Page 1 of 45 Diabetes
Insulin therapy of gestational diabetes does not fully protect offspring from
diet-induced metabolic disorders
Hong Zhu1#, Bin Chen1#, Yi Cheng1,2, Yin Zhou1, Yi-Shang Yan1, Qiong Luo3, Ying
Jiang3, Jian-Zhong Sheng1,2, Guo-Lian Ding4,5*, He-Feng Huang1,4,5*
1. The Key Laboratory of Reproductive Genetics (Zhejiang University), Ministry of
Education, Zhejiang university school of medicine, Hangzhou, Zhejiang, China
2. Department of Pathology and Pathophysiology, Zhejiang University school of
medicine, Hangzhou, Zhejiang, China
3. Department of Obstetrics, Women’s Hospital, Zhejiang University school of
medicine, Hangzhou, China
4. The International Peace Maternity and Child Health Hospital, Institute of
Embryo-Fetal Original Adult Disease, School of Medicine, Shanghai Jiao Tong
University, Shanghai, China
5. Shanghai Key Laboratory of Embryo Original Diseases, Shanghai, China.
# H.Z. and B.C. contributed equally to this study.
*Corresponding author: He-Feng Huang, [email protected], (86)02164073897 or
Guo-Lian Ding, [email protected], (86)18521321298.
Diabetes Publish Ahead of Print, published online January 29, 2019 Diabetes Page 2 of 45
Abstract
Gestational diabetes mellitus (GDM) is associated with increased risk of metabolic
disorders in offspring in later life. Although mounting evidence suggests that therapy
for GDM could improve neonatal health, it is not known whether the therapy confers
long-term metabolic benefits to offspring in their later adult lives. Here, using a
mouse model of diabetes in the latter half of pregnancy to mimic human GDM, we
find that the efficient insulin therapy of GDM confers significant protection against
glucose intolerance and obesity in offspring fed on normal chow diet. However, the
therapy fails to protect offspring when challenged with a high fat diet, especially for
male offspring. Genome-wide DNA methylation profiling of pancreatic islets from
male offspring identified hypermethylated regions in several genes that regulate
2+ insulin secretion, including Abcc8, Cav1.2 and Cav2.3 that encode KATP or Ca channels, which is associated with reduced gene expression and impaired insulin secretion. This finding suggests a methylation-mediated epigenetic mechanism for
GDM-induced intergenerational glucose intolerance. It highlights that even efficient insulin therapy of GDM is insufficient to fully protect adult offspring from diet-induced metabolic disorders.
Keyword: Gestational diabetes mellitus; Insulin therapy; Offspring; Ion channel,
DNA methylation Page 3 of 45 Diabetes
Introduction
Gestational diabetes mellitus (GDM), defined as glucose intolerance first diagnosed
during pregnancy, affects up to 15% of pregnancies in the world (1). GDM is
associated with adverse consequences not only during fetal development such as
stillbirth, visceromegaly, and macrosomia but also later in life (2, 3). Accumulating
evidence suggests that GDM, independent of maternal obesity and genetic
background, predispose offspring to metabolic disorders in later life, such as obesity,
impaired glucose tolerance and diabetes (4-6). Longitudinal studies of GDM offspring
indicate that the maternal glucose level is a strong predictor of altered carbohydrate
metabolism during childhood, which can be extended into adulthood (7, 8).
The therapeutic management of GDM is critical to minimize these complications.
Glycemic control is the cornerstone of GDM management (9). Randomized trials
have confirmed that the therapy of GDM confers immediate benefits such as
reduction of perinatal complications and prevalence of macrosomia (10, 11).
However, it is still unclear whether the therapy of GDM confers long-term metabolic
benefits to offspring (12, 13). Importantly, the appropriate offspring follow-up period
for assessing the effects of GDM therapy is still debatable. Offspring enrolled in most
follow-ups were prepubertal (age 5-10 years), yet the long-term effect of GDM on
offspring metabolic disorders or its reduction through therapy might not be evident
until adolescence or adulthood (12, 14). Diabetes Page 4 of 45
Additionally, offspring gender also has a profound effect. Sexual dimorphism in the response to insult in utero presents with an uneven disease susceptibility: although both genders can be affected, one is more susceptible (15). Metabolic differences exist between male and female fetus (15), differing sensitivities to maternal hyperglycemia may result in sex-specific disease risks later in life (6, 16). Evidence from epidemiological studies demonstrate that the effect of therapy for GDM also differs with fetal sex in infancy and childhood (11, 16). Therefore, fetal sex may influence the impact that therapy for GDM have on offspring long-term health. Moreover, social and environmental factors could also confound the follow-up results. Thus, it remains unknown whether therapy of GDM is a modifiable risk factor for offspring metabolic disorders.
Mechanistically, epigenetic modifications such as DNA methylation, histone modification, and non-coding RNAs provide a plausible link between environment exposures early in development and the susceptibility to diseases later in life (17).
DNA methylation, the most studied epigenetic modification, can alter status of gene expression and be inherited mitotically in somatic cells (17, 18), which provides a potential mechanism by which environment effects on epigenome could have long-term effects on gene expression. Results from animal and human studies support that intrauterine hyperglycemia could result in altered fetal DNA methylation patterns and subsequent changes in the risk of developing disease (6, 19). In epidemiological Page 5 of 45 Diabetes
and experimental studies, glycemic control improved GDM neonatal outcomes.
However, none of studies investigated whether these positive effects were
accompanied by a favorable restoration of DNA methylation (20), which may be
critically important for the susceptibility to disease later in life. Thus, the possibility
that fetal metabolic programming in GDM can have long-term effect on health that
may in turn be modified by therapy of GDM remains open to question.
Since it is difficult to exclude the confounders and analyze the underlying
mechanisms in humans, we established a mouse model of diabetes in the latter half of
pregnancy to mimic human GDM with high incidence during the third trimester of
gestation (21). We treated maternal hyperglycemia with insulin and evaluated the
pancreatic islet β-cell function in offspring. We also addressed whether lifestyle
factors in the adulthood, such as high fat diet, may increase the risk of developing
metabolic disorders in offspring. Finally, we carried out genome-wide DNA
methylation sequencing in offspring pancreatic islets and assessed the alterations of
candidate genes which may contribute to metabolic phenotypes in offspring. Diabetes Page 6 of 45
Research Design and Methods Animal care
All animal protocols were approved by the Zhejiang University Animal Care and Use
Committee. All experiments were performed with Institute of Cancer Research (ICR) mice (22). ICR mice were purchased from Shanghai SLAC Laboratory Animal Co.
(Shanghai, China). Virgin ICR females (age, 6-8 weeks; weight, 26-28g) were mated with normal ICR males. Pregnancy was dated by the presence of a vaginal plug (day
0.5). Pregnant females were randomly assigned to “Control” (Ctrl), “Gestational diabetes mellitus” (GDM) or “GDM + Insulin therapy” (INS) groups. On day 6 and day 12 of pregnancy, GDM and INS dams fasting 8 hours received i.p. injection of streptozotocin (STZ; 100 mg/kg; Sigma, St. Louis, MO), respectively (23, 24) (Fig.
1A). Control pregnant mice received an equal volume of citrate buffer. Blood glucose level was measured via the tail vein 48-72 hours after the second STZ injection, and diabetes was defined as a blood glucose level between 14 and 19 mmol/L (6).
INS dams were treated with recombinant insulin (Novolin® R, Novo Nordisk,
Bagsvaerd, Denmark) by mini-osmotic pumps (Alzet model 1007D, Durect,
Cupertino, CA) at a dose of 0.35 IU/day. Pumps were implanted in INS dams on Day
14.5 or Day 15 of pregnancy. Pumps were implanted posterior to the scapulae under avertin (Sigma) anesthesia (0.1ml per 20 g body wt). Control and GDM dams were implanted with pumps containing normal saline. In order to maintain glycemic level stable, INS dams received another injection of 0.1 units of long acting insulin Page 7 of 45 Diabetes
(Levemir®, Novo Nordisk) about 1 hour prior to the fed state (darkness) during late
gestation. Only mice with near-normal blood glucose level in INS group were
included in the further study.
