Transcriptomic Changes Throughout Post-Hatch Development in Gallus Gallus Pituitary

58:1

e m pritchett and others Chicken pituitary transcriptome 58: 1 43–55 Research

Open Access

Transcriptomic changes throughout post-hatch development in Gallus gallus pituitary

Correspondence 1 2 1 Elizabeth M Pritchett , Susan J Lamont and Carl J Schmidt should be addressed 1Animal and Food Science, University of Delaware, Newark, Delaware, USA to E M Pritchett 2Animal Science, Iowa State University, Ames, Iowa, USA Email [email protected]

Abstract

The pituitary gland is a neuroendocrine organ that works closely with the hypothalamus to affect multiple processes within the body including the stress response, metabolism, Key Words growth and immune function. Relative tissue expression (rEx) is a transcriptome analysis ff chicken method that compares the genes expressed in a particular tissue to the genes expressed ff pituitary in all other tissues with available data. Using rEx, the aim of this study was to identify ff gene expression genes that are uniquely or more abundantly expressed in the pituitary when compared ff development to all other collected chicken tissues. We applied rEx to define genes enriched in the chicken pituitaries at days 21, 22 and 42 post-hatch. rEx analysis identified 25 genes shared between all time points, 295 genes shared between days 21 and 22 and 407 genes unique to day 42. The 25 genes shared by all time points are involved in morphogenesis and general nervous tissue development. The 295 shared genes between days 21 and 22 are involved in neurogenesis and nervous system development and differentiation.

Journal of Molecular Endocrinology The 407 unique day 42 genes are involved in pituitary development, endocrine system development and other hormonally related gene ontology terms. Overall, rEx analysis indicates a focus on nervous system/tissue development at days 21 and 22. By day 42, in addition to nervous tissue development, there is expression of genes involved in the endocrine system, possibly for maturation and preparation for reproduction. This study defines the transcriptome of the chicken pituitary gland and aids in understanding the Journal of Molecular expressed genes critical to its function and maturation. Endocrinology (2017) 58, 43–55

Introduction

The avian pituitary gland is a neuroendocrine organ that (i.e. adrenocorticotropic hormone (ACTH)). The posterior works closely with the hypothalamus to regulate multiple pituitary gland, or the neurohypophysis, is composed processes within the body including the stress response, of nervous tissue and is connected to the hypothalamus reproduction, metabolism, growth and immune function. via the median eminence. Neurosecretory terminals The hypothalamus receives neuronal and endocrine within the posterior pituitary store and release arginine, signals from the brain and body and synthesizes releasing vasotocin (AVT) and mesotocin that are synthesized in hormones that are sent to the pituitary gland to either the supraoptic nucleus and paraventricular nucleus of inhibit or stimulate the production of several hormones the hypothalamus, respectively. Releasing hormones that will directly affect other tissues (i.e. growth hormone synthesized by the hypothalamus are transported to the (GH)) or stimulate the release of further protein products anterior pituitary gland through the hypophyseal blood

http://jme.endocrinology-journals.org © 2017 The authors This work is licensed under a Creative Commons DOI: 10.1530/JME-16-0186 Published by Bioscientifica Ltd. Attribution 3.0 Unported License. Printed in Great Britain Downloaded from Bioscientifica.com at 09/26/2021 01:57:36AM via free access

10.1530/JME-16-0186 Journal of Molecular Endocrinology the QiagenRNeasyMiniKit (Germantown,MD,USA). (8–20 Total glands RNAwas extractedfromwholepituitary preparation andqRT-PCR validation RNA isolation,cDNAsynthesis,Rnaseqlibrary stored at−80°Cuntilfurtheranalysis. Whole pituitarieswereplacedintoliquidnitrogenand on 21,22and42 days post-hatchaspartofalargerstudy. were humanelykilledandthepituitariescollected animals had Research Council 1994 feed (corn-soy),whichmetallNRCrequirements( Committee (AACUC#(27)03-12-14R).Standardbroiler procedures asapprovedbytheAnimalCareandUse andmanagementfollowedallstandards and Husbandry on theUniversityofDelawarefarm(Newark,DE,USA). (Millsboro, DE, USA) and placed in large-colony houses obtained onthedayofhatchfromMountaireHatchery Male Ross708broilerchickens( Animal housingandtissuecollection Materials andmethods gland. critical tothefunctionofpituitary a betterunderstandingofthegenesandpathwaysthatare tissue atspecificpointsindevelopment.Thesedataconfer either moreabundantorareuniquetothisparticular glandthatare expression levelsofgenesinthepituitary tissue plasticity. Theresultsofthisanalysisidentifythe lead tomanychangeswithinthetissueandresultsin gland networks. Themessagesreceivedbythepituitary sent throughneuralendocrine,paracrineandautocrine that itcontainsmanydifferentcelltypes,andsignalsare our laboratory. glandisacomplextissuein Thepituitary chosen aspartofalargerheatstressstudyconductedin fall intothesecondgrowthphase.Thesedayswerealso typical marketage(Schmidt hatch throughday14,andonefrom14to42or identified twodistinctgrowthperiods:onefromdayof the morphometricchangesofbroilerchickenspost-hatch days 21,22and42post-hatch.Previousworkfocusingon analyzed inthebroilerchickenacrossthreetimepoints: has the transcriptome of all other tissues our laboratory gland transcriptome to to comparethe chicken pituitary TSH). Relativetissueexpressionanalysis(rEx)wasused various endocrinehormones(ACTH,GH,LH,FSHand portal systemandregulatetheproductionreleaseof DOI: 10.1530/JME-16-0186 http://jme.endocrinology-journals.org Research mg dependingonage)from individualbirdsusing ad libitum accessthroughoutthetrial.Birds ), and water were supplied, and et al . 2009).Thedaysdiscussed e

