The physiological relevance of the G protein-coupled receptor P2Y14
Dissertation
zur Erlangung des akademischen Grades
Dr. med.
an der Medizinischen Fakultät
der Universität Leipzig
eingereicht von: Jaroslawna Meister
geb. am 27.05.1987 in Rudnyj, Kasachstan
angefertigt am: Institut für Biochemie
Medizinische Fakultät, Universität Leipzig
Betreuer: Prof. Dr. med. Torsten Schöneberg
Dr. rer. nat. Angela Schulz
Beschluss über die Verleihung des Doktorgrades vom: 18.11.2014
1 TABLE OF CONTENTS
TABLE OF CONTENTS ...... 2 BIBLIOGRAPHIC SUMMARY ...... 5 LIST OF FIGURES ...... 6 LIST OF TABLES ...... 7 LIST OF ABBREVIATIONS ...... 8 1 INTRODUCTION ...... 10
1.1 P2Y14 discovery as an orphan GPCR ...... 10
1.2 P2Y14 as a member of the P2Y12-like receptor group ...... 11
1.3 Ligand-binding studies and G-protein coupling of P2Y14 ...... 12
1.4 Physiological relevance of P2Y14 ...... 14 2 OBJECTIVES ...... 15 3 EXPERIMENTAL PROCEDURES...... 16 3.1 Materials ...... 16 3.2 Mice ...... 16
3.2.1 Generation of P2Y14-deficient mice ...... 16 3.2.2 Genotyping ...... 17
3.3 Basic characterization of P2Y14-deficient mice ...... 17 3.3.1 Morphology ...... 17 3.3.2 Quantitative expression analysis ...... 17 3.3.3 LacZ reporter gene assay ...... 18 3.3.4 Laboratory chemistry / histology ...... 18 3.3.5 Behavioral tests ...... 18 3.3.6 Assessment of hemodynamic parameters ...... 19 3.4 Smooth muscle function ...... 19 3.4.1 Gastrointestinal transit experiments ...... 19 3.4.2 Gastrointestinal contractility studies ...... 19 3.4.3 Airway responsiveness ...... 20 3.5 Metabolic studies ...... 20 3.5.1 Glucose and insulin tolerance tests ...... 20 2 3.5.2 Insulin secretion tests ...... 21 3.5.3 Morphometric analysis of pancreatic tissue ...... 21 3.6 Molecular and functional characterization of pancreatic islets...... 21 3.6.1 Islet isolation ...... 21 3.6.2 RNA-sequencing of pancreatic islets ...... 21 3.6.3 Insulin release experiments from isolated islets ...... 22 3.7 Cell culture, transfection and functional assays ...... 23 3.8 Statistical analyses and graphics ...... 23 4 RESULTS ...... 24
4.1 Basic characterization of P2Y14-deficient mice ...... 24
4.2 P2Y14 expression in mouse tissues ...... 30
4.3 Characterization of P2Y14 function in smooth muscles ...... 33
4.3.1 Delayed GI passage in P2Y14-deficient mice ...... 33
4.3.2 Altered airway responsiveness in P2Y14-deficient mice ...... 34
4.4 P2Y14 deficiency alters metabolic functions ...... 35
4.4.1 P2Y14 deficiency results in reduced glucose tolerance ...... 35 4.4.2 Challenging the metabolic phenotype with a western type diet...... 36 4.5 Normal architecture of pancreatic islets ...... 38
4.6 Components involved in insulin release are differentially expressed in P2Y14-deficient islets ...... 39
4.7 Reduced insulin release from pancreatic islets of P2Y14-deficient mice ...... 45
4.8 Functional characterization of mouse and human P2Y14 ...... 46 5 DISCUSSION ...... 49
5.1 P2Y14 deficiency is compatible with life ...... 49
5.2 P2Y14 is widely expressed in mouse tissues ...... 50
5.3 P2Y14 deficiency alters smooth muscle functions in GI tract and airways ...... 50
5.4 P2Y14 deficiency results in reduced glucose tolerance ...... 52
5.5 Reduced insulin release from P2Y14-deficient islets ...... 52 5.6 Conclusion ...... 54 6 SUMMARY...... 55
3 7 REFERENCES ...... 58 8 SUPPLEMENTAL MATERIAL (FIRST AUTHOR PUBLICATION)...... 66 ERKLÄRUNG ÜBER DIE EIGENSTÄNDIGE ABFASSUNG DER ARBEIT ...... 95 CURRICULUM VITAE ...... 96 PUBLICATIONS ...... 98 DANKSAGUNG ...... 99
4 BIBLIOGRAPHIC SUMMARY
Meister, Jaroslawna
The physiological relevance of the G protein-coupled receptor P2Y14
Universität Leipzig, Dissertation
100 pages, 93 references, 14 figures, 8 tables, 1 supplemental material
UDP-sugars were identified as extracellular signaling molecules, assigning a new function to these compounds in addition to their well-defined role in intracellular substrate metabolism and storage. Previously regarded as an orphan receptor, the G protein-coupled receptor
(GPCR) P2Y14 (GPR105) was found to bind extracellular UDP and UDP-sugars. Little is known about the physiological functions of this GPCR. To study its physiological role a gene- deficient (KO) mouse strain expressing the bacterial LacZ reporter gene was used to monitor the physiological expression pattern of P2Y14. P2Y14 is mainly expressed in pancreas and salivary glands and in subpopulations of smooth muscle cells of the gastrointestinal tract, bronchioles, blood vessels and uterus. Among other phenotypical differences KO mice showed a significantly impaired glucose tolerance following oral and intraperitoneal glucose application. An unchanged insulin tolerance points towards an altered pancreatic islet function. Transcriptome analysis of pancreatic islets showed that P2Y14 deficiency significantly changed expression of components involved in insulin secretion. Insulin secretion tests revealed a reduced insulin release from P2Y14-deficient islets highlighting
P2Y14 as a previously unappreciated modulator of proper insulin secretion.
5 LIST OF FIGURES
Fig. 1 Phylogenetic clustering of human P2Y receptors. 12
Fig. 2 Generation of a P2Y14-deficient mouse strain and P2Y14 qPCR design. 16
Fig. 3 Detection of bacterial LacZ reporter gene via β-galactosidase activity in 30 cryosections of selected organs.
Fig. 4 P2Y14 is expressed in a subpopulation of smooth muscle cells in the 31 gastrointestinal tract. Fig. 5 Detection of bacterial LacZ reporter gene in cryosections of pancreas. 32
Fig. 6 P2Y14 transcript and P2Y14-promoter-driven LacZ gene expression in mouse 33 tissues.
Fig. 7 P2Y14-deficient mice showed a delayed gastrointestinal emptying. 34
Fig. 8 Airway responsiveness is reduced in P2Y14-deficient mice. 35
Fig. 9 P2Y14-deficient mice showed reduced glucose tolerance. 36
Fig. 10 P2Y14-deficient mice showed diet-dependent lower serum insulin levels after 37 glucose administration.
Fig. 11 Normal architecture of pancreatic islets in P2Y14-deficient mice. 38
Fig. 12 Signaling pathways involved in insulin secretion from β-cells. 44
Fig. 13 Impaired insulin secretion of isolated pancreatic islets of P2Y14-deficient 46 mice.
Fig. 14 Testing UDP-glucose and UDP at P2Y14 in yeast and mammalian cells. 48
6 LIST OF TABLES
Tab. 1 Body and organ weights of P2Y14-deficient in comparison to WT mice. 24
Tab. 2 Higher blood pressure and pulse in P2Y14-deficient mice. 24 Tab. 3 Behavioral parameters. 25 Tab. 4 Hematology. 26 Tab. 5 Laboratory screen. 28
Tab. 6 Expression of selected transcripts related to insulin release in P2Y14- deficient and WT mice. 40
Tab. 7 Functional enrichment analysis of differentially expressed genes in P2Y14- deficient compared to WT mice. 42
Tab. 8 Functional measurements of mouse and human P2Y14 receptors. 47
7 LIST OF ABBREVIATIONS
ADP adenosine diphosphate ALAT alanine transaminase ASAT aspartate transaminase BMI body mass index bp base pair cAMP cyclic adenosine monophosphate Cch carbachol cDNA complementary desoxyribonucleic acid CNS central nervous system COPD chronic obstructive pulmonary disease COS-7 fibroblast-like cell line Ct threshold cycle DAG diacylglycerol DMEM Dulbecco’s modified Eagle's medium DMR dynamic mass redistribution DNA desoxyribonucleic acid ECMV Encephalomyocarditis virus ES-cell embryonic stem cell FPKM Fragments Per Kilobase of transcript per Million mapped reads GDP guanosine diphosphate GI gastrointestinal GLDH glutamate dehydrogenase GLUT2 glucose transporter 2 GO gene ontology GPCR G protein-coupled receptors GTP guanosine triphosphate HA hemagglutinin H&E hematoxylin and eosin HCT hematocrit HDL high-density lipoprotein HEK-293 human embryonic kidney 293 cells HGB hemoglobin
IP3 inositol (1,4,5)-trisphosphate
8 IRES internal ribosome entry site ITT insulin tolerance test KO knockout KRB Krebs-Ringer solution LacZ β-galactosidase gene LDL low-density lipoprotein loxP locus of X-over P1 MCH mean corpuscular hemoglobin MCHC mean corpuscular hemoglobin concentration MCV mean corpuscular volume MPV mean platelet volume mRNA messenger ribonucleic acid NPY neuropeptide Y OD optical density oGTT oral glucose tolerance test PBS phosphate buffered saline PKA protein kinase A PLCβ phospholipase Cβ PLT platelets qPCR quantitative real time polymerase chain reaction RBC red blood cell RDW red blood cell distribution width RGS regulator of G-protein signaling RMPI Roswell Park Memorial Institute medium SD standard deviation SEM standard error of the mean SNP single nucleotide polymorphism SPF specific pathogen free TAG triacylglycerol UDP uridine diphosphate UTR untranslated region VLDL very low-density lipoprotein WBC white blood cell WT wildtype
9 1 INTRODUCTION
In the regulation of virtual all physiological functions of the human organism, G protein- coupled receptors (GPCR) play a central role. GPCR are involved in the perception of environmental stimuli like light, smell or taste as well as in endocrine and neuronal signaling controlling both cognitive functions and unconscious homeostatic processes. This includes regulation of nutrient uptake, storage and utilization and energy balance, processes that are subject to great attention in metabolic disorder research. With their genes comprising 3% of the entire genome, GPCR form one of the largest protein families (1,2). These over 800 genes can be classified due to structural and physiological aspects. However, the recently used GRAFS classification system groups the receptors in following five classes using phylogenetic features: Glutamate (G), Rhodopsin (R), Adhesion (A), Frizzled/Taste2 (F), and Secretin (S) receptors (3). The most studied rhodopsin receptor class comprises about 700 GPCR, including nearly 400 odorant receptors.
Despite their activation by structurally different ligands and their high functional diversity every GPCR is shown to consist of seven transmembrane helices which are connected by three intracellular and three extracellular loops. Whereas the extracellular N-terminus is in charge of ligand binding, the intracellular C-terminus interacts with a heterotrimeric G protein that determines the downstream signaling. Upon ligand binding conformational changes in the receptor result in the exchange of GDP to GTP and dissociation of the α-subunit and the βγ- dimer of the G-protein complex. Both are able to activate further effectors (4). Usually G proteins are referred to by the isoform of their α-subunit. So far more than 20 isoforms have been identified which can be assigned to four major groups: Gs, Gi/o, Gq/11 and G12/13. Gs coupling stimulates, Gi/o coupling inhibits the adenylyl cyclase activity resulting in elevation or decrease of intracellular cAMP levels, respectively. Activation of Gq/11 subunit leads to generation of second messengers diacylglycerol (DAG) and inositol (1,4,5)-trisphosphate
(IP3) via activation of phosholipase Cβ (PLCβ) (5). G12/13 subunit mediates its signaling by stimulation of Rho guanine-nucleotide exchange factors. However, βγ-dimers as well are shown to affect the activity of ion channels, RGS proteins, and certain types of adenylyl cyclases and phospholipases C (6).
1.1 P2Y14 discovery as an orphan GPCR
Although the physiological function is known for many members of the family of GPCR and about 36% of currently approved drugs act via their activation (7), functional ligands have
10 not been identified yet for more than one hundred so-called orphan receptors. These receptors were predicted from DNA sequences which share sequence motifs characteristic of GPCR using homology screening techniques, such as degenerate polymerase chain reaction and low- stringency hybridization (8,9). In a classic approach, bioactive substances, that were potentially GPCR ligands, were used to identify the receptor. Cloning methods evolved in the late 1980’s and allowed to test possible ligands and tissue extracts on orphan GPCR expressed in heterologous cell systems. The serotonine 5-HT1A receptor (10) and the dopamine D2 receptor (11) were the first deorphanized GPCR. Using this so-called reverse pharmacology approach most of the identified GPCR were assigned to their endogenous agonists by academic research groups and pharmaceutical companies engaged in large-scale deorphanization efforts (9).
Thus, one of the studies discovered P2Y14 (formerly referred to as KIAA0001, VTR 15-20, GPR 105) as a GPCR. KIAA0001 was initially cloned from a human myeloid cell line and shows several attributes (e.g. seven transmembrane domains, consensus sequences for protein kinase phosphorylation, extracellular N-terminus) characteristic for GPCR (12,13). As known for diverse GPCR, the human P2Y14 gene as well shows genomic clustering with other
GPCR. P2Y14 is co-localized with P2Y12, P2Y13, GPR87 and GPR171 on the long arm of the chromosome 3 (14).
1.2 P2Y14 as a member of the P2Y12-like receptor group
P2Y14 belongs to the P2Y12–like receptor group within the family of rhodopsin-like receptors. P2 receptors are activated by extracellular purine and pyrimidine nucleotides and are subdivided into two main families, the P2X ionotropic ligand-gated ion channel receptors and the P2Y metabotropic GPCR. On the basis of their amino acid sequences the eight identified P2Y receptors form two distinct subgroups. The P2Y1 group includes P2Y1, P2Y2,
P2Y4, P2Y6, and P2Y11, whereas the P2Y12 group contains the P2Y12, P2Y13 and P2Y14.
Based on structural similarity and phylogenetic aspects the P2Y12–like receptor group comprises, additional to the above mentioned P2Y12-14 receptors, the orphan receptors GPR34, GPR82, GPR87, and GPR171 (Fig. 1). Phylogenetic analyses of this receptor family show the presence of these GPCR in cartilaginous and bony fishes suggesting their existence for more than 450 million years. The high degree of structural conservation within the P2Y12- like receptor group is a sign of selective constraint on the sequences during the evolution and emphasizes the importance of this group in regulating physiological functions (14).
11
Figure 1 Phylogenetic clustering of human P2Y receptors.
Based on phylogenetic and structural aspects the P2Y12-like receptor group forms a distinct subgroup within the P2Y receptors (14).
The most studied ADP receptor P2Y12 plays a significant role in platelet aggregation and several antithrombotic drugs like clopidogrel, ticagrelor and prasugrel target this GPCR in order to prevent myocardial infarction and strokes. Patients with inactivating mutations in
P2Y12 were shown to have bleeding disorders (15,16). A number of groups characterized the role of P2Y13 in cholesterol metabolism (17-19) and several ongoing studies discuss its influence in bone development (20-22). Knockout (KO) mouse studies revealed the involvement of the orphan GPR82 in energy homeostasis, and indeed, SNP variants in GPR82 could be associated with lower BMI in a human population (23). However, only little is known about the physiological relevance of the other members of the P2Y12-like receptor group.
1.3 Ligand-binding studies and G-protein coupling of P2Y14
In the past years, a number of P2Y12-like receptors were assigned to their endogenous agonists, including various substance classes like nucleotide derivates and lipids (24-27). 12 Thus, P2Y12-like receptor family seems to have high ligand promiscuity showing broad pharmacological profiles as known for other GPCR receptor groups like trace amine- associated receptors (28,29) and MAS-related GPCR (9).
In 2000, P2Y14 was deorphanized using the reverse pharmacology approach. Chambers et al. (30) screened several GPCR, expressed in a heterologous yeast cell system, against a huge library of potential GPCR agonists and found UDP-glucose to activate P2Y14. This was an interesting finding, since UDP-glucose was previously only known as a glucosyl donor in glycogen biosynthesis. Several closely related sugars like UDP-galactose, UDP-glucuronic acid and UDP-N-acetylglucosamine showed agonistic activity on this GPCR as well. These results were verified in mammalian HEK-293 cell both, transiently and stably expressing the
P2Y14 gene and the promiscuous G protein α-subunit Gα16 (30).
Chambers (30) as well studied the G-protein coupling of P2Y14 in GTPγS radioactive assays. UDP-glucose promoted GTPγS binding to endogenous G proteins could be blocked by pre- incubation of mammalian cells with pertussis toxin, indicating that P2Y14 mediates the inhibition of adenylyl cyclase via coupling to Gαi subunits. Fricks (31), Moore (32), Ko (33) and other colleagues used a more robust experimental approach to investigate the signal transduction pathway of this GPCR. Thus, a chimeric Gαqi4 subunit was coexpressed with 2+ P2Y14 to redirect the Gi signaling to the PLC-β pathway following Ca response. These experiments confirmed the preferred Gi coupling of P2Y14 stimulated with UDP-glucose and other UDP-activated sugars.
In more recent studies, UDP alone was controversially discussed as agonist for P2Y14. No agonistic activity of UDP and other P2Y receptor nucleotide ligands was seen in GTPγS binding assays of HEK-293 cells stably expressing P2Y14 (30). Scrivens et al. could not detect any effect of UDP on forskolin-stimulated cAMP levels in isolated human neutrophils and T-lymphocytes (34,35) and similar results were reported by Ko and his colleagues in
COS-7 cells transiently co-expressing the human P2Y14 and the Gqi5 protein (33). However, using different human receptor mutants of P2Y14 Ault and Broach tested antagonistic activity of UDP on UDP-glucose-mediated receptor stimulation (36). Subsequent analyses specified that the detected UDP antagonism was competitive (31). On the other hand, further studies with classic cAMP inhibition assays (37) and nonconventional methods like cellular impedance functional assays (38) described UDP as a potent agonist on human P2Y14.
13 1.4 Physiological relevance of P2Y14
Tissue distribution is often used to anticipate a possible function of a novel protein. P2Y14 mRNA expression and Northern blot analyses showed a widespread expression pattern including high expression levels in placenta, adipose tissue, stomach and intestine and moderate levels in spleen, lung, heart and different brain regions (32,39). P2Y14 was also detected in immune cells, such as B- and T-lymphocytes, neutrophils, dendritic cells, astrocytes, and microglia (32,34,35,40,41). Based on the high prevalence of this GPCR in the immune system, previous studies focused on elucidating the involvement of P2Y14 in immune and inflammatory responses. Indeed, expression of P2Y14 was upregulated following inflammatory injury (42) and similar results were shown by in vivo treatment with lipopolysaccharide for rat brain and spleen (13,32). P2Y14 was reported to mediate mast cell degranulation (43) and dendritic cell maturation by intracellular Ca2+ mobilization (41).
Further, Kook et al. (44) described protective effects of P2Y14 signaling pathway in response to radiation.
Functional studies regarding the high expression levels in the gastrointestinal tract revealed an influence of P2Y14 in gastric motility function, however Bassil et al. demonstrated that some effects of UDP-glucose were independent of P2Y14 signaling (45).
A very recent study identified P2Y14 as one of the 293 GPCR expressed in human pancreatic islets (46). It is known that GPCR play an important role in regulation of hormone secretion from pancreatic islets. Depending on their presence in one of the major islet cells (α-, β-, or δ- cells) the certain GPCR have a different impact on the release of glucagon, insulin or somatostatin (46). Interestingly, only a few GPCR targeting drugs (e.g. GLP-1 receptor agonist exenatide) are approved for the therapy of type 2 diabetes (46). For several nucleotide receptors (e.g. P2Y1, P2Y6, P2Y13) the influence on the secretion of insulin and glucagon has been shown (46). However, the particular cell type within the pancreatic islet that expresses
P2Y14 and its relevance in hormone secretion has not been studied yet.
Considering the fact, that GPCR are related to several endocrine disorders and even malignant diseases (47) and that GPCR are highly relevant as drug targets, previous P2Y14 studies showed enormous potential of this GPCR for future therapeutic applications, but the physiological relevance of P2Y14 still remains to be defined in more detail.
14 2 OBJECTIVES
The UDP-glucose receptor P2Y14 is a member of the P2Y12-like receptor group. Although UDP-sugars and UDP were identified as endogenous agonists of this GPCR the literature is controversial regarding their physiological role. Further, the physiology of P2Y14 is not understood in detail. Therefore, this study aimed at the physiological characterization of
P2Y14 function in vivo. Because high expression was found in the gastrointestinal system, the main focus of this study was directed on exploring a possible role of P2Y14 in the regulation of nutrient uptake and energy metabolism. Taking advantage of a P2Y14-deficient and LacZ- reporter mouse model the following questions were addressed:
1. Where is P2Y14 expressed in mice?
2. Does P2Y14 deficiency have a major impact on mouse ontogenesis?
3. Does P2Y14 influence smooth muscle function?
4. Does and how does P2Y14 affect the regulation of glucose homeostasis?
15 3 EXPERIMENTAL PROCEDURES
3.1 Materials
If not stated otherwise, all standard substances were obtained from Sigma-Aldrich (Taufkirchen, Germany), Merck (Darmstadt, Germany), and C. Roth GmbH (Karlsruhe, Germany). Cell culture material was purchased from Sarstedt (Nümbrecht, Germany).
3.2 Mice
All mice were maintained in a specific pathogen-free barrier facility on a 12-h light/12-h dark cycle with ad libitum access to water and food. Experiments were performed according to the accepted standards of animal care and were approved by the respective regional government agency of the State of Saxony, Germany (T27/11; T46/12; T07/13).
3.2.1 Generation of P2Y14-deficient mice
P2Y14-KO mice were generated at TAKEDA Ltd. (Cambridge, United Kingdom) by targeted disruption of the mouse P2Y14 locus and ES-cell blastocyst injection. Thus, most part of the coding region of P2Y14 was exchanged by a ß-galactosidase cassette harbouring an internal ribosome entry site (IRES) followed by a loxP-floxed neomycin cassette (Fig. 2).
Figure 2 Generation of a P2Y14-deficient mouse strain and P2Y14 qPCR design.
P2Y14-deficient mice were generated at TAKEDA Ltd.. The coding sequence was partly replaced by an ECMV-IRES / ß-galactosidase cassette followed by a loxP-floxed neomycin selection cassette. The neomycin cassette was removed by breeding with EIIa-Cre mice and successful removal was verified by PCR. For qPCR a primer pair matching to exons 1 and 2 was designed. Genotyping of mice was performed as described under 3.2.2 with primers indicated as: for, rev and ß-gal s.
16 Neomycin-resistant ES cells were screened for homologous recombination. Positive ES cell clones were injected into blastocysts. Chimeric offspring was fertile and crossed into a 129S6 background. These mice were crossed with EIIa-Cre mice (C57Bl/6 strain) to remove the neomycin cassette. Correct deletion was verified by PCR and sequencing of the locus. The resulting KO animals were bred with 129S6 animals and all studies were done on a mixed C57BL/6 x 129S6 background with predominance of 129S6. For experiments WT and KO littermates from intercrossed WT and KO parents were used.
3.2.2 Genotyping
Genotyping of mice was carried out by PCR with the following primers: ß-gal sense: 5’-AGAAGGCACATGGCTGAATATCGA-3’ forward: 5`-AGCTGCCGGACGAAGGAGACCCTGCTC-3’ reverse: 5’-GGTTTTGGAAACCTCTAGGTCATTCTG-3’ in two separate PCR reactions (Fig. 2): forward/reverse to amplify WT allele and ß-gal sense/reverse to amplify KO allele. The PCR conditions were 95°C for 3 minutes followed by 35 cycles with 45 sec 95°C, 60°C 30 sec and 72°C for 1 min and a final amplification step of 72°C for 10 min. Amplification of the WT allele and the KO allele resulted in 180-bp and 400-bp fragments, respectively. PCR products were separated via gel electrophoresis on a 2% agarose gel, stained with ethidium bromide, and visualized by ultraviolet illumination.
3.3 Basic characterization of P2Y14-deficient mice
3.3.1 Morphology
Three-month-old mice were inspected for differences in breeding, growth, weight and morphology. Heterozygous females were bred with heterozygous males to document the litter genotype distribution. Body and tail lengths of mice were measured. Animals were monitored for morphological abnormalities during coat, teeth and limb development. Organs were removed and weighed.
3.3.2 Quantitative expression analysis
Several tissues were removed from 3 WT and 3 KO mice and RNA was isolated using TRIZOL (Sigma-Aldrich, Taufkirchen, Germany) according to the manufacturer’s instructions. RNA quantity was measured with a spectrophotometer (Nanodrop ND 1000, NanoDrop products, Wilmington, USA) and RNA quality was controlled by gel electrophoresis. For quantitative real time PCR (qPCR) 1 µg of total RNA was reversely
17 transcribed (Superscript II RT, Invitrogen, Karlsruhe, Germany) using oligo-dT primers. qPCR was performed by Platinum SYBR Green qPCR SuperMix-UDG (Invitrogen) according to manufacturer’s instructions. Primers were designed for the intron-flanking exons 1 and 2 sequences (Fig. 2) to exclude genomic contaminations (sense: 5’- GAAGCCAGACGTGAAGGAGTT-3’; antisense: 5’-CAGGAATCTCAAAGGCAAGCT-3’) resulting in a 156-bp product. qPCR was performed with the MX 3000P instrument (Agilent Technologies GmbH, Boeblingen, Germany) using the following protocol: 2 min at 50 °C, 2 min at 95 °C, 40 cycles of 15 s at 95 °C and 30 s at 60 °C. A product dissociation curve was recorded to verify the presence of a single amplicon. Threshold cycle (Ct) values were determined during the exponential increase of the product in the PCR. After normalization to the house keeping gene ß2-microglobulin calculated ∆Ct values were used to determine the relative expression of P2Y14.
3.3.3 LacZ reporter gene assay
Tissue samples of several organs were prepared from WT and KO mice, covered in Tissue- Tek® (Sakura, Torrance, CA, USA) and snap frozen in liquid nitrogen. The organs were cryosectioned (10 µm) and fixed in acetone-methanol (1:1) solution. Sections were incubated with X-Gal staining solution (500 µg/ml X-gal in 3 mM potassium ferricyanide, 3 mM potassium ferrocyanide, 150 mM NaCl and 2 mM MgCl2 diluted in 0.45 mM HEPES buffer, pH 7.4) at 30 °C overnight to detect the expression of the LacZ reporter gene via ß- galactosidase activity. Following, nuclear fast red staining was performed.