At birth, litter size was equalized to eight. Pups from GDM and INS group were
fostered by normal females until the age of 3 weeks. Offspring were designated as
Ctrl-F1, GDM-F1 and INS-F1. At 8 weeks of age, offspring were divided into two
groups either receiving normal chow diet (NCD) or high fat diet (HFD; 60% energy
as fat; D12492, Research Diets, New Brunswick, NJ) until 20 weeks (Fig. 1A).
In vivo metabolic testing
Intraperitoneal glucose (2 g/kg body wt.) and insulin (0.8 unit/kg body wt.) tolerance
tests were performed in unrestrained conscious mice after a 16- and 4h-fast,
respectively. Serum insulin level was assessed at overnight fasted state (time 0) and
30 min after glucose injection (Crystal Chem, Downers Grove, IL).
Serum analysis
Serum cholesterol, triglyceride, non-esterified fatty acids, high- and low-density
lipoprotein were assayed using a biochemical analyzer (TBA120FR, Toshiba, Tokyo,
Japan). Serum leptin was determined by radioimmunoassay (North Institute, Beijing,
China). HOMA-IR was calculated as follows: fasting serum insulin concentration
(μU/ml) multiplied by fasting blood glucose level (mg/dl) divided by 405 (25).
Islet isolation and in vitro insulin secretion Diabetes Page 8 of 45
Pancreatic islets were isolated from 20-week-old mice as previously described (26)
For indicated experiment, ten islets (size-matched for each batches) were incubated
for 1 h at 37 °C in KRB buffer containing 2.8 mM glucose, and then incubated in the
KRB buffer containing indicated glucose or various chemical compounds including
200 μM tolbutamide (Sigma), 250 μM diazoxide (Sigma), 2 μM Bay K8644 (Sigma)
and 10 μM nifedipine (Sigma). The supernatant was collected for insulin content assay (Abnova, Taiwan, China).
In fetal mice of embryonic day 17 (E17), the pancreas was directly digested in 2 mg/mL collagenase with shaking incubation at 37°C for 25 min. After recover overnight in RPMI medium, fetal islets were handpicked under a stereomicroscope and randomly separated into 5.6 mM, 16.7/5.6 mM and 16.7 mM glucose groups (Fig.
6A).
Methylated DNA Immunoprecipitaton Sequencing (MeDIP-seq)
Male offspring receiving NCD at 20 week of age were chosen for MeDIP-seq analysis. Genomic DNA of pancreatic islets was extracted from nine mice per groups and pooled by each of the three. The MeDIP-seq was performed as described previously (27). Briefly, DNA was sonicated to obtain the DNA fragments (200-700 bp). Sonicated genomic DNA was denatured and immunoprecipitated with anti-5-methylcytosine antibody (#28692, Cell Signaling, Danvers, MA). Illumina libraries were then created from the captured DNA by TruSeq® DNA LT Sample Page 9 of 45 Diabetes
Prep Kit (Illumina, San Diego, CA). The samples were sequenced on Illumina
HiSeq3000 (Illumina).
Gene expression
Total RNA from isolated pancreatic islets was extracted by using RNeasy Micro Kit
(Qiagen, Valencia, CA). cDNA was synthesized using oligo-dT and random primers
(TaKaRa, Dalian, China) for real-time quantitative PCR with SYBR Green detection
(TaKaRa). All primer sequences are shown in Table s1.
DNA methylation
Genomic DNA was extracted from islets by using TIANmap Micro DNA kit
(Tiangen, Beijing, China). Bisulfite was converted using the EpiTect bisulfite kit
(Qiagen) according to the manufacturer’s instructions. Methylation status of gene
promoter regions was analyzed by pyrosequencing (28). In brief, pyrosequencing
primers were designed by Qiagen PyroMark Assay Design software 2.0 (Qiagen)
(Table s2). Specificity of each PCR product was checked by agarose gel analysis.
Pyrosequencing was conducted on a PyroMark Q24 pyrosequencer (Qiagen) by using
PyroMark Gold Q24 reagents (Qiagen), and quantification of methylated and
unmethylated alleles were performed by Pyro Q24 software (Qiagen).
Immunofluorescence Analysis
Fetal islets were identified by detecting insulin with Immunofluorescence as Diabetes Page 10 of 45
previously described (29). Isolated fetal islets were incubated with antibody against insulin. All immunofluorescence images were acquired by laser scanning confocal microscope (Zeiss, Jena, Germany). A description of the antibodies used is shown in
Table s3.
Western Blots
The protein was extracted from mouse islets as described before (29). Samples were separated using 8% SDS/PAGE. Western blots were performed using PVDF membrane and the antibodies which were summarized in the Table s3. Protein bands were visualized by ECL system (Pierce, Rockford, IL).
STZ-treated non-diabetic Model
The identical amount of STZ was injected in pregnant mice as described above. Only glucose level less than 7.5 mM was considered as an STZ-treated nondiabetic model.
Offspring were fostered by normal females until 3-week-old. HFD, GTT and ITT were performed as described above. Islets from the STZ-treated non-diabetic offspring were isolated for further analysis.
Statistically Analysis
All data are shown as mean ± SEM. Statistical analysis were performed by one-way
ANOVA followed by LSD post hoc test, and two-tailed Student test as described in Page 11 of 45 Diabetes
the Table and Figure legends (SPSS 17.0). P < 0.05 was considered statistically
significant. Diabetes Page 12 of 45
Results
Insulin therapy of GDM conferred offspring a partial protection from metabolic disorders.
We established a mouse model of hyperglycemia during the mid-late stage of pregnancy. GDM dams were averaging 328.6 mg/dl of plasma glucose level after twice STZ injection. Blood glucose level declined and averaged 129.5 mg/dl during insulin therapy in INS group (Fig. 1B). Gestational length, litter size and birth weight were similar among the three groups (Table s4, Fig. s1).
Notably, increased body weight and most metabolic abnormalities were seen in
GDM-F1 adult offspring (Fig. 1C and D, Table 1). Insulin therapy was associated with normal weight trajectory, serum glucose and lipid metabolism in adult offspring
(Fig. 1C and D, Table 1). However, these associations were observed only in NCD offspring. When fed with HFD after 8 weeks of age, a significant increase in body weight (Fig. 1C), fasting insulin levels, and lipid levels were seen in INS-F1 males
(Table1). Females in HFD INS-F1 group only exhibited increased body weight compared with HFD Ctrl-F1 females (Fig. 1D).
Insulin therapy-mediated protection against glucose intolerance in offspring was abolished by an exposure to high-fat diet in adulthood
Insulin therapy of GDM resulted in a distinct rescue of glucose intolerance in INS-F1 Page 13 of 45 Diabetes
male offspring, with only an increase in glucose levels at 60 min after injection (Fig.
1E). But strikingly, HFD abolished this protection (Fig. 1E). When subjected to
insulin tolerance test (ITT), only GDM-F1 male mice exhibited significant impaired
insulin sensitivity with aging in NCD group (Fig. s2B, Fig. 1G). However, when
challenged with HFD, not only GDM-F1 males developed much more serious insulin
intolerance, INS-F1 males also exhibited a pronounced impairment of insulin
tolerance compared with controls (Fig. 1G). In female offspring, only GDM-F1
females showed an elevation of glucose level at 30 and 120 min after insulin injection
(Fig. 1H).