pritchett Gallus gallus Printed inGreatBritain andothers National ) were

(FPKM) valuesforfurtheranalysis( as fragments per kilobase of gene per million mapped reads Tophat andCufflinks,expressionlevelswerereported identified andcountedusingsoftwarepackagesBowtie, aligned tothe depth of20–30 HiSeq 2500sequencer. Alllibrariesweresequencedtoa Sequencing andGenotypingcenterusingtheIllumina sequenced attheDelawareBiotechnologyInstitute(DBI) RNAseq kit (San Diego, CA, USA). All 35 samples were preparation using the Illumina Stranded Rnaseq library from day22and1042wereusedforindividual glandsfromday21,10 analysis. Atotalof15pituitary Fluorometer, and quality was assessed by fragment Total RNAquantitywasmeasuredusingaQubit tissues withthefollowingcalculation: median FPKMvalueofeach geneinallothercollected glandwere comparedtothe for eachgeneinthepituitary was analyzedindependently, andmaximum FPKMvalues and coworkers( relative tissue expression (rEx) protocol outlined by Bailey followingthe hypothalamus) analyzedbyourlaboratory duodenum, jejunum,ileum,spleen,retina,pinealand heart fatpad,breastmuscle,cerebellum,heart,liver, to theexpressionofothertissues(abdominalfatpad, gland wascompared The geneexpressionofthepituitary Relative tissueexpression analysis GSE89297. are accessiblethroughGEOseries,accessionnumber in theNCBIGeneExpressionOmnibusapplicationand data generatedinthecurrentprojecthavebeenuploaded was completedusingthedeltaCtmethod.Allsequencing qRT-PCR ( ( hormone ( System forRT-PCR (Invitrogen).cDNAconcentration synthesis using the SuperScript First-Strand Synthesis for eachday(day21,22and42)wereusedcDNA Langmead &Salzberg2012 ( for thefollowinggenes:glycoproteinalphasubunit Applied Biosystems7500FastReal-Time PCRsystem SYBR greenmastermix(AppliedBiosystems)onthe to 30 was determinedusingtheQubitFluorometeranddiluted Chicken pituitarytranscriptome lo PRL CGA Published byBioscientifica Ltd. g 2 ) andthyroid-stimulatinghormonebeta( Median ), follicle-stimulatinghormonebeta( ng/µL forPCR.qRT-PCR wasperformedusingFast Maximum Table 1 GH FPK ), proopiomelanocortin( Bailey million readsperlibrary. Thereadswere Mf Gallus gallus ) was performed in triplicate, and analysis FPK or Mf ea et al c or hhg Downloaded fromBioscientifica.com at09/26/202101:57:36AM . 2009 each en ). Threebiologicalreplicates ei , ver4genomesequence, na gene ). Eachdaytheexpression ll othe in Trapnell pituitary 58 rc POMC : ollected 1 FSHB gland TSHB t al et ), prolactin tissues ), growth . 2009 ). Each 44

(1) via freeaccess , Research e m pritchett and others Chicken pituitary transcriptome 58:1 45

Table 1 Primer sequences used for qRT-PCR transcriptome validation.

Gene Forward primer Reverse primer CGA 5′ GCAACGTGCTGTGTAGCAAAG 3′ 5′ TGGTTCTCTATCTTCACATTGCCTT 3′ FSHB 5′ CGTACAGGGTAGAGCCAACGA 3′ 5′ GGCCCTCAAAAGGCTGAAC 3′ GH 5′ GCTTCAAGAAGGATCTGCACAA 3′ 5′ GCGCCGGCACTTCATC 3′ POMC 5′ GCTACGGCGGCTTCATGA 3′ 5′ CGATGACGTTTTTGAACAGA 3′ PRL 5′ TTGGGCGGGTTCATTCTG 3′ 5′ GGCCGTCCCAGTGAGAGTAA 3′ TSHB 5′ TGGCCATCAACACCACCAT 3′ 5′ CGTTGCTGTCCCGTGTCA 3′

Primer sequences used in qRT-PCR validation of transcriptomic data comparing expression levels between days 21, 22 and 42. Alpha subunit of glycoproteins (CGA), follicle-stimulating hormone, beta (FSHB), growth hormone (GH), proopiomelanocortin (POMC), prolactin (PRL) and thyroid-stimulating hormone, beta (TSHB).

The log2 distribution was used to normalize the 295 shared genes are neuron cell–cell adhesion (4 genes), data and apply a t-test. Resulting genes that were greater oligodendrocyte differentiation (8 genes) and regulation than two standard deviations from the mean and with of gliogenesis (9 genes). Figure 2 shows PathRings output a P value less than 0.05 were considered enriched in the for 295 shared genes between D21 and D22. Significant pituitary gland. The enriched expression of these particular pathways and genes are shown in Table 2. genes is thought to provide the unique functions of the Several genes within the signal transduction pathway pituitary gland or is critical to the overall function of and developmental biology pathway were related to the pituitary gland at that point in development. The axon connection formation and axonal organization enriched genes were uploaded to AmiGO 2 for gene (CNTN1, CNTN2, NFASC, LAMA1 and SLIT1), as well as ontology (GO) term analysis (Carbon et al. 2009), neurite outgrowth (EGF, ERBB4 and NRG3). Additionally, PathRings for pathway analysis (Zhu et al. 2015) and glutamate (GRM3 and GRM7) and GABA (GABRA3) WebGIVI for text mining and the identification of iTerms receptors and genes related to synaptic transmission and (L Sun & CJ Schmidt, unpublished observations). messaging (ASIC4, HRH3 and CHL1) were enriched at days 21 and 22 when compared to all other tissues.

Results

Starting gene lists and final enriched genes by day are

Journal of Molecular Endocrinology available in Supplementary Tables 1, 2, 3, 4, 5 and 6 (see section on supplementary data given at the end of this article) (Supplementary Tables 1, 2 and 3; starting gene list for days 21, 22 and 42, respectively; Supplementary Tables 4, 5 and 6; final enriched gene list for days 21, 22 and 42, respectively). Figure 1 shows a Venn diagram of the number of enriched pituitary genes shared (intersects) and differing (complement) between time points. A total of 25 enriched pituitary genes were shared between all three time points. Day 21 and day 22 were chosen for collection as part of a larger study and share 295 enriched genes compared to all other tissues. By day 42, there are 407 enriched genes not shared with day 21 and 22.

Day 21 and day 22: 295 shared genes

The 295 enriched genes shared between day 21 and day 22 grouped into the following GO terms: structure Figure 1 development (75 genes), neurogenesis (35 genes), neuron Distribution of enriched genes in the chicken (Gallus gallus) pituitary gland by day. Total number of enriched genes after relative tissue differentiation (26 genes) and nervous system development expression analysis in the whole pituitary gland at post-hatch days 21, 22, (43 genes). More specific GO terms associated with the and 42.

) pituitarygland. e

pritchett Printed inGreatBritain andothers Gene symbol ANK2, CHL1,CNTN1,CNTN2,COL9A3, LAMA1,NFASC, NTN1, ANO4, AQP4,ASIC4,GABRA3, SGK2, SLC13A5,SLC15A2, CACNG4, CHRNA4,GABRA3,GRIA4,GRIK2,GRIK3,KCNK2 ADORA1, ARHGEF4,CHRDL1,CNTN1,COL9A3,EGF, ERBB4, neurite outgrowth,axonalmigration,oligodendrocyte At day22,theuniquelyenrichedgenesarerelated to organization atday21( neuronal morphogenesisandsynapsestructure indicates an enrichment of genes associated with Chicken pituitarytranscriptome SLIT1, UNC5A SLC26A4, SLC30A8,SLC44A5,SLC6A9 WNT11, WNT6,WNT7B HRH3, NPBWR1,NRG3,NTRK2,PDE4A,PDE8B,RAMP1, FZD10, GFAP, GNAO1,GPR17,GREM2,GRM3,GRM7,GRPR, Published byBioscientifica Ltd. Gallus gallus P -value 0.05–0.0001,respectively. DB,developmentalbiology;NS, ) pituitaryglands.Significance,determinedbythe Downloaded fromBioscientifica.com at09/26/202101:57:36AM SYNDIG1 , RELN 58 : 1 and LRRTM1 46 via freeaccess ). ). Research e m pritchett and others Chicken pituitary transcriptome 58:1 47

Table 3 Gene ontology (GO) terms and enriched genes within each term for chicken (Gallus gallus) day 42 pituitary glands.