3.3.4 Laboratory chemistry / histology
Serum levels of electrolytes, metabolites, enzymes and hormones were analyzed in three- month-old WT and KO mice according to the guidelines of the German Society of Clinical Chemistry and Laboratory Medicine, using a Hitachi PPE-Modular analyzer (Roche Diagnostics, Mannheim, Germany). Blood cell counting from EDTA blood samples was performed automatically (ScilVet abc; Scil corporation, Viernheim, Germany). Histological slices (5 μm) were prepared from organs being fixed in 4% formaldehyde solution and embedded in paraffin wax. Slices were stained with H&E.
3.3.5 Behavioral tests
The open field test was performed as reported previously (48) using automated measuring technology (TSE Systems, Bad Homburg, Germany). Activity of mice was recorded for a period of 5 min. In a hot plate test (Hot Plate 602001, TSE) the elapsed time until the first 18 reaction of the mice to the heat stimulus (52°C) was recorded. As endpoints shaking or licking of one of the hind paws or jumping off the analgesia meter were used.
3.3.6 Assessment of hemodynamic parameters
Blood pressure and pulse were determined by non-invasive tail-cuff method using the BP- 2000 Blood Pressure Analysis SystemTM (Visitech Systems, USA). Following manufacturer’s instructions, mice were trained to the procedure each day for at least 5 days prior to the actual experiment. After the training period 10 measurements per day of each mouse on 5 consecutive days were performed. Systolic blood pressure, diastolic blood pressure, mean arterial pressure, and pulse were calculated from daily experiments for each mouse and mean out of 10 animals per group was determined.
3.4 Smooth muscle function
3.4.1 Gastrointestinal transit experiments
A gastrointestinal emptying test was performed by oral application of 200 µl dye-labeled non-absorbable liquid dextran blue (20 mg/ml) to mice. Faeces were collected separately for each mouse hourly for 8 hours, vortexed with 300 µl phosphate buffered saline (PBS) and centrifuged at 13,000 rpm for 10 min. The amount of hourly excreted dextran blue was measured photometrical at 620 nm in supernatants. Mice that showed no excretion for at least 2 hours were excluded from the experiment. The sum of totally excreted dextran blue was set 100% and the relative expulsion of dextran blue was compared hourly between the WT and KO mice.
3.4.2 Gastrointestinal contractility studies
For contractility studies mice were sacrificed by cervical dislocation. The intestine from mice was harvested and placed in ice-cold Krebs-Ringer buffer (KRB, 117 mM NaCl, 4.7 mM KCl, 1.2 mM MgCl2, 1.2 mM NaH2PO4, 25 mM NaHCO3, 2.5 mM CaCl2, 11.5 mM glucose, pH 7.4). One cm long equal segments of intestine were placed in 50-ml organ baths
(37 °C) containing KRB solution and continuously gassed with 95% O2 and 5% CO2. To record the contractile activity, each intestine segment was connected to an isometric force transducer (MLT0201 Force Transducer; ADInstrumends GmbH, Spechbach, Germany). The basal tension was set to 10 mN. Intestine segments that did not show spontaneous activity were excluded from the experiment. After a 30 min equilibration phase the effects of 100 µM UDP-glucose and 100 µM carbachol (positive control) were tested. Each stimulation period
19 was monitored for at least 10 min. Intestine segments were washed three times after each stimulation period. Several parameters like mean muscle tension, average tension maximum and minimum, average amplitude, rate of contractions and the area under the curve were analyzed using Lab Chart software (ADInstruments). Data were normalized to recorded spontaneous activity and expressed in percentage.
3.4.3 Airway responsiveness
Lung resistance and dynamic compliance were measured by invasive plethysmography (emka TECHNOLOGIES, Paris, France) in response to inhaled UDP-glucose and methacholine (Sigma-Aldrich). Female mice were anesthetized (100 mg/kg ketamine and 10 mg/kg xylazine; Bayer Leverkusen, Germany), intubated and mechanically ventilated at a tidal volume of 0.2 ml and a frequency of 150 breath/min. Baseline lung resistance, dynamic compliance, and responses to aerosolized saline (0.9% NaCl) were measured first, followed by responses to 100 µM aerosolized UDP-glucose and increasing doses (10 to 80 mg/ml) of aerosolized methacholine (49).
3.5 Metabolic studies
One-month-old mice were kept on standard (Ssniff M-Z: 5% sugar, 4.5% raw fat, 34% starch, 22% raw protein) or western (Ssniff EF R/M TD88137: 32.8% sugar, 21.2% raw fat, 14.5% starch, 17.1% raw protein) type diet (Ssniff GmbH, Soest, Germany) for 3 months. During this period body-weight development was monitored weekly. All metabolic tests (see below) were performed in the same set of animals at the age of 4 months at the interval of one week.
3.5.1 Glucose and insulin tolerance tests
For glucose tolerance tests mice on a standard or a western type diet had been fasted overnight (15 h) and blood glucose levels were measured from tail vein blood before (0 min), 20, 40, 60 and 120 min after oral application (80 mg) or intraperitoneal injection (2 mg/g body weight) of glucose. For insulin tolerance tests blood glucose levels were measured before (0 min) and 15, 30 and 60 min after intraperitoneal injection of human insulin (0.75 U/kg body weight). Blood glucose levels were determined by using an automated blood glucose meter (FreestyleLite, Abbott Diabetes Care Ltd., Oxon, UK).
20 3.5.2 Insulin secretion tests
For insulin secretion tests mice fasted overnight were injected intraperitoneally with glucose (2 mg/g body weight) and blood samples were taken before (0 min), 20, 40 and 60 min after injection. Serum insulin concentrations were measured using an Ultra Sensitive Mouse Insulin Elisa Kit (Crystal Chem, Inc., Downers Grove, IL, USA) in accordance to manufacturer’s instructions.
3.5.3 Morphometric analysis of pancreatic tissue
Pancreata from 5 WT and 5 KO mice fed with western type diet were fixed in 4% formaldehyde and embedded in paraffin wax. Two longitudinal sections (4 µm) were generated every 100 µm of tissue. Each time, the first section was stained with H&E, the second immunostained for insulin with the avidin-biotin complex technique using anti-insulin monoclonal rabbit antibody (100 µg/ml, Cell Signalling, Millipore, Germany) and goat anti- rabbit secondary antibody (7.5 mg/ml, Vector Laboraties, Biozol Diagnostica, Germany). Both sections were photographed with a Zeiss Axioimager Z1 microscope (Carl Zeiss Jena GmbH, Jena, Germany). Ten H&E stained sections per mouse were analyzed for number and area size of pancreatic islets using NIH ImageJ software (http://rsbweb.nih.gov/ij/). For determination of ß-cell area per islet the insulin-positive area of at least 50 islets per mouse was calculated using NIH ImageJ software and related to the total islet area of the investigated slides.
3.6 Molecular and functional characterization of pancreatic islets
3.6.1 Islet isolation
Pancreatic islets were isolated as previously described (50-52). Briefly, mice were sacrificed by cervical dislocation and the pancreas was inflated by intraductal injection of ice- cold DMEM media containing 0.2 mg/ml (1.08 Wünsch Units) Liberase TL Research Grade (Roche Diagnostics GmbH, Mannheim, Germany). Distended pancreas was digested by shaking in a 37 °C water bath for 17 minutes. Isolated islets were washed and picked under a stereomicroscope and incubated overnight at 37°C and 5% CO2 in RPMI-1640 media containing fetal bovine serum for insulin secretion studies.
3.6.2 RNA-sequencing of pancreatic islets
Total RNA from isolated pancreatic islets (10 male mice per genotype) was extracted by using TRIZOL (Sigma-Aldrich) according to the manufacturer’s instructions. RNA quantity
21 was measured by using a spectrophotometer (Nanodrop ND 1000). The RNA quality of all samples was further analyzed on the Agilent 2100 bioanalyzer using the RNA 6000 Nano Chip. cDNA libraries were generated using TruSeq RNA Sample Preparation Kits v2 (Illumina, San Diego, CA, USA) according to the manufacturer’s protocol. Indexed islet libraries of good quality were pooled and used for sequencing on two flow cell lanes on Illumina HiScanSQ System. To confirm base calling correctness the raw data passed a quality check using FastQC software (http://www.bioinformatics.babraham.ac.uk/projects/fastqc). It revealed low PHRED-scale scores at the 3’ end of the 101 bp long reverse reads. These reads were trimmed to a size of 80 bp. Then, reads were assigned to the individual animals using the ligated adapter indices. Further, the samples proceeded filtering to trim the adapter sequences and remove low-quality reads which were shorter than 60 bp or contained more than five bases with a quality score below 15 (PHRED-scale). The paired-end reads were mapped to the reference mouse genome (July 2007 NCBI37/mm9) with Ensembl v66 annotations using Tophat 1.3.3. (53), which aligns reads using Bowtie (version 0.9.9). Mitochondrial reads and reads which did not map uniquely to a genome position were excluded. FPKM (fragments per kilobase of transcript per million mapped reads) values were calculated using Cufflinks 1.3.0 (53,54). Analysis of differential expression was performed using DESeq software package (55). Only genes that were expressed at least in 10 animals were considered for analysis. Functional enrichment analysis of differentially expressed genes (P < 0.05) was determined using ToppGene Suite (56).
3.6.3 Insulin release experiments from isolated islets
For dynamic insulin secretion studies groups of 50 pancreatic islets were placed in a perifusion chamber and continuously perifused with KRB containing (all in mM) 115 NaCl,
20 NaHCO3, 4.7 KCl, 1.2 KH2PO4, 1.2 MgSO4, 2.56 CaCl2, 10 HEPES pH 7.4, 0.1% bovine serum albumin, and 2.8 glucose for over 30 min (flow: 1 ml/min). After this equilibration phase islets were perifused for 30 min with low glucose (2.8 mM) to determine the basal insulin release and then challenged for 30 min with 16.7 mM glucose or 16.7 mM glucose plus 100 µM UDP-glucose. Samples of perifusate were collected every minute and insulin concentration was determined at indicated time points by Insulin AlphaLISA Kit (Perkin Elmer, Rodgau, Germany) following manufacturer’s instructions.
For static incubation studies groups of 5 islets were placed in a 96-well plate. After a 30- minute equilibration period in 200 µl KRB solution containing 2.8 mM glucose, pancreatic islets were stimulated with KRB solution containing either 2.8 mM or 16.7 mM glucose or
22 100 µM UDP-glucose in the presence of 16.7 mM glucose for 30 minutes. The supernatants were then collected for measurement of secreted insulin and islets were lysed in acid-ethanol to extract the residual islet insulin (50,51). Insulin concentrations were determined by Insulin AlphaLISA Kit (Perkin Elmer) following manufacturer’s instructions.
3.7 Cell culture, transfection and functional assays
For yeast experiments, the haploid Saccharomyces cerevisiae yeast strain MPY578t5 (provided by Dr. Mark Pausch) was used for the expression of receptor constructs. Cells were transfected with plasmid DNA using electroporation as described (57). For expression in mammalian cells, COS-7 cells were grown in Dulbecco's modified Eagle's medium (DMEM supplemented with 10% (v/v) fetal bovine serum, 100 units/ml penicillin and 100 μg/ml streptomycin) at 37°C in a humidified 5% CO2 incubator. Transient transfection experiments of COS-7 cells with receptor constructs for cAMP inhibition measurements and for direct cAMP measurements (co-transfected with the chimeric G protein Gαsi5) were essentially performed as described previously (58). For measurements of dynamic mass redistribution (DMR) (59) HEK293 cells were grown in DMEM/F12 medium supplemented with 10% (v/v) fetal bovine serum, 100 units/ml penicillin and 100 μg/ml streptomycin at 37°C in a humidified 5% CO2 incubator and transiently transfected with the receptor constructs and split onto fibronectin-coated 384-well plates one day prior the assay. DMR measurements were performed with the Epic system (Corning, NY, US).
For all transfection experiments the mouse and human P2Y14 coding sequence attached to an N-terminal hemagglutinin (HA) epitope and a C-terminal FLAG epitope was cloned into the mammalian expression vector pcDps. Additionally, for yeast experiments the mouse receptor was introduced into the yeast vector p416GPD. All control receptor plasmids were cloned with the described strategy and verified by Sanger sequencing.
3.8 Statistical analyses and graphics
If not stated otherwise statistical analyses were performed using Student’s t-test and graphics were designed using the GraphPad Prism 5 Software (GraphPad Software, Inc., La Jolla, CA, USA).
23 4 RESULTS
4.1 Basic characterization of P2Y14-deficient mice
To identify phenotypes related to the lack of P2Y14 function, this GPCR gene was removed by targeted deletion and replacement with a LacZ reporter gene (Fig. 2) in a mouse strain. Mice were kept in a SPF unit and under these conditions P2Y14 deficiency is compatible with life. The P2Y14-deficient mouse offspring was vital and fertile. No obvious differences in genotype distribution, breeding, growth, gross morphology and histology were detected on primary inspection compared to WT mice. However, comparison of the organ weights revealed a significantly higher spleen weight in P2Y14-KO mice (Table 1).
Table 1 Body and organ weights of P2Y14-deficient in comparison to WT mice. Organs from three-month-old male and female mice were removed and weighed. Weight per organ is given in gram. Results are mean ± SD. ***P < 0.001.
male female WT (n=19) KO (n=28) WT (n=24) KO (n=18) body weight (g) 25.08 ± 2.25 25.88 ± 1.96 20.9 ± 1.1 22.0 ± 1.34 brain (g) 0.46 ± 0.03 0.46 ± 0.02 0.46 ± 0.01 0.46 ± 0.02 heart (g) 0.13 ± 0.02 0.13 ± 0.01 0.1 ± 0.01 0.1 ± 0.01 lung (g) 0.13 ± 0.02 0.16 ± 0.02 0.14 ± 0.01 0.14 ± 0.02 liver (g) 1.1 ± 0.12 1.15 ± 0.12 0.82 ± 0.09 0.86 ± 0.11 spleen (g) 0.07 ± 0.02 0.11 ± 0.03*** 0.07 ± 0.01 0.09 ± 0.02*** left kidney (g) 0.2 ± 0.03 0.22 ± 0.03 0.13 ± 0.01 0.13 ± 0.02 right kidney (g) 0.2 ± 0.03 0.21 ± 0.03 0.13 ± 0.01 0.14 ± 0.02
Moreover, the analysis of hemodynamic parameters displayed higher blood pressure and heart rate in mice lacking P2Y14 (Table 2).
Table 2 Higher blood pressure and pulse in P2Y14-deficient mice. Blood pressure and pulse were determined by non-invasive tail-cuff method using the BP-2000 Blood Pressure Analysis SystemTM (Visitech Systems, USA). Following manufacturer’s instructions, mice were trained to the procedure each day for at least 5 days prior to the actual experiment. After the training period 10 measurements per day of each mouse on 5 consecutive days were performed. Systolic blood pressure, diastolic blood pressure, mean arterial pressure, and pulse were calculated from daily experiments for each mouse and mean out of 10 animals per group was determined. Data shown as mean ± SEM. ** P < 0.01, *** P < 0.001; Student’s t-test.
WT (n=10) KO (n=10) mean arterial pressure (mmHg) 84.3 ± 1.0 93.8 ± 1.4*** systolic pressure (mmHg) 121.4 ± 1.0 129.8 ± 1.9** diastolic pressure (mmHg) 64.9 ± 1.3 75.7 ± 2.1*** pulse (min-1) 584 ± 15 654 ± 12**
24 In an open field test KO mice were significantly less active than the WT mice spending less time on locomotion and showing a reduced velocity (Table 3). However, no distinct behavioral phenotype could be detected on initial characterization. There was no difference between WT and KO mice in the hot plate test (Table 3).
Table 3 Behavioral parameters.
Open field test: 3-month-old male mice were tested in the setup. Recording and analysis was performed automatically. For hot plate test animals were set on a 52 °C heated plate and time until visible signs of pain were seen was measured. The table shows main parameters as mean ± SD. *P < 0.05; **P < 0.01; Student's t-test
OPENFIELD TEST WT (n=16) KO (n=18) Total activity (s) 102.3 ± 38.3 74.1 ± 34.2* Total activity (%) 34.1 ± 12.8 24.7 ± 11.4* Counts 1068 ± 532 775 ± 386 Velocity (cm s-1) 18.9 ± 5.4 15.1 ± 1.7* Distance (m) 23.1 ± 10.9 14.3 ± 6.7** Distance edges (m) 21.8 ± 9.8 13.2 ± 7.1 Distance center (m) 1.3 ± 1.8 1.1 ± 1.9 Distance corners (m) 12.6 ± 4.6 8.9 ± 4.2* HOT PLATE TEST WT (n=9) KO (n=12) time until signs of pain (s) 24 ± 5.5 21.6 ± 5
Whole blood and serum samples from adult mice were analyzed by an automatic hemocytometer and at the Institute of Laboratory Medicine (Medical Faculty, University of Leipzig). Particular differences in hematological and laboratory parameters were not consistent and rather gender-specific (Tables 4 and 5).
25 Table 4 Hematology.
Whole blood samples from three-month-old mice were analyzed by an automatic hemocytometer (ScilVet ABC; scil animal care company GmbH, Viernheim, Germany). Results are given as mean ± SD. *P < 0.05, **P < 0.01, ***P < 0.001, Student’s t-test.
male female standard diet WT (n=15) KO (n=11) WT (n=14) KO (n=19) WBC (10³ / mm³) 9.4 ± 2 10.4 ± 3.5 7.4 ± 1.4 9.3 ± 3.0 * RBC (10^6 / mm³) 8.4 ± 0.7 8.1 ± 1.3 8.6 ± 0.8 8.5 ± 0.8 HGB (g / dl) 16.9 ± 1.1 16 ± 2.2 17 ± 1.2 17.9 ± 1.1 * HCT (%) 47.5 ± 4.2 44.6 ± 4.4 47.4 ± 4.4 48.7 ± 4.2 PLT (10³ / mm³) 1175 ± 172 1248.5 ± 260.8 991.3 ± 105.8 1121.7 ± 157.5 * MCV (µm³) 56.7 ± 2.1 55.9 ± 8.7 55 ± 2.1 57.2 ± 1.9 ** MCH (pg) 20.3 ± 1.9 19.9 ± 2 19.9 ± 1.6 21.1 ± 1.6 MCHC (g / dl) 35.8 ± 3.3 35.9 ± 4.1 36.1 ± 3.3 36.8 ± 2.7 RDW (%) 13.3 ± 0.7 14.9 ± 0.6 *** 15.1 ± 0.7 13.5 ± 0.9 *** MPV (µm³) 5.2 ± 0.3 5.2 ± 0.3 5.3 ± 0.4 5.1 ± 0.3 LYMPHOCYTES (%) 72.6 ± 4.7 70.3 ± 5.6 74.6 ± 5.7 74 ± 4.7 MONOCYTES (%) 6.2 ± 0.6 6.7 ± 0.9 5.7 ± 1.2 5.4 ± 0.7 GRANULOCYTES (%) 21.2 ± 4.6 23 ± 5 19.7 ± 4.8 20.6 ± 4.4 LYMPHOCYTES (10³ / mm³) 6.8 ± 1.6 7.2 ± 2.3 5.5 ± 1.1 6.9 ± 2.4 MONOCYTES (10³ / mm³) 0.5 ± 0.1 0.7 ± 0.3 0.4 ± 0.1 0.4 ± 0.2 GRANULOCYTES (10³ / mm³) 2.1 ± 0.5 2.5 ± 1.3 1.6 ± 0.4 2 ± 0.6 *
26
male female western diet WT (n=15) KO (n=15) WT (n=14) KO (n=13) WBC (10³ / mm³) 9.6 ± 1.8 8.3 ± 1.8 8 ± 1.9 8.5 ± 2.4 RBC (10^6 / mm³) 11.3 ± 0.7 11.4 ± 1.3 10.8 ± 1.5 9.8 ± 1.7 HGB (g / dl) 18.7 ± 1 18.3 ± 1.5 18.8 ± 2.5 16.5 ± 2.5 * HCT (%) 64 ± 3.1 61.6 ± 6 59.7 ± 6.9 57.7 ± 9.7 PLT (10³ / mm³) 1031.3 ± 205.1 985 ± 162.4 958.3 ± 136.9 941 ± 100 MCV (µm³) 57.2 ± 2.9 54.1 ± 2.3 ** 53 ± 13.8 59 ± 5 MCH (pg) 16.6 ± 0.5 16.1 ± 0.9 17.3 ± 0.5 16.9 ± 0.8 MCHC (g / dl) 29 ± 1.1 29.8 ± 1.0 * 30.5 ± 1.1 28.7 ± 2.2 * RDW (%) 14.1 ± 2.2 14.6 ± 1.2 13.1 ± 1.2 15.7 ± 1.2 *** MPV (µm³) 5.2 ± 0.4 5 ± 0.3 5 ± 0.3 5.2 ± 0.3 LYMPHOCYTES (%) 72 ± 6.2 71.4 ± 6.5 72.3 ± 6.6 75.9 ± 5.8 MONOCYTES (%) 5.9 ± 0.9 4.8 ± 0.7 ** 5.1 ± 1 4.3 ± 0.9 * GRANULOCYTES (%) 22.1 ± 6 23.8 ± 6.6 22.6 ± 5.9 19.8 ± 5.2 LYMPHOCYTES (10³ / mm³) 6.9 ± 1.6 5.9 ± 1.6 5.7 ± 1.6 6.4 ± 1.8 MONOCYTES (10³ / mm³) 0.5 ± 0.1 0.3 ± 0.1 *** 0.4 ± 0.1 0.3 ± 0.1 GRANULOCYTES (10³ / mm³) 2.2 ± 0.6 2 ± 0.6 1.9 ± 0.5 1.8 ± 0.7
27
Table 5 Laboratory screen.
Four-month-old male and female WT and KO mice were subjected to analysis for cholesterol and TAG levels in lipoprotein fractions after a western diet and clinical chemistry parameters. Results are given as mean ± SD. *P < 0.05, **P < 0.01, ***P < 0.001, Student’s t-test.
standard diet male female WT (n=14) KO (n=12) WT (n=15) KO (n=16) ALAT (µkat/l) 0.46 ± 0.15 below detection 0.5 ± 0.14 0.37 ± 0.04 ALBUMIN (g/l) 29.46 ± 3.17 27.77 ± 5.67 33.07 ± 4.66 34.05 ± 2.96 ALCALINE PHOSPHATASE (µkat/l) 0.6 ± 0.06 0.59 ± 0.12 0.84 ± 0.16 0.77 ± 0.17 ASAT (µkat/l) 6.01 ± 3.77 1.88 ± 1.88** 1.53 ± 0.38 1.6 ± 0.41 CALCIUM (mmol/l) 2.11 ± 0.17 2.13 ± 0.15 2.42 ± 0.23 2.42 ± 0.15 CHOLINESTERASE (µkat/l) 81.77 ± 10.97 82.73 ± 11.05 120.64 ± 13.47 122.88 ± 13.11 CHOLESTEROL (mmol/l) 2.71 ± 0.32 2.59 ± 0.49 2.71 ± 0.36 2.66 ± 0.53 GLDH (µkat/l) 0.27 ± 0.25 0.16 ± 0.04 0.3 ± 0.11 0.23 ± 0.08 UREA (mmol/l) 6.97 ± 1.26 8.8 ± 1.51** 4.32 ± 1.03 3.4 ± 0.60** LIPASE (µkat/l) 0.68 ± 0.21 0.49 ± 0.16* 0.47 ± 0.14 0.46 ± 0.11 MAGNESIUM (mmol/l) 0.96 ± 0.18 1.12 ± 0.13* 1.29 ± 0.24 1.24 ± 0.23 PROTEIN (g/l) 49.23 ± 3.73 47.7 ± 3.63 53.28 ± 6.03 54.03 ± 3.14 PHOSPHATE (mmol/l) 2.05 ± 0.37 2.15 ± 0.33 1.91 ± 0.47 1.84 ± 0.24 TRIGLYCERIDES (mmol/l) 0.71 ± 0.25 0.87 ± 0.32 0.97 ± 0.3 0.86 ± 0.22
28
western diet male female WT (n=15) KO (n=15) WT (n=13) KO (n=13) ALAT (µkat/l) 0.67 ± 0.36 0.53 ± 0.18 0.42 ± 0.08 0.35 ± 0.03 ALBUMIN (g/l) 23.89 ± 3.05 23.97 ± 4.2 30.83 ± 3 30.31 ± 3.41 ALCALINE PHOSPHATASE (µkat/l) 0.57 ± 0.13 0.62 ± 0.11 0.78 ± 0.24 0.63 ± 0.12 ASAT (µkat/l) 6.12 ± 3.5 6.37 ± 4.33 1.94 ± 0.27 2.16 ± 0.54 CALCIUM (mmol/l) 1.9 ± 0.19 1.83 ± 0.24 2.51 ± 0.27 2.58 ± 0.2 CHOLINESTERASE (µkat/l) 89.44 ± 11.23 86.45 ± 21.08 154.12 ± 12.47 152.62 ± 17.96 CHOLESTEROL (mmol/l) 3.99 ± 0.55 4.13 ± 0.86 4.49 ± 0.47 4.3 ± 0.44 GLDH (µkat/l) 1.18 ± 0.73 0.35 ± 0.20*** 0.89 ± 0.7 0.37 ± 0.12* UREA (mmol/l) 5.6 ± 1.81 6 ± 2.17 4.53 ± 0.71 5.32 ± 1.18 LIPASE (µkat/l) 0.62 ± 0.31 0.99 ± 0.96 0.56 ± 0.19 0.59 ± 0.37 MAGNESIUM (mmol/l) 1.05 ± 0.2 1.01 ± 0.09 1.3 ± 0.23 1.19 ± 0.28 PROTEIN (g/l) 47.23 ± 4.35 46.64 ± 4.26 58.46 ± 3.42 57.63 ± 3.49 PHOSPHATE (mmol/l) 2.19 ± 0.36 2.27 ± 0.27 2.67 ± 0.56 2.51 ± 0.38 TRIGLYCERIDES (mmol/l) 0.97 ± 0.34 1.22 ± 0.58 0.94 ± 0.16 1.03 ± 0.59 male female lipid profile after western diet WT (n=15) KO (n=15) WT (n=14) KO (n=12) HDL cholesterol (mmol/l) 4.49 ± 0.5 4.52 ± 0.99 3.13 ± 0.54 3.23 ± 0.52 HDL triacylglycerides (mmol/l) 0.76 ± 0.07 0.75 ± 0.1 0.31 ± 0.05 0.38 ± 0.14 LDL cholesterol (mmol/l) 1.86 ± 0.22 1.76 ± 0.31 1.87 ± 0.3 1.58 ± 0.17** LDL triacylglycerides (mmol/l) 1.46 ± 0.29 1.32 ± 0.19 0.55 ± 0.1 0.49 ± 0.11 VLDL cholesterol (mmol/l) 0.22 ± 0.05 0.23 ± 0.04 0.31 ± 0.08 0.28 ± 0.09 VLDL triacylglycerides (mmol/l) 1.16 ± 0.31 1.25 ± 0.29 0.44 ± 0.13 0.37 ± 0.12 total cholesterol (mmol/l) 6.57 ± 0.72 6.52 ± 1.3 5.31 ± 0.79 5.09 ± 0.62
29 4.2 P2Y14 expression in mouse tissues
Because the primary inspection did not reveal any prominent differences between WT and KO mice I next took advantage of the introduced LacZ reporter construct and monitored ß- galactosidase activity in P2Y14-deficient mouse tissues to examine the P2Y14 expression at the cellular level. Whereas WT control tissues showed no specific staining, ß-galactosidase- positive staining was found in uterus, bronchioles, blood vessels, pancreas, salivary glands (Fig. 3), and immune cells.