Defect of insulin secretion could also contribute to glucose intolerance. We assessed
glucose-stimulated-insulin-secretion (GSIS) in vivo and in vitro. In vivo,
glucose-stimulating insulin secretion was reduced in both male and female GDM-F1
offspring (Fig. 2A - D). In INS-F1 group, only males exhibited lower insulin levels in
response to glucose injection (Fig. 2A and B). In vitro, insulin secretory response to
5.6 mM glucose was similar among all groups (Fig. 2E and F). However, islets of
GDM-F1 males or females showed impaired insulin secretion when exposure to 16.7
mM glucose (Fig. 2E and F). Defective insulin response to high glucose (16.7 mM)
was also seen in INS-F1 males (Fig. 2E). No significant difference was found in
INS-F1 females in terms of glucose tolerance, insulin sensitivity, or glucose
stimulated insulin secretion (Fig. 1F and H, Fig. 2C, D and F). Diabetes Page 14 of 45
Insulin therapy of GDM did not restore the altered DNA methylation in
offspring pancreatic islets
Gestational diabetes altered the methylation of 220 (8.11 %) upstream 2k, 201
(7.41 %) downstream 2k, 77 (2.84 %) 5′UTR, 55 (2.03 %) 3′UTR, 711 (26.2 %) CDS,
and 1448 (53.37 %) intron element-associated genes (Fig. 3B, Table s5) in islets of
GDM-F1 male offspring, respectively. Global cytosine methylation status was also
altered in INS-F1 offspring and the methylation of 258 (8.37 %) upstream2k, 237
(7.69 %) downstream2k, 81 (2.63 %) 5′UTR, 70 (2.27 %) 3′UTR, 745 (24.17 %)
CDS, and 1690 (54.83 %) intron element-associated genes were changed, respectively
(Fig. 3B, Table s6). In GDM-F1, 1326 element-associated hypermethylated genes,
326 were also hypermethylated in INS-F1 islets (Fig. 3C), and 1350
element-associated hypomethylated genes, 493 were also hypomethylated in INS-F1
(Fig. 3D).
KEGG (Kyoto Encydopedia of gens and Genomes) analysis showed that the
differentially methylated genes in GDM-F1 and INS-F1 mainly encoded the ion
channels in islet β-cell, and are involved in insulin secretion. These genes selected for
validation were the following: Abcc8 (encoding sulfonylurea receptor 1, Sur1, belonged to ATP-binding cassette superfamily of transporters), Cacna1c (Cav1.2,
encoding one subunit of L-type Ca2+ channels with widespread expression in mouse, rat and human islets β-cell), Cacna1e (Cav2.3, encoding R-type Ca2+ channel and
expressed in rodent and human), and Cacna1g (Cav3.1, encoding T-type Ca2+ current Page 15 of 45 Diabetes
and mainly expressed in NOD mouse, rat and human) (Fig. 3E). MeDIP-seq data
showed that candidate genes above displayed hypermethylation status in GDM and
INS offspring islets compared with controls.
Insulin therapy of GDM did not restore the altered expression of ion channels
and the defective insulin secretion in offspring pancreatic islets.
The mRNA and protein levels of Abcc8, Cav1.2 and Cav2.3 were all significantly
lower in GDM-F1 and INS-F1 males (Fig.4A-G). Additionally, HFD exposure
down-regulated Cav1.2 expression in all groups, but GDM-F1 and INS-F1 males
showed dramatically decreased expression of Cav1.2 after HFD-feeding (Fig.4B, D
and F). The similar alteration of gene expression was also seen in GDM-F1 females
(Fig. s3A-C). But in INS-F1 females, only Cav2.3 showed decreased expression (Fig.
s3C). There was no significant difference in Cav3.1 expression among groups (data
not shown).
Further, insulin secretion responses to ion channel agonists and inhibitors were tested
in the isolated pancreatic islets from male offspring. Tolbutamine, a KATP channel
blocker, stimulated insulin release by 5.52 fold in NCD control islets and 5.05 fold in
HFD control islets, respectively, but tolbutamine responses were significantly reduced
in GDM-F1 and INS-F1 groups (Fig. 4H). Diazoxide, a KATP channel agonist,
significantly inhibited insulin secretion in control islets, but did not have such a
significant effect on GDM-F1 and INS-F1 (Fig. 4I). Bay K8644, a L-type Ca2+ Diabetes Page 16 of 45
channels agonist, stimulated insulin secretion by 25.18 fold in NCD controls, but
islets from GDM-F1 and INS-F1 mice showed decreased insulin secretion by 13.13
fold and 16.35 fold in response to Bay K8644, respectively (Fig. 4J). Additionally,
HFD exposure reduced the responses to Bay K8644 in control islets, but a more
significant decreased insulin secretion was observed in HFD-fed GDM-F1 and
INS-F1 islets (Fig. 4J). Nifedipine, a L-type Ca2+ channels inhibitor, significantly suppressed insulin secretion in control islets, but nifedipine revealed a minor decrement of insulin secretion in INS-F1, and a minimal suppression in GDM-F1
(Fig. 4K). The inhibitory effect of nifedipine on insulin secretion was not significantly affected by HFD exposure, although insulin secretion showed trends to increased levels in GDM-F1 and INS-F1 HFD males (Fig. 4K).
Insulin therapy of GDM did not reverse the altered DNA methylation status in
Abcc8, Cav1.2, and Cav2.3 in offspring pancreatic islets.
Pancreatic islets of 20-week-old offspring were isolated and analyze the methylation
status of 10 cytosine phosphate guanine (CpGs) of Abcc8 promoter, 10 CpGs of Cav
1.2 promoter, and 11 CpGs of Cav 2.3 promoter by pyrosequencing. The CpGs of
Abcc8, Cav1.2 and Cav2.3 showed significant higher DNA methylation status in islets
of both GDM-F1 and INS-F1 males (Fig. 5A-C). Compared with GDM-F1 males,
altered DNA methylation status in Cav1.2 and Cav2.3 were improved to different
degree in INS-F1 males (Fig. 5B and C). Further, we found that the effect of GDM
treatment on DNA methylation in the three targets genes with sex-specific difference Page 17 of 45 Diabetes
(Fig.5 and Fig. s3). Notably, maternal glycemic control was associated with a distinct
restoration of DNA methylation levels in Abcc8 and Cav1.2 in INS-F1 females (Fig.
s3D and E), and a moderate hypermethylated level in Cav2.3 promoter regions (Fig.
s3F). Additionally, HFD-feeding caused a significantly higher DNA methylated level
at Cav1.2 promoter regions in GDM and INS offspring (Fig. 4B, Fig. s3E), but the
effect of HFD on DNA methylation was not found in Abcc8 and Cav2.3.
Effect of high glucose on fetal islets gene expression and DNA methylation
We collected islets from normal E17 mice to verify whether high glucose
environment directly affected islet gene expression and DNA methylation. Treating
fetal islets with high glucose (16.7 mM) for the entire 6-day significantly increased
Abcc8, Cav1.2 and Cav2.3 promoter DNA methylation levels and reduced their gene
expression compared to physiological glucose level (5.6 mM) (Fig. 6C, F-H). In
16.7/5.6 mM group, the increased Abcc8, Cav1.2 and Cav2.3 DNA methylation levels
and reduced gene transcription persisted during subsequent culture at 5.6 mM glucose
(Fig. 6C, F-H). Moreover, we examined DNA methylation enzyme (Dnmts) and
demethylation enzyme (TETs) expression in fetal islet after high glucose exposure.
We found that Dnmt1, not Dnmt3a/3b, expression level was up-regulated in both 16.7
mM and 16.7/5.6 mM groups (Fig. 6D), and TET2 and TET3, not TET1, expression
levels were also down-regulated in 16.7 mM and 16.7/5.6 mM groups (Fig. 6E).