Gene ontology (GO) term # of genes in GO term Gene symbol Pituitary gland development 11 DRD2, GHRHR, ISL1, LHX3, PAX6, PITX1, PITX2, POU1F1, SIX3, TBX19, WNT5A Endocrine system development 16 CGA, CRHR1, DRD2, GHRHR, ISL1, LHX3, NR5A1, PAX6, PITX1, PITX2, POU1F1, RFX6, RFX8, SIX3, TBX19, WNT5A Regulation of hormone levels 17 CGA, CPE, CRHR1, DIO2, DRD2, ESR1, FOXL2, GHRHR, GHSR, ILDR1, INHBA, NR5A1, PASK, PCSK1, POMC, PRL, RFX6 Cell–cell signaling 24 C2CD4C, CACNA1B, CADPS, CGA, CHRNA3, CPE, CRHR1, DRD2, GABRG1, GHRHR, GHSR, GPR149, HTR1B, INHBA, KLF4, LHX5, LOC100858799, P2RX2, PDYN, PENK, PITX2, POMC, SYT4, WNT5A

differentiation and myelination (FA2H, GLDN, PLP1, hormone metabolic process and regulation of EPHA2, PTGDS, PTGS1 and STMN4). Two immune- hormone levels (28 genes) and cell–cell signaling related genes were also enriched in day 22: histone (18 genes) (Table 3). In addition to endocrine-related deacetylase 11 (HDAC11) and complement regulatory GO terms, neurogenesis (34 genes) and nervous protein CD59 molecule (CD59). Although these genes system development (42 genes), GO terms were also were uniquely enriched in the pituitary gland at day present within day 42 enriched genes. Figure 3 shows 22, the mean FPKM for these genes at days 21 and 22 the pituitary-specific iTerms and genes output from were both high in comparison to day 42 ((HDAC11: day WebGIVI for the day 42 time point. At day 42, expression 21: 75.27, day 22: 84.64, day 42: 6.53); (CD59: day 21: of endocrine-related genes such as GH, PRL, CGA, 467.2, day 22: 505.7, day 42: 54.0)). TSHB, FSHB and POMC increased and the following fold changes were seen in the transcriptomic data between days 22 and 42: GH 2700-fold, PRL 3000-fold, CGA Day 42: 407 genes (alpha subunit for FSHB, TSHB LHB) 1600-fold, TSHB At day 42, there are 407 unique genes with the 2300-fold, FSHB 6800-fold and POMC 2600-fold. To following GO terms: pituitary gland development validate these robust transcriptomic changes, qRT-PCR

Journal of Molecular Endocrinology (11 genes), endocrine system development (15 genes), results are summarized in Fig. 4.

Figure 3 Adapted WebGIVI output for chicken (Gallus gallus) pituitary iTerms and enriched genes expressed at day 42. Adapted WebGIVI output for general ‘pituitary’ iTerms. Red circles indicate iTerms generated by WebGIVI. Black outlined circles indicate genes from the enriched gene input list. Gray lines (edges) show connections between genes and iTerms. Blue filled genes are pituitary transcription factors. Orange filled genes are receptors for hypothalamus releasing hormones. Green filled genes are beta subunits of follicle stimulating hormone (FSH) and thyroid stimulating hormone (TSH).

pritchett POMC , PAX6 , , MYT1 ), prolactin( PHOX2B SIX6 Printed inGreatBritain andothers , ISL1 , ) andNK2 COL11A1 SOX3 , , PITX1 PRL SOX8 FSHB and ), ), , ,

member 4( receptors). Acidsensingionchannelsubunitfamily neurite outgrowth)andsignaling(GABAglutamate tissuedevelopment(axonformationand nervous 22 resultsinsimilarlyenrichedgenesinvolved Relative tissueexpressionanalysisfordays21and Day 21and22:shared anduniqueenrichedgenes Discussion oligodendrocyte progenitorcells( gliogenesis andmayplayaroleindifferentiationof ( expression correlateswitholigodendrocytecellgrowth system, the developing and adult central nervous role inregulating oligodendrocyte differentiation. In with anexpressionpatternthatindicatesapotential Homeobox 2( typically associatedwithhistone deacetylases( it ispossiblehasfunctions thatareunknownornot Because its functioninhealthytissues( muscle, kidneyandtestis;however, littleisknownabout abundant transcriptsaredetectedinthebrain,skeletal macrophages increased in micemacrophages,whereaschromatinchanges in tolerance and suppression can promote the expressionofinterleukin10( is placedinitsowncategory, classIV. transcription. group ofenzymesthatinteractwithhistonestoregulate 22: Two immune-relatedgeneswerealsoenrichedinday and maintenancecontinuesthroughoutdevelopment. it isunclearifthisfluctuationbetweenmorphogenesis tissue,and morphogenesis tomaintenanceofthenervous This maybeindicativeofadevelopmentalchangefrom day 21toneuriteoutgrowthandmyelinationat22. neuronal morphogenesisandsynapseorganizationat enriched genesatdays21and22indicateashiftfrom hormone secretion( is involved in neurotransmitter release and pituitary Receptor H3( expression inthebrain( signal transductionandisknowntohavehighest assembly of the membraneattack complex (MAC)during 2002 Wang gene, inhibiting Chicken pituitarytranscriptome Nielsen Published byBioscientifica Ltd. HDAC11 ). et al CD59 HDAC11 t al et . 2011 isacellsurfaceglycoprotein thatinhibitsthe ASIC4 and . 2004 HDAC11 HRH3 NKX2-2 ). Studiesinvestigating isauniquehistonedeacetylase, and IL10 ) isasodiumchannelinvolvedin ). ) isareceptorforhistamine,which CD59 Nuutinen &Panula2010 production( ). NKX2-2 is the most novel of the group and Downloaded fromBioscientifica.com at09/26/202101:57:36AM MYT1 Grunder HDAC11 . Histone deacetylases are a isageneassociatedwith isaDNA-bindingprotein Rousseau et al recruitmentto Deubzer Villagra IL10 58 . 2001 HDAC11 : 1 ), andimmune IL10 HDAC11 et al t al et ). Histamine t al et expression ). Uniquely . 2006 regulates Gao . 2012 . 2009 found MYT1 et al IL10 48 ). via freeaccess ). ). . ,

Research e m pritchett and others Chicken pituitary transcriptome 58:1 49

Table 4 Mean FPKM values for 25 shared genes between days 21, 22 and 42 in the chicken (Gallus gallus) pituitary gland.