WT KO lung
uterus Figure 3 Detection of bacterial LacZ reporter gene via ß- galactosidase activity in cryosections of selected organs.
To monitor the expression of P2Y14 in vivo at the cellular level a transgenic KO mouse was generated by replacement of the P2Y14–coding blood vessels region with an expression cassette harboring an internal ribosome entry site and the bacterial LacZ reporter gene under control of the endogenous P2Y14 promoter. Sites of LacZ expression were located in cryosections using X-Gal, and
sublingual gland counterstained with nuclear fast red. Whereas no ß-galactosidase activity was detected in WT mice, KO mice showed intensive ß-galactosidase staining in several smooth muscle or contractile cell-containing organs. A pancreas indicates arterial vessel, V indicates venous blood vessel.
30 Interestingly, staining in the GI tract was positive only in a subpopulation of smooth muscle cells (Fig. 4A/B). In all parts of the GI tract smooth muscle cells of the thin layer of the muscularis mucosae were ß-galactosidase positive (Fig. 4A/B). From the ileum to the rectum a subpopulation of smooth muscle cells within the circular smooth muscle layer showed positive staining (Fig. 4A/B). In the rectum also the longitudinal smooth muscle layer displayed intensive ß-galactosidase activity (Fig. 4A/B).
Figure 4 P2Y14 is expressed in a subpopulation of smooth muscle cells in the gastrointestinal tract.
Expression of P2Y14 was monitored in vivo using a LacZ reporter gene (see 3.3.3). (A) KO mice showed intensive ß-galactosidase staining in a subpopulation of smooth muscle cells throughout the GI tract. (B) The expression of P2Y14 in certain muscle layers of the GI tract is schematically given.
Co-staining of c-kit, which is a marker of Cajal cells and mast cells in the GI tract (60,61), revealed no obvious overlap with the ß-galactosidase-positive structures (data not shown). In contrast the ß-galactosidase staining was partly reminiscent of the reported divergent reactivity of intestinal smooth muscle cells with characteristic smooth muscle cell markers (i.e. alpha-smooth muscle actin (ASMA), gamma-smooth muscle actin (GSMA)) (62). Interestingly, cells next to the pancreatic acini (Fig. 5A-C) and myoepithelial cells of the salivary glands (Fig. 3) were stained. Further, few cells within the islet (Fig. 5 B/D) were ß- galactosidase-positive. However, the distribution pattern of these cells did not completely correspond with one of the known major cell types within the islet of Langerhans.
31 D A interlobular duct B
C islet
acini
20 µm 20 µm
C acini D
duct
5 µm 5 µm
Figure 5 Detection of bacterial LacZ reporter gene in cryosections of pancreas. (A/B) Expression of LacZ reporter gene in exocrine and endocrine parts of the pancreas. The enlarged picture details show the expression in the acini (B/C) and in cells of the islet (D).
One should keep in mind that P2Y14 promoter-driven ß-galactosidase-expression was monitored in KO mice and may reflect transcript over- or even non-physiological expression due to P2Y14 deficiency. To address this issue, expression of the 5’UTR region of WT and
KO P2Y14 gene transcripts, which were structurally similar in both WT and KO animals, was measured by qPCR in a number of tissues (Fig. 6). As presented in Fig. 6B, ΔCt values of transcript expression showed a high correlation between WT and KO in all tissues (r2 = 0.9058).
32 Figure 6 P2Y14 transcript and P2Y14-promoter-driven LacZ gene expression in mouse tissues.
Total RNA was extracted from several tissues from WT and P2Y14-KO mice (n=3) and mRNA levels
of either P2Y14 or LacZ transcripts were determined by SYBR Green qPCR analysis. Expression data are shown as ΔCt values normalized to the house keeping gene ß2-microglobulin. (A) qPCR analysis shows a widespread receptor distribution with high expression levels in pancreas, salivary glands, brain and parts of the GI tract and lowest expression in liver. Data shown as mean ± SEM. (B) Expression of bacterial LacZ reporter gene in KO mice correlates (r2=0.9058) with the expression of
P2Y14 in WT mice. Dashed line indicates the 95% confidence interval.
Both data sets revealed that P2Y14 is widely expressed in mouse tissues with high expression levels in pancreas, salivary glands, brain, lung and parts of the gastrointestinal tract and lowest expression in liver (Fig. 6).
4.3 Characterization of P2Y14 function in smooth muscles
4.3.1 Delayed GI passage in P2Y14-deficient mice
To study the consequences of P2Y14 deficiency in the GI tract, different segments of the intestine were placed in an organ bath and the contractile activity was recorded. Duodenal segments and segments of ileum and colon displayed regular basal activity showing no differences regarding mean muscle tension, amplitude or frequency of contractions between the genotypes. Following carbachol and electric stimulation all intestine segments of WT and KO mice showed an increase of contractile activity in a similar manner. Because no effect of
33 UDP-glucose (up to 1 mM) on basal and carbachol-stimulated and electric-stimulated contraction of isolated small intestine and colon was found (data not shown), I speculated that the contribution of P2Y14 is more distinct and may present its significance only when the entire GI passage is observed. Therefore, a dye-labeled dextran was applied to mice orally and the excretion in faeces was measured hourly. On average three hours after the oral application of dextran blue the mice begun to excrete the dye. In comparison to WT animals the expulsion of dextran blue was significantly delayed in KO mice (Fig. 7). Interestingly, more KO animals (5 KO vs. 1 WT) had to be excluded from analysis according to the exclusion criterion (see 3.4.1).
Figure 7 P2Y14-deficient mice showed a delayed gastrointestinal emptying. A dye-labeled dextran was applied to mice orally and the excretion in faeces was measured hourly. The excretion of blue dextran is shown relative to the total excreted blue dextran after 8 hours. Five KO mice but only one WT animal had to be excluded from analysis according to the exclusion criterion (see 3.4.1). OD620 nm (∆ 8h) = 0.8770 ± 0.0630 for WT and OD620 nm (∆ 8h) = 0.5636 ± 0.0731 for KO mice were set to 100%, respectively. Data shown as mean ± SEM. * P < 0.05; ** P < 0.01; *** P < 0.001; Student’s t-test
4.3.2 Altered airway responsiveness in P2Y14-deficient mice
P2Y14-reporter gene expression was also found in smooth muscle cells of bronchioles (Fig.
3). To dissect P2Y14 function in respiratory tract invasive plethysmography experiments were performed testing airway resistance and dynamic compliance in intubated and mechanically ventilated mice. Aerosolized UDP-glucose had no effect on respiratory functions tested (Fig. 8). Both WT and KO mice displayed adequate response to the cholinergic agent methacholine
34 (Fig. 8A). However, KO mice showed significantly higher dynamic compliance in response to increasing inhaled doses of methacholine (Fig. 8B).
Figure 8 Airway responsiveness is reduced in P2Y14-deficient mice. Lung resistance (A) and dynamic compliance (B) were measured by invasive plethysmography (emka TECHNOLOGIES) in response to inhaled UDP-glucose and increasing doses of methacholine. Data shown as mean ± SD. Baseline values (set to 100%) were: lung resistance 1.28 ± 0.41 mmHg x s/ml for WT mice and 1.11 ± 0.34 mmHg x s/ml for KO mice, dynamic compliance 0.84 ± 0.56 ml/mmHg for WT and 0.72 ± 0.43 ml/mmHg for KO mice; * P < 0.05; Student’s t-test. For statistic analysis of the entire methacholine test a paired two-tailed t-test (marked by a long line) was performed (P = 0.0105 for dynamic compliance).
4.4 P2Y14 deficiency alters metabolic functions
4.4.1 P2Y14 deficiency results in reduced glucose tolerance
The initial phenotype screen also included basic metabolic tests. Following oral glucose application KO mice showed significantly higher transient blood glucose levels (Fig. 9A). To differentiate whether the enteral glucose resorption was increased in KO mice due to the prolonged gastrointestinal emptying (see Fig. 7), intraperitoneal glucose tolerance tests were performed. Blood glucose levels were also increased in KO mice following intraperitoneal glucose injection (Fig. 9B) excluding differences in enteral glucose resorption. In order to evaluate the insulin sensitivity in KO mice insulin tolerance tests were performed. Both genotypes showed no alterations in the decline of blood glucose levels following intraperitoneal insulin injection (Fig. 10A), suggesting unchanged insulin sensitivity in KO mice. Serum insulin levels were analyzed during intraperitoneal glucose tolerance tests. Here, KO mice tended to have lower serum insulin levels after intraperitoneal glucose application (Fig. 10C).
35 4.4.2 Challenging the metabolic phenotype with a western type diet
To study whether high caloric nutrition can aggravate the phenotype found in KO mice, 4- week-old mice were kept on a western type diet for 3 months. WT and KO mice gained significantly body weight under the western type diet. But whereas there were no alterations in body weight development between WT and KO mice kept on standard diet, KO mice fed the western diet gained significantly less weight (KO: 178 ± 15% vs. WT: 196 ± 23%, P < 0.05). However, detailed analysis of serum cholesterol and TAG levels in all lipoprotein fractions revealed no differences between WT and KO mice fed a western type diet (see 4.1 Table 5). Interestingly, glucose tolerances following oral and intraperitoneal glucose application were significantly reduced in KO mice kept under western type diet (Fig. 9C/D).
Figure 9 P2Y14-deficient mice showed reduced glucose tolerance. Glucose tolerance tests were performed either by oral application (A, C) of 80 mg glucose or by intraperitoneal (B, D) glucose injection (2 mg/g body weight) to overnight fasted male mice kept under standard (A, B) or western (C, D) type diet. Blood glucose levels shown as mean ± SD. * P < 0.05; ** P < 0.01; *** P < 0.001; Student’s t-test
Next, insulin tolerance tests were performed to evaluate whether the higher glucose levels observed in KO mice in the oGTT were because of altered insulin sensitivity. There were no differences in the decline of blood glucose levels following intraperitoneal insulin injection
36 between WT and KO mice kept on western type diet (Fig. 10B), although both genotypes showed lower insulin sensitivity as a result of higher body weight due to high caloric nutrition. As insulin sensitivity did not account for altered oGTT in KO mice serum insulin levels in WT and KO mice during intraperitoneal glucose tolerance tests were analyzed. Interestingly, after 12 weeks of western type diet glucose-stimulated insulin secretion of KO mice was significantly lower 40 and 60 min after intraperitoneal glucose injection compared to WT mice (Fig. 10D).
Figure 10 P2Y14-deficient mice showed diet-dependent lower serum insulin levels after glucose administration. First, blood glucose levels were measured in an insulin tolerance test (ITT) after intraperitoneal injection of insulin (0.75 U/kg body weight) in male mice kept under standard (A) and western (B) type diet. Blood glucose levels before insulin application (set to 100%) were 4.9 ± 0.6 mmol/l for WT and 5.8 ± 1.0 mmol/l for KO mice fed with standard diet, and 5.6 ± 0.7 mmol/l for WT and 6.1 ± 0.9 mmol/l for KO mice kept under western type diet. Data shown as mean ± SD. * P < 0.05; Student’s t-test. Then, serum insulin levels were determined before (0 min) and 20, 40 and 60 min after intraperitoneal glucose injection (2 mg/g of body weight) in male mice kept under standard (C) and western type (D) diet. Data shown as mean ± SEM. ** P < 0.01; Student’s t-test
37 4.5 Normal architecture of pancreatic islets
As the highest expression of P2Y14 was noticed in pancreas (Figs. 5 and 6) and the functional data pointed towards a lower pancreatic insulin secretion after oral und intraperitoneal glucose administration, morphometric analyses in H&E and insulin immunohistochemistry stained pancreatic slices in P2Y14-KO mice were performed. Neither the number nor the size of the pancreatic islets differed between WT and KO mice (Fig. 11A/C). Also, the insulin immunopositive areas were similar in both genotypes, suggesting no gross morphological abnormalities in islet development (Fig. 11B/D).
Figure 11 Normal architecture of pancreatic islets in P2Y14-deficient mice. (A) Representative H&E stained pancreatic section used for morphometric analyses. (B) Insulin immunohistochemistry of representative pancreatic islets. (C) The number and area of islets in 10 serial slices of pancreatic tissue were determined using NIH ImageJ Software. The number of islets was 141 ± 17 in WT and 157 ± 11 in KO mice. (D) β-cell mass was determined as ratio of insulin positive area to total pancreatic islet area. Data shown as mean ± SD.
38 4.6 Components involved in insulin release are differentially expressed in P2Y14- deficient islets
Since P2Y14-deficient islets did not show obvious morphological differences I screened for those at a molecular level. Thus, mRNA expression in isolated pancreatic islets from WT and KO mice was analyzed in a transcriptome-wide approach using RNA-sequencing. Approximately 13 million reads per animal were analyzed. The quality of the expression data was confirmed by verifying the presence of selected islet-specific transcripts. As expected, insulin, glucagon, somatostatin and SUR1/Kir6.2 transcripts were highly expressed in islets of both, WT and KO mice (Table 6).
In line with the data from immunohistochemistry there was no difference in insulin mRNA expression levels between WT and KO (Table 6). The expression of P2Y14 gene was significantly reduced in KO mice (Table 6), but one should note that P2Y14 transcripts in the KO islets represented mRNA sequences of the 5’UTR region and not of the coding region (see Fig. 2).
815 genes were found differentially expressed between WT and KO mice (329 transcripts downregulated, 486 transcripts upregulated, P < 0.05). Functional enrichment analysis of differentially expressed genes disclosed several GO (Gene Ontology) categories related to protein synthesis, signaling pathways and hormone secretion (Table 7).
39
Table 6 Expression of selected transcripts related to insulin release in P2Y14-deficient and WT mice. Analysis of differential expression in pancreatic islets was performed using DESeq software package.
normalized counts (DESeq) normalized counts (DESeq) Gene Name Ensembl ID Mouse Description p-value WT KO UDP-glucose P2yr14 ENSMUSG00000036381 150.669 ± 67.367 51.233 ± 31.351 1.55E-05 receptor Ins1 ENSMUSG00000035804 Insulin 1 1152011.035 ± 292272.566 1259275.220 ± 367446.561 0.39634 Ins2 ENSMUSG00000000215 Insulin 2 23707662.257 ± 6243962.404 26673072.360 ± 7544683.224 0.32514 Gcg ENSMUSG00000000394 Glucagon 1573442.614 ± 332358.640 1118086.770 ± 428209.260 0.00935 Sst ENSMUSG00000004366 Somatostatin 109603.517 ± 26948.775 78143.829 ± 26039.779 0.03064 Insr ENSMUSG00000005534 Insulin receptor 787.091 ± 93.101 918.837 ± 249.758 0.25710 Insulin receptor- Insrr ENSMUSG00000005640 15144.613 ± 3513.097 16533.489 ± 3935.146 0.55844 related receptor Glucagon Gcgr ENSMUSG00000025127 1664.742 ± 428.258 1519.357 ± 316.953 0.48272 receptor Somatostatin Sstr1 ENSMUSG00000035431 42.117 ± 32.920 15.753 ± 9.191 0.03221 receptor 1 Somatostatin Sstr2 ENSMUSG00000047904 184.474 ± 79.801 117.072 ± 66.365 0.02693 receptor 2 Somatostatin Sstr3 ENSMUSG00000044933 2081.031 ± 553.613 2084.433 ± 394.202 0.92098 receptor 3 Somatostatin Sstr4 ENSMUSG00000037014 3.725 ± 4.102 1.836 ± 3.349 0.83452 receptor 4 Somatostatin Sstr5 ENSMUSG00000050824 1.714 ± 3.783 0.841 ± 1.995 1 receptor 5 Slc2a2 ENSMUSG00000027690 GLUT2 13545.200 ± 4388.043 9864.047 ± 2396.638 0.02151 Gck ENSMUSG00000041798 Glucokinase 5233.313 ± 2382.235 4290.637 ± 1140.332 0.47089 Abcc8 ENSMUSG00000040136 SUR1 35996.663 ± 7296.922 33147.884 ± 7820.323 0.65933 Kcnj11 ENSMUSG00000070561 Kir6.2 1395.498 ± 181.626 1448.442 ± 401.472 0.87691 Pdx1 ENSMUSG00000029644 pancreatic and 1375.043 ± 385.507 1145.584 ± 120.464 0.16201
40 duodenal homeobox 1 Cacna1c ENSMUSG00000051331 4416.180 ± 1642.112 3020.178 ± 1114.107 0.03284 Cacna1d ENSMUSG00000015968 L-type calcium 6319.115 ± 1502.032 6014.105 ± 1966.976 0.54487 channel α1- Cacna1f ENSMUSG00000031142 subunits 126.956 ± 106.971 85.304 ± 35.759 0.36549 Cacna1s ENSMUSG00000026407 2.895 ± 6.173 5.758 ± 12.204 0.19040 Cacna1g ENSMUSG00000020866 T-type calcium 942.481 ± 437.464 772.241 ± 262.283 0.42725 Cacna1h ENSMUSG00000024112 channel α1- 978.104 ± 393.856 615.766 ± 174.645 0.04259 Cacna1i ENSMUSG00000022416 subunits 91.118 ± 64.381 65.418 ± 41.993 0.32531 Cacna2d1 ENSMUSG00000040118 Voltage- 10097.878 ± 2300.350 9583.156 ± 2186.810 0.54478 Cacna2d2 ENSMUSG00000010066 dependent 711.329 ± 348.331 586.156 ± 217.327 0.41999 Cacna2d3 ENSMUSG00000021991 calcium channel 126.052 ± 22.894 89.065 ± 31.253 0.07272 Cacna2d4 ENSMUSG00000041460 α2δ-subunits 30.534 ± 13.830 32.242 ± 32.546 0.50999 Cacnb1 ENSMUSG00000020882 Voltage- 1236.722 ± 312.148 1214.727 ± 354.465 0.63333 Cacnb2 ENSMUSG00000057914 dependent 1900.381 ± 463.540 1567.767 ± 289.201 0.14638 Cacnb3 ENSMUSG00000003352 calcium channel 2214.024 ± 387.968 2105.138 ± 420.606 0.62697 Cacnb4 ENSMUSG00000017412 β-subunits 112.675 ± 41.338 116.486 ± 37.496 0.53251 Cacng1 ENSMUSG00000020722 0 ± 0 0.171 ± 0.541 0.75784 Cacng2 ENSMUSG00000019146 7.166 ± 5.535 3.537 ± 2.860 0.27770 Cacng3 ENSMUSG00000066189 Voltage- 0.978 ± 2.122 3.992 ± 4.077 0.09313 Cacng4 ENSMUSG00000020723 dependent 102.566 ± 48.997 111.682 ± 58.461 0.57746 Cacng5 ENSMUSG00000040373 calcium channel 1.717 ± 3.288 1.543 ± 2.674 0.88201 Cacng6 ENSMUSG00000078815 γ-subunits 1.238 ± 3.915 1.699 ± 2.654 0.91835 Cacng7 ENSMUSG00000069806 17.747 ± 13.035 22.773 ± 19.587 0.56912 Cacng8 ENSMUSG00000053395 0.373 ± 1.179 0 ± 0 0.68948
41 Table 7 Functional enrichment analysis of differentially expressed genes in P2Y14-deficient compared to WT mice.
Genes ID Biological Process (downregulated in KO) (upregulated in KO) p-value Rps8, Rps12, Mrpl12, Rps3, Rpl36a, Rplp0, structural Rpl22, Rps27a, Rps15a, Rps27l, Mrpl11, GO:0003735 constituent 0.0000104 Mrpl20, Mrps23, Mrpl15, Rpl6, Rpl11, Rpl12, of ribosome Rpl17, Mrpl13, Mrpl33, Mrpl24 Adora1, Slc2a2, Glp1r, Gal, Gcg, Cacna1c, Fam132a, Rasl10b, Bad, Ltbp4, Hla-drb1, GO:0042886 amide transport Ffar1, Pde1c, Sc14a2, Rbp4, Itpr1, Mafa, 0.0056743 Upk3a, Phpt1 Edn3, Ghrl, Stxbp5l,Gpr119, Cartpt Adora1, Slc2a2, Glp1r, Gal, Gcg, Cacna1c, GO:0002790 peptide secretion Ffar1, Pde1c, Rbp4, Itpr1, Mafa, Edn3, Ghrl, Fam132a, Rasl10b, Bad, Ltbp4, Hla-drb1, Phpt1 0.0092096 Stxbp5l, Gpr119, Cartpt Rps8, Rps12, Rps3, Rpl36a, Rpl0, Rpl22, translational GO:0006415 Rps271, Rps15a, Ict1, Rpl6, Rpl11, Rpl12, 0.0079669 termination Rpl17 cellular protein Rps8, Rps12, Rps3, Stmn2, Rpl36a, Rpl0, GO:0043624 complex Nes, Mical2 Rpl22, Rps27a, Rps15a, Capza1, Ict1, Rpl6, 0.0121003 disassembly Rpl11, Rpl12, Rpl17 neuropeptide Gpr115, Glp1r, Gal, Calca, Sstr1, Sstr2, GO:0007218 signaling Nmur1, Galr1, Hcrtr2, Emr1 0.0123548 Gpr111, Gpr112, Gpr98, Cartpt, Lphn3 pathway Rps8, Rps12, Rps3, Stmn2, Rpl36a, Rpl0, protein complex GO:0043241 Nes, Mical2 Rpl22, Rps27a, Rps15a, Capza1, Ict1, Rpl6, 0.0186688 disassembly Rpl11, Rpl12, Rpl17 Slc2a2, Glp1r, Gal, Gcg, Cacna1c, Ffar1, peptide hormone GO:0030072 Pde1c, Rbp4, Itpt1, Mafa, Edn3, Ghrl, Stxbp5l, Fam132a, Rasl10b, Bad, Ltbp4, Hla-drb1, Phpt1, 0.02243 secretion Gpr119, Cartpt Adora1, Scl2a2, Glp1r, Gal, Gcg, Cacna1c, GO:0015833 peptide transport Ffar1, Pde1c, Rbp4, Itpr1, Mafa, Edn3, Ghrl, Fam132a, Rasl10b, Bad, Ltbp4, Hla-drb1, Phpt1 0.0321108 Stxbp5l, Gpr119, Cartpt
42 Adh4, Adh1, Adora1, Cacna1h, Slc2a2, Glp1r, regulation of Gal, Gcg, Cacna1c, Ffar1, Hsdrb2, Pde1c, Fam132a, Rasl10b, Bad, Ltbp4, Tg, Ngf, GO:0010817 0.0548341 hormone levels Rbp4, Itp r1, Mafa, Edn3, Ghrl, Stxbp5l, Sult1e1, Hla-drb1, Lrat, Phpt1, Reln Gpr119, Cartpt, Enpep
43 Since serum insulin levels were reduced in KO mice I mainly focused on genes known to be related to glucose sensing, insulin exocytosis and its modulation. Selected components involved in insulin release and their changes in transcript levels are schematically given in Figure 12.
Figure 12 Signaling pathways involved in insulin secretion from β-cells.
Several components involved in insulin release from pancreatic islets are shown. P2Y14 deficiency led to increased (green) and decreased (red) transcription of several genes compared to islets from WT mice. Detailed data from RNASeq experiments are given in Table 6 and Table 7.
Glucose uptake through the glucose transporter 2 (GLUT2) is a first key step in regulation of insulin release (63) (Fig. 12). The expression of GLUT2 (Slc2a2) was significantly downregulated in KO.
The major trigger of insulin vesicle exocytosis is an increase in intracellular Ca2+ (63) and cAMP and protein kinase A (PKA) activity are known to amplify insulin exocytosis (64). In 2+ the classical model of GPCR-modulated insulin release, Gq (Ca ) and Gs (cAMP) activating receptors promote insulin release, whereas Gi/o protein-coupled receptors reduce insulin
44 release by inhibiting adenylyl cyclases and reducing cAMP levels in β-cells. Indeed, several components involved in receptor- and ion channel-controlled intracellular Ca2+ levels were downregulated in islets of KO mice, among them the subunits CACNA1C and CACNA1H of 2+ the voltage-dependent Ca channels (VDCC), the endoplasmic reticulum IP3 receptor (ITPR1), cAMP-degrading phosphodiesterases PDE1C and PDE4D (65), several GPCR known to modulate insulin release such as the free-fatty acid receptor FFAR1 (66), calcium- sensing receptor (CASR), GLP1 receptor (GLP1R), GPR119, somatostatin receptors SSTR1 and SSTR2 (and their agonist somatostatin) (46,67).
4.7 Reduced insulin release from pancreatic islets of P2Y14-deficient mice
It is almost impossible to functionally analyze all components found to be differentially expressed between WT und KO at both, their individual level and their signaling network level. Therefore, I studied insulin secretion, as one integral islet function, in perifused and static treated islets in vitro.
Although intracellular insulin content was similar in lysed islets isolated from WT and KO mice (Fig. 13A), the insulin release following stimulation with low (2.8 mM) and high glucose (16.7 mM) during a 30 min incubation was significantly reduced in islets lacking
P2Y14 (Fig. 13B/C). To study the kinetics of insulin release, isolated islets were placed in a perifusion chamber and continuously perifused with KRB solution containing different glucose concentrations. The initial insulin release peak and the sustained insulin release were significantly reduced in KO islets stimulated with a high glucose concentration (16.7 mM) (Fig. 13D). Stimulation of the isolated pancreatic islets with UDP-glucose alone and in presence of 16.7 mM glucose did not significantly reduce or increase insulin release (Fig. 13B-D).