Assessment of STZ's effect on offspring metabolism and gene expression Diabetes Page 18 of 45
STZ, a cytotoxic agent, is targeted to islet β cells to induce diabetes in specific species
(30). In contrast to adult pancreatic β cells, STZ had no cytotoxic effect on fetal pro-islets (31). Although STZ does cross the placenta to a limited extent, it is evident that fetal pancreas does not concentrate this cytotoxic agent (32). Furthermore, STZ's half-life is very short (5-15min) in vivo (30), but differentiation of pancreatic endocrine cells occurs after the Day 15 of gestation in mouse (33), implying that low dose of STZ may not directly act for offspring metabolic dysfunction and alterations in gene expression. To further evaluate STZ's effect on offspring, we collected the
STZ-alone-treated non-diabetic pregnant mice. No significant difference was found with respect to glucose tolerance, insulin sensitivity in NCD or HFD offspring between STZ-treated and control group (Fig s4). qPCR analysis also showed that no significant changes in ion channel expression in STZ-treated group (Fig s5). Page 19 of 45 Diabetes
Discussion
In this study, we provide the first experimental evidence addressing the effects of
insulin therapy on GDM offspring long-term metabolic health. Insulin therapy
resulted in a significant improvement of metabolic disorders in offspring fed with
NCD. But importantly, in response to HFD, the offspring developed significantly
exacerbated glucose intolerance, obesity, and insulin resistance. These abnormalities
were more obvious in males than in females, suggesting that males might be more
vulnerable to the adverse environment. The findings indicate that predisposition to
metabolic disorders still persisted in offspring even with efficient insulin therapy of
GDM, and was significantly enhanced by HFD challenge.
For the offspring with insulin therapy of GDM, impaired glucose tolerance (IGT) is
an early key phenotype with a major contribution from β-cell dysfunctions. Both in
vivo and in vitro experiments confirm that the offspring exhibited reduced
glucose-stimulated insulin secretion. Epigenetic modifications provide a plausible link
between intrauterine environment and alterations in gene expression that may lead to
disease phenotype (17). In accordance with the sex differences of phenotypes, the
alterations in gene expression and DNA methylation were also more obvious in males
than that in females. In the male offspring, Medip-seq data of pancreatic islets showed
hypermethylated status of insulin secretion regulating genes, including ion channel
genes Abcc8, Cav1.2 and Cav2.3. Consistently, downregulated expression of Abcc8, Diabetes Page 20 of 45
2+ Cav1.2 and Cav2.3, and impairment of KATP and L-type Ca channels mediated insulin secretion were observed. However, the female offspring only exhibited higher
DNA methylation and lower expression of Cav2.3, suggesting that at least at the
promoter regions of the three target genes, the epigenetic modification of male fetus
might be more sensitive to the intrauterine hyperglycemia than female.
The Abcc8, Cav1.2 and Cav2.3 are all important ion channel genes but with different
functions in pancreatic islets. In agreement, Abcc8 encodes a regulatory subunit of
KATP channel, coupling the blood glucose level to membrane electricity activity and
insulin secretion (34). Abcc8-/- mice display moderate glucose intolerance, isolated
islets from Abcc8-/- mice show impaired first-phase insulin secretion and response to
tolbutamide (35). Cav1.2, encoding a subunit of L-type calcium channel, functions as
an important role in Ca2+ entry pathway (36). Pancreatic β-cell selective Cav1.2
ablation decreases whole cell Ca2+ current by only 45%, but almost abolishes
first-phase insulin secretion and causes glucose intolerance (37). In contrast, Cav2.3
mediates the second phase of insulin secretion, involving in recruiting insulin granules
from pools which are not immediately available to release insulin when glucose
loaded (38, 39). Isolated islets from Cav2.3-/- mice exhibited reduced insulin content
but normal GSIS, implying that the Cav2.3-deficiency may be offset by other
compensatory mechanisms (40). This may explain the sex different phenotype in
offspring after insulin therapy of GDM. Compare with the obvious glucose
intolerance of male offspring, the female offspring with decreased expression of Page 21 of 45 Diabetes
Cav2.3 alone showed normal glucose tolerance and GSIS.
Further, in vitro culture confirmed the effect of short high glucose exposure on Abcc8,
Cav1.2 and Cav2.3 gene expression and DNA methylation in fetal islets. Our animal
model, together with in vitro culture, provide evidence that early development is
sensitive to the extrinsic factors (41), and short exposure to intrauterine
hyperglycemia is sufficient to persistently affect ion channel gene expression and
DNA methylation. Although direct transfer of our experimental results to the human
situation warrants caution, it is important to recognize that one of the major
difficulties with GDM is symptoms-free, and the pregnant woman is usually unaware
that she has GDM until it is diagnosed at routine prenatal screening (42), suggesting
that the fetus might already be exposed to the adverse intrauterine environment and
exhibit adaptive changes in epigenome (43). Additionally, in vitro experiment showed
that the altered gene expression of DNA methyl-writing and methyl-erasing enzymes
persisted during subsequent normal glucose culture, indicating that other deleterious
factors induced by hyperglycemia may also contribute to the sustained epigenetic
alterations. Maternal glucose can freely permeate the placenta, and glucose excursions
not only cause fetal hyperglycemia, but also induce fetal hyperinsulinemia and
oxidative stress (44, 45). Although insulin therapy of GDM normalized maternal
blood glucose level, it was unknown whether insulin intervention reversed other
adverse factors. If not, they may persist to affect fetal development and epigenetic
modifications (45). Diabetes Page 22 of 45
Postnatal environment conditions are also important cues for inducing adult metabolic diseases (46). In our study, HFD exposure exacerbated glucose intolerance. But importantly, this HFD-induced prediabetic state in GDM offspring, whether with insulin therapy or not, was more severe than that observed in control offspring, suggesting that early fetal insult could impair the ability to adapt HFD. In postnatal life, extrinsic factors can affect the epigenome postnatally as well (46-48).
Consistently, we found that HFD caused a higher DNA methylation level of Cav1.2.
However, compared with control offspring, the pre- and postnatal factors act synergistically to induce a more significant hypermethylated level of Cav1.2 in the offspring with insulin therapy for GDM, which may partly contribute to the exacerbated glucose intolerance after HFD exposure. An additional factor likely to be responsible for the exacerbated glucose intolerance is insulin resistance. Defective insulin secretion and action are two major causes to diabetes mellitus (49, 50).
Notably, even with insulin therapy of GDM, insulin resistance arises when the offspring were challenged with HFD in adulthood. While the underlying mechanisms are still unknown, it is interesting to note that these offspring in HFD group displayed significant obese phenotypes, suggesting that insulin resistance might be associated with the overweight and lipid metabolism disorders.
In summary, our study provides novel experimental evidence about the effects of insulin therapy of GDM on offspring long-term health, revealing that these offspring Page 23 of 45 Diabetes
are still susceptible to metabolic disorders, especially exposed to adverse postnatal
environment. Although our finding was generated in mouse model, it is important to
recognize that even with efficient insulin therapy of GDM, the follow-ups and
lifestyle interventions are still necessary to the offspring during postnatal life. Further,
the results show that short exposure to maternal diabetes during early development is
sufficient to cause persistent alterations in DNA methylation and expression of genes
that regulate insulin secretion, suggesting a methylation-mediated epigenetic
mechanism for GDM-induced intergenerational glucose intolerance. These altered
epigenetic markers not only partly explained the susceptibility in GDM offspring, but
importantly, will hopefully allow for the early diagnosis and therapy of individuals
with a propensity for adult-onset disease. In light of our results, efficacious screenings
and more early interventions should be administrated in GDM patients. More
importantly, further elucidation of the molecular events that enable prior to glycemic
control to result in offspring protection may lead to the development of new
approaches for reducing the fetal originated adult diseases. Diabetes Page 24 of 45
Acknowledgements
Funding
This work was supported by the Special Fund for the National Key Research and
Development Plan Grant (No. 2017YFC1001300), the National Natural Science
Foundation of China (No. 31671569, No. 81490742, No. 31471405 and No.
31571556), the Municipal Human Resources Development Program for Outstanding
Young Talents in Medical and Health Sciences in Shanghai (No. 2017YQ047) and the
Fundamental Research Funds for the Central Universities.