Gene Description Day 21 Day 22 Day 42 ADIRF Adipogenesis regulatory factor 2.16 1.722 1.8 CASR Calcium-sensing receptor 2.33 2.57 2.41 COL11A1 Collagen, type XI, alpha 1 17.17 20.74 24.49 DNAH5 Dynein, axonemal, heavy chain 5 0.55 0.4 0.98 FAM135B Family with sequence similarity 135, member B 1.82 1.82 2.08 FAM3B Family with sequence similarity 3, member B 5 3.98 3.4 GPC3 Glypican 3 15.17 15.82 12.37 LOC101749214 Uncharacterized LOC101749214 1.68 1.45 0.99 LOC101749680 Uncharacterized LOC101749680 0.53 0.76 1.21 LOC101749716 Uncharacterized LOC101749716 0.95 0.67 1.79 LOC101749894 Homeobox protein Nkx-2.2-like 17.42 20.4 16.02 LOC101750727 Uncharacterized LOC101750727 1777.2 1074.13 958.83 LOC421690 Vacuolar protein 8-like 0.56 0.82 0.61 MATN4 Matrilin 4 2.2 2.1 7.02 MDGA2 MAM domain containing glycosylphosphatidylinositol anchor 2 14.16 16.98 14.25 MOV10L1 Mov10l1, Moloney leukemia virus 10-like 1, homolog (mouse) 4.53 3.53 6.09 MYT1 Myelin transcription factor 1 8.5 8.9 7.35 NALCN Sodium leak channel, non-selective 14 13.27 10.73 NKX2-2 NK2 homeobox 2 20.34 25.9 18.47 RNF182 Ring finger protein 182 1.43 1.53 3.14 SIX6 SIX homeobox 6 53.92 51.5 44.8 SORCS1 Sortilin-related VPS10 domain containing receptor 1 13.6 14.65 16.97 SOX3 SRY (sex determining region Y)-box 3 4.99 5.04 3.95 TRAPPC4 Trafficking protein particle complex 4 36.72 38.12 34.17 UMODL1 Uromodulin-like 1 1.3 1.52 2.55

Mean FPKM values in the pituitary gland for 25 shared enriched genes in days 21, 22 and 42 when compared to all other tissues (abdominal and heart fat, breast muscle, cerebellum, heart, liver, duodenum, jejunum, ileum, spleen, retina, pineal and hypothalamus).

complement attack (Huang et al. 2001). Activation of the appears to be focused on developing and maintaining complement attack can lead to inflammation and lysis nervous tissue connections and signaling. of cells and needs to be highly regulated. CD59 inhibits MAC osmolytic pore formation thereby protecting cells

Journal of Molecular Endocrinology Day 42 enriched genes (Liu et al. 2007). It is possible that development of the pars tuberalis and the macrophages within this region By day 42, gene expression suggests a shift in the focus result in enrichment of these immune-related genes at of the pituitary gland through maturation from strictly days 21 and 22 but not day 42 and may provide anti- nervous tissue development and signaling to endocrine- inflammatory functions during neuronal development. and hormone-related functions. Most notably, there is Overall, the focus of the pituitary gland at days 21 and 22 the robust increase in expression of peptide hormone

Figure 5 Adapted WebGIVI output for chicken (Gallus gallus) pituitary iTerms and 25 shared enriched genes expressed at days 21, 22 and 42. Adapted WebGIVI output for 25 genes enriched at all three time points and corresponding iTerms. Red circles indicate iTerms generated by WebGIVI. Black outlined circles indicate genes from the enriched gene input list. Gray lines (edges) show connections between genes and iTerms.

pritchett Printed inGreatBritain andothers TF symbol LOC427656 HES6 DLX1 NR2E1 VAX1 TBX22 ST18 SOX8 POU3F1 PHOX2B OLIG3 NTN1 NPAS3 MSX1 LHX2 IRX1 FOXL1 FOXC2 MYT1 NKX2-2 TBX20 TBX19 SMAD7 SIX3 SIX1 RHOXF1 RFX6 RBPJL RAX PRRX2 POU1F1 PITX2 PITX1 PAX6 NR5A1 NR4A3 NHLH2 NEUROG1 NEUROD1 LHX3 ISL1 INHBA IRF6 HES5 FOXL2 FOXG1 FOS ESR1 DMBX1 CHURC1 SOX10 Chicken pituitarytranscriptome Published byBioscientifica Ltd. Gallus gallus TF description Forkhead boxproteinL1-like Hes familyBHLHtranscriptionfactor6 Distal-Less homeobox1 Nuclear receptorsubfamily2groupE Ventral anteriorhomeobox1 T-box 22 Suppression oftumorigenicity18,zincfinger SRY-box 8 POU class3homeobox1 Paired likehomeobox2B Oligodendrocyte transcriptionfactor3 Netrin 1 Neuronal PAS domainprotein3 Msh homeobox1 LIM homeobox2 Iroquois homebox1 Forkhead boxL1 Forkhead boxC2 Myelin transcriptionfactor1 NK2 homeobox2 T-box 20 T-box 19 SMAD familymember7 SIX homeobox3 SIX homeobox1 Rhox homeoboxfamilymember1 Regulatory factorX6 Recombination signalbindingproteinfor Retina andanteriorneuralfoldhomeobox Paired relatedhomeobox2 POU class1homeobox Paired likehomeodomain2 Paired likehomeodomain1 Paired box6 Nuclear receptorsubfamily5groupA Nuclear receptorsubfamily4groupA Nescient helix-loop-helix2 Neurogenin 1 Neuronal differentiation 1 LIM homeobox3 ISL LIMhomeobox1 Inhibin betaA Interferon regulatoryfactor6 Hes familyBHLHtranscriptionfactor5 Forkhead boxL2 Forkhead boxG1 FBJ murineosteosarcomaviraloncogene Estrogen receptor1 Diencephalon/mesencephalon homeobox1 Churchill domaincontaining1 SRY-box 10 member 1 immunoglobulin kappaJregionlike member 1 member 3 homolog ) pituitaryglands. Downloaded fromBioscientifica.com at09/26/202101:57:36AM 58 : 1 50 via freeaccess Research e m pritchett and others Chicken pituitary transcriptome 58:1 51