45 Figure 13 Impaired insulin secretion of isolated pancreatic islets of P2Y14-deficient mice. For cumulative insulin measurements (A-C), pancreatic islets were isolated from WT and KO male mice and incubated 30 min with KRB solution containing 2.8 mM glucose, 16.7 mM glucose or 16.7 mM glucose plus 100 µM UDP-glucose (n=5-7). Insulin levels of lysed islets (A), in the supernatants (B) and the ratio of both (C) are shown. For kinetic insulin measurements (D), pancreatic islets were isolated from WT and KO male mice and continuously perifused with KRB solution containing 2.8 mM glucose, 16.7 mM glucose, or 16.7 mM glucose plus 100 µM UDP-glucose. Insulin levels shown as mean ± SEM. * P < 0.05; ** P < 0.01; *** P < 0.001; Student’s t-test
4.8 Functional characterization of mouse and human P2Y14
Because UDP-glucose showed no physiological activity on WT mouse tissues in several assays (see 4.3.1, 4.3.2, 4.7), the agonistic properties of UDP and UDP-glucose were reevaluated using several different in vitro approaches.
First, a heterologous yeast expression system was used because it lacks any nucleotide receptors. Here, GPCR activation is linked to cell growth via a chimeric G protein. The mouse
46 ADP receptor P2Y12 served as positive control and showed a robust cell growth upon MeS-
ADP stimulation whereas UDP and UDP-glucose had no effect on P2Y12 (Fig. 14). When expressed in this yeast cell system the mouse P2Y14 displayed a high constitutive activity compared to P2Y12 (Fig. 14A). Both, UDP-glucose and UDP, were able to slightly increase yeast growth (Fig. 14A) suggesting some agonistic activity at P2Y14.
Since results from this artificial system are not always transferable to mammalian cell expression systems (68) the mouse and the human P2Y14 cotransfected with a chimeric Gαsi5 protein were tested in mammalian cells using direct cAMP measurements. This chimeric G protein directs Gi-coupled receptors to the Gs/adenylyl cyclase pathway. Mock transfected cells were used as negative control. The positive controls (mouse Y2 and human muscarinic M2 receptors) displayed adequate response to their agonists neuropeptide Y (NPY) and carbachol (Cch), respectively (Table 8). The human and mouse P2Y14 showed increased basal activity but only an insignificant increase of cAMP levels (Table 8) upon stimulation with UDP or UDP-glucose.
Table 8 Functional measurements of mouse and human P2Y14 receptors.
Mouse and human P2Y14 constructs and two other Gi-coupled receptors as controls were transfected for cAMP inhibition and direct cAMP measurements (via a chimeric Gαsi5 protein) as described in 3.8. For inhibition of cAMP, transfected COS-7 cells were stimulated either with 5 µM forskolin (FSK) or together with the indicated agonists for 15 minutes. Forskolin-stimulated values of each receptor were set 100% and % of inhibition due to the agonist stimulation was calculated for each receptor. Forskolin-stimulated cAMP values for each receptor and mock transfected cells (in nM) are given in brackets. Basal cAMP levels prior Forskolin-stimulation for mock-transfected cells were 0.88 ± 0.57 nM. The number of assays is indicated in each column. All assays were performed in triplicates. cAMP inhibition cAMP (nM) % of FSK stimulation cotransfected Gαsi5 transfected construct agonist (n=10) (n=4) FSK/basal 100 (7.78 ± 1.29) 2.71 ± 1.42 UDP 96.93 ± 9.53 2.95 ± 2.22 mock UDP-Glc 104.06 ± 18.13 3.12 ± 1.18 NPY 106.08 ± 27.75 3.12 ± 1.44 CCh 92.13 ± 17.59 2.67 ± 1.76 FSK/basal 100 (8.96 ± 1.92) 7.22 ± 1.99
mouse P2y14 UDP 103.37 ± 22.91 8.10 ± 2.18 UDP-Glc 93.81 ± 21.66 9.20 ± 2.05 FSK/basal 100 (8.73 ± 3.12) 7.49 ± 3.00
human P2Y14 UDP 99.10 ± 18.56 8.04 ± 3.26 UDP-Glc 98.88 ± 21.47 8.86 ± 3.50 FSK/basal 100 (11.54 ± 3.21) 4.18 ± 0.98 mouse Y2R NPY 64.49 ± 15.09 12.10 ± 3.24 FSK/basal 100 (12.09 ± 3.30) 4.93 ± 0.56 human M2R CCh 80.00 ± 21.28 11.34 ± 2.96 47 Next, COS-7 cells transfected with the human and mouse P2Y14 were tested in classical cAMP inhibition assays where cAMP levels were increased by forskolin. In contrast to the experiments with chimeric G proteins no increased basal activity was seen in P2Y14- transfected cells (Table 8). Neither UDP nor UDP-glucose showed agonistic activity at P2Y14 whereas stimulation of Gi-coupled Y2 and muscarinic M2 receptors partially inhibited forskolin-induced cAMP formation (Table 8).
Finally, the mouse P2Y14 was tested in a more sensitive and kinetic assay using dynamic mass redistribution (EPIC ®). Experiments showed no significant signal for UDP-glucose and
UDP on mouse P2Y14-transfected compared to mock-transfected cells (Fig. 14B). However, the neuropeptide Y Y2 receptor (positive control) showed a robust transient after NPY stimulation (Fig. 14B).
Figure 14 Testing UDP-glucose and UDP at P2Y14 in yeast and mammalian cells. (A) Genetically engineered yeast cells (69) transformed with the indicated receptor constructs were analyzed without (basal) and with agonist (10 µM). Receptor activation was measured after 40 hours as growth of yeast cells in histidine-depleted medium by recording the optical density (OD) at 600 nm. Data (mean ± SD) from two independent experiments (in triplicate) are shown. (B) Transiently transfected HEK293 cells (P2Y14, neuropeptide Y receptor Y2) were seeded in 384-well plates the day prior DMR measurements (59). Cells were challenged with indicated concentrations of the corresponding agonist (UDP, UDP-glucose, NPY) and wavelength shift (in pm) was monitored. Each receptor stimulation curve was first corrected against own buffer control (basal) and second, against mock-transfected cells stimulated with the respective agonist. Data from three independent experiments (mean ± SEM) were summarized, each performed in quadruplicate.
48 5 DISCUSSION
Although widely expressed, previous studies on P2Y14 mainly focused on immune cells and its relevance in inflammatory responses (13,32,34,35,40-42). Initial evidence indicates a role of P2Y14 in UDP-glucose-mediated chemotaxis of neutrophils and bone marrow cells, mast cell degranulation and proliferation of T cells (34,35,43,70). However, studies suggest that UDP-glucose can mediate cellular effects via P2Y14-dependent and -independent pathways (45,71,72). To study the physiological function of P2Y14 a KO mouse line was established by targeted deletion of this GPCR gene and replacement with a LacZ reporter gene.
5.1 P2Y14 deficiency is compatible with life
The P2Y14-deficient offspring was characterized in a primary screen searching for major anomalies in morphology and development. KO mice were vital and fertile. This is consistent with a very recent study investigating P2Y14 relevance in embryonic lethality after radiation (44). Except for a significantly higher spleen weight (Table 1) and slightly increased blood pressure (Table 2) no obvious differences in genotype distribution, breeding, growth, gross morphology, histology, laboratory chemistry and behavior were detected on primary inspection in comparison to WT mice (Tables 3-5). Scrivens and Dickenson (35) focused in their study on the expression of P2Y14 in spleen and characterized the involvement of this GPCR in T-cell function. Indeed, UDP-glucose was able to inhibit the proliferation of murine spleen-derived T-cells induced by IL-2 and anti-CD3 antibody treatment (35). In line with my data, Kook et al. (44) described higher spleen weights of P2Y14-deficient offspring following prenatal radiation, suggesting a protective effect of P2Y14 deficiency in preventing spleen cell damage. Controversially, in utero pretreatment of WT mice with the putative receptor agonist
UDP-glucose mimicked the effect found in mice lacking P2Y14 (44).
However, the rather mild phenotype of P2Y14-deficient animals was observed under SPF conditions. It was shown that over 40% of all GPCR-deficient mouse models only display an obvious phenotype after challenging with a pathogen, drug or other challenging conditions (47). Therefore, tissue distribution analyses are often useful to obtain information about possible functions.
49 5.2 P2Y14 is widely expressed in mouse tissues
Quantitative PCR analyses showed a ubiquitous expression of P2Y14 in mouse tissues with high expression levels in pancreas, salivary glands, brain, lung and the GI tract and lowest expression in liver (Fig. 6A) Taking advantage of the introduced LacZ reporter construct the expression was tracked to a subpopulation of smooth muscle cells throughout the GI tract (Fig. 4). Several co-stainings with known smooth muscle cell markers revealed no overlap with the ß-galactosidase-positive cells. To my best knowledge, there is no other smooth muscle subtype which may correspond to the cells marked by the P2Y14-reporter construct and may indicate a previously non-described smooth muscle cell subpopulation.
Reporter gene expression can, in principle, show adverse expression effects due to adaptation to the lack of the deleted gene. To address this issue P2Y14 and LacZ reporter gene expression were studied in WT and KO mice. Quantitative PCR experiments showed that the mRNA expression levels and the tissue expression specificity of the reporter LacZ was similar to
P2Y14 (Fig. 6B). This equivalence of transcript levels almost excluded compensatory or reactive LacZ expression effects following P2Y14 deficiency in KO tissues and showed that the reporter gene properly indicates P2Y14 expression in tissues. Furthermore, it implicates that the reporter gene construct most probably does not influence the phenotypes that were studied in more detail.
The ubiquitous expression of P2Y14 in mouse tissues is in accord with previous findings in human and rat tissues (32,39,40) but now adds that in many organs distinct smooth muscle cells are the cellular basis of broad expression levels previously found in qPCR and Western blot analyses.
5.3 P2Y14 deficiency alters smooth muscle functions in GI tract and airways
To study the consequences of P2Y14 deficiency in the different smooth muscle-containing organs several GI tract and bronchial tract functions were tested. A previous study in rat revealed high P2Y14 mRNA levels and found UDP-glucose-dependent increase in the baseline muscle tension of the forestomach. However, comparison of WT und P2Y14- deficient mice revealed no differences in gastric emptying (45).
In studies with isolated intestine the contractility of several GI segments of KO mice was not different from those of WT mice following electric and carbachol stimulations. Moreover, UDP-glucose showed no effect on contraction of intestine preparations of WT mice.
50 However, observing the entire GI passage the lack of P2Y14 reduced GI emptying (Fig. 7), suggesting a more distinct effect of P2Y14 on smooth muscle function of the GI tract.
Interestingly, P2Y14-expressing bronchioles were also affected by deficiency of this GPCR.
Thus, P2Y14-KO mice displayed a higher dynamic compliance in response to inhaled methacholine (Fig. 8) during invasive plethysmography tests. Taken together, with the previously described role of P2Y14 in immune and inflammatory responses this is an interesting finding as chronic pulmonary diseases like asthma or chronic obstructive pulmonary disease (COPD) show inflammatory and narrowing remodeling processes in the bronchioli and airway hyperresponsiveness (73,74). Indeed, it has been shown that sputum samples from patients with airway inflammation contain higher levels of UDP-glucose (75) and Müller et al. (76) described the involvement of P2Y14 in release of chemokines like IL-8 from human airway epithelial cells. Interestingly, the involvement in asthma pathogenesis has been demonstrated for the ADP receptor P2Y12, another member of the P2Y12-like receptor group (77).
By analogy, differential expression of P2Y14 was also found in intestinal biopsies of patients with chronic bowel diseases (78). This group of disorders comprises Crohn’s disease and ulcerative colitis and is characterized by intestinal inflammation (77). In fact, P2Y14 was the only nucleotide receptor-related gene that displayed a positive expression correlation with grade of inflammation in ulcerative colitis (78). Further studies of P2Y14 function in murine models of acute or chronic lung diseases and inflammatory bowel diseases are required to dissect its possible contribution to these disorders.
Furthermore, one should note, that P2Y14 is expressed in venous blood vessels (Fig. 3) and
P2Y14 deficiency led to significant increases in blood pressure and heart rate (Table 2). There is some evidence that P2Y14 may have vasocontractile function on arteries (79) but P2Y14 expression in smooth muscle cells in arteries is controversially discussed (80,81). I found some ß-galactosidase positive arteries only in lung and CNS (circulus arteriosus Willisii)
(data not shown). Future studies will address if there is a physiological link between P2Y14 expression in the vascular system and hemodynamic functions.
In sum, these studies show that P2Y14 is highly expressed in a distinct subset of smooth muscle cells. P2Y14 expressed on those cells modulate contractile function of the GI and the bronchial tracts.
51 5.4 P2Y14 deficiency results in reduced glucose tolerance
The most obvious phenotype was the reduced oral glucose tolerance (Fig. 9A/C) in P2Y14- deficient mice. Altered glucose resorption, reduced insulin sensitivity and decreased pancreatic insulin secretion can contribute to an impaired oral glucose tolerance. Resorptional problems in the GI tract could not account for the reduced oral glucose tolerance since P2Y14- KO mice also showed significantly higher blood glucose levels following intraperitoneal glucose injection (Fig. 9B/D). The observed reduced glucose tolerance in P2Y14-deficient mice more likely results from the lower pancreatic insulin secretion after glucose application
(Fig. 10C/D). In a recent paper, Xu et al. (82) showed improved glucose tolerance in P2Y14- deficient mice fed with a high-fat diet due to an elevated insulin sensitivity e.g. of the liver. This is in contrast to my data where insulin sensitivity of KO and WT mice was not different (Fig. 10A/B). It was argued that reduced macrophage infiltration and hepatic inflammation account for improved hepatic insulin sensitivity (82). As in my study (Fig. 10C/D), Xu et al. (82) found reduced serum insulin levels after glucose administration in KO mice. This important finding remained unappreciated in their study and other pathophysiological mechanisms were not considered. In a more reasonable scenario, lower insulin levels result in a reduced hepatic steatosis, as found in (82) under high-fat diet. In fact, the differential expression of genes involved in lipid and glycogen metabolism in liver, as found in (82), can be interpreted as a consequence of lower insulin levels. It is well known that insulin stimulates the expression of lipogenic enzymes such as fatty-acid synthase and acetyl-CoA carboxylase and inhibits the transcription of gluconeogenic enzymes such as glucose-6- phosphatase and phosphoenolpyruvate carboxykinase (83). The hepatic inflammation is most likely secondary to the alimentary hepatic steatosis found in Xu et al (82). Since the western type diet I used in my experiments does not significantly differ from the high-fat diet (see 3.5) Xu et al. fed the mice (26.3% carbohydrates, 34.9% fat, 26.2% protein) I further focused on the reason for the lower blood insulin levels (Fig. 10 C/D) which were seen already in animals fed with standard chow.
5.5 Reduced insulin release from P2Y14-deficient islets
Since morphological changes and altered number of pancreatic islets did not account for the reduced serum insulin levels in P2Y14-deficient mice, differences at the molecular level were studied in detail using a transcriptome-wide approach.
52 In line with ß-galacosidase staining of pancreatic tissue (Fig. 5D), the RNA-sequencing data (Table 6), also qPCR analysis (∆Ct = 7.64 ± 0.55), and other studies (46) clearly demonstrate
P2Y14 expression in pancreatic islets. Transcriptome data showed significant changes in relevant components of glucose sensing, Ca2+-triggered and GPCR-modulated insulin release pathways (Fig. 12) in islets of P2Y14-deficient mice which suggested changes in islet function of KO animals and indeed, in vitro experiments revealed a negative impact of P2Y14 deficiency on glucose-dependent insulin release from isolated pancreatic islets (Fig. 13) and confirmed my in vivo findings.
Since P2Y14 couples to Gi/o proteins, inhibits adenylyl cyclases and mobilizes intracellular 2+ Ca (41,43) most probably via release of Gβγ dimers from Gi proteins (84), one would expect that loss of this gene should rather improve glucose-mediated insulin release from β-cells. However, UDP-glucose alone was neither able to significantly release insulin nor significantly reduce glucose-induced insulin release from isolated islets (see Fig. 13B-D). Therefore, I re-evaluated the agonistic properties of UDP- and UDP-glucose at the mouse and human P2Y14 with different methods in vitro. Techniques using chimeric G proteins in yeast and mammalian heterologous expression systems showed high basal activity of P2Y14 and some minor UDP- and UDP-glucose-mediated responses (Fig. 14A, Table 8). However, UDP and UDP-glucose did not significantly activate P2Y14 in classic cAMP inhibition assay (Table
8) and label-free DMR (Fig. 14B), whereas the Gi-coupled neuropeptide Y receptor Y2 showed robust agonist-mediated signals in all tests. At the current stage, UDP and UDP- glucose show weak agonistic activity at P2Y14 in functional assays using chimeric G proteins (30). Label-free and classic second messenger assays as well as my in vivo data with knock- out mice do not provide evidence for physiological activities of UDP and UDP-glucose at
P2Y14. Further studies using clear-cut controls (e.g. gene-deficient animals) are required to finally prove or disprove UDP-Glc and UDP as physiological agonists for P2Y14.
The cell type within Langerhans islets, where a specific GPCR is expressed, determines its function on insulin exocytosis. Currently, the cell type(s) of pancreatic islets expressing
P2Y14 is unknown. Further, the effect of a given GPCR on insulin release apparently not only depends on its G protein-coupling mode. Thus, Gq protein-coupled receptors such as the
GnRH receptor inhibits insulin release whereas the exclusively Gi protein-coupled cannabinoid receptor type 1 and the melanin-concentrating hormone receptor stimulate insulin release from islets (46). The most abundant somatostatin receptor SSTR3 (see Table 6), which is Gi/o protein-coupled, has no significant effect on insulin release (46). As for several GPCR
53 expressed in pancreatic islets (46) the specific signaling pathway how P2Y14 modulates gene expression and functions of islets needs to be studied further.
5.6 Conclusion
Mice with P2Y14 deficiency present a rather mild phenotype under SPF conditions.
However, my studies revealed involvement of P2Y14 in GI tract emptying and glucose homeostasis regulation. The lack of P2Y14 function reduced intestine passage and glucose- stimulated insulin release from pancreatic islets in vitro and in vivo. It is of interest that several GPCR, e.g. GLP1R, GPR39, M3 muscarinic receptor and galanin receptor, modulate both, GI motility and glucose-induced insulin secretion (85-88). For P2Y14 it is currently unclear whether this GPCR realizes its effect by acute activation of its signaling cascade or during islet ontogenesis. The gross transcriptome changes found in P2Y14-deficient islets may also suggest a more complex alteration of the expression profile indicating a role of P2Y14 in subdifferentiation of islets cells. Indeed, some genes which are involved in differentiation and maturation of pancreatic islet cell types (e.g. MAFA, MAFB, REG2) (89-91) are differentially expressed in the islets isolated from P2Y14-deficient mice (Fig. 12). Although there were no differences in gross islet morphology and islet size distribution (Fig. 11), there is evidence that e.g. pancreatic β-cells are not homogenous but rather present functionally different subpopulations with distinguishable functionality (92,93). Thus, P2Y14-mediated signaling may be one signal that modulates distinct functionalities of islet cells. Since Langerhans islets derived from pancreatic ductal cells during ontogenesis and P2Y14 expression was morphologically also found in the exocrine pancreas (Fig. 5A-C), more detailed studies should focus on the relevance of P2Y14 in pancreas development. Further studies with conditional β-cell-specific KO mice can help to differentiate between acute and adaptive effects of P2Y14 deficiency. Moreover, P2Y14 gene variants may contribute to a prediabetic state that enhances the risk of metabolic disease in humans. This obviously raises the questions whether there are polymorphisms of the P2Y14 gene within the human population that define this risk and whether signatures of recent selection can be found at the locus.
Nevertheless, findings in this study identify P2Y14 as a novel modulator of insulin secretion.
54 6 SUMMARY
Dissertation zur Erlangung des akademischen Grades
Dr. med.
Titel: The physiological relevance of the G protein-coupled receptor P2Y14
eingereicht von: Jaroslawna Meister
angefertigt am: Institut für Biochemie Medizinische Fakultät, Universität Leipzig
betreut von: Prof. Dr. med. Torsten Schöneberg Dr. rer. nat. Angela Schulz
eingereicht im: 07/2014
G protein-coupled receptors (GPCR) play a significant role in regulating virtual all physiological functions and more than one third of currently clinically used drugs target GPCR. However, there are approximately one hundred so-called orphan GPCR to whom neither the physiological function nor the endogenous ligand has been assigned yet. Therefore, the identification of their role in organism could display new targets for therapeutic applications.
The UDP-glucose receptor P2Y14 is a GPCR that belongs to the family of the P2Y12-like receptors due to phylogenetic relation. This group comprises among other receptors the clopidogrel-sensitive ADP receptor P2Y12 whose pivotal role in platelet aggregation and immune function has been well characterized in several studies. However, only little is known about the physiological function of other GPCR of the P2Y12-like receptor group. Previous studies on P2Y14 function focused on its involvement in immune and inflammatory responses based on the high abundance of this GPCR in the immune system. Because high expression was found in the gastrointestinal (GI) system, it seemed reasonable to investigate a possible role of P2Y14 in the regulation of nutrient uptake and energy metabolism. Taking advantage
55 of a gene-deficient (KO) mouse strain this study aimed at the characterization of the biological consequences of UDP-glucose receptor deficiency.
The study revealed the following main results:
1. The generated P2Y14-KO mouse strain showed no obvious phenotypes regarding genotype distribution, breeding, growth, development and morphology. The
P2Y14-deficient offspring was vital and fertile and displayed no gross differences in laboratory screens and behavioral tests except for a higher spleen weight and increased blood pressure and heart rate under specific pathogen free (SPF) conditions.
2. P2Y14 is widely expressed in mouse tissues showing high expression levels in pancreas, salivary glands, brain, lung, and parts of the GI tract and lowest
expression in liver. Using a LacZ reporter gene the expression of the P2Y14 was tracked to distinct smooth muscle cells within the GI tract. This smooth muscle cell population is different to any other described subpopulations (e.g. Cajal cells).
3. P2Y14 deficiency in mice results in altered smooth muscle function in the GI and
bronchial tracts. P2Y14-KO mice show a prolonged GI passage in GI transit
experiments. In an invasive plethysmography test mice deficient for P2Y14 showed enhanced lung compliance following increasing doses of inhaled methacholine.
These results indicate a role of P2Y14 in modulating the contractile function of smooth muscle cells expressing this GPCR. 4. Metabolic studies revealed a reduced oral and intraperitoneal glucose tolerance in
P2Y14-KO mice kept under standard and western type diet. By performing insulin tolerance and insulin secretion tests this phenotype was pinpointed to lower serum
insulin levels following glucose application in mice lacking P2Y14. 5. Morphometric analyses of pancreatic tissue displayed no differences in number
and size of the islets of P2Y14-KO mice in comparison to WT mice, suggesting no gross morphological abnormalities in islet development.
6. To assess possible differences in islets of P2Y14-KO mice at the molecular level RNA expression was analyzed in a transcriptome-wide approach using RNA- sequencing. 815 genes were found differentially expressed between the islets of KO and WT mice. Transcriptome data show significant alterations in expression of components relevant for glucose sensing, Ca2+-triggered and GPCR-modulated
56 insulin release pathways in islets of P2Y14-deficient mice suggesting changes in islet function of KO animals. 7. In vitro insulin secretion experiments demonstrated a reduced insulin release from
isolated pancreatic islets of P2Y14-deficient mice despite similar amount of produced insulin in islets isolated from both WT and KO mice.
In conclusion, mice with P2Y14 deficiency present a rather mild phenotype with higher spleen weight and delayed GI tract emptying under SPF conditions. However, more detailed analysis of metabolic parameters revealed a significantly reduced glucose tolerance and insulin secretion in KO mice. In addition to immune function these metabolic data indicate a role of
P2Y14 in the regulation of energy homeostasis via modulation of the insulin release.