Author contributions
H.Z. and B.C. designed and performed experiments, analyzed data. Y.C., Y.Z. and
Y.-S.Y. contributed to study design, conducted experiments and assisted with the data analysis. H.Z., G.-L.D. wrote and edited the manuscript. J.-Z.S. contributed to the study design and discussion, and edited the manuscript. Q.L. and Y.J. contributed to the discussion and edited the manuscript. G.-L.D. and H.-F.H. designed and supervised the research, contributed to discussion and edited the manuscript. H.-F.H. is the guarantor of this work and, as such, had full access to all data in the study and takes responsibility for the integrity and accuracy of data analysis.
Conflict of Interest
Authors have no potential conflicts of interest related to this article. Page 25 of 45 Diabetes
References:
1. Chiefari E, Arcidiacono B, Foti D, Brunetti A: Gestational diabetes mellitus: an updated overview. J Endocrinol Invest 2017; 40:899-909. 2. Rosenn B, Tsang RC: The effects of maternal diabetes on the fetus and neonate. Ann Clin Lab Sci 1991; 21:153-170. 3. Catalano PM, Kirwen JP, Mouzon SH, King J: Gestational Diabetes and Insulin Resistance: Role in Short- and Long-Term Implications for Mother and Fetus. J. Nutr. 2003; 133:1674S-1683S. 4. Dabelea D: The Predisposition to Obesity and Diabetes in Offspring of Diabetic Mothers. Diabetes Care 2007; 30: S169-S174. 5. Clausen TD, Mathiesen ER, Hansen T, Pedersen O, Jensen DM, Lauenborg J, Damm P: High Prevalence of Type 2 Diabetes and Pre-Diabetes in Adult Offspring of Women With Gestational Diabetes Mellitus or Type 1 Diabetes: The role of intrauterine hyperglycemia. Diabetes Care 2008; 31:340-346. 6. Ding G, Wang F, Shu J, Tian S, Jiang Y, Zhang D, Wang N, Luo Q, Zhang Y, Jin F, Leung PCK, Sheng J, Huang H: Transgenerational Glucose Intolerance With Igf2/H19 Epigenetic Alterations in Mouse Islet Induced by Intrauterine Hyperglycemia. Diabetes 10.2337/db11-1314, 2012 7. Clausen TD, Mathiesen ER, Hansen T, Pedersen O, Jensen DM, Lauenborg J, Schmidt L, Damm P: Overweight and the Metabolic Syndrome in Adult Offspring of Women with Diet-Treated Gestational Diabetes Mellitus or Type 1 Diabetes. J Clin Endocr Metab 2009; 94:2464-2470. 8. Aerts L, Vercruysse L, Van Assche FA: The endocrine pancreas in virgin and pregnant offspring of diabetic pregnant rats. Diabetes Res Clin Pract 1997; 38:9-19. 9. Amanda Bird Hoffert Gilmartin SHUJ: Gestational Diabetes Mellitus. Rev Obstet Gynecol. 2008; 3:129-134. 10. Crowther CA, Hiller JE, Moss JR, McPhee A, Jeffries WS, Robinson JS: Effect of Treatment of Gestational Diabetes Mellitus on Pregnancy Outcomes. N Engl J Med 2005; 352:2477-2486. 11.Landon MB, Spong CY, Thom E, Carpenter MW, Ramin SM, Casey B, Wapner RJ, Varner MW, Rouse DJ, Thorp JJM, Sciscione A, Catalano P, Harper M, Saade G, Lain KY, Sorokin YPAM, E. TJ, Anderson GB: A Multicenter, Randomized Trial of Treatment for Mild Gestational Diabetes. N Engl J Med 2009; 361:1339-1348. 12. Gillman MW, Oakey H, Baghurst PA, Volkmer RE, Robinson JS, Crowther CA: Effect of Treatment of Gestational Diabetes Mellitus on Obesity in the Next Generation. Diabetes Care 2010; 33:964-968. 13. Landon MB, Rice MM, Varner MW, Casey BM, Reddy UM, Wapner RJ, Rouse DJ, Biggio Jr. JR, Thorp JM, Chien EK, Saade G, Peaceman AM, Blackwell SC, VanDorsten JP: Mild Gestational Diabetes Mellitus and Long-Term Child Health. Diabetes Care 2015; 38:445-452. 14. Dabelea D, Crume T: Maternal Environment and the Transgenerational Cycle of Obesity and Diabetes. Diabetes 2011; 60:1849-1855. 15. Sundrani DP, Roy SS, Jadhav AT, Joshi SR: Sex-specific differences and developmental programming for diseases in later life. Reprod Fert Develop, 2017, 29, 2085–2099. 16. Lingwood BE, Mortimer RH, Henry AM, d’Emden MC, Colditz PB, LÊ Cao KA, Fullerton AM, Callaway LA: Determinants of body fat in infants of women with gestational diabetes mellitus differ Diabetes Page 26 of 45
with fetal sex. Diabetes Care 2011; 34: 2581–2585. 17.Jirtle RL, Skinner MK: Environmental epigenomics and disease susceptibility. Nat Rev Genet 2007; 8:253-262. 18.Klose RJ, Bird AP: Genomic DNA methylation: the mark and its mediators. Trends Biochem Sci 2006; 31:89-97. 19.Finer S, Mathews C, Lowe R, Smart M, Hillman S, Foo L, Sinha A, Williams D, Rakyan VK, Hitman GA: Maternal gestational diabetes is associated with genome-wide DNA methylation variation in placenta and cord blood of exposed offspring. Hum Mol Genet 2015; 24:3021-3029. 20.Ruchat SM, Hivert MF, Bouchard L. Epigenetic programming of obesity and diabetes by in utero exposure to gestational diabetes mellitus. Nutr Rev 2013;71(suppl. 1) S88-S94. 21.Buchanan TA, Xiang AH: Gestational diabetes mellitus. J Clin Invest 2005; 115:485-491. 22.Chia R, Achilli F, Festing MFW, Fisher EMC. The origins and uses of mouse outbred stocks. Nat Genet 2005; 37:1181-1186. 23.Zhang M, Lv X, Li J, Xu Z, Chen L: The Characterization of High-Fat Diet and Multiple Low-Dose Streptozotocin Induced Type 2 Diabetes Rat Model. Exp Diabetes Res 2008; 2008:1-9. 24.Wang MY, Chen L, Clark GO, Lee Y, Stevens RD, Ilkayeva OR, Wenner BR, Bain JR, Charron MJ, Newgard CB, Unger RH: Leptin therapy in insulin-deficient type I diabetes. P Natl Acad Sci USA 2010; 107:4813-4819. 25.Vogt MC, Paeger L, Hess S, Steculorum SM, Awazawa M, Hampel B, Neupert S, Nicholls HT, Mauer J, Hausen AC, Predel R, Kloppenburg P, Horvath TL, Bruning JC: Neonatal insulin action impairs hypothalamic neurocircuit formation in response to maternal high-fat feeding. Cell 2014; 156:495-509. 26.Martinez SC, Tanabe K, Cras-Meneur C, Abumrad NA, Bernal-Mizrachi E, Permutt MA: Inhibition of Foxo1 protects pancreatic islet beta-cells against fatty acid and endoplasmic reticulum stress-induced apoptosis. Diabetes,10.2337/db07-0595 27.Weber M, Hellmann I, Stadler MB, Ramos L, Pääbo S, Rebhan M, Schübeler D: Distribution, silencing potential and evolutionary impact of promoter DNA methylation in the human genome. Nat Genet 2007; 39:457-466. 28.Radford EJ, Ito M, Shi H, Corish JA, Yamazawa K, Isganaitis E, Seisenberger S, Hore TA, Reik W, Erkek S, Peters AHFM, Patti ME, Ferguson-Smith AC: In utero undernourishment perturbs the adult sperm methylome and intergenerational metabolism. Science 2014; 345:1255903. 29.Park SH, Ryu SY, Yu WJ, Han YE, Ji YS, Oh K, Sohn JW, Lim A, Jeon JP, Lee H, Lee KH, Lee