genes GH, PRL, TSHB and FSHB. This change in enriched of biogenic amines and peptides) in the pituitary genes could be in preparation for reproduction. In gland and is involved in secretion of serotonin and addition to receptors for releasing hormones from the other neurotransmitters in Caenorhabditis elegans and hypothalamus, and beta subunits of follicle-stimulating Drosophila melanogaster (Wassenberg & Martin 2002). hormone (FSH) and thyroid-stimulating hormone (TSH), SYT4 is a synaptotagmin that is a member of the vesicle two other genes of interest are carboxypeptidase E (CPE) integral membrane SNARE genes. Once hormones are and deiodinase type 2 (DIO2). CPE is a carboxypeptidase produced, they are stored in secretory granules where B-like enzyme involved in peptide and neurotransmitter extracellular signals induce fusion with the plasma synthesis and processing of neuropeptides. membrane and subsequent release (Moore et al. Immunohistochemical studies in the rat have shown 2002). SYT4 is an inhibitor of regulated exocytosis immunoreactivity within all components of the (Wassenberg & Martin 2002). hypothalamic-neurohypophyseal system (Lynch et al. Cocaine- and amphetamine-regulated transcript 1990). CPE has prohormone processing functions in (CARTPT) is an anorectic peptide that is expressed in neuroendocrine cells and directs proopiomelanocortin the hypothalamus and the anterior pituitary. In the (POMC) to the secretory pathway where it is later anterior pituitary, CARTPT is present in corticotrophs, cleaved to produce ACTH (Dhanvantari et al. 2002). gonadotrophs, lactotrophs and thyrotrophs. CARTPT

DIO2 converts thyroxine (T4) to triiodothyronine (T3), mRNA expression is regulated by corticosterone and the main metabolic hormone important for neuronal corticotropin-releasing hormone (CRH) from the development and differentiation in the brain (Noda hypothalamus via corticotropin-releasing hormone

2015). Circulating levels of T4 are transported across receptor 1 (CRHR1). Intracerebroventricular injections the blood–brain barrier to astrocytes by organic anion- of CARTPT lead to elevated ACTH and corticosterone transporting polypeptide (OATPs) transporters and levels, suggesting that CARTPT can activate the

converted by DIO2 to T3. T3 is important for neuron, hypothalamic–pituitary–adrenal (HPA) axis and may microglia, astrocyte and oligodendrocyte development be involved in the processes of the HPA axis, such and function and thyroid hormone dysfunction can as the stress response (Mo et al. 2015). Similarly, influence these processes (Karlsson et al. 2016). DIO2 gastrin-releasing peptide (GRP) is a neuropeptide that expression is also involved in seasonal reproduction in affects AVP and CRH secretion from the hypothalamus birds and is expressed during long day conditions. The and acts directly at the pituitary gland by increasing

increased day length leads to an increase in T3 which then the effects of AVP and CRH release on corticotrophs Journal of Molecular Endocrinology stimulates the release of FSH and luteinizing hormone (Olsen et al. 1992). (LH) for reproduction (Karlsson et al. 2016). The exact location of DIO2 expression in the brain is still under Day 21, 22 and 42: 25 shared enriched genes investigation although it is thought to be exclusively expressed in the glial compartment (Egri et al. 2016). Of the 25 shared genes between days 21, 22 and 42, This research shows expression in the pituitary gland genes related to the extracellular matrix (ECM) were suggesting future work should identify the location of enriched. The ECM organizes and fills the space between DIO2 mRNA within the pituitary. cells and is composed of glycosaminoglycans and Dopamine receptor D2 (DRD2) and somatostatin fibrous proteins such as collagen and elastin. The ECM receptor 5 (SSTR5) are receptors found in the brain. DRD2 not only provides support to surrounding cells but also is expressed in lactotrophs and inhibits prolactin release. influences proliferation, differentiation and survival SSTR5 is involved in the regulation of GH and TSH. Both (Alberts et al. 2002). ECM gene collagen type XI alpha 1 DRD2 and SSTR5 are also involved in ACTH release in (COL11A1) encodes for an alpha chain of a minor pituitary tumors (Tani et al. 2011). fibrillary collagen and is important for extracellular Calcium-dependent secretion activator (CADPS) matrix organization and has been associated with cell and synaptotagmin IV (SYT4) gene products are proliferation and migration (Mio et al. 2007, Shen et al. involved in the calcium-dependent vesicle-mediated 2016). Matrilin-4 (MATN4) is in the matrilin family of exocytosis of neurotransmitters and peptides in proteins and is a recently characterized extracellular conjunction with plasma membrane-associated and matrix protein that is expressed in a variety of tissues, vesicle integral membrane SNAREs. CADPS is essential including the brain (Wagener et al. 2001). The pituitary in exocytosis of dense-core vesicles (used for exocytosis gland is involved in nervous tissue and endocrine

http://jme.endocrinology-journals.org © 2017 Society for Endocrinology Published by Bioscientifica Ltd. DOI: 10.1530/JME-16-0186 Printed in Great Britain Downloaded from Bioscientifica.com at 09/26/2021 01:57:36AM via free access Journal of Molecular Endocrinology glycoprotein hormones(CGA). Inhumansandmice, two genes are associated with the alpha peptide of functions infibroblasts ( associated with pro-apoptotic and pro-inflammatory 18 ( and factors areassociatedwithneurogenesis( type ofneuron( to exitthecellcycleanddifferentiationaparticular development toregulateneuraltubeprogenitorcells homeobox 2B( develops( single pituitary developmentandensures thatonly pituitary-specific a in whichfibroblastgrowthfactor10( development, forebrain ( luteinizing hormone-releasinghormoneneuronsinthe specifically directsthedevelopmentandmigrationof system. axon guidanceinthedevelopingnervous ventral anteriorhomeobox1( were enriched.Netrin1lamininrelated( shared betweendays21and22,14transcriptionfactors gland wereidentified. Within the295 enrichedgenes with particularpointsindevelopmentofthepituitary functions, transcriptionfactorsthatmaybeassociated ( development, differentiationandfunction celltranscription and are essential to pituitary Transcription factors(TF)controltherateof Enriched transcriptionfactorgenes cell proliferation( and havebeenassociatedwithnegativeregulationof systempredominately expressedinthecentralnervous tissue repair( like growth,andfunctionduringmorphogenesis with extracellularligandstoinfluencecellprocesses, proteoglycans anchoredtothecellsurfacethatinteract glypican memberwithinthefamilyofheparinsulfate the ECMtoinfluencecellcyclecontrol. differentiation. Glypican3( enriched genesinvolvedincellproliferationand to enrichmentforspecificECMgenes,therearealso growth andmaintenancethroughoutlife.Inaddition and the ECM is an important component of tissue development (i.e. initiation reproductive maturation), toaccommodatetheconditionsofis necessary to signalsfromthehypothalamus.Thisplasticity signaling anddisplaystissueplasticityinresponse Mizokami DOI: 10.1530/JME-16-0186 http://jme.endocrinology-journals.org Research ST18 NPAS3 ) is uniformly expressed in the brain and is Schwarting ), whereas suppression of tumorigenicity t al et VAX1 Bernfield PHOX2B Dubreuil . 2008 Sung isresponsibleforlimitingtheareas t al et ). Becauseoftheirinfluential et al ) iscriticalduringembryonic et al t al et Bharti Yang . 2004 . 2003 . 2000 VAX1 . 1999 e GPC3

pritchett ). Two transcription ) arebothrelatedto . 2011 FGF10 ) interactswith ). Glypicansare . 2008 Printed inGreatBritain andothers ). Pairedlike ) caninduce NTN1 GPC3 ). Lastly, POU3F1 NTN1 ) and isa