57 7 REFERENCES
1. Lander, E. S., Linton, L. M., Birren, B., Nusbaum, C., Zody, M. C., Baldwin, J., Devon, K., Dewar, K., Doyle, M., FitzHugh, W., Funke, R., Gage, D., Harris, K., Heaford, A., Howland, J., Kann, L., Lehoczky, J., LeVine, R., McEwan, P., McKernan, K., Meldrim, J., Mesirov, J. P., Miranda, C., Morris, W., Naylor, J., Raymond, C., Rosetti, M., Santos, R., Sheridan, A., Sougnez, C., Stange-Thomann, N., Stojanovic, N., Subramanian, A., Wyman, D., Rogers, J., Sulston, J., Ainscough, R., Beck, S., Bentley, D., Burton, J., Clee, C., Carter, N., Coulson, A., Deadman, R., Deloukas, P., Dunham, A., Dunham, I., Durbin, R., French, L., Grafham, D., Gregory, S., Hubbard, T., Humphray, S., Hunt, A., Jones, M., Lloyd, C., McMurray, A., Matthews, L., Mercer, S., Milne, S., Mullikin, J. C., Mungall, A., Plumb, R., Ross, M., Shownkeen, R., Sims, S., Waterston, R. H., Wilson, R. K., Hillier, L. W., McPherson, J. D., Marra, M. A., Mardis, E. R., Fulton, L. A., Chinwalla, A. T., Pepin, K. H., Gish, W. R., Chissoe, S. L., Wendl, M. C., Delehaunty, K. D., Miner, T. L., Delehaunty, A., Kramer, J. B., Cook, L. L., Fulton, R. S., Johnson, D. L., Minx, P. J., Clifton, S. W., Hawkins, T., Branscomb, E., Predki, P., Richardson, P., Wenning, S., Slezak, T., Doggett, N., Cheng, J. F., Olsen, A., Lucas, S., Elkin, C., Uberbacher, E., Frazier, M., Gibbs, R. A., Muzny, D. M., Scherer, S. E., Bouck, J. B., Sodergren, E. J., Worley, K. C., Rives, C. M., Gorrell, J. H., Metzker, M. L., Naylor, S. L., Kucherlapati, R. S., Nelson, D. L., Weinstock, G. M., Sakaki, Y., Fujiyama, A., Hattori, M., Yada, T., Toyoda, A., Itoh, T., Kawagoe, C., Watanabe, H., Totoki, Y., Taylor, T., Weissenbach, J., Heilig, R., Saurin, W., Artiguenave, F., Brottier, P., Bruls, T., Pelletier, E., Robert, C., Wincker, P., Smith, D. R., Doucette-Stamm, L., Rubenfield, M., Weinstock, K., Lee, H. M., Dubois, J., Rosenthal, A., Platzer, M., Nyakatura, G., Taudien, S., Rump, A., Yang, H., Yu, J., Wang, J., Huang, G., Gu, J., Hood, L., Rowen, L., Madan, A., Qin, S., Davis, R. W., Federspiel, N. A., Abola, A. P., Proctor, M. J., Myers, R. M., Schmutz, J., Dickson, M., Grimwood, J., Cox, D. R., Olson, M. V., Kaul, R., Raymond, C., Shimizu, N., Kawasaki, K., Minoshima, S., Evans, G. A., Athanasiou, M., Schultz, R., Roe, B. A., Chen, F., Pan, H., Ramser, J., Lehrach, H., Reinhardt, R., McCombie, W. R., de la Bastide, M., Dedhia, N., Blocker, H., Hornischer, K., Nordsiek, G., Agarwala, R., Aravind, L., Bailey, J. A., Bateman, A., Batzoglou, S., Birney, E., Bork, P., Brown, D. G., Burge, C. B., Cerutti, L., Chen, H. C., Church, D., Clamp, M., Copley, R. R., Doerks, T., Eddy, S. R., Eichler, E. E., Furey, T. S., Galagan, J., Gilbert, J. G., Harmon, C., Hayashizaki, Y., Haussler, D., Hermjakob, H., Hokamp, K., Jang, W., Johnson, L. S., Jones, T. A., Kasif, S., Kaspryzk, A., Kennedy, S., Kent, W. J., Kitts, P., Koonin, E. V., Korf, I., Kulp, D., Lancet, D., Lowe, T. M., McLysaght, A., Mikkelsen, T., Moran, J. V., Mulder, N., Pollara, V. J., Ponting, C. P., Schuler, G., Schultz, J., Slater, G., Smit, A. F., Stupka, E., Szustakowski, J., Thierry-Mieg, D., Thierry-Mieg, J., Wagner, L., Wallis, J., Wheeler, R., Williams, A., Wolf, Y. I., Wolfe, K. H., Yang, S. P., Yeh, R. F., Collins, F., Guyer, M. S., Peterson, J., Felsenfeld, A., Wetterstrand, K. A., Patrinos, A., Morgan, M. J., de Jong, P., Catanese, J. J., Osoegawa, K., Shizuya, H., Choi, S., and Chen, Y. J. (2001) Initial sequencing and analysis of the human genome. Nature 409, 860-921 2. Venter, J. C., Adams, M. D., Myers, E. W., Li, P. W., Mural, R. J., Sutton, G. G., Smith, H. O., Yandell, M., Evans, C. A., Holt, R. A., Gocayne, J. D., Amanatides, P., Ballew, R. M., Huson, D. H., Wortman, J. R., Zhang, Q., Kodira, C. D., Zheng, X. H., Chen, L., Skupski, M., Subramanian, G., Thomas, P. D., Zhang, J., Gabor Miklos, G. L., Nelson, C., Broder, S., Clark, A. G., Nadeau, J., McKusick, V. A., Zinder, N., Levine, A. J., Roberts, R. J., Simon, M., Slayman, C., Hunkapiller, M., Bolanos, R.,
58 Delcher, A., Dew, I., Fasulo, D., Flanigan, M., Florea, L., Halpern, A., Hannenhalli, S., Kravitz, S., Levy, S., Mobarry, C., Reinert, K., Remington, K., Abu-Threideh, J., Beasley, E., Biddick, K., Bonazzi, V., Brandon, R., Cargill, M., Chandramouliswaran, I., Charlab, R., Chaturvedi, K., Deng, Z., Di Francesco, V., Dunn, P., Eilbeck, K., Evangelista, C., Gabrielian, A. E., Gan, W., Ge, W., Gong, F., Gu, Z., Guan, P., Heiman, T. J., Higgins, M. E., Ji, R. R., Ke, Z., Ketchum, K. A., Lai, Z., Lei, Y., Li, Z., Li, J., Liang, Y., Lin, X., Lu, F., Merkulov, G. V., Milshina, N., Moore, H. M., Naik, A. K., Narayan, V. A., Neelam, B., Nusskern, D., Rusch, D. B., Salzberg, S., Shao, W., Shue, B., Sun, J., Wang, Z., Wang, A., Wang, X., Wang, J., Wei, M., Wides, R., Xiao, C., Yan, C., Yao, A., Ye, J., Zhan, M., Zhang, W., Zhang, H., Zhao, Q., Zheng, L., Zhong, F., Zhong, W., Zhu, S., Zhao, S., Gilbert, D., Baumhueter, S., Spier, G., Carter, C., Cravchik, A., Woodage, T., Ali, F., An, H., Awe, A., Baldwin, D., Baden, H., Barnstead, M., Barrow, I., Beeson, K., Busam, D., Carver, A., Center, A., Cheng, M. L., Curry, L., Danaher, S., Davenport, L., Desilets, R., Dietz, S., Dodson, K., Doup, L., Ferriera, S., Garg, N., Gluecksmann, A., Hart, B., Haynes, J., Haynes, C., Heiner, C., Hladun, S., Hostin, D., Houck, J., Howland, T., Ibegwam, C., Johnson, J., Kalush, F., Kline, L., Koduru, S., Love, A., Mann, F., May, D., McCawley, S., McIntosh, T., McMullen, I., Moy, M., Moy, L., Murphy, B., Nelson, K., Pfannkoch, C., Pratts, E., Puri, V., Qureshi, H., Reardon, M., Rodriguez, R., Rogers, Y. H., Romblad, D., Ruhfel, B., Scott, R., Sitter, C., Smallwood, M., Stewart, E., Strong, R., Suh, E., Thomas, R., Tint, N. N., Tse, S., Vech, C., Wang, G., Wetter, J., Williams, S., Williams, M., Windsor, S., Winn-Deen, E., Wolfe, K., Zaveri, J., Zaveri, K., Abril, J. F., Guigo, R., Campbell, M. J., Sjolander, K. V., Karlak, B., Kejariwal, A., Mi, H., Lazareva, B., Hatton, T., Narechania, A., Diemer, K., Muruganujan, A., Guo, N., Sato, S., Bafna, V., Istrail, S., Lippert, R., Schwartz, R., Walenz, B., Yooseph, S., Allen, D., Basu, A., Baxendale, J., Blick, L., Caminha, M., Carnes-Stine, J., Caulk, P., Chiang, Y. H., Coyne, M., Dahlke, C., Mays, A., Dombroski, M., Donnelly, M., Ely, D., Esparham, S., Fosler, C., Gire, H., Glanowski, S., Glasser, K., Glodek, A., Gorokhov, M., Graham, K., Gropman, B., Harris, M., Heil, J., Henderson, S., Hoover, J., Jennings, D., Jordan, C., Jordan, J., Kasha, J., Kagan, L., Kraft, C., Levitsky, A., Lewis, M., Liu, X., Lopez, J., Ma, D., Majoros, W., McDaniel, J., Murphy, S., Newman, M., Nguyen, T., Nguyen, N., Nodell, M., Pan, S., Peck, J., Peterson, M., Rowe, W., Sanders, R., Scott, J., Simpson, M., Smith, T., Sprague, A., Stockwell, T., Turner, R., Venter, E., Wang, M., Wen, M., Wu, D., Wu, M., Xia, A., Zandieh, A., and Zhu, X. (2001) The sequence of the human genome. Science 291, 1304-1351 3. Schioth, H. B., and Fredriksson, R. (2005) The GRAFS classification system of G- protein coupled receptors in comparative perspective. Gen Comp Endocrinol 142, 94- 101 4. Pierce, K. L., Premont, R. T., and Lefkowitz, R. J. (2002) Seven-transmembrane receptors. Nat Rev Mol Cell Biol 3, 639-650 5. Wess, J. (1998) Molecular basis of receptor/G-protein-coupling selectivity. Pharmacol Ther 80, 231-264 6. Wettschureck, N., and Offermanns, S. (2005) Mammalian G proteins and their cell type specific functions. Physiol Rev 85, 1159-1204 7. Rask-Andersen, M., Almen, M. S., and Schioth, H. B. Trends in the exploitation of novel drug targets. Nat Rev Drug Discov 10, 579-590 8. Libert, F., Parmentier, M., Lefort, A., Dinsart, C., Van Sande, J., Maenhaut, C., Simons, M. J., Dumont, J. E., and Vassart, G. (1989) Selective amplification and cloning of four new members of the G protein-coupled receptor family. Science 244, 569-572
59 9. Civelli, O., Reinscheid, R. K., Zhang, Y., Wang, Z., Fredriksson, R., and Schioth, H. B. (2013) G protein-coupled receptor deorphanizations. Annu Rev Pharmacol Toxicol 53, 127-146 10. Fargin, A., Raymond, J. R., Lohse, M. J., Kobilka, B. K., Caron, M. G., and Lefkowitz, R. J. (1988) The genomic clone G-21 which resembles a beta-adrenergic receptor sequence encodes the 5-HT1A receptor. Nature 335, 358-360 11. Bunzow, J. R., Van Tol, H. H., Grandy, D. K., Albert, P., Salon, J., Christie, M., Machida, C. A., Neve, K. A., and Civelli, O. (1988) Cloning and expression of a rat D2 dopamine receptor cDNA. Nature 336, 783-787 12. Nomura, N., Miyajima, N., Sazuka, T., Tanaka, A., Kawarabayasi, Y., Sato, S., Nagase, T., Seki, N., Ishikawa, K., and Tabata, S. (1994) Prediction of the coding sequences of unidentified human genes. I. The coding sequences of 40 new genes (KIAA0001-KIAA0040) deduced by analysis of randomly sampled cDNA clones from human immature myeloid cell line KG-1. DNA Res 1, 27-35 13. Charlton, M. E., Williams, A. S., Fogliano, M., Sweetnam, P. M., and Duman, R. S. (1997) The isolation and characterization of a novel G protein-coupled receptor regulated by immunologic challenge. Brain Research 764, 141-148 14. Schoneberg, T., Hermsdorf, T., Engemaier, E., Engel, K., Liebscher, I., Thor, D., Zierau, K., Rompler, H., and Schulz, A. (2007) Structural and functional evolution of the P2Y(12)-like receptor group. Purinergic Signal 3, 255-268 15. Secco, G. G., Parisi, R., Mirabella, F., Fattori, R., Genoni, G., Agostoni, P., De Luca, G., Marino, P. N., Lupi, A., and Rognoni, A. P2Y12 inhibitors: pharmacologic mechanism and clinical relevance. Cardiovasc Hematol Agents Med Chem 11, 101- 105 16. Hollopeter, G., Jantzen, H. M., Vincent, D., Li, G., England, L., Ramakrishnan, V., Yang, R. B., Nurden, P., Nurden, A., Julius, D., and Conley, P. B. (2001) Identification of the platelet ADP receptor targeted by antithrombotic drugs. Nature 409, 202-207 17. Lichtenstein, L., Serhan, N., Annema, W., Combes, G., Robaye, B., Boeynaems, J. M., Perret, B., Tietge, U. J., Laffargue, M., and Martinez, L. O. Lack of P2Y13 in mice fed a high cholesterol diet results in decreased hepatic cholesterol content, biliary lipid secretion and reverse cholesterol transport. Nutr Metab (Lond) 10, 67 18. Serhan, N., Cabou, C., Verdier, C., Lichtenstein, L., Malet, N., Perret, B., Laffargue, M., and Martinez, L. O. Chronic pharmacological activation of P2Y13 receptor in mice decreases HDL-cholesterol level by increasing hepatic HDL uptake and bile acid secretion. Biochim Biophys Acta 1831, 719-725 19. Fabre, A. C., Malaval, C., Ben Addi, A., Verdier, C., Pons, V., Serhan, N., Lichtenstein, L., Combes, G., Huby, T., Briand, F., Collet, X., Nijstad, N., Tietge, U. J., Robaye, B., Perret, B., Boeynaems, J. M., and Martinez, L. O. P2Y13 receptor is critical for reverse cholesterol transport. Hepatology 52, 1477-1483 20. Biver, G., Wang, N., Gartland, A., Orriss, I., Arnett, T. R., Boeynaems, J. M., and Robaye, B. Role of the P2Y13 Receptor in the Differentiation of Bone Marrow Stromal Cells into Osteoblasts and Adipocytes. Stem Cells 31, 2747-2758 21. Orriss, I., Syberg, S., Wang, N., Robaye, B., Gartland, A., Jorgensen, N., Arnett, T., and Boeynaems, J. M. Bone phenotypes of P2 receptor knockout mice. Front Biosci (Schol Ed) 3, 1038-1046 22. Wang, N., Robaye, B., Gossiel, F., Boeynaems, J. M., and Gartland, A. The P2Y13 receptor regulates phosphate metabolism and FGF-23 secretion with effects on skeletal development. Faseb J 23. Engel, K. M., Schrock, K., Teupser, D., Holdt, L. M., Tonjes, A., Kern, M., Dietrich, K., Kovacs, P., Krugel, U., Scheidt, H. A., Schiller, J., Huster, D., Brockmann, G. A.,
60 Augustin, M., Thiery, J., Bluher, M., Stumvoll, M., Schoneberg, T., and Schulz, A. Reduced food intake and body weight in mice deficient for the G protein-coupled receptor GPR82. PLoS One 6, e29400 24. Sugo, T., Tachimoto, H., Chikatsu, T., Murakami, Y., Kikukawa, Y., Sato, S., Kikuchi, K., Nagi, T., Harada, M., Ogi, K., Ebisawa, M., and Mori, M. (2006) Identification of a lysophosphatidylserine receptor on mast cells. Biochem Biophys Res Commun 341, 1078-1087 25. von Kugelgen, I. (2006) Pharmacological profiles of cloned mammalian P2Y-receptor subtypes. Pharmacol Ther 110, 415-432 26. Tabata, K., Baba, K., Shiraishi, A., Ito, M., and Fujita, N. (2007) The orphan GPCR GPR87 was deorphanized and shown to be a lysophosphatidic acid receptor. Biochem Biophys Res Commun 363, 861-866 27. Nonaka, Y., Hiramoto, T., and Fujita, N. (2005) Identification of endogenous surrogate ligands for human P2Y12 receptors by in silico and in vitro methods. Biochem Biophys Res Commun 337, 281-288 28. Staubert, C., Boselt, I., Bohnekamp, J., Rompler, H., Enard, W., and Schoneberg, T. Structural and functional evolution of the trace amine-associated receptors TAAR3, TAAR4 and TAAR5 in primates. PLoS One 5, e11133 29. Kleinau, G., Pratzka, J., Nurnberg, D., Gruters, A., Fuhrer-Sakel, D., Krude, H., Kohrle, J., Schoneberg, T., and Biebermann, H. Differential modulation of Beta- adrenergic receptor signaling by trace amine-associated receptor 1 agonists. PLoS One 6, e27073 30. Chambers, J. K., Macdonald, L. E., Sarau, H. M., Ames, R. S., Freeman, K., Foley, J. J., Zhu, Y., McLaughlin, M. M., Murdock, P., McMillan, L., Trill, J., Swift, A., Aiyar, N., Taylor, P., Vawter, L., Naheed, S., Szekeres, P., Hervieu, G., Scott, C., Watson, J. M., Murphy, A. J., Duzic, E., Klein, C., Bergsma, D. J., Wilson, S., and Livi, G. P. (2000) A G protein-coupled receptor for UDP-glucose. J Biol Chem 275, 10767-10771 31. Fricks, I. P., Maddileti, S., Carter, R. L., Lazarowski, E. R., Nicholas, R. A., Jacobson, K. A., and Harden, T. K. (2008) UDP Is a Competitive Antagonist at the Human P2Y14 Receptor. Journal of Pharmacology and Experimental Therapeutics 325, 588- 594 32. Moore, D. J., Murdock, P. R., Watson, J. M., Faull, R. L., Waldvogel, H. J., Szekeres, P. G., Wilson, S., Freeman, K. B., and Emson, P. C. (2003) GPR105, a novel Gi/o- coupled UDP-glucose receptor expressed on brain glia and peripheral immune cells, is regulated by immunologic challenge: possible role in neuroimmune function. Brain Res Mol Brain Res 118, 10-23 33. Ko, H., Fricks, I., Ivanov, A. A., Harden, T. K., and Jacobson, K. A. (2007) Structure- activity relationship of uridine 5'-diphosphoglucose analogues as agonists of the human P2Y14 receptor. J Med Chem 50, 2030-2039 34. Scrivens, M., and Dickenson, J. M. (2006) Functional expression of the P2Y14 receptor in human neutrophils. Eur J Pharmacol 543, 166-173 35. Scrivens, M., and Dickenson, J. M. (2005) Functional expression of the P2Y14 receptor in murine T-lymphocytes. Br J Pharmacol 146, 435-444 36. Ault, A. D., and Broach, J. R. (2006) Creation of GPCR-based chemical sensors by directed evolution in yeast. Protein Eng Des Sel 19, 1-8 37. Carter, R. L., Fricks, I. P., Barrett, M. O., Burianek, L. E., Zhou, Y., Ko, H., Das, A., Jacobson, K. A., Lazarowski, E. R., and Harden, T. K. (2009) Quantification of Gi- mediated inhibition of adenylyl cyclase activity reveals that UDP is a potent agonist of the human P2Y14 receptor. Mol Pharmacol 76, 1341-1348 38. Hamel, M., Henault, M., Hyjazie, H., Morin, N., Bayly, C., Skorey, K., Therien, A. G., Mancini, J., Brideau, C., and Kargman, S. (2011) Discovery of novel P2Y14
61 agonist and antagonist using conventional and nonconventional methods. J Biomol Screen 16, 1098-1105 39. Freeman, K., Tsui, P., Moore, D., Emson, P. C., Vawter, L., Naheed, S., Lane, P., Bawagan, H., Herrity, N., Murphy, K., Sarau, H. M., Ames, R. S., Wilson, S., Livi, G. P., and Chambers, J. K. (2001) Cloning, pharmacology, and tissue distribution of G- protein-coupled receptor GPR105 (KIAA0001) rodent orthologs. Genomics 78, 124- 128 40. Kobayashi, K., Fukuoka, T., Yamanaka, H., Dai, Y., Obata, K., Tokunaga, A., and Noguchi, K. (2006) Neurons and glial cells differentially express P2Y receptor mRNAs in the rat dorsal root ganglion and spinal cord. J Comp Neurol 498, 443-454 41. Skelton, L., Cooper, M., Murphy, M., and Platt, A. (2003) Human immature monocyte-derived dendritic cells express the G protein-coupled receptor GPR105 (KIAA0001, P2Y14) and increase intracellular calcium in response to its agonist, uridine diphosphoglucose. J Immunol 171, 1941-1949 42. Malin, S. A., and Molliver, D. C. (2010) Gi- and Gq-coupled ADP (P2Y) receptors act in opposition to modulate nociceptive signaling and inflammatory pain behavior. Mol Pain 6, 21 43. Gao, Z. G., Ding, Y., and Jacobson, K. A. (2010) UDP-glucose acting at P2Y14 receptors is a mediator of mast cell degranulation. Biochem Pharmacol 79, 873-879 44. Kook, S. H., Cho, J. S., Morrison, A., Wiener, E., Lee, S. B., Scadden, D., and Lee, B. C. (2013) The purinergic P2Y14 receptor axis is a molecular determinant for organism survival under in utero radiation toxicity. Cell Death Dis 4, e703 45. Bassil, A. K., Bourdu, S., Townson, K. A., Wheeldon, A., Jarvie, E. M., Zebda, N., Abuin, A., Grau, E., Livi, G. P., Punter, L., Latcham, J., Grimes, A. M., Hurp, D. P., Downham, K. M., Sanger, G. J., Winchester, W. J., Morrison, A. D., and Moore, G. B. (2009) UDP-glucose modulates gastric function through P2Y14 receptor-dependent and -independent mechanisms. Am J Physiol Gastrointest Liver Physiol 296, G923- 930 46. Amisten, S., Salehi, A., Rorsman, P., Jones, P. M., and Persaud, S. J. (2013) An atlas and functional analysis of G-protein coupled receptors in human islets of Langerhans. Pharmacol Ther 139, 359-391 47. Schoneberg, T., Schulz, A., Biebermann, H., Hermsdorf, T., Rompler, H., and Sangkuhl, K. (2004) Mutant G-protein-coupled receptors as a cause of human diseases. Pharmacol Ther 104, 173-206 48. Engel, K. M., Schrock, K., Teupser, D., Holdt, L. M., Tonjes, A., Kern, M., Dietrich, K., Kovacs, P., Krugel, U., Scheidt, H. A., Schiller, J., Huster, D., Brockmann, G. A., Augustin, M., Thiery, J., Bluher, M., Stumvoll, M., Schoneberg, T., and Schulz, A. (2011) Reduced food intake and body weight in mice deficient for the G protein- coupled receptor GPR82. PLoS One 6, e29400 49. Schutze, N., Lehmann, I., Bonisch, U., Simon, J. C., and Polte, T. (2010) Exposure to mycotoxins increases the allergic immune response in a murine asthma model. Am J Respir Crit Care Med 181, 1188-1199 50. Kong, K. C., Butcher, A. J., McWilliams, P., Jones, D., Wess, J., Hamdan, F. F., Werry, T., Rosethorne, E. M., Charlton, S. J., Munson, S. E., Cragg, H. A., Smart, A. D., and Tobin, A. B. (2010) M3-muscarinic receptor promotes insulin release via receptor phosphorylation/arrestin-dependent activation of protein kinase D1. Proc Natl Acad Sci U S A 107, 21181-21186 51. Sassmann, A., Gier, B., Grone, H. J., Drews, G., Offermanns, S., and Wettschureck, N. (2010) The Gq/G11-mediated signaling pathway is critical for autocrine potentiation of insulin secretion in mice. J Clin Invest 120, 2184-2193
62 52. Yesil, P., Michel, M., Chwalek, K., Pedack, S., Jany, C., Ludwig, B., Bornstein, S. R., and Lammert, E. (2009) A new collagenase blend increases the number of islets isolated from mouse pancreas. Islets 1, 185-190 53. Trapnell, C., Roberts, A., Goff, L., Pertea, G., Kim, D., Kelley, D. R., Pimentel, H., Salzberg, S. L., Rinn, J. L., and Pachter, L. (2012) Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks. Nat Protoc 7, 562-578 54. Roberts, A., Pimentel, H., Trapnell, C., and Pachter, L. (2011) Identification of novel transcripts in annotated genomes using RNA-Seq. Bioinformatics 27, 2325-2329 55. Anders, S., and Huber, W. (2010) Differential expression analysis for sequence count data. Genome Biol 11, R106 56. Chen, J., Bardes, E. E., Aronow, B. J., and Jegga, A. G. (2009) ToppGene Suite for gene list enrichment analysis and candidate gene prioritization. Nucleic Acids Res 37, W305-311 57. Thor, D., Le Duc, D., Strotmann, R., and Schoneberg, T. (2009) Luciferase activity under direct ligand-dependent control of a muscarinic acetylcholine receptor. BMC Biotechnol 9, 46 58. Schulz, A., and Schoneberg, T. (2003) The structural evolution of a P2Y-like G- protein-coupled receptor. J Biol Chem 278, 35531-35541 59. Schroder, R., Janssen, N., Schmidt, J., Kebig, A., Merten, N., Hennen, S., Muller, A., Blattermann, S., Mohr-Andra, M., Zahn, S., Wenzel, J., Smith, N. J., Gomeza, J., Drewke, C., Milligan, G., Mohr, K., and Kostenis, E. (2010) Deconvolution of complex G protein-coupled receptor signaling in live cells using dynamic mass redistribution measurements. Nat Biotechnol 28, 943-949 60. Komuro, T. (2006) Structure and organization of interstitial cells of Cajal in the gastrointestinal tract. J Physiol 576, 653-658 61. Radenkovic, G., Ilic, I., Zivanovic, D., Vlajkovic, S., Petrovic, V., and Mitrovic, O. (2010) C-kit-immunopositive interstitial cells of Cajal in human embryonal and fetal oesophagus. Cell Tissue Res 340, 427-436 62. Shimoda, H., Kudo, T., Takahashi, Y., and Kato, S. (2000) Ultrastructural and histochemical characterization of special muscle cells in the monkey small intestine. Archives of histology and cytology 63, 217-228 63. Henquin, J. C. (2009) Regulation of insulin secretion: a matter of phase control and amplitude modulation. Diabetologia 52, 739-751 64. Dyachok, O., and Gylfe, E. (2004) Ca(2+)-induced Ca(2+) release via inositol 1,4,5- trisphosphate receptors is amplified by protein kinase A and triggers exocytosis in pancreatic beta-cells. J Biol Chem 279, 45455-45461 65. Han, P., Werber, J., Surana, M., Fleischer, N., and Michaeli, T. (1999) The calcium/calmodulin-dependent phosphodiesterase PDE1C down-regulates glucose- induced insulin secretion. J Biol Chem 274, 22337-22344 66. Alquier, T., Peyot, M. L., Latour, M. G., Kebede, M., Sorensen, C. M., Gesta, S., Ronald Kahn, C., Smith, R. D., Jetton, T. L., Metz, T. O., Prentki, M., and Poitout, V. (2009) Deletion of GPR40 impairs glucose-induced insulin secretion in vivo in mice without affecting intracellular fuel metabolism in islets. Diabetes 58, 2607-2615 67. Strowski, M. Z., Parmar, R. M., Blake, A. D., and Schaeffer, J. M. (2000) Somatostatin inhibits insulin and glucagon secretion via two receptors subtypes: an in vitro study of pancreatic islets from somatostatin receptor 2 knockout mice. Endocrinology 141, 111-117 68. Thor, D., Schulz, A., Hermsdorf, T., and Schoneberg, T. (2008) Generation of an agonistic binding site for blockers of the M(3) muscarinic acetylcholine receptor. Biochem J 412, 103-112
