimbic and prelimbic cortex in the rat. Synapse 51, 32–58.

Vyas, A., Mitra, R., Shankaranarayana Rao, B.S., Chattarji, S., 2002. Chronic stress induces contrasting patterns of dendritic remodeling in hippocampal and amygdaloid neurons. J. Neurosci. 22, 6810–6818.

Warden, M.R., Selimbeyoglu, A., Mirzabekov, J.J., Lo, M., Thompson, K.R., Kim, S.-Y., Adhikari, A., Tye, K.M., Frank, L.M., Deisseroth, K., 2012. A prefrontal cortex-brainstem neuronal projection that controls response to behavioural challenge. Nature 492, 428–432.

156

Waters-Wood, S.M., Xiao, L., Denburg, N.L., Hernandez, M., Bechara, A., 2012. Failure to learn from repeated mistakes: persistent decision-making impairment as measured by the iowa gambling task in patients with ventromedial prefrontal cortex lesions. J. Int. Neuropsychol. Soc. 18, 927–930.

Webster, M.J., Knable, M.B., O’Grady, J., Orthmann, J., Weickert, C.S., 2002. Regional specificity of brain glucocorticoid receptor mRNA alterations in subjects with schizophrenia and mood disorders. Mol. Psychiatry 7, 924,985–994.

Wei, Q., Lu, X.-Y., Liu, L., Schafer, G., Shieh, K.-R., Burke, S., Robinson, T.E., Watson, S.J., Seasholtz, A.F., Akil, H., 2004. Glucocorticoid receptor overexpression in forebrain: a mouse model of increased emotional lability. Proc. Natl. Acad. Sci. U. S. A. 101, 11851– 11856.

Wellman, C.L., 2001. Dendritic reorganization in pyramidal neurons in medial prefrontal cortex after chronic corticosterone administration. J. Neurobiol. 49, 245–253.

Wen, L., Lu, Y.-S., Zhu, X.-H., Li, X.-M., Woo, R.-S., Chen, Y.-J., Yin, D.-M., Lai, C., Terry, A.V.J., Vazdarjanova, A., Xiong, W.-C., Mei, L., 2010. Neuregulin 1 regulates pyramidal neuron activity via ErbB4 in parvalbumin-positive interneurons. Proc. Natl. Acad. Sci. U. S. A. 107, 1211–1216.

Wikstrom, A.-C., 2003. Glucocorticoid action and novel mechanisms of steroid resistance: role of glucocorticoid receptor-interacting proteins for glucocorticoid responsiveness. J. Endocrinol. 178, 331–337.

Woods, S.C., Seeley, R.J., Porte, D.J., Schwartz, M.W., 1998. Signals that regulate food intake and energy homeostasis. Science 280, 1378–1383.

Wulsin, A.C., Herman, J.P., Solomon, M.B., 2010. Mifepristone decreases depression-like behavior and modulates neuroendocrine and central hypothalamic-pituitary-adrenocortical axis responsiveness to stress. Psychoneuroendocrinology 35, 1100–1112.

Yehuda, R., Halligan, S.L., Golier, J.A., Grossman, R., Bierer, L.M., 2004. Effects of trauma exposure on the cortisol response to dexamethasone administration in PTSD and major depressive disorder. Psychoneuroendocrinology 29, 389–404.

Yehuda, R., Teicher, M.H., Trestman, R.L., Levengood, R.A., Siever, L.J., 1996. Cortisol regulation in posttraumatic stress disorder and major depression: a chronobiological analysis. Biol. Psychiatry 40, 79–88.

Young, E.A., Abelson, J., Lightman, S.L., 2004. Cortisol pulsatility and its role in stress regulation and health. Front. Neuroendocrinol. 25, 69–76.

Yuen, E.Y., Liu, W., Karatsoreos, I.N., Feng, J., McEwen, B.S., Yan, Z., 2009. Acute stress enhances glutamatergic transmission in prefrontal cortex and facilitates working memory. Proc. Natl. Acad. Sci. U. S. A. 106, 14075–14079.

157

Yuen, E.Y., Liu, W., Karatsoreos, I.N., Ren, Y., Feng, J., McEwen, B.S., Yan, Z., 2011. Mechanisms for acute stress-induced enhancement of glutamatergic transmission and working memory. Mol. Psychiatry 16, 156–170.

Yuen, E.Y., Wei, J., Liu, W., Zhong, P., Li, X., Yan, Z., 2012. Repeated stress causes cognitive impairment by suppressing glutamate receptor expression and function in prefrontal cortex. Neuron 73, 962–977.

Zahrt, J., Taylor, J.R., Mathew, R.G., Arnsten, A.F., 1997. Supranormal stimulation of D1 dopamine receptors in the rodent prefrontal cortex impairs spatial working memory performance. J. Neurosci. 17, 8528–8535.

Zarrindast, M.R., Bakhsha, A., Rostami, P., Shafaghi, B., 2002. Effects of intrahippocampal injection of GABAergic drugs on memory retention of passive avoidance learning in rats. J. Psychopharmacol. 16, 313–319.

Zarrindast, M.R., Shamsi, T., Azarmina, P., Rostami, P., Shafaghi, B., 2004. GABAergic system and imipramine-induced impairment of memory retention in rats. Eur. Neuropsychopharmacol. 14, 59–64.

Zheng, G., Zhang, X., Chen, Y., Zhang, Y., Luo, W., Chen, J., 2007. Evidence for a role of GABAA receptor in the acute restraint stress-induced enhancement of spatial memory. Brain Res. 1181, 61–73.

Ziegler, D.R., Edwards, M.R., Ulrich-Lai, Y.M., Herman, J.P., Cullinan, W.E., 2012. Brainstem origins of glutamatergic innervation of the rat hypothalamic paraventricular nucleus. J. Comp. Neurol. 520, 2369–2394.

Zobel, A.W., Yassouridis, A., Frieboes, R.M., Holsboer, F., 1999. Prediction of medium-term outcome by cortisol response to the combined dexamethasone-CRH test in patients with remitted depression. Am. J. Psychiatry 156, 949–951.

158