LH- andFSH-expressingcellsT-box 19( A member1( ( 1993 of transcription factorthatisresponsiblefortheactivation POU class1homeobox( and severalareinvolvedinendocrine-relatedprocesses. types ( ( to influencedevelopmentthroughaxonalguidance in post-hatchbirdssuggeststhesegenesmaycontinue 22 were identified; however, the presence of these genes developmentatdays21andassociated withembryonic ( glandin thedevelopmentofposteriorpituitary CGA promoter( ( ( pituitary and thyroid-stimulatinghormonecellsoftheanterior CGA expressionandislocalizedingrowthhormone Msh Homeobox1( maturation. oligodendrocyte differentiation, proliferationand in all days, glucose uptake). in insulin-relatedprocesses(i.e.insulinreceptors, RFX6 the brainisaninsulin-sensitiveorganandperhaps normally associated with brain tissue ( day 42ratherthantheparalogoustranscriptionfactor the pancreas ( a transcriptionfactormostcommonlyassociatedwith not showntobeenrichedinourdata.Itissurprisingthat tissues, particularlythebrain( characterized inhumansandisexpressedseveral factorX7( gene, regulatory may regulatepancreaticdevelopment.Theparalogous factor expressedprimarilyinpancreatictissuesand factor X6( POMC geneexpression( factor involvedincorticotrophdifferentiationand 1 ( CGA promoter( ( 2005 promoter andaffectstheexpressionofACTH( restricted tocorticotrophswhereitbindsthePOMC Chicken pituitarytranscriptome Zhu VAX1 Davis LHX2 FOXL2 Published byBioscientifica Ltd. GH NEUROD1 Thirty transcriptionfactorsareenrichedatday42 Two enrichedtranscriptionfactors found pituitary ). Limhomeobox3( development) andiscriticalforproperpituitary is present in the chicken pituitary gland toassist ispresentinthechickenpituitary t al et , ) and limiting the growth of pituitary-related cell) andlimitingthegrowthofpituitary-related ) isatranscriptionfactorknowntorepressthe NTN1 et al ) areassociatedwithpositiveregulationofthe PRL . 2005 . 2010 Mizokami RFX6 and ). ) hasbeenidentifiedasatranscription MYT1 MYT1 NR5A1 RFX6 Susa ) isanewlycharacterizedtranscription ). Severaltranscriptionfactorsnormally ). Nuclear receptor subfamily 5 group Susa TSHB isaDNA-bindingprotein with and ) is present in the pituitary glandat) is presentinthe pituitary et al ) functionsinthedevelopmentof MSX1 et al t al et genetranscription( Downloaded fromBioscientifica.com at09/26/202101:57:36AM . 2006 NXK2-2 Tani POU1F1 . 2006 LHX3 ) hasbeenassociatedwith . 2008 Aftab RFX7 ). Neurondifferentiation t al et ) andForkheadboxL2 ) andhasadirectrole , are both related to ) isapituitary-specific ). LIMHomeobox2 . 2011 ), isalsorecently et al 58 : RFX7 1 . 2008 ). Regulatory Pfaffle ); however, TBX19 Zhu ) butwas et al et al 52 ) is via freeaccess . . Research e m pritchett and others Chicken pituitary transcriptome 58:1 53

an expression pattern that indicates a potential role Supplementary data in regulating oligodendrocyte differentiation. In This is linked to the online version of the paper at http://dx.doi.org/10.1530/ the developing and adult central nervous system, JME-16-0186. MYT1 expression correlates with oligodendrocyte cell growth (Nielsen et al. 2004). NKX2-2 is associated with gliogenesis and may play a role in the differentiation Declaration of interest of oligodendrocyte progenitor cells (Rousseau et al. The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported. 2006). The presence of these TFs in all days indicates the need for continued oligodendrocyte proliferation. This proliferation may accommodate new connections Funding between the pituitary gland and other brain regions, This project was supported by Agriculture and Food Research Initiative specifically the hypothalamus, and may be important Competitive Grant 2011-67003-30228 from the United States Department for establishing and maintaining the connections of Agriculture National Institute of Food and Agriculture. within the hypothalamo–pituitary axis. Other neuronal- related TFs independent of those identified at days 21 and 22 were enriched at day 42 (i.e. CHURC1, DMBX1). Author contribution statement E M P, C J S and S J L conceived and designed the experiments. E M P and These transcription factors should be explored further C J S performed the experiments. E M P and C J S analyzed the data. E M P, to determine the temporal relationship as it is possible C J S and S J L contributed reagents/materials/analysis tools. E M P wrote these TFs are necessary to establish the endocrine-related the paper. processes within the pituitary gland. TF results also point to a maturation shift from prominently neuronal-related TFs at day 21/22 to endocrine-related TFs at day 42. Acknowledgements The authors would like to thank Matheus Reis for his help in conducting In summary, there is a transcriptome focus on the bird trial, members of the Schmidt Laboratory for assistance during nervous tissue development, signaling and maturation at necropsies and Dr Erin Brannick and Dr Robert Dyer for aiding in proper days 21 and 22 post-hatch. By day 42, there is a shift from collection of the pituitary gland. Special thanks to Schmidt Lab member Blair Schneider for assistance with pituitary gland RNA preparation. strictly nervous tissue gene expression toward endocrine- related processes, possibly indicating maturation in preparation for reproduction. The results of this study References lead to valuable insight into the genes involved in