63 69. Pausch, M. H., Lai, M., Tseng, E., Paulsen, J., Bates, B., and Kwak, S. (2004) Functional expression of human and mouse P2Y12 receptors in Saccharomyces cerevisiae. Biochem Biophys Res Commun 324, 171-177 70. Lee, B. C., Cheng, T., Adams, G. B., Attar, E. C., Miura, N., Lee, S. B., Saito, Y., Olszak, I., Dombkowski, D., Olson, D. P., Hancock, J., Choi, P. S., Haber, D. A., Luster, A. D., and Scadden, D. T. (2003) P2Y-like receptor, GPR105 (P2Y14), identifies and mediates chemotaxis of bone-marrow hematopoietic stem cells. Genes Dev 17, 1592-1604 71. Scrivens, M., and Dickenson, J. M. (2005) Pharmacological effects mediated by UDP- glucose that are independent of P2Y14 receptor expression. Pharmacol Res 51, 533- 538 72. Cho, J., Yusuf, R., Kook, S., Attar, E., Lee, D., Park, B., Cheng, T., Scadden, D. T., and Lee, B. C. (2014) Purinergic P2Y14 receptor modulates stress-induced hematopoietic stem/progenitor cell senescence. J Clin Invest 10.1172/JCI61636 73. Hogg, J. C., Macklem, P. T., and Thurlbeck, W. M. (1968) Site and nature of airway obstruction in chronic obstructive lung disease. N Engl J Med 278, 1355-1360 74. Apter, A. J. (2014) Advances in adult asthma diagnosis and treatment in 2013. J Allergy Clin Immunol 133, 49-56 75. Kreda, S. M., Okada, S. F., van Heusden, C. A., O'Neal, W., Gabriel, S., Abdullah, L., Davis, C. W., Boucher, R. C., and Lazarowski, E. R. (2007) Coordinated release of nucleotides and mucin from human airway epithelial Calu-3 cells. J Physiol 584, 245- 259 76. Muller, T., Bayer, H., Myrtek, D., Ferrari, D., Sorichter, S., Ziegenhagen, M. W., Zissel, G., Virchow, J. C., Jr., Luttmann, W., Norgauer, J., Di Virgilio, F., and Idzko, M. (2005) The P2Y14 receptor of airway epithelial cells: coupling to intracellular Ca2+ and IL-8 secretion. Am J Respir Cell Mol Biol 33, 601-609 77. Idzko, M., Ferrari, D., and Eltzschig, H. K. (2014) Nucleotide signalling during inflammation. Nature 509, 310-317 78. Rybaczyk, L., Rozmiarek, A., Circle, K., Grants, I., Needleman, B., Wunderlich, J. E., Huang, K., and Christofi, F. L. (2009) New bioinformatics approach to analyze gene expressions and signaling pathways reveals unique purine gene dysregulation profiles that distinguish between CD and UC. Inflamm Bowel Dis 15, 971-984 79. Alsaqati, M., Latif, M. L., Chan, S. L., and Ralevic, V. (2014) Novel vasocontractile role of the P2Y(14) receptor: characterization of its signalling in porcine isolated pancreatic arteries. Br J Pharmacol 171, 701-713 80. Kauffenstein, G., Drouin, A., Thorin-Trescases, N., Bachelard, H., Robaye, B., D'Orleans-Juste, P., Marceau, F., Thorin, E., and Sevigny, J. (2010) NTPDase1 (CD39) controls nucleotide-dependent vasoconstriction in mouse. Cardiovasc Res 85, 204-213 81. Govindan, S., Taylor, E. J., and Taylor, C. W. (2010) Ca(2+) signalling by P2Y receptors in cultured rat aortic smooth muscle cells. Br J Pharmacol 160, 1953-1962 82. Xu, J., Morinaga, H., Oh, D., Li, P., Chen, A., Talukdar, S., Mamane, Y., Mancini, J. A., Nawrocki, A. R., Lazarowski, E., Olefsky, J. M., and Kim, J. J. (2012) GPR105 ablation prevents inflammation and improves insulin sensitivity in mice with diet- induced obesity. J Immunol 189, 1992-1999 83. Saltiel, A. R., and Kahn, C. R. (2001) Insulin signalling and the regulation of glucose and lipid metabolism. Nature 414, 799-806 84. Lin, Y., and Smrcka, A. V. (2011) Understanding molecular recognition by G protein betagamma subunits on the path to pharmacological targeting. Mol Pharmacol 80, 551-557
64 85. Drucker, D. J. (2003) Enhancing incretin action for the treatment of type 2 diabetes. Diabetes Care 26, 2929-2940 86. Holst, B., Egerod, K. L., Jin, C., Petersen, P. S., Ostergaard, M. V., Hald, J., Sprinkel, A. M., Storling, J., Mandrup-Poulsen, T., Holst, J. J., Thams, P., Orskov, C., Wierup, N., Sundler, F., Madsen, O. D., and Schwartz, T. W. (2009) G protein-coupled receptor 39 deficiency is associated with pancreatic islet dysfunction. Endocrinology 150, 2577-2585 87. Mitsukawa, K., Lu, X., and Bartfai, T. (2008) Galanin, galanin receptors and drug targets. Cell Mol Life Sci 65, 1796-1805 88. Duttaroy, A., Zimliki, C. L., Gautam, D., Cui, Y., Mears, D., and Wess, J. (2004) Muscarinic stimulation of pancreatic insulin and glucagon release is abolished in m3 muscarinic acetylcholine receptor-deficient mice. Diabetes 53, 1714-1720 89. Hang, Y., and Stein, R. (2011) MafA and MafB activity in pancreatic beta cells. Trends Endocrinol Metab 22, 364-373 90. Artner, I., Le Lay, J., Hang, Y., Elghazi, L., Schisler, J. C., Henderson, E., Sosa- Pineda, B., and Stein, R. (2006) MafB: an activator of the glucagon gene expressed in developing islet alpha- and beta-cells. Diabetes 55, 297-304 91. Lu, Y., Ponton, A., Okamoto, H., Takasawa, S., Herrera, P. L., and Liu, J. L. (2006) Activation of the Reg family genes by pancreatic-specific IGF-I gene deficiency and after streptozotocin-induced diabetes in mouse pancreas. Am J Physiol Endocrinol Metab 291, E50-58 92. Schuit, F. C. (1996) Factors determining the glucose sensitivity and glucose responsiveness of pancreatic beta cells. Horm Res 46, 99-106 93. Pipeleers, D. G. (1992) Heterogeneity in pancreatic beta-cell population. Diabetes 41, 777-781
65 8 SUPPLEMENTAL MATERIAL
(FIRST AUTHOR PUBLICATION)
66
Metabolism: The G Protein-coupled Receptor P2Y14 Influences Insulin Release and Smooth Muscle Function in Mice
Jaroslawna Meister, Diana Le Duc, Albert Ricken, Ralph Burkhardt, Joachim Thiery, Helga Pfannkuche, Tobias Polte, Johannes Grosse, Torsten Schoneberg and Angela Schulz J. Biol. Chem. published online July 3, 2014
from Downloaded
Access the most updated version of this article at doi: 10.1074/jbc.M114.580803
Find articles, minireviews, Reflections and Classics on similar topics on the JBC Affinity Sites. http://www.jbc.org/
Alerts: • When this article is cited • When a correction for this article is posted
by guest on July 3, 2014 3, July on guest by Click here to choose from all of JBC's e-mail alerts
Supplemental material: http://www.jbc.org/content/suppl/2014/07/03/M114.580803.DC1.html
This article cites 0 references, 0 of which can be accessed free at http://www.jbc.org/content/early/2014/07/03/jbc.M114.580803.full.html#ref-list-1
67
JBC Papers in Press. Published on July 3, 2014 as Manuscript M114.580803 The latest version is at http://www.jbc.org/cgi/doi/10.1074/jbc.M114.580803 -/- Reduced insulin release in P2Y14 mice
The G Protein-coupled Receptor P2Y14 Influences Insulin Release and Smooth Muscle Function in Mice
Jaroslawna Meister1,2, Diana Le Duc1, Albert Ricken3, Ralph Burkhardt4, Joachim Thiery4, 5 6 7 1# 1,2 Helga Pfannkuche , Tobias Polte , Johannes Grosse , Torsten Schöneberg , Angela Schulz
1Institute of Biochemistry, 2IFB Adiposity Diseases, 3Institute of Anatomy, 4Institute of Laboratory Medicine, Medical Faculty, University of Leipzig, Leipzig, Germany 5Institute of Veterinary Physiology, Faculty of Veterinary Medicine, University of Leipzig, Leipzig, Germany 6Department of Environmental Immunology, UFZ-Helmholtz Centre for Environmental Research Leipzig- Halle, Leipzig, Germany, Department of Dermatology, Venerology and Allergology, Leipzig University Medical Center, Leipzig, Germany 7Takeda Cambridge Ltd, Cambridge, United Kingdom -/- Running title: Reduced insulin release in P2Y14 mice
#Address correspondence to: Torsten Schöneberg, Institute of Biochemistry, Molecular Biochemistry, Medical Faculty, University of Leipzig, Johannisallee 30, 04103 Leipzig, Germany, Phone: +49-341- 9722-176, Fax: +49-341-9722-159, E-mail: [email protected]
Keywords: G protein-coupled receptors, gene knockout, glucose metabolism, pancreatic islets, signal transduction
Background: The relevance of the widely expressed in pancreas and salivary glands and expressed GPCR P2Y14 is only partially in subpopulations of smooth muscle cells of the understood. gastrointestinal tract, blood vessels, lung and Results: Analysis of P2Y14 KO mice revealed uterus. Among other phenotypical differences decreased gastrointestinal emptying, reduced KO mice showed a significantly impaired glucose tolerance and insulin release. glucose tolerance following oral and Conclusion: P2Y14 function is required for proper intraperitoneal glucose application. An intestine emptying and adequate glucose response. unchanged insulin tolerance suggested altered Significance: P2Y14 plays a role in smooth muscle pancreatic islet function. Transcriptome function and maintaining energy homoeostasis by analysis of pancreatic islets showed that P2Y14 influencing insulin release. deficiency significantly changed expression of components involved in insulin secretion. ABSTRACT Insulin secretion tests revealed a reduced UDP-sugars were identified as extracellular insulin release from P2Y14-deficient islets signaling molecules, assigning a new function to highlighting P2Y14 as a new modulator of these compounds in addition to their well proper insulin secretion. defined role in intracellular substrate metabolism and storage. Previously regarded as Although the physiological function is known an orphan receptor, the G protein-coupled for many members of the family of GPCR, receptor (GPCR) P2Y14 (GPR105) was found to functional ligands have not been identified yet for bind extracellular UDP and UDP-sugars. Little more than one hundred so-called orphan receptors. is known about the physiological functions of In the past years, academic research groups and this GPCR. To study its physiological role we pharmaceutical companies engaged in large-scale used a gene-deficient (KO) mouse strain deorphanization efforts for these receptors expressing the bacterial LacZ reporter gene to employing ligand screening studies and analyses of monitor the physiological expression pattern of receptor-deficient mouse models (1). One of these P2Y14. We found that P2Y14 is mainly studies revealed P2Y14 (formerly named GPR105)
68 -/- Reduced insulin release in P2Y14 mice as a receptor that is activated by UDP-glucose and cells were grown in DMEM/F12 medium closely related sugars (2,3). This was an interesting supplemented with 10% (v/v) fetal bovine serum, finding as UDP-glucose is a pivotal metabolite in 100 units/ml penicillin and 100 μg/ml intracellular glucose storage pathways including streptomycin at 37°C in a humidified 5% CO2 glycogen biosynthesis. In more recent studies, incubator and transiently transfected with the UDP alone was described as ligand for P2Y14 receptor constructs and split onto fibronectin- (4,5), however, another group tested the agonistic coated 384-well plates one day prior the assay. activity of UDP but found no activation of P2Y14 DMR measurements were performed with the Epic (2). P2Y14 belongs to the P2Y12–like receptor system (Corning, NY, US). group within the family of rhodopsin-like For all transfection experiments the mouse and receptors. The P2Y12–like receptor group human P2Y14 coding sequence attached to an N- comprises the ADP receptors P2Y12 and P2Y13, terminal Hemagglutinin epitope and a C-terminal P2Y14 and the receptors GPR34, GPR82, GPR87, FLAG epitope was cloned into the mammalian and GPR171 (6). P2Y14 mRNA expression expression vector pcD-ps. Additionally, for yeast analysis showed a widespread expression pattern experiments the mouse receptor was introduced including high expression levels in placenta, into the yeast vector p416GPD. All control adipose tissue, stomach and intestine and moderate receptor plasmids were cloned with the described levels in spleen, lung, heart and different brain strategy. regions (3,7). P2Y14 was also detected in immune Generation of P2Y14-deficient mice - P2Y14- cells like B- and T-lymphocytes, neutrophils, KO mice were generated at TAKEDA Ltd. dendritic cells, astrocytes, and microglia (7-11) (Cambridge, United Kingdom) by targeted suggesting a physiological function in immune disruption of the mouse P2Y14 locus and ES-cell response. Indeed, expression of P2Y14 was blastocyst injection. Thus, most part of the coding upregulated in response to inflammatory injury region of P2Y14 was exchanged by a ß- (12) and similar results were shown by in vivo galactosidase cassette harbouring an internal treatment with lipopolysaccharide for rat brain and ribosome entry site (IRES) followed by a loxP- spleen (7,13). However, as the strongest floxed neomycin cassette (Fig. 1). After removal expression was found in the gastrointestinal (GI) of the neomycin cassette, the resulting KO animals system, we explored a possible role of P2Y14 in were bred with 129S6 animals and all studies were the regulation of nutrient uptake and energy done on a mixed C57BL/6 x 129S6 background metabolism. with predominance of 129S6. For experiments WT and KO littermates from intercrossed WT and KO EXPERIMENTAL PROCEDURES parents were used. Genotyping of mice was carried Cell culture, transfection and functional assays out by PCR with the following primers: ß-gal – For yeast experiments, the haploid sense (5’- Saccharomyces cerevisiae yeast strain MPY578t5 AGAAGGCACATGGCTGAATATCGA -3’), (provided by Dr. Mark Pausch) was used for the forward (5`- expression of receptor constructs. Cells were AGCTGCCGGACGAAGGAGACCCTGCTC-3’) transfected with plasmid DNA using and reverse (5’- electroporation as described (14). For expression GGTTTTGGAAACCTCTAGGTCATTCTG-3’) in mammalian cells, COS-7 cells were grown in in two separate PCR reactions (Fig. 1): Dulbecco's modified Eagle's medium (DMEM forward/reverse to amplify WT allele (180 bp) and supplemented with 10% (v/v) fetal bovine serum, ß-gal sense/reverse to amplify KO allele (400 bp). 100 units/ml penicillin and 100 μg/ml The PCR conditions were 95°C for 3 minutes streptomycin) at 37°C in a humidified 5% CO2 followed by 35 cycles with 45 sec 95°C, 60°C 30 incubator. Transient transfection experiments of sec and 72°C for 1 min and a final amplification COS-7 cells with receptor constructs for cAMP step of 72°C for 10 min. inhibition measurements and for direct cAMP All mice were maintained in a specific measurements (co-transfected with the chimeric G pathogen-free barrier facility on a 12-h light/12-h protein Gαsi5) were essentially performed as dark cycle with ad libitum access to water and described previously (15). For measurements of food. Experiments were performed according to dynamic mass redistribution (DMR) (16) HEK293 the accepted standards of animal care and were
69 -/- Reduced insulin release in P2Y14 mice approved by the respective regional government formaldehyde solution and embedded in paraffin agency of the State of Saxony, Germany (T27/11; wax. Slices were stained with H&E. Blood cell T46/12; T07/13). counting from EDTA blood samples was Quantitative expression analysis - Several performed automatically (ScilVet abc; Scil tissues were removed from 3 WT and 3 KO mice corporation, Viernheim, Germany). Open field and and RNA was isolated using TRIZOL (Sigma- hot plate tests were performed as reported Aldrich, Taufkirchen, Germany) according to the previously (17) using automated measuring manufacturer’s instructions. RNA quantity was technology (TSE Systems, Bad Homburg, measured with a spectrophotometer (Nanodrop ND Germany; Hot Plate 602001, TSE)). 1000, NanoDrop products, Wilmington, USA) and Gastrointestinal transit and contractility RNA quality was controlled by gel electrophoresis. studies - A gastrointestinal emptying test was For quantitative real time PCR (qPCR) 1 µg of performed by oral application of 200 µl dye- total RNA was reversely transcribed (Superscript labeled non-absorbable liquid dextran blue (20 II RT, Invitrogen, Karlsruhe, Germany) using mg/ml) to mice. Faeces were collected hourly for 8 oligo-dT primers. qPCR was performed by hours, vortexed with 300 µl phosphate buffered Platinum SYBR Green qPCR SuperMix-UDG saline (PBS) and centrifuged at 13,000 rpm for 10 (Invitrogen) according to manufacturer’s min. The amount of hourly excreted dextran blue instructions. Primers were designed for the intron- was measured photometrical at 620 nm in flanking exons 1 and 2 sequences (Fig. 1) to supernatants. Mice that showed no excretion for at exclude genomic contaminations (sense: 5’- least 2 hours were excluded from the experiment. GAAGCCAGACGTGAAGGAGTT-3’; antisense: For contractility studies mice were sacrificed by 5’-CAGGAATCTCAAAGGCAAGCT-3’) cervical dislocation. The intestine from mice was resulting in a 156-bp product. qPCR was harvested and placed in ice-cold Krebs-Ringer performed with the MX 3000P instrument (Agilent buffer (KRB). One cm long equal segments of Technologies GmbH, Boeblingen, Germany) using intestine were placed in 50-ml organ baths (37 °C) the following protocol: 2 min at 50 °C, 2 min at 95 containing KRB solution and continuously gassed °C, 40 cycles of 15 s at 95 °C and 30 s at 60 °C. A with 95% O2 and 5% CO2. To record the product dissociation curve was recorded to verify contractile activity, each intestine segment was the presence of a single amplicon. Threshold cycle connected to an isometric force transducer (Ct) values were determined during the (MLT0201 Force Transducer; ADInstrumends exponential increase of the product in the PCR. GmbH, Spechbach, Germany). The basal tension After normalization to the house keeping gene ß2- was set to 10 mN. Several parameters like mean microglobulin calculated ∆Ct values were used to muscle tension, average tension maximum and determine the relative expression of P2Y14. minimum, average amplitude, rate of contractions LacZ reporter gene assay - Tissue samples of and the area under the curve and the effect of 100 several organs were prepared from WT and KO µM UDP-glucose and 100 µM carbachol (positive mice, covered in Tissue-Tek® (Sakura, Torrance, control) were analyzed using Lab Chart software CA, USA) and snap frozen in liquid nitrogen. The (ADInstruments). Data were normalized to organs were cryosectioned (10 µm) and fixed in recorded spontaneous activity and expressed in acetone-methanol (1:1) solution. Sections were percentage. incubated with X-Gal staining solution at 30 °C Hemodynamic parameters - Blood pressure and overnight to detect the expression of the LacZ pulse were determined by non-invasive tail-cuff reporter gene via ß-galactosidase activity. method using the BP-2000 Blood Pressure Laboratory chemistry/histology/behavioral Analysis SystemTM (Visitech Systems, Apex, NC, tests – Serum levels of electrolytes, metabolites, USA). Following manufacturer’s instructions, enzymes and hormones were analyzed in 3-month- mice were trained to the procedure each day for at old WT and KO mice according to the guidelines least 5 days prior to the actual experiment. After of the German Society of Clinical Chemistry and the training period 10 measurements per day of Laboratory Medicine, using a Hitachi PPE- each mouse on 5 consecutive days were Modular analyzer (Roche Diagnostics, Mannheim, performed. Systolic blood pressure, diastolic blood Germany). Histological slices (5 μm) were pressure, mean arterial pressure, and pulse were prepared from organs being fixed in 4% calculated from daily experiments for each mouse
70 -/- Reduced insulin release in P2Y14 mice and mean out of 10 animals per group was complex technique using anti-insulin monoclonal determined. rabbit antibody (100 µg/ml, Cell Signalling, Airway responsiveness - Lung resistance and Millipore, Germany) and goat anti-rabbit dynamic compliance were measured by invasive secondary antibody (7.5 mg/ml, Vector Laboraties, plethysmography (emka TECHNOLOGIES, Paris, Biozol Diagnostica, Germany). Both sections were France) in response to inhaled UDP-glucose and photographed with a Zeiss Axioimager Z1 methacholine (Sigma-Aldrich). Female mice were microscope (Carl Zeiss Jena GmbH, Jena, anesthetized (100 mg/kg ketamine and 10 mg/kg Germany). Ten H&E stained sections per mouse xylazine; Bayer Leverkusen, Germany), intubated were analyzed for number and area size of and mechanically ventilated at a tidal volume of pancreatic islets using NIH ImageJ software. For 0.2 ml and a frequency of 150 breath/min. Baseline determination of ß-cell area per islet the insulin- lung resistance, dynamic compliance, and positive area of at least 50 islets per mouse was responses to aerosolized saline (0.9 % NaCl) were calculated using NIH ImageJ software and related measured first, followed by responses to 100 µM to the total islet area of the investigated slides. aerosolized UDP-glucose and increasing doses (10 Isolation of pancreatic islets and insulin to 80 mg/ml) of aerosolized methacholine (18). secretion experiments - Pancreatic islets were Metabolic studies - 1-month-old mice were kept isolated as previously described (19-21). Briefly, on standard (Ssniff M-Z: 5% sugar, 4.5% raw fat, mice were sacrificed by cervical dislocation and 34% starch, 22% raw protein) or western (Ssniff the pancreas was inflated by intraductal injection EF R/M TD88137: 32.8% sugar, 21.2% raw fat, of ice-cold DMEM media containing 0.2 mg/ml 14.5% starch, 17.1% raw protein) type diet (Ssniff (1.08 Wünsch Units) Liberase TL Research Grade GmbH, Soest, Germany) for 3 months. During this (Roche Diagnostics GmbH, Mannheim, Germany). period body-weight development was monitored Distended pancreas was digested by shaking in a weekly. For glucose tolerance tests mice on a 37 °C water bath for 17 minutes. Isolated islets standard or a western type diet had been fasted were washed and picked under a stereomicroscope overnight (15 h) and blood glucose levels were and incubated overnight at 37°C and 5% CO2 in measured before (0 min), 20, 40, 60 and 120 min RPMI-1640 media containing fetal bovine serum after oral application (80 mg) or intraperitoneal for insulin secretion studies. For dynamic insulin injection (2 mg/g body weight) of glucose. For secretion studies groups of 50 pancreatic islets insulin tolerance tests blood glucose levels were were placed in a perifusion chamber and measured before (0 min) and 15, 30 and 60 min continuously perifused with KRB for 30 min after intraperitoneal injection of human insulin (flow: 1 ml/min). After this equilibration phase (0.75 U/kg body weight). Blood glucose levels islets were perifused for 30 min with low glucose were determined by using an automated blood (2.8 mM) to determine the basal insulin release glucose meter (FreestyleLite, Abbott Diabetes and then challenged for 30 min with 16.7 mM Care Ltd., Oxon, UK). For insulin secretion tests glucose or 16.7 mM glucose plus 100 µM UDP- mice fasted overnight were injected glucose. Samples of perifusate were collected intraperitoneally with glucose (2 mg/g body every minute and insulin concentration was weight) and blood samples were taken before (0 determined at indicated time points by Insulin min), 20, 40 and 60 min after injection. Serum AlphaLISA Kit (Perkin Elmer, Rodgau, Germany). insulin concentrations were measured using an For static incubation studies groups of 5 islets were Ultra Sensitive Mouse Insulin Elisa Kit (Crystal placed in a 96-well plate. After a 30-minute Chem, Inc., Downers Grove, IL, USA). All equilibration period in KRB solution containing metabolic tests were performed with the same set 2.8 mM glucose, pancreatic islets were stimulated of animals (one-week interval between the tests). with KRB solution containing either 2.8 mM or Morphometric analysis - Pancreata from 5 WT 16.7 mM glucose or 100 µM UDP-glucose in the and 5 KO mice fed with western type diet were presence of 16.7 mM glucose for 30 minutes. The fixed in 4 % formaldehyde and embedded in supernatants were then collected for measurement paraffin wax. Two longitudinal sections (4 µm) of secreted insulin and islets were lysed in acid- were generated every 100 µm of tissue. Each time, ethanol to extract the residual islet insulin (19,20). the first section was stained with H&E, the second Insulin concentrations were determined by Insulin immunostained for insulin with the avidin-biotin AlphaLISA Kit (Perkin Elmer).