SH, Berggren PO, Jeon JH, Ho WK: Leptin promotes KATP channel trafficking by AMPK signaling in pancreatic β-cells. P Natl Acad Sci USA 2013; 110:12673-12678. 30.Srinivasan K, Ramarao P: Animal models in type 2 diabetes research: An overview. Indian J Med Res 2007; 3:451-472. 31.Liu X, Hering BJ, Brendel MD, Bretzel RG: The effect of streptozotocin on the function of fetal porcine and rat pancreatic (pro-) islets. Exp Clin Endocrinol 1994; 102:374-379. 32.Reynolds WA, Chez RA, Bhuyan BK, Neil GL: Placental transfer of streptozotocin in the rhesus monkey. Diabetes 1974; 23:777-782. 33.Pictet RL, Clark WR, Williams RH, Rutter WJ: An Ultrastructural Analysis of the Developing Embryonic Pancreas. Dev Biol 1972; 29:436-476. 34.Aguilar-Bryan L, Bryan J: Molecular biology of adenosine triphosphate-sensitive potassium channels. Endocr Rev 1999; 20:101-135. Page 27 of 45 Diabetes
35.Seghers V, Nakazaki M, DeMayo F, Aguilar-Bryan L, Bryan J: Sur1 Knockout Mice
A Model For KATP Channel-Independent Regulation Of Insulin Secretion. J Biol Chem 2000; 275:9270-9277. 36.Yang S, Berggren P: The Role of Voltage-Gated Calcium Channels in Pancreatic β -Cell Physiology and Pathophysiology. Endocr Rev 2006; 27:621-676. 37.Schulla V, Renström E, Feil R, Feil S, Franklin I, Gjinovci A, Jing X, Laux D, Ludquist I, Msgnuson MA, Obermüller S, Olofsson CS, Salehi A, Wendt A, Klugbauer N, Woollheim CB, Rorsman P, Hofmann F: Impaired insulin secretion and glucose tolerance in b cell-selective CaV1.2 Ca2+ channel null mice. The EMBO Journal 2003; 22:3844-3854. 38.Yang S, Berggren P: CaV2.3 channel and PKCλ: new players in insulin secretion. J Clin Invest 2005; 115:16-20. 39.Jing X, Li D, Olofsson CS, Salehi A, Surve VV, Caballero J, Ivarsson R, Lundquist I, Pereverzev A, Schneider T, Rorsman P, Renström E: CaV2.3 calcium channels control second-phase insulin release. J Clin Invest 2005; 115:146-154. 40.Drobinskaya I, Neumaier F, Pereverzev A, Hescheler J, Schneider T: Diethyldithiocarbamate-mediated zinc ion chelation reveals role of Cav2.3 channels in glucagon secretion. BBA-Mol Cell Res 2015; 1853:953-964. 41.Tobi EW, Lumey LH, Talens RP, Kremer D, Putter H, Stein AD, Slagboom PE, Heijmans BT: DNA methylation differences after exposure to prenatal famine are common and timing- and sex-specific. Hum Mol Genet 2009; 18:4046-4053. 42.Carolan-Olah MC: Educational and intervention programmes for gestational diabetes mellitus (GDM) management: An integrative review. Collegian 2016; 23:103-114. 43.Gluckman PD, Hanson MA, Cooper C, Thornburg KL: Effect of In Utero and Early-Life Conditions on Adult Health and Disease. N Engl J Med 2008; 359:61-73. 44.Metzger BELL, D. R. HDRM: Hyperglycemia and adverse pregnancy outcomes. N Engl J Med. 2008; 33:115-122. 45.Luo ZC, Fraser WD, Julien P, Deal CL, Audibert F, Smith GN, Xiong X, Walker M: Tracing the origins of “ fetal origins ” of adult diseases: Programming by oxidative stress? Med Hypotheses 2006; 66:38-44. 46.Srinivasan M, Patel MS: Metabolic programming in the immediate postnatal period. Trends Endocrin Met 2008; 19:146-152. 47.Feil R, Fraga MF: Epigenetics and the environment: emerging patterns and implications. Nat Rev Genet 2012; 13:97-109. 48.Newnham JP, Moss TJ, Nitsos I, Sloboda DM, Challis JR: Nutrition and the early origins of adult disease. Asia Pac J Clin Nutr 2002; 11 Suppl 3: S537-S542. 49.Muoio DM, Newgard CB: Molecular and metabolic mechanisms of insulin resistance and β-cell failure in type 2 diabetes. Nat Rev Mol Cell Bio 2008; 9:193-205. 50.White MF: Insulin Signaling in Health and Disease. Science 2003; 302:1710-1711. Diabetes Page 28 of 45
Table 1. Metabolic parameters in F1 offspring. NCD HFD Ctrl-F1 INS-F1 GDM-F1 Ctrl-F1 INS-F1 GDM-F1 Male(n) 8 10 9 8 11 11 TC (mM) 2.58±0.09 2.86±0.10 3.56±0.15**## 2.74±0.05 3.55±0.13* 3.82±0.37** TG (mM) 1.14±0.13 1.04±0.13 1.61±0.11*## 1.35±0.10 1.78±0.13 2.34±0.21**# NEFA(mM) 1.08±0.11 1.13±0.08 1.38±0.07*# 1.18±0.05 1.42±0.09* 1.6±0.08** HDL (mM) 1.74±0.10 1.80±0.11 1.98±0.08 1.61±0.18 1.52±0.09 1.78±0.14 LDL (mM) 0.99±0.08 1.02±0.06 1.28±0.08*# 0.90±0.17 1.51±0.10* 1.57±0.24* Leptin (ng/mL) 3.55±0.31 3.25±0.28 2.95±0.19 2.77±0.19 3.27±0.21 2.89±0.19 Glucose (mg/dL) 64.00±1.08 60.12±1.22 67.68±3.20# 71±5.82 77.38±3.30 83.69±3.77* Insulin (ng/mL) 0.20±0.03 0.21±0.03 0.30±0.02**## 0.29±0.02 0.71±0.06** 0.85±0.12** HOMA-IR 0.67±0.11 0.67±0.05 1.07±0.11**## 1.04±0.05 2.87±0.25** 3.74±0.55** Female (n) 8 8 10 8 10 10 TC (mM) 1.78±0.07 2.1±0.20 2.98±0.22**## 2.48±0.20 2.57±0.05 3.19±0.22*## TG (mM) 1.23±0.07 1.35±0.17 1.55±0.12 1.25±0.03 1.70±0.13 1.86±0.14* NEFA(mM) 1.33±0.09 1.37±0.08 1.76±0.12**## 1.40±0.06 1.52±0.11 2.03±0.15**## HDL (mM) 0.94±0.04 1.06±0.16 1.45±0.11**# 1.36±0.20 1.49±0.33 1.49±0.10 LDL (mM) 0.48±0.04 0.59±0.10 0.93±0.15**# 0.94±0.12 1.29±0.09 1.33±0.12 Leptin (ng/mL) 2.97±0.19 2.79±0.25 2.65±0.30 2.91±0.30 3.10±0.13 3.10±0.26 Glucose (mg/dL) 57.43±1.00 53.95±1.00 55.70±2.55 59.60±2.57 58.56±3.05 59.16±1.34 Insulin (ng/mL) 0.26±0.03 0.29±0.04 0.33±0.03 0.29±0.02 0.34±0.03 0.38±0.02* HOMA-IR 0.79±0.08 0.84±0.13 0.97±0.11 0.91±0.08 1.02±0.10 1.19±0.08* TC total cholesterol; TG triacylglycerol; HDL high-density lipoprotein; LDL low-density lipoprotein; NEFA non-esterified fatty acids. All parameters were measured at 20 weeks of age. All data were expressed as mean±S.E.M. *P <0.05 vs. Ctrl-F1, ** P <0.01 vs. Ctrl-F1. # P <0.05 vs. INS-F1, ## P <0.01 vs. INS-F1. Significance was determined by ANOVA. Page 29 of 45 Diabetes
Figure legends
Figure 1. Experimental design, offspring growth curves and glucose tolerance. (A) Experimental design. (B) Maternal blood glucose level during pregnancy (n = 6
mice per group). (C) Postnatal growth curves for male offspring (nCtrl-F1_NCD=8, nINS-F1_NCD=10, nGDM-F1_NCD=10, nCtrl-F1_HFD=8, nINS-F1_HFD=8, nGDM-F1_HFD=10). (D) Postnatal growth curves for female offspring (nCtrl-F1_NCD=7, nINS-F1_NCD=7, nGDM-F1_NCD=8, nCtrl-F1_HFD=6, nINS-F1_HFD=9, nGDM-F1_HFD=7). (E) Glucose tolerance test and AUC of 20-week-old F1 male offspring (nCtrl-F1_NCD=6, nINS-F1_NCD=7, nGDM-F1_NCD=7, nCtrl-F1_HFD=6, nINS-F1_HFD=7, nGDM-F1_HFD=6). (F) Glucose tolerance test and AUC of 20-week-old F1 female offspring (nCtrl-F1_NCD=5, nINS-F1_NCD=5, nGDM-F1_NCD=6, nCtrl-F1_HFD=5, nINS-F1_HFD=6, nGDM-F1_HFD=6). (G) Insulin tolerance test in 20-week-old F1 male offspring (nCtrl-F1_NCD=6, nINS-F1_NCD=8, nGDM-F1_NCD=6, nCtrl-F1_HFD=8, nINS-F1_HFD=9, nGDM-F1_HFD=10). (H) Insulin tolerance test in 20-week-old F1 female offspring (nCtrl-F1_NCD=5, nINS-F1_NCD=6, nGDM-F1_NCD=5, nCtrl-F1_HFD=6, nINS-F1_HFD=7, nGDM-F1_HFD=8). All data were expressed as mean±S.E.M. * P < 0.05 vs. Ctrl-F1; ** P < 0.01 vs. Ctrl-F1. # P < 0.05 vs. INS-F1; ## P < 0.01 vs. INS-F1 (ANOVA).