Journal of Molecular Endocrinology the pituitary gland at several points in development, Aftab S, Semenec L, Shih-Chieh Chu J & Cheng N 2008 Identification and characterization of novel human tissue-specific RFX particularly related to maturation. Future work aims to transcription factors. BMC Evolutionary Biology 8 226. utilize fluorescent in situ hybridization techniques to (doi:10.1186/1471-2148-8-226) investigate the location of particular mRNA transcripts Alberts B, Johnson A, Lewis J, Raff M, Roberts K & Walter P 2002 The extracellular matrix of animals. In Molecular Biology of the Cell, edn within the pituitary such as DIO2 and RFX6. Future 4. New York, NY, USA: Garland Science. work should investigate the transcriptomic differences, Bailey MJ, Coon SL, Carter DA, Humphries A, Kim J, Shi Q, Gaildrat P, particularly related to neuronal and endocrine Morin F, Ganguly S, Hogenesch JB, et al. 2009 Night/Day changes in pineal expression of >600 genes. Central role of Adrenergic/cAMP maturation, as a function of age in male broiler chicken signaling. Journal of Biological Chemistry 284 7606–7622. pituitary glands by collecting additional time points in (doi:10.1074/jbc.m808394200) future trials. The pituitary gland is a tissue that contains Bernfield M, Gotte M, Park PW, Reizes O, Fitzgerald ML, Lincecum J & Zako M 1999 Functions of cell surface heparan sulfate many different cell types and exerts many physiological proteoglycans. Biochemistry 68 729–777. (doi:10.1146/annurev. changes based on the input received from the body biochem.68.1.729) and the environment. Whole tissue transcriptomics is Bharti K, Gasper M, Bertuzzi S & Arnheiter H 2011 Lack of the ventral anterior homeodomain transcription factor VAX1 leads to induction informative but cellular transcriptomic changes that of a secondary pituitary. Development 138 873–878. (doi:10.1242/ may have important physiological impacts may be lost dev.056465) or not as robust. Single-cell transcriptomic data could Carbon S, Ireland A, Mungall CJ, Shu SQ, Marshall B & Lewis S 2009 AmiGO: online access to ontology and annotation data. further elucidate the cellular transcriptomic differences Bioinformatics 25 288–289. (doi:10.1093/bioinformatics/btn615) that may influence the development and function of the Davis SW, Castinetti F, Carvalho LR, Ellsworth BS, Potok MA, Lyons RH, pituitary gland. Single-cell transcriptome analysis would Brinkmeier ML, Raetzman LT, Carninci P, Mortensen AH, et al. 2010 Molecular mechanisms of pituitary organogenesis: In search of novel allow for identification of more prevalent cell types and regulatory genes. Molecular and Cellular Endocrinology 323 4–19. the transcriptomic changes throughout development. (doi:10.1016/j.mce.2009.12.012)

http://jme.endocrinology-journals.org © 2017 Society for Endocrinology Published by Bioscientifica Ltd. DOI: 10.1530/JME-16-0186 Printed in Great Britain Downloaded from Bioscientifica.com at 09/26/2021 01:57:36AM via free access Journal of Molecular Endocrinology Moore HPH, Andresen JM, Eaton BA, Grabe M, Haugwitz M, Qu MM & Qu MM Haugwitz M, Grabe M, Eaton BA, Andresen JM, Moore HPH, 2015 Wang Y &Li J Cui L, Lin D, Deng Q, Huang L, Cai G, Mo C, Itoh Y, & Takekoshi S, Osamura RY Mizokami Y, Itoh J, Egashira N, Hirose Y,Mio F, Kawaguchi Y, Chiba K, Mikami Y, Oya T, Mori M, 1990Carboxypeptidase E &Snyder SH Hutton JC Braas KM, Lynch DR, 2007Molecularandfunctional &Chen X Zhang J Liu G, 2012Fastgapped-readalignmentwith &Salzberg SL Langmead B Wright D, Hagenblad J, Johnsen H, Fallahshahroudi A, Karlsson AC, 2001 &Cai C Li W, Chen S Mao X, Jiang D, Zhen C, Gou D, Huang J, 2001Acid-sensingion &Fink JK Rainier S Geisler HS, Grunder S, Gao L, Cueto MA, Asselbergs F & Atadja P 2002Cloningandfunctional &Atadja P Asselbergs F Cueto MA, Gao L, & Fulop BD Hashimoto H, Reglodi D, Egri P, Denes A, Fekete C, 2000The &Goridis C Brunet JF Dubreuil V, Pattyn A, Hirsch MR, Hammond K, Steinbach PJ, Snell CR, Arnaoutova I, Dhanvantari S, & Sommer A Haendler B, Lodrini M, Oehme I, Schier MC, Deubzer HE, DOI: 10.1530/JME-16-0186 http://jme.endocrinology-journals.org Research Machen TE 2002 Biosynthesis and secretion of pituitary hormones: 2002Biosynthesisand secretionofpituitary Machen TE mce.2015.09.007) Molecular andCellularEndocrinology through CRHtype1receptorinchickenanteriorpituitary. amphetamine-regulated transcriptgene(CART1)expression Corticotropin-releasing hormone(CRH)stimulatescocaine-and s12022-008-9021-7) adenomas. and pituitary 2008ExpressionofMSX1inhumannormalpituitaries Matsumae M (doi:10.1086/522377) ofHumanGenetics American Journal XI collage,isassociatedwithsusceptibilitytolumbardischerniation. polymorphism inCOL11A1,whichencodesthealpha1chainoftype Ozaki K, Matsumoto M, Kamata M, gland. system andpituitary (CPE): immunocytochemicallocalizationintheratcentralnervous (doi:10.1016/j.molimm.2007.04.006) Pseudosciana crocea. characterization ofaCD59analoguefromlargeyellowcroaker Bowtie 2. ygcen.2016.02.010) Comparative Endocrinology photoperiodic responseandreproductioninchickens. the thyroidstimulatinghormonereceptorgene(TSHR)modulates 2016Adomesticationrelatedmutationin &Jensen P Andersson L (doi:10.1111/j.1574-695X.2001.tb00521.x) Immunology andMedicalMicrobiology lysis bytheexpressionofhumanDAF, CD59,andMCP. Protection ofxenogeneiccellsfromhumancomplement-mediated ejhg.5200699) ofHumanGenetics Journal and evaluationasacandidateforparoxysmaldystonia. channel (ASIC)4gene:Physicalmapping,genomicorganisation, (doi:10.1074/jbc.M111871200) deacetylase family. characterization ofHDAC11,anovelmemberthehumanhistone (doi:10.1210/en.2015-1982) type 2deiodinaseinmalemice. (PACAP) (HPT)axisvia regulatesthehypothalamo-pituitary-thyroid adenylatecyclase-activatingpolypeptide 2016Pituitary Gereben B cycle exitandidentity. Phox2b transcriptionfactorcoordinatelyregulatesneuronalcell (doi:10.1021/bi015698n) c-terminal transmembraneinsertion. prohormone sortingreceptor, granulesviaa isanchoredtosecretory 2002CarboxypeptidaseE,a &Loh YP London E Caputo GA, ijc.27876) ofCancer Journal International 2012HDAC11isanoveldrugtargetincarcinomas. Witt O Nature Methods

Journal ofBiologicalChemistry Journal Molecular Immunology Development

Endocrine Pathology

9 228

357–359. 9 Journal ofNeuroscience Journal 672–676.

132 69–78. Endocrinology 2200–2208.

et al 127

31 5 (doi:10.1038/nmeth.1923) Biochemistry (doi:10.1016/j. e 1271–1277. 166–177.

44 pritchett

3661–3671. 19

157 (doi:10.1002/ 54–61.