71 -/- Reduced insulin release in P2Y14 mice
RNA-sequencing of pancreatic islets - Total phenotypes related to the lack of P2Y14 function, RNA from isolated pancreatic islets (10 male mice this GPCR gene was removed by targeted deletion per genotype) was extracted by using TRIZOL and replacement with a LacZ reporter gene. The (Sigma-Aldrich) according to the manufacturer’s P2Y14-deficient offspring was vital and fertile. instructions and RNA quantity was measured using This is consistent with a very recent study a spectrophotometer (Nanodrop ND 1000). The investigating P2Y14 relevance in embryonic RNA quality of all samples was analyzed on the lethality after radiation (32). Except for a Agilent 2100 bioanalyzer using the RNA 6000 significantly higher spleen weight (suppl. Table Nano Chip. cDNA libraries were generated using S1) and slightly increased blood pressure (suppl. TruSeq RNA Sample Preparation Kits v2 Table S1) no obvious differences in genotype (Illumina, San Diego, CA, USA) according to the distribution, breeding, growth, gross morphology, manufacturer’s protocol. Indexed islet libraries of histology, laboratory chemistry and behavior were good quality were pooled and used for sequencing detected on primary inspection compared to WT on two flow cell lanes on an Illumina HiScanSQ mice (suppl. Table S1). System. To confirm base calling correctness the raw data passed a quality check using FastQC P2Y14 is widely expressed in mouse tissues – software. It revealed low PHRED-scale scores at We next took advantage of the introduced LacZ the 3’ end of the 101 bp long reverse reads. These reporter construct and monitored ß-galactosidase reads were trimmed to a size of 80 bp. Then, reads activity in P2Y14-deficient mouse tissues. Whereas were assigned to the individual animals using the WT control tissues showed no specific staining, ß- ligated adapter indices. Further, the samples galactosidase-positive staining was found in proceeded filtering to trim the adapter sequences uterus, bronchioles, blood vessels, pancreas, and remove low-quality reads which were shorter salivary glands (Figs. 2A and 3), and immune than 60 bp or contained more than five bases with cells. Interestingly, staining in the GI tract was a quality score below 15 (PHRED-scale). The positive only in a subpopulation of smooth muscle paired-end reads were mapped to the reference cells (Fig. 2B/C). In all parts of the GI tract smooth mouse genome (July 2007 NCBI37/mm9) with muscle cells of the thin layer of the muscularis Ensembl v66 annotations using Tophat 1.3.3. (22), mucosae were ß-galactosidase positive (Fig. which aligns reads using Bowtie (version 0.9.9). 2B/C). From the ileum to the rectum a Mitochondrial reads and reads which did not map subpopulation of smooth muscle cells within the uniquely to a genome position were excluded. circular smooth muscle layer showed positive FPKM (fragments per kilobase of transcript per staining (Fig. 2B/C). In the rectum also the million mapped reads) values were calculated longitudinal smooth muscle layer displayed using Cufflinks 1.3.0 (22,23). Analysis of intensive ß-galactosidase activity (Fig.2B/C). Co- differential expression was performed using staining of c-kit, which is a marker of Cajal cells DESeq software package (24). Only genes that and mast cells in the GI tract (33,34), revealed no were expressed at least in 10 animals were obvious overlap with the ß-galactosidase-positive considered for analysis. Functional enrichment structures (data not shown). In contrast the ß- analysis of differentially expressed genes (P < galactosidase staining was partly reminiscent of 0.05) was determined using ToppGene Suite (25). the reported divergent reactivity of intestinal smooth muscle cells with characteristic smooth RESULTS AND DISCUSSION muscle cell markers (i.e. alpha-smooth muscle Although widely expressed, previous studies on actin (ASMA), gamma-smooth muscle actin P2Y14 mainly focused on immune cells and its (GSMA)) (35). To our best knowledge, there is no relevance in inflammatory responses (7-12,26). other smooth muscle subtype which may Initial evidence indicates a role of P2Y14 in UDP- correspond to the cells marked by the P2Y14- glucose-mediated chemotaxis of neutrophils and reporter construct. bone marrow cells, mast cell degranulation and Further assessment of the LacZ expression in proliferation of T cells (9,10,27,28). However, pancreatic tissue showed ß-galactosidase-positive studies suggest that UDP-glucose can mediate staining in exocrine and endocrine glandular cellular effects via P2Y14-dependent and - structures (Fig. 3). Interestingly, cells next to the independent pathways (29-31). To identify pancreatic acini (Fig. 3A-C) and myoepithelial
72 -/- Reduced insulin release in P2Y14 mice
cells of the salivary glands (Fig. 2A) were stained. P2Y14-reporter gene expression was also found Investigations addressing the specific functions of in smooth muscle cells of bronchioles (Fig. 2A). the myoepithelial cells are ongoing. To dissect its function in respiratory tract invasive One should keep in mind that P2Y14-promoter- plethysmography tests were performed. Although driven ß-galactosidase-expression was monitored UDP-glucose had no effect on respiratory in KO mice and may reflect transcript over- or functions tested, KO mice showed significantly even non-physiological expression due to P2Y14 higher dynamic compliance in response to deficiency. To address this issue, we measured increasing inhaled doses of methacholine (Fig. 6). expression of the 5’UTR region of WT and KO One should note the expression of P2Y14 in P2Y14 gene transcripts, which were structurally mainly venous blood vessels (Fig. 2A) and similar in both WT and KO animals, by qPCR in a significant increases in blood pressure and heart number of tissues (Fig. 4). As presented in Fig. 4B, rate of P2Y14-deficient mice (suppl. Table S1). ΔCt values of transcript expression showed a high There is some evidence that P2Y14 may have 2 correlation between WT and KO in all tissues (r = vasocontractile function on arteries (36) but P2Y14 0.9058). This almost excluded compensatory or expression in smooth muscle cells in arteries is reactive LacZ expression effects following P2Y14 controversially discussed (37,38). We found some deficiency in KO tissues. Both data sets revealed ß-galactosidase positive arteries only in lung and that P2Y14 is widely expressed in mouse tissues CNS (circulus arteriosus Willisii) (data not with high expression levels in pancreas, salivary shown). Future studies will address if there is a glands, brain, lung and parts of the gastrointestinal physiological link between P2Y14 expression in tract and lowest expression in liver (Fig. 4). This is the vascular system and hemodynamic functions. in accord with previous findings in human and rat In sum, we show that P2Y14 is highly expressed tissues (3,7,8) but now adds that distinct smooth in a distinct subset of smooth muscle cells. P2Y14 muscle cells and immune cells are the cellular expressed on those cells modulate contractile basis of broad expression levels previously found function of the GI and the bronchial tracts. in qPCR and Western blot analyses. P2Y14 deficiency results in reduced glucose P2Y14 deficiency alters smooth muscle tolerance – Our phenotype screen also included functions in GI tract and airways – To study the basic metabolic tests. Following oral glucose consequences of P2Y14 deficiency in the different application KO mice showed significantly higher smooth muscle containing organs we tested several transient blood glucose levels (Fig. 7A). To GI tract and bronchial tract functions. A previous differentiate whether the enteral glucose resorption study in rat revealed high P2Y14 mRNA levels and was increased in KO mice due to the prolonged found UDP-glucose-dependent increase in the gastrointestinal emptying (see above), baseline muscle tension of the forestomach. intraperitoneal glucose tolerance tests were However, comparison of WT und P2Y14-deficient performed. Blood glucose levels were also mice revealed no differences in gastric emptying increased in KO mice following intraperitoneal (30). Because we found no effect of UDP-glucose glucose injection (Fig. 7B) excluding differences (up to 1 mM) on basal and carbachol-stimulated in enteral glucose resorption. To study whether and electric-stimulated contraction of isolated high caloric nutrition can aggravate the phenotype small intestine and colon (data not shown), we found in KO mice, 4-week-old mice were kept on speculated that the contribution of P2Y14 is more a western type diet for 3 months. WT and KO mice distinct and may present its significance only when gained significantly body weight under the western the entire GI passage is observed. Thus, a dye- type diet. But whereas there were no alterations in labeled dextran was applied to mice orally and the body weight development between WT and KO excretion in faeces was measured hourly. In mice kept on standard diet, KO mice fed the comparison to WT animals the expulsion of western diet gained significantly less weight (KO: dextran blue was significantly delayed in KO mice 178 ± 15% vs. WT: 196 ± 23%, P < 0.05). (Fig. 5). Interestingly, more KO animals (5 KO vs. However, detailed analysis of serum cholesterol 1 WT) had to be excluded from analysis according and TAG levels in all lipoprotein fractions to our exclusion criterion (see Experimental revealed no differences between WT and KO mice Procedures). fed a western type diet (suppl. Table S1).
73 -/- Reduced insulin release in P2Y14 mice
Interestingly, glucose tolerances following oral and following high caloric nutrition as seen in our intraperitoneal glucose application were P2Y14-deficient mice kept under western type diet. significantly reduced in KO mice kept under The hepatic inflammation is most likely secondary western type diet (Fig. 7C/D). to the alimentary hepatic steatosis found in (39). Next, we performed insulin tolerance tests to Since the western type diet we used does not evaluate whether the higher glucose levels significantly differ from the high-fat diet (see observed in KO mice in the oGTT were because of Experimental Procedures) Xu et al fed the mice altered insulin sensitivity. There were no (26.3% carbohydrates, 34.9% fat, 26.2% protein) differences in the decline of blood glucose levels we further focused on the reason for the lower following intraperitoneal insulin injection between blood insulin levels which were seen already in WT and KO mice (Fig. 8A). Similar results were animals fed with standard chow. found for mice kept on western type diet (Fig. 8B) although both genotypes showed lower insulin Components involved in insulin release are sensitivity as a result of higher body weight due to differentially expressed in P2Y14-deficient islets – high caloric nutrition. As insulin sensitivity did not Our functional data pointed towards a lower account for altered oGTT in KO mice we analyzed pancreatic insulin secretion after intraperitoneal insulin levels in WT and KO mice during glucose administration. High expression of P2Y14 intraperitoneal glucose tolerance tests. On chow was noticed in the exocrine pancreas (Figs. 3 and diet, KO mice (16 weeks old) tended to have lower 4) but also in pancreatic islets (Fig. 3D). We first serum insulin levels after intraperitoneal glucose performed morphometric analyses in H&E and application (Fig. 8C). Interestingly, after 12 weeks insulin immunohistochemistry stained slices in of western type diet glucose-stimulated insulin P2Y14-KO mice. Neither the number nor the size secretion of KO mice was significantly lower 40 of the pancreatic islets differed between WT and and 60 min after intraperitoneal glucose injection KO mice (Fig. 9A/C). Also, the insulin compared to WT mice (Fig. 8D). immunopositive areas were similar in both In a recent paper, Xu et al (39) showed genotypes, suggesting no gross morphological improved glucose tolerance in P2Y14-deficient abnormalities in islet development (Fig. 9B/D). mice fed with a high-fat diet due to an elevated Since P2Y14-deficient islets did not show insulin sensitivity e.g. of the liver. This is in obvious morphological differences we screened for contrast to our data where insulin sensitivity of KO those at a molecular level. Thus, mRNA and WT mice was not different (Fig. 8A/B). It was expression in WT and KO pancreatic islets was argued that reduced macrophage infiltration and analyzed in a transcriptome-wide approach using hepatic inflammation account for improved hepatic RNA-sequencing. Approximately 13 million reads insulin sensitivity (39). As in our study (Fig. per animal were analyzed. As expected, insulin, 8C/D), Xu et al (39) found reduced serum insulin glucagon, somatostatin and SUR1/Kir6.2 levels after glucose administration in KO mice. transcripts were highly expressed in islets of both, This important finding remained unappreciated in WT and KO mice. In line with the data from their study and other pathophysiological immunohistochemistry there was no difference in mechanisms were not considered. In a more insulin mRNA expression levels between WT and reasonable scenario, lower insulin levels result in a KO (suppl. Table S2). The expression of P2Y14 reduced hepatic steatosis, as found in (39) under gene was significantly reduced in KO mice (suppl. high-fat diet. In fact, the differential expression of Table S2), but one should note that detected P2Y14 genes involved in lipid and glycogen metabolism transcripts in the KO islets represented mRNA in liver, as found in (39), can be interpreted as a sequences of the 5’UTR region and not of the consequence of lower insulin levels. It is well coding region (Fig. 1). In line with our RNASeq known that insulin stimulates the expression of data, also qPCR analysis (∆Ct = 7.64 ± 0.55), ß- lipogenic enzymes such as fatty-acid synthase and galacosidase staining of pancreatic tissue (Fig. 3) acetyl-CoA carboxylase and inhibits the and other studies (41) clearly demonstrate P2Y14 transcription of gluconeogenic enzymes such as expression in pancreatic islets. glucose-6-phosphatase and phosphoenolpyruvate 815 genes were found differentially expressed carboxykinase (40). Thus, reduced insulin between WT and KO mice (329 transcripts secretion may also result in reduced weight gain downregulated, 486 transcripts upregulated, P <
74 -/- Reduced insulin release in P2Y14 mice
0.05, the complete list can be provided on request). network level. Therefore, we studied insulin Functional enrichment analysis of differentially secretion, as one integral islet function, in expressed genes disclosed several GO (Gene perifused and static treated islets in vitro. Although Ontology) categories related to protein synthesis, intracellular insulin content was similar in lysed signaling pathways and hormone secretion (suppl. islets isolated from WT and KO mice (Fig. 11A), Table S3). Since serum insulin levels were reduced the insulin release following stimulation with low in KO mice we mainly focused on genes known to (2.8 mM) and high glucose (16.7 mM) during a 30 be related to glucose sensing, insulin exocytosis min incubation was significantly reduced in islets and its modulation. Selected components involved lacking P2Y14 (Fig. 11B/C). To study the kinetics in insulin release and their changes in transcript of insulin release, isolated islets were placed in a levels are schematically given in Figure 10. perifusion chamber and continuously perifused Glucose uptake through the glucose transporter with KRB solution containing different glucose 2 (GLUT2) is a first key step in regulation of concentrations. The initial insulin release peak and insulin release (42) (Fig. 10). The expression of the sustained insulin release were significantly GLUT2 (Slc2a2) was significantly downregulated reduced in KO islets stimulated with a high in KO mice and may indicate a possibly reduced glucose concentration (16.7 mM) (Fig. 11D). glucose-sensing or -responding ability of the islets. These data clearly demonstrated that P2Y14 The major trigger of insulin vesicle exocytosis deficiency has a negative impact on glucose- is an increase in intracellular Ca2+ (42) and cAMP dependent insulin release from isolated pancreatic and protein kinase A (PKA) activity are known to islets and confirmed our in vivo findings. amplify insulin exocytosis (43). In the classical Since P2Y14 couples to Gi/o proteins, inhibits 2+ model of GPCR-modulated insulin release, Gq adenylyl cyclases and mobilizes intracellular Ca 2+ (Ca ) and Gs (cAMP) activating receptors (11,28) most probably via release of Gβγ dimers promote insulin release, whereas Gi/o protein- from Gi proteins (47), one would expect that loss coupled receptors reduce insulin release by of this gene should rather improve glucose- inhibiting adenylyl cyclases and reducing cAMP mediated insulin release from β-cells. However, levels in β-cells. Indeed, several components UDP-glucose alone was neither able to involved in receptor- and ion channel-controlled significantly release insulin nor significantly intracellular Ca2+ levels were downregulated in reduce glucose-induced insulin release from islets of KO mice, among them the subunits isolated islets (see Fig. 11). Therefore, we re- CACNA1C and CACNA1H of the voltage- evaluated the agonistic properties of UDP- and 2+ dependent Ca channels (VDCC), the endoplasmic UDP-glucose at the mouse and human P2Y14 with reticulum IP3 receptor (ITPR1), cAMP-degrading different methods in vitro. Techniques using phosphodiesterases PDE1C and PDE4D (44), chimeric G proteins in yeast and mammalian several GPCR known to modulate insulin release heterologous expression systems showed high such as the free-fatty acid receptor FFAR1 (45), basal activity of P2Y14 and some minor UDP- and calcium-sensing receptor (CASR), GLP1 receptor UDP-glucose-mediated responses (Fig. 12A, Table (GLP1R), GPR119, somatostatin receptors SSTR1 1). However, UDP and UDP-glucose did not and SSTR2 (and their agonist somatostatin) significantly activate P2Y14 in classic cAMP (41,46). inhibition assay (Table 1) and label-free DMR In sum, transcriptome data showed significant (Fig. 12B), whereas the Gi-coupled neuropeptide changes in relevant components of glucose Y receptor Y2 showed robust agonist-mediated sensing, Ca2+-triggered and GPCR-modulated signals in all tests. At the current stage, UDP and insulin release pathways in islets of P2Y14- UDP-glucose show weak agonistic activity at deficient mice which suggested changes in islet P2Y14 in functional assays using chimeric G function of KO animals. proteins (2). Label-free and classic second messenger assays as well as our in vivo data with Reduced insulin release from pancreatic islets knock-out mice do not provide evidence for of P2Y14-deficient mice – It is almost impossible to physiological activities of UDP and UDP-glucose functionally analyze all components found to be at P2Y14. Further studies using clear-cut controls differentially expressed between WT und KO at (e.g. gene-deficient animals) are required to finally both, their individual level and their signaling
75 -/- Reduced insulin release in P2Y14 mice prove or disprove UDP-Glc and UDP as modulates distinct functionalities of islet cells. physiological agonists for P2Y14. Since Langerhans islets derived from pancreatic The cell type within Langerhans islets, where a ductal cells during ontogenesis and P2Y14 specific GPCR is expressed, determines its expression was morphologically also found in the function on insulin exocytosis. Currently, the cell exocrine pancreas (Fig. 3), more detailed studies type(s) of pancreatic islets expressing P2Y14 is should focus on the relevance of P2Y14 in pancreas unknown. Further, the effect of a given GPCR on development. Further studies with conditional β- insulin release apparently not only depends on its cell-specific KO mice can help to differentiate G protein-coupling mode. Thus, Gq protein- between acute and adaptive effects of P2Y14 coupled receptors such as the GnRH receptor deficiency. Nevertheless, our findings identify inhibits insulin release whereas the exclusively Gi P2Y14 as a novel modulator of insulin secretion. protein-coupled cannabinoid receptor type 1 and the melanin-concentrating hormone receptor stimulate insulin release from islets (41). The most abundant somatostatin receptor SSTR3 (see suppl. Table S2), which is Gi/o protein-coupled, has no significant effect on insulin release (41). As for several GPCR expressed in pancreatic islets (41) the specific signaling pathway how P2Y14 modulates gene expression and functions of islets needs to be studied further.
CONCLUSION Mice with P2Y14 deficiency present a rather mild phenotype under SPF (specific pathogen free) conditions. However, our studies revealed involvement of P2Y14 in GI tract emptying and glucose homeostasis regulation. The lack of P2Y14 function reduced intestine passage and glucose- stimulated insulin release from pancreatic islets in vitro and in vivo. It is of interest that several GPCR, e.g. GLP1R, GPR39, M3 muscarinic receptor and galanin receptor, modulate both, GI motility and glucose-induced insulin secretion (48- 51). For P2Y14 it is currently unclear whether this GPCR realizes its effect by acute activation of its signaling cascade or during islet ontogenesis. The gross transcriptome changes found in P2Y14- deficient islets may also suggest a more complex alteration of the expression profile indicating a role of P2Y14 in subdifferentiation of islets cells. Indeed, some genes which are involved in differentiation and maturation of pancreatic islet cell types (e.g. MAFA, MAFB, REG2) (52-54) are differentially expressed in the islets isolated from P2Y14-deficient mice (Fig. 10). Although we did not find differences in gross islet morphology and islet size distribution (Fig. 9), there is evidence that e.g. pancreatic β-cells are not homogenous but rather present functionally different subpopulations with distinguishable functionality (55,56). Thus, P2Y14-mediated signaling may be one signal that
76 -/- Reduced insulin release in P2Y14 mice
REFERENCES
1. Civelli, O., Reinscheid, R. K., Zhang, Y., Wang, Z., Fredriksson, R., and Schioth, H. B. (2013) G protein-coupled receptor deorphanizations. Annu Rev Pharmacol Toxicol 53, 127-146 2. Chambers, J. K., Macdonald, L. E., Sarau, H. M., Ames, R. S., Freeman, K., Foley, J. J., Zhu, Y., McLaughlin, M. M., Murdock, P., McMillan, L., Trill, J., Swift, A., Aiyar, N., Taylor, P., Vawter, L., Naheed, S., Szekeres, P., Hervieu, G., Scott, C., Watson, J. M., Murphy, A. J., Duzic, E., Klein, C., Bergsma, D. J., Wilson, S., and Livi, G. P. (2000) A G protein-coupled receptor for UDP-glucose. J Biol Chem 275, 10767-10771 3. Freeman, K., Tsui, P., Moore, D., Emson, P. C., Vawter, L., Naheed, S., Lane, P., Bawagan, H., Herrity, N., Murphy, K., Sarau, H. M., Ames, R. S., Wilson, S., Livi, G. P., and Chambers, J. K. (2001) Cloning, pharmacology, and tissue distribution of G-protein-coupled receptor GPR105 (KIAA0001) rodent orthologs. Genomics 78, 124-128 4. Carter, R. L., Fricks, I. P., Barrett, M. O., Burianek, L. E., Zhou, Y., Ko, H., Das, A., Jacobson, K. A., Lazarowski, E. R., and Harden, T. K. (2009) Quantification of Gi-mediated inhibition of adenylyl cyclase activity reveals that UDP is a potent agonist of the human P2Y14 receptor. Mol Pharmacol 76, 1341-1348 5. Hamel, M., Henault, M., Hyjazie, H., Morin, N., Bayly, C., Skorey, K., Therien, A. G., Mancini, J., Brideau, C., and Kargman, S. (2011) Discovery of novel P2Y14 agonist and antagonist using conventional and nonconventional methods. J Biomol Screen 16, 1098-1105 6. Schoneberg, T., Hermsdorf, T., Engemaier, E., Engel, K., Liebscher, I., Thor, D., Zierau, K., Rompler, H., and Schulz, A. (2007) Structural and functional evolution of the P2Y(12)-like receptor group. Purinergic Signal 3, 255-268 7. Moore, D. J., Murdock, P. R., Watson, J. M., Faull, R. L., Waldvogel, H. J., Szekeres, P. G., Wilson, S., Freeman, K. B., and Emson, P. C. (2003) GPR105, a novel Gi/o-coupled UDP-glucose receptor expressed on brain glia and peripheral immune cells, is regulated by immunologic challenge: possible role in neuroimmune function. Brain Res Mol Brain Res 118, 10-23 8. Kobayashi, K., Fukuoka, T., Yamanaka, H., Dai, Y., Obata, K., Tokunaga, A., and Noguchi, K. (2006) Neurons and glial cells differentially express P2Y receptor mRNAs in the rat dorsal root ganglion and spinal cord. J Comp Neurol 498, 443-454 9. Scrivens, M., and Dickenson, J. M. (2005) Functional expression of the P2Y14 receptor in murine T-lymphocytes. Br J Pharmacol 146, 435-444 10. Scrivens, M., and Dickenson, J. M. (2006) Functional expression of the P2Y14 receptor in human neutrophils. Eur J Pharmacol 543, 166-173 11. Skelton, L., Cooper, M., Murphy, M., and Platt, A. (2003) Human immature monocyte-derived dendritic cells express the G protein-coupled receptor GPR105 (KIAA0001, P2Y14) and increase intracellular calcium in response to its agonist, uridine diphosphoglucose. J Immunol 171, 1941- 1949 12. Malin, S. A., and Molliver, D. C. (2010) Gi- and Gq-coupled ADP (P2Y) receptors act in opposition to modulate nociceptive signaling and inflammatory pain behavior. Mol Pain 6, 21 13. Charlton, M. E., Williams, A. S., Fogliano, M., Sweetnam, P. M., and Duman, R. S. (1997) The isolation and characterization of a novel G protein-coupled receptor regulated by immunologic challenge. Brain Research 764, 141-148 14. Thor, D., Le Duc, D., Strotmann, R., and Schoneberg, T. (2009) Luciferase activity under direct ligand-dependent control of a muscarinic acetylcholine receptor. BMC Biotechnol 9, 46 15. Schulz, A., and Schoneberg, T. (2003) The structural evolution of a P2Y-like G-protein-coupled receptor. J Biol Chem 278, 35531-35541 16. Schroder, R., Janssen, N., Schmidt, J., Kebig, A., Merten, N., Hennen, S., Muller, A., Blattermann, S., Mohr-Andra, M., Zahn, S., Wenzel, J., Smith, N. J., Gomeza, J., Drewke, C., Milligan, G., Mohr, K., and Kostenis, E. (2010) Deconvolution of complex G protein-coupled
77 -/- Reduced insulin release in P2Y14 mice