Figure 2. Glucose-stimulated insulin secretion. In vivo: (A) Serum insulin levels at fasting state and 30 min after glucose injection and (B) the fold change in serum insulin after glucose loaded in male offspring
(nCtrl-F1_NCD=7, nINS-F1_NCD=7, nGDM-F1_NCD=7, nCtrl-F1_HFD=7, nINS-F1_HFD=9, nGDM-F1_HFD=12). (C) Serum insulin levels at fasting state and 30 min after glucose injection and (D) the fold change in serum insulin after glucose loaded in female
offspring (nCtrl-F1_NCD=7, nINS-F1_NCD=8, nGDM-F1_NCD=10, nCtrl-F1_HFD=6, nINS-F1_HFD=6, nGDM-F1_HFD=7). In vitro: (E) Glucose stimulated insulin secretion in isolated islets from 20-week-old male offspring (n=5 mice per group). (F) Glucose stimulated insulin secretion in isolated islets from 20-week-old female offspring (n=5 mice per group). All data were expressed as mean±S.E.M. * P < 0.05 vs. Ctrl-F1, ** P < 0.01 vs. Ctrl-F1. # P < 0.05 vs. INS-F1; ## P < 0.01 vs. INS-F1 (ANOVA).
Figure 3. DNA methylation patterns in pancreatic islets of male offspring. (A) Heat map of differentially methylated DMRs between Ctrl-F1(C) and GDM-F1 (G), Ctrl-F1 (C) and INS-F1 (I). (B) Distribution of differentially methylated peaks within the genome in G vs. C and I vs. C. (C) Venn diagrams of hypermethylated genes overlapped between G vs. C and I vs. C. (D) Venn diagrams of hypomethylated genes overlapped between G vs. C and I vs. C. (E) KEGG analysis of differentially methylated genes associated with type 2 diabetes.
Figure 4. Ion channels expression and insulin secretion in the pancreatic islets of male offspring. (A-C) Representative mRNA levels of Abcc8, Cav1.2 and Cav2.3 in islets of Diabetes Page 30 of 45
20-week-old male offspring (nCtrl-F1_NCD=7, nINS-F1_NCD=6, nGDM-F1_NCD=8, nCtrl-F1_HFD=5, nINS-F1_HFD=6, nGDM-F1_HFD=6). (D-G) Representative protein levels of Abcc8, Cav1.2 and Cav2.3 in islets of 20-week-old male offspring (n=4 mice per group). (H) Tolbutamide (200 µM) - stimulated insulin secretion. (I) Diazoxide (250 µM) inhibit insulin secretion. (J) Bay K8644 (2 µM)-stimulated insulin secretion. (K) Nifedipine (10 µM) inhibit insulin secretion. Isolated 20-week-old islets, n=5 mice per group. All data were expressed as mean±S.E.M. * P < 0.05 vs. Ctrl-F1, ** P < 0.01 vs. Ctrl-F1; # P < 0.05 vs. INS-F1; ## P < 0.01 vs. INS-F1; § P < 0.05 vs. Ctrl-F1_NCD, §§ P < 0.01 vs. Ctrl-F1_NCD (ANOVA).
Figure 5. Analysis of DNA methylation level in male offspring pancreatic islets by pyrosequencing. (A) Methylation status of Abcc8 promoter regions, mean DNA methylation and average methylation in each CpG site in male offspring islets. (B) Methylation status of Cav1.2 promoter regions, mean DNA methylation and average methylation in each CpG site in male offspring islets. (C) Methylation status of Cav2.3 promoter regions, mean DNA methylation and average methylation in each CpG site in male offspring
islets. Data are expressed as methylation percentage of each CpG sites (nNCD=6 mice per group and nHFD=4 mice per group). * P < 0.05 vs. Ctrl-F1, ** P < 0.01 vs. Ctrl-F1; # P < 0.05 vs. INS-F1, ## P < 0.01 vs. INS-F1; § P < 0.05 vs. Ctrl-F1_NCD, §§ P < 0.01 vs. Ctrl-F1_NCD (ANOVA).