277

(doi:10.1016/j. Printed inGreatBritain

41 1–11. 10 andothers 52–60. 25748–25755. 1592–1599. General and (doi:10.1007/ FEMS European Olsen L, Knigge U &Warberg J 1992Gastrin-releasingpeptide Knigge U Olsen L, 2010Histamineinneurotransmissionandbrain &Panula P Nuutinen S 2015Possibleroleofglialcellsintherelationshipbetween Noda M 2004Myelin &Armstrong RC Hudson LD Berndt JA, Nielsen JA, National Research Council1994NutrientRequirementsofPoultry, 9th Rousseau A, Nutt CL, Betensky RA, Iafrate AJ, Han M, Ligon KL, Ligon KL, Han M, Iafrate AJ, Betensky RA, Nutt CL, Rousseau A, 1993Pit-1andpituitary &Heimann G Pfaffle RW, Brown MR Parks JS, Wagener R, Kobbe B, Aszodi A, Aeschlimann D & Paulsson M 2001 &Paulsson M Aeschlimann D Aszodi A, Wagener R, Kobbe B, Cheng F, Nguyen D, Villagra A, Wang HW, Maurin M, Glozak M, Suarez I, 2009TopHat:discovering &Salzberg SL splice Trapnell C, Pachter L Tani Y, Yoshimoto T, Sugiyama T, Izumiyama H, Yamada T &Hirata Y 2006CofactorCLIM2promotes Susa T, Sato T, &Kato Y Ono T, Kato T 2003Growth &Kim MK Kim JC Hwang SY, Farooq M, Sung YK, 2016COL11A1is &Miao C Zhu B Zhang Z, Yang M, Lin Q, Shen L, Bless EP, &Tobet S 2004 Raitcheva D, ACkerman SL Schwarting GA, 2009 &Saylor WW Kingham B Feierstein E, Persia ME, Schmidt CJ, Chicken pituitarytranscriptome Published byBioscientifica Ltd. Neurology ASCL1, andNKX2-2. astrocytic lineagemarkersindiffusegliomas:useofYKL-40,APOE, 2006Expressionofoligodendroglialand &Louis DN Rowitch DH JPEM.1993.6.3-4.229) function. 2710–2716. stimulation ofcorticotropinsecretioninmalerats. (doi:10.1007/978-1-4419-8056-4_10) diseases. Neuroscience thyroid dysfunctionandmentaldisorders. Neuroscience differentiation ofoligodendrocytelineagecells. transcription factor1(Myt1)modulatestheproliferationand ed. Washington, USA:NationalAcademyPress. 16–25. dynamics andregulation. Genomics overlap withthegeneencoding transcriptionfactorRBP-I. Characterization ofthemousematrilin-4 gene:A5 tolerance. HDAC11 regulatestheexpressionofinterleukin10andimmune Wright KL, Atadja PW, Bhalla K, bioinformatics/btp120) junctions withRNA-seq. (doi:10.1507/endocrj.K10E-389) ACTH-secretingtumors. pituitary and transcription factorsandreceptorsbetweennon-pituitary 2011 DifferentialgeneexpressionprofilesofPOMC-relatedenzymes, (doi:10.1016/j.bbaexp.2006.08.004) alpha subunitgene. LHX2 intheexpressionofporcine glycoproteinhormone pituitary the repressiveactionofLIMhomeodomaintranscriptionfactor (doi:10.1038/emm.2003.34) factor 2signaling. knockdown ofglypican-3isindependentinsulin-likegrowth promotion ofHepG2hepatomacellsbyantisense-mediated Reports cell proliferation,migration,invasionanddrugresistance. overexpressed inrecurrentnon-smallcelllungcancerandpromotes (doi:10.1111/j.1460-9568.2004.03094.x) of LHRHneurons. pathway Netrin 1-mediatedchemoattractionregulatesthemigratory 00055 since the1950s. Comparison ofamodernbroilerlineandheritageunselected jnen.0000248543.90304.2b) )

(doi:10.1076/apab.110.1.16.903) 36

Advances inExperimentalMedicineandBiology

76 Journal ofPediatricEndocrinology Journal 65 877–885. Nature Immunology

(doi:10.1210/en.130.5.2710) 89–98. 9 25 1149–1156. 1–7. 111–123. Poultry Science Poultry Experimental andMolecularMedicine European Journal ofNeuroscienceEuropean Journal (doi:10.3389/fncel.2015.00194) (doi:10.1006/geno.2001.6589) BBA Gene Structure andExpressionBBA GeneStructure (doi: 10.3892/or.2016.4869) Journal ofNeuropathology andExperimentalJournal Bioinformatics (doi:10.1016/j.mcn.2003.10.001) (doi:10.1097/01. Archives ofPhysiologyandBiochemistry Downloaded fromBioscientifica.com at09/26/202101:57:36AM

88 92–100. et al Endocrine Journal 2610–2619. . 2009 The histone deacetylase . 2009Thehistonedeacetylase

25 (doi:10.1038/ni.1673)

1105–1111. 6 Frontiers inCellular 229–233. 58 ( doi:10.3382/ps.2009- : Molecular andCellular 1

19 58 ′ Endocrinology antiparallel 11–20.

297–303.

(doi:10.1515/ 1759 709 35 (doi:10.1093/ 257–262. 95–107. Oncology 403–409.

54 110

130 via freeaccess

Research e m pritchett and others Chicken pituitary transcriptome 58:1 55

Wang H, Cheng F, Woan K, Sahakian E, Merino O, Rock-Klotz J, Vicente- proinflammatory gene expression in fibroblasts. FASEB Journal 22 Suarez I, Pinilla-Ibarz J, Wright JL, Seto E, et al. 2011 Histone 3956–3967. (doi:10.1096/fj.08-111013) deacetylase inhibitor LAQ824 augments inflammatory responses in Zhu X, Lin CR, Prefontaine GG, Tollkuhn J & Rosenfeld MG 2005 macrophages through transcriptional regulation of IL-10. Journal of Genetic control of pituitary development and hypopituitarism. Immunology 186 3986–3996. (doi:10.4049/jimmunol.1001101) Current Opinion in Genetics and Development 15 332–340. Wassenberg JJ & Martin TFJ 2002 Role of CAPS in dense-core vesicle (doi:10.1016/j.gde.2005.04.011) exocytosis. Annals of the New York Academy of Science 971 201–209. Zhu Y, Sun L, Garbarino A, Schmidt C, Fang J & Chen J 2015 PathRings: (doi:10.1111/j.1749-6632.2002.tb04464.x) a web-based tool for exploration of ortholog and expression data in Yang J, Siqueira MF, Behl Y, Alikhani M & Graves DT 2008 The biological pathways. BMC Bioinformatics 16 1–7. (doi:10.1186/ transcription factor ST18 regulates proapoptotic and s12859-014-0430-y)

Received in final form 8 November 2016 Accepted 17 November 2016 Accepted Preprint published online 17 November 2016 Journal of Molecular Endocrinology