receptor signaling in live cells using dynamic mass redistribution measurements. Nat Biotechnol 28, 943-949 17. Engel, K. M., Schrock, K., Teupser, D., Holdt, L. M., Tonjes, A., Kern, M., Dietrich, K., Kovacs, P., Krugel, U., Scheidt, H. A., Schiller, J., Huster, D., Brockmann, G. A., Augustin, M., Thiery, J., Bluher, M., Stumvoll, M., Schoneberg, T., and Schulz, A. (2011) Reduced food intake and body weight in mice deficient for the G protein-coupled receptor GPR82. PLoS One 6, e29400 18. Schutze, N., Lehmann, I., Bonisch, U., Simon, J. C., and Polte, T. (2010) Exposure to mycotoxins increases the allergic immune response in a murine asthma model. Am J Respir Crit Care Med 181, 1188-1199 19. Kong, K. C., Butcher, A. J., McWilliams, P., Jones, D., Wess, J., Hamdan, F. F., Werry, T., Rosethorne, E. M., Charlton, S. J., Munson, S. E., Cragg, H. A., Smart, A. D., and Tobin, A. B. (2010) M3-muscarinic receptor promotes insulin release via receptor phosphorylation/arrestin- dependent activation of protein kinase D1. Proc Natl Acad Sci U S A 107, 21181-21186 20. Sassmann, A., Gier, B., Grone, H. J., Drews, G., Offermanns, S., and Wettschureck, N. (2010) The Gq/G11-mediated signaling pathway is critical for autocrine potentiation of insulin secretion in mice. J Clin Invest 120, 2184-2193 21. Yesil, P., Michel, M., Chwalek, K., Pedack, S., Jany, C., Ludwig, B., Bornstein, S. R., and Lammert, E. (2009) A new collagenase blend increases the number of islets isolated from mouse pancreas. Islets 1, 185-190 22. Trapnell, C., Roberts, A., Goff, L., Pertea, G., Kim, D., Kelley, D. R., Pimentel, H., Salzberg, S. L., Rinn, J. L., and Pachter, L. (2012) Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks. Nat Protoc 7, 562-578 23. Roberts, A., Pimentel, H., Trapnell, C., and Pachter, L. (2011) Identification of novel transcripts in annotated genomes using RNA-Seq. Bioinformatics 27, 2325-2329 24. Anders, S., and Huber, W. (2010) Differential expression analysis for sequence count data. Genome Biol 11, R106 25. Chen, J., Bardes, E. E., Aronow, B. J., and Jegga, A. G. (2009) ToppGene Suite for gene list enrichment analysis and candidate gene prioritization. Nucleic Acids Res 37, W305-311 26. Charlton, M. E., Williams, A. S., Fogliano, M., Sweetnam, P. M., and Duman, R. S. (1997) The isolation and characterization of a novel G protein-coupled receptor regulated by immunologic challenge. Brain Research 764, 141-148 27. Lee, B. C., Cheng, T., Adams, G. B., Attar, E. C., Miura, N., Lee, S. B., Saito, Y., Olszak, I., Dombkowski, D., Olson, D. P., Hancock, J., Choi, P. S., Haber, D. A., Luster, A. D., and Scadden, D. T. (2003) P2Y-like receptor, GPR105 (P2Y14), identifies and mediates chemotaxis of bone-marrow hematopoietic stem cells. Genes Dev 17, 1592-1604 28. Gao, Z. G., Ding, Y., and Jacobson, K. A. (2010) UDP-glucose acting at P2Y14 receptors is a mediator of mast cell degranulation. Biochem Pharmacol 79, 873-879 29. Scrivens, M., and Dickenson, J. M. (2005) Pharmacological effects mediated by UDP-glucose that are independent of P2Y14 receptor expression. Pharmacol Res 51, 533-538 30. Bassil, A. K., Bourdu, S., Townson, K. A., Wheeldon, A., Jarvie, E. M., Zebda, N., Abuin, A., Grau, E., Livi, G. P., Punter, L., Latcham, J., Grimes, A. M., Hurp, D. P., Downham, K. M., Sanger, G. J., Winchester, W. J., Morrison, A. D., and Moore, G. B. (2009) UDP-glucose modulates gastric function through P2Y14 receptor-dependent and -independent mechanisms. Am J Physiol Gastrointest Liver Physiol 296, G923-930 31. Cho, J., Yusuf, R., Kook, S., Attar, E., Lee, D., Park, B., Cheng, T., Scadden, D. T., and Lee, B. C. (2014) Purinergic P2Y14 receptor modulates stress-induced hematopoietic stem/progenitor cell senescence. J Clin Invest 10.1172/JCI61636 32. Kook, S. H., Cho, J. S., Morrison, A., Wiener, E., Lee, S. B., Scadden, D., and Lee, B. C. (2013) The purinergic P2Y receptor axis is a molecular determinant for organism survival under in utero radiation toxicity. Cell Death Dis 4, e703 33. Komuro, T. (2006) Structure and organization of interstitial cells of Cajal in the gastrointestinal tract. J Physiol 576, 653-658
78 -/- Reduced insulin release in P2Y14 mice
34. Radenkovic, G., Ilic, I., Zivanovic, D., Vlajkovic, S., Petrovic, V., and Mitrovic, O. (2010) C-kit- immunopositive interstitial cells of Cajal in human embryonal and fetal oesophagus. Cell Tissue Res 340, 427-436 35. Shimoda, H., Kudo, T., Takahashi, Y., and Kato, S. (2000) Ultrastructural and histochemical characterization of special muscle cells in the monkey small intestine. Archives of histology and cytology 63, 217-228 36. Alsaqati, M., Latif, M. L., Chan, S. L., and Ralevic, V. (2013) Novel vasocontractile role of the P2Y receptor: characterisation of its signalling in porcine isolated pancreatic arteries. Br J Pharmacol 37. Kauffenstein, G., Drouin, A., Thorin-Trescases, N., Bachelard, H., Robaye, B., D'Orleans-Juste, P., Marceau, F., Thorin, E., and Sevigny, J. (2010) NTPDase1 (CD39) controls nucleotide- dependent vasoconstriction in mouse. Cardiovasc Res 85, 204-213 38. Govindan, S., Taylor, E. J., and Taylor, C. W. (2010) Ca(2+) signalling by P2Y receptors in cultured rat aortic smooth muscle cells. Br J Pharmacol 160, 1953-1962 39. Xu, J., Morinaga, H., Oh, D., Li, P., Chen, A., Talukdar, S., Mamane, Y., Mancini, J. A., Nawrocki, A. R., Lazarowski, E., Olefsky, J. M., and Kim, J. J. (2012) GPR105 ablation prevents inflammation and improves insulin sensitivity in mice with diet-induced obesity. J Immunol 189, 1992-1999 40. Saltiel, A. R., and Kahn, C. R. (2001) Insulin signalling and the regulation of glucose and lipid metabolism. Nature 414, 799-806 41. Amisten, S., Salehi, A., Rorsman, P., Jones, P. M., and Persaud, S. J. (2013) An atlas and functional analysis of G-protein coupled receptors in human islets of Langerhans. Pharmacol Ther 139, 359-391 42. Henquin, J. C. (2009) Regulation of insulin secretion: a matter of phase control and amplitude modulation. Diabetologia 52, 739-751 43. Dyachok, O., and Gylfe, E. (2004) Ca(2+)-induced Ca(2+) release via inositol 1,4,5-trisphosphate receptors is amplified by protein kinase A and triggers exocytosis in pancreatic beta-cells. J Biol Chem 279, 45455-45461 44. Han, P., Werber, J., Surana, M., Fleischer, N., and Michaeli, T. (1999) The calcium/calmodulin- dependent phosphodiesterase PDE1C down-regulates glucose-induced insulin secretion. J Biol Chem 274, 22337-22344 45. Alquier, T., Peyot, M. L., Latour, M. G., Kebede, M., Sorensen, C. M., Gesta, S., Ronald Kahn, C., Smith, R. D., Jetton, T. L., Metz, T. O., Prentki, M., and Poitout, V. (2009) Deletion of GPR40 impairs glucose-induced insulin secretion in vivo in mice without affecting intracellular fuel metabolism in islets. Diabetes 58, 2607-2615 46. Strowski, M. Z., Parmar, R. M., Blake, A. D., and Schaeffer, J. M. (2000) Somatostatin inhibits insulin and glucagon secretion via two receptors subtypes: an in vitro study of pancreatic islets from somatostatin receptor 2 knockout mice. Endocrinology 141, 111-117 47. Lin, Y., and Smrcka, A. V. (2011) Understanding molecular recognition by G protein betagamma subunits on the path to pharmacological targeting. Mol Pharmacol 80, 551-557 48. Drucker, D. J. (2003) Enhancing incretin action for the treatment of type 2 diabetes. Diabetes Care 26, 2929-2940 49. Holst, B., Egerod, K. L., Jin, C., Petersen, P. S., Ostergaard, M. V., Hald, J., Sprinkel, A. M., Storling, J., Mandrup-Poulsen, T., Holst, J. J., Thams, P., Orskov, C., Wierup, N., Sundler, F., Madsen, O. D., and Schwartz, T. W. (2009) G protein-coupled receptor 39 deficiency is associated with pancreatic islet dysfunction. Endocrinology 150, 2577-2585 50. Mitsukawa, K., Lu, X., and Bartfai, T. (2008) Galanin, galanin receptors and drug targets. Cell Mol Life Sci 65, 1796-1805 51. Duttaroy, A., Zimliki, C. L., Gautam, D., Cui, Y., Mears, D., and Wess, J. (2004) Muscarinic stimulation of pancreatic insulin and glucagon release is abolished in m3 muscarinic acetylcholine receptor-deficient mice. Diabetes 53, 1714-1720
79 -/- Reduced insulin release in P2Y14 mice
52. Hang, Y., and Stein, R. (2011) MafA and MafB activity in pancreatic beta cells. Trends Endocrinol Metab 22, 364-373 53. Artner, I., Le Lay, J., Hang, Y., Elghazi, L., Schisler, J. C., Henderson, E., Sosa-Pineda, B., and Stein, R. (2006) MafB: an activator of the glucagon gene expressed in developing islet alpha- and beta-cells. Diabetes 55, 297-304 54. Lu, Y., Ponton, A., Okamoto, H., Takasawa, S., Herrera, P. L., and Liu, J. L. (2006) Activation of the Reg family genes by pancreatic-specific IGF-I gene deficiency and after streptozotocin- induced diabetes in mouse pancreas. Am J Physiol Endocrinol Metab 291, E50-58 55. Schuit, F. C. (1996) Factors determining the glucose sensitivity and glucose responsiveness of pancreatic beta cells. Horm Res 46, 99-106 56. Pipeleers, D. G. (1992) Heterogeneity in pancreatic beta-cell population. Diabetes 41, 777-781 57. Pausch, M. H., Lai, M., Tseng, E., Paulsen, J., Bates, B., and Kwak, S. (2004) Functional expression of human and mouse P2Y12 receptors in Saccharomyces cerevisiae. Biochem Biophys Res Commun 324, 171-177
80 -/- Reduced insulin release in P2Y14 mice
FOOTNOTES Acknowledgements – For excellent technical assistance and their help in different methods we especially thank Susann Lautenschläger (Institute of Biochemistry), Luzie Eichentopf (IFB Adiposity Diseases), Anne Butthof (Institute of Biochemistry), Franziska Jeromin (Institute of Laboratory Medicine) and Claudia Merkwitz (Institute of Anatomy) (all from the Medical Faculty, University of Leipzig, Leipzig, Germany). For support in bioinformatics we thank Vera Lede (Institute of Biochemistry). We thank Antonia Sassmann (Max-Planck-Institut für Herz- und Lungenforschung, Bad Nauheim, Germany) for her help establishing the islet experiments and Knut Krohn (core unit “DNA technologies”, IZKF Leipzig, Medical Faculty, University of Leipzig, Leipzig, Germany) for performing the Illumina sequencing. We further thank Ingo Bechmann (Institute of Anatomy, Medical Faculty, University of Leipzig, Leipzig, Germany) for lively discussions. This work was supported by the Deutsche Forschungsgemeinschaft (Scho 624/7-1, FOR 748) and the IFB Leipzig (BMBF). The authors declare that there are no conflicts of interest. Abbreviations – DMR, dynamic mass redistribution; FPKM, fragments per kilobase of transcript per million mapped reads; GI, gastrointestinal; GLUT2, glucose transporter 2; GO, Gene Ontology; GPCR, G protein-coupled receptor; KRB, Krebs-Ringer buffer; oGTT, oral glucose tolerance test; PKA, protein kinase A; SSTR1, somatostatin type 1 receptor
FIGURE LEGENDS
FIGURE 1. Generation of a P2Y14-deficient mouse strain and P2Y14 qPCR design. P2Y14-deficient mice were generated at TAKEDA Ltd.. The coding sequence was partly replaced by an ECMV-IRES / ß-galactosidase cassette followed by a loxP-floxed neomycin selection cassette. We removed neomycin cassette by breeding with EIIa-Cre mice and successful removal was verified by PCR. For qPCR a primer pair matching to exon 1 and 2 was designed. Genotyping of mice was performed as described in Experimental Procedures with primers indicated as: for, rev and ß-gal s.
FIGURE 2. Detection of bacterial LacZ reporter gene via ß-galactosidase activity in cryosections of selected organs. To monitor the expression of P2Y14 in vivo at the cellular level a transgenic KO mouse was generated by replacement of the P2Y14–coding region with an expression cassette harboring an internal ribosome entry site and the bacterial LacZ reporter gene under control of the endogenous P2Y14 promoter. Sites of LacZ expression were located in cryosections using X-Gal, and counterstained with nuclear fast red. (A) Whereas no ß-galactosidase activity was detected in WT mice, KO mice showed intensive ß-galactosidase staining several other smooth muscle or contractile cell-containing organs. A indicates arterial vessel, V indicates venous blood vessel. (B) ß-galactosidase staining in the GI tract was only positive in a subpopulation of smooth muscle cells. (C) The expression of P2Y14 in certain muscle layers throughout the GI tract is schematically given.
FIGURE 3. Detection of bacterial LacZ reporter gene in cryosections of pancreatic tissue. (A) Expression of LacZ reporter gene in exocrine and endocrine parts of the pancreas. The enlarged picture details show the expression in the acini (B/C) and in cells of the islet (D).
FIGURE 4. P2Y14 transcript and P2Y14-promoter-driven LacZ gene expression in mouse tissues. Total RNA was extracted from several tissues from WT and P2Y14-KO mice (n=3) and mRNA levels of either P2Y14 or LacZ transcripts were determined by SYBR Green qPCR analysis. Primers were designed for the intron-flanking exons 1 and 2 (see Fig. 1). Expression data are shown as ∆Ct values normalized to the house keeping gene ß2-microglobulin. (A) qPCR analysis shows a widespread receptor distribution with high expression levels in pancreas, salivary glands, brain and parts of the gastrointestinal tract and lowest expression in liver. Data shown as mean ± SEM. (B) Expression of bacterial LacZ reporter gene in
81 -/- Reduced insulin release in P2Y14 mice
2 KO mice correlates (r =0.9058) with the expression of P2Y14 in WT mice. Dashed line indicates the 95 % confidence interval.
FIGURE 5. P2Y14-deficient mice showed a delayed gastrointestinal emptying. A dye-labeled dextran was applied to mice orally and the excretion in faeces was measured hourly. The excretion of blue dextran is shown relative to the total excreted blue dextran after 8 hours. Five KO mice but only one WT animal had to be excluded from analysis according to our exclusion criterion (see Experimental Procedures). OD620 nm (∆ 8h) = 0.8770 ± 0.0630 for WT and OD620 nm (∆ 8h) = 0.5636 ± 0.0731 for KO mice were set to 100 % respectively. Data shown as mean ± SEM. * P < 0.05; ** P < 0.01; *** P < 0.001; Student’s t-test
FIGURE 6. Airway responsiveness is reduced in P2Y14-deficient mice. Lung resistance (A) and dynamic compliance (B) were measured by invasive plethysmography (emka TECHNOLOGIES) in response to inhaled UDP-glucose and increasing doses of methacholine. Data shown as mean ± SD. Baseline values (set to 100 %) were: lung resistance 1.28 ± 0.41 mmHg x s/ml for WT mice and 1.11 ± 0.34 mmHg x s/ml for KO mice, dynamic compliance 0.84 ± 0.56 ml/mmHg for WT and 0.72 ± 0.43 ml/mmHg for KO mice; * P < 0.05; Student’s t-test. For statistic analysis of the entire methacholine test a paired two-tailed t-test (marked by a long line) was performed (P = 0.0105 for dynamic compliance).
FIGURE 7. P2Y14-deficient mice show reduced glucose tolerance. Glucose tolerance tests were performed either by oral application (A, C) of 80 mg glucose or by intraperitoneal (B, D) glucose injection (2 mg/g body weight) to overnight fasted male mice kept under standard (A, B) or western (C, D) type diet. Blood glucose levels shown as mean ± SD. * P < 0.05; ** P < 0.01; *** P < 0.001; Student’s t-test
FIGURE 8. P2Y14-deficient mice showed diet-dependent lower serum insulin levels after glucose administration. First, blood glucose levels were measured in an insulin tolerance test (ITT) after intraperitoneal injection of insulin (0.75 U/kg body weight) in male mice kept under standard (A) and western (B) type diet. Blood glucose levels before insulin application (set to 100 %) were 4.9 ± 0.6 mmol/l for WT and 5.8 ± 1.0 mmol/l for KO mice fed with standard diet, and 5.6 ± 0.7 mmol/l for WT and 6.1 ± 0.9 mmol/l for KO mice kept under western type diet. Data shown as mean ± SD. * P < 0.05; Student’s t-test. Then, serum insulin levels were determined before (0 min) and 20, 40 and 60 min after intraperitoneal glucose injection (2 mg/g of body weight) in male mice kept under standard (C) and western type (D) diet. Data shown as mean ± SEM. ** P < 0.01; Student’s t-test
FIGURE 9. Normal architecture of pancreatic islets in P2Y14-deficient mice. (A) Representative H&E stained pancreatic section used for morphometric analyses. (B) Insulin immunohistochemistry of representative pancreatic islets. (C) The number and area of islets in 10 serial slices of pancreatic tissue were determined using NIH ImageJ Software. The number of islets was 141 ± 17 in WT and 157 ± 11 in KO mice. (D) β-cell mass was determined as ratio of insulin positive area to total pancreatic islet area. Data shown as mean ± SD.
FIGURE 10. Signaling pathways involved in insulin secretion from β-cells. Several components involved in insulin release from pancreatic islets are shown. P2Y14 deficiency led to increased (green) and decreased (red) transcription of several genes compared to islets from WT mice. Detailed data from RNASeq experiments are given in supplemental Table S2 and Table S3. A list of all differentially expressed transcripts can be provided on request.
FIGURE 11. Impaired insulin secretion of isolated pancreatic islets of P2Y14-deficient mice.
82 -/- Reduced insulin release in P2Y14 mice
For cumulative insulin measurements (A-C), pancreatic islets were isolated from WT and KO male mice and incubated 30 min with KRB solution containing 2.8 mM glucose, 16.7 mM glucose or 16.7 mM glucose plus 100 µM UDP-glucose (n=5-7). Insulin levels of lysed islets (A), in the supernatants (B) and the ratio of both (C) are shown. For kinetic insulin measurements (D), pancreatic islets were isolated from WT and KO male mice and continuously perifused with KRB solution containing 2.8 mM glucose, 16.7 mM glucose, or 16.7 mM glucose plus 100 µM UDP-glucose. Insulin levels shown as mean ± SEM. * P < 0.05; ** P < 0.01; *** P < 0.001; Student’s t-test
FIGURE 12. Testing UDP-glucose and UDP at P2Y14 in yeast and mammalian cells. (A) Genetically engineered yeast cells (57) transformed with the indicated receptor constructs were analyzed without (basal) and with agonist (10 µM). Receptor activation was measured after 40 hours as growth of yeast cells in histidine-depleted medium by recording the optical density (OD) at 600 nm. Data (mean ± SD) from two independent experiments (in triplicate) are shown. (B) Transiently transfected HEK293 cells (P2Y14, neuropeptide Y receptor Y2) were seeded in 384-well plates the day prior DMR measurements (16). Cells were challenged with indicated concentrations of the corresponding agonist (UDP, UDP-glucose, NPY) and wavelength shift (in pm) was monitored. Each receptor stimulation curve was first corrected against own buffer control (basal) and second, against mock-transfected cells stimulated with the respective agonist. Data from three independent experiments (mean ± SEM) were summarized, each performed in quadruplicate.
83 -/- Reduced insulin release in P2Y14 mice
TABLES
TABLE 1. Functional measurements of mouse and human P2Y14 receptors.
Mouse and human P2Y14 constructs and two other Gi-coupled receptors as controls were transfected for cAMP inhibition and direct cAMP measurements (via a chimeric Gɑsi5 protein) as described in Experimental Procedures. For inhibition of cAMP, transfected COS-7 cells were stimulated either with 5 µM Forskolin (FSK) or together with the indicated agonists for 15 minutes. Forskolin-stimulated values of each receptor were set 100% and % of inhibition due to the agonist stimulation was calculated for each receptor. Forskolin-stimulated cAMP values for each receptor and mock transfected cells (in nM) are given in brackets. Basal cAMP levels prior Forskolin-stimulation for mock-transfected cells were 0.88 ± 0.57 nM. The number of assays is indicated in each column. All assays were performed in triplicates.
cAMP inhibition cAMP (nM) % of FSK stimulation cotransfected Gαsi5 transfected construct agonist (n=10) (n=4) FSK/basal 100 (7.78 ± 1.29) 2.71 ± 1.42 UDP 96.93 ± 9.53 2.95 ± 2.22 mock UDP-Glc 104.06 ± 18.13 3.12 ± 1.18 NPY 106.08 ± 27.75 3.12 ± 1.44 CCh 92.13 ± 17.59 2.67 ± 1.76 FSK/basal 100 (8.96 ± 1.92) 7.22 ± 1.99
mouse P2y14 UDP 103.37 ± 22.91 8.10 ± 2.18 UDP-Glc 93.81 ± 21.66 9.20 ± 2.05 FSK/basal 100 (8.73 ± 3.12) 7.49 ± 3.00
human P2Y14 UDP 99.10 ± 18.56 8.04 ± 3.26 UDP-Glc 98.88 ± 21.47 8.86 ± 3.50 FSK/basal 100 (11.54 ± 3.21) 4.18 ± 0.98 mouse Y2R NPY 64.49 ± 15.09 12.10 ± 3.24 FSK/basal 100 (12.09 ± 3.30) 4.93 ± 0.56 human M2R CCh 80.00 ± 21.28 11.34 ± 2.96
84 -/- Reduced insulin release in P2Y14 mice
FIGURE 1
85 -/- Reduced insulin release in P2Y14 mice
FIGURE 2
86 -/- Reduced insulin release in P2Y14 mice
FIGURE 3
87 -/- Reduced insulin release in P2Y14 mice
FIGURE 4
FIGURE 5
88 -/- Reduced insulin release in P2Y14 mice
FIGURE 6
FIGURE 7
89 -/- Reduced insulin release in P2Y14 mice
FIGURE 8
90 -/- Reduced insulin release in P2Y14 mice
FIGURE 9
91 -/- Reduced insulin release in P2Y14 mice
FIGURE 10
92 -/- Reduced insulin release in P2Y14 mice
FIGURE 11
93 -/- Reduced insulin release in P2Y14 mice
FIGURE 12
94 ERKLÄRUNG ÜBER DIE EIGENSTÄNDIGE ABFASSUNG DER ARBEIT
Hiermit erkläre ich, dass ich die vorliegende Arbeit selbständig und ohne unzulässige Hilfe oder Benutzung anderer als der angegebenen Hilfsmittel angefertigt habe. Ich versichere, dass Dritte von mir weder unmittelbar noch mittelbar geldwerte Leistungen für Arbeiten erhalten haben, die im Zusammenhang mit dem Inhalt der vorgelegten Dissertation stehen, und dass die vorgelegte Arbeit weder im Inland noch im Ausland in gleicher oder ähnlicher Form einer anderen Prüfungsbehörde zum Zweck einer Promotion oder eines anderen Prüfungsverfahrens vorgelegt wurde. Alles aus anderen Quellen und von anderen Personen übernommene Material, das in der Arbeit verwendet wurde oder auf das direkt Bezug genommen wird, wurde als solches kenntlich gemacht. Insbesondere wurden alle Personen genannt, die direkt an der Entstehung der vorliegenden Arbeit beteiligt waren.
………………………… ………………………………
Datum Unterschrift
95 CURRICULUM VITAE
Jaroslawna Meister
Date of Birth: 27.05.1987
Place of Birth: Rudnyj, Kazakhstan
Nationality: German
Private Address:
Institutional Address: University Leipzig Institute of Biochemistry, Faculty of Medicine Johannisallee 30 04103 Leipzig
E-mail: [email protected]
EDUCATION and QUALIFICATIONS
04/2014 - 07/2014 Practical year tertial in Surgery Vascular, General, Visceral and Thoracic Surgery, Parkkrankenhaus Leipzig
12/2013 - 04/2014 Practical year tertial in Anaesthesiology and Intensive Care Department of Anaesthesiology and Intensive Care, University Clinic of Leipzig
08/2013 - 12/2013 Practical year tertial in Internal Medicine Cardiology, Cardiac Center Leipzig Endocrinology, University Clinic of Leipzig
07/2013 Obesity Research Summer Boot Camp, Canadian Obesity Network, Alberta, Canada
02/2013 Online-Tutorial “Computing (R) for Data Analysis”, John Hopkins University (Accomplishment with distinction)
2012 – 2013 Scholarship within MD Pro2 program of the IFB Adiposity Diseases, Leipzig
Since 2010 Doctoral studies: “The physiological relevance of the G
protein-coupled receptor P2Y14” Doctoral scholarship of Faculty of Medicine, Leipzig
2010 Student assistant at St. Elisabeth Hospital, Leipzig
96 2009 Anatomy tutor at dissection course, Institute of Anatomy, Leipzig
Since 2007 Medical studies, University Leipzig Physikum 2.0 (09/2009) (Estimated graduation 12/2014)
1999 – 2007 Carl-von-Bach-Gymnasium, Stollberg (Abitur 1.0)
1998 – 1999 Albrecht-Dürer-Grundschule, Stollberg
1998 Emigration from Kazakhstan
1993 – 1998 Mathematical school, Rudnyj
CORE COMPETENCIES
Experience in: molecular biology/genetics (most standard techniques), animal experiments, histology, cell culture, signal transduction assays, bioinformatics/programming
LANGUAGES
Russian: mother tongue
German: (almost) mother tongue
English: fluent
POSTER AWARDS
th Poster award: “The metabolic relevance of the UDP-glucose receptor P2Y14”, 11 Research Festival 2012, Leipzig
th Poster award: “The physiological relevance of the UDP-glucose receptor P2Y14”, 5 Joint Italian-German Purine Club Meeting 2013, Italy
Scientific photo award “Fascination Microcosm” 2012, Zeiss
97 PUBLICATIONS
Meister J, Le Duc D, Ricken A, Burkhardt R, Thiery J, Pfannkuche H, Polte T, Grosse J, Schöneberg T, Schulz A. The G protein-coupled receptor P2Y14 influences insulin release and smooth muscle function in mice J. Biol. Chem. published July 3, 2014 as doi:10.1074/jbc.M114.580803
Merkwitz C, Blaschuk OW, Schulz A, Lochhead P, Meister J, Ehrlich A, Ricken AM. The ductal origin of structural and functional heterogeneity between pancreatic islets Prog Histochem Cytochem. 2013 Oct;48(3):103-40
98 DANKSAGUNG
Während der Arbeit an meiner Dissertation hatte ich das Glück von vielen Menschen Unterstützung erhalten zu haben.
Besonders dankbar bin ich Dr. Angela Schulz und Prof. Dr. Torsten Schöneberg.
Angela hat mich auf ihre geduldige und freundliche Art in nahezu alle Methoden, die ich heute beherrsche, eingearbeitet. Ohne sie hätte ich in dem Jahr, in dem ich vom Medizinstudium ausgesetzt habe, nicht das Pensum an Arbeit bewältigen können. Angela hatte stets ein offenes Ohr für die Freuden und Schwierigkeiten des experimentellen Arbeitens und immer eine Lösung für das Problem, das mir gerade im Weg stand, parat. Ich danke Angela für ihre Unterstützung, die weit über die Anforderungen, die man an seine Betreuerin stellt, hinausging.
Ich danke Torsten für das Interesse und die Begeisterung an Wissenschaft und Forschung, die er mir vom ersten Tag an vermittelt hat. Durch seine Unterstützung wurden scheinbar unmögliche Experimente machbar, ich konnte mich weiterentwickeln, mich neuen Herausforderungen stellen und hatte stets Raum, meine eigenen Ideen und Gedanken einzubringen. Meine Anfragen und Korrekturarbeiten hat er schnell und unkompliziert bearbeitet. Ich danke Torsten ebenfalls für seine Bemühungen, sich um die finanzielle Unterstützung im Rahmen von Stipendien zu kümmern.
Angela und Torsten sind nicht unerheblich an meiner weiteren Berufswahl beteiligt.
An dieser Stelle auch vielen Dank an die Medizinische Fakultät und an IFB Adipositas für die finanzielle Hilfe durch Stipendien, die mir zusätzliche Möglichkeiten und vor allem Zeit für das experimentelle Arbeiten eingeräumt haben.
Lieben Dank an alle Kollegen der AG Schöneberg für die zahlreichen Ideen, Ratschläge und konstruktive Diskussionen.
Weiterhin, danke ich PD Dr. Albert Ricken (Institut für Anatomie, Medizinische Fakultät, Universität Leipzig) für die Beratung und Unterstützung in anatomischen Fragen und seine histologische Expertise.
Mein Dank gilt auch PD Dr. Helga Pfannkuche (Veterinär-Physiologisches Institut, Veterinärmedizinische Fakultät, Universität Leipzig) für die Kooperation bei den Kontraktilitätsuntersuchungen des Darmgewebes und Dr. Antonia Sassmann (Abteilung für 99 Pharmakologie, MPI für Herz- und Lungenforschung, Bad Nauheim) für das Beibringen der Methode der Inselisolation.
Nicht zuletzt möchte ich meiner Familie und meinen Freunden für ihre liebevolle Unterstützung auf dem Weg der Promotion danken. Sie haben stets meinen Rücken gestärkt und haben für Abwechslung und Freude neben dem Studium und der Dissertation gesorgt.
100