Figure 6. Fetal islets experiment in vitro. (A) Schematic representation of experimental design. (B) Fetal islets ex vivo were culture overnight and identified by detecting insulin with immunofluorescence. Black scale, 200 µm; White scale bar, 50 µm. (C-E): Expression levels of target genes, DNA methyltransferase genes and demethyltransferase genes in fetal islets (n=3 replicates per group, and 3 independent isolation). (F-H) Methylation status of Abcc8, Cav1.2 and Cav2.3 in fetal islets cultured in medium containing indicated glucose (n=3 replicates per group, and 2 independent isolation). All data were expressed as mean±S.E.M. * P < 0.05 vs. 5.6 mM, ** P < 0.01 vs. 5.6 mM; # P < 0.05 vs. 16.7/5.6 mM, ## P < 0.01 vs. 16.7/5.6 mM (ANOVA). Page 31 of 45 Diabetes
Figure 1 Diabetes Page 32 of 45
Figure 2 Page 33 of 45 Diabetes
Figure 3 Diabetes Page 34 of 45
Figure 4 Page 35 of 45 Diabetes
Figure 5 Diabetes Page 36 of 45
Figure 6 Page 37 of 45 Diabetes
Supplementary Tables and Figures
Table s1 Primers are used for RT-qPCR. Sequences are printed in the 5’ to 3’direction. Transcript Primers Abcc8 F: GGAGTGGACAGGACTGAAGG R: AGTCAAGGCGGAGACACAGA Cav1.2 F: CAGGAGGTGATGGAGAAGCCA R: CTGCAGGCGGAACCTGTTGTT Cav1.3 F: GGGGTCCAGCTGTTCAAGGGGAA R: GCATGATGAGGACGAACATCATG Cav2.3 F: CCGATGTCTGCTCCCAACATG R: CCTCCGATAAAGGCTGGGGTG Cav3.1 F: CACCAAGTCTGAGTCAGAGC R: TGATTTCATCTCATGATGGGC β-actin F: AGTGTGACGTTGACATCCGT R: GCAGCTCAGTAACAGTCCGC Dnmt1 F: ACCTGGAGAGCAGAAATGGC R:TCCTCGTAGCCACGGAACTA Dnmt3a F: CAGAGCCGCCTGAAGCC R: TCTTCCTTGCCACGGTTCTC Dnmt3b F: TCAGAAGGCTGGAGACCTCCCTCTT R:TTCAGTGACCAGTCCTCAGACACGAA TET1 F: AATGGGCCAACCAGGAAGAG R:GTTGTGTGAACCTGATTTATTGTGG TET2 F: ATATTGATGCGGAGGCGAGG R:CAAATCCTACAGGGCAGCCA TET3 F: TCCGGGAACTCATGGAGGAT R:GAACTCTTCCCCTCCTTGCC Diabetes Page 38 of 45
Table s2 Pyrosequencing primers. (Primers used at 100 nM)
Gene Primers Annealing [Btn] indicates biotinylated primer temp ℃ primer1 F: GGGGATTTTTTTGATTTATATTTAGTTGAG 55 R: [Btn]AACCCCCCCCTTCCAACTACTCTTATA S: TTTGGTTATTATTTTTATTTAGATA primer2 F: AGTGTAGAGATTAGTGAGGAATAGTG 56 Abcc8 R:[Btn] ACCCCTTCTAAAAAAAAATATAAAATTCCA S: TTTTTAGAGAGTTTGTATTTTAAGG primer3 F: AGAAGGGGTTTTTTTAGTTTAGAGGT 55 R: [Btn]AAATTATCAACATCTCCATCCATACT S: ATTTATAGTTTTTTAAGGTTGTG Primer1 F: ATGAAGAGTGTAAAGGGAGATG 55 R:[Btn] AATCCTAAATCCCACACACAAT S: TTAAGGAAAATGAGAATATTAATG Primer2 F: TTGTAAGGGTAGGATGTTAAGGAGTT 55 R: [Btn] ACCCCTATTTCTTCATTCTACTTTAACACT S: GTTAAGGAGTTGTTGG Primer3 F: GGTTATTAAAAGGAGTATTAAGATAGAGG 55 Cav1.2 R: [Btn] CACCTCCTAAAAACTTAATAAACTCT S: AAAATAGTTTTGTAGATTAGTAGTA Primer4 F: TTTTAGTTTAGTTTAATAGTTGGGGAGAGT 56 R: [Btn] AACCTTATCACCTTCTCCCTATCT S: ATTGGTTATAGTTTAGAGTTGTA Primer5 F: GAATAGGGGGGTTGGTGGTA 56 R: [Btn] CCATCTCAAAAACACCCTAATATATCTCC S: GAAGTTTGAGATGATTAAGT Primer1 F: TGAGGAAGTTAGGTATGTGGATTAAG 55 R: [Btn] AAAACAACCAAACCCAAATACCAACATC Cav2.3 S: TTGTATGTTGATTTTGGGA Primer2 F: GATTTAATAGTTTAGAGTAGGGTTGAAGA 55 R: [Btn] CACAAACAAACTCAAAACCTTATCC S: AGTTTGTAGGGGTTTTTA Page 39 of 45 Diabetes
Table s3 Information about antibodies for immunostaining.
Primary Antibody
1st Ab Company Cat. No. Dilution Application
Insulin Cell Signal #4590 1:100 IF
Abcc8 Abcam ab134292 1:2000 WB
Cav1.2 Abcam ab58552 1:200 WB
Cav2.3 Alomone Lab Acc-006 1:200 WB
Potassium ATPase Abcam ab76020 1:100000 WB
Second Antibody
2 nd Ab Company Cat. No. Dilution Application
Donkey anti-rabbit-Alexa 594 Jackson 711-585-192 1:200 IF
Goat anti-mouse H&L (HRP) Abcam ab6789 1:10000 WB
Goat anti-rabbit H&L (HRP) Abcam ab6721 1:10000 WB Diabetes Page 40 of 45
Table s4 Gestational length and litter size in F0 mice. Control-F0 INS-F0 GDM-F0 Gestational length 19.63 ± 0.48 19.00 ± 0.00 19.25 ± 0.48 (days) Litter size 10.83 ± 0.75 10.00 ± 0.37 10.33 ± 0.42 (n) All data were expressed as mean±S.E.M. (n=6 mice per group).
Table s5 Differentially methylated genes in pancreatic islets of GDM-F1 male offspring. (https://www.dropbox.com/s/t68tfyyp9pi1ms0/Table_s5.xlsx?dl=0)
Table s6 Differentially methylated genes in pancreatic islets of INS-F1 male offspring. (https://www.dropbox.com/s/clmb34q42fyhe6k/Table_s6.xlsx?dl=0) Page 41 of 45 Diabetes
Supplementary figures
Figure s1. Body weight at birth in F1 offspring. All data were expressed as mean±S.E.M. (n=20 mice per group, three litters) (ANOVA). Diabetes Page 42 of 45
Figure s2. GTT and ITT in F1 offspring at 8 weeks. (A) Glucose tolerance test (n=8 mice per group). (B) Insulin tolerance test in 8-week-old F1 offspring (in male offspring, nCtrl-F1=15, nINS-F1=11, nGDM-F1=15; in female offspring, nCtrl-F1=9, nINS-F1=7, nGDM-F1=10). All data were expressed as mean±S.E.M. * P < 0.05 vs. Ctrl-F1, ** P < 0.01 vs. Ctrl-F1; # P < 0.05 vs. INS-F1, ## P < 0.01 vs. INS-F1 (ANOVA). Page 43 of 45 Diabetes
Figure s3. Ion channels gene expression and DNA methylation status in female F1 offspring. (A-C) Ion channel gene expression in islets of GDM-F1 and INS- females offspring (n=5 mice per group). (D-F) Methylation status of Abcc8, Cav1.2
and Cav2.3 promoter regions in female offspring islets (nNCD=5 mice per group and nHFD=4 mice per group). All data were expressed as mean±S.E.M. * P < 0.05 vs. Ctrl-F1, ** P < 0.01 vs. Ctrl-F1; # P < 0.05 vs. INS-F1, ## P < 0.01 vs. INS-F1; § P < 0.05 vs. Ctrl-F1_ NCD; §§ P < 0.01 vs. Ctrl-F1_ NCD (ANOVA). Diabetes Page 44 of 45
Figure s4. GTT and ITT in F1 offspring of STZ-treated non-diabetic group. (A) Glucose tolerance test and AUC in 20-week-old offspring fed with NCD (in male
offspring, nControl=5, nSTZ-alone=7; in female offspring, nControl=6, nSTZ-alone=6). (B) Glucose tolerance test and AUC in 20-week-old offspring fed with HFD (in male
offspring, nControl=6, nSTZ-alone=6; in female offspring, nControl=5, nSTZ-alone=5). (C): Insulin tolerance test in 20-week-old offspring fed with NCD (in male offspring,
nControl=5, nSTZ-alone=7; in female offspring, nControl=6, nSTZ-alone=6). (D) Insulin tolerance test in 20-week-old offspring fed with HFD (in male offspring, nControl=6, nSTZ-alone=6; in female offspring, nControl=5, nSTZ-alone=5). All data were expressed as mean±S.E.M. Page 45 of 45 Diabetes
Figure s5. The expression levels of ion channel genes in STZ-treated non-diabetic offspring. (A) Expression levels of ion channel genes in STZ-treated non-diabetic offspring fed with NCD (n=5 mice per group). (B) Expression levels of ion channel genes in STZ-treated non-diabetic offspring fed with HFD (n=5 mice per group). All data were expressed as mean±S.E.M.